#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA6	23460	genome.wustl.edu	37	17	67109433	67109433	+	Silent	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr17:67109433C>T	ENST00000284425.2	-	15	2145	c.1971G>A	c.(1969-1971)ctG>ctA	p.L657L		NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	657	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					TACGCTCTCTCAGGAGGCTCC	0.418																																																	0													88.0	81.0	84.0					17																	67109433		2203	4300	6503	SO:0001819	synonymous_variant	0			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.1971G>A	17.37:g.67109433C>T			Q6NSH9|Q8N856|Q8WWZ6	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L657	ENST00000284425.2	37	c.1971	CCDS11683.1	17																																																																																			ABCA6	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000154262		0.418	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA6	HGNC	protein_coding	OTTHUMT00000450463.1	-	0.00	86	0	C	NM_080284		67109433	-1	tier1	-	no_errors	ENST00000284425	ensembl	human	known	74_37	silent	73.97	19	54	SNP	1.000	T
ABHD2	11057	genome.wustl.edu	37	15	89736499	89736499	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr15:89736499G>T	ENST00000352732.5	+	10	1550	c.1030G>T	c.(1030-1032)Gac>Tac	p.D344Y	ABHD2_ENST00000565973.1_Missense_Mutation_p.D344Y|ABHD2_ENST00000355100.3_Missense_Mutation_p.D344Y	NM_152924.4	NP_690888.1	P08910	ABHD2_HUMAN	abhydrolase domain containing 2	344					negative regulation of cell migration (GO:0030336)|response to wounding (GO:0009611)	integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|soft_tissue(1)	23	Lung NSC(78;0.0472)|all_lung(78;0.089)					TAATGCAGCTGACGATCCGTT	0.433																																					Colon(11;252 417 24570 33239 41878)												0													221.0	178.0	193.0					15																	89736499		2200	4299	6499	SO:0001583	missense	0			X12433	CCDS10348.1	15q26.1	2006-10-06			ENSG00000140526	ENSG00000140526		"""Abhydrolase domain containing"""	18717	protein-coding gene	gene with protein product		612196					Standard	NM_152924		Approved	LABH2	uc002bnk.2	P08910	OTTHUMG00000148684	ENST00000352732.5:c.1030G>T	15.37:g.89736499G>T	ENSP00000268129:p.Asp344Tyr		Q53G48|Q53GU0|Q5FVD9|Q8TC79	Missense_Mutation	SNP	pfam_AB_hydrolase_1,pirsf_AB-Hydro_YheT	p.D344Y	ENST00000352732.5	37	c.1030	CCDS10348.1	15	.	.	.	.	.	.	.	.	.	.	G	29.5	5.007673	0.93287	.	.	ENSG00000140526	ENST00000352732;ENST00000355100	T;T	0.65916	-0.18;-0.18	5.33	5.33	0.75918	Uncharacterised protein family UPF0017, hydrolase-like, conserved site (1);Alpha/beta hydrolase fold-1 (1);	0.000000	0.85682	D	0.000000	T	0.81847	0.4909	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84225	0.0463	10	0.87932	D	0	-3.4242	19.3947	0.94603	0.0:0.0:1.0:0.0	.	344	P08910	ABHD2_HUMAN	Y	344	ENSP00000268129:D344Y;ENSP00000347217:D344Y	ENSP00000268129:D344Y	D	+	1	0	ABHD2	87537503	1.000000	0.71417	0.983000	0.44433	0.980000	0.70556	9.093000	0.94163	2.644000	0.89710	0.563000	0.77884	GAC	ABHD2	-	pfam_AB_hydrolase_1,pirsf_AB-Hydro_YheT	ENSG00000140526		0.433	ABHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD2	HGNC	protein_coding	OTTHUMT00000309074.2	-	0.00	97	0	G			89736499	+1	tier1	-	no_errors	ENST00000352732	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
ADAM2	2515	genome.wustl.edu	37	8	39679180	39679180	+	Splice_Site	SNP	T	T	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr8:39679180T>A	ENST00000265708.4	-	5	372	c.269A>T	c.(268-270)aAt>aTt	p.N90I	ADAM2_ENST00000347580.4_Splice_Site_p.N90I|ADAM2_ENST00000523181.1_5'UTR|ADAM2_ENST00000379853.2_Splice_Site_p.N90I|ADAM2_ENST00000521880.1_Splice_Site_p.N90I	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	90					adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		GTGGCAGAAATTCTGAAAGAT	0.308																																																	0													74.0	74.0	74.0					8																	39679180		2203	4297	6500	SO:0001630	splice_region_variant	0			U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.268-1A>T	8.37:g.39679180T>A			P78326|Q9UQQ8	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.N90I	ENST00000265708.4	37	c.269	CCDS34884.1	8	.	.	.	.	.	.	.	.	.	.	T	16.03	3.007438	0.54361	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	T;T;T;T	0.06294	3.32;3.32;3.32;3.32	5.51	4.36	0.52297	Peptidase M12B, propeptide (1);	.	.	.	.	T	0.19967	0.0480	M	0.78223	2.4	0.40786	D	0.983211	B;D;B;B	0.69078	0.153;0.997;0.251;0.153	B;D;B;B	0.70487	0.179;0.969;0.112;0.179	T	0.00964	-1.1498	8	.	.	.	.	5.7126	0.17943	0.0:0.087:0.1706:0.7425	.	90;90;90;90	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	I	90	ENSP00000343854:N90I;ENSP00000369182:N90I;ENSP00000265708:N90I;ENSP00000429352:N90I	.	N	-	2	0	ADAM2	39798337	0.201000	0.23410	0.990000	0.47175	0.959000	0.62525	0.282000	0.18829	0.931000	0.37242	0.528000	0.53228	AAT	ADAM2	-	pfam_Peptidase_M12B_N	ENSG00000104755		0.308	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM2	HGNC	protein_coding	OTTHUMT00000376926.1	-	0.00	108	0	T	NM_001464	Missense_Mutation	39679180	-1	tier1	-	no_errors	ENST00000265708	ensembl	human	known	74_37	missense	41.91	79	57	SNP	0.873	A
ADCY1	107	genome.wustl.edu	37	7	45614684	45614684	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr7:45614684G>T	ENST00000297323.7	+	1	564	c.542G>T	c.(541-543)aGc>aTc	p.S181I	ADCY1_ENST00000432715.1_5'UTR	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	181					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CCCGTGCGCAGCCTGCTGGCC	0.672																																																	0													21.0	18.0	19.0					7																	45614684		2188	4279	6467	SO:0001583	missense	0			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.542G>T	7.37:g.45614684G>T	ENSP00000297323:p.Ser181Ile		A4D2L8|Q75MI1	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.S181I	ENST00000297323.7	37	c.542	CCDS34631.1	7	.	.	.	.	.	.	.	.	.	.	G	10.46	1.356582	0.24598	.	.	ENSG00000164742	ENST00000297323;ENST00000545300	T	0.78481	-1.18	3.7	3.7	0.42460	.	0.060259	0.64402	D	0.000006	T	0.64438	0.2598	L	0.29908	0.895	0.36759	D	0.883168	B	0.06786	0.001	B	0.06405	0.002	T	0.66176	-0.5989	10	0.46703	T	0.11	.	9.1177	0.36769	0.0:0.2249:0.7751:0.0	.	181	Q08828	ADCY1_HUMAN	I	181	ENSP00000297323:S181I	ENSP00000297323:S181I	S	+	2	0	ADCY1	45581209	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	4.618000	0.61211	1.879000	0.54435	0.205000	0.17691	AGC	ADCY1	-	NULL	ENSG00000164742		0.672	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY1	HGNC	protein_coding	OTTHUMT00000340055.2	-	0.00	70	0	G	NM_021116		45614684	+1	tier1	-	no_errors	ENST00000297323	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
AGPS	8540	genome.wustl.edu	37	2	178333231	178333231	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:178333231C>T	ENST00000264167.4	+	10	1230	c.1084C>T	c.(1084-1086)Cac>Tac	p.H362Y	AGPS_ENST00000409888.1_Intron	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	362	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			TGATATCCATCACTTCATCAT	0.328																																																	0													75.0	79.0	77.0					2																	178333231		2203	4299	6502	SO:0001583	missense	0			Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.1084C>T	2.37:g.178333231C>T	ENSP00000264167:p.His362Tyr		A5D8U9|Q2TU35	Missense_Mutation	SNP	pfam_FAD-linked_oxidase_C,pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2,superfamily_FAD-linked_Oxase-like_C	p.H362Y	ENST00000264167.4	37	c.1084	CCDS2275.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.107150	0.94292	.	.	ENSG00000018510	ENST00000264167;ENST00000536686	D	0.82711	-1.64	5.78	5.78	0.91487	FAD-linked oxidase, FAD-binding, subdomain 2 (1);FAD-binding, type 2 (2);	0.095712	0.64402	D	0.000001	D	0.92688	0.7676	M	0.91768	3.24	0.80722	D	1	D	0.64830	0.994	P	0.61201	0.885	D	0.93555	0.6890	10	0.72032	D	0.01	.	19.9867	0.97352	0.0:1.0:0.0:0.0	.	362	O00116	ADAS_HUMAN	Y	362;232	ENSP00000264167:H362Y	ENSP00000264167:H362Y	H	+	1	0	AGPS	178041477	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.103000	0.77014	2.712000	0.92718	0.655000	0.94253	CAC	AGPS	-	superfamily_FAD-bd_2	ENSG00000018510		0.328	AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPS	HGNC	protein_coding	OTTHUMT00000255730.2	-	0.00	121	0	C			178333231	+1	tier1	-	no_errors	ENST00000264167	ensembl	human	known	74_37	missense	36.70	119	69	SNP	1.000	T
AKAP13	11214	genome.wustl.edu	37	15	86279365	86279365	+	Splice_Site	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr15:86279365G>T	ENST00000394518.2	+	33	7652	c.7557G>T	c.(7555-7557)gaG>gaT	p.E2519D	AKAP13_ENST00000394510.2_Splice_Site_p.E764D|AKAP13_ENST00000361243.2_Splice_Site_p.E2523D|AKAP13_ENST00000560579.1_3'UTR	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2519	Interaction with ESR1.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GAAACAGTGAGGTAAGGACAT	0.269																																					Melanoma(94;603 1453 3280 32295 32951)												0													112.0	114.0	113.0					15																	86279365		2202	4299	6501	SO:0001630	splice_region_variant	0			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.7557+1G>T	15.37:g.86279365G>T			Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.E2523D	ENST00000394518.2	37	c.7569	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	G	25.7	4.663982	0.88251	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000394510	T;T;T	0.22336	1.96;1.96;3.18	5.66	5.66	0.87406	.	.	.	.	.	T	0.45296	0.1335	M	0.62723	1.935	0.53688	D	0.999978	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.954	T	0.27971	-1.0058	9	0.62326	D	0.03	.	16.8998	0.86110	0.0:0.0:1.0:0.0	.	2519;2523	Q12802;Q12802-2	AKP13_HUMAN;.	D	2523;2519;2522;2498;764	ENSP00000354718:E2523D;ENSP00000378026:E2519D;ENSP00000378018:E764D	ENSP00000354718:E2523D	E	+	3	2	AKAP13	84080369	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.204000	0.77872	2.669000	0.90835	0.655000	0.94253	GAG	AKAP13	-	NULL	ENSG00000170776		0.269	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1		0.00	67	0	G	NM_007200	Missense_Mutation	86279365	+1			no_errors	ENST00000361243	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
ALDH4A1	8659	genome.wustl.edu	37	1	19203950	19203950	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:19203950C>A	ENST00000375341.3	-	10	1354	c.1097G>T	c.(1096-1098)gGg>gTg	p.G366V	ALDH4A1_ENST00000538309.1_Missense_Mutation_p.G306V|ALDH4A1_ENST00000538839.1_Missense_Mutation_p.G366V|ALDH4A1_ENST00000290597.5_Missense_Mutation_p.G366V|RP13-279N23.2_ENST00000494072.3_3'UTR	NM_003748.3	NP_003739.2	P30038	AL4A1_HUMAN	aldehyde dehydrogenase 4 family, member A1	366					4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|proline biosynthetic process (GO:0006561)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	1-pyrroline-5-carboxylate dehydrogenase activity (GO:0003842)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|electron carrier activity (GO:0009055)|identical protein binding (GO:0042802)			cervix(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CAGCAGCCGCCCTTTGATCTG	0.682																																																	0													24.0	25.0	24.0					1																	19203950		2201	4300	6501	SO:0001583	missense	0			U24266	CCDS188.1, CCDS53272.1	1p36	2008-02-05			ENSG00000159423	ENSG00000159423	1.5.1.12	"""Aldehyde dehydrogenases"""	406	protein-coding gene	gene with protein product		606811		ALDH4		8621661	Standard	NM_003748		Approved	P5CDh	uc001bbc.3	P30038	OTTHUMG00000002443	ENST00000375341.3:c.1097G>T	1.37:g.19203950C>A	ENSP00000364490:p.Gly366Val		A8K1Q7|B4DGE4|D2D4A3|Q16882|Q53HU4|Q5JNV6|Q8IZ38|Q96IF0|Q9UDI6	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_1-pyrroline-5-COlate_DH	p.G366V	ENST00000375341.3	37	c.1097	CCDS188.1	1	.	.	.	.	.	.	.	.	.	.	C	13.86	2.361794	0.41801	.	.	ENSG00000159423	ENST00000290597;ENST00000375341;ENST00000538839;ENST00000538309	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	4.52	-0.981	0.10269	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.849423	0.10531	N	0.663870	T	0.20129	0.0484	L	0.29908	0.895	0.50313	D	0.999865	B	0.11235	0.004	B	0.19946	0.027	T	0.13308	-1.0514	10	0.48119	T	0.1	-17.2802	6.4129	0.21700	0.0:0.2357:0.5135:0.2509	.	366	P30038	AL4A1_HUMAN	V	366;366;366;306	ENSP00000290597:G366V;ENSP00000364490:G366V;ENSP00000446071:G366V;ENSP00000442988:G306V	ENSP00000290597:G366V	G	-	2	0	ALDH4A1	19076537	0.984000	0.35163	1.000000	0.80357	0.971000	0.66376	0.101000	0.15251	0.359000	0.24239	-0.165000	0.13383	GGG	ALDH4A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_1-pyrroline-5-COlate_DH	ENSG00000159423		0.682	ALDH4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH4A1	HGNC	protein_coding	OTTHUMT00000006954.1	-	0.00	38	0	C			19203950	-1	tier1	-	no_errors	ENST00000290597	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.997	A
ANKRD26P1	124149	genome.wustl.edu	37	16	46534259	46534259	+	RNA	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:46534259C>T	ENST00000571006.1	-	0	655							Q6NSI1	AR26L_HUMAN	ankyrin repeat domain 26 pseudogene 1																		TTGTCTGGTGCCACTTCATTT	0.338																																																	0																																												0			BC070117		16q11.2	2014-03-18	2009-06-12		ENSG00000261239	ENSG00000261239			32955	pseudogene	pseudogene							Standard	NR_026556		Approved	FLJ43980	uc002eeb.3	Q6NSI1	OTTHUMG00000175593		16.37:g.46534259C>T				RNA	SNP	-	NULL	ENST00000571006.1	37	NULL		16	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.080246	0.00375	.	.	ENSG00000155319	ENST00000329373	.	.	.	2.11	-4.23	0.03789	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	5.5625	0.17152	0.3527:0.4599:0.1874:0.0	.	.	.	.	X	165	.	ENSP00000331873:W165X	W	-	3	0	ANKRD26P1	45091760	0.983000	0.35010	0.002000	0.10522	0.011000	0.07611	0.048000	0.14078	-1.381000	0.02112	-0.802000	0.03209	TGG	ANKRD26P1	-	-	ENSG00000261239		0.338	ANKRD26P1-007	KNOWN	basic	processed_transcript	ANKRD26P1	HGNC	pseudogene	OTTHUMT00000437932.1	-	0.00	36	0	C	NR_026556		46534259	-1	tier1	-	no_errors	ENST00000566201	ensembl	human	known	74_37	rna	47.06	18	16	SNP	0.032	T
ANKRD36C	400986	genome.wustl.edu	37	2	96604621	96604621	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:96604621G>C	ENST00000456556.1	-	22	1673	c.1589C>G	c.(1588-1590)tCa>tGa	p.S530*				Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	530							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						GAATCTAGTTGAAATGTGATC	0.299																																																	0																																										SO:0001587	stop_gained	0			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.1589C>G	2.37:g.96604621G>C	ENSP00000403302:p.Ser530*		C9JZ08|Q15694|Q53S06|Q658V2	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S530*	ENST00000456556.1	37	c.1589		2	.	.	.	.	.	.	.	.	.	.	N	16.95	3.262531	0.59431	.	.	ENSG00000174501	ENST00000456556	.	.	.	1.22	1.22	0.21188	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	5.819	0.18516	0.0:0.0:1.0:0.0	.	.	.	.	X	530	.	ENSP00000403302:S530X	S	-	2	0	AC073995.2	95968348	0.003000	0.15002	0.002000	0.10522	0.107000	0.19398	0.704000	0.25661	0.949000	0.37715	0.290000	0.19541	TCA	ANKRD36C	-	NULL	ENSG00000174501		0.299	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	HGNC	protein_coding	OTTHUMT00000338799.2	-	0.00	290	0	G	NM_001010914		96604621	-1	tier1	-	no_errors	ENST00000456556	ensembl	human	known	74_37	nonsense	8.45	271	25	SNP	0.003	C
ANKRD36	375248	genome.wustl.edu	37	2	97830162	97830162	+	Nonsense_Mutation	SNP	C	C	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:97830162C>G	ENST00000461153.2	+	20	1731	c.1487C>G	c.(1486-1488)tCa>tGa	p.S496*	ANKRD36_ENST00000420699.2_Nonsense_Mutation_p.S496*			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	496										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						GATCACATTTCAACTAGATTC	0.313																																																	0													103.0	71.0	81.0					2																	97830162		692	1590	2282	SO:0001587	stop_gained	0			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.1487C>G	2.37:g.97830162C>G	ENSP00000419530:p.Ser496*		B4E3I8|Q6UX02|Q86X62|Q9HCD1	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S496*	ENST00000461153.2	37	c.1487	CCDS54379.1	2	.	.	.	.	.	.	.	.	.	.	.	25.1	4.604011	0.87157	.	.	ENSG00000135976	ENST00000461153;ENST00000420699	.	.	.	0.945	0.945	0.19543	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	5.2713	0.15627	0.0:1.0:0.0:0.0	.	.	.	.	X	496	.	ENSP00000391950:S496X	S	+	2	0	ANKRD36	97193889	0.003000	0.15002	0.002000	0.10522	0.135000	0.20990	0.683000	0.25349	0.811000	0.34303	0.184000	0.17185	TCA	ANKRD36	-	NULL	ENSG00000135976		0.313	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36	HGNC	protein_coding	OTTHUMT00000339154.5	-	0.00	157	0	C			97830162	+1	tier1	-	no_errors	ENST00000420699	ensembl	human	known	74_37	nonsense	7.01	146	11	SNP	0.003	G
ANKZF1	55139	genome.wustl.edu	37	2	220096650	220096650	+	Splice_Site	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:220096650G>A	ENST00000323348.5	+	3	323	c.149G>A	c.(148-150)gGc>gAc	p.G50D	ANKZF1_ENST00000410034.3_Splice_Site_p.G50D|ATG9A_ENST00000409618.1_5'Flank|ATG9A_ENST00000361242.4_5'Flank|ATG9A_ENST00000396761.2_5'Flank|ATG9A_ENST00000409422.1_5'Flank|ANKZF1_ENST00000409849.1_Intron|ATG9A_ENST00000488833.1_5'Flank	NM_018089.2	NP_060559.2	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing 1	50						membrane (GO:0016020)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	23		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCTTATTTAGGCTCAGGGGAG	0.423																																																	0													70.0	69.0	69.0					2																	220096650		1837	4083	5920	SO:0001630	splice_region_variant	0			AF364318	CCDS42821.1, CCDS63129.1	2q35	2013-01-10			ENSG00000163516	ENSG00000163516		"""Zinc fingers, C2H2-type"", ""Ankyrin repeat domain containing"""	25527	protein-coding gene	gene with protein product						12477932	Standard	NM_018089		Approved	FLJ10415, ZNF744	uc002vkg.3	Q9H8Y5	OTTHUMG00000154533	ENST00000323348.5:c.149-1G>A	2.37:g.220096650G>A			Q9NVZ4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G50D	ENST00000323348.5	37	c.149	CCDS42821.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.04|19.04	3.749249|3.749249	0.69533|0.69533	.|.	.|.	ENSG00000163516|ENSG00000163516	ENST00000416565|ENST00000323348;ENST00000410034;ENST00000447157;ENST00000436226	.|T;T	.|0.26223	.|1.75;1.75	4.53|4.53	3.56|3.56	0.40772|0.40772	.|.	.|0.395247	.|0.28527	.|N	.|0.015028	T|T	0.31857|0.31857	0.0810|0.0810	L|L	0.41710|0.41710	1.295|1.295	0.37156|0.37156	D|D	0.902364|0.902364	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	T|T	0.22487|0.22487	-1.0215|-1.0215	6|10	0.87932|0.09338	D|T	0|0.73	.|.	6.6746|6.6746	0.23087|0.23087	0.1307:0.0:0.8693:0.0|0.1307:0.0:0.8693:0.0	.|.	.|50	.|Q9H8Y5	.|ANKZ1_HUMAN	T|D	32|50	.|ENSP00000321617:G50D;ENSP00000386337:G50D	ENSP00000406514:A32T|ENSP00000321617:G50D	A|G	+|+	1|2	0|0	ANKZF1|ANKZF1	219804894|219804894	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.773000|0.773000	0.43773|0.43773	0.874000|0.874000	0.28065|0.28065	2.348000|2.348000	0.79779|0.79779	0.467000|0.467000	0.42956|0.42956	GCT|GGC	ANKZF1	-	NULL	ENSG00000163516		0.423	ANKZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKZF1	HGNC	protein_coding	OTTHUMT00000335790.1	-	0.00	61	0	G	NM_018089	Missense_Mutation	220096650	+1	tier1	-	no_errors	ENST00000323348	ensembl	human	known	74_37	missense	5.19	72	4	SNP	0.998	A
AQP12A	375318	genome.wustl.edu	37	2	241631651	241631651	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:241631651C>T	ENST00000337801.4	+	2	353	c.284C>T	c.(283-285)tCt>tTt	p.S95F	AQP12A_ENST00000429564.1_Missense_Mutation_p.S107F|AC011298.2_ENST00000407635.2_lincRNA	NM_198998.2	NP_945349.1	Q8IXF9	AQ12A_HUMAN	aquaporin 12A	95						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(2)|kidney(3)|large_intestine(2)|lung(7)	14		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		GCCGAGCAGTCTCTGCCTGGC	0.677																																																	0													30.0	42.0	38.0					2																	241631651		2065	4254	6319	SO:0001583	missense	0			AB040748		2q37.3	2013-06-03	2005-05-26	2005-05-26	ENSG00000184945	ENSG00000184945		"""Ion channels / Aquaporins"""	19941	protein-coding gene	gene with protein product		609789	"""aquaporin 12"""	AQP12			Standard	NM_198998		Approved		uc002vzu.3	Q8IXF9	OTTHUMG00000183906	ENST00000337801.4:c.284C>T	2.37:g.241631651C>T	ENSP00000337144:p.Ser95Phe			Missense_Mutation	SNP	pfam_MIP,superfamily_Aquaporin-like,pirsf_Aquaporin_11/12,prints_Aquaporin_12,prints_MIP	p.S107F	ENST00000337801.4	37	c.320		2	.	.	.	.	.	.	.	.	.	.	.	9.451	1.090621	0.20471	.	.	ENSG00000184945	ENST00000337801;ENST00000373309;ENST00000429564;ENST00000420599	T;T	0.15487	2.42;2.42	2.56	2.56	0.30785	Aquaporin-like (2);	0.383937	0.27345	N	0.019798	T	0.36826	0.0981	M	0.76002	2.32	0.24694	N	0.993293	D	0.62365	0.991	D	0.66847	0.947	T	0.05699	-1.0869	10	0.62326	D	0.03	-0.5276	10.891	0.46996	0.0:1.0:0.0:0.0	.	95	Q8IXF9	AQ12A_HUMAN	F	95;33;107;80	ENSP00000337144:S95F;ENSP00000405899:S107F	ENSP00000337144:S95F	S	+	2	0	AQP12A	241280324	0.031000	0.19500	0.642000	0.29436	0.064000	0.16182	2.760000	0.47581	1.464000	0.47987	0.164000	0.16699	TCT	AQP12A	-	pfam_MIP,superfamily_Aquaporin-like,pirsf_Aquaporin_11/12,prints_Aquaporin_12	ENSG00000184945		0.677	AQP12A-001	KNOWN	basic|appris_principal	protein_coding	AQP12A	HGNC	protein_coding	OTTHUMT00000257185.2	-	0.00	102	0	C	NM_198998		241631651	+1	tier1	-	no_errors	ENST00000429564	ensembl	human	known	74_37	missense	22.52	86	25	SNP	0.283	T
ARFGEF2	10564	genome.wustl.edu	37	20	47649631	47649631	+	Silent	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr20:47649631C>T	ENST00000371917.4	+	39	5253	c.5253C>T	c.(5251-5253)ctC>ctT	p.L1751L		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	1751					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TCCCTGAGCTCCGAGCAGTTC	0.453																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)												0													92.0	77.0	82.0					20																	47649631		2203	4300	6503	SO:0001819	synonymous_variant	0			AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.5253C>T	20.37:g.47649631C>T			Q5TFT9|Q9NTS1	Silent	SNP	pfam_Sec7_dom,pfam_DUF1981_Sec7_assoc,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.L1751	ENST00000371917.4	37	c.5253	CCDS13411.1	20																																																																																			ARFGEF2	-	superfamily_ARM-type_fold	ENSG00000124198		0.453	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF2	HGNC	protein_coding	OTTHUMT00000079627.1	-	0.00	92	0	C	NM_006420		47649631	+1	tier1	-	no_errors	ENST00000371917	ensembl	human	known	74_37	silent	17.36	100	21	SNP	1.000	T
ARHGAP10	79658	genome.wustl.edu	37	4	148786095	148786095	+	Silent	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr4:148786095G>A	ENST00000336498.3	+	6	824	c.585G>A	c.(583-585)gaG>gaA	p.E195E		NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10	0					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		AGAAGTTTGAGTTTGTGGAAC	0.378																																																	0													115.0	116.0	116.0					4																	148786095		2203	4300	6503	SO:0001819	synonymous_variant	0			BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.585G>A	4.37:g.148786095G>A			Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Silent	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_RhoGAP_dom,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.E195	ENST00000336498.3	37	c.585	CCDS34075.1	4																																																																																			ARHGAP10	-	NULL	ENSG00000071205		0.378	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP10	HGNC	protein_coding	OTTHUMT00000365005.1	-	0.00	98	0	G	NM_024605		148786095	+1	tier1	-	no_errors	ENST00000336498	ensembl	human	known	74_37	silent	35.96	57	32	SNP	1.000	A
ARR3	407	genome.wustl.edu	37	X	69497288	69497288	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chrX:69497288C>T	ENST00000307959.8	+	9	569	c.518C>T	c.(517-519)cCg>cTg	p.P173L	ARR3_ENST00000374495.3_Missense_Mutation_p.P173L	NM_004312.2	NP_004303.2	P36575	ARRC_HUMAN	arrestin 3, retinal (X-arrestin)	173					endocytosis (GO:0006897)|regulation of protein phosphorylation (GO:0001932)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)				endometrium(3)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	16						TTTGCACCACCGGAGGCAGGC	0.592																																																	0													72.0	62.0	65.0					X																	69497288		2203	4300	6503	SO:0001583	missense	0				CCDS14399.1	Xq13.1	2013-10-11			ENSG00000120500	ENSG00000120500			710	protein-coding gene	gene with protein product	"""arrestin 4"""	301770				8224247	Standard	NM_004312		Approved	ARRX	uc004dyb.2	P36575	OTTHUMG00000021768	ENST00000307959.8:c.518C>T	X.37:g.69497288C>T	ENSP00000311538:p.Pro173Leu		B5B0B9|Q5JT23|Q5JT24|Q6IBF5|Q96EN2	Missense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set,prints_Arrestin	p.P173L	ENST00000307959.8	37	c.518	CCDS14399.1	X	.	.	.	.	.	.	.	.	.	.	C	3.490	-0.104088	0.06967	.	.	ENSG00000120500	ENST00000374495;ENST00000374480;ENST00000307959	T;T	0.13901	2.55;2.97	4.37	-3.3	0.05003	.	1.655470	0.02801	N	0.123197	T	0.06371	0.0164	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.31752	-0.9932	10	0.23302	T	0.38	.	4.6341	0.12516	0.2429:0.398:0.0:0.3591	.	173;173	P36575;P36575-2	ARRC_HUMAN;.	L	173	ENSP00000363619:P173L;ENSP00000311538:P173L	ENSP00000311538:P173L	P	+	2	0	ARR3	69414013	0.000000	0.05858	0.006000	0.13384	0.070000	0.16714	-0.642000	0.05427	-0.247000	0.09597	-0.312000	0.09012	CCG	ARR3	-	NULL	ENSG00000120500		0.592	ARR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARR3	HGNC	protein_coding	OTTHUMT00000057055.2	-	0.00	49	0	C	NM_004312		69497288	+1	tier1	-	no_errors	ENST00000307959	ensembl	human	known	74_37	missense	26.19	31	11	SNP	0.001	T
ATRNL1	26033	genome.wustl.edu	37	10	117309029	117309029	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr10:117309029G>A	ENST00000355044.3	+	26	3904	c.3778G>A	c.(3778-3780)Gct>Act	p.A1260T	ATRNL1_ENST00000423111.2_Missense_Mutation_p.A311T|ATRNL1_ENST00000303745.7_Missense_Mutation_p.A53T	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1260					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		AACTTGTTGGGCTTCTCGACG	0.333																																																	0													130.0	124.0	126.0					10																	117309029		2203	4300	6503	SO:0001583	missense	0			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3778G>A	10.37:g.117309029G>A	ENSP00000347152:p.Ala1260Thr		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_Plexin_repeat,pfam_CUB_dom,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_CUB_dom,superfamily_Plexin-like_fold,smart_EG-like_dom,smart_CUB_dom,smart_Plexin-like_fold,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.A1260T	ENST00000355044.3	37	c.3778	CCDS7592.1	10	.	.	.	.	.	.	.	.	.	.	G	22.6	4.316580	0.81469	.	.	ENSG00000107518	ENST00000355044;ENST00000423111;ENST00000303745	T;T;T	0.51574	0.7;0.7;0.7	5.74	5.74	0.90152	.	0.108849	0.64402	D	0.000009	T	0.59582	0.2204	L	0.40543	1.245	0.48236	D	0.999616	D;P	0.89917	1.0;0.734	D;B	0.80764	0.994;0.257	T	0.49485	-0.8935	10	0.20046	T	0.44	-14.0876	17.7147	0.88332	0.0:0.0:1.0:0.0	.	311;1260	B4DH41;Q5VV63	.;ATRN1_HUMAN	T	1260;311;53	ENSP00000347152:A1260T;ENSP00000409624:A311T;ENSP00000307660:A53T	ENSP00000307660:A53T	A	+	1	0	ATRNL1	117299019	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.863000	0.92288	2.723000	0.93209	0.591000	0.81541	GCT	ATRNL1	-	NULL	ENSG00000107518		0.333	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	HGNC	protein_coding	OTTHUMT00000050507.3	-	0.00	74	0	G	XM_049349		117309029	+1	tier1	-	no_errors	ENST00000355044	ensembl	human	known	74_37	missense	18.87	43	10	SNP	1.000	A
ATXN3	4287	genome.wustl.edu	37	14	92537355	92537357	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr14:92537355_92537357delCTG	ENST00000532032.1	-	10	922_924	c.913_915delCAG	c.(913-915)cagdel	p.Q305del	ATXN3_ENST00000503767.1_In_Frame_Del_p.Q290del|ATXN3_ENST00000393287.5_In_Frame_Del_p.Q305del|ATXN3_ENST00000545170.1_In_Frame_Del_p.Q314del|ATXN3_ENST00000554491.1_5'UTR|ATXN3_ENST00000340660.6_In_Frame_Del_p.Q250del|ATXN3_ENST00000502250.1_In_Frame_Del_p.Q126del|ATXN3_ENST00000429774.2_In_Frame_Del_p.Q298del			P54252	ATX3_HUMAN	ataxin 3	305	Poly-Gln.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|cellular response to misfolded protein (GO:0071218)|intermediate filament cytoskeleton organization (GO:0045104)|microtubule cytoskeleton organization (GO:0000226)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|monoubiquitinated protein deubiquitination (GO:0035520)|nervous system development (GO:0007399)|nucleotide-excision repair (GO:0006289)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell-substrate adhesion (GO:0010810)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|identical protein binding (GO:0042802)|Lys48-specific deubiquitinase activity (GO:1990380)|Lys63-specific deubiquitinase activity (GO:0061578)|omega peptidase activity (GO:0008242)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	12		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		ATAGGTCCCCctgctgctgctgc	0.448																																					Esophageal Squamous(190;752 2094 29897 44875 49530)												0																																										SO:0001651	inframe_deletion	0			U64820	CCDS9900.1, CCDS32143.1, CCDS45154.1, CCDS53908.1, CCDS73680.1	14q21	2014-09-17	2004-08-12	2004-08-13	ENSG00000066427	ENSG00000066427		"""Ataxins"""	7106	protein-coding gene	gene with protein product		607047	"""Machado-Joseph disease (spinocerebellar ataxia 3, olivopontocerebellar ataxia 3, autosomal dominant, ataxin 3)"""	SCA3, MJD		8358439	Standard	NM_004993		Approved	ATX3, JOS	uc001yac.4	P54252	OTTHUMG00000162212	ENST00000532032.1:c.913_915delCAG	14.37:g.92537364_92537366delCTG	ENSP00000437157:p.Gln305del		A7LFZ5|D6RDL9|E9PB63|O15284|O15285|O15286|Q8N189|Q96TC3|Q96TC4|Q9H3N0	In_Frame_Del	DEL	pfam_Josephin,pfam_Ubiquitin-int_motif,smart_Ubiquitin-int_motif,pfscan_Josephin,pfscan_Ubiquitin-int_motif,prints_Josephin	p.Q314in_frame_del	ENST00000532032.1	37	c.942_940		14																																																																																			ATXN3	-	NULL	ENSG00000066427		0.448	ATXN3-015	KNOWN	basic	protein_coding	ATXN3	HGNC	protein_coding	OTTHUMT00000388065.1		0.00	76	0	CTG	NM_004993		92537357	-1	tier1		no_errors	ENST00000545170	ensembl	human	known	74_37	in_frame_del	8.93	51	5	DEL	0.435:0.701:0.831	-
B3GAT2	135152	genome.wustl.edu	37	6	71571660	71571660	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:71571660A>T	ENST00000230053.6	-	3	1366	c.758T>A	c.(757-759)gTc>gAc	p.V253D	SMAP1_ENST00000370455.3_3'UTR	NM_080742.2	NP_542780.1	Q9NPZ5	B3GA2_HUMAN	beta-1,3-glucuronyltransferase 2	253					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						GGACAAAATGACTTGAAGACT	0.353																																																	0													76.0	77.0	77.0					6																	71571660		2203	4300	6503	SO:0001583	missense	0			AB075843	CCDS4974.1	6q12	2014-07-08	2014-07-08		ENSG00000112309	ENSG00000112309	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	922	protein-coding gene	gene with protein product	"""glucuronosyltransferase S"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 2"""	607497				12383500	Standard	NM_080742		Approved	GlcAT-S	uc003pfv.3	Q9NPZ5	OTTHUMG00000014997	ENST00000230053.6:c.758T>A	6.37:g.71571660A>T	ENSP00000230053:p.Val253Asp		Q5JS09|Q8TF38|Q96NK4	Missense_Mutation	SNP	pfam_Glyco_trans_43	p.V253D	ENST00000230053.6	37	c.758	CCDS4974.1	6	.	.	.	.	.	.	.	.	.	.	A	27.9	4.876597	0.91664	.	.	ENSG00000112309	ENST00000230053	T	0.65178	-0.14	5.51	5.51	0.81932	.	0.061028	0.64402	D	0.000004	T	0.75295	0.3830	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.994	T	0.79867	-0.1622	10	0.87932	D	0	-3.0583	15.6117	0.76727	1.0:0.0:0.0:0.0	.	181;253	Q29RV3;Q9NPZ5	.;B3GA2_HUMAN	D	253	ENSP00000230053:V253D	ENSP00000230053:V253D	V	-	2	0	B3GAT2	71628381	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.339000	0.96797	2.086000	0.62901	0.528000	0.53228	GTC	B3GAT2	-	pfam_Glyco_trans_43	ENSG00000112309		0.353	B3GAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GAT2	HGNC	protein_coding	OTTHUMT00000041150.2	-	0.00	24	0	A	NM_080742		71571660	-1	tier1	-	no_errors	ENST00000230053	ensembl	human	known	74_37	missense	46.15	7	6	SNP	1.000	T
BDNF	627	genome.wustl.edu	37	11	27679009	27679011	+	3'UTR	DEL	TGT	TGT	-	rs3838785|rs397693902	byFrequency	TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	TGT	TGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:27679009_27679011delTGT	ENST00000525528.1	-	0	2194_2196				BDNF_ENST00000395978.3_3'UTR|BDNF-AS_ENST00000530686.1_RNA|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000395983.3_3'UTR|BDNF-AS_ENST00000501176.2_RNA|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000395980.2_3'UTR|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000418212.1_3'UTR|BDNF-AS_ENST00000532965.1_RNA|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000395981.3_3'UTR|BDNF_ENST00000356660.4_3'UTR|BDNF_ENST00000532997.1_3'UTR|BDNF_ENST00000584049.1_5'UTR|BDNF_ENST00000533246.1_3'UTR|BDNF_ENST00000533131.1_3'UTR|BDNF_ENST00000314915.6_3'UTR|BDNF_ENST00000439476.2_3'UTR|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000525950.1_3'UTR|BDNF_ENST00000420794.1_3'UTR|BDNF_ENST00000395986.2_3'UTR|BDNF_ENST00000438929.1_3'UTR|BDNF_ENST00000530861.1_3'UTR	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						TGTGTGTGTGTGTTTTTTTTCTG	0.271																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.*359ACA>-	11.37:g.27679009_27679011delTGT			A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	RNA	DEL	-	NULL	ENST00000525528.1	37	NULL	CCDS7866.1	11																																																																																			BDNF	-	-	ENSG00000176697		0.271	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BDNF	HGNC	protein_coding	OTTHUMT00000388135.1		0.00	35	0	TGT	NM_170735		27679011	-1	tier1		no_errors	ENST00000584049	ensembl	human	known	74_37	rna	11.54	23	3	DEL	0.021:0.000:0.000	-
BNC2	54796	genome.wustl.edu	37	9	16436780	16436780	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr9:16436780C>A	ENST00000380672.4	-	6	1469	c.1412G>T	c.(1411-1413)tGc>tTc	p.C471F	BNC2_ENST00000545497.1_Missense_Mutation_p.C376F|BNC2_ENST00000380666.2_Missense_Mutation_p.C471F|BNC2_ENST00000380667.2_Missense_Mutation_p.C404F	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		TTCAATGGTGCATCGATGTTT	0.438																																																	0													142.0	133.0	136.0					9																	16436780		2203	4300	6503	SO:0001583	missense	0			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.1412G>T	9.37:g.16436780C>A	ENSP00000370047:p.Cys471Phe			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C471F	ENST00000380672.4	37	c.1412	CCDS6482.2	9	.	.	.	.	.	.	.	.	.	.	C	16.82	3.228416	0.58777	.	.	ENSG00000173068	ENST00000380672;ENST00000418777;ENST00000380667;ENST00000545497;ENST00000544198;ENST00000380666;ENST00000540340	T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3	6.07	6.07	0.98685	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.78298	0.4261	M	0.74467	2.265	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;0.999;0.995;1.0;0.998;1.0	D;D;D;D;D;D;D;D;D	0.97110	1.0;0.996;0.996;1.0;0.994;0.979;0.997;0.994;0.997	T	0.78430	-0.2207	10	0.87932	D	0	-12.7889	20.6439	0.99570	0.0:1.0:0.0:0.0	.	376;404;471;297;471;428;471;376;236	F5H586;B1APH0;Q6ZN30-2;B4E3J2;F5H8G9;Q5H9S4;Q6ZN30;B4DR27;D3DRJ1	.;.;.;.;.;.;BNC2_HUMAN;.;.	F	471;428;404;376;297;471;471	ENSP00000370047:C471F;ENSP00000408370:C428F;ENSP00000370042:C404F;ENSP00000444640:C376F;ENSP00000370041:C471F	ENSP00000370041:C471F	C	-	2	0	BNC2	16426780	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.818000	0.86416	2.884000	0.98904	0.655000	0.94253	TGC	BNC2	-	smart_Znf_C2H2-like	ENSG00000173068		0.438	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BNC2	HGNC	protein_coding	OTTHUMT00000216901.5	-	0.00	109	0	C	NM_017637		16436780	-1	tier1	-	no_errors	ENST00000380672	ensembl	human	known	74_37	missense	10.99	81	10	SNP	1.000	A
BTBD16	118663	genome.wustl.edu	37	10	124096128	124096128	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr10:124096128G>T	ENST00000260723.4	+	15	1634	c.1383G>T	c.(1381-1383)aaG>aaT	p.K461N	BTBD16_ENST00000368994.2_Missense_Mutation_p.K462N|BTBD16_ENST00000495370.2_3'UTR	NM_144587.2	NP_653188.2	Q32M84	BTBDG_HUMAN	BTB (POZ) domain containing 16	461										breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(3)|skin(2)|stomach(1)|urinary_tract(1)	15		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)				TTGACGGCAAGTGGCAGGAGT	0.527																																																	0													133.0	98.0	110.0					10																	124096128		2203	4300	6503	SO:0001583	missense	0			AK058088	CCDS31301.1	10q26.13	2013-01-24	2006-07-04	2006-07-04	ENSG00000138152	ENSG00000138152		"""BTB/POZ domain containing"""	26340	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 87"""	C10orf87			Standard	NM_144587		Approved	FLJ25359, Em:AC061711.1	uc001lgc.1	Q32M84	OTTHUMG00000019182	ENST00000260723.4:c.1383G>T	10.37:g.124096128G>T	ENSP00000260723:p.Lys461Asn		A6NM63|Q4VXL1|Q96LN0	Missense_Mutation	SNP	superfamily_BTB/POZ_fold	p.K462N	ENST00000260723.4	37	c.1386	CCDS31301.1	10	.	.	.	.	.	.	.	.	.	.	G	8.240	0.806709	0.16467	.	.	ENSG00000138152	ENST00000260723;ENST00000368994	T;T	0.18174	2.23;2.23	5.64	2.54	0.30619	.	0.692450	0.13646	N	0.372646	T	0.08268	0.0206	N	0.12746	0.255	0.20926	N	0.999825	B;B	0.11235	0.004;0.004	B;B	0.11329	0.006;0.006	T	0.23048	-1.0199	10	0.37606	T	0.19	-8.7582	3.9971	0.09563	0.1943:0.0:0.6047:0.201	.	462;461	Q32M84-2;Q32M84	.;BTBDG_HUMAN	N	461;462	ENSP00000260723:K461N;ENSP00000357990:K462N	ENSP00000260723:K461N	K	+	3	2	BTBD16	124086118	0.845000	0.29573	0.878000	0.34440	0.555000	0.35460	0.373000	0.20484	1.393000	0.46605	0.655000	0.94253	AAG	BTBD16	-	NULL	ENSG00000138152		0.527	BTBD16-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BTBD16	HGNC	protein_coding	OTTHUMT00000050780.3		0.00	55	0	G	NM_144587		124096128	+1			no_errors	ENST00000368994	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.510	T
BNIP3	664	genome.wustl.edu	37	10	133784260	133784260	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr10:133784260C>T	ENST00000368636.4	-	5	545	c.421G>A	c.(421-423)Gcc>Acc	p.A141T	BNIP3_ENST00000540159.1_Missense_Mutation_p.A141T	NM_004052.2	NP_004043.2	Q12983	BNIP3_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 3	141					apoptotic process (GO:0006915)|autophagic cell death (GO:0048102)|brown fat cell differentiation (GO:0050873)|cell death (GO:0008219)|cellular response to cobalt ion (GO:0071279)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|granzyme-mediated apoptotic signaling pathway (GO:0008626)|intrinsic apoptotic signaling pathway in response to hypoxia (GO:1990144)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrial protein catabolic process (GO:0035694)|negative regulation of apoptotic process (GO:0043066)|negative regulation of membrane potential (GO:0045837)|negative regulation of mitochondrial fusion (GO:0010637)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane permeability (GO:0046902)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTPase binding (GO:0051020)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|skin(1)	7		all_cancers(35;4e-11)|all_epithelial(44;5.07e-08)|Ovarian(717;2.61e-05)|Lung NSC(174;0.00237)|all_lung(145;0.00354)|Breast(234;0.023)|all_neural(114;0.0299)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)		Epithelial(32;1.59e-12)|all cancers(32;3.75e-11)|OV - Ovarian serous cystadenocarcinoma(35;2.57e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CTGAGGGTGGCCGTGCGCTTC	0.522																																																	0													76.0	70.0	72.0					10																	133784260		2203	4300	6503	SO:0001583	missense	0			U15174	CCDS7663.1	10q26.3	2003-11-05	2002-08-29		ENSG00000176171	ENSG00000176171			1084	protein-coding gene	gene with protein product		603293	"""BCL2/adenovirus E1B 19kD-interacting protein 3"""			7954800	Standard	NM_004052		Approved	Nip3	uc001lkv.1	Q12983	OTTHUMG00000019278	ENST00000368636.4:c.421G>A	10.37:g.133784260C>T	ENSP00000357625:p.Ala141Thr		O14620|Q96GP0	Missense_Mutation	SNP	pfam_BNIP3	p.A141T	ENST00000368636.4	37	c.421	CCDS7663.1	10	.	.	.	.	.	.	.	.	.	.	C	0.403	-0.917257	0.02415	.	.	ENSG00000176171	ENST00000368636;ENST00000540159	.	.	.	4.45	2.46	0.29980	.	0.275088	0.41712	D	0.000827	T	0.23014	0.0556	N	0.16656	0.425	0.09310	N	0.999999	B	0.02656	0.0	B	0.08055	0.003	T	0.16837	-1.0389	9	0.21014	T	0.42	-3.8997	8.6823	0.34216	0.2657:0.4475:0.2869:0.0	.	141	Q12983	BNIP3_HUMAN	T	141	.	ENSP00000357625:A141T	A	-	1	0	BNIP3	133634250	0.020000	0.18652	0.018000	0.16275	0.301000	0.27625	0.169000	0.16641	0.510000	0.28216	0.655000	0.94253	GCC	BNIP3	-	pfam_BNIP3	ENSG00000176171		0.522	BNIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNIP3	HGNC	protein_coding	OTTHUMT00000051039.1	-	0.00	108	0	C			133784260	-1	tier1	-	no_errors	ENST00000368636	ensembl	human	known	74_37	missense	28.87	69	28	SNP	0.064	T
C17orf74	201243	genome.wustl.edu	37	17	7330415	7330415	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr17:7330415G>T	ENST00000333870.3	+	3	1179	c.1105G>T	c.(1105-1107)Gaa>Taa	p.E369*	C17orf74_ENST00000574034.1_3'UTR|RP11-104H15.7_ENST00000575310.1_RNA	NM_175734.4	NP_783861.3	Q0P670	CQ074_HUMAN	chromosome 17 open reading frame 74	369						integral component of membrane (GO:0016021)				cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	22		Prostate(122;0.157)				CCCATCCACGGAACCCTTGGG	0.697																																																	0													27.0	35.0	32.0					17																	7330415		2113	4216	6329	SO:0001587	stop_gained	0			BC044816	CCDS42255.1	17p13.1	2012-05-30			ENSG00000184560	ENSG00000184560			27315	protein-coding gene	gene with protein product						12477932	Standard	NM_175734		Approved		uc002ggw.3	Q0P670	OTTHUMG00000178190	ENST00000333870.3:c.1105G>T	17.37:g.7330415G>T	ENSP00000328061:p.Glu369*			Nonsense_Mutation	SNP	NULL	p.E369*	ENST00000333870.3	37	c.1105	CCDS42255.1	17	.	.	.	.	.	.	.	.	.	.	G	12.76	2.035779	0.35893	.	.	ENSG00000184560	ENST00000333870	.	.	.	4.72	2.56	0.30785	.	0.365817	0.20017	N	0.100995	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-11.4457	4.6817	0.12738	0.1123:0.0:0.6699:0.2178	.	.	.	.	X	369	.	ENSP00000328061:E369X	E	+	1	0	C17orf74	7271139	0.028000	0.19301	0.613000	0.29037	0.024000	0.10985	1.714000	0.37961	2.331000	0.79229	0.491000	0.48974	GAA	C17orf74	-	NULL	ENSG00000184560		0.697	C17orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf74	HGNC	protein_coding	OTTHUMT00000440933.2	-	0.00	82	0	G	NM_175734		7330415	+1	tier1	-	no_errors	ENST00000333870	ensembl	human	known	74_37	nonsense	6.58	70	5	SNP	0.081	T
C18orf54	162681	genome.wustl.edu	37	18	51888438	51888438	+	Intron	SNP	T	T	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr18:51888438T>C	ENST00000300091.5	+	3	921				C18orf54_ENST00000578138.1_Intron|C18orf54_ENST00000382911.4_Missense_Mutation_p.Y237H	NM_173529.4	NP_775800.3	Q8IYD9	LAS2_HUMAN	chromosome 18 open reading frame 54							extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	15				Colorectal(16;0.0206)|READ - Rectum adenocarcinoma(59;0.186)		TGAAAAGAATTACCCAAGATG	0.373																																																	0																																										SO:0001627	intron_variant	0			AK126503	CCDS11956.1, CCDS74223.1	18q21	2012-10-24			ENSG00000166845	ENSG00000166845			13796	protein-coding gene	gene with protein product	"""lung adenoma susceptibility protein 2"""	613258					Standard	XM_005258201		Approved	MGC33382, LAS2	uc031rij.1	Q8IYD9	OTTHUMG00000132703	ENST00000300091.5:c.589+120T>C	18.37:g.51888438T>C			I7HFJ6|Q6MZU3|Q6ZTL6	Missense_Mutation	SNP	NULL	p.Y237H	ENST00000300091.5	37	c.709	CCDS11956.1	18	.	.	.	.	.	.	.	.	.	.	T	19.23	3.786980	0.70337	.	.	ENSG00000166845	ENST00000382911	T	0.27720	1.65	5.64	5.64	0.86602	.	0.159741	0.43579	D	0.000548	T	0.55893	0.1949	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57323	-0.7831	8	.	.	.	-7.2195	14.8418	0.70230	0.0:0.0:0.0:1.0	.	237	Q8IYD9-2	.	H	237	ENSP00000372368:Y237H	.	Y	+	1	0	C18orf54	50142436	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	5.324000	0.65863	2.153000	0.67306	0.482000	0.46254	TAC	C18orf54	-	NULL	ENSG00000166845		0.373	C18orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C18orf54	HGNC	protein_coding	OTTHUMT00000256001.1		0.00	44	0	T	NM_173529		51888438	+1			no_errors	ENST00000382911	ensembl	human	novel	74_37	missense	6.12	46	3	SNP	1.000	C
C19orf12	83636	genome.wustl.edu	37	19	30193514	30193514	+	3'UTR	SNP	G	G	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr19:30193514G>C	ENST00000392278.2	-	0	690				C19orf12_ENST00000392275.1_5'UTR|C19orf12_ENST00000592153.1_3'UTR|C19orf12_ENST00000323670.9_3'UTR|C19orf12_ENST00000392276.1_3'UTR	NM_001031726.3	NP_001026896.2	Q9NSK7	CS012_HUMAN	chromosome 19 open reading frame 12						cell death (GO:0008219)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)						Ovarian(5;0.000567)|Breast(6;0.0203)|Esophageal squamous(110;0.239)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0435)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.183)			TGATGATGTGGAGATTCCCCA	0.552																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK057185	CCDS12418.2, CCDS42542.1, CCDS59373.1, CCDS74325.1	19q13.11	2013-07-24			ENSG00000131943	ENSG00000131943			25443	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 4"""	614297	"""spastic paraplegia 43 (autosomal recessive)"""	SPG43		21981780, 23857908	Standard	NM_031448		Approved	MGC10922, DKFZP762D096, NBIA4	uc002nsj.3	Q9NSK7	OTTHUMG00000149838	ENST00000392278.2:c.*105C>G	19.37:g.30193514G>C			B3KQ16|Q0D2Q0|Q6P4C5|Q9BSL7	RNA	SNP	-	NULL	ENST00000392278.2	37	NULL	CCDS42542.1	19																																																																																			C19orf12	-	-	ENSG00000131943		0.552	C19orf12-003	KNOWN	basic|exp_conf|CCDS	protein_coding	C19orf12	HGNC	protein_coding	OTTHUMT00000313509.2	-	0.00	43	0	G	NM_031448		30193514	-1	tier1	-	no_errors	ENST00000392275	ensembl	human	known	74_37	rna	44.00	14	11	SNP	0.000	C
C1orf105	92346	genome.wustl.edu	37	1	172414300	172414300	+	Splice_Site	SNP	T	T	C	rs371586803		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:172414300T>C	ENST00000367727.4	+	2	305		c.e2+2		PIGC_ENST00000344529.4_5'Flank|PIGC_ENST00000258324.1_5'Flank|PIGC_ENST00000367728.1_5'Flank|PIGC_ENST00000484368.1_5'Flank	NM_139240.3	NP_640333.3	O95561	CA105_HUMAN	chromosome 1 open reading frame 105											large_intestine(1)|lung(12)|prostate(1)|skin(1)	15						TCCCAGAAGGTAACCTCTCAG	0.448																																																	0													65.0	66.0	66.0					1																	172414300		2203	4300	6503	SO:0001630	splice_region_variant	0			AL035295	CCDS1301.1, CCDS72983.1	1q24.3	2012-06-26			ENSG00000180999	ENSG00000180999			29591	protein-coding gene	gene with protein product						12477932	Standard	NM_139240		Approved		uc001gik.3	O95561	OTTHUMG00000034750	ENST00000367727.4:c.107+2T>C	1.37:g.172414300T>C			Q8IY02	Splice_Site	SNP	-	e2+2	ENST00000367727.4	37	c.107+2	CCDS1301.1	1	.	.	.	.	.	.	.	.	.	.	T	11.63	1.695764	0.30052	.	.	ENSG00000180999	ENST00000367727;ENST00000488100	.	.	.	4.06	4.06	0.47325	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.7123	0.40254	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	C1orf105	170680923	1.000000	0.71417	1.000000	0.80357	0.491000	0.33493	2.978000	0.49305	2.059000	0.61396	0.533000	0.62120	.	C1orf105	-	-	ENSG00000180999		0.448	C1orf105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf105	HGNC	protein_coding	OTTHUMT00000084062.2	-	0.00	59	0	T	NM_139240	Intron	172414300	+1	tier1	-	no_errors	ENST00000367727	ensembl	human	known	74_37	splice_site	24.56	43	14	SNP	1.000	C
C2orf73	129852	genome.wustl.edu	37	2	54562094	54562094	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:54562094A>G	ENST00000398634.2	+	2	209	c.167A>G	c.(166-168)aAc>aGc	p.N56S	C2orf73_ENST00000405749.1_Intron|C2orf73_ENST00000491538.1_Intron	NM_001100396.1	NP_001093866.1	Q8N5S3	CB073_HUMAN	chromosome 2 open reading frame 73	56										breast(2)	2						AAATTCATTAACACAAATGCA	0.328																																																	0													86.0	73.0	77.0					2																	54562094		1862	4086	5948	SO:0001583	missense	0			BC031669, AK097617	CCDS46285.1	2p16.2	2008-07-07			ENSG00000177994	ENSG00000177994			26861	protein-coding gene	gene with protein product						14702039	Standard	NM_001100396		Approved	FLJ40298	uc002rxt.1	Q8N5S3	OTTHUMG00000151826	ENST00000398634.2:c.167A>G	2.37:g.54562094A>G	ENSP00000381631:p.Asn56Ser		A0AV79|A0AV81|Q8N7V4	Missense_Mutation	SNP	NULL	p.N56S	ENST00000398634.2	37	c.167	CCDS46285.1	2	.	.	.	.	.	.	.	.	.	.	A	6.884	0.532582	0.13127	.	.	ENSG00000177994	ENST00000486488;ENST00000398634	T;T	0.32272	1.46;1.46	4.39	2.02	0.26589	.	0.845751	0.10331	N	0.687587	T	0.19604	0.0471	L	0.34521	1.04	0.20307	N	0.999915	B	0.32160	0.358	B	0.30495	0.116	T	0.20273	-1.0280	10	0.27785	T	0.31	-24.0972	4.5901	0.12302	0.729:0.0:0.0975:0.1735	.	56	Q8N5S3	CB073_HUMAN	S	62;56	ENSP00000417971:N62S;ENSP00000381631:N56S	ENSP00000381631:N56S	N	+	2	0	C2orf73	54415598	0.996000	0.38824	0.975000	0.42487	0.782000	0.44232	2.047000	0.41269	0.793000	0.33875	0.460000	0.39030	AAC	C2orf73	-	NULL	ENSG00000177994		0.328	C2orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf73	HGNC	protein_coding	OTTHUMT00000324075.2	-	0.00	79	0	A	NM_001100396		54562094	+1	tier1	-	no_errors	ENST00000398634	ensembl	human	known	74_37	missense	20.00	68	17	SNP	0.878	G
C6orf118	168090	genome.wustl.edu	37	6	165715620	165715620	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:165715620A>G	ENST00000230301.8	-	2	211	c.191T>C	c.(190-192)cTg>cCg	p.L64P	C6orf118_ENST00000543069.1_5'UTR	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	64										breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		GTTGGGGTTCAGGTGTCCAGA	0.587																																																	0													110.0	121.0	117.0					6																	165715620		2203	4300	6503	SO:0001583	missense	0				CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.191T>C	6.37:g.165715620A>G	ENSP00000230301:p.Leu64Pro		Q8TC11	Missense_Mutation	SNP	superfamily_Ribonuclease/ribotoxin	p.L64P	ENST00000230301.8	37	c.191	CCDS5288.1	6	.	.	.	.	.	.	.	.	.	.	A	15.24	2.773389	0.49786	.	.	ENSG00000112539	ENST00000230301	T	0.43294	0.95	5.31	5.31	0.75309	.	0.000000	0.53938	D	0.000049	T	0.53498	0.1800	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.60214	-0.7307	10	0.87932	D	0	.	12.826	0.57721	1.0:0.0:0.0:0.0	.	64	Q5T5N4	CF118_HUMAN	P	64	ENSP00000230301:L64P	ENSP00000230301:L64P	L	-	2	0	C6orf118	165635610	1.000000	0.71417	0.995000	0.50966	0.172000	0.22775	4.774000	0.62339	2.012000	0.59069	0.533000	0.62120	CTG	C6orf118	-	NULL	ENSG00000112539		0.587	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C6orf118	HGNC	protein_coding	OTTHUMT00000043026.1	-	0.00	22	0	A	NM_144980		165715620	-1	tier1	-	no_errors	ENST00000230301	ensembl	human	known	74_37	missense	23.08	10	3	SNP	1.000	G
CDKN2A	1029	genome.wustl.edu	37	9	21967209	21967209	+	IGR	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr9:21967209G>A	ENST00000304494.5	-	0	1218				C9orf53_ENST00000441769.2_Missense_Mutation_p.R4H|RP11-145E5.5_ENST00000404796.2_Intron	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A						cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0(1)|p.0?(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		ATGAGGCAGCGTGGACAGGAG	0.488		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																																							2	Whole gene deletion(2)	lung(2)																																								SO:0001628	intergenic_variant	0			L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686		9.37:g.21967209G>A			A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	NULL	p.R4H	ENST00000304494.5	37	c.11	CCDS6510.1	9	.	.	.	.	.	.	.	.	.	.	G	3.162	-0.171827	0.06421	.	.	ENSG00000224854	ENST00000441769	.	.	.	1.95	-3.9	0.04181	.	.	.	.	.	T	0.34861	0.0912	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.40365	-0.9567	5	0.87932	D	0	.	4.1266	0.10129	0.5865:0.0:0.2369:0.1766	.	.	.	.	H	4	.	ENSP00000414893:R4H	R	+	2	0	C9orf53	21957209	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-1.290000	0.02777	-1.567000	0.01671	-0.459000	0.05422	CGT	C9orf53	-	NULL	ENSG00000224854		0.488	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C9orf53	HGNC	protein_coding	OTTHUMT00000051915.1	-	0.00	38	0	G	NM_000077		21967209	+1	tier1	-	no_errors	ENST00000441769	ensembl	human	known	74_37	missense	26.67	11	4	SNP	0.000	A
CACNA2D4	93589	genome.wustl.edu	37	12	1963175	1963175	+	Missense_Mutation	SNP	C	C	T	rs368331985		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr12:1963175C>T	ENST00000382722.5	-	23	2550	c.2188G>A	c.(2188-2190)Gcg>Acg	p.A730T	CACNA2D4_ENST00000585708.1_Missense_Mutation_p.A666T|CACNA2D4_ENST00000588077.1_Missense_Mutation_p.A666T|CACNA2D4_ENST00000585732.1_Missense_Mutation_p.A591T|CACNA2D4_ENST00000539048.2_Intron|CACNA2D4_ENST00000586184.1_Missense_Mutation_p.A730T|CACNA2D4_ENST00000587995.1_Missense_Mutation_p.A705T	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	730					calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		GTCACCACCGCGTCAAACAGC	0.617																																					Colon(2;101 179 21030 23310 28141)												0								C	THR/ALA	0,4250		0,0,2125	49.0	58.0	55.0		2188	5.4	0.2	12		55	1,8467		0,1,4233	no	missense	CACNA2D4	NM_172364.4	58	0,1,6358	TT,TC,CC		0.0118,0.0,0.0079	probably-damaging	730/1138	1963175	1,12717	2125	4234	6359	SO:0001583	missense	0			AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.2188G>A	12.37:g.1963175C>T	ENSP00000372169:p.Ala730Thr		Q7Z3S8|Q86XZ5|Q8IZS9	Missense_Mutation	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.A730T	ENST00000382722.5	37	c.2188	CCDS44785.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.658215	0.96734	0.0	1.18E-4	ENSG00000151062	ENST00000456077;ENST00000280663;ENST00000382722	T	0.35789	1.29	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.66237	0.2769	M	0.90542	3.125	0.80722	D	1	D;D	0.71674	0.998;0.998	D;P	0.64321	0.924;0.802	T	0.72792	-0.4186	10	0.54805	T	0.06	.	17.9462	0.89039	0.0:1.0:0.0:0.0	.	730;730	Q7Z3S7-2;Q7Z3S7	.;CA2D4_HUMAN	T	666;730;730	ENSP00000372169:A730T	ENSP00000280663:A730T	A	-	1	0	CACNA2D4	1833436	1.000000	0.71417	0.158000	0.22627	0.966000	0.64601	5.738000	0.68613	2.542000	0.85734	0.655000	0.94253	GCG	CACNA2D4	-	NULL	ENSG00000151062		0.617	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	CACNA2D4	HGNC	protein_coding	OTTHUMT00000398230.2	-	0.00	60	0	C			1963175	-1	tier1	-	no_errors	ENST00000382722	ensembl	human	known	74_37	missense	45.71	38	32	SNP	1.000	T
CADM1	23705	genome.wustl.edu	37	11	115080346	115080346	+	Silent	SNP	T	T	G	rs148111993	byFrequency	TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:115080346T>G	ENST00000452722.3	-	8	1046	c.1026A>C	c.(1024-1026)acA>acC	p.T342T	CADM1_ENST00000537058.1_Silent_p.T342T|CADM1_ENST00000537140.1_Intron|CADM1_ENST00000331581.6_Silent_p.T342T|CADM1_ENST00000542447.2_Intron|CADM1_ENST00000536727.1_Intron	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		tggtggtggttgttgtggGAG	0.433													T|||	7	0.00139776	0.0038	0.0	5008	,	,		10841	0.0		0.002	False		,,,				2504	0.0																0													46.0	51.0	49.0					11																	115080346		2201	4296	6497	SO:0001819	synonymous_variant	0			AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1026A>C	11.37:g.115080346T>G				Silent	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like_dom	p.T342	ENST00000452722.3	37	c.1026	CCDS8373.1	11																																																																																			CADM1	-	NULL	ENSG00000182985		0.433	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CADM1	HGNC	protein_coding	OTTHUMT00000398753.2	-	0.00	112	0	T	NM_014333		115080346	-1	tier1	rs148111993	no_errors	ENST00000452722	ensembl	human	known	74_37	silent	12.90	81	12	SNP	1.000	G
CADM2	253559	genome.wustl.edu	37	3	85961663	85961663	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:85961663C>G	ENST00000407528.2	+	5	705	c.643C>G	c.(643-645)Cag>Gag	p.Q215E	CADM2_ENST00000405615.2_Missense_Mutation_p.Q217E|CADM2_ENST00000383699.3_Missense_Mutation_p.Q224E	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	215	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		TGCCACCCCTCAGGTAGCCAT	0.483																																																	0													109.0	93.0	98.0					3																	85961663		2203	4300	6503	SO:0001583	missense	0			AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.643C>G	3.37:g.85961663C>G	ENSP00000384575:p.Gln215Glu		G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_C1-set,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like_dom	p.Q217E	ENST00000407528.2	37	c.649	CCDS54614.1	3	.	.	.	.	.	.	.	.	.	.	C	14.73	2.623407	0.46840	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	D;D;D	0.85702	-2.02;-2.02;-2.02	5.5	5.5	0.81552	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.157917	0.56097	D	0.000022	T	0.78349	0.4269	L	0.31926	0.97	0.53005	D	0.999965	B;B;B	0.19445	0.036;0.002;0.017	B;B;B	0.18263	0.021;0.009;0.007	T	0.73078	-0.4096	10	0.07644	T	0.81	.	19.3937	0.94596	0.0:1.0:0.0:0.0	.	217;224;215	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	E	224;215;217	ENSP00000373200:Q224E;ENSP00000384575:Q215E;ENSP00000384193:Q217E	ENSP00000373200:Q224E	Q	+	1	0	CADM2	86044353	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.539000	0.67199	2.583000	0.87209	0.591000	0.81541	CAG	CADM2	-	pfscan_Ig-like_dom	ENSG00000175161		0.483	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CADM2	HGNC	protein_coding	OTTHUMT00000352822.1	-	0.00	74	0	C	NM_153184		85961663	+1	tier1	-	no_errors	ENST00000405615	ensembl	human	known	74_37	missense	7.41	125	10	SNP	1.000	G
CALCR	799	genome.wustl.edu	37	7	93108802	93108802	+	Silent	SNP	A	A	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr7:93108802A>T	ENST00000394441.1	-	3	384	c.69T>A	c.(67-69)ctT>ctA	p.L23L	CALCR_ENST00000359558.2_Silent_p.L41L|CALCR_ENST00000421592.1_Silent_p.L23L|CALCR_ENST00000360249.4_Silent_p.L23L|CALCR_ENST00000426151.1_Silent_p.L23L	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	41					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	AAAAGGCAGGAAGAATTGGGG	0.378																																																	0													126.0	122.0	124.0					7																	93108802		2203	4300	6503	SO:0001819	synonymous_variant	0			L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.69T>A	7.37:g.93108802A>T			A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GCPR_2_calcitonin_rcpt_fam,prints_GPCR_2_secretin-like,prints_GPCR_2_calcitonin_rcpt	p.L41	ENST00000394441.1	37	c.123	CCDS5631.1	7																																																																																			CALCR	-	NULL	ENSG00000004948		0.378	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	CALCR	HGNC	protein_coding	OTTHUMT00000254661.2	-	0.00	35	0	A	NM_001742		93108802	-1	tier1	-	no_errors	ENST00000359558	ensembl	human	known	74_37	silent	42.86	12	9	SNP	0.012	T
CAPN7	23473	genome.wustl.edu	37	3	15248038	15248038	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:15248038G>T	ENST00000253693.2	+	1	289	c.36G>T	c.(34-36)caG>caT	p.Q12H	COL6A4P1_ENST00000446690.2_RNA	NM_014296.2	NP_055111.1	Q9Y6W3	CAN7_HUMAN	calpain 7	12					positive regulation of epithelial cell migration (GO:0010634)|self proteolysis (GO:0097264)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|endopeptidase activity (GO:0004175)|MIT domain binding (GO:0090541)			breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|skin(2)	22						ACGCTGTGCAGTTCGCCCGTC	0.697																																																	0													15.0	18.0	17.0					3																	15248038		2144	4220	6364	SO:0001583	missense	0			AB028639	CCDS2624.1	3p24	2008-07-18			ENSG00000131375	ENSG00000131375			1484	protein-coding gene	gene with protein product	"""calpain like protease"", ""homolog of Aspergillus Nidulans PALB"""	606400				8163008, 10051333	Standard	NM_014296		Approved	PalBH	uc003bzn.3	Q9Y6W3	OTTHUMG00000129863	ENST00000253693.2:c.36G>T	3.37:g.15248038G>T	ENSP00000253693:p.Gln12His			Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_MIT,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_MIT,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,prints_Calpain_cysteine_protease,pfscan_Peptidase_C2_calpain_cat	p.Q12H	ENST00000253693.2	37	c.36	CCDS2624.1	3	.	.	.	.	.	.	.	.	.	.	G	9.156	1.017463	0.19355	.	.	ENSG00000131375	ENST00000253693	T	0.70749	-0.51	4.76	1.69	0.24217	MIT (2);	0.435086	0.22428	N	0.060195	T	0.40862	0.1134	N	0.02011	-0.69	0.33062	D	0.534217	B	0.02656	0.0	B	0.04013	0.001	T	0.40942	-0.9536	10	0.40728	T	0.16	-6.7488	9.2844	0.37749	0.1563:0.1311:0.7127:0.0	.	12	Q9Y6W3	CAN7_HUMAN	H	12	ENSP00000253693:Q12H	ENSP00000253693:Q12H	Q	+	3	2	CAPN7	15223042	1.000000	0.71417	0.999000	0.59377	0.038000	0.13279	0.909000	0.28558	0.444000	0.26612	0.555000	0.69702	CAG	CAPN7	-	pfam_MIT,smart_MIT	ENSG00000131375		0.697	CAPN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN7	HGNC	protein_coding	OTTHUMT00000252105.2	-	0.00	71	0	G	NM_014296		15248038	+1	tier1	-	no_errors	ENST00000253693	ensembl	human	known	74_37	missense	29.63	38	16	SNP	1.000	T
CAPZA2	830	genome.wustl.edu	37	7	116520179	116520180	+	Intron	INS	-	-	T	rs375369783		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr7:116520179_116520180insT	ENST00000361183.3	+	2	178				CAPZA2_ENST00000458284.2_Intron|CAPZA2_ENST00000490693.1_Intron	NM_006136.2	NP_006127.1	P47755	CAZA2_HUMAN	capping protein (actin filament) muscle Z-line, alpha 2						actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|membrane (GO:0016020)|WASH complex (GO:0071203)				endometrium(2)|kidney(3)|large_intestine(4)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	13	all_cancers(3;8.53e-08)|all_epithelial(6;7.79e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)		GBM - Glioblastoma multiforme(2;5.01e-06)|STAD - Stomach adenocarcinoma(10;0.000512)|all cancers(2;0.00326)			AAGTTGGCCAATTTTTTTTTAA	0.337																																																	0																																										SO:0001627	intron_variant	0				CCDS5768.1	7q31.2-q31.3	2008-07-18			ENSG00000198898	ENSG00000198898			1490	protein-coding gene	gene with protein product	"""F-actin capping protein alpha-2 subunit"""	601571					Standard	NM_006136		Approved	CAPZ, CAPPA2	uc003vil.3	P47755	OTTHUMG00000023185	ENST00000361183.3:c.40-8001->T	7.37:g.116520188_116520188dupT			B4DG50	Frame_Shift_Ins	INS	NULL	p.L36fs	ENST00000361183.3	37	c.98_99	CCDS5768.1	7																																																																																			CAPZA2	-	NULL	ENSG00000198898		0.337	CAPZA2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPZA2	HGNC	protein_coding	OTTHUMT00000059506.4		0.00	38	0	-	NM_006136		116520180	+1	tier1		no_errors	ENST00000449080	ensembl	human	known	74_37	frame_shift_ins	13.33	26	4	INS	0.000:0.021	T
CCDC15	80071	genome.wustl.edu	37	11	124875054	124875054	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:124875054G>C	ENST00000344762.5	+	13	2616	c.2357G>C	c.(2356-2358)aGa>aCa	p.R786T	CCDC15_ENST00000529051.1_Missense_Mutation_p.R786T	NM_025004.2	NP_079280.2	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	786						centrosome (GO:0005813)				central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(1)	23	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		gatattGAGAGAGAACAAGTT	0.338																																																	0													46.0	39.0	41.0					11																	124875054		1824	4075	5899	SO:0001583	missense	0			BC018540	CCDS44756.1	11q24.2	2008-02-05			ENSG00000149548	ENSG00000149548			25798	protein-coding gene	gene with protein product							Standard	NM_025004		Approved	FLJ13215	uc001qbm.4	Q0P6D6	OTTHUMG00000165940	ENST00000344762.5:c.2357G>C	11.37:g.124875054G>C	ENSP00000341684:p.Arg786Thr		Q9H8U7	Missense_Mutation	SNP	NULL	p.R786T	ENST00000344762.5	37	c.2357	CCDS44756.1	11	.	.	.	.	.	.	.	.	.	.	G	21.8	4.205899	0.79127	.	.	ENSG00000149548	ENST00000529051;ENST00000344762	T;T	0.72505	-0.49;-0.66	5.42	5.42	0.78866	.	0.000000	0.42172	D	0.000744	D	0.83353	0.5236	M	0.67397	2.05	0.32256	N	0.570742	D	0.89917	1.0	D	0.91635	0.999	D	0.85541	0.1215	10	0.62326	D	0.03	-7.0178	18.3628	0.90380	0.0:0.0:1.0:0.0	.	786	Q0P6D6	CCD15_HUMAN	T	786	ENSP00000435403:R786T;ENSP00000341684:R786T	ENSP00000341684:R786T	R	+	2	0	CCDC15	124380264	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	5.656000	0.67988	2.689000	0.91719	0.655000	0.94253	AGA	CCDC15	-	NULL	ENSG00000149548		0.338	CCDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC15	HGNC	protein_coding	OTTHUMT00000387131.1	-	0.00	122	0	G	NM_025004		124875054	+1	tier1	-	no_errors	ENST00000344762	ensembl	human	known	74_37	missense	20.51	93	24	SNP	1.000	C
CCDC17	149483	genome.wustl.edu	37	1	46088492	46088492	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:46088492G>A	ENST00000528266.1	-	5	818	c.671C>T	c.(670-672)tCc>tTc	p.S224F	CCDC17_ENST00000421127.2_Missense_Mutation_p.S215F|CCDC17_ENST00000343901.2_Missense_Mutation_p.S192F|CCDC17_ENST00000464739.1_5'Flank|CCDC17_ENST00000445048.2_Intron			Q96LX7	CCD17_HUMAN	coiled-coil domain containing 17	224										kidney(1)|large_intestine(1)|lung(1)|ovary(2)	5	Acute lymphoblastic leukemia(166;0.155)					CTCTCGCCGGGAGCTCAGCGG	0.687																																																	0													16.0	16.0	16.0					1																	46088492		2201	4298	6499	SO:0001583	missense	0				CCDS44131.1, CCDS44131.2, CCDS53314.1	1p34.1	2014-02-12			ENSG00000159588	ENSG00000159588			26574	protein-coding gene	gene with protein product							Standard	NM_001190182		Approved	FLJ33084	uc010olt.2	Q96LX7	OTTHUMG00000007822	ENST00000528266.1:c.671C>T	1.37:g.46088492G>A	ENSP00000432172:p.Ser224Phe		A1A4Y7|B4DNX7|B4E1Q5|C9J8L2|Q0P683|Q5T629	Missense_Mutation	SNP	NULL	p.S192F	ENST00000528266.1	37	c.575	CCDS44131.2	1	.	.	.	.	.	.	.	.	.	.	G	15.49	2.850530	0.51270	.	.	ENSG00000159588	ENST00000421127;ENST00000343901;ENST00000528266	T;T;T	0.19250	2.16;2.16;2.16	5.04	4.1	0.47936	.	1.678270	0.02728	N	0.114711	T	0.22898	0.0553	L	0.29908	0.895	0.09310	N	1	D;P;P	0.54964	0.969;0.799;0.799	P;B;B	0.44811	0.461;0.366;0.366	T	0.25813	-1.0121	10	0.66056	D	0.02	-0.0073	9.9275	0.41501	0.1002:0.0:0.8998:0.0	.	224;215;192	Q96LX7;Q96LX7-5;F2Z395	CCD17_HUMAN;.;.	F	215;192;224	ENSP00000389415:S215F;ENSP00000341451:S192F;ENSP00000432172:S224F	ENSP00000341451:S192F	S	-	2	0	CCDC17	45861079	0.001000	0.12720	0.012000	0.15200	0.005000	0.04900	0.539000	0.23175	2.501000	0.84356	0.561000	0.74099	TCC	CCDC17	-	NULL	ENSG00000159588		0.687	CCDC17-008	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CCDC17	HGNC	protein_coding	OTTHUMT00000386833.1	-	0.00	148	0	G	NM_152500		46088492	-1	tier1	-	no_errors	ENST00000343901	ensembl	human	known	74_37	missense	47.73	92	84	SNP	0.003	A
CCDC81	60494	genome.wustl.edu	37	11	86120398	86120398	+	Silent	SNP	G	G	A	rs553491893		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:86120398G>A	ENST00000445632.2	+	10	1481	c.1209G>A	c.(1207-1209)ccG>ccA	p.P403P	CCDC81_ENST00000354755.1_Silent_p.P313P|CCDC81_ENST00000528728.1_Silent_p.P138P|CCDC81_ENST00000278487.3_Silent_p.P138P	NM_001156474.1	NP_001149946.1	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81	403										kidney(3)|large_intestine(8)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	20		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				ATGAGAAACCGGAATTTTATG	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		13195	0.001		0.0	False		,,,				2504	0.0																0													45.0	51.0	48.0					11																	86120398		2202	4298	6500	SO:0001819	synonymous_variant	0			AK131331	CCDS8276.1, CCDS53691.1	11q14.2	2006-03-09			ENSG00000149201	ENSG00000149201			26281	protein-coding gene	gene with protein product							Standard	NM_001156474		Approved	FLJ16339, FLJ23514	uc001pbx.2	Q6ZN84	OTTHUMG00000167213	ENST00000445632.2:c.1209G>A	11.37:g.86120398G>A			A0AVL7|Q53FW3|Q9H5E5	Silent	SNP	superfamily_IHF-like_DNA-bd_dom	p.P403	ENST00000445632.2	37	c.1209	CCDS53691.1	11																																																																																			CCDC81	-	NULL	ENSG00000149201		0.388	CCDC81-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC81	HGNC	protein_coding	OTTHUMT00000393756.1	-	0.00	253	0	G	NM_021827		86120398	+1	tier1	-	no_errors	ENST00000445632	ensembl	human	known	74_37	silent	20.92	154	41	SNP	0.128	A
CCM2	83605	genome.wustl.edu	37	7	45113868	45113868	+	Splice_Site	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr7:45113868G>T	ENST00000258781.6	+	9	1064		c.e9-1		CCM2_ENST00000461377.1_Splice_Site|CCM2_ENST00000474617.1_Splice_Site|CCM2_ENST00000475551.1_Splice_Site|CCM2_ENST00000541586.1_Splice_Site|CCM2_ENST00000381112.3_Splice_Site|CCM2_ENST00000544363.1_Splice_Site	NM_031443.3	NP_113631.1	Q9BSQ5	CCM2_HUMAN	cerebral cavernous malformation 2						blood vessel endothelial cell differentiation (GO:0060837)|cell-cell junction organization (GO:0045216)|endothelial cell development (GO:0001885)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|integrin-mediated signaling pathway (GO:0007229)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|stress-activated MAPK cascade (GO:0051403)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)	cytoplasm (GO:0005737)|protein complex (GO:0043234)				NS(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						CTCTCTTGCAGCTGCGCACCA	0.607																																																	0													51.0	48.0	49.0					7																	45113868		2203	4300	6503	SO:0001630	splice_region_variant	0			BC004903	CCDS5500.1, CCDS34630.1, CCDS55108.1, CCDS55109.1	7p13	2014-09-17	2004-02-13	2004-02-18	ENSG00000136280	ENSG00000136280			21708	protein-coding gene	gene with protein product	"""malcavernin"""	607929	"""chromosome 7 open reading frame 22"""	C7orf22		9811928	Standard	NM_001029835		Approved	MGC4607	uc003tms.3	Q9BSQ5	OTTHUMG00000129246	ENST00000258781.6:c.916-1G>T	7.37:g.45113868G>T			A4D2L4|B3KUV0|D3DVL4|E9PDJ3|F5H0E1|F5H551|Q71RE5|Q8TAT4	Splice_Site	SNP	-	e9-1	ENST00000258781.6	37	c.979-1	CCDS5500.1	7	.	.	.	.	.	.	.	.	.	.	G	20.8	4.045729	0.75846	.	.	ENSG00000136280	ENST00000258781;ENST00000541586;ENST00000544363;ENST00000475551;ENST00000381112;ENST00000474617	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7483	0.88427	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCM2	45080393	1.000000	0.71417	0.842000	0.33263	0.825000	0.46686	9.856000	0.99531	2.613000	0.88420	0.561000	0.74099	.	CCM2	-	-	ENSG00000136280		0.607	CCM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCM2	HGNC	protein_coding	OTTHUMT00000251348.1	-	0.00	52	0	G	NM_031443	Intron	45113868	+1	tier1	-	no_errors	ENST00000381112	ensembl	human	known	74_37	splice_site	7.14	52	4	SNP	1.000	T
CCSER1	401145	genome.wustl.edu	37	4	92520186	92520186	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr4:92520186C>G	ENST00000509176.1	+	11	2969	c.2681C>G	c.(2680-2682)aCt>aGt	p.T894S	CCSER1_ENST00000333691.8_Missense_Mutation_p.T894S	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	894																	GAGCTGCAAACTCTAGGCCAG	0.443																																																	0													26.0	23.0	24.0					4																	92520186		692	1591	2283	SO:0001583	missense	0				CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.2681C>G	4.37:g.92520186C>G	ENSP00000425040:p.Thr894Ser		Q4W5M0|Q86V57	Missense_Mutation	SNP	NULL	p.T894S	ENST00000509176.1	37	c.2681	CCDS47099.1	4	.	.	.	.	.	.	.	.	.	.	C	15.57	2.871388	0.51695	.	.	ENSG00000184305	ENST00000509176;ENST00000333691	T;T	0.33865	1.39;1.39	5.49	5.49	0.81192	.	.	.	.	.	T	0.28532	0.0706	N	0.19112	0.55	0.25864	N	0.983787	B	0.14805	0.011	B	0.15484	0.013	T	0.09684	-1.0663	9	0.29301	T	0.29	-1.447	17.9056	0.88917	0.0:1.0:0.0:0.0	.	894	Q9C0I3	F190A_HUMAN	S	894	ENSP00000425040:T894S;ENSP00000329482:T894S	ENSP00000329482:T894S	T	+	2	0	FAM190A	92739209	1.000000	0.71417	0.996000	0.52242	0.669000	0.39330	3.984000	0.56923	2.732000	0.93576	0.650000	0.86243	ACT	CCSER1	-	NULL	ENSG00000184305		0.443	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCSER1	HGNC	protein_coding	OTTHUMT00000363109.3	-	0.00	79	0	C	NM_001145065		92520186	+1	tier1	-	no_errors	ENST00000333691	ensembl	human	known	74_37	missense	28.57	25	10	SNP	1.000	G
CDC16	8881	genome.wustl.edu	37	13	115012590	115012591	+	Intron	INS	-	-	T	rs5807004		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr13:115012590_115012591insT	ENST00000356221.3	+	11	1079				CDC16_ENST00000375308.1_Intron|MIR548AR_ENST00000582191.1_RNA|CDC16_ENST00000252457.5_Intron|CDC16_ENST00000360383.3_Intron|CDC16_ENST00000375310.1_Intron|CDC16_ENST00000252458.6_Intron|CDC16_ENST00000375312.3_Intron			Q13042	CDC16_HUMAN	cell division cycle 16						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of mitosis (GO:0007088)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|spindle (GO:0005819)				endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			AAGAATAAATGttttttttttt	0.351																																																	0																																										SO:0001627	intron_variant	0			U18291	CCDS9542.2	13q34	2013-01-17	2013-01-17		ENSG00000130177	ENSG00000130177		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1720	protein-coding gene	gene with protein product	"""anaphase-promoting complex, subunit 6"""	603461	"""CDC16 (cell division cycle 16, S. cerevisiae, homolog)"", ""CDC16 cell division cycle 16 homolog (S. cerevisiae)"", ""cell division cycle 16 homolog (S. cerevisiae)"""			7736578	Standard	NM_001078645		Approved	APC6, ANAPC6, CUT9	uc001vul.1	Q13042	OTTHUMG00000017402	ENST00000356221.3:c.971+111->T	13.37:g.115012601_115012601dupT			A2A365|Q5T8C8|Q96AE6|Q9Y564	RNA	INS	-	NULL	ENST00000356221.3	37	NULL	CCDS9542.2	13																																																																																			CDC16	-	-	ENSG00000130177		0.351	CDC16-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDC16	HGNC	protein_coding	OTTHUMT00000276737.1		0.00	22	0	-	NM_003903		115012591	+1	tier1		no_errors	ENST00000494581	ensembl	human	known	74_37	rna	15.38	22	4	INS	0.000:0.004	T
CFH	3075	genome.wustl.edu	37	1	196694303	196694303	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:196694303G>C	ENST00000367429.4	+	12	1989	c.1749G>C	c.(1747-1749)aaG>aaC	p.K583N		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	583	Sushi 10. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						CTGATCGCAAGAAAGACCAGT	0.348																																																	0													77.0	67.0	70.0					1																	196694303		2203	4300	6503	SO:0001583	missense	0			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.1749G>C	1.37:g.196694303G>C	ENSP00000356399:p.Lys583Asn		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.K583N	ENST00000367429.4	37	c.1749	CCDS1385.1	1	.	.	.	.	.	.	.	.	.	.	G	14.77	2.634575	0.47049	.	.	ENSG00000000971	ENST00000367429	T	0.64618	-0.11	5.74	-2.88	0.05682	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.44808	0.1311	L	0.50333	1.59	0.09310	N	1	B	0.30634	0.288	B	0.22880	0.042	T	0.24119	-1.0169	9	0.17832	T	0.49	.	5.4073	0.16328	0.4395:0.2569:0.3036:0.0	.	583	P08603	CFAH_HUMAN	N	583	ENSP00000356399:K583N	ENSP00000356399:K583N	K	+	3	2	CFH	194960926	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.443000	0.06862	-0.767000	0.04633	-0.903000	0.02851	AAG	CFH	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000000971		0.348	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000086412.2	-	0.00	50	0	G	NM_000186		196694303	+1	tier1	-	no_errors	ENST00000367429	ensembl	human	known	74_37	missense	10.61	59	7	SNP	0.000	C
CHD7	55636	genome.wustl.edu	37	8	61754274	61754276	+	Missense_Mutation	TNP	TAA	TAA	GCG	rs530345787		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T|A|A	T|A|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr8:61754274_61754276TAA>GCG	ENST00000423902.2	+	20	5084_5086	c.4605_4607TAA>GCG	c.(4603-4608)gcTAAg>gcGCGg	p.K1536R	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1536					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			AAAAGTGGGCTAAGAAGGCTGAA	0.394																																																	0																																										SO:0001583	missense	0			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.4605_4607TAA>GCG	8.37:g.61754274TAA>GCG	ENSP00000392028:p.Lys1536Arg		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent|Missense_Mutation|Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.A1535|p.K1536Q|p.K1536R	ENST00000423902.2	37	c.4605|c.4606|c.4607	CCDS47865.1	8																																																																																			CHD7	-	NULL	ENSG00000171316		0.394	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2	-	0.00	139|141|142	0	T|A|A	XM_098762		61754274|61754275|61754276	+1	tier1	-	no_errors	ENST00000423902	ensembl	human	known	74_37	silent|missense|missense	14.58|14.48|14.48	123|124|124	21	SNP	0.227|1.000|1.000	G|C|G
CHRNA1	1134	genome.wustl.edu	37	2	175614679	175614679	+	Missense_Mutation	SNP	G	G	A	rs374391312		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:175614679G>A	ENST00000261007.5	-	8	1138	c.1072C>T	c.(1072-1074)Cgg>Tgg	p.R358W	CHRNA1_ENST00000409542.1_Missense_Mutation_p.R251W|CHRNA1_ENST00000348749.5_Missense_Mutation_p.R333W|CHRNA1_ENST00000409219.1_Missense_Mutation_p.R333W|AC018890.6_ENST00000442996.1_RNA	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	358					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	CTCACCTTCCGCACCCAGTTG	0.567																																																	0			GRCh37	CM086805	CHRNA1	M		G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	95.0	79.0	85.0		997,1072	3.6	1.0	2		85	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CHRNA1	NM_000079.3,NM_001039523.2	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	333/458,358/483	175614679	1,13005	2203	4300	6503	SO:0001583	missense	0			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.1072C>T	2.37:g.175614679G>A	ENSP00000261007:p.Arg358Trp		B4DRV6|D3DPE8	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel	p.R358W	ENST00000261007.5	37	c.1072	CCDS33331.1	2	.	.	.	.	.	.	.	.	.	.	G	17.14	3.312388	0.60414	0.0	1.16E-4	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542;ENST00000409219	D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35	5.64	3.61	0.41365	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.95329	0.8484	M	0.93462	3.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.95783	0.8818	10	0.87932	D	0	.	11.9266	0.52823	0.0:0.0:0.4057:0.5943	.	333;358	Q53SH4;P02708	.;ACHA_HUMAN	W	333;358;251;333	ENSP00000261008:R333W;ENSP00000261007:R358W;ENSP00000387026:R251W;ENSP00000386611:R333W	ENSP00000261007:R358W	R	-	1	2	CHRNA1	175322925	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.055000	0.64282	1.315000	0.45114	0.655000	0.94253	CGG	CHRNA1	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM	ENSG00000138435		0.567	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	CHRNA1	HGNC	protein_coding	OTTHUMT00000334116.1	-	0.00	35	0	G			175614679	-1	tier1	-	no_errors	ENST00000261007	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	A
CIRH1A	84916	genome.wustl.edu	37	16	69199442	69199442	+	Intron	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:69199442C>T	ENST00000314423.7	+	15	2010				CIRH1A_ENST00000352319.4_Intron|CIRH1A_ENST00000563094.1_Silent_p.L616L			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)						maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		GAGTTCTTCACTGCTACCTCC	0.398																																					Melanoma(69;1156 1278 4951 8715 52012)												0													128.0	98.0	108.0					16																	69199442		2198	4300	6498	SO:0001627	intron_variant	0			AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.1833+13C>T	16.37:g.69199442C>T			Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.L616	ENST00000314423.7	37	c.1846	CCDS10872.1	16																																																																																			CIRH1A	-	NULL	ENSG00000141076		0.398	CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIRH1A	HGNC	protein_coding	OTTHUMT00000268950.2	-	0.00	54	0	C	NM_032830		69199442	+1	tier1	-	no_errors	ENST00000563094	ensembl	human	novel	74_37	silent	5.26	72	4	SNP	0.000	T
CIZ1	25792	genome.wustl.edu	37	9	130928602	130928602	+	Silent	SNP	T	T	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr9:130928602T>G	ENST00000393608.1	-	17	2773	c.2571A>C	c.(2569-2571)acA>acC	p.T857T	CIZ1_ENST00000277465.4_Silent_p.T829T|CIZ1_ENST00000372954.1_Silent_p.T777T|CIZ1_ENST00000538431.1_Silent_p.T883T|CIZ1_ENST00000325721.8_Silent_p.T828T|CIZ1_ENST00000372938.5_Silent_p.T857T|CIZ1_ENST00000476727.2_5'Flank|CIZ1_ENST00000541172.1_Silent_p.T756T|CIZ1_ENST00000357558.5_Silent_p.T829T|CIZ1_ENST00000372948.3_Silent_p.T801T	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	857					maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						TGAACAGGGCTGTCAAAGCGT	0.647																																																	0													42.0	44.0	43.0					9																	130928602		2186	4277	6463	SO:0001819	synonymous_variant	0			AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.2571A>C	9.37:g.130928602T>G			A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Silent	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,pfscan_Znf_C2H2_matrin	p.T883	ENST00000393608.1	37	c.2649	CCDS6894.1	9																																																																																			CIZ1	-	NULL	ENSG00000148337		0.647	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIZ1	HGNC	protein_coding	OTTHUMT00000054399.1	-	0.00	153	0	T	NM_012127		130928602	-1	tier1	-	no_errors	ENST00000538431	ensembl	human	known	74_37	silent	33.33	64	32	SNP	0.956	G
CNEP1R1	255919	genome.wustl.edu	37	16	50063691	50063691	+	Silent	SNP	A	A	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:50063691A>T	ENST00000427478.2	+	3	207	c.153A>T	c.(151-153)atA>atT	p.I51I	CNEP1R1_ENST00000565556.1_Silent_p.I19I|CNEP1R1_ENST00000458059.3_Silent_p.I68I|CNEP1R1_ENST00000562576.1_Silent_p.I51I	NM_001281789.1	NP_001268718.1	Q8N9A8	NEPR1_HUMAN	CTD nuclear envelope phosphatase 1 regulatory subunit 1	51					lipid metabolic process (GO:0006629)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of triglyceride biosynthetic process (GO:0010867)|protein localization to nucleus (GO:0034504)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|Nem1-Spo7 phosphatase complex (GO:0071595)|nuclear membrane (GO:0031965)											ACTGGTTAATAGACCCTGAGA	0.318																																																	0													179.0	160.0	166.0					16																	50063691		1853	4083	5936	SO:0001819	synonymous_variant	0			AK095420	CCDS45480.1, CCDS61931.1	16q12.1	2012-02-01	2012-02-01	2012-02-01	ENSG00000205423	ENSG00000205423			26759	protein-coding gene	gene with protein product	"""nuclear envelope phosphatase 1-regulatory subunit 1"""		"""chromosome 16 open reading frame 69"", ""transmembrane protein 188"""	C16orf69, TMEM188		22134922	Standard	NM_153261		Approved	FLJ38101, NEP1-R1	uc002eft.3	Q8N9A8		ENST00000427478.2:c.153A>T	16.37:g.50063691A>T			Q4G1A9|Q5H9V0|Q8NE06	Silent	SNP	pfam_Transmembrane_protein_188	p.I68	ENST00000427478.2	37	c.204		16																																																																																			CNEP1R1	-	pfam_Transmembrane_protein_188	ENSG00000205423		0.318	CNEP1R1-201	KNOWN	basic|appris_principal	protein_coding	CNEP1R1	HGNC	protein_coding		-	0.00	101	0	A	NM_153261		50063691	+1	tier1	-	no_errors	ENST00000458059	ensembl	human	known	74_37	silent	16.94	103	21	SNP	1.000	T
CMTM2	146225	genome.wustl.edu	37	16	66613777	66613777	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:66613777G>C	ENST00000268595.2	+	1	418	c.267G>C	c.(265-267)gaG>gaC	p.E89D	RP11-403P17.2_ENST00000568430.1_RNA|CMTM2_ENST00000379486.2_Missense_Mutation_p.E89D	NM_144673.2	NP_653274.1	Q8TAZ6	CKLF2_HUMAN	CKLF-like MARVEL transmembrane domain containing 2	89	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.068)|Epithelial(162;0.212)		GGCACGCTGAGATCAAGATTC	0.597																																																	0													41.0	45.0	44.0					16																	66613777		2201	4300	6501	SO:0001583	missense	0			BC025354	CCDS10814.1, CCDS56001.1	16q22.1-q22.3	2008-02-05	2005-11-08	2005-11-08	ENSG00000140932	ENSG00000140932			19173	protein-coding gene	gene with protein product		607885	"""chemokine-like factor super family 2"", ""chemokine-like factor superfamily 2"""	CKLFSF2			Standard	NM_001199317		Approved	MGC39436, FLJ25732	uc002ept.3	Q8TAZ6	OTTHUMG00000137501	ENST00000268595.2:c.267G>C	16.37:g.66613777G>C	ENSP00000268595:p.Glu89Asp		Q5I2A4|Q8N7E5	Missense_Mutation	SNP	NULL	p.E89D	ENST00000268595.2	37	c.267	CCDS10814.1	16	.	.	.	.	.	.	.	.	.	.	G	15.49	2.847981	0.51164	.	.	ENSG00000140932	ENST00000379486;ENST00000268595	T;T	0.49432	0.78;1.43	4.51	2.53	0.30540	Marvel (1);	1.012970	0.07912	N	0.974506	T	0.52837	0.1759	L	0.48642	1.525	0.09310	N	1	D;D	0.56968	0.978;0.978	P;P	0.56343	0.796;0.647	T	0.35351	-0.9792	10	0.48119	T	0.1	-22.373	5.9933	0.19478	0.1045:0.2173:0.6783:0.0	.	89;89	Q5I2A4;Q8TAZ6	.;CKLF2_HUMAN	D	89	ENSP00000368800:E89D;ENSP00000268595:E89D	ENSP00000268595:E89D	E	+	3	2	CMTM2	65171278	0.667000	0.27484	0.050000	0.19076	0.305000	0.27757	0.850000	0.27737	0.805000	0.34159	0.561000	0.74099	GAG	CMTM2	-	NULL	ENSG00000140932		0.597	CMTM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CMTM2	HGNC	protein_coding	OTTHUMT00000268808.1	-	0.00	62	0	G			66613777	+1	tier1	-	no_errors	ENST00000268595	ensembl	human	known	74_37	missense	37.14	44	26	SNP	0.057	C
COL5A1	1289	genome.wustl.edu	37	9	137642670	137642670	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr9:137642670A>G	ENST00000371817.3	+	13	2018	c.1604A>G	c.(1603-1605)aAa>aGa	p.K535R		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	535	Interrupted collagenous region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GCGGGCTCCAAAGGCCCCATG	0.627																																																	0													36.0	37.0	37.0					9																	137642670		2202	4300	6502	SO:0001583	missense	0			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.1604A>G	9.37:g.137642670A>G	ENSP00000360882:p.Lys535Arg		Q15094|Q5SUX4	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.K535R	ENST00000371817.3	37	c.1604	CCDS6982.1	9	.	.	.	.	.	.	.	.	.	.	A	20.0	3.929692	0.73327	.	.	ENSG00000130635	ENST00000371817	D	0.90955	-2.76	4.54	4.54	0.55810	.	0.059417	0.64402	N	0.000004	D	0.95105	0.8414	M	0.84511	2.7	0.53005	D	0.999964	D	0.63880	0.993	D	0.70935	0.971	D	0.95418	0.8504	10	0.59425	D	0.04	.	13.1516	0.59492	1.0:0.0:0.0:0.0	.	535	P20908	CO5A1_HUMAN	R	535	ENSP00000360882:K535R	ENSP00000360882:K535R	K	+	2	0	COL5A1	136782491	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.072000	0.89496	1.804000	0.52760	0.460000	0.39030	AAA	COL5A1	-	NULL	ENSG00000130635		0.627	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A1	HGNC	protein_coding	OTTHUMT00000054954.2		0.00	105	0	A	NM_000093		137642670	+1			no_errors	ENST00000371817	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	G
COL6A1	1291	genome.wustl.edu	37	21	47423920	47423920	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr21:47423920T>C	ENST00000361866.3	+	35	3194	c.3080T>C	c.(3079-3081)cTg>cCg	p.L1027P	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	1027	C-terminal globular domain.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		AAGGTGGCGCTGGGCTAGCCC	0.612																																																	0													49.0	52.0	51.0					21																	47423920		2202	4299	6501	SO:0001583	missense	0			M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.3080T>C	21.37:g.47423920T>C	ENSP00000355180:p.Leu1027Pro		O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.L1027P	ENST00000361866.3	37	c.3080	CCDS13727.1	21	.	.	.	.	.	.	.	.	.	.	T	13.45	2.241975	0.39598	.	.	ENSG00000142156	ENST00000361866	D	0.92048	-2.96	4.83	2.28	0.28536	.	0.568629	0.16049	N	0.232043	D	0.85128	0.5626	L	0.29908	0.895	0.43703	D	0.996168	P	0.37955	0.612	B	0.34722	0.188	T	0.79605	-0.1734	10	0.72032	D	0.01	-5.8849	8.6564	0.34066	0.3376:0.0:0.0:0.6624	.	1027	P12109	CO6A1_HUMAN	P	1027	ENSP00000355180:L1027P	ENSP00000355180:L1027P	L	+	2	0	COL6A1	46248348	0.514000	0.26202	0.486000	0.27416	0.518000	0.34316	0.472000	0.22116	0.149000	0.19098	0.486000	0.48141	CTG	COL6A1	-	NULL	ENSG00000142156		0.612	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A1	HGNC	protein_coding	OTTHUMT00000206877.1	-	0.00	89	0	T	NM_001848		47423920	+1	tier1	-	no_errors	ENST00000361866	ensembl	human	known	74_37	missense	5.68	83	5	SNP	0.325	C
COL6A5	256076	genome.wustl.edu	37	3	130098602	130098602	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:130098602G>A	ENST00000432398.2	+	4	1503	c.1009G>A	c.(1009-1011)Gga>Aga	p.G337R	COL6A5_ENST00000265379.6_Missense_Mutation_p.G337R	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	337	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						AAGAGCACAAGGAGTGCCTCA	0.493																																																	0													120.0	101.0	107.0					3																	130098602		692	1591	2283	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.1009G>A	3.37:g.130098602G>A	ENSP00000390895:p.Gly337Arg		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.G337R	ENST00000432398.2	37	c.1009		3	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349808	0.61183	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	T;T	0.79940	-1.32;-1.32	5.34	5.34	0.76211	.	.	.	.	.	D	0.91026	0.7177	M	0.87971	2.92	0.40268	D	0.978253	D	0.89917	1.0	D	0.97110	1.0	D	0.92067	0.5661	9	0.52906	T	0.07	.	17.8255	0.88664	0.0:0.0:1.0:0.0	.	337	A8TX70-2	.	R	337	ENSP00000390895:G337R;ENSP00000265379:G337R	ENSP00000265379:G337R	G	+	1	0	COL6A5	131581292	1.000000	0.71417	0.720000	0.30636	0.928000	0.56348	5.116000	0.64661	2.503000	0.84419	0.455000	0.32223	GGA	COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000172752		0.493	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		-	0.00	46	0	G	NM_153264		130098602	+1	tier1	-	no_errors	ENST00000265379	ensembl	human	known	74_37	missense	11.11	64	8	SNP	0.988	A
COX5A	9377	genome.wustl.edu	37	15	75219207	75219207	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr15:75219207T>C	ENST00000322347.6	-	3	392	c.239A>G	c.(238-240)tAt>tGt	p.Y80C	COX5A_ENST00000568783.1_Missense_Mutation_p.Y80C|COX5A_ENST00000567270.1_Missense_Mutation_p.Y41C|COX5A_ENST00000564811.1_Missense_Mutation_p.Y80C|COX5A_ENST00000562233.1_Intron|COX5A_ENST00000568517.1_5'UTR	NM_004255.3	NP_004246.2	P20674	COX5A_HUMAN	cytochrome c oxidase subunit Va	80					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)	cytochrome-c oxidase activity (GO:0004129)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|pancreas(1)	3						AACCATATCATAGGTAACAAG	0.383																																																	0													77.0	74.0	75.0					15																	75219207		2197	4295	6492	SO:0001583	missense	0			M22760	CCDS10273.1	15q25	2011-07-04			ENSG00000178741	ENSG00000178741	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2267	protein-coding gene	gene with protein product		603773				10072584, 2853101	Standard	NM_004255		Approved		uc002azi.4	P20674	OTTHUMG00000142825	ENST00000322347.6:c.239A>G	15.37:g.75219207T>C	ENSP00000317780:p.Tyr80Cys		P30045|Q8TB65	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su5A/6,superfamily_Cyt_c_oxidase_su5A/6	p.Y80C	ENST00000322347.6	37	c.239	CCDS10273.1	15	.	.	.	.	.	.	.	.	.	.	T	23.5	4.426123	0.83667	.	.	ENSG00000178741	ENST00000322347	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.81370	0.4808	M	0.87097	2.86	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	D	0.84711	0.0734	9	0.72032	D	0.01	-9.5927	14.9026	0.70692	0.0:0.0:0.0:1.0	.	80	P20674	COX5A_HUMAN	C	80	.	ENSP00000317780:Y80C	Y	-	2	0	COX5A	73006260	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.552000	0.82192	2.201000	0.70794	0.533000	0.62120	TAT	COX5A	-	pfam_Cyt_c_oxidase_su5A/6,superfamily_Cyt_c_oxidase_su5A/6	ENSG00000178741		0.383	COX5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX5A	HGNC	protein_coding	OTTHUMT00000286417.1	-	0.00	81	0	T	NM_004255		75219207	-1	tier1	-	no_errors	ENST00000322347	ensembl	human	known	74_37	missense	25.49	38	13	SNP	1.000	C
CPD	1362	genome.wustl.edu	37	17	28706683	28706683	+	Missense_Mutation	SNP	C	C	A	rs530282755		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr17:28706683C>A	ENST00000225719.4	+	1	761	c.685C>A	c.(685-687)Ccc>Acc	p.P229T	CPD_ENST00000543464.2_5'Flank	NM_001304.4	NP_001295.2	O75976	CBPD_HUMAN	carboxypeptidase D	229	Carboxypeptidase-like 1.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metallocarboxypeptidase activity (GO:0004181)|serine-type carboxypeptidase activity (GO:0004185)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(13)|skin(5)|stomach(1)|urinary_tract(1)	36						CACCGGCGAACCCCCCGCCCT	0.701																																																	0																																										SO:0001583	missense	0			U65090	CCDS11257.1, CCDS56025.1	17q11.2	2012-02-10			ENSG00000108582	ENSG00000108582	3.4.17.22		2301	protein-coding gene	gene with protein product	"""metallocarboxypeptidase D"""	603102				9628828, 9355738	Standard	NM_001304		Approved	GP180	uc002hfb.2	O75976	OTTHUMG00000132797	ENST00000225719.4:c.685C>A	17.37:g.28706683C>A	ENSP00000225719:p.Pro229Thr		B7Z7T9|B7ZAU4|F5GZH6|O15377|Q86SH9|Q86XE6	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14,prints_Peptidase_M14	p.P229T	ENST00000225719.4	37	c.685	CCDS11257.1	17	.	.	.	.	.	.	.	.	.	.	C	9.678	1.148457	0.21288	.	.	ENSG00000108582	ENST00000225719	T	0.03152	4.03	3.7	2.69	0.31865	Peptidase M14, carboxypeptidase A (2);	0.662303	0.14231	N	0.332757	T	0.11367	0.0277	M	0.72576	2.205	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.42310	-0.9459	10	0.10902	T	0.67	.	5.592	0.17307	0.1982:0.6991:0.0:0.1026	.	229	O75976	CBPD_HUMAN	T	229	ENSP00000225719:P229T	ENSP00000225719:P229T	P	+	1	0	CPD	25730809	0.997000	0.39634	0.980000	0.43619	0.869000	0.49853	1.431000	0.34925	0.722000	0.32252	0.454000	0.30748	CCC	CPD	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000108582		0.701	CPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPD	HGNC	protein_coding	OTTHUMT00000256214.3	-	0.00	17	0	C	NM_001304		28706683	+1	tier1	-	no_errors	ENST00000225719	ensembl	human	known	74_37	missense	32.00	16	8	SNP	0.847	A
CRIP1	1396	genome.wustl.edu	37	14	105954503	105954503	+	Splice_Site	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr14:105954503C>T	ENST00000330233.7	+	2	984	c.41C>T	c.(40-42)gCc>gTc	p.A14V	CRIP1_ENST00000392531.3_Splice_Site_p.A14V|C14orf80_ENST00000392527.1_5'Flank|CRIP1_ENST00000409393.2_Splice_Site_p.A14V|C14orf80_ENST00000329886.7_5'Flank|C14orf80_ENST00000334656.7_5'Flank|CRIP1_ENST00000551180.1_5'Flank			P50238	CRIP1_HUMAN	cysteine-rich protein 1 (intestinal)	14	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell proliferation (GO:0008283)|cellular response to antibiotic (GO:0071236)|cellular response to UV-B (GO:0071493)|heart development (GO:0007507)|immune response (GO:0006955)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|prostate gland stromal morphogenesis (GO:0060741)|regulation of gene expression (GO:0010468)|response to organic substance (GO:0010033)|response to zinc ion (GO:0010043)	cytoplasm (GO:0005737)	AT DNA binding (GO:0003680)|DNA binding, bending (GO:0008301)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)						Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0188)	Epithelial(152;0.235)		GCCTCTGCAGCCGAGAGGGTG	0.667																																																	0													37.0	40.0	39.0					14																	105954503		2203	4299	6502	SO:0001630	splice_region_variant	0				CCDS10004.1	14q32.33	2004-06-18			ENSG00000213145	ENSG00000213145			2360	protein-coding gene	gene with protein product		123875				9480758	Standard	NM_001311		Approved	CRIP	uc001yri.4	P50238	OTTHUMG00000029908	ENST00000330233.7:c.41-1C>T	14.37:g.105954503C>T			H3BPI2|Q13628|Q53XY7|Q96J34	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.A14V	ENST00000330233.7	37	c.41	CCDS10004.1	14	.	.	.	.	.	.	.	.	.	.	C	23.1	4.378525	0.82682	.	.	ENSG00000213145	ENST00000330233;ENST00000409393;ENST00000392531	T;T;T	0.60920	0.15;0.15;0.15	4.76	4.76	0.60689	Zinc finger, LIM-type (5);	0.000000	0.47093	U	0.000256	T	0.61776	0.2374	.	.	.	0.80722	D	1	B	0.24186	0.099	B	0.37943	0.261	T	0.64664	-0.6354	9	0.66056	D	0.02	.	16.3441	0.83117	0.0:1.0:0.0:0.0	.	14	P50238	CRIP1_HUMAN	V	14	ENSP00000332449:A14V;ENSP00000386340:A14V;ENSP00000376315:A14V	ENSP00000447493:A14V	A	+	2	0	CRIP1	105025548	1.000000	0.71417	0.978000	0.43139	0.545000	0.35147	5.618000	0.67722	2.186000	0.69663	0.650000	0.86243	GCC	CRIP1	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000213145		0.667	CRIP1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CRIP1	HGNC	protein_coding	OTTHUMT00000335466.2	-	0.00	56	0	C	NM_001311	Missense_Mutation	105954503	+1	tier1	-	no_errors	ENST00000330233	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.999	T
CRISPLD1	83690	genome.wustl.edu	37	8	75932277	75932277	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr8:75932277C>G	ENST00000262207.4	+	12	1675	c.1207C>G	c.(1207-1209)Ctc>Gtc	p.L403V	CRISPLD1_ENST00000523524.1_Missense_Mutation_p.L215V|CRISPLD1_ENST00000517786.1_Missense_Mutation_p.L217V	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	403	LCCL 2. {ECO:0000255|PROSITE- ProRule:PRU00123}.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			TGTGGAACAGCTCTGTCCATT	0.413																																																	0													137.0	125.0	129.0					8																	75932277		2203	4300	6503	SO:0001583	missense	0			AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.1207C>G	8.37:g.75932277C>G	ENSP00000262207:p.Leu403Val		B2RA60|B7Z929	Missense_Mutation	SNP	pfam_LCCL,pfam_CAP_domain,superfamily_CAP_domain,superfamily_LCCL,smart_Allrgn_V5/Tpx1,smart_LCCL,pfscan_LCCL,prints_Allrgn_V5/Tpx1	p.L403V	ENST00000262207.4	37	c.1207	CCDS6219.1	8	.	.	.	.	.	.	.	.	.	.	C	15.23	2.773342	0.49786	.	.	ENSG00000121005	ENST00000262207;ENST00000523524;ENST00000517786	D;D;D	0.89485	-2.52;-2.52;-2.52	5.44	3.51	0.40186	LCCL (5);	0.074942	0.49305	D	0.000149	D	0.91297	0.7256	L	0.61387	1.9	0.42650	D	0.993443	D;P	0.63046	0.992;0.64	D;B	0.76071	0.987;0.334	D	0.89295	0.3622	10	0.36615	T	0.2	.	6.7372	0.23415	0.1398:0.6516:0.0:0.2086	.	217;403	B7Z929;Q9H336	.;CRLD1_HUMAN	V	403;215;217	ENSP00000262207:L403V;ENSP00000430105:L215V;ENSP00000429746:L217V	ENSP00000262207:L403V	L	+	1	0	CRISPLD1	76094832	0.983000	0.35010	1.000000	0.80357	0.999000	0.98932	0.555000	0.23422	1.537000	0.49254	0.650000	0.86243	CTC	CRISPLD1	-	pfam_LCCL,superfamily_LCCL,smart_LCCL,pfscan_LCCL	ENSG00000121005		0.413	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD1	HGNC	protein_coding	OTTHUMT00000379117.1	-	0.00	74	0	C	NM_031461		75932277	+1	tier1	-	no_errors	ENST00000262207	ensembl	human	known	74_37	missense	42.35	49	36	SNP	0.998	G
CRYBG3	131544	genome.wustl.edu	37	3	97600041	97600041	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:97600041G>T	ENST00000182096.4	+	4	1350	c.1286G>T	c.(1285-1287)gGt>gTt	p.G429V		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2377							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						TTTATATTGGGTTCTCTCAAA	0.368																																																	0													94.0	93.0	93.0					3																	97600041		1821	4072	5893	SO:0001583	missense	0					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.1286G>T	3.37:g.97600041G>T	ENSP00000182096:p.Gly429Val		B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.G429V	ENST00000182096.4	37	c.1286		3	.	.	.	.	.	.	.	.	.	.	G	13.84	2.356168	0.41700	.	.	ENSG00000080200	ENST00000182096	T	0.77750	-1.12	4.89	4.89	0.63831	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.088115	0.49305	N	0.000141	D	0.82715	0.5097	M	0.87971	2.92	0.80722	D	1	B	0.24426	0.103	B	0.31946	0.138	T	0.82804	-0.0276	10	0.54805	T	0.06	.	16.5888	0.84759	0.0:0.0:1.0:0.0	.	429	Q68DQ2	CRBG3_HUMAN	V	429	ENSP00000182096:G429V	ENSP00000182096:G429V	G	+	2	0	CRYBG3	99082731	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	6.245000	0.72398	2.430000	0.82344	0.650000	0.86243	GGT	CRYBG3	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin	ENSG00000080200		0.368	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	CRYBG3	HGNC	protein_coding	OTTHUMT00000353751.1		0.00	76	0	G	NM_153605		97600041	+1			no_errors	ENST00000182096	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
DACH1	1602	genome.wustl.edu	37	13	72440792	72440792	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr13:72440792G>T	ENST00000359684.2	-	1	115	c.116C>A	c.(115-117)tCt>tAt	p.S39Y	DACH1_ENST00000354591.4_Missense_Mutation_p.S39Y|DACH1_ENST00000313174.7_Missense_Mutation_p.S39Y|DACH1_ENST00000305425.4_Missense_Mutation_p.S39Y			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	39					cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		AGGAGCCGGAGACGAAGTCGC	0.682																																																	0													20.0	27.0	25.0					13																	72440792		1955	4132	6087	SO:0001583	missense	0			AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.116C>A	13.37:g.72440792G>T	ENSP00000352712:p.Ser39Tyr		D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.S39Y	ENST00000359684.2	37	c.116		13	.	.	.	.	.	.	.	.	.	.	G	11.72	1.721683	0.30503	.	.	ENSG00000165659	ENST00000305425;ENST00000313174;ENST00000354591;ENST00000359684;ENST00000377826	T;T;T;T	0.42513	1.02;0.97;1.31;1.26	3.22	3.22	0.36961	.	0.838726	0.10343	U	0.686072	T	0.42944	0.1225	N	0.24115	0.695	0.35262	D	0.779671	D;D;P	0.60160	0.987;0.987;0.902	P;P;P	0.52217	0.693;0.693;0.563	T	0.57318	-0.7832	10	0.72032	D	0.01	-4.1655	14.5579	0.68115	0.0:0.0:1.0:0.0	.	39;39;39	Q9UI36-4;Q9UI36-3;Q9UI36-2	.;.;.	Y	39	ENSP00000304994:S39Y;ENSP00000318506:S39Y;ENSP00000346604:S39Y;ENSP00000352712:S39Y	ENSP00000304994:S39Y	S	-	2	0	DACH1	71338793	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	5.916000	0.69981	1.607000	0.50170	0.462000	0.41574	TCT	DACH1	-	NULL	ENSG00000165659		0.682	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	DACH1	HGNC	protein_coding	OTTHUMT00000045240.1		0.00	79	0	G	NM_004392		72440792	-1			no_errors	ENST00000359684	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	T
DCDC2	51473	genome.wustl.edu	37	6	24205236	24205236	+	Silent	SNP	G	G	T	rs9467075	byFrequency	TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:24205236G>T	ENST00000378454.3	-	8	1318	c.1017C>A	c.(1015-1017)gtC>gtA	p.V339V	DCDC2_ENST00000378450.3_Silent_p.V92V	NM_001195610.1|NM_016356.3	NP_001182539.1|NP_057440.2	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	339					cellular defense response (GO:0006968)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|neuron migration (GO:0001764)|visual learning (GO:0008542)					breast(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32		Ovarian(999;0.101)				TTACCTGATCGACTGGAACCT	0.398																																																	0													238.0	220.0	226.0					6																	24205236		2203	4299	6502	SO:0001819	synonymous_variant	0			AB032980	CCDS4550.1	6p22.1	2008-02-05			ENSG00000146038	ENSG00000146038			18141	protein-coding gene	gene with protein product		605755				10601354, 10574461	Standard	NM_001195610		Approved	RU2, KIAA1154, DCDC2A	uc003ndx.3	Q9UHG0	OTTHUMG00000016275	ENST00000378454.3:c.1017C>A	6.37:g.24205236G>T			Q5VTR8|Q5VTR9|Q86W35|Q9UFD1|Q9UHG1|Q9ULR6	Silent	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.V339	ENST00000378454.3	37	c.1017	CCDS4550.1	6																																																																																			DCDC2	-	NULL	ENSG00000146038		0.398	DCDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCDC2	HGNC	protein_coding	OTTHUMT00000043604.1	-	0.00	79	0	G	NM_016356		24205236	-1	tier1	-	no_errors	ENST00000378454	ensembl	human	known	74_37	silent	5.33	71	4	SNP	0.001	T
DENND6B	414918	genome.wustl.edu	37	22	50752258	50752258	+	Silent	SNP	G	G	C	rs115446109	byFrequency	TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr22:50752258G>C	ENST00000413817.3	-	14	1259	c.1188C>G	c.(1186-1188)ctC>ctG	p.L396L	XX-C283C717.1_ENST00000453835.1_RNA	NM_001001794.3	NP_001001794.3	Q8NEG7	DEN6B_HUMAN	DENN/MADD domain containing 6B	396					positive regulation of Rab GTPase activity (GO:0032851)	endosome (GO:0005768)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										GCAGCCGTTTGAGCAGCGCCT	0.677																																																	0													34.0	40.0	38.0					22																	50752258		2091	4205	6296	SO:0001819	synonymous_variant	0			AK054743	CCDS46732.1	22q13.33	2012-10-03	2012-10-03	2012-10-03	ENSG00000205593	ENSG00000205593		"""DENN/MADD domain containing"""	32690	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member B"""	FAM116B		21330364	Standard	NM_001001794		Approved	MGC33692, AFI1B	uc011arv.1	Q8NEG7	OTTHUMG00000150210	ENST00000413817.3:c.1188C>G	22.37:g.50752258G>C			A6X8I5	Silent	SNP	pfam_Afi1_N,pfam_DENN_dom,pfam_ABL9/DENND6_dom	p.L396	ENST00000413817.3	37	c.1188	CCDS46732.1	22																																																																																			DENND6B	-	pfam_Afi1_N	ENSG00000205593		0.677	DENND6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND6B	HGNC	protein_coding	OTTHUMT00000316845.3	-	0.00	81	0	G	NM_001001794		50752258	-1	tier1	-	no_errors	ENST00000413817	ensembl	human	known	74_37	silent	20.00	48	12	SNP	0.999	C
DFNB59	494513	genome.wustl.edu	37	2	179320838	179320838	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:179320838C>T	ENST00000409117.3	+	4	865	c.509C>T	c.(508-510)tCa>tTa	p.S170L	DFNB59_ENST00000375129.4_Missense_Mutation_p.S170L|DFNB59_ENST00000605419.1_3'UTR	NM_001042702.3	NP_001036167.1	Q0ZLH3	PJVK_HUMAN	deafness, autosomal recessive 59	170					sensory perception of sound (GO:0007605)	neuronal cell body (GO:0043025)				breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			CGACAGTGCTCACTGTCTGTG	0.453																																																	0			GRCh37	CD073602	DFNB59	D							56.0	56.0	56.0					2																	179320838		2021	4175	6196	SO:0001583	missense	0			BC020859, BQ887979	CCDS42787.1	2q31.2	2011-07-01			ENSG00000204311	ENSG00000204311			29502	protein-coding gene	gene with protein product		610219				16804542	Standard	NM_001042702		Approved	pejvakin	uc002umi.4	Q0ZLH3	OTTHUMG00000154425	ENST00000409117.3:c.509C>T	2.37:g.179320838C>T	ENSP00000386647:p.Ser170Leu		A0PK14|B9EJE2	Missense_Mutation	SNP	pfam_Gasdermin	p.S170L	ENST00000409117.3	37	c.509	CCDS42787.1	2	.	.	.	.	.	.	.	.	.	.	C	26.7	4.758857	0.89843	.	.	ENSG00000204311	ENST00000409117;ENST00000375129	T;T	0.21543	2.0;2.0	5.66	5.66	0.87406	.	0.000000	0.33272	U	0.005095	T	0.36580	0.0972	L	0.47716	1.5	0.80722	D	1	D	0.53619	0.961	P	0.57009	0.811	T	0.00428	-1.1745	10	0.30854	T	0.27	-23.9341	20.1041	0.97884	0.0:1.0:0.0:0.0	.	170	Q0ZLH3	PJVK_HUMAN	L	170	ENSP00000386647:S170L;ENSP00000364271:S170L	ENSP00000364271:S170L	S	+	2	0	DFNB59	179029084	1.000000	0.71417	0.968000	0.41197	0.926000	0.56050	7.742000	0.85008	2.826000	0.97356	0.655000	0.94253	TCA	DFNB59	-	pfam_Gasdermin	ENSG00000204311		0.453	DFNB59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNB59	HGNC	protein_coding	OTTHUMT00000335160.1	-	0.00	104	0	C			179320838	+1	tier1	-	no_errors	ENST00000375129	ensembl	human	known	74_37	missense	42.16	59	43	SNP	1.000	T
DHRS4L1	728635	genome.wustl.edu	37	14	24505694	24505694	+	RNA	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr14:24505694C>T	ENST00000558293.1	+	0	33					NR_102693.1																						GGAACCCAGACTTGCTGGTCT	0.692																																																	0													40.0	40.0	40.0					14																	24505694		2203	4300	6503			0																															14.37:g.24505694C>T				RNA	SNP	-	NULL	ENST00000558293.1	37	NULL		14																																																																																			RP11-468E2.9	-	-	ENSG00000225766		0.692	RP11-468E2.9-005	KNOWN	basic	processed_transcript	DHRS4L1	Clone_based_vega_gene	pseudogene	OTTHUMT00000417272.1	-	0.00	127	0	C			24505694	+1	tier1	-	no_errors	ENST00000558293	ensembl	human	known	74_37	rna	21.80	104	29	SNP	0.000	T
DHX29	54505	genome.wustl.edu	37	5	54589922	54589922	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr5:54589922G>A	ENST00000251636.5	-	6	851	c.703C>T	c.(703-705)Cga>Tga	p.R235*	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	235						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)	p.R235*(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				TCAGCATATCGTAAAATCCAC	0.303																																																	1	Substitution - Nonsense(1)	endometrium(1)											96.0	96.0	96.0					5																	54589922		2201	4298	6499	SO:0001587	stop_gained	0			AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.703C>T	5.37:g.54589922G>A	ENSP00000251636:p.Arg235*		O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Nonsense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R235*	ENST00000251636.5	37	c.703	CCDS34158.1	5	.	.	.	.	.	.	.	.	.	.	G	18.02	3.529189	0.64860	.	.	ENSG00000067248	ENST00000251636	.	.	.	5.94	3.04	0.35103	.	0.313012	0.37261	N	0.002162	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.409	0.60931	0.0:0.0:0.5299:0.4701	.	.	.	.	X	235	.	ENSP00000251636:R235X	R	-	1	2	DHX29	54625679	0.038000	0.19896	0.218000	0.23776	0.277000	0.26821	1.284000	0.33249	0.328000	0.23435	0.573000	0.79308	CGA	DHX29	-	NULL	ENSG00000067248		0.303	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX29	HGNC	protein_coding	OTTHUMT00000368532.1		0.00	26	0	G	NM_019030		54589922	-1			no_errors	ENST00000251636	ensembl	human	known	74_37	nonsense	9.09	20	2	SNP	0.736	A
DLD	1738	genome.wustl.edu	37	7	107558429	107558429	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr7:107558429G>T	ENST00000205402.5	+	12	1578	c.1297G>T	c.(1297-1299)Gct>Tct	p.A433S	DLD_ENST00000437604.2_Missense_Mutation_p.A385S|DLD_ENST00000440410.1_Missense_Mutation_p.A410S|DLD_ENST00000537148.1_Missense_Mutation_p.A334S	NM_000108.3	NP_000099.2	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase	433					branched-chain amino acid catabolic process (GO:0009083)|cell redox homeostasis (GO:0045454)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|gastrulation (GO:0007369)|lysine catabolic process (GO:0006554)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|proteolysis (GO:0006508)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of membrane potential (GO:0042391)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|tricarboxylic acid cycle (GO:0006099)	acrosomal matrix (GO:0043159)|cilium (GO:0005929)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dihydrolipoyl dehydrogenase activity (GO:0004148)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(10)|prostate(1)	20					Flavin adenine dinucleotide(DB03147)	TAAGACAAATGCTGACACAGA	0.433																																																	0													136.0	128.0	131.0					7																	107558429		2203	4300	6503	SO:0001583	missense	0			AB209703	CCDS5749.1	7q31-q32	2006-05-22	2006-05-22		ENSG00000091140	ENSG00000091140	1.8.1.4		2898	protein-coding gene	gene with protein product	"""E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex"""	238331	"""dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2-oxo-glutarate complex, branched chain keto acid dehydrogenase complex)"""	LAD, GCSL			Standard	NM_000108		Approved	DLDH	uc003vet.3	P09622	OTTHUMG00000154813	ENST00000205402.5:c.1297G>T	7.37:g.107558429G>T	ENSP00000205402:p.Ala433Ser		B2R5X0|B4DHG0|B4DT69|Q14131|Q14167|Q59EV8|Q8WTS4	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_nucl-diS_OxRdtase_dimer,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_FAD_bind_dom,pfam_GIDA-rel,superfamily_FAD/NAD-linked_Rdtase_dimer,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,prints_Pyridine_nuc-diS_OxRdtase_2,tigrfam_Lipoamide_DH	p.A433S	ENST00000205402.5	37	c.1297	CCDS5749.1	7	.	.	.	.	.	.	.	.	.	.	G	12.27	1.888685	0.33348	.	.	ENSG00000091140	ENST00000205402;ENST00000417551;ENST00000537148;ENST00000440410;ENST00000437604;ENST00000539590	D;D;D;D;D	0.92149	-2.98;-2.98;-2.98;-2.98;-2.98	6.17	6.17	0.99709	FAD/NAD-linked reductase, dimerisation (1);Pyridine nucleotide-disulphide oxidoreductase, dimerisation (2);	0.046212	0.85682	D	0.000000	D	0.86883	0.6040	N	0.21240	0.645	0.80722	D	1	B;B;B	0.14805	0.011;0.01;0.0	B;B;B	0.22152	0.034;0.038;0.009	T	0.81079	-0.1095	10	0.07325	T	0.83	-20.2844	20.8794	0.99867	0.0:0.0:1.0:0.0	.	410;385;433	E9PEX6;B4DT69;P09622	.;.;DLDH_HUMAN	S	433;433;334;410;385;383	ENSP00000205402:A433S;ENSP00000390667:A433S;ENSP00000442399:A334S;ENSP00000417016:A410S;ENSP00000387542:A385S	ENSP00000205402:A433S	A	+	1	0	DLD	107345665	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.897000	0.87356	2.941000	0.99782	0.655000	0.94253	GCT	DLD	-	pfam_Pyr_nucl-diS_OxRdtase_dimer,superfamily_FAD/NAD-linked_Rdtase_dimer,prints_Hg_reductase,tigrfam_Lipoamide_DH	ENSG00000091140		0.433	DLD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLD	HGNC	protein_coding	OTTHUMT00000337194.3	-	0.00	52	0	G	NM_000108		107558429	+1	tier1	-	no_errors	ENST00000205402	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
DNAH1	25981	genome.wustl.edu	37	3	52427419	52427419	+	Missense_Mutation	SNP	G	G	A	rs376742990		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:52427419G>A	ENST00000420323.2	+	66	10805	c.10544G>A	c.(10543-10545)cGc>cAc	p.R3515H		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3580					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AACGTCTGCCGCAGCCTCTTT	0.542																																																	0								G	HIS/ARG	1,4295		0,1,2147	94.0	107.0	103.0		10544	4.5	1.0	3		103	0,8516		0,0,4258	no	missense	DNAH1	NM_015512.4	29	0,1,6405	AA,AG,GG		0.0,0.0233,0.0078	probably-damaging	3515/4266	52427419	1,12811	2148	4258	6406	SO:0001583	missense	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.10544G>A	3.37:g.52427419G>A	ENSP00000401514:p.Arg3515His		B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase	p.R3515H	ENST00000420323.2	37	c.10544	CCDS46842.1	3	.	.	.	.	.	.	.	.	.	.	G	33	5.198058	0.94997	2.33E-4	0.0	ENSG00000114841	ENST00000420323;ENST00000273600	T	0.80566	-1.39	4.46	4.46	0.54185	.	0.000000	0.64402	D	0.000010	D	0.93000	0.7772	H	0.96460	3.825	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.942	D	0.95373	0.8466	10	0.87932	D	0	.	17.341	0.87296	0.0:0.0:1.0:0.0	.	3515;3580	C9JXH6;Q9P2D7-2	.;.	H	3515;268	ENSP00000401514:R3515H	ENSP00000273600:R268H	R	+	2	0	DNAH1	52402459	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.675000	0.84002	2.324000	0.78689	0.563000	0.77884	CGC	DNAH1	-	NULL	ENSG00000114841		0.542	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	-	0.00	92	0	G	NM_015512		52427419	+1	tier1	-	no_errors	ENST00000420323	ensembl	human	known	74_37	missense	6.15	60	4	SNP	1.000	A
DNAH5	1767	genome.wustl.edu	37	5	13865870	13865870	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr5:13865870C>T	ENST00000265104.4	-	27	4366	c.4262G>A	c.(4261-4263)aGt>aAt	p.S1421N	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1421	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTCTATGACACTGTTGTACAG	0.343									Kartagener syndrome																																								0													58.0	60.0	59.0					5																	13865870		2203	4299	6502	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.4262G>A	5.37:g.13865870C>T	ENSP00000265104:p.Ser1421Asn		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.S1421N	ENST00000265104.4	37	c.4262	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	C	9.054	0.992871	0.18966	.	.	ENSG00000039139	ENST00000265104	T	0.61040	0.14	5.9	2.06	0.26882	Dynein heavy chain, domain-2 (1);	0.252596	0.44285	N	0.000464	T	0.29976	0.0750	N	0.08118	0	0.24732	N	0.993085	B	0.02656	0.0	B	0.12837	0.008	T	0.16453	-1.0402	10	0.16420	T	0.52	.	6.5355	0.22350	0.0:0.5708:0.1625:0.2667	.	1421	Q8TE73	DYH5_HUMAN	N	1421	ENSP00000265104:S1421N	ENSP00000265104:S1421N	S	-	2	0	DNAH5	13918870	0.000000	0.05858	0.965000	0.40720	0.991000	0.79684	-0.544000	0.06077	0.097000	0.17492	0.650000	0.86243	AGT	DNAH5	-	pfam_Dynein_heavy_dom-2	ENSG00000039139		0.343	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2		0.00	57	0	C	NM_001369		13865870	-1			no_errors	ENST00000265104	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.633	T
DSCR3	10311	genome.wustl.edu	37	21	38593512	38593512	+	IGR	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr21:38593512G>T	ENST00000309117.6	-	0	3256				AP001432.14_ENST00000440629.1_lincRNA|DSCR9_ENST00000454482.2_lincRNA|DSCR3_ENST00000399000.3_5'Flank	NM_006052.1	NP_006043.1	O14972	DSCR3_HUMAN	Down syndrome critical region gene 3							nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9						CGGCTGTGGAGCCCAGACCCC	0.721											OREG0026204	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													17.0	22.0	20.0					21																	38593512		2198	4290	6488	SO:0001628	intergenic_variant	0			D87343	CCDS33553.1	21q22.2	2008-05-22			ENSG00000157538	ENSG00000157538			3044	protein-coding gene	gene with protein product		605298				9399594	Standard	NM_006052		Approved	DCRA	uc002ywf.1	O14972	OTTHUMG00000086659		21.37:g.38593512G>T		879	B2R6T8|B7Z6B1|D3DSH4|Q2TAY6	RNA	SNP	-	NULL	ENST00000309117.6	37	NULL	CCDS33553.1	21																																																																																			DSCR9	-	-	ENSG00000230366		0.721	DSCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCR9	HGNC	protein_coding	OTTHUMT00000194807.1	-	0.00	87	0	G			38593512	+1	tier1	-	no_errors	ENST00000454482	ensembl	human	known	74_37	rna	7.35	63	5	SNP	0.001	T
DUSP27	92235	genome.wustl.edu	37	1	167096645	167096645	+	Silent	SNP	G	G	A	rs139214807		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:167096645G>A	ENST00000361200.2	+	6	2443	c.2277G>A	c.(2275-2277)gcG>gcA	p.A759A	DUSP27_ENST00000443333.1_Silent_p.A759A|DUSP27_ENST00000271385.5_Silent_p.A759A|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	759					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						CAGTACCAGCGGCTAGCTGCC	0.562																																																	0													80.0	67.0	71.0					1																	167096645		2203	4300	6503	SO:0001819	synonymous_variant	0			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2277G>A	1.37:g.167096645G>A			A0AUM4|Q9C074	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.A759	ENST00000361200.2	37	c.2277	CCDS30932.1	1																																																																																			DUSP27	-	NULL	ENSG00000198842		0.562	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	HGNC	protein_coding	OTTHUMT00000083244.1	-	0.00	37	0	G	NM_001080426		167096645	+1	tier1	-	no_errors	ENST00000271385	ensembl	human	known	74_37	silent	8.00	46	4	SNP	0.001	A
EIF2S3L	0	genome.wustl.edu	37	12	10659503	10659503	+	Silent	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr12:10659503C>T	ENST00000538173.1	+	1	1015	c.1002C>T	c.(1000-1002)ggC>ggT	p.G334G	EIF2S3L_ENST00000322446.3_Silent_p.G334G			Q2VIR3	IF2GL_HUMAN		334							GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation initiation factor activity (GO:0003743)			lung(8)	8						CTGCTCCAGGCGGTCTTATTG	0.423																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000538173.1:c.1002C>T	12.37:g.10659503C>T			Q5I0X0|Q6KF84	Silent	SNP	pfam_EF_GTP-bd_dom,pfam_TIF2_gsu_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Transl_B-barrel,superfamily_Transl_elong_EF1A/Init_IF2_C,prints_EF_GTP-bd_dom	p.G334	ENST00000538173.1	37	c.1002		12																																																																																			EIF2S3L	-	pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_B-barrel	ENSG00000180574		0.423	EIF2S3L-002	KNOWN	basic|appris_principal	protein_coding	ENSG00000180574	Uniprot_gn	protein_coding	OTTHUMT00000400341.3	-	0.00	136	0	C			10659503	+1	tier1	-	no_errors	ENST00000538173	ensembl	human	known	74_37	silent	32.64	97	47	SNP	0.991	T
AL512635.1	0	genome.wustl.edu	37	9	20295050	20295053	+	RNA	DEL	ATAC	ATAC	-	rs576414314|rs149208825|rs200522043	byFrequency	TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	ATAC	ATAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr9:20295050_20295053delATAC	ENST00000408817.1	+	0	49_52																											atatatatatatacacacacacat	0.299																																																	0																																												0																															9.37:g.20295050_20295053delATAC				RNA	DEL	-	NULL	ENST00000408817.1	37	NULL		9																																																																																			AL512635.1	-	-	ENSG00000221744		0.299	AL512635.1-201	NOVEL	basic	miRNA	ENSG00000221744	Clone_based_ensembl_gene	miRNA			0.00	14	0	ATAC			20295053	+1	tier1		no_errors	ENST00000408817	ensembl	human	novel	74_37	rna	33.33	4	2	DEL	0.001:0.000:0.000:0.000	-
SNORA70	26778	genome.wustl.edu	37	18	3025533	3025533	+	RNA	DEL	A	A	-			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr18:3025533delA	ENST00000516449.1	-	0	31									small nucleolar RNA, H/ACA box 70																		ACAACTTCTTAAAAAAAAAAt	0.473																																																	0																																												0			Y11164		Xq28	2013-09-05	2006-04-05	2006-04-05	ENSG00000207165	ENSG00000207165		"""ncRNAs / Small nucleolar RNAs : H/ACA box containing"""	10231	non-coding RNA	RNA, small nucleolar			"""RNA, U70 small nucleolar"""	RNU70		9106664, 15199136	Standard	NR_000011		Approved	U70, DXS648E	uc021raw.1				18.37:g.3025533delA				RNA	DEL	-	NULL	ENST00000516449.1	37	NULL		18																																																																																			SNORA70	-	-	ENSG00000252258		0.473	SNORA70.21-201	NOVEL	basic	snoRNA	ENSG00000252258	RFAM	snoRNA			0.00	42	0	A	NR_000011		3025533	-1	tier1		no_errors	ENST00000516449	ensembl	human	novel	74_37	rna	7.41	25	2	DEL	0.000	-
WASH6P	653440	genome.wustl.edu	37	X	155251430	155251430	+	RNA	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chrX:155251430G>A	ENST00000461007.1	+	0	438				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										AGATTGAGAAGATCAAGGGCA	0.592																																																	0																																												0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155251430G>A			A6NGF1|Q8N305	RNA	SNP	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			AJ271736.10	-	-	ENSG00000270726		0.592	WASH6P-016	KNOWN	basic	processed_transcript	ENSG00000270726	Clone_based_vega_gene	pseudogene	OTTHUMT00000058840.1	-	0.00	131	0	G	NG_008380		155251430	+1	tier1	-	no_errors	ENST00000285718	ensembl	human	known	74_37	rna	29.70	116	49	SNP	1.000	A
TAGAP	117289	genome.wustl.edu	37	6	159463326	159463326	+	Intron	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:159463326G>A	ENST00000367066.3	-	5	480				TAGAP_ENST00000338313.5_Intron|RP1-111C20.4_ENST00000606470.1_RNA|RP1-111C20.4_ENST00000607391.1_RNA|RP1-111C20.4_ENST00000606466.1_RNA|RP1-111C20.4_ENST00000607796.1_RNA|TAGAP_ENST00000326965.6_Intron	NM_001278733.1|NM_054114.3	NP_001265662.1|NP_473455.2	Q8N103	TAGAP_HUMAN	T-cell activation RhoGTPase activating protein						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|autonomic_ganglia(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(2)|skin(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		ACAGTGTTAAGAAGCAAAGAT	0.393											OREG0017760	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													49.0	56.0	53.0					6																	159463326		2203	4299	6502	SO:0001627	intron_variant	0			AF385429	CCDS5261.1, CCDS5262.1, CCDS5263.1	6q25.3	2011-09-07	2008-03-25		ENSG00000164691	ENSG00000164691		"""Rho GTPase activating proteins"""	15669	protein-coding gene	gene with protein product		609667	"""T-cell activation GTPase activating protein"""			16375659, 18311140, 18356936	Standard	NM_152133		Approved	FLJ32631, IDDM21, ARHGAP47	uc003qrz.3	Q8N103	OTTHUMG00000015923	ENST00000367066.3:c.149-50C>T	6.37:g.159463326G>A		1801	Q2NKM8|Q8NI40|Q96KZ2|Q96QA2	RNA	SNP	-	NULL	ENST00000367066.3	37	NULL	CCDS5261.1	6																																																																																			RP1-111C20.4	-	-	ENSG00000271913		0.393	TAGAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000271913	Clone_based_vega_gene	protein_coding	OTTHUMT00000042890.1	-	0.00	28	0	G	NM_054114		159463326	+1	tier1	-	no_errors	ENST00000606466	ensembl	human	known	74_37	rna	72.41	8	21	SNP	0.000	A
EPAS1	2034	genome.wustl.edu	37	2	46607509	46607510	+	Frame_Shift_Ins	INS	-	-	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:46607509_46607510insA	ENST00000263734.3	+	12	2208_2209	c.1698_1699insA	c.(1699-1701)atgfs	p.M567fs		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	567					angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			GCTTCAGTGCCATGACAAACAT	0.614																																																	0																																										SO:0001589	frameshift_variant	0			U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.1699dupA	2.37:g.46607510_46607510dupA	ENSP00000263734:p.Met567fs		Q86VA2|Q99630	Frame_Shift_Ins	INS	pfam_PAS_fold_3,pfam_HIF-1_TAD_C,pfam_HIF_alpha_subunit,pfam_PAS_fold,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_bHLH_dom,tigrfam_PAS	p.M566fs	ENST00000263734.3	37	c.1698_1699	CCDS1825.1	2																																																																																			EPAS1	-	NULL	ENSG00000116016		0.614	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPAS1	HGNC	protein_coding	OTTHUMT00000250752.2		0.00	57	0	-	NM_001430		46607510	+1	tier1		no_errors	ENST00000263734	ensembl	human	known	74_37	frame_shift_ins	38.98	36	23	INS	1.000:1.000	A
EPRS	2058	genome.wustl.edu	37	1	220160602	220160602	+	Nonsense_Mutation	SNP	T	T	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:220160602T>A	ENST00000366923.3	-	20	3189	c.2920A>T	c.(2920-2922)Aag>Tag	p.K974*	snoU13_ENST00000459217.1_RNA	NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	974	Charged.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	TTATTCTGCTTTTCAGATTTA	0.433																																																	0													99.0	93.0	95.0					1																	220160602		2203	4300	6503	SO:0001587	stop_gained	0			X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.2920A>T	1.37:g.220160602T>A	ENSP00000355890:p.Lys974*		A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Nonsense_Mutation	SNP	pfam_Glu/Gln-tRNA-synth_Ib_cat-dom,pfam_WHEP-TRS,pfam_Glu/Gln-tRNA-synth_Ib_codon-bd,pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Pro-tRNA_ligase_II_C,pfam_Anticodon-bd,superfamily_Ribosomal_L25/Gln-tRNA_synth,superfamily_Anticodon-bd,superfamily_Pro-tRNA_synth_II,superfamily_S15_NS1_RNA-bd,superfamily_Glutathione-S-Trfase_C-like,smart_Pro-tRNA_ligase_II_C,prints_Glu/Gln-tRNA-synth,prints_Pro-tRNA-ligase_IIa,pfscan_aa-tRNA-synth_II,pfscan_WHEP-TRS,tigrfam_Pro-tRNA-ligase_IIa_arc-type,tigrfam_Glu-tRNA-synth_arc/euk	p.K974*	ENST00000366923.3	37	c.2920	CCDS31027.1	1	.	.	.	.	.	.	.	.	.	.	T	44	11.131186	0.99520	.	.	ENSG00000136628	ENST00000366923	.	.	.	5.9	5.9	0.94986	.	0.045918	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.9345	16.3245	0.82970	0.0:0.0:0.0:1.0	.	.	.	.	X	974	.	ENSP00000355890:K974X	K	-	1	0	EPRS	218227225	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.740000	0.84986	2.254000	0.74563	0.460000	0.39030	AAG	EPRS	-	NULL	ENSG00000136628		0.433	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPRS	HGNC	protein_coding	OTTHUMT00000091133.2	-	0.00	30	0	T	NM_004446		220160602	-1	tier1	-	no_errors	ENST00000366923	ensembl	human	known	74_37	nonsense	48.68	39	37	SNP	1.000	A
ERG	2078	genome.wustl.edu	37	21	39795352	39795352	+	Missense_Mutation	SNP	C	C	T	rs372598575		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr21:39795352C>T	ENST00000417133.2	-	5	574	c.389G>A	c.(388-390)cGc>cAc	p.R130H	ERG_ENST00000398905.1_Missense_Mutation_p.R123H|ERG_ENST00000398919.2_Missense_Mutation_p.R130H|ERG_ENST00000442448.1_Missense_Mutation_p.R130H|ERG_ENST00000398911.1_Missense_Mutation_p.R130H|ERG_ENST00000288319.7_Missense_Mutation_p.R123H|ERG_ENST00000398897.1_Missense_Mutation_p.R31H|ERG_ENST00000429727.2_Missense_Mutation_p.R123H|ERG_ENST00000453032.2_Missense_Mutation_p.R31H|ERG_ENST00000398907.1_Missense_Mutation_p.R123H|ERG_ENST00000398910.1_Missense_Mutation_p.R130H	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	Q12809	KCNH2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog	148	PAC. {ECO:0000255|PROSITE- ProRule:PRU00141}.				cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)		EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	lung(2)|ovary(1)|skin(1)	4		Prostate(19;3.6e-06)			Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GATAACTCTGCGCTCGTTCGT	0.607			T	"""EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1"""	"""Ewing sarcoma, prostate, AML"""																																Esophageal Squamous(130;336 1700 3010 3083 40589)			Dom	yes		21	21q22.3	2078	v-ets erythroblastosis virus E26 oncogene like (avian)		"""M, E, L"""	0								C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	233.0	151.0	179.0		389,92,389,368	5.1	1.0	21		179	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	ERG	NM_001136154.1,NM_001136155.1,NM_004449.4,NM_182918.3	29,29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	130/487,31/388,130/463,123/480	39795352	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS13657.1, CCDS13658.1, CCDS46648.1, CCDS46649.1, CCDS58789.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157554	ENSG00000157554			3446	protein-coding gene	gene with protein product	"""v-ets avian erythroblastosis virus E26 oncogene related"", ""transcriptional regulator ERG (transforming protein ERG)"", ""v-ets erythroblastosis virus E26 oncogene like"", ""TMPRSS2-ERG prostate cancer specific"""	165080	"""v-ets avian erythroblastosis virus E26 oncogene related"""			3274086	Standard	NM_001136154		Approved	erg-3, p55	uc002yxa.3	P11308	OTTHUMG00000090767	ENST00000417133.2:c.389G>A	21.37:g.39795352C>T	ENSP00000414150:p.Arg130His		A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	pfam_Ets_dom,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.R130H	ENST00000417133.2	37	c.389	CCDS46648.1	21	.	.	.	.	.	.	.	.	.	.	C	34	5.352114	0.95830	0.0	1.16E-4	ENSG00000157554	ENST00000398905;ENST00000398907;ENST00000288319;ENST00000398897;ENST00000398911;ENST00000417133;ENST00000398910;ENST00000442448;ENST00000453032;ENST00000398919;ENST00000429727	T;T;T;T;T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52	5.05	5.05	0.67936	Sterile alpha motif/pointed domain (2);Pointed domain (3);	0.106537	0.64402	D	0.000013	T	0.56366	0.1980	M	0.65975	2.015	0.58432	D	0.999991	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D	0.83275	0.996;0.987;0.993;0.984;0.981;0.959	T	0.59994	-0.7349	10	0.87932	D	0	.	18.7902	0.91971	0.0:1.0:0.0:0.0	.	123;130;123;130;130;123	B4E3C5;P11308;B5MDW0;P11308-6;P11308-1;P11308-4	.;ERG_HUMAN;.;.;.;.	H	123;123;123;31;130;130;130;130;31;130;123	ENSP00000381877:R123H;ENSP00000381879:R123H;ENSP00000288319:R123H;ENSP00000381871:R31H;ENSP00000381882:R130H;ENSP00000414150:R130H;ENSP00000381881:R130H;ENSP00000394694:R130H;ENSP00000396268:R31H;ENSP00000381891:R130H	ENSP00000288319:R123H	R	-	2	0	ERG	38717222	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.445000	0.80570	2.503000	0.84419	0.561000	0.74099	CGC	ERG	-	pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom	ENSG00000157554		0.607	ERG-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ERG	HGNC	protein_coding	OTTHUMT00000207532.2		0.00	72	0	C	NM_182918		39795352	-1			no_errors	ENST00000398919	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
ERI2	112479	genome.wustl.edu	37	16	20809366	20809366	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:20809366G>C	ENST00000357967.4	-	9	1798	c.1756C>G	c.(1756-1758)Cca>Gca	p.P586A	ERI2_ENST00000569729.1_3'UTR|ERI2_ENST00000564349.1_Missense_Mutation_p.P493A|ERI2_ENST00000389345.5_Missense_Mutation_p.P321A|ERI2_ENST00000300005.3_Intron|ERI2_ENST00000563117.1_Missense_Mutation_p.P493A	NM_001142725.1	NP_001136197.1	A8K979	ERI2_HUMAN	ERI1 exoribonuclease family member 2	586							exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(2)	11						CTCTTCCATGGCTCTTGTAGG	0.423																																																	0													106.0	85.0	91.0					16																	20809366		692	1591	2283	SO:0001583	missense	0			BC010503	CCDS10590.1, CCDS45436.1	16p12.3	2014-02-18	2009-10-07	2008-12-16	ENSG00000196678	ENSG00000196678		"""Enhanced RNAi three prime mRNA exonucleases"""	30541	protein-coding gene	gene with protein product	"""enhanced RNAi three prime mRNA exonuclease homolog 2 (C.elegans)"", ""exoribonuclease 2"", ""zinc finger, GRF-type containing 5"""		"""exonuclease domain containing 1"""	EXOD1		10819331	Standard	NM_080663		Approved	KIAA1504, MGC16943, ZGRF5	uc010vbb.1	A8K979	OTTHUMG00000131557	ENST00000357967.4:c.1756C>G	16.37:g.20809366G>C	ENSP00000350651:p.Pro586Ala		Q6ZSJ2|Q96FR9|Q9P224|Q9Y6V3	Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,pfam_Znf_GRF,superfamily_RNaseH-like_dom,smart_Exonuclease	p.P586A	ENST00000357967.4	37	c.1756	CCDS45436.1	16	.	.	.	.	.	.	.	.	.	.	G	7.988	0.752695	0.15778	.	.	ENSG00000196678	ENST00000357967;ENST00000389345	T;T	0.18960	2.19;2.18	5.63	2.61	0.31194	.	0.427905	0.23014	N	0.052934	T	0.15739	0.0379	L	0.54323	1.7	0.20926	N	0.999821	P	0.39282	0.666	B	0.32149	0.141	T	0.15838	-1.0423	10	0.12766	T	0.61	-7.6795	11.4128	0.49935	0.1991:0.0:0.8009:0.0	.	586	A8K979	ERI2_HUMAN	A	586;321	ENSP00000350651:P586A;ENSP00000373996:P321A	ENSP00000350651:P586A	P	-	1	0	ERI2	20716867	0.990000	0.36364	0.959000	0.39883	0.434000	0.31775	2.142000	0.42177	0.764000	0.33197	-0.194000	0.12790	CCA	ERI2	-	NULL	ENSG00000196678		0.423	ERI2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ERI2	HGNC	protein_coding		-	0.00	77	0	G	NM_080663		20809366	-1	tier1	-	no_errors	ENST00000357967	ensembl	human	known	74_37	missense	36.51	40	23	SNP	0.491	C
ERVV-2	100271846	genome.wustl.edu	37	19	53553253	53553254	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr19:53553253_53553254CC>AA	ENST00000601417.1	+	2	1355_1356	c.749_750CC>AA	c.(748-750)aCC>aAA	p.T250K		NM_001191055.1	NP_001177984.1	B6SEH9	ERVV2_HUMAN	endogenous retrovirus group V, member 2	250						integral component of membrane (GO:0016021)											TGGGCCTGTACCCCTCCTGGCT	0.505																																																	0																																										SO:0001583	missense	0			AI434519, CA417098, DA863698	CCDS59420.1	19q13.41	2014-05-02			ENSG00000268964	ENSG00000268964			39051	other	endogenous retrovirus						18826608, 21542922	Standard	NM_001191055		Approved		uc021uzd.1	B6SEH9	OTTHUMG00000182943	Exception_encountered	19.37:g.53553253_53553254delinsAA	ENSP00000472919:p.Thr250Lys			Missense_Mutation|Silent	SNP	pfam_TLV/ENV_coat_polyprotein	p.T250N|p.T250	ENST00000601417.1	37	c.749|c.750	CCDS59420.1	19																																																																																			ERVV-2	-	NULL	ENSG00000268964		0.505	ERVV-2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ERVV-2	HGNC	protein_coding	OTTHUMT00000464404.1	-	0.00	88|89	0	C	NM_001191055		53553253|53553254	+1	tier1	-	no_errors	ENST00000601417	ensembl	human	known	74_37	missense|silent	27.27|26.92	56|57	21	SNP	0.048|0.052	A
ETNPPL	64850	genome.wustl.edu	37	4	109674128	109674128	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr4:109674128C>G	ENST00000296486.3	-	6	695	c.541G>C	c.(541-543)Gac>Cac	p.D181H	ETNPPL_ENST00000510706.1_Missense_Mutation_p.D141H|ETNPPL_ENST00000411864.2_Missense_Mutation_p.D175H|ETNPPL_ENST00000512646.1_Missense_Mutation_p.D123H	NM_001146590.1|NM_031279.3	NP_001140062.1|NP_112569.2	Q8TBG4	AT2L1_HUMAN	ethanolamine-phosphate phospho-lyase	181						mitochondrion (GO:0005739)	ethanolamine-phosphate phospho-lyase activity (GO:0050459)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)										TCTGCATGGTCTTCTCTATAT	0.363																																																	0													158.0	147.0	151.0					4																	109674128		2203	4300	6503	SO:0001583	missense	0			AJ298293	CCDS3682.1, CCDS54792.1, CCDS54793.1	4q25	2013-06-12	2013-06-12	2013-06-12	ENSG00000164089	ENSG00000164089	4.2.3.2		14404	protein-coding gene	gene with protein product		614682	"""alanine-glyoxylate aminotransferase 2-like 1"""	AGXT2L1		7592550, 22241472	Standard	NM_031279		Approved		uc003hzc.3	Q8TBG4	OTTHUMG00000161036	ENST00000296486.3:c.541G>C	4.37:g.109674128C>G	ENSP00000296486:p.Asp181His		B7Z1Y0|E9PBY0|Q9H174	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase	p.D181H	ENST00000296486.3	37	c.541	CCDS3682.1	4	.	.	.	.	.	.	.	.	.	.	C	19.51	3.841656	0.71488	.	.	ENSG00000164089	ENST00000296486;ENST00000411864;ENST00000512646;ENST00000510706	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.46	2.79	0.32731	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.179615	0.64402	D	0.000017	T	0.63908	0.2551	M	0.84773	2.715	0.58432	D	0.999996	P;P;P	0.48407	0.829;0.795;0.91	P;P;P	0.59171	0.792;0.689;0.853	T	0.61983	-0.6950	9	.	.	.	-11.0279	7.8478	0.29435	0.1324:0.7289:0.0:0.1387	.	123;175;181	E9PBY0;Q8TBG4-2;Q8TBG4	.;.;AT2L1_HUMAN	H	181;175;123;141	ENSP00000296486:D181H;ENSP00000392269:D175H;ENSP00000427065:D123H;ENSP00000423240:D141H	.	D	-	1	0	AGXT2L1	109893577	1.000000	0.71417	0.949000	0.38748	0.930000	0.56654	2.110000	0.41873	0.269000	0.21961	0.655000	0.94253	GAC	ETNPPL	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase	ENSG00000164089		0.363	ETNPPL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ETNPPL	HGNC	protein_coding	OTTHUMT00000363508.1	-	0.00	73	0	C	NM_031279		109674128	-1	tier1	-	no_errors	ENST00000296486	ensembl	human	known	74_37	missense	32.26	42	20	SNP	1.000	G
EXOC7	23265	genome.wustl.edu	37	17	74097765	74097765	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr17:74097765T>G	ENST00000335146.7	-	3	359	c.306A>C	c.(304-306)agA>agC	p.R102S	EXOC7_ENST00000332065.5_Missense_Mutation_p.R102S|EXOC7_ENST00000467929.2_Missense_Mutation_p.R61S|EXOC7_ENST00000405575.4_Missense_Mutation_p.R102S|EXOC7_ENST00000607838.1_Missense_Mutation_p.R102S|EXOC7_ENST00000411744.2_Missense_Mutation_p.R102S|EXOC7_ENST00000589210.1_Missense_Mutation_p.R102S|EXOC7_ENST00000406660.3_Missense_Mutation_p.R102S			Q9UPT5	EXOC7_HUMAN	exocyst complex component 7	102					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	14			LUSC - Lung squamous cell carcinoma(166;0.187)			CTCACCCCTCTCTGATGATCT	0.547																																																	0													128.0	108.0	114.0					17																	74097765		2203	4300	6503	SO:0001583	missense	0			BC029432	CCDS11741.1, CCDS32738.1, CCDS45781.1, CCDS45782.1, CCDS45784.1, CCDS74164.1	17q25.3	2013-01-22			ENSG00000182473	ENSG00000182473			23214	protein-coding gene	gene with protein product		608163				12477932	Standard	NM_001013839		Approved	EXO70, KIAA1067, YJL085W, Exo70p	uc010wsw.2	Q9UPT5	OTTHUMG00000150720	ENST00000335146.7:c.306A>C	17.37:g.74097765T>G	ENSP00000334100:p.Arg102Ser		B5MC69|B8XXP2|Q8ND93|Q8WV91|Q96FF0|Q9H8C3|Q9H9X3|Q9HA32	Missense_Mutation	SNP	pfam_Exo70,superfamily_Cullin_repeat-like_dom	p.R102S	ENST00000335146.7	37	c.306	CCDS45782.1	17	.	.	.	.	.	.	.	.	.	.	T	16.79	3.219882	0.58560	.	.	ENSG00000182473	ENST00000332065;ENST00000405575;ENST00000335146;ENST00000357231;ENST00000425372;ENST00000411744;ENST00000405068;ENST00000442951;ENST00000406660	.	.	.	5.91	2.84	0.33178	Cullin repeat-like-containing domain (1);	0.147132	0.64402	D	0.000017	T	0.45637	0.1352	L	0.49126	1.545	0.52501	D	0.999955	B;B;B;B;P;P;B;B;B	0.47604	0.037;0.067;0.131;0.122;0.666;0.898;0.04;0.348;0.067	B;B;B;B;B;P;B;B;B	0.45712	0.113;0.093;0.058;0.088;0.167;0.491;0.035;0.22;0.077	T	0.26467	-1.0102	9	0.16896	T	0.51	-22.454	8.457	0.32906	0.0:0.6967:0.0:0.3033	.	102;102;61;61;102;102;102;102;102	Q9UPT5-5;Q9UPT5-6;B4DJ07;F5H1P1;B5MCY9;Q9UPT5-4;Q9UPT5;Q9UPT5-2;Q9UPT5-1	.;.;.;.;.;.;EXOC7_HUMAN;.;.	S	102;102;102;102;61;102;102;49;102	.	ENSP00000333806:R102S	R	-	3	2	EXOC7	71609360	0.997000	0.39634	1.000000	0.80357	0.950000	0.60333	0.484000	0.22308	0.372000	0.24591	-0.242000	0.12053	AGA	EXOC7	-	superfamily_Cullin_repeat-like_dom	ENSG00000182473		0.547	EXOC7-006	KNOWN	basic|CCDS	protein_coding	EXOC7	HGNC	protein_coding	OTTHUMT00000319768.2	-	0.00	53	0	T	NM_015219		74097765	-1	tier1	-	no_errors	ENST00000335146	ensembl	human	known	74_37	missense	25.00	48	16	SNP	1.000	G
FABP3	2170	genome.wustl.edu	37	1	31838684	31838684	+	3'UTR	SNP	C	C	T	rs371423628		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:31838684C>T	ENST00000373713.2	-	0	512				FABP3_ENST00000497275.1_5'UTR	NM_004102.3	NP_004093.1	P05413	FABPH_HUMAN	fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)						cholesterol homeostasis (GO:0042632)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid import (GO:0044539)|negative regulation of cell proliferation (GO:0008285)|phospholipid homeostasis (GO:0055091)|positive regulation of phospholipid biosynthetic process (GO:0071073)|regulation of fatty acid oxidation (GO:0046320)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to insulin (GO:0032868)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasm (GO:0016528)	cytoskeletal protein binding (GO:0008092)|icosatetraenoic acid binding (GO:0050543)|long-chain fatty acid binding (GO:0036041)|long-chain fatty acid transporter activity (GO:0005324)|oleic acid binding (GO:0070538)			large_intestine(1)|lung(2)|ovary(2)	5		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0185)|READ - Rectum adenocarcinoma(331;0.149)		GGTGCTGAGTCGAGGGGTAGC	0.522																																																	0													108.0	82.0	91.0					1																	31838684		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			U57623	CCDS342.1	1p33-p32	2013-03-01	2003-09-10		ENSG00000121769	ENSG00000121769		"""Fatty acid binding protein family"""	3557	protein-coding gene	gene with protein product		134651	"""fatty acid binding protein 11"""	MDGI, FABP11		8661024	Standard	NM_004102		Approved	H-FABP, O-FABP	uc001bss.1	P05413	OTTHUMG00000003797	ENST00000373713.2:c.*49G>A	1.37:g.31838684C>T			B2RAB6|Q5VV93|Q99957	RNA	SNP	-	NULL	ENST00000373713.2	37	NULL	CCDS342.1	1																																																																																			FABP3	-	-	ENSG00000121769		0.522	FABP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FABP3	HGNC	protein_coding	OTTHUMT00000010683.1	-	0.00	50	0	C	NM_004102		31838684	-1	tier1	-	no_errors	ENST00000497275	ensembl	human	known	74_37	rna	19.61	41	10	SNP	0.498	T
FAM104A	84923	genome.wustl.edu	37	17	71205859	71205861	+	In_Frame_Del	DEL	TGC	TGC	-	rs141426163	byFrequency	TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	TGC	TGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr17:71205859_71205861delTGC	ENST00000403627.3	-	3	428_430	c.368_370delGCA	c.(367-372)agcatc>atc	p.S123del	FAM104A_ENST00000581110.1_In_Frame_Del_p.A90del|FAM104A_ENST00000583024.1_In_Frame_Del_p.A96del|FAM104A_ENST00000405159.3_In_Frame_Del_p.S144del|FAM104A_ENST00000583178.1_5'UTR|FAM104A_ENST00000580032.1_In_Frame_Del_p.S33del	NM_032837.2	NP_116226.2	Q969W3	F104A_HUMAN	family with sequence similarity 104, member A	123	Ser-rich.									endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6			LUSC - Lung squamous cell carcinoma(166;0.197)			GGGCTATTGAtgctgctgctgct	0.596																																																	0																																										SO:0001651	inframe_deletion	0			AK027681	CCDS11693.2, CCDS45766.1, CCDS74143.1, CCDS74144.1	17q25.1	2005-12-16			ENSG00000133193	ENSG00000133193			25918	protein-coding gene	gene with protein product							Standard	NM_032837		Approved	FLJ14775	uc002jjj.4	Q969W3	OTTHUMG00000150564	ENST00000403627.3:c.368_370delGCA	17.37:g.71205868_71205870delTGC	ENSP00000384648:p.Ser123del		B4E339	In_Frame_Del	DEL	NULL	p.S144in_frame_del	ENST00000403627.3	37	c.433_431	CCDS11693.2	17																																																																																			FAM104A	-	NULL	ENSG00000133193		0.596	FAM104A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM104A	HGNC	protein_coding	OTTHUMT00000318935.1		0.00	40	0	TGC	NM_032837		71205861	-1	tier1		no_errors	ENST00000405159	ensembl	human	known	74_37	in_frame_del	6.06	31	2	DEL	1.000:1.000:1.000	-
FAM124B	79843	genome.wustl.edu	37	2	225244631	225244631	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:225244631C>T	ENST00000409685.3	-	2	1292	c.1027G>A	c.(1027-1029)Gcc>Acc	p.A343T	FAM124B_ENST00000389874.3_3'UTR	NM_001122779.1	NP_001116251.1	Q9H5Z6	F124B_HUMAN	family with sequence similarity 124B	343										endometrium(2)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	16		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		TTCATTCTGGCCCCGGATTCA	0.552																																																	0													25.0	31.0	29.0					2																	225244631		692	1591	2283	SO:0001583	missense	0			AK075126	CCDS2461.1, CCDS46527.1	2q36.2	2008-02-05			ENSG00000124019	ENSG00000124019			26224	protein-coding gene	gene with protein product						12477932	Standard	NM_001122779		Approved	FLJ22746	uc002vnx.3	Q9H5Z6	OTTHUMG00000133168	ENST00000409685.3:c.1027G>A	2.37:g.225244631C>T	ENSP00000386895:p.Ala343Thr		A6NNC7|Q8NBZ4|Q8TAV7	Missense_Mutation	SNP	NULL	p.A343T	ENST00000409685.3	37	c.1027	CCDS46527.1	2	.	.	.	.	.	.	.	.	.	.	C	10.70	1.423290	0.25639	.	.	ENSG00000124019	ENST00000409685	T	0.32272	1.46	5.92	-0.35	0.12606	.	.	.	.	.	T	0.14270	0.0345	L	0.29908	0.895	0.09310	N	1	B	0.20052	0.041	B	0.16722	0.016	T	0.33369	-0.9871	9	0.06099	T	0.92	-0.5779	1.5522	0.02578	0.1361:0.3429:0.1326:0.3884	.	343	Q9H5Z6	F124B_HUMAN	T	343	ENSP00000386895:A343T	ENSP00000386895:A343T	A	-	1	0	FAM124B	224952875	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.022000	0.13511	-0.371000	0.08004	-0.136000	0.14681	GCC	FAM124B	-	NULL	ENSG00000124019		0.552	FAM124B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM124B	HGNC	protein_coding	OTTHUMT00000330873.1	-	0.00	64	0	C	NM_024785		225244631	-1	tier1	-	no_errors	ENST00000409685	ensembl	human	known	74_37	missense	7.79	71	6	SNP	0.000	T
FAM73B	84895	genome.wustl.edu	37	9	131812166	131812166	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr9:131812166G>A	ENST00000358369.4	+	6	825	c.599G>A	c.(598-600)cGg>cAg	p.R200Q	FAM73B_ENST00000406926.2_Missense_Mutation_p.R200Q|FAM73B_ENST00000277475.5_Missense_Mutation_p.R200Q	NM_032809.2	NP_116198.2	Q7L4E1	FA73B_HUMAN	family with sequence similarity 73, member B	200					bone development (GO:0060348)	integral component of membrane (GO:0016021)		p.R200L(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)	13						GTGGGCCAGCGGGGGGACAGC	0.637																																																	1	Substitution - Missense(1)	lung(1)											61.0	60.0	61.0					9																	131812166		2203	4300	6503	SO:0001583	missense	0			AK074127	CCDS6917.1	9q34.13	2008-02-05	2005-08-11	2005-08-11	ENSG00000148343	ENSG00000148343			23621	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 54"""	C9orf54			Standard	NM_032809		Approved	FLJ14596, FLJ00199	uc004bxa.3	Q7L4E1	OTTHUMG00000020770	ENST00000358369.4:c.599G>A	9.37:g.131812166G>A	ENSP00000351138:p.Arg200Gln		Q8NBM3|Q8TEJ6|Q969E6	Missense_Mutation	SNP	pfam_DUF2217	p.R200Q	ENST00000358369.4	37	c.599	CCDS6917.1	9	.	.	.	.	.	.	.	.	.	.	G	16.10	3.027270	0.54683	.	.	ENSG00000148343	ENST00000358369;ENST00000406926;ENST00000277475	T;T;T	0.24908	1.83;1.83;1.83	5.25	4.35	0.52113	.	0.101474	0.64402	D	0.000009	T	0.30696	0.0773	M	0.73217	2.22	0.43803	D	0.996351	B;B	0.31655	0.334;0.118	B;B	0.32090	0.048;0.14	T	0.14643	-1.0465	10	0.72032	D	0.01	-10.6034	12.8299	0.57740	0.0791:0.0:0.9209:0.0	.	264;200	B4DZP8;Q7L4E1	.;FA73B_HUMAN	Q	200	ENSP00000351138:R200Q;ENSP00000384662:R200Q;ENSP00000277475:R200Q	ENSP00000277475:R200Q	R	+	2	0	FAM73B	130851987	0.766000	0.28496	0.764000	0.31436	0.012000	0.07955	2.894000	0.48640	1.207000	0.43291	0.313000	0.20887	CGG	FAM73B	-	pfam_DUF2217	ENSG00000148343		0.637	FAM73B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM73B	HGNC	protein_coding	OTTHUMT00000054542.7		0.00	22	0	G	NM_032809		131812166	+1			no_errors	ENST00000358369	ensembl	human	known	74_37	missense	11.76	15	2	SNP	0.981	A
FAT1	2195	genome.wustl.edu	37	4	187541055	187541055	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr4:187541055T>C	ENST00000441802.2	-	10	6894	c.6685A>G	c.(6685-6687)Att>Gtt	p.I2229V		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2229	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TTGAAGTTAATAGTGAACTGG	0.532										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0													169.0	174.0	172.0					4																	187541055		2034	4182	6216	SO:0001583	missense	0			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.6685A>G	4.37:g.187541055T>C	ENSP00000406229:p.Ile2229Val			Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.I2229V	ENST00000441802.2	37	c.6685	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	T	3.176	-0.168870	0.06461	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.58506	0.33	5.05	-0.604	0.11626	Cadherin (4);Cadherin-like (1);	0.102294	0.64402	N	0.000004	T	0.47911	0.1471	L	0.55834	1.745	0.54753	D	0.999986	B	0.11235	0.004	B	0.21708	0.036	T	0.31613	-0.9937	10	0.34782	T	0.22	.	9.8547	0.41079	0.0:0.2586:0.0:0.7414	.	2229	Q14517	FAT1_HUMAN	V	2229;2231	ENSP00000406229:I2229V	ENSP00000260147:I2231V	I	-	1	0	FAT1	187778049	0.489000	0.26004	0.069000	0.20011	0.074000	0.17049	0.806000	0.27126	-0.148000	0.11234	-0.274000	0.10170	ATT	FAT1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000083857		0.532	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	-	0.00	60	0	T	NM_005245		187541055	-1	tier1	-	no_errors	ENST00000441802	ensembl	human	known	74_37	missense	44.64	31	25	SNP	0.782	C
FAXC	84553	genome.wustl.edu	37	6	99728727	99728727	+	3'UTR	SNP	C	C	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:99728727C>A	ENST00000389677.5	-	0	1825				FAXC_ENST00000538471.1_3'UTR|FAXC_ENST00000461803.1_5'UTR	NM_032511.2	NP_115900.1	Q5TGI0	FAXC_HUMAN	failed axon connections homolog (Drosophila)							integral component of membrane (GO:0016021)											ATCATAAAAACTATCAGCTGA	0.373																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC011583	CCDS34500.1	6q16.3	2012-02-07	2012-02-07	2012-02-07	ENSG00000146267	ENSG00000146267			20742	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 168"""	C6orf168		12477932	Standard	NM_032511		Approved	MGC2817, dJ273F20	uc003ppj.4	Q5TGI0	OTTHUMG00000015261	ENST00000389677.5:c.*313G>T	6.37:g.99728727C>A			B3KU39|Q96F61|Q96LU3|Q9BR58|Q9BSS2	RNA	SNP	-	NULL	ENST00000389677.5	37	NULL	CCDS34500.1	6																																																																																			FAXC	-	-	ENSG00000146267		0.373	FAXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAXC	HGNC	protein_coding	OTTHUMT00000041589.4	-	0.00	17	0	C	NM_032511		99728727	-1	tier1	-	no_errors	ENST00000461803	ensembl	human	known	74_37	rna	25.00	9	3	SNP	0.000	A
FAXC	84553	genome.wustl.edu	37	6	99728980	99728980	+	3'UTR	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:99728980G>A	ENST00000389677.5	-	0	1572				FAXC_ENST00000538471.1_3'UTR|FAXC_ENST00000461803.1_5'UTR	NM_032511.2	NP_115900.1	Q5TGI0	FAXC_HUMAN	failed axon connections homolog (Drosophila)							integral component of membrane (GO:0016021)											TGCTACCTGGGAAAATGGACC	0.502																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC011583	CCDS34500.1	6q16.3	2012-02-07	2012-02-07	2012-02-07	ENSG00000146267	ENSG00000146267			20742	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 168"""	C6orf168		12477932	Standard	NM_032511		Approved	MGC2817, dJ273F20	uc003ppj.4	Q5TGI0	OTTHUMG00000015261	ENST00000389677.5:c.*60C>T	6.37:g.99728980G>A			B3KU39|Q96F61|Q96LU3|Q9BR58|Q9BSS2	RNA	SNP	-	NULL	ENST00000389677.5	37	NULL	CCDS34500.1	6																																																																																			FAXC	-	-	ENSG00000146267		0.502	FAXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAXC	HGNC	protein_coding	OTTHUMT00000041589.4	-	0.00	78	0	G	NM_032511		99728980	-1	tier1	-	no_errors	ENST00000461803	ensembl	human	known	74_37	rna	5.56	68	4	SNP	0.921	A
FBXO15	201456	genome.wustl.edu	37	18	71797743	71797743	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr18:71797743delT	ENST00000419743.2	-	4	562	c.483delA	c.(481-483)aaafs	p.K161fs	FBXO15_ENST00000269500.5_Frame_Shift_Del_p.K85fs	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	161						SCF ubiquitin ligase complex (GO:0019005)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		ATGCTATTTGTTTTGTGATAT	0.403																																																	0													149.0	147.0	148.0					18																	71797743		2203	4300	6503	SO:0001589	frameshift_variant	0			AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.483delA	18.37:g.71797743delT	ENSP00000393154:p.Lys161fs		B3KST3	Frame_Shift_Del	DEL	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.K161fs	ENST00000419743.2	37	c.483	CCDS45884.1	18																																																																																			FBXO15	-	superfamily_F-box_dom	ENSG00000141665		0.403	FBXO15-002	KNOWN	basic|CCDS	protein_coding	FBXO15	HGNC	protein_coding	OTTHUMT00000444223.1		0.00	70	0	T	NM_152676		71797743	-1	tier1		no_errors	ENST00000419743	ensembl	human	known	74_37	frame_shift_del	12.90	54	8	DEL	0.022	-
ZNF395	55893	genome.wustl.edu	37	8	28218519	28218519	+	Silent	SNP	G	G	A	rs368064690		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr8:28218519G>A	ENST00000344423.5	-	2	254	c.123C>T	c.(121-123)gcC>gcT	p.A41A	ZNF395_ENST00000523095.1_Silent_p.A41A|ZNF395_ENST00000523202.1_Silent_p.A41A	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	41					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		GCTGGGGAGCGGCCCCTTCTA	0.682																																																	0								G		1,4405		0,1,2202	22.0	26.0	25.0		123	-10.0	0.0	8		25	0,8600		0,0,4300	no	coding-synonymous	ZNF395	NM_018660.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		41/514	28218519	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.123C>T	8.37:g.28218519G>A			B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.R342C	ENST00000344423.5	37	c.1024	CCDS6067.1	8																																																																																			FBXO16	-	NULL	ENSG00000214050		0.682	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO16	HGNC	protein_coding	OTTHUMT00000219976.1	-	0.00	113	0	G			28218519	-1	tier1	-	no_errors	ENST00000521548	ensembl	human	known	74_37	missense	30.85	65	29	SNP	0.000	A
FGB	2244	genome.wustl.edu	37	4	155488798	155488798	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr4:155488798T>C	ENST00000302068.4	+	4	607	c.544T>C	c.(544-546)Tat>Cat	p.Y182H	FGB_ENST00000509493.1_5'UTR|FGB_ENST00000502545.1_3'UTR	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	182					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	GCACCAATTATATATAGATGA	0.338																																					NSCLC(106;1133 1613 21870 46110 52656)												0													92.0	90.0	91.0					4																	155488798		2203	4300	6503	SO:0001583	missense	0				CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.544T>C	4.37:g.155488798T>C	ENSP00000306099:p.Tyr182His		A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,pfam_Fibrinogen_a/b/g_coil_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.Y182H	ENST00000302068.4	37	c.544	CCDS3786.1	4	.	.	.	.	.	.	.	.	.	.	T	18.60	3.658776	0.67586	.	.	ENSG00000171564	ENST00000302068;ENST00000537843	D	0.83163	-1.69	5.77	5.77	0.91146	Fibrinogen, alpha/beta/gamma chain, coiled coil domain (2);	0.218158	0.49916	D	0.000133	D	0.89301	0.6676	M	0.76002	2.32	0.80722	D	1	D;D	0.61080	0.989;0.967	P;P	0.59761	0.863;0.787	D	0.89006	0.3425	10	0.42905	T	0.14	.	16.383	0.83481	0.0:0.0:0.0:1.0	.	165;182	B4E1D3;P02675	.;FIBB_HUMAN	H	182;165	ENSP00000306099:Y182H	ENSP00000306099:Y182H	Y	+	1	0	FGB	155708248	0.993000	0.37304	0.896000	0.35187	0.828000	0.46876	7.150000	0.77403	2.326000	0.78906	0.533000	0.62120	TAT	FGB	-	pfam_Fibrinogen_a/b/g_coil_dom	ENSG00000171564		0.338	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGB	HGNC	protein_coding	OTTHUMT00000317595.1	-	0.00	55	0	T	NM_005141		155488798	+1	tier1	-	no_errors	ENST00000302068	ensembl	human	known	74_37	missense	34.09	29	15	SNP	0.986	C
FHOD1	29109	genome.wustl.edu	37	16	67268058	67268058	+	Silent	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:67268058C>T	ENST00000258201.4	-	13	1795	c.1548G>A	c.(1546-1548)aaG>aaA	p.K516K		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	516	FH1.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		TCAGTGGCTCCTTGGGCTCTG	0.637																																																	0													64.0	70.0	68.0					16																	67268058		2198	4300	6498	SO:0001819	synonymous_variant	0			AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.1548G>A	16.37:g.67268058C>T			Q59F76|Q6Y1F2|Q76MS8|Q8N521	Silent	SNP	pfam_FH2_Formin,superfamily_ARM-type_fold,smart_FH2_Formin	p.K516	ENST00000258201.4	37	c.1548	CCDS10834.1	16																																																																																			FHOD1	-	NULL	ENSG00000135723		0.637	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHOD1	HGNC	protein_coding	OTTHUMT00000268844.2	-	0.00	124	0	C			67268058	-1	tier1	-	no_errors	ENST00000258201	ensembl	human	known	74_37	silent	16.67	95	19	SNP	0.034	T
FPGT-TNNI3K	100526835	genome.wustl.edu	37	1	74835185	74835185	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:74835185G>T	ENST00000370899.3	+	18	1923	c.1886G>T	c.(1885-1887)tGc>tTc	p.C629F	TNNI3K_ENST00000370891.2_Missense_Mutation_p.C629F|TNNI3K_ENST00000326637.3_Missense_Mutation_p.C528F|FPGT-TNNI3K_ENST00000370895.1_Missense_Mutation_p.C629F|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.C642F|RP11-439H8.4_ENST00000415549.2_RNA	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough									p.C528F(1)									GTGGGTGCTTGCTTGAATGAT	0.468																																																	1	Substitution - Missense(1)	lung(1)											252.0	220.0	231.0					1																	74835185		2203	4300	6503	SO:0001583	missense	0					1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.1886G>T	1.37:g.74835185G>T	ENSP00000359936:p.Cys629Phe			Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom	p.C642F	ENST00000370899.3	37	c.1925		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.3|23.3	4.398236|4.398236	0.83120|0.83120	.|.	.|.	ENSG00000116783|ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783;ENSG00000116783	ENST00000526236;ENST00000525480|ENST00000370899;ENST00000370895;ENST00000557284;ENST00000370891;ENST00000326637;ENST00000534020	.|D;D;D;D;D;D	.|0.84442	.|-1.85;-1.85;-1.85;-1.85;-1.85;-1.85	5.27|5.27	5.27|5.27	0.74061|0.74061	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.89501|0.89501	0.6733|0.6733	L|L	0.53561|0.53561	1.675|1.675	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.76494	.|0.999;0.999;0.999;0.994	.|D;D;D;P	.|0.72338	.|0.977;0.961;0.961;0.808	D|D	0.90471|0.90471	0.4453|0.4453	5|10	.|0.87932	.|D	.|0	.|.	18.8831|18.8831	0.92364|0.92364	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|528;629;629;629	.|Q59H18;Q59H18-1;Q59H18-4;Q59H18-3	.|TNI3K_HUMAN;.;.;.	S|F	75;48|629;629;629;629;528;52	.|ENSP00000359936:C629F;ENSP00000359932:C629F;ENSP00000450895:C629F;ENSP00000359928:C629F;ENSP00000322251:C528F;ENSP00000434975:C52F	.|ENSP00000322251:C528F	A|C	+|+	1|2	0|0	AC093158.1|RP11-653A5.2;AC093158.1	74607773|74607773	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	7.488000|7.488000	0.81441|0.81441	2.449000|2.449000	0.82847|0.82847	0.561000|0.561000	0.74099|0.74099	GCT|TGC	FPGT-TNNI3K	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000259030		0.468	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	FPGT-TNNI3K	HGNC	protein_coding	OTTHUMT00000026438.3		0.00	54	0	G			74835185	+1			no_errors	ENST00000557284	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	T
FXR1	8087	genome.wustl.edu	37	3	180688017	180688017	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:180688017G>A	ENST00000357559.4	+	15	1858	c.1474G>A	c.(1474-1476)Gat>Aat	p.D492N	FXR1_ENST00000480918.1_Missense_Mutation_p.D479N|FXR1_ENST00000468861.1_Missense_Mutation_p.D407N|FXR1_ENST00000491062.1_Missense_Mutation_p.D443N|FXR1_ENST00000305586.7_Missense_Mutation_p.D407N|FXR1_ENST00000445140.2_Missense_Mutation_p.D492N	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	492					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			TGCAGACACTGATGCCAGCGA	0.433																																																	0													132.0	114.0	120.0					3																	180688017		2203	4300	6503	SO:0001583	missense	0			M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1474G>A	3.37:g.180688017G>A	ENSP00000350170:p.Asp492Asn		A8K9B8|Q7Z450|Q8N6R8	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet-like_dom,superfamily_NA-bd_OB-fold,smart_KH_dom,pfscan_KH_dom_type_1	p.D492N	ENST00000357559.4	37	c.1474	CCDS3238.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.693966	0.96793	.	.	ENSG00000114416	ENST00000357559;ENST00000305586;ENST00000491062;ENST00000468861;ENST00000445140;ENST00000480918	T;T;T;T;T;T	0.44482	1.63;1.45;0.93;0.92;0.92;1.44	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.64450	0.2599	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.968;0.968;0.998;0.981;0.993	D;P;P;D;P;D	0.85130	0.997;0.772;0.772;0.995;0.886;0.977	T	0.63690	-0.6580	10	0.72032	D	0.01	-18.2892	20.3011	0.98612	0.0:0.0:1.0:0.0	.	479;443;407;436;492;492	B4DXZ6;E9PFF5;E7EU85;E7ERF5;P51114-2;P51114	.;.;.;.;.;FXR1_HUMAN	N	492;407;443;407;492;479	ENSP00000350170:D492N;ENSP00000307633:D407N;ENSP00000420643:D443N;ENSP00000420515:D407N;ENSP00000388828:D492N;ENSP00000418097:D479N	ENSP00000307633:D407N	D	+	1	0	FXR1	182170711	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.804000	0.96469	0.650000	0.86243	GAT	FXR1	-	NULL	ENSG00000114416		0.433	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR1	HGNC	protein_coding	OTTHUMT00000350265.5	-	0.00	54	0	G			180688017	+1	tier1	-	no_errors	ENST00000357559	ensembl	human	known	74_37	missense	9.41	77	8	SNP	1.000	A
GABRG3	2567	genome.wustl.edu	37	15	27778007	27778007	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr15:27778007G>A	ENST00000333743.6	+	10	1638	c.1384G>A	c.(1384-1386)Gtt>Att	p.V462I	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	462					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GGTCTACTGGGTTGGATACCT	0.502																																					NSCLC(114;800 1656 7410 37729 45293)												0													51.0	51.0	51.0					15																	27778007		1944	4141	6085	SO:0001583	missense	0				CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.1384G>A	15.37:g.27778007G>A	ENSP00000331912:p.Val462Ile		G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,prints_GABAA_rcpt,prints_GABBAg3_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.V462I	ENST00000333743.6	37	c.1384	CCDS45195.1	15	.	.	.	.	.	.	.	.	.	.	G	14.95	2.689696	0.48097	.	.	ENSG00000182256	ENST00000333743	D	0.83506	-1.73	5.57	4.55	0.56014	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.267267	0.33075	N	0.005318	T	0.63792	0.2541	N	0.04373	-0.215	0.80722	D	1	B	0.24533	0.105	B	0.25140	0.058	T	0.58352	-0.7651	10	0.09338	T	0.73	.	13.1334	0.59395	0.083:0.0:0.917:0.0	.	462	Q99928	GBRG3_HUMAN	I	462	ENSP00000331912:V462I	ENSP00000331912:V462I	V	+	1	0	GABRG3	25451602	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	6.350000	0.73017	1.185000	0.42971	0.650000	0.86243	GTT	GABRG3	-	superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAa_rcpt,tigrfam_Neur_channel	ENSG00000182256		0.502	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRG3	HGNC	protein_coding	OTTHUMT00000103584.2	-	0.00	118	0	G			27778007	+1	tier1	-	no_errors	ENST00000333743	ensembl	human	known	74_37	missense	12.90	134	20	SNP	1.000	A
GALR3	8484	genome.wustl.edu	37	22	38219537	38219537	+	Missense_Mutation	SNP	C	C	T	rs144316004		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr22:38219537C>T	ENST00000249041.2	+	1	149	c.124C>T	c.(124-126)Ctc>Ttc	p.L42F		NM_003614.1	NP_003605.1	O60755	GALR3_HUMAN	galanin receptor 3	42					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|learning or memory (GO:0007611)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|peptide hormone binding (GO:0017046)			endometrium(1)|liver(2)|lung(1)	4	Melanoma(58;0.045)					GCTGGCAGTGCTCCTGCAGCC	0.647																																																	0													71.0	59.0	63.0					22																	38219537		2203	4300	6503	SO:0001583	missense	0			AF073799	CCDS13958.1	22q113.1	2012-08-08			ENSG00000128310	ENSG00000128310		"""GPCR / Class A : Galanin receptors"""	4134	protein-coding gene	gene with protein product		603692				9722565, 9832121	Standard	NM_003614		Approved		uc003aub.1	O60755	OTTHUMG00000150658	ENST00000249041.2:c.124C>T	22.37:g.38219537C>T	ENSP00000249041:p.Leu42Phe		Q53YJ4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Galanin_rcpt,prints_GPCR_Rhodpsn,prints_Galnin_3_rcpt	p.L42F	ENST00000249041.2	37	c.124	CCDS13958.1	22	.	.	.	.	.	.	.	.	.	.	C	23.7	4.451637	0.84209	.	.	ENSG00000128310	ENST00000249041	T	0.39406	1.08	5.55	5.55	0.83447	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	T	0.62684	0.2448	M	0.72576	2.205	0.52501	D	0.999959	D	0.89917	1.0	D	0.83275	0.996	T	0.63994	-0.6511	10	0.72032	D	0.01	.	12.9364	0.58316	0.0:0.9267:0.0:0.0733	.	42	O60755	GALR3_HUMAN	F	42	ENSP00000249041:L42F	ENSP00000249041:L42F	L	+	1	0	GALR3	36549483	1.000000	0.71417	1.000000	0.80357	0.626000	0.37791	4.805000	0.62561	2.885000	0.99019	0.655000	0.94253	CTC	GALR3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000128310		0.647	GALR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALR3	HGNC	protein_coding	OTTHUMT00000319452.1		0.00	52	0	C			38219537	+1			no_errors	ENST00000249041	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
GATAD2A	54815	genome.wustl.edu	37	19	19605162	19605162	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr19:19605162G>T	ENST00000360315.3	+	5	906	c.594G>T	c.(592-594)caG>caT	p.Q198H	GATAD2A_ENST00000252577.5_Missense_Mutation_p.Q198H|GATAD2A_ENST00000429563.2_Intron|GATAD2A_ENST00000358713.3_Missense_Mutation_p.Q198H|GATAD2A_ENST00000537887.1_Intron|GATAD2A_ENST00000404158.1_Missense_Mutation_p.Q198H	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	198					anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						GGGGCACTCAGAACATTCCTG	0.637																																																	0													101.0	77.0	85.0					19																	19605162		2203	4300	6503	SO:0001583	missense	0			AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.594G>T	19.37:g.19605162G>T	ENSP00000353463:p.Gln198His		B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Missense_Mutation	SNP	pfam_Znf_GATA,pfscan_Znf_GATA	p.Q198H	ENST00000360315.3	37	c.594	CCDS12402.2	19	.	.	.	.	.	.	.	.	.	.	G	17.15	3.316344	0.60524	.	.	ENSG00000167491	ENST00000360315;ENST00000252577;ENST00000404158;ENST00000358713	T;T;T	0.34275	1.42;1.37;1.42	5.08	1.51	0.23008	.	0.251319	0.35495	N	0.003163	T	0.36358	0.0964	N	0.24115	0.695	0.80722	D	1	D;D	0.61080	0.989;0.989	P;P	0.62014	0.897;0.897	T	0.12116	-1.0560	10	0.56958	D	0.05	-10.9977	7.3036	0.26434	0.3632:0.0:0.6368:0.0	.	217;198	B5MC40;Q86YP4	.;P66A_HUMAN	H	198;198;217;198	ENSP00000353463:Q198H;ENSP00000252577:Q198H;ENSP00000351552:Q198H	ENSP00000252577:Q198H	Q	+	3	2	GATAD2A	19466162	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	3.047000	0.49854	0.556000	0.29098	-0.291000	0.09656	CAG	GATAD2A	-	NULL	ENSG00000167491		0.637	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATAD2A	HGNC	protein_coding	OTTHUMT00000326671.4	-	0.00	42	0	G	NM_017660		19605162	+1	tier1	-	no_errors	ENST00000358713	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
GCM2	9247	genome.wustl.edu	37	6	10877517	10877517	+	Missense_Mutation	SNP	G	G	A	rs532834782		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:10877517G>A	ENST00000379491.4	-	2	346	c.199C>T	c.(199-201)Cgc>Tgc	p.R67C	RP11-637O19.3_ENST00000480294.1_Intron|SYCP2L_ENST00000543878.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	67					cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				TTGGTGTTGCGCATGGCCCAG	0.597																																																	0													97.0	77.0	84.0					6																	10877517		2203	4300	6503	SO:0001583	missense	0			AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.199C>T	6.37:g.10877517G>A	ENSP00000368805:p.Arg67Cys		D3GDV6|Q5THN5	Missense_Mutation	SNP	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	p.R67C	ENST00000379491.4	37	c.199	CCDS4517.1	6	.	.	.	.	.	.	.	.	.	.	G	22.7	4.326977	0.81690	.	.	ENSG00000124827	ENST00000379491	T	0.80994	-1.44	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.89040	0.6602	M	0.84585	2.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90286	0.4319	10	0.87932	D	0	-20.4115	14.6371	0.68696	0.0:0.0:0.8546:0.1454	.	67	O75603	GCM2_HUMAN	C	67	ENSP00000368805:R67C	ENSP00000368805:R67C	R	-	1	0	GCM2	10985503	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.763000	0.55257	2.679000	0.91253	0.650000	0.86243	CGC	GCM2	-	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	ENSG00000124827		0.597	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCM2	HGNC	protein_coding	OTTHUMT00000039844.1		0.00	36	0	G			10877517	-1			no_errors	ENST00000379491	ensembl	human	known	74_37	missense	16.67	30	6	SNP	1.000	A
GLB1L	79411	genome.wustl.edu	37	2	220103229	220103229	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:220103229C>G	ENST00000295759.7	-	13	1528	c.1215G>C	c.(1213-1215)gaG>gaC	p.E405D	GLB1L_ENST00000497855.1_5'UTR|GLB1L_ENST00000392089.2_Missense_Mutation_p.E405D|GLB1L_ENST00000409640.1_Missense_Mutation_p.E315D|GLB1L_ENST00000356283.3_Missense_Mutation_p.E315D			Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like	405					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCTTGACAGCCTCAAAGGTCA	0.468																																																	0													97.0	101.0	99.0					2																	220103229		2203	4300	6503	SO:0001583	missense	0				CCDS2437.1, CCDS74657.1	2q36.1	2008-02-05			ENSG00000163521	ENSG00000163521			28129	protein-coding gene	gene with protein product						12975309	Standard	XM_005246850		Approved	MGC10771	uc002vkm.3	Q6UWU2	OTTHUMG00000133133	ENST00000295759.7:c.1215G>C	2.37:g.220103229C>G	ENSP00000295759:p.Glu405Asp		Q96DR0	Missense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.E405D	ENST00000295759.7	37	c.1215	CCDS2437.1	2	.	.	.	.	.	.	.	.	.	.	C	15.18	2.755574	0.49362	.	.	ENSG00000163521	ENST00000295759;ENST00000409640;ENST00000392089;ENST00000356283	D;D;D;D	0.97994	-4.65;-4.46;-4.65;-4.46	5.01	3.22	0.36961	.	0.000000	0.85682	D	0.000000	D	0.98473	0.9491	M	0.87456	2.885	0.54753	D	0.999985	D;P	0.89917	1.0;0.521	D;B	0.83275	0.996;0.289	D	0.98329	1.0532	10	0.66056	D	0.02	-21.5618	8.8083	0.34952	0.0:0.772:0.0:0.228	.	315;405	Q6UWU2-2;Q6UWU2	.;GLB1L_HUMAN	D	405;315;405;315	ENSP00000295759:E405D;ENSP00000386354:E315D;ENSP00000375939:E405D;ENSP00000348628:E315D	ENSP00000295759:E405D	E	-	3	2	GLB1L	219811473	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.930000	0.28858	0.833000	0.34828	0.655000	0.94253	GAG	GLB1L	-	NULL	ENSG00000163521		0.468	GLB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLB1L	HGNC	protein_coding	OTTHUMT00000256822.2	-	0.00	80	0	C	NM_024506		220103229	-1	tier1	-	no_errors	ENST00000295759	ensembl	human	known	74_37	missense	39.13	69	45	SNP	1.000	G
GLMN	11146	genome.wustl.edu	37	1	92713443	92713443	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:92713443T>A	ENST00000370360.3	-	17	1658	c.1577A>T	c.(1576-1578)aAt>aTt	p.N526I	GLMN_ENST00000534881.1_Missense_Mutation_p.N512I	NM_053274.2	NP_444504.1	Q92990	GLMN_HUMAN	glomulin, FKBP associated protein	526					muscle cell differentiation (GO:0042692)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of T cell proliferation (GO:0042130)|neural tube closure (GO:0001843)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of phosphorylation (GO:0042327)|regulation of gene expression, epigenetic (GO:0040029)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|vasculogenesis (GO:0001570)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul3-RING ubiquitin ligase complex (GO:0031463)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|cullin-RING ubiquitin ligase complex (GO:0031461)|intracellular (GO:0005622)	hepatocyte growth factor receptor binding (GO:0005171)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase inhibitor activity (GO:0055105)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)	17		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		ACCTTGGCTATTTTTAATTTC	0.279									Multiple Glomus Tumors (of the Skin), Familial																																								0													87.0	95.0	92.0					1																	92713443		2202	4291	6493	SO:0001583	missense	0	Familial Cancer Database	Multiple Familial Glomangiomas, Hereditary Multiple Glomus Tumors, Familial Multiple Glomangiomatosis, Inherited Cutaneous Venous Anomalies, incl. Familial Multiple Glomangiomyoma	U73704	CCDS738.1	1p22.1	2008-02-05	2004-07-01		ENSG00000174842	ENSG00000174842			14373	protein-coding gene	gene with protein product		601749	"""venous malformation with glomus cells"""	VMGLOM		8955134	Standard	XM_005270400		Approved	FAP48, GLML, GVM, FKBPAP	uc001dor.3	Q92990	OTTHUMG00000010283	ENST00000370360.3:c.1577A>T	1.37:g.92713443T>A	ENSP00000359385:p.Asn526Ile		Q5VVC3|Q9BVE8	Missense_Mutation	SNP	pfam_YAP-bd/Alf4/glomulin	p.N526I	ENST00000370360.3	37	c.1577	CCDS738.1	1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.951211	0.73787	.	.	ENSG00000174842	ENST00000370360;ENST00000534881	T;T	0.48522	0.82;0.81	6.03	3.61	0.41365	.	0.330942	0.38326	N	0.001727	T	0.40862	0.1134	L	0.54323	1.7	0.40992	D	0.984864	P;P	0.51147	0.942;0.927	P;P	0.52189	0.692;0.596	T	0.39272	-0.9622	10	0.56958	D	0.05	-9.949	9.5222	0.39143	0.0:0.0653:0.1224:0.8123	.	512;526	B4DJ85;Q92990	.;GLMN_HUMAN	I	526;512	ENSP00000359385:N526I;ENSP00000440156:N512I	ENSP00000359385:N526I	N	-	2	0	GLMN	92486031	0.997000	0.39634	0.988000	0.46212	0.924000	0.55760	1.743000	0.38258	2.308000	0.77769	0.533000	0.62120	AAT	GLMN	-	pfam_YAP-bd/Alf4/glomulin	ENSG00000174842		0.279	GLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLMN	HGNC	protein_coding	OTTHUMT00000028358.1	-	0.00	125	0	T	NM_007070		92713443	-1	tier1	-	no_errors	ENST00000370360	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.996	A
GOLPH3	64083	genome.wustl.edu	37	5	32126582	32126582	+	Silent	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr5:32126582C>T	ENST00000265070.6	-	4	948	c.633G>A	c.(631-633)caG>caA	p.Q211Q	GOLPH3_ENST00000512668.1_5'Flank	NM_022130.3	NP_071413.1	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3 (coat-protein)	211					cell adhesion molecule production (GO:0060352)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|gene expression (GO:0010467)|glycoprotein biosynthetic process (GO:0009101)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|Golgi vesicle budding (GO:0048194)|lamellipodium assembly (GO:0030032)|leukocyte tethering or rolling (GO:0050901)|positive regulation of protein secretion (GO:0050714)|positive regulation of TOR signaling (GO:0032008)|protein retention in Golgi apparatus (GO:0045053)|protein secretion (GO:0009306)|regulation of mitochondrion organization (GO:0010821)	cytosol (GO:0005829)|endosome (GO:0005768)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|phosphatidylinositol-4-phosphate binding (GO:0070273)			kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11						TGATGAGGCGCTGCTTAATGT	0.468																																																	0													220.0	206.0	211.0					5																	32126582		2203	4300	6503	SO:0001819	synonymous_variant	0			AK075156	CCDS3896.1	5p13.2	2008-07-18			ENSG00000113384	ENSG00000113384			15452	protein-coding gene	gene with protein product	"""golgi peripheral membrane protein 1, 34 kDa"", ""golgi protein"", ""coat-protein"", ""golgi-associated protein"""	612207				11042173, 16263763	Standard	NM_022130		Approved	GPP34, GOPP1, MIDAS	uc003jhp.1	Q9H4A6	OTTHUMG00000090679	ENST00000265070.6:c.633G>A	5.37:g.32126582C>T			Q9UIW5	Silent	SNP	pfam_GPP34	p.Q211	ENST00000265070.6	37	c.633	CCDS3896.1	5																																																																																			GOLPH3	-	pfam_GPP34	ENSG00000113384		0.468	GOLPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLPH3	HGNC	protein_coding	OTTHUMT00000207363.2	-	0.00	104	0	C	NM_022130		32126582	-1	tier1	-	no_errors	ENST00000265070	ensembl	human	known	74_37	silent	20.33	98	25	SNP	1.000	T
GPI	2821	genome.wustl.edu	37	19	34855878	34855878	+	5'Flank	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr19:34855878C>T	ENST00000356487.5	+	0	0				GPI_ENST00000586425.1_5'Flank|GPI_ENST00000415930.3_Missense_Mutation_p.P22S	NM_000175.3	NP_000166.2	P06744	G6PI_HUMAN	glucose-6-phosphate isomerase						aldehyde catabolic process (GO:0046185)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|hemostasis (GO:0007599)|humoral immune response (GO:0006959)|learning or memory (GO:0007611)|methylglyoxal biosynthetic process (GO:0019242)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucose-6-phosphate isomerase activity (GO:0004347)|intramolecular transferase activity (GO:0016866)|monosaccharide binding (GO:0048029)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	25	Esophageal squamous(110;0.162)					gcccaccctcccCACTGCCAC	0.672																																																	0																																										SO:0001631	upstream_gene_variant	0			M61214	CCDS12437.1, CCDS54246.1	19q13.1	2012-10-02	2010-05-11			ENSG00000105220	5.3.1.9		4458	protein-coding gene	gene with protein product		172400	"""glucose phosphate isomerase"""			2387591, 8575767	Standard	NM_001184722		Approved	AMF, NLK	uc002nvg.2	P06744			19.37:g.34855878C>T	Exception_encountered		B4DG39|Q9BRD3|Q9BSK5|Q9UHE6	Missense_Mutation	SNP	pfam_G6P_Isomerase,prints_G6P_Isomerase	p.P22S	ENST00000356487.5	37	c.64	CCDS12437.1	19	.	.	.	.	.	.	.	.	.	.	C	7.168	0.586977	0.13749	.	.	ENSG00000105220	ENST00000415930	D	0.92805	-3.11	1.77	-3.54	0.04653	.	.	.	.	.	T	0.77552	0.4147	.	.	.	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.64228	-0.6457	8	0.07175	T	0.84	.	4.8224	0.13398	0.0:0.4024:0.1944:0.4032	.	22	B4DG39	.	S	22	ENSP00000405573:P22S	ENSP00000405573:P22S	P	+	1	0	GPI	39547718	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.579000	0.05834	-1.889000	0.01112	-1.598000	0.00824	CCC	GPI	-	NULL	ENSG00000105220		0.672	GPI-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPI	HGNC	protein_coding	OTTHUMT00000451693.3	-	0.00	36	0	C			34855878	+1	tier1	-	no_errors	ENST00000415930	ensembl	human	known	74_37	missense	19.05	34	8	SNP	0.000	T
GPR152	390212	genome.wustl.edu	37	11	67219230	67219230	+	Silent	SNP	C	C	T	rs367572061		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:67219230C>T	ENST00000312457.2	-	1	970	c.966G>A	c.(964-966)ccG>ccA	p.P322P	CABP4_ENST00000438189.2_5'Flank	NM_206997.1	NP_996880.1	Q8TDT2	GP152_HUMAN	G protein-coupled receptor 152	322						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			TGAAGCTGCCCGGCCGCTCCT	0.662																																					Pancreas(102;800 1581 2723 7382 33622)												0								C		0,4400		0,0,2200	42.0	42.0	42.0		966	-8.6	0.0	11		42	1,8589	1.2+/-3.3	0,1,4294	no	coding-synonymous	GPR152	NM_206997.1		0,1,6494	TT,TC,CC		0.0116,0.0,0.0077		322/471	67219230	1,12989	2200	4295	6495	SO:0001819	synonymous_variant	0			AY255600	CCDS8165.1	11q13.2	2013-09-20			ENSG00000175514	ENSG00000175514		"""GPCR / Class A : Orphans"""	23622	protein-coding gene	gene with protein product						12679517	Standard	NM_206997		Approved	PGR5	uc001olm.3	Q8TDT2	OTTHUMG00000168032	ENST00000312457.2:c.966G>A	11.37:g.67219230C>T			Q0VD88|Q86SM0	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.P322	ENST00000312457.2	37	c.966	CCDS8165.1	11																																																																																			GPR152	-	NULL	ENSG00000175514		0.662	GPR152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR152	HGNC	protein_coding	OTTHUMT00000397623.1	-	0.00	82	0	C			67219230	-1	tier1	-	no_errors	ENST00000312457	ensembl	human	known	74_37	silent	24.19	47	15	SNP	0.000	T
GSG1L	146395	genome.wustl.edu	37	16	27840120	27840120	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:27840120A>C	ENST00000447459.2	-	5	904	c.820T>G	c.(820-822)Ttc>Gtc	p.F274V	GSG1L_ENST00000380898.2_Missense_Mutation_p.F119V|GSG1L_ENST00000569166.1_Missense_Mutation_p.F119V|GSG1L_ENST00000380897.3_Missense_Mutation_p.F119V|GSG1L_ENST00000395724.3_Missense_Mutation_p.F223V	NM_001109763.1	NP_001103233.1	Q6UXU4	GSG1L_HUMAN	GSG1-like	274					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	asymmetric synapse (GO:0032279)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(4)	17						CTCTCCCGGAAGTACTTGATG	0.602																																																	0													94.0	81.0	86.0					16																	27840120		2197	4300	6497	SO:0001583	missense	0			AK128775	CCDS10631.1, CCDS45450.1	16p11.2	2014-01-20			ENSG00000169181	ENSG00000169181			28283	protein-coding gene	gene with protein product						22813734	Standard	NM_001109763		Approved	MGC18079, PRO19651, KTSR5831	uc002doz.2	Q6UXU4	OTTHUMG00000131676	ENST00000447459.2:c.820T>G	16.37:g.27840120A>C	ENSP00000394954:p.Phe274Val		Q7Z6F8|Q8TB81	Missense_Mutation	SNP	pfam_GSG-1,pfam_PMP22/EMP/MP20/Claudin	p.F274V	ENST00000447459.2	37	c.820	CCDS45450.1	16	.	.	.	.	.	.	.	.	.	.	A	16.39	3.109326	0.56398	.	.	ENSG00000169181	ENST00000447459;ENST00000395724;ENST00000380898;ENST00000380897	T;T	0.36157	1.31;1.27	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.24005	0.0581	N	0.19112	0.55	0.53005	D	0.999967	P;P;P	0.47962	0.794;0.903;0.9	B;B;B	0.43052	0.31;0.406;0.219	T	0.02698	-1.1122	10	0.29301	T	0.29	2.0183	8.7845	0.34811	0.9138:0.0:0.0862:0.0	.	223;119;274	Q6UXU4-3;Q6UXU4-4;Q6UXU4	.;.;GSG1L_HUMAN	V	274;223;119;119	ENSP00000394954:F274V;ENSP00000379074:F223V	ENSP00000370282:F119V	F	-	1	0	GSG1L	27747621	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.332000	0.72934	1.986000	0.57962	0.528000	0.53228	TTC	GSG1L	-	NULL	ENSG00000169181		0.602	GSG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GSG1L	HGNC	protein_coding	OTTHUMT00000433832.2	-	0.00	49	0	A	NM_144675		27840120	-1	tier1	-	no_errors	ENST00000447459	ensembl	human	known	74_37	missense	56.72	29	38	SNP	1.000	C
GSTP1	2950	genome.wustl.edu	37	11	67353972	67353972	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:67353972C>T	ENST00000398606.3	+	7	806	c.557C>T	c.(556-558)gCc>gTc	p.A186V	GSTP1_ENST00000398603.1_Missense_Mutation_p.A150V|GSTP1_ENST00000498765.1_3'UTR	NM_000852.3	NP_000843.1	P09211	GSTP1_HUMAN	glutathione S-transferase pi 1	186	GST C-terminal.			A -> P (in Ref. 2; CAA30894). {ECO:0000305}.	cellular response to lipopolysaccharide (GO:0071222)|central nervous system development (GO:0007417)|common myeloid progenitor cell proliferation (GO:0035726)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biosynthetic process (GO:0009890)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of leukocyte proliferation (GO:0070664)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|nitric oxide storage (GO:0035732)|positive regulation of superoxide anion generation (GO:0032930)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of stress-activated MAPK cascade (GO:0032872)|response to reactive oxygen species (GO:0000302)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|TRAF2-GSTP1 complex (GO:0097057)|vesicle (GO:0031982)	dinitrosyl-iron complex binding (GO:0035731)|glutathione transferase activity (GO:0004364)|JUN kinase binding (GO:0008432)|kinase regulator activity (GO:0019207)|nitric oxide binding (GO:0070026)|S-nitrosoglutathione binding (GO:0035730)			central_nervous_system(1)|cervix(1)|endometrium(4)|lung(2)|ovary(1)	9					Busulfan(DB01008)|Carboplatin(DB00958)|Chlorambucil(DB00291)|Cisplatin(DB00515)|Clomipramine(DB01242)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	CGCCTCAGTGCCCGGCCCAAG	0.622																																																	0													39.0	42.0	41.0					11																	67353972		2021	4165	6186	SO:0001583	missense	0			U12472	CCDS41679.1	11q13.2	2014-09-17	2008-07-18		ENSG00000084207	ENSG00000084207	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4638	protein-coding gene	gene with protein product		134660		FAEES3, GST3		1885604, 7587384, 19915149	Standard	NM_000852		Approved	GSTP	uc001omf.3	P09211	OTTHUMG00000137430	ENST00000398606.3:c.557C>T	11.37:g.67353972C>T	ENSP00000381607:p.Ala186Val		O00460|Q15690|Q5TZY3	Missense_Mutation	SNP	pfam_GST_C,pfam_Glutathione_S-Trfase_N,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_pi	p.A186V	ENST00000398606.3	37	c.557	CCDS41679.1	11	.	.	.	.	.	.	.	.	.	.	C	17.85	3.489574	0.64074	.	.	ENSG00000084207	ENST00000398606;ENST00000398603	T;T	0.02656	4.21;4.21	5.3	5.3	0.74995	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.147640	0.43579	D	0.000543	T	0.08447	0.0210	M	0.87758	2.905	0.38960	D	0.958531	B	0.32188	0.359	B	0.34180	0.177	T	0.02004	-1.1231	9	0.56958	D	0.05	-32.0327	14.4484	0.67367	0.0:1.0:0.0:0.0	.	186	P09211	GSTP1_HUMAN	V	186;150	ENSP00000381607:A186V;ENSP00000381604:A150V	ENSP00000381604:A150V	A	+	2	0	GSTP1	67110548	1.000000	0.71417	0.245000	0.24217	0.238000	0.25445	3.594000	0.54008	2.463000	0.83235	0.563000	0.77884	GCC	GSTP1	-	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	ENSG00000084207		0.622	GSTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTP1	HGNC	protein_coding	OTTHUMT00000268504.1		0.00	72	0	C	NM_000852		67353972	+1			no_errors	ENST00000398606	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.923	T
HAS3	3038	genome.wustl.edu	37	16	69147349	69147349	+	Silent	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:69147349C>T	ENST00000306560.1	+	3	798	c.642C>T	c.(640-642)tgC>tgT	p.C214C	HAS3_ENST00000219322.3_Silent_p.C214C|HAS3_ENST00000569188.1_Silent_p.C214C	NM_005329.2	NP_005320.2	O00219	HYAS3_HUMAN	hyaluronan synthase 3	214					carbohydrate metabolic process (GO:0005975)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of transcription, DNA-templated (GO:0045893)|small molecule metabolic process (GO:0044281)	hyaluranon cable (GO:0036117)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)	p.C214C(2)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(2)	16		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		TGCAGGTGTGCGACTCTGACA	0.612											OREG0023905	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					2	Substitution - coding silent(2)	large_intestine(2)											107.0	95.0	99.0					16																	69147349		2198	4300	6498	SO:0001819	synonymous_variant	0			BC021853	CCDS10870.1, CCDS10871.1	16q22.1	2013-02-22			ENSG00000103044	ENSG00000103044	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4820	protein-coding gene	gene with protein product		602428				9169154, 9083017	Standard	NM_005329		Approved		uc010cfh.3	O00219	OTTHUMG00000137562	ENST00000306560.1:c.642C>T	16.37:g.69147349C>T		1112	A8K5T5|Q8WTZ0|Q9NYP0	Silent	SNP	pfam_Chitin_synth_fng,pfam_Glyco_trans_2	p.C214	ENST00000306560.1	37	c.642	CCDS10871.1	16																																																																																			HAS3	-	pfam_Chitin_synth_fng,pfam_Glyco_trans_2	ENSG00000103044		0.612	HAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAS3	HGNC	protein_coding	OTTHUMT00000268898.2		0.00	40	0	C	NM_138612		69147349	+1			no_errors	ENST00000306560	ensembl	human	known	74_37	silent	7.69	36	3	SNP	0.987	T
HLA-F	3134	genome.wustl.edu	37	6	29691240	29691240	+	5'UTR	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:29691240C>T	ENST00000376861.1	+	0	384				HLA-F_ENST00000440587.2_5'UTR|HLA-F_ENST00000259951.7_5'UTR|HLA-F_ENST00000434407.2_5'Flank|HLA-F_ENST00000334668.4_5'UTR			P30511	HLAF_HUMAN	major histocompatibility complex, class I, F						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						AGGTTGGGGTCATGGCGCCCC	0.627																																																	0													44.0	56.0	52.0					6																	29691240		1462	2702	4164	SO:0001623	5_prime_UTR_variant	0			AY253269	CCDS43437.1, CCDS43438.1, CCDS43439.1	6p21.3	2013-01-11			ENSG00000204642	ENSG00000204642		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4963	protein-coding gene	gene with protein product		143110				1688605	Standard	NM_018950		Approved		uc003nno.4	P30511	OTTHUMG00000031156	ENST00000376861.1:c.-1C>T	6.37:g.29691240C>T			Q5JQI8|Q5JQJ1|Q5SPT5|Q860R0|Q8MGQ1|Q8WLP5|Q95HC0|Q9TP68	RNA	SNP	-	NULL	ENST00000376861.1	37	NULL	CCDS43438.1	6																																																																																			HLA-F	-	-	ENSG00000204642		0.627	HLA-F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-F	HGNC	protein_coding	OTTHUMT00000195083.1	-	0.00	107	0	C	NM_018950		29691240	+1	tier1	-	no_errors	ENST00000462777	ensembl	human	known	74_37	rna	32.46	77	37	SNP	0.022	T
HNRNPDL	9987	genome.wustl.edu	37	4	83347630	83347630	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr4:83347630T>A	ENST00000295470.5	-	6	1353	c.1178A>T	c.(1177-1179)tAt>tTt	p.Y393F	HNRNPDL_ENST00000349655.4_Intron|HNRNPDL_ENST00000502762.1_Missense_Mutation_p.Y393F|HNRNPDL_ENST00000602300.1_Missense_Mutation_p.Y274F|HNRNPDL_ENST00000514511.1_5'UTR	NM_001207000.1|NM_031372.3	NP_001193929.1|NP_112740.1	O14979	HNRDL_HUMAN	heterogeneous nuclear ribonucleoprotein D-like	393	Gly-rich.|Necessary for interaction with TNPO1.|Tyr-rich.				regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|single-stranded DNA binding (GO:0003697)										GTAGTCTGCATATCCCTGTCC	0.338																																																	0													108.0	105.0	106.0					4																	83347630		2203	4300	6503	SO:0001583	missense	0			D89092	CCDS3593.1, CCDS75153.1	4q21.22	2013-06-12		2013-06-12	ENSG00000152795	ENSG00000152795		"""RNA binding motif (RRM) containing"""	5037	protein-coding gene	gene with protein product		607137		HNRPDL		10072754, 9524220	Standard	NM_001207000		Approved	JKTBP, laAUF1	uc003hmr.3	O14979	OTTHUMG00000130299	ENST00000295470.5:c.1178A>T	4.37:g.83347630T>A	ENSP00000295470:p.Tyr393Phe		Q6SPF2|Q7KZ74|Q7KZ75|Q96IM0|Q96S43	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Y393F	ENST00000295470.5	37	c.1178	CCDS3593.1	4	.	.	.	.	.	.	.	.	.	.	t	14.23	2.474416	0.43942	.	.	ENSG00000152795	ENST00000295470;ENST00000502762	D;D	0.86432	-2.12;-2.12	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.92080	0.7490	M	0.78049	2.395	0.80722	D	1	P	0.52842	0.956	P	0.62184	0.899	D	0.90117	0.4196	10	0.19147	T	0.46	.	16.2104	0.82151	0.0:0.0:0.0:1.0	.	393	O14979	HNRDL_HUMAN	F	393	ENSP00000295470:Y393F;ENSP00000422040:Y393F	ENSP00000295470:Y393F	Y	-	2	0	HNRPDL	83566654	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.448000	0.66612	2.289000	0.77006	0.459000	0.35465	TAT	HNRNPDL	-	NULL	ENSG00000152795		0.338	HNRNPDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPDL	HGNC	protein_coding	OTTHUMT00000252644.1	-	0.00	64	0	T	NM_005463		83347630	-1	tier1	-	no_errors	ENST00000295470	ensembl	human	known	74_37	missense	27.87	44	17	SNP	1.000	A
HOXD10	3236	genome.wustl.edu	37	2	176982185	176982185	+	Silent	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:176982185G>A	ENST00000249501.4	+	1	879	c.624G>A	c.(622-624)caG>caA	p.Q208Q	HOXD10_ENST00000490088.2_Intron	NM_002148.3	NP_002139.2	P28358	HXD10_HUMAN	homeobox D10	208					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|neuromuscular process (GO:0050905)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		TGAGCGGCCAGGAGCCCACCA	0.652																																																	0													23.0	28.0	26.0					2																	176982185		2193	4275	6468	SO:0001819	synonymous_variant	0				CCDS2266.1	2q31.1	2014-09-17	2005-12-22		ENSG00000128710	ENSG00000128710		"""Homeoboxes / ANTP class : HOXL subclass"""	5133	protein-coding gene	gene with protein product		142984	"""homeo box D10"""	HOX4, HOX4D		1973146, 1358459	Standard	NM_002148		Approved		uc002ukj.3	P28358	OTTHUMG00000132511	ENST00000249501.4:c.624G>A	2.37:g.176982185G>A			Q6NT10	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,prints_Homeobox_metazoa,pfscan_Homeobox_dom	p.Q208	ENST00000249501.4	37	c.624	CCDS2266.1	2																																																																																			HOXD10	-	NULL	ENSG00000128710		0.652	HOXD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXD10	HGNC	protein_coding	OTTHUMT00000255692.2	-	0.00	117	0	G			176982185	+1	tier1	-	no_errors	ENST00000249501	ensembl	human	known	74_37	silent	38.26	71	44	SNP	1.000	A
HS6ST3	266722	genome.wustl.edu	37	13	96743467	96743467	+	Silent	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr13:96743467C>T	ENST00000376705.2	+	1	375	c.351C>T	c.(349-351)aaC>aaT	p.N117N		NM_153456.3	NP_703157.2	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	117					heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)	integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					CCCCGGAAAACGGCTCCCTGC	0.677																																																	0													18.0	19.0	18.0					13																	96743467		2191	4281	6472	SO:0001819	synonymous_variant	0			AF539426	CCDS9481.1	13q32.2	2007-12-04			ENSG00000185352	ENSG00000185352		"""Sulfotransferases, membrane-bound"""	19134	protein-coding gene	gene with protein product		609401					Standard	NM_153456		Approved		uc001vmw.4	Q8IZP7	OTTHUMG00000017232	ENST00000376705.2:c.351C>T	13.37:g.96743467C>T			Q5W0L0|Q68CW6	Silent	SNP	pfam_Sulfotransferase,superfamily_P-loop_NTPase	p.N117	ENST00000376705.2	37	c.351	CCDS9481.1	13																																																																																			HS6ST3	-	NULL	ENSG00000185352		0.677	HS6ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS6ST3	HGNC	protein_coding	OTTHUMT00000045517.2		0.00	71	0	C	NM_153456		96743467	+1			no_errors	ENST00000376705	ensembl	human	known	74_37	silent	5.48	69	4	SNP	0.962	T
HSD17B12	51144	genome.wustl.edu	37	11	43859885	43859885	+	Silent	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:43859885G>A	ENST00000278353.4	+	8	674	c.555G>A	c.(553-555)ctG>ctA	p.L185L	RP11-613D13.5_ENST00000530450.1_RNA	NM_016142.2	NP_057226.1	Q53GQ0	DHB12_HUMAN	hydroxysteroid (17-beta) dehydrogenase 12	185					cellular lipid metabolic process (GO:0044255)|estrogen biosynthetic process (GO:0006703)|extracellular matrix organization (GO:0030198)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cell-substrate adhesion (GO:0010811)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|heparin binding (GO:0008201)			endometrium(2)|large_intestine(4)|lung(4)	10						GGGCTATTCTGAACATTTCAT	0.363																																					Ovarian(58;548 1143 13948 16572 34258)												0													145.0	135.0	138.0					11																	43859885		2203	4300	6503	SO:0001819	synonymous_variant	0			AF078850	CCDS7905.1	11q11	2011-09-20				ENSG00000149084	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	18646	protein-coding gene	gene with protein product	"""3-ketoacyl-CoA reductase"", ""short chain dehydrogenase/reductase family 12C, member 1"""	609574				12482854, 19027726	Standard	NM_016142		Approved	KAR, SDR12C1	uc001mxq.4	Q53GQ0		ENST00000278353.4:c.555G>A	11.37:g.43859885G>A			A8K9B0|D3DR23|Q96EA9|Q96JU2|Q9Y6G8	Silent	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.L185	ENST00000278353.4	37	c.555	CCDS7905.1	11																																																																																			HSD17B12	-	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	ENSG00000149084		0.363	HSD17B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B12	HGNC	protein_coding	OTTHUMT00000389594.1	-	0.00	78	0	G			43859885	+1	tier1	-	no_errors	ENST00000278353	ensembl	human	known	74_37	silent	25.40	47	16	SNP	1.000	A
HTR1F	3355	genome.wustl.edu	37	3	88039960	88039960	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:88039960C>G	ENST00000319595.4	+	1	115	c.61C>G	c.(61-63)Cca>Gca	p.P21A		NM_000866.3	NP_000857.1	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled	21					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)	p.P21S(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Ketamine(DB01221)|Methysergide(DB00247)|Mianserin(DB06148)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	AAACAGAATGCCATCCAAAAT	0.388																																																	1	Substitution - Missense(1)	large_intestine(1)											127.0	126.0	126.0					3																	88039960		2203	4300	6503	SO:0001583	missense	0			L05597	CCDS2920.1	3p12	2012-08-08	2012-02-03		ENSG00000179097	ENSG00000179097		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5292	protein-coding gene	gene with protein product		182134	"""5-hydroxytryptamine (serotonin) receptor 1F"""			8384716, 8380639	Standard	NM_000866		Approved	HTR1EL, 5-HT1F	uc003dqr.2	P30939	OTTHUMG00000159008	ENST00000319595.4:c.61C>G	3.37:g.88039960C>G	ENSP00000322924:p.Pro21Ala			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_5HT1F_rcpt,prints_GPCR_Rhodpsn,prints_5HT_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.P21A	ENST00000319595.4	37	c.61	CCDS2920.1	3	.	.	.	.	.	.	.	.	.	.	C	8.555	0.876370	0.17395	.	.	ENSG00000179097	ENST00000319595	T	0.38887	1.11	5.74	4.81	0.61882	.	0.207171	0.41823	D	0.000814	T	0.21962	0.0529	N	0.08118	0	0.30013	N	0.814996	B	0.20368	0.044	B	0.21708	0.036	T	0.10706	-1.0618	10	0.17369	T	0.5	.	11.1044	0.48194	0.2938:0.7061:0.0:0.0	.	21	P30939	5HT1F_HUMAN	A	21	ENSP00000322924:P21A	ENSP00000322924:P21A	P	+	1	0	HTR1F	88122650	1.000000	0.71417	1.000000	0.80357	0.464000	0.32679	4.121000	0.57904	2.714000	0.92807	0.585000	0.79938	CCA	HTR1F	-	prints_5HT1F_rcpt	ENSG00000179097		0.388	HTR1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1F	HGNC	protein_coding	OTTHUMT00000352890.1	-	0.00	85	0	C	NM_000866		88039960	+1	tier1	-	no_errors	ENST00000319595	ensembl	human	known	74_37	missense	14.19	127	21	SNP	1.000	G
HYDIN	54768	genome.wustl.edu	37	16	70942309	70942309	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:70942309C>T	ENST00000393567.2	-	49	8392	c.8242G>A	c.(8242-8244)Gcc>Acc	p.A2748T		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2748					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TCGCCATTGGCTGGCACGATC	0.498																																																	0													5.0	5.0	5.0					16																	70942309		1740	3933	5673	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.8242G>A	16.37:g.70942309C>T	ENSP00000377197:p.Ala2748Thr		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_PapD-like	p.A2748T	ENST00000393567.2	37	c.8242	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	18.68	3.675057	0.67928	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01369	4.97	5.39	3.38	0.38709	.	0.253773	0.19280	U	0.118196	T	0.05410	0.0143	M	0.72894	2.215	0.80722	D	1	D	0.53151	0.958	P	0.55161	0.77	T	0.42120	-0.9470	10	0.34782	T	0.22	.	15.2163	0.73270	0.0:0.7234:0.2766:0.0	.	2747	F8WD23	.	T	2748;2747	ENSP00000377197:A2748T	ENSP00000313052:A2747T	A	-	1	0	HYDIN	69499810	0.997000	0.39634	0.972000	0.41901	0.585000	0.36419	1.849000	0.39318	0.616000	0.30141	-0.241000	0.12123	GCC	HYDIN	-	NULL	ENSG00000157423		0.498	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	-	0.00	69	0	C			70942309	-1	tier1	-	no_errors	ENST00000393567	ensembl	human	putative	74_37	missense	32.79	41	20	SNP	0.985	T
SMC4	10051	genome.wustl.edu	37	3	160117253	160117253	+	5'UTR	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:160117253C>T	ENST00000357388.3	+	0	162				IFT80_ENST00000477495.1_5'Flank|RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000462787.1_5'Flank|SMC4_ENST00000469762.1_5'Flank|SMC4_ENST00000344722.5_5'Flank|SMC4_ENST00000360111.2_5'Flank|IFT80_ENST00000496589.1_5'Flank|IFT80_ENST00000326448.7_5'UTR	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4						kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AAAAGAATCCCTCGCTCTTCC	0.438																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.-290C>T	3.37:g.160117253C>T			A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	RNA	SNP	-	NULL	ENST00000357388.3	37	NULL	CCDS3189.1	3																																																																																			IFT80	-	-	ENSG00000068885		0.438	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT80	HGNC	protein_coding	OTTHUMT00000352862.1	-	0.00	62	0	C			160117253	-1	tier1	-	no_errors	ENST00000498145	ensembl	human	known	74_37	rna	8.18	101	9	SNP	0.001	T
IGFBP3	3486	genome.wustl.edu	37	7	45956987	45956987	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr7:45956987G>A	ENST00000275521.6	-	2	588	c.455C>T	c.(454-456)cCg>cTg	p.P152L	IGFBP3_ENST00000465642.1_5'UTR|IGFBP3_ENST00000381083.4_Missense_Mutation_p.P158L|IGFBP3_ENST00000381086.5_Missense_Mutation_p.P55L	NM_000598.4|NM_001013398.1	NP_000589.2|NP_001013416.1	P17936	IBP3_HUMAN	insulin-like growth factor binding protein 3	152	Ser/Thr-rich.				apoptotic process (GO:0006915)|cellular protein metabolic process (GO:0044267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoblast differentiation (GO:0001649)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of myoblast differentiation (GO:0045663)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|insulin-like growth factor binding protein complex (GO:0016942)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activator activity (GO:0008160)			large_intestine(6)|lung(7)|pancreas(1)|prostate(3)	17					Mecasermin(DB01277)	GGAGACGGACGGGCTCTCCAC	0.527											OREG0018049	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													70.0	68.0	68.0					7																	45956987		2203	4300	6503	SO:0001583	missense	0				CCDS5505.1, CCDS34632.1	7p12.3	2014-09-17			ENSG00000146674	ENSG00000146674			5472	protein-coding gene	gene with protein product	"""growth hormone-dependent binding protein"", ""acid stable subunit of the 140 K IGF complex"", ""binding protein 53"", ""binding protein 29"", ""IGF-binding protein 3"""	146732				1695633	Standard	NM_000598		Approved	IBP3, BP-53	uc003tnr.3	P17936	OTTHUMG00000023769	ENST00000275521.6:c.455C>T	7.37:g.45956987G>A	ENSP00000275521:p.Pro152Leu	935	A4D2F5|D3DVM0|Q2V509|Q6P1M6|Q9UCL4	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_IGFBP-like,superfamily_Thyroglobulin_1,superfamily_Growth_fac_rcpt_N_dom,smart_IGFBP-like,smart_Thyroglobulin_1,prints_IGFBP_1-6_chordata,prints_IGFBP-3,pfscan_Thyroglobulin_1	p.P158L	ENST00000275521.6	37	c.473	CCDS5505.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.767|8.767	0.925103|0.925103	0.18056|0.18056	.|.	.|.	ENSG00000146674|ENSG00000146674	ENST00000545032;ENST00000275521;ENST00000381086;ENST00000438491;ENST00000442142;ENST00000381083;ENST00000433047;ENST00000448817|ENST00000428530	T;T;T;T|.	0.25085|.	2.43;1.82;2.43;1.82|.	5.55|5.55	0.4|0.4	0.16331|0.16331	.|.	5.133940|.	0.00166|.	N|.	0.000003|.	T|T	0.09158|0.09158	0.0226|0.0226	N|N	0.02539|0.02539	-0.55|-0.55	0.09310|0.09310	N|N	1|1	B;B;B|.	0.10296|.	0.001;0.002;0.003|.	B;B;B|.	0.06405|.	0.001;0.002;0.002|.	T|T	0.30707|0.30707	-0.9969|-0.9969	10|5	0.33141|.	T|.	0.24|.	-12.1522|-12.1522	3.0464|3.0464	0.06155|0.06155	0.1296:0.081:0.3944:0.395|0.1296:0.081:0.3944:0.395	.|.	55;152;137|.	B3KWK7;P17936;B4DN53|.	.;IBP3_HUMAN;.|.	L|C	129;152;55;138;50;158;124;42|4	ENSP00000275521:P152L;ENSP00000370476:P55L;ENSP00000370473:P158L;ENSP00000389668:P42L|.	ENSP00000275521:P152L|.	P|R	-|-	2|1	0|0	IGFBP3|IGFBP3	45923512|45923512	0.707000|0.707000	0.27866|0.27866	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	0.657000|0.657000	0.24963|0.24963	-0.200000|-0.200000	0.10300|0.10300	-1.268000|-1.268000	0.01426|0.01426	CCG|CGT	IGFBP3	-	NULL	ENSG00000146674		0.527	IGFBP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGFBP3	HGNC	protein_coding	OTTHUMT00000251356.3	-	0.00	48	0	G	NM_001013398		45956987	-1	tier1	-	no_errors	ENST00000381083	ensembl	human	known	74_37	missense	20.93	34	9	SNP	0.003	A
INCENP	3619	genome.wustl.edu	37	11	61897831	61897831	+	Silent	SNP	C	C	A	rs571110517		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:61897831C>A	ENST00000394818.3	+	4	1034	c.832C>A	c.(832-834)Cgg>Agg	p.R278R	INCENP_ENST00000278849.4_Silent_p.R278R	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	278					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						TTCTCCATGGCGGGAGCGGGT	0.677																																																	0													59.0	62.0	61.0					11																	61897831		2202	4299	6501	SO:0001819	synonymous_variant	0			AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.832C>A	11.37:g.61897831C>A			A8MQD2|Q5Y192	Silent	SNP	pfam_INCENP_N,pfam_Inner_centromere_prot_ARK-bd	p.R278	ENST00000394818.3	37	c.832	CCDS44624.1	11																																																																																			INCENP	-	NULL	ENSG00000149503		0.677	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INCENP	HGNC	protein_coding	OTTHUMT00000394723.2	-	0.00	89	0	C	NM_020238		61897831	+1	tier1	-	no_errors	ENST00000394818	ensembl	human	known	74_37	silent	28.92	59	24	SNP	0.064	A
ITGAM	3684	genome.wustl.edu	37	16	31341216	31341216	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:31341216C>T	ENST00000287497.8	+	25	3041	c.2966C>T	c.(2965-2967)aCc>aTc	p.T989I	ITGAM_ENST00000544665.3_Missense_Mutation_p.T990I			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	989					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						CCCCAGGTCACCTTCTCCGAG	0.632																																																	0													29.0	34.0	33.0					16																	31341216		1997	4138	6135	SO:0001583	missense	0			J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.2966C>T	16.37:g.31341216C>T	ENSP00000287497:p.Thr989Ile		Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.T990I	ENST00000287497.8	37	c.2969	CCDS45470.1	16	.	.	.	.	.	.	.	.	.	.	C	5.113	0.206453	0.09704	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.23552	1.9;1.9	5.06	-5.18	0.02840	Integrin alpha-2 (1);	.	.	.	.	T	0.11623	0.0283	N	0.25144	0.715	0.09310	N	1	B;B	0.11235	0.004;0.004	B;B	0.11329	0.006;0.006	T	0.33033	-0.9884	9	0.21540	T	0.41	.	2.9961	0.05998	0.1158:0.2452:0.115:0.524	.	989;989	Q4VAK1;P11215	.;ITAM_HUMAN	I	990;989	ENSP00000441691:T990I;ENSP00000287497:T989I	ENSP00000287497:T989I	T	+	2	0	ITGAM	31248717	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-1.046000	0.03525	-0.789000	0.04498	0.557000	0.71058	ACC	ITGAM	-	pfam_Integrin_alpha-2	ENSG00000169896		0.632	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAM	HGNC	protein_coding	OTTHUMT00000432816.1	-	0.00	16	0	C	NM_000632		31341216	+1	tier1	-	no_errors	ENST00000544665	ensembl	human	known	74_37	missense	41.18	10	7	SNP	0.000	T
ITGB1	3688	genome.wustl.edu	37	10	33214829	33214829	+	Silent	SNP	G	G	A	rs12261912	byFrequency	TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr10:33214829G>A	ENST00000396033.2	-	6	891	c.756C>T	c.(754-756)ttC>ttT	p.F252F	ITGB1_ENST00000423113.1_Silent_p.F252F|ITGB1_ENST00000302278.3_Silent_p.F252F|ITGB1_ENST00000374956.4_Silent_p.F252F|ITGB1_ENST00000484088.1_5'Flank	NM_133376.2	NP_596867.1	P05556	ITB1_HUMAN	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	252	VWFA.				axon extension (GO:0048675)|axon guidance (GO:0007411)|B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cardiac muscle cell differentiation (GO:0055007)|cell fate specification (GO:0001708)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|formation of radial glial scaffolds (GO:0021943)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell migration (GO:0008354)|heterotypic cell-cell adhesion (GO:0034113)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|maternal process involved in female pregnancy (GO:0060135)|mesodermal cell differentiation (GO:0048333)|negative regulation of anoikis (GO:2000811)|negative regulation of cell projection organization (GO:0031345)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein transport within lipid bilayer (GO:0032594)|regulation of cell cycle (GO:0051726)|regulation of collagen catabolic process (GO:0010710)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of immune response (GO:0050776)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|response to transforming growth factor beta (GO:0071559)|sarcomere organization (GO:0045214)|tight junction assembly (GO:0070830)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha1-beta1 complex (GO:0034665)|integrin alpha10-beta1 complex (GO:0034680)|integrin alpha11-beta1 complex (GO:0034681)|integrin alpha2-beta1 complex (GO:0034666)|integrin alpha3-beta1 complex (GO:0034667)|integrin alpha7-beta1 complex (GO:0034677)|integrin alpha8-beta1 complex (GO:0034678)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|intercalated disc (GO:0014704)|invadopodium membrane (GO:0071438)|membrane (GO:0016020)|membrane raft (GO:0045121)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|cell adhesion molecule binding (GO:0050839)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|peptide binding (GO:0042277)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|virus receptor activity (GO:0001618)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Ovarian(717;1.34e-05)|Breast(68;0.0634)			Antithymocyte globulin(DB00098)	TGATGGCATCGAAACCACCTT	0.363													g|||	2	0.000399361	0.0	0.0	5008	,	,		18811	0.0		0.0	False		,,,				2504	0.002																0								G	,,	0,4406		0,0,2203	111.0	103.0	106.0		756,756,756	3.4	1.0	10	dbSNP_120	106	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	ITGB1	NM_002211.3,NM_033668.2,NM_133376.2	,,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,,	252/799,252/802,252/799	33214829	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			BC020057	CCDS7174.1	10p11.2	2010-10-13			ENSG00000150093	ENSG00000150093		"""CD molecules"", ""Integrins"""	6153	protein-coding gene	gene with protein product		135630		FNRB, MSK12, MDF2		2524991	Standard	NM_033668		Approved	CD29, GPIIA	uc001iwt.4	P05556	OTTHUMG00000017928	ENST00000396033.2:c.756C>T	10.37:g.33214829G>A			A8K6N2|D3DRX9|D3DRY3|D3DRY4|D3DRY5|P78466|P78467|Q13089|Q13090|Q13091|Q13212|Q14622|Q14647|Q29RW2|Q7Z3V1|Q8WUM6	Silent	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_tail,pfam_Integrin_bsu_cyt_dom,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	p.F252	ENST00000396033.2	37	c.756	CCDS7174.1	10																																																																																			ITGB1	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N,prints_Integrin_bsu	ENSG00000150093		0.363	ITGB1-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGB1	HGNC	protein_coding	OTTHUMT00000047496.1	-	0.00	80	0	G	NM_002211		33214829	-1	tier1	rs12261912	no_errors	ENST00000374956	ensembl	human	known	74_37	silent	20.47	101	26	SNP	1.000	A
KDM1B	221656	genome.wustl.edu	37	6	18215271	18215271	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:18215271G>T	ENST00000297792.5	+	16	1624	c.1447G>T	c.(1447-1449)Ggg>Tgg	p.G483W	KDM1B_ENST00000546309.2_Missense_Mutation_p.G6W|KDM1B_ENST00000397244.1_Missense_Mutation_p.G484W|KDM1B_ENST00000388870.2_Missense_Mutation_p.G716W			Q8NB78	KDM1B_HUMAN	lysine (K)-specific demethylase 1B	715					DNA methylation involved in gamete generation (GO:0043046)|histone H3-K4 demethylation (GO:0034720)|multicellular organismal development (GO:0007275)|regulation of DNA methylation (GO:0044030)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-monomethyl-K4 specific) (GO:0034649)|oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|large_intestine(6)|lung(8)|skin(3)|upper_aerodigestive_tract(1)	25						TGTGATTGCCGGGGAGGCTGT	0.567																																																	0													77.0	73.0	74.0					6																	18215271		2203	4300	6503	SO:0001583	missense	0			AK125318	CCDS34343.1	6p22.3	2011-07-01	2009-09-29	2009-09-29	ENSG00000165097	ENSG00000165097		"""Chromatin-modifying enzymes / K-demethylases"""	21577	protein-coding gene	gene with protein product		613081	"""amine oxidase, flavin containing 1"", ""chromosome 6 open reading frame 193"", ""amine oxidase (flavin containing) domain 1"""	C6orf193, AOF1		19407342, 19727073	Standard	NM_153042		Approved	FLJ34109, FLJ33898, dJ298J15.2, bA204B7.3, FLJ43328, LSD2	uc003ncn.1	Q8NB78	OTTHUMG00000014316	ENST00000297792.5:c.1447G>T	6.37:g.18215271G>T	ENSP00000297792:p.Gly483Trp		A2A2C5|A2A2C6|Q5TGV3|Q6AI15|Q6ZUU4|Q8N258|Q96EL7	Missense_Mutation	SNP	pfam_Amino_oxidase,pfam_Znf_CW,pfam_FAD-dep_OxRdtase,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_SWIRM,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_mOase_FAD-bd,pfam_CHP00275_HI0933-like,pfam_FAD_bind_dom,superfamily_Homeodomain-like,pfscan_SWIRM,pfscan_Znf_CW	p.G716W	ENST00000297792.5	37	c.2146	CCDS34343.1	6	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281140	0.80692	.	.	ENSG00000165097	ENST00000546309;ENST00000388870;ENST00000397244;ENST00000297792;ENST00000388869	D;D;D;D	0.94537	-3.45;-3.45;-3.45;-3.45	5.99	5.99	0.97316	Amine oxidase (1);	0.000000	0.85682	D	0.000000	D	0.98267	0.9426	H	0.94658	3.565	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98563	1.0642	10	0.87932	D	0	-2.9655	20.4753	0.99175	0.0:0.0:1.0:0.0	.	532;715;483	A2A2C4;Q8NB78;A2A2C6	.;KDM1B_HUMAN;.	W	6;716;484;483;713	ENSP00000442670:G6W;ENSP00000373522:G716W;ENSP00000380419:G484W;ENSP00000297792:G483W	ENSP00000297792:G483W	G	+	1	0	KDM1B	18323250	1.000000	0.71417	0.633000	0.29310	0.473000	0.32948	9.830000	0.99415	2.844000	0.97970	0.650000	0.86243	GGG	KDM1B	-	pfam_Amino_oxidase	ENSG00000165097		0.567	KDM1B-002	KNOWN	basic|CCDS	protein_coding	KDM1B	HGNC	protein_coding	OTTHUMT00000277080.1	-	0.00	37	0	G	NM_153042		18215271	+1	tier1	-	no_errors	ENST00000388870	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
KIAA0319	9856	genome.wustl.edu	37	6	24564464	24564464	+	Silent	SNP	C	C	T	rs571054596		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:24564464C>T	ENST00000378214.3	-	15	2921	c.2397G>A	c.(2395-2397)tcG>tcA	p.S799S	KIAA0319_ENST00000537886.1_Silent_p.S799S|KIAA0319_ENST00000543707.1_Silent_p.S799S|KIAA0319_ENST00000430948.2_Silent_p.S754S|KIAA0319_ENST00000535378.1_Silent_p.S790S	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	799	PKD 5. {ECO:0000255|PROSITE- ProRule:PRU00151}.				negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						TGTCTGTGTCCGAGGCCCCCT	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		18545	0.0		0.0	False		,,,				2504	0.001																0													87.0	71.0	76.0					6																	24564464		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.2397G>A	6.37:g.24564464C>T			A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Silent	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_MANSC_N,smart_Fibronectin_type3,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.S799	ENST00000378214.3	37	c.2397	CCDS34348.1	6																																																																																			KIAA0319	-	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_Fibronectin_type3,smart_PKD/Chitinase_dom	ENSG00000137261		0.597	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319	HGNC	protein_coding	OTTHUMT00000040009.1	-	0.00	70	0	C	NM_014809		24564464	-1	tier1	-	no_errors	ENST00000378214	ensembl	human	known	74_37	silent	41.05	56	39	SNP	0.099	T
KIAA1614	57710	genome.wustl.edu	37	1	180904863	180904863	+	Silent	SNP	G	G	A	rs377007881		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:180904863G>A	ENST00000367588.4	+	5	1873	c.1818G>A	c.(1816-1818)gcG>gcA	p.A606A	KIAA1614_ENST00000367587.1_Silent_p.A227A	NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	606										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						TGTGCCCTGCGGAGGTGGACT	0.652																																																	0										2,4346		0,2,2172	26.0	31.0	29.0		1818	-1.3	0.0	1		29	0,8512		0,0,4256	no	coding-synonymous	KIAA1614	NM_020950.1		0,2,6428	AA,AG,GG		0.0,0.046,0.0156		606/1191	180904863	2,12858	2174	4256	6430	SO:0001819	synonymous_variant	0			AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.1818G>A	1.37:g.180904863G>A			Q5VZ45|Q9HCF8	Silent	SNP	NULL	p.A606	ENST00000367588.4	37	c.1818	CCDS41442.1	1																																																																																			KIAA1614	-	NULL	ENSG00000135835		0.652	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1614	HGNC	protein_coding	OTTHUMT00000085151.1	-	0.00	48	0	G	XM_046531		180904863	+1	tier1	-	no_errors	ENST00000367588	ensembl	human	known	74_37	silent	14.04	49	8	SNP	0.188	A
KIF3C	3797	genome.wustl.edu	37	2	26203716	26203716	+	Silent	SNP	G	G	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:26203716G>C	ENST00000264712.3	-	1	1650	c.1071C>G	c.(1069-1071)cgC>cgG	p.R357R	KIF3C_ENST00000405914.1_Silent_p.R357R	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	357	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTTGGCAAAGCGCAAGGTGG	0.592																																																	0													90.0	82.0	85.0					2																	26203716		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.1071C>G	2.37:g.26203716G>C			O43544|Q4ZG18|Q53SX5|Q562F7	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R357	ENST00000264712.3	37	c.1071	CCDS1719.1	2																																																																																			KIF3C	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom	ENSG00000084731		0.592	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF3C	HGNC	protein_coding	OTTHUMT00000211611.1	-	0.00	94	0	G			26203716	-1	tier1	-	no_errors	ENST00000264712	ensembl	human	known	74_37	silent	6.40	117	8	SNP	1.000	C
KLF6	1316	genome.wustl.edu	37	10	3824010	3824010	+	Missense_Mutation	SNP	C	C	G	rs201647969	byFrequency	TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr10:3824010C>G	ENST00000497571.1	-	2	759	c.499G>C	c.(499-501)Ggg>Cgg	p.G167R	KLF6_ENST00000173785.4_5'UTR|KLF6_ENST00000542957.1_Missense_Mutation_p.G167R|KLF6_ENST00000469435.1_Missense_Mutation_p.G167R	NM_001160124.1|NM_001300.5	NP_001153596.1|NP_001291.3	Q99612	KLF6_HUMAN	Kruppel-like factor 6	167					B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				Colorectal(1;0.238)		GGCAGCTCCCCGGGCACGCAA	0.632											OREG0019980	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													65.0	64.0	64.0					10																	3824010		2203	4300	6503	SO:0001583	missense	0			U51869	CCDS7060.1, CCDS53490.1	10p15	2013-01-08	2004-11-29	2004-12-01	ENSG00000067082	ENSG00000067082		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	2235	protein-coding gene	gene with protein product	"""GC-rich binding factor"""	602053	"""core promoter element binding protein"""	BCD1, ST12, COPEB		9503030, 9685731	Standard	NM_001300		Approved	CPBP, GBF, Zf9, PAC1	uc001iha.3	Q99612	OTTHUMG00000017567	ENST00000497571.1:c.499G>C	10.37:g.3824010C>G	ENSP00000419923:p.Gly167Arg	614	B2RE86|B4DDN0|D3DRR1|F5H3M5|Q5VUT7|Q5VUT8|Q9BT79	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G167R	ENST00000497571.1	37	c.499	CCDS7060.1	10	.	.	.	.	.	.	.	.	.	.	C	13.94	2.385836	0.42308	.	.	ENSG00000067082	ENST00000497571;ENST00000542957;ENST00000469435	T;T;T	0.53423	3.75;0.62;0.84	4.99	4.99	0.66335	.	0.166626	0.53938	D	0.000044	T	0.56093	0.1962	L	0.46157	1.445	0.33605	D	0.602839	P;D;D;P	0.61697	0.834;0.99;0.988;0.933	B;P;P;P	0.61328	0.273;0.887;0.706;0.447	T	0.67321	-0.5700	10	0.51188	T	0.08	.	10.8444	0.46735	0.0:0.9139:0.0:0.0861	.	167;167;167;167	D3GC14;F5H3M5;Q99612-2;Q99612	.;.;.;KLF6_HUMAN	R	167	ENSP00000419923:G167R;ENSP00000445301:G167R;ENSP00000419079:G167R	ENSP00000419079:G167R	G	-	1	0	KLF6	3814010	0.044000	0.20184	0.360000	0.25837	0.255000	0.26057	0.568000	0.23623	2.309000	0.77851	0.561000	0.74099	GGG	KLF6	-	NULL	ENSG00000067082		0.632	KLF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF6	HGNC	protein_coding	OTTHUMT00000046495.1		0.00	47	0	C			3824010	-1			no_errors	ENST00000497571	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.593	G
KLK9	284366	genome.wustl.edu	37	19	51506391	51506391	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr19:51506391C>G	ENST00000594211.1	-	5	729	c.729G>C	c.(727-729)tgG>tgC	p.W243C	KLK9_ENST00000376832.4_Missense_Mutation_p.W243C|KLK8_ENST00000391806.2_5'Flank|KLK8_ENST00000593490.1_5'Flank|CTB-147C22.9_ENST00000594512.1_RNA|KLK8_ENST00000600767.1_5'Flank|KLK9_ENST00000250366.6_Missense_Mutation_p.W243C|KLK8_ENST00000320838.5_5'Flank|KLK8_ENST00000347619.4_5'Flank|KLK8_ENST00000291726.7_5'Flank			Q9UKQ9	KLK9_HUMAN	kallikrein-related peptidase 9	243	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7		all_neural(266;0.0652)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		TTTCTTGGATCCAGTCAAGGT	0.642																																																	0													113.0	119.0	117.0					19																	51506391		2203	4300	6503	SO:0001583	missense	0			AF135026	CCDS12816.1	19q13.33	2008-02-05	2006-10-27					"""Kallikreins"""	6370	protein-coding gene	gene with protein product		605504	"""kallikrein 9"""			16800724, 16800723	Standard	NM_012315		Approved	KLK-L3	uc002pux.1	Q9UKQ9		ENST00000594211.1:c.729G>C	19.37:g.51506391C>G	ENSP00000469417:p.Trp243Cys		Q6QA55	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.W243C	ENST00000594211.1	37	c.729	CCDS12816.1	19	.	.	.	.	.	.	.	.	.	.	C	14.71	2.616544	0.46736	.	.	ENSG00000213022	ENST00000376832;ENST00000250366	D;D	0.99121	-5.45;-5.45	4.23	4.23	0.50019	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.99573	0.9846	H	0.98487	4.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97549	1.0091	9	0.87932	D	0	.	14.5296	0.67915	0.0:1.0:0.0:0.0	.	243;243	Q2XQG6;Q9UKQ9	.;KLK9_HUMAN	C	243	ENSP00000366028:W243C;ENSP00000250366:W243C	ENSP00000250366:W243C	W	-	3	0	KLK9	56198203	1.000000	0.71417	0.998000	0.56505	0.146000	0.21551	5.577000	0.67444	2.358000	0.79984	0.556000	0.70494	TGG	KLK9	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000269741		0.642	KLK9-002	NOVEL	basic|appris_principal|CCDS	protein_coding	KLK9	Uniprot_gn	protein_coding	OTTHUMT00000465226.1	-	0.00	100	0	C	NM_012315		51506391	-1	tier1	-	no_errors	ENST00000250366	ensembl	human	known	74_37	missense	21.95	63	18	SNP	1.000	G
KLRF1	51348	genome.wustl.edu	37	12	9994939	9994939	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr12:9994939T>G	ENST00000279544.3	+	5	561	c.497T>G	c.(496-498)cTa>cGa	p.L166R	KLRF1_ENST00000324214.4_Missense_Mutation_p.L116R|KLRF1_ENST00000354855.3_Intron|KLRF1_ENST00000537723.1_Intron	NM_016523.1	NP_057607	Q9NZS2	KLRF1_HUMAN	killer cell lectin-like receptor subfamily F, member 1	166	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|MHC class I receptor activity (GO:0032393)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)	13						CAGAAAAACCTAAGACAATTA	0.338																																																	0													123.0	116.0	118.0					12																	9994939		1837	4086	5923	SO:0001583	missense	0			AF175206	CCDS41750.1	12p13.31	2011-08-30			ENSG00000150045	ENSG00000150045		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	13342	protein-coding gene	gene with protein product		605029				10671213	Standard	NM_001291823		Approved	CLEC5C, NKp80	uc021qux.1	Q9NZS2		ENST00000279544.3:c.497T>G	12.37:g.9994939T>G	ENSP00000279544:p.Leu166Arg		Q4KMT5|Q96PR2|Q96PR3|Q9NZS1	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.L166R	ENST00000279544.3	37	c.497	CCDS41750.1	12	.	.	.	.	.	.	.	.	.	.	T	0.006	-2.046671	0.00398	.	.	ENSG00000150045	ENST00000324214;ENST00000279544	T;T	0.21191	2.02;2.02	3.09	3.09	0.35607	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.327393	0.17222	N	0.182288	T	0.40839	0.1133	M	0.71036	2.16	0.25463	N	0.987897	B;D	0.76494	0.139;0.999	B;D	0.83275	0.06;0.996	T	0.06716	-1.0811	9	.	.	.	.	7.9772	0.30161	0.0:0.0:0.0:1.0	.	166;116	Q9NZS2;Q9NZS2-2	KLRF1_HUMAN;.	R	116;166	ENSP00000322487:L116R;ENSP00000279544:L166R	.	L	+	2	0	KLRF1	9886206	0.000000	0.05858	0.081000	0.20488	0.021000	0.10359	0.265000	0.18515	1.675000	0.50919	0.454000	0.30748	CTA	KLRF1	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000150045		0.338	KLRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRF1	HGNC	protein_coding	OTTHUMT00000399535.1	-	0.00	78	0	T	NM_016523		9994939	+1	tier1	-	no_errors	ENST00000279544	ensembl	human	known	74_37	missense	24.69	61	20	SNP	0.139	G
KRR1	11103	genome.wustl.edu	37	12	75897754	75897754	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr12:75897754C>A	ENST00000229214.4	-	7	784	c.761G>T	c.(760-762)cGc>cTc	p.R254L	KRR1_ENST00000438169.2_Intron	NM_007043.6	NP_008974.5	Q13601	KRR1_HUMAN	KRR1, small subunit (SSU) processome component, homolog (yeast)	254	Lys-rich.				rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	11						TGGTTCCTTGCGTTTATTCAC	0.353																																																	0													215.0	199.0	204.0					12																	75897754		2203	4300	6503	SO:0001583	missense	0			U55766	CCDS9012.1	12q	2011-03-15	2006-05-18	2006-05-18	ENSG00000111615	ENSG00000111615			5176	protein-coding gene	gene with protein product		612817	"""HIV-1 rev binding protein 2"", ""HIV-1 Rev binding protein 2"""	HRB2		7505766, 11027267, 11359931, 8675026	Standard	NM_007043		Approved	RIP-1	uc001sxt.3	Q13601	OTTHUMG00000169759	ENST00000229214.4:c.761G>T	12.37:g.75897754C>A	ENSP00000229214:p.Arg254Leu		A0FIK6|A0JLP0|B2R989|E7EUQ0|Q8NEA8|Q8TC37|Q96AT5	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom	p.R254L	ENST00000229214.4	37	c.761	CCDS9012.1	12	.	.	.	.	.	.	.	.	.	.	C	22.1	4.247699	0.80024	.	.	ENSG00000111615	ENST00000229214	T	0.30448	1.53	5.86	4.97	0.65823	.	0.098444	0.64402	D	0.000001	T	0.49321	0.1550	M	0.91196	3.185	0.80722	D	1	P	0.38711	0.643	B	0.41764	0.366	T	0.61277	-0.7095	10	0.87932	D	0	-11.0911	14.9098	0.70746	0.0:0.9314:0.0:0.0686	.	254	Q13601	KRR1_HUMAN	L	254	ENSP00000229214:R254L	ENSP00000229214:R254L	R	-	2	0	KRR1	74184021	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.125000	0.77193	1.483000	0.48342	0.585000	0.79938	CGC	KRR1	-	NULL	ENSG00000111615		0.353	KRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRR1	HGNC	protein_coding	OTTHUMT00000405727.1	-	0.00	120	0	C	NM_007043		75897754	-1	tier1	-	no_errors	ENST00000229214	ensembl	human	known	74_37	missense	34.23	73	38	SNP	1.000	A
KRTAP10-6	386674	genome.wustl.edu	37	21	46011400	46011400	+	Silent	SNP	G	G	A	rs371252868		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr21:46011400G>A	ENST00000400368.1	-	1	986	c.966C>T	c.(964-966)tcC>tcT	p.S322S	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	322	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.S322S(5)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						AGGCACCACAGGAGGGGACGG	0.692																																																	5	Substitution - coding silent(5)	endometrium(3)|urinary_tract(1)|prostate(1)											66.0	81.0	76.0					21																	46011400		2201	4300	6501	SO:0001819	synonymous_variant	0			AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.966C>T	21.37:g.46011400G>A				Silent	SNP	NULL	p.S322	ENST00000400368.1	37	c.966	CCDS42959.1	21																																																																																			KRTAP10-6	-	NULL	ENSG00000188155		0.692	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-6	HGNC	protein_coding	OTTHUMT00000128037.1		0.00	39	0	G	NM_198688		46011400	-1			no_errors	ENST00000400368	ensembl	human	known	74_37	silent	5.80	64	4	SNP	1.000	A
KRTAP5-11	440051	genome.wustl.edu	37	11	71293138	71293138	+	3'UTR	SNP	G	G	T	rs114237482	byFrequency	TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:71293138G>T	ENST00000398530.1	-	0	783				KRTAP5-11_ENST00000526239.1_5'UTR|AP000867.1_ENST00000343767.3_3'UTR	NM_001005405.2	NP_001005405.1	Q6L8G4	KR511_HUMAN	keratin associated protein 5-11							keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						GTCAGCCCAGGGAGAAGAAGA	0.542																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB126080	CCDS41685.1	11q13.4	2008-11-06			ENSG00000204571	ENSG00000204571		"""Keratin associated proteins"""	23606	protein-coding gene	gene with protein product						15144888	Standard	NM_001005405		Approved	KRTAP5.11, KRTAP5-6	uc001oqu.3	Q6L8G4	OTTHUMG00000057586	ENST00000398530.1:c.*275C>A	11.37:g.71293138G>T				RNA	SNP	-	NULL	ENST00000398530.1	37	NULL	CCDS41685.1	11																																																																																			KRTAP5-11	-	-	ENSG00000204571		0.542	KRTAP5-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-11	HGNC	protein_coding	OTTHUMT00000127969.1	-	0.00	64	0	G	NM_001005405		71293138	-1	tier1	-	no_errors	ENST00000526239	ensembl	human	known	74_37	rna	20.66	96	25	SNP	0.000	T
KSR1	8844	genome.wustl.edu	37	17	25783889	25783889	+	Missense_Mutation	SNP	C	C	T	rs200078630		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr17:25783889C>T	ENST00000319524.6	+	1	220	c.220C>T	c.(220-222)Cgg>Tgg	p.R74W	KSR1_ENST00000509603.2_Missense_Mutation_p.R74W			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1	74					Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		GCAGGAGATACGGACCCTGGA	0.672																																					Esophageal Squamous(88;1120 1336 6324 10502 16832)												0													31.0	31.0	31.0					17																	25783889		876	1991	2867	SO:0001583	missense	0			U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.220C>T	17.37:g.25783889C>T	ENSP00000323178:p.Arg74Trp		F8WEA9|H7BYU0|Q13476	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R74W	ENST00000319524.6	37	c.220		17	.	.	.	.	.	.	.	.	.	.	C	29.6	5.023035	0.93462	.	.	ENSG00000141068	ENST00000319524;ENST00000509603	D;D	0.90676	-2.71;-2.69	4.93	2.76	0.32466	.	0.000000	0.85682	D	0.000000	D	0.93158	0.7821	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.93720	0.7032	7	0.87932	D	0	.	13.1017	0.59224	0.2871:0.7129:0.0:0.0	.	.	.	.	W	74	ENSP00000323178:R74W;ENSP00000438795:R74W	ENSP00000323178:R74W	R	+	1	2	KSR1	22808016	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.445000	0.44899	1.172000	0.42781	0.563000	0.77884	CGG	KSR1	-	NULL	ENSG00000141068		0.672	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	KSR1	HGNC	protein_coding		-	0.00	59	0	C	NM_014238		25783889	+1	tier1	-	no_errors	ENST00000319524	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
LARP4B	23185	genome.wustl.edu	37	10	871242	871242	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr10:871242G>A	ENST00000316157.3	-	12	1287	c.1247C>T	c.(1246-1248)tCt>tTt	p.S416F		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	416					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						CCGCAGATGAGATTTACTAGG	0.368																																																	0													82.0	88.0	86.0					10																	871242		2203	4300	6503	SO:0001583	missense	0			D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.1247C>T	10.37:g.871242G>A	ENSP00000326128:p.Ser416Phe		A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd	p.S416F	ENST00000316157.3	37	c.1247	CCDS31131.1	10	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146414	0.77888	.	.	ENSG00000107929	ENST00000316157	T	0.32515	1.45	5.57	4.66	0.58398	.	0.154616	0.64402	D	0.000011	T	0.40171	0.1106	L	0.32530	0.975	0.50813	D	0.999896	D	0.69078	0.997	P	0.57679	0.825	T	0.33624	-0.9861	10	0.66056	D	0.02	-1.4761	15.8429	0.78864	0.0:0.0:0.8631:0.1369	.	416	Q92615	LAR4B_HUMAN	F	416	ENSP00000326128:S416F	ENSP00000326128:S416F	S	-	2	0	LARP4B	861242	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.361000	0.73070	1.356000	0.45884	0.655000	0.94253	TCT	LARP4B	-	NULL	ENSG00000107929		0.368	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP4B	HGNC	protein_coding	OTTHUMT00000046395.2	-	0.00	84	0	G	NM_015155		871242	-1	tier1	-	no_errors	ENST00000316157	ensembl	human	known	74_37	missense	24.59	46	15	SNP	1.000	A
LCT	3938	genome.wustl.edu	37	2	136562471	136562471	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:136562471C>T	ENST00000264162.2	-	10	4340	c.4330G>A	c.(4330-4332)Gtg>Atg	p.V1444M		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1444	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TAGTGGGACACGCCCAGGTTC	0.537																																																	0													122.0	105.0	111.0					2																	136562471		2203	4300	6503	SO:0001583	missense	0			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4330G>A	2.37:g.136562471C>T	ENSP00000264162:p.Val1444Met		Q4ZG58	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.V1444M	ENST00000264162.2	37	c.4330	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	C	19.28	3.798192	0.70567	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.57273	0.41	5.32	5.32	0.75619	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.67277	0.2876	L	0.53671	1.685	0.80722	D	1	P	0.51351	0.944	P	0.59357	0.856	T	0.69764	-0.5057	10	0.87932	D	0	-20.0423	19.0251	0.92929	0.0:1.0:0.0:0.0	.	1444	P09848	LPH_HUMAN	M	1444;876	ENSP00000264162:V1444M	ENSP00000264162:V1444M	V	-	1	0	LCT	136278941	1.000000	0.71417	0.326000	0.25389	0.306000	0.27790	7.818000	0.86416	2.493000	0.84123	0.580000	0.79431	GTG	LCT	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000115850		0.537	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	-	0.00	115	0	C	NM_002299		136562471	-1	tier1	-	no_errors	ENST00000264162	ensembl	human	known	74_37	missense	19.33	96	23	SNP	1.000	T
ZNRF1	84937	genome.wustl.edu	37	16	75147474	75147474	+	IGR	SNP	T	T	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:75147474T>C	ENST00000335325.4	+	0	4620				LDHD_ENST00000450168.2_Missense_Mutation_p.N349D|LDHD_ENST00000300051.4_Missense_Mutation_p.N372D|RP11-252E2.1_ENST00000499110.1_RNA	NM_032268.4	NP_115644.1	Q8ND25	ZNRF1_HUMAN	zinc and ring finger 1, E3 ubiquitin protein ligase						proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|lysosome (GO:0005764)|membrane (GO:0016020)|synapse (GO:0045202)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)	1						TACCAGGCATTGTGCCGTGCT	0.647																																																	0													21.0	24.0	23.0					16																	75147474		2196	4297	6493	SO:0001628	intergenic_variant	0			AF378524	CCDS10912.1	16q22.3	2013-01-09	2012-02-23		ENSG00000186187	ENSG00000186187		"""RING-type (C3HC4) zinc fingers"""	18452	protein-coding gene	gene with protein product		612060	"""zinc and ring finger 1"""				Standard	NM_032268		Approved	nin283, FLJ14846, DKFZp434E229	uc002fdl.1	Q8ND25	OTTHUMG00000137606		16.37:g.75147474T>C			D3DUJ9|Q9H083	Missense_Mutation	SNP	pfam_FAD-linked_oxidase_C,pfam_Oxid_FAD_bind_N,superfamily_FAD-linked_Oxase-like_C,superfamily_FAD-bd_2	p.N372D	ENST00000335325.4	37	c.1114	CCDS10912.1	16	.	.	.	.	.	.	.	.	.	.	T	7.941	0.742798	0.15642	.	.	ENSG00000166816	ENST00000450168;ENST00000300051	D;D	0.87571	-2.27;-2.27	5.09	5.09	0.68999	FAD-linked oxidase-like, C-terminal (1);FAD-linked oxidase, C-terminal (1);	0.236955	0.42821	D	0.000645	T	0.79347	0.4430	N	0.25426	0.745	0.39254	D	0.964082	B;B	0.10296	0.002;0.003	B;B	0.18871	0.008;0.023	T	0.74423	-0.3670	10	0.14656	T	0.56	-13.0794	14.8687	0.70437	0.0:0.0:0.0:1.0	.	349;372	Q86WU2-2;Q86WU2	.;LDHD_HUMAN	D	349;372	ENSP00000417011:N349D;ENSP00000300051:N372D	ENSP00000300051:N372D	N	-	1	0	LDHD	73704975	0.998000	0.40836	0.976000	0.42696	0.030000	0.12068	1.868000	0.39509	1.916000	0.55485	0.379000	0.24179	AAT	LDHD	-	pfam_FAD-linked_oxidase_C,superfamily_FAD-linked_Oxase-like_C	ENSG00000166816		0.647	ZNRF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDHD	HGNC	protein_coding	OTTHUMT00000269020.2	-	0.00	46	0	T			75147474	-1	tier1	-	no_errors	ENST00000300051	ensembl	human	known	74_37	missense	48.15	28	26	SNP	1.000	C
PRDM16	63976	genome.wustl.edu	37	1	2984044	2984044	+	5'Flank	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:2984044C>T	ENST00000270722.5	+	0	0				PRDM16_ENST00000514189.1_5'Flank|LINC00982_ENST00000321336.1_RNA|PRDM16_ENST00000442529.2_5'Flank|PRDM16_ENST00000441472.2_5'Flank|PRDM16_ENST00000511072.1_5'Flank|PRDM16_ENST00000378391.2_5'Flank|LINC00982_ENST00000445317.1_RNA|PRDM16_ENST00000378398.3_5'Flank			Q9HAZ2	PRD16_HUMAN	PR domain containing 16						brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		AGCAGGGAAGCGGTGCCGACC	0.706			T	EVI1	"""MDS, AML"""																																			Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	0																																										SO:0001631	upstream_gene_variant	0			AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581		1.37:g.2984044C>T	Exception_encountered		A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	RNA	SNP	-	NULL	ENST00000270722.5	37	NULL	CCDS41236.2	1																																																																																			LINC00982	-	-	ENSG00000177133		0.706	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LINC00982	HGNC	protein_coding	OTTHUMT00000001382.3		0.00	56	0	C	NM_022114		2984044	-1			no_errors	ENST00000321336	ensembl	human	known	74_37	rna	5.13	74	4	SNP	0.000	T
LINGO1	84894	genome.wustl.edu	37	15	77907091	77907091	+	Silent	SNP	C	C	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr15:77907091C>G	ENST00000355300.6	-	2	1332	c.1158G>C	c.(1156-1158)cgG>cgC	p.R386R	LINGO1_ENST00000561030.1_Silent_p.R380R	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	386	LRRCT.				central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						TGAAGTTGAGCCGCCAGCGGC	0.627																																																	0													21.0	26.0	24.0					15																	77907091		2059	4189	6248	SO:0001819	synonymous_variant	0			AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.1158G>C	15.37:g.77907091C>G			D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Silent	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R386	ENST00000355300.6	37	c.1158	CCDS45313.1	15																																																																																			LINGO1	-	NULL	ENSG00000169783		0.627	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO1	HGNC	protein_coding	OTTHUMT00000419546.1	-	0.00	103	0	C	NM_032808		77907091	-1	tier1	-	no_errors	ENST00000355300	ensembl	human	known	74_37	silent	29.51	43	18	SNP	1.000	G
LOC100129550	100129550	genome.wustl.edu	37	3	122606017	122606017	+	lincRNA	SNP	G	G	A	rs559372578		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:122606017G>A	ENST00000610128.1	+	0	230					NR_024618.1																						aagtctgggcgtctgtcttct	0.458													G|||	1	0.000199681	0.0	0.0	5008	,	,		20325	0.001		0.0	False		,,,				2504	0.0																0																																												0																															3.37:g.122606017G>A				RNA	SNP	-	NULL	ENST00000610128.1	37	NULL		3																																																																																			RP11-67L2.2	-	-	ENSG00000273033		0.458	RP11-67L2.2-001	KNOWN	basic	lincRNA	LOC100129550	Clone_based_vega_gene	lincRNA	OTTHUMT00000471805.1	-	0.00	51	0	G			122606017	+1	tier1	-	no_errors	ENST00000610128	ensembl	human	known	74_37	rna	24.49	37	12	SNP	0.001	A
GOLGA2P7	388152	genome.wustl.edu	37	15	84868718	84868718	+	RNA	SNP	G	G	A	rs200105620		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr15:84868718G>A	ENST00000559668.1	-	0	3597					NR_049748.1																						CGGGGGGGGGGGGGGGAGGGG	0.701																																																	0																																												0																															15.37:g.84868718G>A				RNA	SNP	-	NULL	ENST00000559668.1	37	NULL		15																																																																																			AC103965.1	-	-	ENSG00000225151		0.701	AC103965.1-008	KNOWN	basic	processed_transcript	LOC101929847	Clone_based_vega_gene	pseudogene	OTTHUMT00000418802.1		0.00	29	0	G			84868718	-1			no_errors	ENST00000316967	ensembl	human	known	74_37	rna	15.38	11	2	SNP	0.300	A
LINC01125	728537	genome.wustl.edu	37	2	98306750	98306750	+	RNA	SNP	A	A	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:98306750A>T	ENST00000451384.2	+	0	666				AC017099.3_ENST00000598824.1_RNA|AC017099.3_ENST00000599959.1_RNA|AC017099.3_ENST00000599015.1_RNA|AC017099.3_ENST00000595588.1_RNA|AC017099.3_ENST00000597941.1_RNA|AC017099.3_ENST00000599435.1_RNA|AC017099.3_ENST00000595492.1_RNA|AC017099.3_ENST00000598144.1_RNA|AC017099.3_ENST00000596529.1_RNA|AC017099.3_ENST00000599501.1_RNA|AC017099.3_ENST00000603835.1_RNA|AC017099.3_ENST00000600331.1_RNA|AC017099.3_ENST00000600606.1_RNA|AC017099.3_ENST00000597654.1_RNA|AC017099.3_ENST00000599666.1_RNA|AC017099.3_ENST00000598737.1_RNA|AC017099.3_ENST00000445382.2_RNA|AC017099.3_ENST00000594273.1_RNA|AC017099.3_ENST00000596069.1_RNA|AC017099.3_ENST00000601499.1_RNA|AC017099.3_ENST00000601509.1_RNA|AC017099.3_ENST00000601580.1_RNA|AC017099.3_ENST00000458149.3_RNA	NR_038386.1																						CTCCTAAACCAGAATATTTCC	0.358																																																	0																																												0																															2.37:g.98306750A>T				RNA	SNP	-	NULL	ENST00000451384.2	37	NULL		2																																																																																			AC017099.3	-	-	ENSG00000228486		0.358	AC017099.3-001	KNOWN	basic|exp_conf	antisense	LOC728537	Clone_based_vega_gene	antisense	OTTHUMT00000329293.2	-	0.00	89	0	A			98306750	+1	tier1	-	no_errors	ENST00000445382	ensembl	human	known	74_37	rna	5.00	76	4	SNP	0.014	T
LPHN2	23266	genome.wustl.edu	37	1	82409141	82409141	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:82409141C>G	ENST00000370728.1	+	8	1531	c.886C>G	c.(886-888)Ctt>Gtt	p.L296V	LPHN2_ENST00000394879.1_Missense_Mutation_p.L296V|LPHN2_ENST00000370730.1_Missense_Mutation_p.L296V|LPHN2_ENST00000370713.1_Missense_Mutation_p.L296V|LPHN2_ENST00000370717.2_Missense_Mutation_p.L296V|LPHN2_ENST00000271029.4_Missense_Mutation_p.L296V|LPHN2_ENST00000319517.6_Missense_Mutation_p.L296V|LPHN2_ENST00000359929.3_Missense_Mutation_p.L296V|LPHN2_ENST00000335786.5_Missense_Mutation_p.L296V|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000370725.1_Missense_Mutation_p.L296V|LPHN2_ENST00000370715.1_Missense_Mutation_p.L296V|LPHN2_ENST00000370723.1_Missense_Mutation_p.L296V|LPHN2_ENST00000370721.1_Missense_Mutation_p.L300V|LPHN2_ENST00000370727.1_Missense_Mutation_p.L296V			O95490	LPHN2_HUMAN	latrophilin 2	296	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TCCATACACTCTTCGATTTGA	0.413																																																	0													133.0	123.0	126.0					1																	82409141		2203	4300	6503	SO:0001583	missense	0			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.886C>G	1.37:g.82409141C>G	ENSP00000359763:p.Leu296Val		A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.L296V	ENST00000370728.1	37	c.886		1	.	.	.	.	.	.	.	.	.	.	C	18.69	3.678694	0.68042	.	.	ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.94793	-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.98166	0.9394	H	0.94847	3.59	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.99029	1.0820	10	0.87932	D	0	.	19.4356	0.94792	0.0:1.0:0.0:0.0	.	296;296;296	O95490-3;O95490-4;O95490-2	.;.;.	V	300;296;296;296;296;296;296;296;296;296;296;296;296;296	ENSP00000359756:L300V;ENSP00000359763:L296V;ENSP00000359765:L296V;ENSP00000359762:L296V;ENSP00000359760:L296V;ENSP00000359758:L296V;ENSP00000353006:L296V;ENSP00000359750:L296V;ENSP00000359748:L296V;ENSP00000322270:L296V;ENSP00000359752:L296V;ENSP00000378344:L296V;ENSP00000271029:L296V;ENSP00000337306:L296V	ENSP00000271029:L296V	L	+	1	0	LPHN2	82181729	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.725000	0.68507	2.591000	0.87537	0.455000	0.32223	CTT	LPHN2	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000117114		0.413	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	LPHN2	HGNC	protein_coding	OTTHUMT00000027188.1	-	0.00	34	0	C	NM_012302		82409141	+1	tier1	-	no_errors	ENST00000370717	ensembl	human	known	74_37	missense	23.53	39	12	SNP	1.000	G
LRFN2	57497	genome.wustl.edu	37	6	40399644	40399644	+	Silent	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:40399644G>A	ENST00000338305.6	-	2	1751	c.1209C>T	c.(1207-1209)agC>agT	p.S403S		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	403						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					GGCTGGTCTTGCTGGAGCCAG	0.662																																																	0													43.0	44.0	44.0					6																	40399644		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1209C>T	6.37:g.40399644G>A			A5PKU3|Q5SYP9	Silent	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S403	ENST00000338305.6	37	c.1209	CCDS34443.1	6																																																																																			LRFN2	-	NULL	ENSG00000156564		0.662	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN2	HGNC	protein_coding	OTTHUMT00000040488.1	-	0.00	90	0	G	XM_166372		40399644	-1	tier1	-	no_errors	ENST00000338305	ensembl	human	known	74_37	silent	19.54	70	17	SNP	1.000	A
LRIG1	26018	genome.wustl.edu	37	3	66432729	66432729	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:66432729C>T	ENST00000273261.3	-	16	3109	c.2585G>A	c.(2584-2586)gGc>gAc	p.G862D	LRIG1_ENST00000496559.2_5'UTR|SLC25A26_ENST00000536651.1_Intron|LRIG1_ENST00000383703.3_Missense_Mutation_p.G839D	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	862					innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		GGCCTGAGGGCCACCCTCGGT	0.567																																																	0													147.0	148.0	147.0					3																	66432729		2203	4300	6503	SO:0001583	missense	0			AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.2585G>A	3.37:g.66432729C>T	ENSP00000273261:p.Gly862Asp		Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Cys-rich_flank_reg_C,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G862D	ENST00000273261.3	37	c.2585	CCDS33783.1	3	.	.	.	.	.	.	.	.	.	.	C	19.34	3.809139	0.70797	.	.	ENSG00000144749	ENST00000273261;ENST00000383703;ENST00000383702	T;T	0.76186	-0.56;-1.0	5.65	4.76	0.60689	.	0.191535	0.45606	D	0.000355	T	0.82259	0.4998	L	0.59436	1.845	0.40147	D	0.976907	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.979;1.0;1.0	D	0.83497	0.0073	10	0.62326	D	0.03	.	10.6701	0.45753	0.0:0.681:0.2503:0.0687	.	839;862;862	Q96JA1-2;Q5XWD3;Q96JA1	.;.;LRIG1_HUMAN	D	862;839;765	ENSP00000273261:G862D;ENSP00000373208:G839D	ENSP00000273261:G862D	G	-	2	0	LRIG1	66515419	0.995000	0.38212	0.999000	0.59377	0.815000	0.46073	2.880000	0.48530	1.347000	0.45714	0.655000	0.94253	GGC	LRIG1	-	NULL	ENSG00000144749		0.567	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG1	HGNC	protein_coding	OTTHUMT00000351930.1		0.00	58	0	C	NM_015541		66432729	-1			no_errors	ENST00000273261	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.984	T
LRRC4	64101	genome.wustl.edu	37	7	127669037	127669037	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr7:127669037G>A	ENST00000249363.3	-	2	1914	c.1657C>T	c.(1657-1659)Cgg>Tgg	p.R553W	SND1_ENST00000354725.3_Intron	NM_022143.4	NP_071426.1	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4	553					postsynaptic density protein 95 clustering (GO:0097119)|regulation of synapse organization (GO:0050807)|synapse organization (GO:0050808)	cell junction (GO:0030054)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(4)|pancreas(1)|skin(2)	26				Lung(243;0.124)		TGCTGGTGCCGCTTACGAAGT	0.532																																																	0													63.0	54.0	57.0					7																	127669037		2201	4300	6501	SO:0001583	missense	0			AF196976	CCDS5799.1	7q31	2013-01-14	2003-11-19		ENSG00000128594	ENSG00000128594		"""Immunoglobulin superfamily / I-set domain containing"""	15586	protein-coding gene	gene with protein product		610486	"""leucine-rich repeat-containing 4"""			12969517	Standard	NM_022143		Approved	NAG14	uc003vmk.3	Q9HBW1	OTTHUMG00000157563	ENST00000249363.3:c.1657C>T	7.37:g.127669037G>A	ENSP00000249363:p.Arg553Trp		A4D0Y9|Q14DU9|Q6ZMI8|Q96A85	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R553W	ENST00000249363.3	37	c.1657	CCDS5799.1	7	.	.	.	.	.	.	.	.	.	.	G	14.77	2.633314	0.47049	.	.	ENSG00000128594	ENST00000249363	T	0.36340	1.26	4.8	3.85	0.44370	.	0.000000	0.64402	D	0.000008	T	0.52092	0.1713	L	0.57536	1.79	0.49299	D	0.999775	D	0.89917	1.0	D	0.67548	0.952	T	0.54735	-0.8249	10	0.87932	D	0	.	12.0004	0.53226	0.0:0.0:0.8167:0.1833	.	553	Q9HBW1	LRRC4_HUMAN	W	553	ENSP00000249363:R553W	ENSP00000249363:R553W	R	-	1	2	LRRC4	127456273	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	3.114000	0.50383	2.494000	0.84150	0.561000	0.74099	CGG	LRRC4	-	NULL	ENSG00000128594		0.532	LRRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC4	HGNC	protein_coding	OTTHUMT00000349170.1	-	0.00	70	0	G	NM_022143		127669037	-1	tier1	-	no_errors	ENST00000249363	ensembl	human	known	74_37	missense	24.07	41	13	SNP	1.000	A
LRRC41	10489	genome.wustl.edu	37	1	46763994	46763994	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:46763994T>C	ENST00000343304.6	-	2	533	c.248A>G	c.(247-249)tAt>tGt	p.Y83C	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	83					protein ubiquitination (GO:0016567)	membrane (GO:0016020)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					CTCCAAGTAATATATATTGAG	0.433																																																	0													96.0	98.0	98.0					1																	46763994		2203	4300	6503	SO:0001583	missense	0			AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.248A>G	1.37:g.46763994T>C	ENSP00000343298:p.Tyr83Cys		A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.Y83C	ENST00000343304.6	37	c.248	CCDS533.1	1	.	.	.	.	.	.	.	.	.	.	T	16.80	3.221949	0.58560	.	.	ENSG00000132128	ENST00000343304;ENST00000371972	D	0.83755	-1.76	5.8	5.8	0.92144	.	0.089995	0.47852	D	0.000203	D	0.83995	0.5375	N	0.24115	0.695	0.31893	N	0.616966	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.957;0.991;0.957	D	0.85721	0.1325	10	0.87932	D	0	0.0675	10.5062	0.44834	0.1445:0.0:0.0:0.8555	.	83;61;83	Q15345-3;E9PE58;Q15345	.;.;LRC41_HUMAN	C	83;61	ENSP00000343298:Y83C	ENSP00000343298:Y83C	Y	-	2	0	LRRC41	46536581	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.253000	0.58791	2.216000	0.71823	0.482000	0.46254	TAT	LRRC41	-	NULL	ENSG00000132128		0.433	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC41	HGNC	protein_coding	OTTHUMT00000021438.1	-	0.00	138	0	T	NM_006369		46763994	-1	tier1	-	no_errors	ENST00000343304	ensembl	human	known	74_37	missense	41.30	81	57	SNP	1.000	C
LRRK2	120892	genome.wustl.edu	37	12	40753118	40753118	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr12:40753118G>T	ENST00000298910.7	+	47	6958	c.6900G>T	c.(6898-6900)ttG>ttT	p.L2300F		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2300					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GTACTCCATTGATGTGTTTGA	0.358																																																	0													96.0	94.0	94.0					12																	40753118		2203	4300	6503	SO:0001583	missense	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.6900G>T	12.37:g.40753118G>T	ENSP00000298910:p.Leu2300Phe		A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.L2300F	ENST00000298910.7	37	c.6900	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	G	11.87	1.767064	0.31320	.	.	ENSG00000188906	ENST00000298910	T	0.39787	1.06	5.92	1.36	0.22044	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.202112	0.43416	D	0.000561	T	0.35941	0.0949	L	0.60455	1.87	0.34349	D	0.689694	B;B	0.11235	0.004;0.004	B;B	0.13407	0.009;0.009	T	0.40608	-0.9554	10	0.46703	T	0.11	.	9.117	0.36764	0.0636:0.3756:0.4652:0.0956	.	2300;2300	Q17RV3;Q5S007	.;LRRK2_HUMAN	F	2300	ENSP00000298910:L2300F	ENSP00000298910:L2300F	L	+	3	2	LRRK2	39039385	0.997000	0.39634	0.919000	0.36401	0.856000	0.48823	0.268000	0.18571	0.360000	0.24265	-0.283000	0.09986	TTG	LRRK2	-	superfamily_WD40_repeat_dom	ENSG00000188906		0.358	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	-	0.00	98	0	G	XM_058513		40753118	+1	tier1	-	no_errors	ENST00000298910	ensembl	human	known	74_37	missense	12.82	101	15	SNP	0.757	T
LZTR1	8216	genome.wustl.edu	37	22	21341811	21341811	+	Silent	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr22:21341811C>T	ENST00000215739.8	+	4	698	c.339C>T	c.(337-339)acC>acT	p.T113T	LZTR1_ENST00000389355.3_Silent_p.T94T|LZTR1_ENST00000479606.1_3'UTR	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	113					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CCACTGGGACCCCACCGGCCC	0.667																																																	0													51.0	48.0	49.0					22																	21341811		2203	4300	6503	SO:0001819	synonymous_variant	0			D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.339C>T	22.37:g.21341811C>T			Q14776|Q20WK0	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_Kelch_1,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.T113	ENST00000215739.8	37	c.339	CCDS33606.1	22																																																																																			LZTR1	-	smart_Kelch_1	ENSG00000099949		0.667	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTR1	HGNC	protein_coding	OTTHUMT00000320387.1	-	0.00	58	0	C	NM_006767		21341811	+1	tier1	-	no_errors	ENST00000215739	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.968	T
MAN2A2	4122	genome.wustl.edu	37	15	91459419	91459419	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr15:91459419T>C	ENST00000559717.1	+	20	3386	c.2927T>C	c.(2926-2928)cTc>cCc	p.L976P	MAN2A2_ENST00000431652.2_Missense_Mutation_p.L484P|MAN2A2_ENST00000558538.1_3'UTR|MAN2A2_ENST00000360468.3_Missense_Mutation_p.L976P|MAN2A2_ENST00000430376.2_Missense_Mutation_p.L166P			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	976					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GGCCAAGGGCTCAAGGACAAC	0.642																																																	0													97.0	90.0	93.0					15																	91459419		2198	4298	6496	SO:0001583	missense	0			L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.2927T>C	15.37:g.91459419T>C	ENSP00000452948:p.Leu976Pro		A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.L976P	ENST00000559717.1	37	c.2927	CCDS32332.1	15	.	.	.	.	.	.	.	.	.	.	T	22.0	4.236882	0.79800	.	.	ENSG00000196547	ENST00000360468;ENST00000431652;ENST00000430376	D;D;D	0.86627	-2.15;-2.15;-2.15	5.53	5.53	0.82687	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.85682	D	0.000000	D	0.94036	0.8089	M	0.87900	2.915	0.80722	D	1	P;D;D	0.64830	0.621;0.994;0.994	P;D;D	0.72982	0.463;0.979;0.968	D	0.94975	0.8120	10	0.87932	D	0	-35.0722	15.3636	0.74503	0.0:0.0:0.0:1.0	.	484;604;976	B4DEU9;B4DIK4;P49641	.;.;MA2A2_HUMAN	P	976;484;166	ENSP00000353655:L976P;ENSP00000388221:L484P;ENSP00000394372:L166P	ENSP00000353655:L976P	L	+	2	0	MAN2A2	89260423	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.099000	0.63709	0.477000	0.44152	CTC	MAN2A2	-	pfam_Glyco_hydro_38_C,superfamily_Gal_mutarotase_SF_dom	ENSG00000196547		0.642	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2A2	HGNC	protein_coding	OTTHUMT00000418246.5	-	0.00	163	0	T	NM_006122		91459419	+1	tier1	-	no_errors	ENST00000360468	ensembl	human	known	74_37	missense	60.36	44	67	SNP	1.000	C
MAP3K4	4216	genome.wustl.edu	37	6	161494611	161494611	+	Silent	SNP	C	C	T	rs374997561		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:161494611C>T	ENST00000392142.4	+	5	2212	c.2064C>T	c.(2062-2064)gaC>gaT	p.D688D	MAP3K4_ENST00000366919.2_Silent_p.D688D|MAP3K4_ENST00000366920.2_Silent_p.D688D|MAP3K4_ENST00000348824.7_Silent_p.D688D	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	688					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		GCAACATTGACGCTTTTGAAG	0.443																																																	0								C	,	0,4406		0,0,2203	104.0	107.0	106.0		2064,2064	-4.0	0.4	6		106	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	MAP3K4	NM_005922.2,NM_006724.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	688/1609,688/1559	161494611	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.2064C>T	6.37:g.161494611C>T			A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D688	ENST00000392142.4	37	c.2064	CCDS34565.1	6																																																																																			MAP3K4	-	NULL	ENSG00000085511		0.443	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K4	HGNC	protein_coding	OTTHUMT00000042988.3	-	0.00	62	0	C			161494611	+1	tier1	-	no_errors	ENST00000392142	ensembl	human	known	74_37	silent	10.42	43	5	SNP	0.912	T
MARK3	4140	genome.wustl.edu	37	14	103932740	103932740	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr14:103932740G>T	ENST00000429436.2	+	10	1468	c.958G>T	c.(958-960)Gtt>Ttt	p.V320F	MARK3_ENST00000416682.2_Missense_Mutation_p.V343F|MARK3_ENST00000440884.3_Missense_Mutation_p.V241F|MARK3_ENST00000553942.1_Missense_Mutation_p.V320F|MARK3_ENST00000561071.1_Intron|MARK3_ENST00000335102.5_Missense_Mutation_p.V343F|MARK3_ENST00000303622.9_Missense_Mutation_p.V320F|MARK3_ENST00000216288.7_Missense_Mutation_p.V320F	NM_001128918.1|NM_001128919.1	NP_001122390.1|NP_001122391.1	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3	320						plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30		Melanoma(154;0.155)	Epithelial(46;0.241)			CAAACCATTTGTTGAACCAGA	0.363																																																	0													105.0	95.0	98.0					14																	103932740		1911	4129	6040	SO:0001583	missense	0			M80359	CCDS41993.1, CCDS45165.1, CCDS45166.1, CCDS45167.1, CCDS55947.1	14q32.32	2014-04-07			ENSG00000075413	ENSG00000075413			6897	protein-coding gene	gene with protein product		602678				9533022	Standard	NM_002376		Approved	CTAK1, KP78, PAR-1A	uc001ymz.4	P27448	OTTHUMG00000171789	ENST00000429436.2:c.958G>T	14.37:g.103932740G>T	ENSP00000411397:p.Val320Phe		O60219|Q86TT8|Q8TB41|Q8WX83|Q96RG1|Q9UMY9|Q9UN34	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V320F	ENST00000429436.2	37	c.958	CCDS45165.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.08|13.08	2.129156|2.129156	0.37533|0.37533	.|.	.|.	ENSG00000075413|ENSG00000075413	ENST00000554627|ENST00000335102;ENST00000440884;ENST00000416682;ENST00000429436;ENST00000303622;ENST00000216288;ENST00000553942	.|T;T;T;T;T;T;T	.|0.73681	.|-0.77;3.1;-0.71;-0.74;-0.73;1.8;-0.76	5.69|5.69	1.88|1.88	0.25563|0.25563	.|Protein kinase-like domain (1);	.|0.237482	.|0.44097	.|D	.|0.000499	T|T	0.62466|0.62466	0.2430|0.2430	N|N	0.20685|0.20685	0.6|0.6	0.54753|0.54753	D|D	0.999989|0.999989	.|B;B;B;B;B;B;B	.|0.31318	.|0.319;0.215;0.117;0.026;0.179;0.061;0.072	.|B;B;B;B;B;B;B	.|0.38378	.|0.272;0.121;0.049;0.061;0.047;0.076;0.049	T|T	0.59445|0.59445	-0.7453|-0.7453	5|10	.|0.72032	.|D	.|0.01	.|.	10.6392|10.6392	0.45584|0.45584	0.2357:0.0:0.7643:0.0|0.2357:0.0:0.7643:0.0	.|.	.|343;343;320;320;241;320;320	.|P27448-7;P27448-2;P27448-6;P27448;Q86TT8;P27448-4;P27448-3	.|.;.;.;MARK3_HUMAN;.;.;.	F|F	87|343;241;343;320;320;320;320	.|ENSP00000335347:V343F;ENSP00000402104:V241F;ENSP00000408092:V343F;ENSP00000411397:V320F;ENSP00000303698:V320F;ENSP00000216288:V320F;ENSP00000450772:V320F	.|ENSP00000216288:V320F	L|V	+|+	3|1	2|0	MARK3|MARK3	103002493|103002493	0.990000|0.990000	0.36364|0.36364	0.110000|0.110000	0.21437|0.21437	0.831000|0.831000	0.47069|0.47069	1.525000|1.525000	0.35953|0.35953	0.082000|0.082000	0.17018|0.17018	0.650000|0.650000	0.86243|0.86243	TTG|GTT	MARK3	-	superfamily_Kinase-like_dom	ENSG00000075413		0.363	MARK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK3	HGNC	protein_coding	OTTHUMT00000415144.1	-	0.00	42	0	G	NM_001128918		103932740	+1	tier1	-	no_errors	ENST00000429436	ensembl	human	known	74_37	missense	12.50	21	3	SNP	0.795	T
MCC	4163	genome.wustl.edu	37	5	112420953	112420953	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr5:112420953G>T	ENST00000302475.4	-	7	1446	c.883C>A	c.(883-885)Cct>Act	p.P295T	MCC_ENST00000408903.3_Missense_Mutation_p.P485T|MCC_ENST00000514701.3_5'UTR|MCC_ENST00000515367.2_Missense_Mutation_p.P232T	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	295					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		AGGCGGCCAGGGCTGGAGGGA	0.552																																																	0													167.0	165.0	166.0					5																	112420953		2202	4300	6502	SO:0001583	missense	0				CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.883C>A	5.37:g.112420953G>T	ENSP00000305617:p.Pro295Thr		D3DT05|Q6ZR04	Missense_Mutation	SNP	pfam_USH1C-bd_PDZ_domain,superfamily_tRNA-bd_arm	p.P295T	ENST00000302475.4	37	c.883	CCDS4111.1	5	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958746	0.53400	.	.	ENSG00000171444	ENST00000302475;ENST00000515367;ENST00000408903	T;T;T	0.39229	2.23;2.23;1.09	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.49609	0.1567	N	0.19112	0.55	0.80722	D	1	D;D;D;D	0.76494	0.998;0.998;0.999;0.998	D;D;D;D	0.80764	0.981;0.981;0.994;0.981	T	0.32824	-0.9892	10	0.13853	T	0.58	-17.6001	19.8927	0.96935	0.0:0.0:1.0:0.0	.	295;257;485;295	B7Z6G0;B3KTX0;P23508-2;P23508	.;.;.;CRCM_HUMAN	T	295;232;485	ENSP00000305617:P295T;ENSP00000421615:P232T;ENSP00000386227:P485T	ENSP00000305617:P295T	P	-	1	0	MCC	112448852	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.562000	0.82300	2.711000	0.92665	0.655000	0.94253	CCT	MCC	-	NULL	ENSG00000171444		0.552	MCC-001	KNOWN	basic|CCDS	protein_coding	MCC	HGNC	protein_coding	OTTHUMT00000250736.3	-	0.00	56	0	G	NM_001085377		112420953	-1	tier1	-	no_errors	ENST00000302475	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
MEGF10	84466	genome.wustl.edu	37	5	126746293	126746293	+	Splice_Site	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr5:126746293G>A	ENST00000274473.6	+	10	1397	c.1130G>A	c.(1129-1131)aGc>aAc	p.S377N	MEGF10_ENST00000508365.1_Splice_Site_p.S377N|MEGF10_ENST00000503335.2_Splice_Site_p.S377N|MEGF10_ENST00000418761.2_Splice_Site_p.S377N	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	377	Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		AACACTCATAGGTGAGTGTCA	0.527																																																	0													42.0	36.0	38.0					5																	126746293		2203	4300	6503	SO:0001630	splice_region_variant	0			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.1130+1G>A	5.37:g.126746293G>A			Q68DE5|Q8WUL3	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_EGF_extracell,superfamily_Proteinase_amylase_inhib_dom,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.S377N	ENST00000274473.6	37	c.1130	CCDS4142.1	5	.	.	.	.	.	.	.	.	.	.	G	32	5.128978	0.94473	.	.	ENSG00000145794	ENST00000503335;ENST00000508365;ENST00000418761;ENST00000274473	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	5.93	5.93	0.95920	EGF-like, laminin (2);	0.000000	0.85682	D	0.000000	T	0.71134	0.3304	M	0.83223	2.63	0.80722	D	1	D;D	0.71674	0.974;0.998	P;D	0.73708	0.877;0.981	T	0.65228	-0.6219	10	0.18276	T	0.48	-36.3469	20.3539	0.98825	0.0:0.0:1.0:0.0	.	377;377	Q96KG7-2;Q96KG7	.;MEG10_HUMAN	N	377	ENSP00000423354:S377N;ENSP00000423195:S377N;ENSP00000416284:S377N;ENSP00000274473:S377N	ENSP00000274473:S377N	S	+	2	0	MEGF10	126774192	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.995000	0.88328	2.826000	0.97356	0.655000	0.94253	AGC	MEGF10	-	pfam_EGF_laminin,smart_EG-like_dom,smart_EGF_laminin	ENSG00000145794		0.527	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF10	HGNC	protein_coding	OTTHUMT00000250973.2	-	0.00	46	0	G	NM_032446	Missense_Mutation	126746293	+1	tier1	-	no_errors	ENST00000274473	ensembl	human	known	74_37	missense	21.21	26	7	SNP	1.000	A
MEP1B	4225	genome.wustl.edu	37	18	29784155	29784155	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr18:29784155T>C	ENST00000269202.6	+	7	426	c.379T>C	c.(379-381)Tca>Cca	p.S127P	MEP1B_ENST00000581447.1_Missense_Mutation_p.S127P	NM_005925.2	NP_005916.2	Q16820	MEP1B_HUMAN	meprin A, beta	127	Metalloprotease.				digestion (GO:0007586)|inflammatory response (GO:0006954)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						CTGCTGGTCTTCAGTAGGAAA	0.493																																																	0													72.0	77.0	75.0					18																	29784155		2070	4227	6297	SO:0001583	missense	0			X81333	CCDS45846.1	18q12.2-q12.3	2003-12-17				ENSG00000141434	3.4.24.18		7020	protein-coding gene	gene with protein product		600389				7774936	Standard	NM_005925		Approved		uc002kxj.4	Q16820		ENST00000269202.6:c.379T>C	18.37:g.29784155T>C	ENSP00000269202:p.Ser127Pro		B7ZM35|B9EGL6|Q670J1	Missense_Mutation	SNP	pirsf_Pept_M12A_Meprin,pfam_Peptidase_M12A,pfam_MAM_dom,pfam_MATH,superfamily_TRAF-like,superfamily_ConA-like_lec_gl_sf,smart_Peptidase_Metallo,smart_MAM_dom,smart_MATH,prints_Peptidase_M12A,prints_MAM_dom,pfscan_EG-like_dom,pfscan_MATH,pfscan_MAM_dom	p.S127P	ENST00000269202.6	37	c.379	CCDS45846.1	18	.	.	.	.	.	.	.	.	.	.	T	13.23	2.175345	0.38413	.	.	ENSG00000141434	ENST00000269202	T	0.63580	-0.05	5.93	4.74	0.60224	Peptidase, metallopeptidase (1);Peptidase M12A, astacin (1);Metallopeptidase, catalytic domain (1);	0.556751	0.20145	N	0.098286	T	0.72228	0.3434	L	0.59912	1.85	0.34940	D	0.750268	D	0.54601	0.967	D	0.63192	0.912	T	0.76945	-0.2771	10	0.35671	T	0.21	-0.5881	12.3136	0.54942	0.1269:0.0:0.0:0.8731	.	127	Q16820	MEP1B_HUMAN	P	127	ENSP00000269202:S127P	ENSP00000269202:S127P	S	+	1	0	MEP1B	28038153	0.981000	0.34729	0.762000	0.31397	0.657000	0.38888	4.966000	0.63715	1.010000	0.39314	0.533000	0.62120	TCA	MEP1B	-	pirsf_Pept_M12A_Meprin,pfam_Peptidase_M12A,smart_Peptidase_Metallo	ENSG00000141434		0.493	MEP1B-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MEP1B	HGNC	protein_coding	OTTHUMT00000447755.1	-	0.00	126	0	T	NM_005925		29784155	+1	tier1	-	no_errors	ENST00000269202	ensembl	human	known	74_37	missense	18.70	99	23	SNP	0.924	C
MGAT3	4248	genome.wustl.edu	37	22	39883406	39883406	+	Silent	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr22:39883406C>T	ENST00000341184.6	+	2	269	c.54C>T	c.(52-54)tgC>tgT	p.C18C		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	18					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)			endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					CCGGCCTGTGCCTCATCTCCT	0.557																																																	0													214.0	206.0	209.0					22																	39883406		2203	4300	6503	SO:0001819	synonymous_variant	0			D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.54C>T	22.37:g.39883406C>T			A6NGD0|Q14CK5|Q6IC49|Q9UH32	Silent	SNP	pfam_Glyco_trans_17	p.C18	ENST00000341184.6	37	c.54	CCDS13994.2	22																																																																																			MGAT3	-	NULL	ENSG00000128268		0.557	MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT3	HGNC	protein_coding	OTTHUMT00000075039.2	-	0.00	46	0	C	NM_002409		39883406	+1	tier1	-	no_errors	ENST00000341184	ensembl	human	known	74_37	silent	9.09	40	4	SNP	1.000	T
MGLL	11343	genome.wustl.edu	37	3	127411061	127411061	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:127411061C>A	ENST00000434178.2	-	8	1788	c.892G>T	c.(892-894)Gga>Tga	p.G298*	MGLL_ENST00000453507.2_Nonsense_Mutation_p.G278*|MGLL_ENST00000398101.3_Nonsense_Mutation_p.G272*|MGLL_ENST00000398104.1_Nonsense_Mutation_p.G298*|MGLL_ENST00000476682.1_5'UTR|MGLL_ENST00000265052.5_Nonsense_Mutation_p.G308*			Q99685	MGLL_HUMAN	monoglyceride lipase	298					acylglycerol acyl-chain remodeling (GO:0036155)|acylglycerol catabolic process (GO:0046464)|arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|fatty acid biosynthetic process (GO:0006633)|glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|long term synaptic depression (GO:0060292)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|regulation of endocannabinoid signaling pathway (GO:2000124)|regulation of inflammatory response (GO:0050727)|regulation of sensory perception of pain (GO:0051930)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acylglycerol lipase activity (GO:0047372)|lipid binding (GO:0008289)|lysophospholipase activity (GO:0004622)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6						GACGCAGTTCCTGCCGTGGCT	0.562																																																	0													82.0	82.0	82.0					3																	127411061		1906	4124	6030	SO:0001587	stop_gained	0			BC000551	CCDS43148.1, CCDS46902.1, CCDS58852.1	3p13-q13.33	2014-03-14			ENSG00000074416	ENSG00000074416	3.1.1.23		17038	protein-coding gene	gene with protein product		609699				9495531	Standard	NM_007283		Approved	HU-K5, MGL	uc003ejx.4	Q99685	OTTHUMG00000159641	ENST00000434178.2:c.892G>T	3.37:g.127411061C>A	ENSP00000402798:p.Gly298*		B3KRC2|B7Z9D1|Q6IBG9|Q96AA5	Nonsense_Mutation	SNP	pfam_Lysophospholipase_put,pfam_AB_hydrolase_1,pfam_Lipase_3,pfam_Esterase_put,pfam_AB_hydrolase_3,prints_AB_hydrolase_1	p.G308*	ENST00000434178.2	37	c.922	CCDS43148.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.446939|6.446939	0.97572|0.97572	.|.	.|.	ENSG00000074416|ENSG00000074416	ENST00000434178;ENST00000265052;ENST00000398104;ENST00000398101;ENST00000487473;ENST00000536024;ENST00000453507;ENST00000484451|ENST00000496306	.|.	.|.	.|.	4.94|4.94	2.98|2.98	0.34508|0.34508	.|.	0.531595|.	0.20489|.	N|.	0.091335|.	.|T	.|0.50701	.|0.1631	.|.	.|.	.|.	0.34347|0.34347	D|D	0.68944|0.68944	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.59118	.|-0.7514	.|4	0.46703|.	T|.	0.11|.	-18.3188|-18.3188	9.014|9.014	0.36159|0.36159	0.0:0.811:0.0:0.189|0.0:0.811:0.0:0.189	.|.	.|.	.|.	.|.	X|H	298;308;298;272;150;308;278;192|203	.|.	ENSP00000265052:G308X|.	G|Q	-|-	1|3	0|2	MGLL|MGLL	128893751|128893751	0.014000|0.014000	0.17966|0.17966	0.005000|0.005000	0.12908|0.12908	0.042000|0.042000	0.13812|0.13812	1.516000|1.516000	0.35856|0.35856	0.927000|0.927000	0.37143|0.37143	0.491000|0.491000	0.48974|0.48974	GGA|CAG	MGLL	-	NULL	ENSG00000074416		0.562	MGLL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGLL	HGNC	protein_coding	OTTHUMT00000356637.2	-	0.00	84	0	C	NM_007283		127411061	-1	tier1	-	no_errors	ENST00000265052	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	0.023	A
SHANK2	22941	genome.wustl.edu	37	11	70718454	70718454	+	Intron	SNP	C	C	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:70718454C>A	ENST00000338508.4	-	17	1177				MIR3664_ENST00000579074.1_RNA			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			AGACAGAGTTCCCTACCTTCA	0.478																																																	0																																										SO:0001627	intron_variant	0			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000338508.4:c.1177+24151G>T	11.37:g.70718454C>A			C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	RNA	SNP	-	NULL	ENST00000338508.4	37	NULL		11																																																																																			MIR3664	-	-	ENSG00000263744		0.478	SHANK2-201	KNOWN	basic|appris_principal	protein_coding	MIR3664	HGNC	protein_coding		-	0.00	24	0	C	NM_012309		70718454	-1	tier1	-	no_errors	ENST00000579074	ensembl	human	known	74_37	rna	71.79	11	28	SNP	0.000	A
MMS22L	253714	genome.wustl.edu	37	6	97676779	97676779	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:97676779G>A	ENST00000275053.4	-	14	2295	c.2030C>T	c.(2029-2031)gCc>gTc	p.A677V	MMS22L_ENST00000369251.2_Missense_Mutation_p.A637V	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	677					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						CCTGATTCTGGCCAGAACAGC	0.323																																																	0													75.0	75.0	75.0					6																	97676779		2203	4300	6503	SO:0001583	missense	0				CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.2030C>T	6.37:g.97676779G>A	ENSP00000275053:p.Ala677Val		D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A677V	ENST00000275053.4	37	c.2030	CCDS5039.1	6	.	.	.	.	.	.	.	.	.	.	G	21.6	4.175831	0.78564	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.36157	1.27;1.27	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.45155	0.1328	M	0.69823	2.125	0.58432	D	0.999998	D;P	0.61697	0.99;0.902	P;P	0.59825	0.864;0.52	T	0.34527	-0.9825	10	0.41790	T	0.15	-8.1437	13.7763	0.63055	0.0733:0.0:0.9267:0.0	.	637;677	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	V	677;637	ENSP00000275053:A677V;ENSP00000358254:A637V	ENSP00000275053:A677V	A	-	2	0	MMS22L	97783500	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	6.865000	0.75500	2.630000	0.89119	0.591000	0.81541	GCC	MMS22L	-	NULL	ENSG00000146263		0.323	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMS22L	HGNC	protein_coding	OTTHUMT00000041573.3	-	0.00	90	0	G	NM_198468		97676779	-1	tier1	-	no_errors	ENST00000275053	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	A
MROH9	80133	genome.wustl.edu	37	1	170985417	170985417	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:170985417C>G	ENST00000367759.4	+	17	2002	c.1848C>G	c.(1846-1848)gaC>gaG	p.D616E		NM_001163629.1	NP_001157101.1	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	0																	ACGAACTGGACAAAGTGACCT	0.418																																																	0													174.0	142.0	151.0					1																	170985417		692	1591	2283	SO:0001583	missense	0			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367759.4:c.1848C>G	1.37:g.170985417C>G	ENSP00000356733:p.Asp616Glu		A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D616E	ENST00000367759.4	37	c.1848	CCDS53429.1	1	.	.	.	.	.	.	.	.	.	.	C	19.87	3.906644	0.72868	.	.	ENSG00000117501	ENST00000367759	T	0.66280	-0.2	5.26	4.33	0.51752	.	.	.	.	.	T	0.49098	0.1537	L	0.27053	0.805	0.25039	N	0.991214	D	0.65815	0.995	P	0.60886	0.88	T	0.30707	-0.9969	9	0.28530	T	0.3	.	10.3367	0.43854	0.0:0.9045:0.0:0.0955	.	616	F5GWX6	.	E	616	ENSP00000356733:D616E	ENSP00000356733:D616E	D	+	3	2	C1orf129	169252041	0.989000	0.36119	0.989000	0.46669	0.016000	0.09150	0.780000	0.26760	2.614000	0.88457	0.555000	0.69702	GAC	MROH9	-	superfamily_ARM-type_fold	ENSG00000117501		0.418	MROH9-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH9	HGNC	protein_coding		-	0.00	104	0	C	NM_025063		170985417	+1	tier1	-	no_errors	ENST00000367759	ensembl	human	known	74_37	missense	30.00	90	39	SNP	0.994	G
MRPS22	56945	genome.wustl.edu	37	3	139074623	139074623	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:139074623T>A	ENST00000495075.1	+	9	1410	c.978T>A	c.(976-978)aaT>aaA	p.N326K	MRPS22_ENST00000478464.1_Missense_Mutation_p.N285K|MRPS22_ENST00000310776.4_Missense_Mutation_p.N326K|MRPS22_ENST00000465056.1_Missense_Mutation_p.N325K			P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	326						mitochondrial ribosome (GO:0005761)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12						AGGGAATAAATTTAATCAAGG	0.418																																																	0													53.0	56.0	55.0					3																	139074623		2203	4300	6503	SO:0001583	missense	0			AF226045	CCDS3107.1	3q23	2012-09-13			ENSG00000175110	ENSG00000175110		"""Mitochondrial ribosomal proteins / small subunits"""	14508	protein-coding gene	gene with protein product		605810				11175783	Standard	NM_020191		Approved	MRP-S22, GK002, C3orf5, GIBT	uc003etb.3	P82650	OTTHUMG00000159910	ENST00000495075.1:c.978T>A	3.37:g.139074623T>A	ENSP00000418008:p.Asn326Lys		Q9H3I1	Missense_Mutation	SNP	pfam_Ribosomal_S22_mit	p.N326K	ENST00000495075.1	37	c.978	CCDS3107.1	3	.	.	.	.	.	.	.	.	.	.	T	14.22	2.471760	0.43942	.	.	ENSG00000175110	ENST00000495075;ENST00000310776;ENST00000465056;ENST00000478464	D;D;D;D	0.81908	-1.54;-1.54;-1.55;-1.54	5.76	-6.64	0.01801	.	0.432153	0.27558	N	0.018829	T	0.60235	0.2253	N	0.16478	0.41	0.58432	D	0.999999	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.09377	0.004;0.004;0.002	T	0.04140	-1.0974	10	0.56958	D	0.05	-0.6942	4.0945	0.09985	0.0974:0.1232:0.195:0.5844	.	285;325;326	G5E9W7;G5E9V5;P82650	.;.;RT22_HUMAN	K	326;326;325;285	ENSP00000418008:N326K;ENSP00000310785:N326K;ENSP00000418233:N325K;ENSP00000419303:N285K	ENSP00000310785:N326K	N	+	3	2	MRPS22	140557313	0.403000	0.25319	0.025000	0.17156	0.970000	0.65996	-0.407000	0.07178	-1.501000	0.01817	0.533000	0.62120	AAT	MRPS22	-	NULL	ENSG00000175110		0.418	MRPS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPS22	HGNC	protein_coding	OTTHUMT00000358120.1	-	0.00	96	0	T	NM_020191		139074623	+1	tier1	-	no_errors	ENST00000310776	ensembl	human	known	74_37	missense	19.21	143	34	SNP	0.270	A
MSH2	4436	genome.wustl.edu	37	2	47702214	47702214	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:47702214G>A	ENST00000233146.2	+	12	2033	c.1810G>A	c.(1810-1812)Gct>Act	p.A604T	MSH2_ENST00000543555.1_Missense_Mutation_p.A538T|MSH2_ENST00000406134.1_Missense_Mutation_p.A604T	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	604	Interaction with EXO1.				ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(2)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TCAGCTAGATGCTGTTGTCAG	0.373			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	4	Whole gene deletion(2)|Unknown(2)	haematopoietic_and_lymphoid_tissue(3)|prostate(1)											127.0	113.0	117.0					2																	47702214		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.1810G>A	2.37:g.47702214G>A	ENSP00000233146:p.Ala604Thr		B4E2Z2|O75488	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mmatch_repair_MutS_con_dom,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_DNA_mmatch_repair_MutS_con_dom,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_MSH2	p.A604T	ENST00000233146.2	37	c.1810	CCDS1834.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.542253	0.96474	.	.	ENSG00000095002	ENST00000233146;ENST00000543555;ENST00000406134;ENST00000419559;ENST00000413880	D;D;D	0.91295	-2.82;-2.82;-2.82	5.61	5.61	0.85477	DNA mismatch repair protein MutS, core (3);	0.000000	0.85682	D	0.000000	D	0.94466	0.8219	L	0.61218	1.895	0.80722	D	1	D;D;P	0.69078	0.997;0.997;0.908	D;D;P	0.65573	0.914;0.936;0.796	D	0.94531	0.7736	10	0.72032	D	0.01	-18.4783	19.6426	0.95764	0.0:0.0:1.0:0.0	.	538;604;604	B4E2Z2;E9PHA6;P43246	.;.;MSH2_HUMAN	T	604;538;604;604;390	ENSP00000233146:A604T;ENSP00000442697:A538T;ENSP00000384199:A604T	ENSP00000233146:A604T	A	+	1	0	MSH2	47555718	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.006000	0.93592	2.650000	0.89964	0.655000	0.94253	GCT	MSH2	-	pfam_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_core,pirsf_DNA_mismatch_repair_MSH2	ENSG00000095002		0.373	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH2	HGNC	protein_coding	OTTHUMT00000250805.3	-	0.00	92	0	G			47702214	+1	tier1	-	no_errors	ENST00000233146	ensembl	human	known	74_37	missense	33.93	74	38	SNP	1.000	A
MT-ND2	4536	genome.wustl.edu	37	M	1949	1949	+	5'Flank	SNP	G	G	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chrM:1949G>C	ENST00000361453.3	+	0	0				MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TM_ENST00000387377.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						AAGAGCACACCCGTCTATGTA	0.428																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.1949G>C	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			MT-RNR2	-	-	ENSG00000210082		0.428	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		-	0.00	11	0	G	YP_003024027		1949	+1	tier1	-	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	50.00	7	7	SNP	NULL	C
MT-ND2	4536	genome.wustl.edu	37	M	2289	2289	+	5'Flank	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chrM:2289G>A	ENST00000361453.3	+	0	0				MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TM_ENST00000387377.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						TATCACCCTATAGAAGAACTA	0.388																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2289G>A	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			MT-RNR2	-	-	ENSG00000210082		0.388	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding			0.00	139	0	G	YP_003024027		2289	+1			no_errors	ENST00000387347	ensembl	human	known	74_37	rna	5.00	152	8	SNP	NULL	A
MTSS1	9788	genome.wustl.edu	37	8	125575201	125575201	+	Missense_Mutation	SNP	C	C	T	rs551211348		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr8:125575201C>T	ENST00000518547.1	-	10	1330	c.857G>A	c.(856-858)cGg>cAg	p.R286Q	MTSS1_ENST00000395508.2_Missense_Mutation_p.R20Q|MTSS1_ENST00000523587.1_5'UTR|MTSS1_ENST00000524090.1_Missense_Mutation_p.R176Q|MTSS1_ENST00000354184.4_Missense_Mutation_p.R86Q|MTSS1_ENST00000378017.3_Missense_Mutation_p.R286Q|MTSS1_ENST00000431961.2_Missense_Mutation_p.R86Q|NDUFB9_ENST00000522532.1_Intron|MTSS1_ENST00000325064.5_Missense_Mutation_p.R290Q	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	286	Ser-rich.				actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GCCGCTGGACCGGGAGTCACT	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18421	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(160;622 1893 3862 8546 12509)												0													45.0	39.0	41.0					8																	125575201		2203	4299	6502	SO:0001583	missense	0			AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.857G>A	8.37:g.125575201C>T	ENSP00000429064:p.Arg286Gln		J3KNK6|Q8TCA2|Q96RX2	Missense_Mutation	SNP	pfam_IRSp53/MIM_homology_IMD,pfscan_WH2_dom	p.R286Q	ENST00000518547.1	37	c.857	CCDS6353.1	8	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265808	0.80358	.	.	ENSG00000170873	ENST00000378017;ENST00000518547;ENST00000354184;ENST00000395508;ENST00000325064;ENST00000431961;ENST00000524090;ENST00000522118	T;T;T;T;T;T;T;T	0.45668	1.49;1.48;1.49;1.42;1.48;1.49;1.47;0.89	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.61274	0.2334	L	0.56769	1.78	0.58432	D	0.999998	D;D;D;D;D;D	0.89917	1.0;1.0;0.991;0.992;0.997;1.0	D;D;P;P;P;D	0.83275	0.994;0.994;0.464;0.644;0.683;0.996	T	0.50215	-0.8854	10	0.17369	T	0.5	-20.2161	19.9823	0.97331	0.0:1.0:0.0:0.0	.	176;20;286;286;286;86	E7EWW5;B7Z3B6;A5YM41;O43312;O43312-4;O43312-2	.;.;.;MTSS1_HUMAN;.;.	Q	286;286;86;20;290;86;176;86	ENSP00000367256:R286Q;ENSP00000429064:R286Q;ENSP00000346119:R86Q;ENSP00000378884:R20Q;ENSP00000322804:R290Q;ENSP00000393606:R86Q;ENSP00000428319:R176Q;ENSP00000428145:R86Q	ENSP00000322804:R290Q	R	-	2	0	MTSS1	125644382	0.997000	0.39634	0.461000	0.27105	0.583000	0.36354	4.956000	0.63645	2.788000	0.95919	0.650000	0.86243	CGG	MTSS1	-	NULL	ENSG00000170873		0.622	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTSS1	HGNC	protein_coding	OTTHUMT00000109625.3		0.00	30	0	C	NM_014751		125575201	-1			no_errors	ENST00000518547	ensembl	human	known	74_37	missense	9.38	29	3	SNP	0.998	T
MYO1H	283446	genome.wustl.edu	37	12	109831212	109831212	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr12:109831212delT	ENST00000431443.2	+	2	203	c.203delT	c.(202-204)cttfs	p.L68fs	MYO1H_ENST00000310903.5_Frame_Shift_Del_p.L68fs	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	68	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						CAGATGGAACTTTATCAAGGG	0.448																																																	0													100.0	97.0	98.0					12																	109831212		1923	4135	6058	SO:0001589	frameshift_variant	0				CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.203delT	12.37:g.109831212delT	ENSP00000444076:p.Leu68fs		F5H3C6	Frame_Shift_Del	DEL	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.Y69fs	ENST00000431443.2	37	c.203		12																																																																																			MYO1H	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000174527		0.448	MYO1H-201	KNOWN	basic	protein_coding	MYO1H	HGNC	protein_coding			0.00	83	0	T	NM_173597		109831212	+1			no_errors	ENST00000431443	ensembl	human	known	74_37	frame_shift_del	7.92	93	8	DEL	1.000	0
MYO5B	4645	genome.wustl.edu	37	18	47406771	47406771	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr18:47406771G>T	ENST00000285039.7	-	23	3399	c.3100C>A	c.(3100-3102)Ctc>Atc	p.L1034I	MYO5B_ENST00000324581.6_Missense_Mutation_p.L175I	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1034					endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		TGGTTGTTGAGCTGTTCTTTC	0.428																																																	0													237.0	244.0	242.0					18																	47406771		1861	4091	5952	SO:0001583	missense	0			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.3100C>A	18.37:g.47406771G>T	ENSP00000285039:p.Leu1034Ile		B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L1034I	ENST00000285039.7	37	c.3100	CCDS42436.1	18	.	.	.	.	.	.	.	.	.	.	G	17.34	3.364345	0.61513	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.27256	1.68;1.68	5.39	5.39	0.77823	.	0.063358	0.64402	D	0.000004	T	0.30293	0.0760	L	0.47716	1.5	0.47341	D	0.999399	B;D	0.54397	0.212;0.966	B;P	0.45167	0.062;0.472	T	0.01935	-1.1244	10	0.44086	T	0.13	.	18.3012	0.90164	0.0:0.0:1.0:0.0	.	1034;175	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	I	1034;175	ENSP00000285039:L1034I;ENSP00000315531:L175I	ENSP00000285039:L1034I	L	-	1	0	MYO5B	45660769	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.039000	0.57325	2.684000	0.91462	0.650000	0.86243	CTC	MYO5B	-	NULL	ENSG00000167306		0.428	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	HGNC	protein_coding	OTTHUMT00000448515.2	-	0.00	76	0	G			47406771	-1	tier1	-	no_errors	ENST00000285039	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
NCAPD3	23310	genome.wustl.edu	37	11	134037925	134037925	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:134037925A>G	ENST00000534548.2	-	27	3603	c.3539T>C	c.(3538-3540)gTc>gCc	p.V1180A		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	1180					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		TTCCTGCATGACTACATTTGC	0.468																																																	0													256.0	214.0	229.0					11																	134037925		2201	4297	6498	SO:0001583	missense	0			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.3539T>C	11.37:g.134037925A>G	ENSP00000433681:p.Val1180Ala		A6NFS2|Q4KMQ9	Missense_Mutation	SNP	superfamily_ARM-type_fold,pirsf_NCAPD3	p.V1180A	ENST00000534548.2	37	c.3539	CCDS31723.1	11	.	.	.	.	.	.	.	.	.	.	A	14.29	2.489950	0.44249	.	.	ENSG00000151503	ENST00000534548;ENST00000527944;ENST00000530396	T;T;T	0.56941	0.43;0.43;0.43	5.52	4.39	0.52855	Armadillo-type fold (1);	0.052484	0.85682	N	0.000000	T	0.33933	0.0880	L	0.31578	0.945	0.80722	D	1	B;B	0.33904	0.431;0.045	B;B	0.25987	0.065;0.012	T	0.08166	-1.0735	10	0.11182	T	0.66	-22.8916	11.364	0.49660	0.9287:0.0:0.0713:0.0	.	1180;240	P42695;Q96FA6	CNDD3_HUMAN;.	A	1180;85;216	ENSP00000433681:V1180A;ENSP00000432532:V85A;ENSP00000435173:V216A	ENSP00000432532:V85A	V	-	2	0	NCAPD3	133543135	1.000000	0.71417	0.986000	0.45419	0.933000	0.57130	6.989000	0.76219	0.940000	0.37473	0.477000	0.44152	GTC	NCAPD3	-	superfamily_ARM-type_fold,pirsf_NCAPD3	ENSG00000151503		0.468	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD3	HGNC	protein_coding	OTTHUMT00000393575.2		0.00	38	0	A	NM_015261		134037925	-1			no_errors	ENST00000534548	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	G
NDUFB7	4713	genome.wustl.edu	37	19	14682780	14682780	+	Silent	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr19:14682780G>T	ENST00000215565.2	-	1	94	c.33C>A	c.(31-33)ggC>ggA	p.G11G		NM_004146.5	NP_004137.2	P17568	NDUB7_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa	11					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						CCGAGGCATCGCCCAGGTAGC	0.697																																																	0													22.0	23.0	22.0					19																	14682780		2200	4297	6497	SO:0001819	synonymous_variant	0				CCDS12314.1	19p13.12	2011-07-04	2002-08-29		ENSG00000099795	ENSG00000099795		"""Mitochondrial respiratory chain complex / Complex I"""	7702	protein-coding gene	gene with protein product	"""NADH-ubiquinone oxidoreductase B18 subunit"", ""complex I B18 subunit"""	603842	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7 (18kD, B18)"""			9763677, 10830904	Standard	NM_004146		Approved	B18, CI-B18, MGC2480	uc002mzg.3	P17568		ENST00000215565.2:c.33C>A	19.37:g.14682780G>T			Q6ICN9|Q9UI16	Silent	SNP	pfam_NADH_UbQ_OxRdtase_B18_su	p.G11	ENST00000215565.2	37	c.33	CCDS12314.1	19																																																																																			NDUFB7	-	NULL	ENSG00000099795		0.697	NDUFB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFB7	HGNC	protein_coding	OTTHUMT00000466025.1	-	0.00	27	0	G	NM_004146		14682780	-1	tier1	-	no_errors	ENST00000215565	ensembl	human	known	74_37	silent	13.79	25	4	SNP	0.010	T
NEB	4703	genome.wustl.edu	37	2	152448643	152448643	+	Intron	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:152448643G>A	ENST00000172853.10	-	78	11749				NEB_ENST00000604864.1_Missense_Mutation_p.R4911C|NEB_ENST00000427231.2_Missense_Mutation_p.R4911C|NEB_ENST00000409198.1_Intron|NEB_ENST00000603639.1_Missense_Mutation_p.R4911C|NEB_ENST00000397345.3_Missense_Mutation_p.R4911C			P20929	NEBU_HUMAN	nebulin						muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CAGGCATTGCGATACAATGGC	0.383																																																	0													482.0	307.0	360.0					2																	152448643		692	1591	2283	SO:0001627	intron_variant	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.11602-15775C>T	2.37:g.152448643G>A			F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.R4911C	ENST00000172853.10	37	c.14731		2	.	.	.	.	.	.	.	.	.	.	g	10.99	1.508728	0.27036	.	.	ENSG00000183091	ENST00000397345;ENST00000427231	T;T	0.55930	0.49;0.49	2.65	1.73	0.24493	.	.	.	.	.	T	0.57286	0.2043	M	0.75085	2.285	0.58432	D	0.999998	.	.	.	.	.	.	T	0.55140	-0.8187	7	0.54805	T	0.06	.	3.7817	0.08683	0.1281:0.0:0.4466:0.4253	.	.	.	.	C	4911	ENSP00000380505:R4911C;ENSP00000416578:R4911C	ENSP00000380505:R4911C	R	-	1	0	NEB	152156889	0.002000	0.14202	0.933000	0.37362	0.690000	0.40134	0.550000	0.23345	0.413000	0.25759	0.454000	0.30748	CGC	NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.383	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		-	0.00	326	0	G	NM_004543		152448643	-1	tier1	-	no_errors	ENST00000397345	ensembl	human	known	74_37	missense	10.34	286	33	SNP	0.941	A
NFE2L2	4780	genome.wustl.edu	37	2	178098810	178098810	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:178098810C>T	ENST00000397062.3	-	2	789	c.235G>A	c.(235-237)Gag>Aag	p.E79K	NFE2L2_ENST00000423513.1_Missense_Mutation_p.E63K|NFE2L2_ENST00000446151.2_Missense_Mutation_p.E63K|NFE2L2_ENST00000464747.1_Missense_Mutation_p.E63K|NFE2L2_ENST00000397063.4_Missense_Mutation_p.E63K	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	79					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E79K(10)|p.E79Q(10)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TCACCTGTCTCTTCATCTAGT	0.443			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																														Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	20	Substitution - Missense(20)	lung(13)|oesophagus(4)|upper_aerodigestive_tract(1)|urinary_tract(1)|cervix(1)											147.0	146.0	146.0					2																	178098810		1899	4107	6006	SO:0001583	missense	0				CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.235G>A	2.37:g.178098810C>T	ENSP00000380252:p.Glu79Lys		B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,superfamily_Serpin_dom,smart_bZIP,pfscan_bZIP	p.E79K	ENST00000397062.3	37	c.235	CCDS42782.1	2	.	.	.	.	.	.	.	.	.	.	C	20.1	3.936470	0.73442	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48;1.48;1.48	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.64271	0.2583	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;1.0;1.0	D;D;D;D	0.85130	0.996;0.985;0.997;0.996	T	0.68700	-0.5339	10	0.72032	D	0.01	.	19.9976	0.97389	0.0:1.0:0.0:0.0	.	63;63;63;79	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	K	63;79;63;63;63;63;63	ENSP00000380253:E63K;ENSP00000380252:E79K;ENSP00000411575:E63K;ENSP00000391590:E63K;ENSP00000400073:E63K;ENSP00000412191:E63K;ENSP00000410015:E63K	ENSP00000380252:E79K	E	-	1	0	NFE2L2	177807056	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.298000	0.78815	2.737000	0.93849	0.563000	0.77884	GAG	NFE2L2	-	NULL	ENSG00000116044		0.443	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	NFE2L2	HGNC	protein_coding	OTTHUMT00000257752.4	-	0.00	101	0	C	NM_006164		178098810	-1	tier1	-	no_errors	ENST00000397062	ensembl	human	known	74_37	missense	36.36	91	52	SNP	1.000	T
NIPA2	81614	genome.wustl.edu	37	15	23006588	23006588	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr15:23006588G>A	ENST00000337451.3	-	8	1328	c.716C>T	c.(715-717)gCc>gTc	p.A239V	NIPA2_ENST00000398013.3_Missense_Mutation_p.A239V|NIPA2_ENST00000359727.4_Missense_Mutation_p.A220V|NIPA2_ENST00000398014.2_Missense_Mutation_p.A239V|NIPA2_ENST00000539711.2_Missense_Mutation_p.A220V	NM_030922.6	NP_112184.4	Q8N8Q9	NIPA2_HUMAN	non imprinted in Prader-Willi/Angelman syndrome 2	239						early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(4)|skin(1)	15		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;1.48e-06)|Epithelial(43;1.44e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000353)		TATATCCAGGGCCCTATTTAG	0.428																																																	0													113.0	131.0	125.0					15																	23006588		2202	4300	6502	SO:0001583	missense	0			AY732242	CCDS73693.1, CCDS73694.1	15q11.2	2008-02-05			ENSG00000140157	ENSG00000140157			17044	protein-coding gene	gene with protein product		608146				14508708	Standard	NM_001008860		Approved		uc001yuz.3	Q8N8Q9	OTTHUMG00000129101	ENST00000337451.3:c.716C>T	15.37:g.23006588G>A	ENSP00000337618:p.Ala239Val		F8W7Y8|Q96F03|Q9BVS2	Missense_Mutation	SNP	pfam_Mg_trans_NIPA,pfam_DMT	p.A239V	ENST00000337451.3	37	c.716	CCDS10010.1	15	.	.	.	.	.	.	.	.	.	.	G	21.1	4.097967	0.76870	.	.	ENSG00000140157	ENST00000337451;ENST00000398014;ENST00000359727;ENST00000539711;ENST00000398013	D;D;D	0.94280	-3.39;-3.39;-3.39	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.97760	0.9265	H	0.94925	3.6	0.80722	D	1	D;D	0.63880	0.993;0.986	D;D	0.70016	0.967;0.952	D	0.98463	1.0597	10	0.87932	D	0	-10.0284	19.6178	0.95640	0.0:0.0:1.0:0.0	.	220;239	F8W7Y8;Q8N8Q9	.;NIPA2_HUMAN	V	239;239;220;239;220	ENSP00000337618:A239V;ENSP00000381096:A239V;ENSP00000352762:A220V	ENSP00000337618:A239V	A	-	2	0	NIPA2	20558029	1.000000	0.71417	1.000000	0.80357	0.348000	0.29142	9.731000	0.98807	2.709000	0.92574	0.655000	0.94253	GCC	NIPA2	-	pfam_Mg_trans_NIPA	ENSG00000140157		0.428	NIPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPA2	HGNC	protein_coding	OTTHUMT00000251137.1	-	0.00	32	0	G	NM_030922		23006588	-1	tier1	-	no_errors	ENST00000337451	ensembl	human	known	74_37	missense	13.46	45	7	SNP	1.000	A
NKX2-2	4821	genome.wustl.edu	37	20	21492752	21492752	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr20:21492752C>A	ENST00000377142.4	-	2	987	c.631G>T	c.(631-633)Gac>Tac	p.D211Y	NKX2-2-AS1_ENST00000549659.1_RNA	NM_002509.3	NP_002500.1	O95096	NKX22_HUMAN	NK2 homeobox 2	211					astrocyte differentiation (GO:0048708)|brain development (GO:0007420)|digestive tract development (GO:0048565)|endocrine pancreas development (GO:0031018)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|oligodendrocyte development (GO:0014003)|optic nerve development (GO:0021554)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell fate commitment (GO:0003327)|ventral spinal cord interneuron fate determination (GO:0060580)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|core promoter proximal region DNA binding (GO:0001159)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						GGTTTGCCGTCCCTGACCAAG	0.672																																																	0													34.0	37.0	36.0					20																	21492752		2203	4300	6503	SO:0001583	missense	0			AF019415	CCDS13145.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125820	ENSG00000125820		"""Homeoboxes / ANTP class : NKL subclass"""	7835	protein-coding gene	gene with protein product		604612	"""NK-2 (Drosophila) homolog B"", ""NK2 transcription factor related, locus 2 (Drosophila)"""	NKX2B		9703340, 1346742	Standard	NM_002509		Approved	NKX2.2	uc002wsi.3	O95096	OTTHUMG00000170524	ENST00000377142.4:c.631G>T	20.37:g.21492752C>A	ENSP00000366347:p.Asp211Tyr			Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.D211Y	ENST00000377142.4	37	c.631	CCDS13145.1	20	.	.	.	.	.	.	.	.	.	.	C	26.5	4.744814	0.89663	.	.	ENSG00000125820	ENST00000377142	D	0.92699	-3.09	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.96488	0.8854	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.96735	0.9542	10	0.87932	D	0	.	19.4854	0.95027	0.0:1.0:0.0:0.0	.	211	O95096	NKX22_HUMAN	Y	211	ENSP00000366347:D211Y	ENSP00000366347:D211Y	D	-	1	0	NKX2-2	21440752	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.808000	0.86044	2.596000	0.87737	0.462000	0.41574	GAC	NKX2-2	-	NULL	ENSG00000125820		0.672	NKX2-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX2-2	HGNC	protein_coding	OTTHUMT00000078278.9	-	0.00	93	0	C			21492752	-1	tier1	-	no_errors	ENST00000377142	ensembl	human	known	74_37	missense	9.80	92	10	SNP	1.000	A
NRXN3	9369	genome.wustl.edu	37	14	79432736	79432736	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr14:79432736G>A	ENST00000554719.1	+	9	2136	c.1645G>A	c.(1645-1647)Gag>Aag	p.E549K	NRXN3_ENST00000335750.5_Missense_Mutation_p.E549K	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	142					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CATTGCAGTCGAGCTTGTCAA	0.428																																																	0													150.0	133.0	139.0					14																	79432736		2203	4300	6503	SO:0001583	missense	0			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.1645G>A	14.37:g.79432736G>A	ENSP00000451648:p.Glu549Lys		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G	p.E911K	ENST00000554719.1	37	c.2731	CCDS9870.1	14	.	.	.	.	.	.	.	.	.	.	G	23.7	4.445986	0.84101	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750	T;T	0.80480	-1.38;-1.38	5.74	5.74	0.90152	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.90283	0.6961	.	.	.	0.80722	D	1	D;D	0.89917	1.0;0.993	D;P	0.91635	0.999;0.686	D	0.89136	0.3513	8	.	.	.	.	20.2982	0.98569	0.0:0.0:1.0:0.0	.	922;549	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	K	922;911;549;549	ENSP00000451648:E549K;ENSP00000338349:E549K	.	E	+	1	0	NRXN3	78502489	1.000000	0.71417	0.554000	0.28268	0.357000	0.29423	9.869000	0.99810	2.873000	0.98535	0.563000	0.77884	GAG	NRXN3	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000021645		0.428	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413787.1		0.00	35	0	G	NM_001105250		79432736	+1			no_errors	ENST00000554738	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	A
NT5E	4907	genome.wustl.edu	37	6	86181158	86181158	+	Intron	SNP	A	A	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:86181158A>G	ENST00000257770.3	+	3	800				NT5E_ENST00000369646.3_Missense_Mutation_p.R256G|NT5E_ENST00000369651.3_Intron	NM_002526.3	NP_002517.1	P21589	5NTD_HUMAN	5'-nucleotidase, ecto (CD73)						adenosine biosynthetic process (GO:0046086)|AMP catabolic process (GO:0006196)|dephosphorylation (GO:0016311)|DNA metabolic process (GO:0006259)|negative regulation of inflammatory response (GO:0050728)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Cytarabine(DB00987)|Pentoxifylline(DB00806)	TTGTTTCAAAAGGATTGCATG	0.388																																					Melanoma(140;797 1765 2035 2752 18208)												0													66.0	67.0	67.0					6																	86181158		2203	4300	6503	SO:0001627	intron_variant	0			X55740	CCDS5002.1, CCDS56439.1	6q14-q21	2013-08-28	2002-04-18	2002-04-19	ENSG00000135318	ENSG00000135318	3.1.3.5	"""CD molecules"""	8021	protein-coding gene	gene with protein product		129190	"""5' nucleotidase (CD73)"""	NT5			Standard	NM_002526		Approved	CD73, eN, eNT, CALJA	uc003pko.4	P21589	OTTHUMG00000015139	ENST00000257770.3:c.751+15A>G	6.37:g.86181158A>G			B3KQI8|O75520|Q5W116	Missense_Mutation	SNP	pfam_PEstase_dom,prints_5_nucleotidase/apyrase	p.R256G	ENST00000257770.3	37	c.766	CCDS5002.1	6	.	.	.	.	.	.	.	.	.	.	A	6.626	0.483992	0.12581	.	.	ENSG00000135318	ENST00000369646	.	.	.	4.89	-0.159	0.13379	.	.	.	.	.	T	0.06234	0.0161	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39643	-0.9604	6	.	.	.	.	4.0711	0.09882	0.5923:0.0:0.2611:0.1466	.	256	Q96B60	.	G	256	.	.	R	+	1	2	NT5E	86237877	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.261000	0.18442	0.022000	0.15160	0.459000	0.35465	AGG	NT5E	-	NULL	ENSG00000135318		0.388	NT5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5E	HGNC	protein_coding	OTTHUMT00000041388.1	-	0.00	78	0	A			86181158	+1	tier1	-	no_errors	ENST00000369646	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.000	G
ODF2L	57489	genome.wustl.edu	37	1	86848664	86848664	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:86848664C>T	ENST00000359242.3	-	6	738	c.457G>A	c.(457-459)Gaa>Aaa	p.E153K	ODF2L_ENST00000294678.2_Missense_Mutation_p.E153K|ODF2L_ENST00000370566.3_Missense_Mutation_p.E153K|ODF2L_ENST00000394731.1_Missense_Mutation_p.E22K|ODF2L_ENST00000370567.1_Missense_Mutation_p.E153K|ODF2L_ENST00000317336.7_Missense_Mutation_p.E153K	NM_001007022.2	NP_001007023.2	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like	153						centrosome (GO:0005813)				endometrium(2)|kidney(2)|large_intestine(10)|lung(6)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	24				all cancers(265;0.0313)|Epithelial(280;0.0611)		GCCTCCTTTTCAAATACCTTC	0.299																																																	0													57.0	63.0	61.0					1																	86848664		2203	4297	6500	SO:0001583	missense	0				CCDS30763.1, CCDS41354.1, CCDS30763.2, CCDS41354.2, CCDS53339.1	1p22.3	2008-02-05			ENSG00000122417	ENSG00000122417			29225	protein-coding gene	gene with protein product						10574462	Standard	NM_020729		Approved	KIAA1229	uc001dll.2	Q9ULJ1	OTTHUMG00000010080	ENST00000359242.3:c.457G>A	1.37:g.86848664C>T	ENSP00000359600:p.Glu153Lys		A8MU56|B4E037|Q05C40|Q5BJG5|Q5TBX3|Q5TBX4|Q86X31	Missense_Mutation	SNP	NULL	p.E153K	ENST00000359242.3	37	c.457	CCDS41354.2	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.987049	0.74589	.	.	ENSG00000122417	ENST00000441121;ENST00000370566;ENST00000359242;ENST00000460698;ENST00000317336;ENST00000370567;ENST00000394731;ENST00000457680;ENST00000294678;ENST00000479890;ENST00000394733;ENST00000465959	T;T;T;T;T;T;T;T;T	0.61627	1.67;1.64;1.73;1.66;1.65;1.72;1.66;1.41;0.09	5.59	5.59	0.84812	.	0.049368	0.85682	D	0.000000	T	0.66973	0.2844	M	0.70275	2.135	0.47584	D	0.999464	D;D;D;D;D;D	0.89917	1.0;0.992;0.993;0.993;0.998;0.993	D;P;P;D;D;D	0.87578	0.998;0.811;0.851;0.909;0.91;0.932	T	0.60652	-0.7221	10	0.15499	T	0.54	-11.175	17.4501	0.87589	0.0:1.0:0.0:0.0	.	153;153;153;153;153;153	B4E037;B4DZ83;Q9ULJ1-2;Q9ULJ1-4;Q9ULJ1-3;Q9ULJ1	.;.;.;.;.;ODF2L_HUMAN	K	153;153;153;29;153;153;22;22;153;22;22;153	ENSP00000359597:E153K;ENSP00000359600:E153K;ENSP00000433092:E29K;ENSP00000320165:E153K;ENSP00000359598:E153K;ENSP00000378219:E22K;ENSP00000294678:E153K;ENSP00000432834:E22K;ENSP00000378220:E22K	ENSP00000294678:E153K	E	-	1	0	ODF2L	86621252	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	2.010000	0.40913	2.783000	0.95769	0.655000	0.94253	GAA	ODF2L	-	NULL	ENSG00000122417		0.299	ODF2L-001	KNOWN	basic|CCDS	protein_coding	ODF2L	HGNC	protein_coding	OTTHUMT00000027873.2	-	0.00	105	0	C			86848664	-1	tier1	-	no_errors	ENST00000317336	ensembl	human	known	74_37	missense	12.96	92	14	SNP	1.000	T
VASP	7408	genome.wustl.edu	37	19	46032328	46032328	+	IGR	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr19:46032328C>T	ENST00000245932.6	+	0	2305				OPA3_ENST00000323060.3_Missense_Mutation_p.A177T	NM_003370.3	NP_003361.1	P50552	VASP_HUMAN	vasodilator-stimulated phosphoprotein						actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|neural tube closure (GO:0001843)|positive regulation of actin filament polymerization (GO:0030838)|protein homotetramerization (GO:0051289)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	profilin binding (GO:0005522)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)	18		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0145)|GBM - Glioblastoma multiforme(486;0.154)		TTCTCGGACGCCGGCGCAACT	0.667																																																	0													31.0	37.0	35.0					19																	46032328		2015	3982	5997	SO:0001628	intergenic_variant	0				CCDS33051.1	19q13.32	2012-02-22			ENSG00000125753	ENSG00000125753			12652	protein-coding gene	gene with protein product		601703				8812448	Standard	XM_005259199		Approved		uc002pcg.3	P50552			19.37:g.46032328C>T			B2RBT9|Q6PIZ1|Q93035	Missense_Mutation	SNP	pfam_OPA3-like	p.A177T	ENST00000245932.6	37	c.529	CCDS33051.1	19	.	.	.	.	.	.	.	.	.	.	C	12.56	1.975737	0.34848	.	.	ENSG00000125741	ENST00000323060	D	0.85339	-1.97	3.37	-2.34	0.06704	.	.	.	.	.	T	0.59348	0.2187	.	.	.	0.19300	N	0.999978	B	0.06786	0.001	B	0.04013	0.001	T	0.53479	-0.8433	8	0.02654	T	1	-13.425	3.9781	0.09483	0.0:0.4721:0.1879:0.3401	.	177	Q9H6K4-2	.	T	177	ENSP00000319817:A177T	ENSP00000319817:A177T	A	-	1	0	OPA3	50724168	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.776000	0.00776	-0.115000	0.11915	0.549000	0.68633	GCG	OPA3	-	NULL	ENSG00000125741		0.667	VASP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPA3	HGNC	protein_coding	OTTHUMT00000459589.1	-	0.00	18	0	C			46032328	-1	tier1	-	no_errors	ENST00000323060	ensembl	human	known	74_37	missense	52.94	8	9	SNP	0.000	T
OPRL1	4987	genome.wustl.edu	37	20	62730100	62730100	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr20:62730100A>G	ENST00000349451.3	+	6	1473	c.1061A>G	c.(1060-1062)aAg>aGg	p.K354R	OPRL1_ENST00000336866.2_Missense_Mutation_p.K354R|OPRL1_ENST00000355631.4_Missense_Mutation_p.K354R	NM_001200019.1	NP_001186948.1	P41146	OPRX_HUMAN	opiate receptor-like 1	354					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavior (GO:0007610)|opioid receptor signaling pathway (GO:0038003)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|nociceptin receptor activity (GO:0001626)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					AGCATTGCCAAGGACGTGGCC	0.642																																																	0													63.0	56.0	58.0					20																	62730100		2201	4298	6499	SO:0001583	missense	0				CCDS13556.1	20q13.33	2012-08-08			ENSG00000125510	ENSG00000125510		"""GPCR / Class A : Opioid receptors"""	8155	protein-coding gene	gene with protein product	"""LC132 receptor-like"", ""orphanin FQ receptor"", ""kappa3-related opioid receptor"""	602548				8137918	Standard	NM_000913		Approved	NOCIR, ORL1, OOR, KOR-3	uc021wgs.1	P41146	OTTHUMG00000033027	ENST00000349451.3:c.1061A>G	20.37:g.62730100A>G	ENSP00000336764:p.Lys354Arg		Q8TD34|Q8WYH9|Q9H4K4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_X_opioid_rcpt,prints_GPCR_Rhodpsn,prints_Opioid_rcpt,prints_Somatstn_rcpt,prints_Neuropept_B/W_rcpt,prints_NPY_rcpt	p.K354R	ENST00000349451.3	37	c.1061	CCDS13556.1	20	.	.	.	.	.	.	.	.	.	.	A	2.871	-0.234055	0.05983	.	.	ENSG00000125510	ENST00000336866;ENST00000355631;ENST00000349451	T;T;T	0.63744	-0.06;-0.06;-0.06	5.12	-2.6	0.06190	.	0.241349	0.39146	N	0.001455	T	0.27933	0.0688	N	0.03238	-0.38	0.35324	D	0.784993	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.44314	-0.9336	10	0.02654	T	1	.	10.8518	0.46775	0.5794:0.0:0.4206:0.0	.	349;354	P41146-2;P41146	.;OPRX_HUMAN	R	354	ENSP00000336843:K354R;ENSP00000347848:K354R;ENSP00000336764:K354R	ENSP00000336843:K354R	K	+	2	0	OPRL1	62200544	1.000000	0.71417	0.237000	0.24090	0.675000	0.39556	1.926000	0.40084	-0.905000	0.03871	0.449000	0.29647	AAG	OPRL1	-	prints_X_opioid_rcpt	ENSG00000125510		0.642	OPRL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OPRL1	HGNC	protein_coding	OTTHUMT00000080295.1	-	0.00	45	0	A	NM_182647		62730100	+1	tier1	-	no_errors	ENST00000336866	ensembl	human	known	74_37	missense	20.59	26	7	SNP	0.994	G
OR2B2	81697	genome.wustl.edu	37	6	27879293	27879293	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:27879293C>A	ENST00000303324.2	-	1	881	c.805G>T	c.(805-807)Gac>Tac	p.D269Y		NM_033057.2	NP_149046.2	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B, member 2	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	22						TTTCCCCGGTCTTTGGAGCTG	0.443																																																	0													87.0	82.0	84.0					6																	27879293		2203	4300	6503	SO:0001583	missense	0			Z98744	CCDS4641.1	6p22.3-p21.3	2014-02-19	2002-02-28		ENSG00000168131	ENSG00000168131		"""GPCR / Class A : Olfactory receptors"""	13966	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 9"""	OR2B9			Standard	NM_033057		Approved	hs6M1-10, OR6-1, OR2B2Q	uc011dkw.2	Q9GZK3	OTTHUMG00000014495	ENST00000303324.2:c.805G>T	6.37:g.27879293C>A	ENSP00000304419:p.Asp269Tyr		B2RNH2|Q9GZL2|Q9Y299	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D269Y	ENST00000303324.2	37	c.805	CCDS4641.1	6	.	.	.	.	.	.	.	.	.	.	C	9.157	1.017837	0.19355	.	.	ENSG00000168131	ENST00000303324	T	0.00152	8.66	4.42	4.42	0.53409	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41194	U	0.000934	T	0.00241	0.0007	M	0.88640	2.97	0.09310	N	1	D	0.69078	0.997	D	0.70227	0.968	T	0.13282	-1.0515	10	0.87932	D	0	.	9.0305	0.36256	0.0:0.8951:0.0:0.1049	.	269	Q9GZK3	OR2B2_HUMAN	Y	269	ENSP00000304419:D269Y	ENSP00000304419:D269Y	D	-	1	0	OR2B2	27987272	0.005000	0.15991	1.000000	0.80357	0.031000	0.12232	1.051000	0.30417	2.371000	0.80710	0.563000	0.77884	GAC	OR2B2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000168131		0.443	OR2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2B2	HGNC	protein_coding	OTTHUMT00000040163.1	-	0.00	91	0	C			27879293	-1	tier1	-	no_errors	ENST00000303324	ensembl	human	known	74_37	missense	13.27	85	13	SNP	0.072	A
OR2T8	343172	genome.wustl.edu	37	1	248084839	248084839	+	Missense_Mutation	SNP	C	C	T	rs200305171		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:248084839C>T	ENST00000319968.4	+	1	520	c.520C>T	c.(520-522)Cac>Tac	p.H174Y		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CGAGATCGATCACTTCTTCTG	0.557																																																	0													53.0	38.0	43.0					1																	248084839		2193	4267	6460	SO:0001583	missense	0				CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.520C>T	1.37:g.248084839C>T	ENSP00000326225:p.His174Tyr			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.H174Y	ENST00000319968.4	37	c.520	CCDS31100.1	1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.481738	0.44147	.	.	ENSG00000177462	ENST00000319968	T	0.00183	8.6	3.37	3.37	0.38596	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36303	U	0.002679	T	0.00356	0.0011	M	0.87827	2.91	0.28837	N	0.896819	B	0.25105	0.118	B	0.33392	0.163	T	0.02437	-1.1159	10	0.87932	D	0	.	13.6463	0.62283	0.0:1.0:0.0:0.0	.	174	A6NH00	OR2T8_HUMAN	Y	174	ENSP00000326225:H174Y	ENSP00000326225:H174Y	H	+	1	0	OR2T8	246151462	0.002000	0.14202	0.048000	0.18961	0.326000	0.28443	0.217000	0.17603	1.709000	0.51313	0.404000	0.27445	CAC	OR2T8	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000177462		0.557	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T8	HGNC	protein_coding	OTTHUMT00000096862.1	-	0.00	33	0	C	NM_001005522		248084839	+1	tier1	rs200305171	no_errors	ENST00000319968	ensembl	human	known	74_37	missense	9.68	56	6	SNP	0.579	T
OR2T33	391195	genome.wustl.edu	37	1	248436938	248436938	+	Missense_Mutation	SNP	A	A	C	rs544654849		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:248436938A>C	ENST00000318021.2	-	1	200	c.179T>G	c.(178-180)cTc>cGc	p.L60R		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	60						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L60P(1)		NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TTGGCTCAGGAGGAAGTACAT	0.532													a|||	1	0.000199681	0.0	0.0	5008	,	,		16079	0.0		0.001	False		,,,				2504	0.0																1	Substitution - Missense(1)	lung(1)											83.0	75.0	78.0					1																	248436938		2202	4300	6502	SO:0001583	missense	0				CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.179T>G	1.37:g.248436938A>C	ENSP00000324687:p.Leu60Arg		B2RNN0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L60R	ENST00000318021.2	37	c.179	CCDS31109.1	1	.	.	.	.	.	.	.	.	.	.	-	17.60	3.430930	0.62844	.	.	ENSG00000177212	ENST00000318021	T	0.03181	4.02	2.7	2.7	0.31948	GPCR, rhodopsin-like superfamily (1);	0.311215	0.17524	U	0.171116	T	0.24851	0.0603	H	0.95504	3.68	0.38338	D	0.943983	D	0.89917	1.0	D	0.79108	0.992	T	0.33904	-0.9850	10	0.87932	D	0	.	10.997	0.47582	1.0:0.0:0.0:0.0	.	60	Q8NG76	O2T33_HUMAN	R	60	ENSP00000324687:L60R	ENSP00000324687:L60R	L	-	2	0	OR2T33	246503561	1.000000	0.71417	0.726000	0.30738	0.923000	0.55619	6.784000	0.75084	1.178000	0.42870	0.404000	0.27445	CTC	OR2T33	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000177212		0.532	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T33	HGNC	protein_coding	OTTHUMT00000097354.1	-	0.00	86	0	A	NM_001004695		248436938	-1	tier1	-	no_errors	ENST00000318021	ensembl	human	known	74_37	missense	21.13	56	15	SNP	0.840	C
OR4C11	219429	genome.wustl.edu	37	11	55371598	55371598	+	Silent	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:55371598G>A	ENST00000302231.4	-	1	276	c.252C>T	c.(250-252)ctC>ctT	p.L84L		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	84						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						TCTTTTCAGAGAGAGCATCCA	0.398																																																	0													84.0	78.0	80.0					11																	55371598		2176	4012	6188	SO:0001819	synonymous_variant	0			AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.252C>T	11.37:g.55371598G>A			B9EIL4|Q8NGL8	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L84	ENST00000302231.4	37	c.252	CCDS31503.1	11																																																																																			OR4C11	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000172188		0.398	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C11	HGNC	protein_coding	OTTHUMT00000383268.1	-	0.00	57	0	G	NM_001004700		55371598	-1	tier1	-	no_errors	ENST00000302231	ensembl	human	known	74_37	silent	76.92	15	50	SNP	0.000	A
OR4D10	390197	genome.wustl.edu	37	11	59245409	59245409	+	Silent	SNP	C	C	T	rs375485138		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:59245409C>T	ENST00000530162.1	+	1	564	c.507C>T	c.(505-507)tgC>tgT	p.C169C		NM_001004705.1	NP_001004705.1	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D, member 10	169						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TCCCTTTCTGCGGACCCAATG	0.498																																																	0								T		2,4400	821.3+/-416.4	0,2,2199	111.0	111.0	111.0		507	4.7	1.0	11		111	0,8590		0,0,4295	no	coding-synonymous	OR4D10	NM_001004705.1		0,2,6494	TT,TC,CC		0.0,0.0454,0.0154		169/312	59245409	2,12990	2201	4295	6496	SO:0001819	synonymous_variant	0			AB065808	CCDS53636.1	11q12.1	2012-10-03		2004-03-10	ENSG00000254466	ENSG00000254466		"""GPCR / Class A : Olfactory receptors"""	15173	protein-coding gene	gene with protein product				OR4D10P			Standard	NM_001004705		Approved	OST711	uc001nnz.1	Q8NGI6	OTTHUMG00000167341	ENST00000530162.1:c.507C>T	11.37:g.59245409C>T			B2RNH6	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C169	ENST00000530162.1	37	c.507	CCDS53636.1	11																																																																																			OR4D10	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000254466		0.498	OR4D10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D10	HGNC	protein_coding	OTTHUMT00000394235.1	-	0.00	77	0	C	NM_001004705		59245409	+1	tier1	-	no_errors	ENST00000530162	ensembl	human	known	74_37	silent	50.00	42	42	SNP	0.996	T
OSBPL6	114880	genome.wustl.edu	37	2	179238720	179238720	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:179238720A>G	ENST00000190611.4	+	15	1875	c.1499A>G	c.(1498-1500)gAg>gGg	p.E500G	OSBPL6_ENST00000359685.3_Missense_Mutation_p.E464G|OSBPL6_ENST00000315022.2_Missense_Mutation_p.E504G|OSBPL6_ENST00000392505.2_Missense_Mutation_p.E525G|OSBPL6_ENST00000357080.4_Missense_Mutation_p.E433G|OSBPL6_ENST00000409045.3_Missense_Mutation_p.E469G|OSBPL6_ENST00000409631.1_Missense_Mutation_p.E464G	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	500					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			GATGCCCAAGAGGTGCTCCTC	0.468																																																	0													149.0	133.0	139.0					2																	179238720		2203	4300	6503	SO:0001583	missense	0			AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.1499A>G	2.37:g.179238720A>G	ENSP00000190611:p.Glu500Gly		B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	pfam_Oxysterol-bd,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E504G	ENST00000190611.4	37	c.1511	CCDS2277.1	2	.	.	.	.	.	.	.	.	.	.	A	31	5.091094	0.94149	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000357080;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T;T	0.19669	2.35;2.48;2.13;2.38;2.36;2.48;2.35	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.48642	0.1511	M	0.76574	2.34	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;0.999;1.0;0.999;1.0	D;D;D;D;D;D	0.85130	0.994;0.997;0.991;0.997;0.986;0.994	T	0.50800	-0.8785	10	0.87932	D	0	-20.0817	16.2806	0.82678	1.0:0.0:0.0:0.0	.	469;504;464;525;500;433	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3;Q86V84	.;.;.;.;OSBL6_HUMAN;.	G	525;464;433;469;500;464;504	ENSP00000376293:E525G;ENSP00000352713:E464G;ENSP00000349591:E433G;ENSP00000387248:E469G;ENSP00000190611:E500G;ENSP00000386885:E464G;ENSP00000318723:E504G	ENSP00000190611:E500G	E	+	2	0	OSBPL6	178946966	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.251000	0.95483	2.248000	0.74166	0.533000	0.62120	GAG	OSBPL6	-	NULL	ENSG00000079156		0.468	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OSBPL6	HGNC	protein_coding	OTTHUMT00000334393.2	-	0.00	67	0	A	NM_032523		179238720	+1	tier1	-	no_errors	ENST00000315022	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	G
PAPD4	167153	genome.wustl.edu	37	5	78944904	78944904	+	Silent	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr5:78944904G>A	ENST00000296783.3	+	11	1217	c.918G>A	c.(916-918)ccG>ccA	p.P306P	PAPD4_ENST00000504233.1_Intron|PAPD4_ENST00000428308.2_Silent_p.P306P|PAPD4_ENST00000453514.1_Silent_p.P306P|PAPD4_ENST00000423041.2_Silent_p.P302P			Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	306					hematopoietic progenitor cell differentiation (GO:0002244)|histone mRNA catabolic process (GO:0071044)|mRNA processing (GO:0006397)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|nuclear RNA-directed RNA polymerase complex (GO:0031380)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)			biliary_tract(1)|breast(2)|endometrium(4)|kidney(3)|large_intestine(9)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		GAGTTCGTCCGTTAGTGCTGG	0.378																																																	0													125.0	118.0	120.0					5																	78944904		2203	4300	6503	SO:0001819	synonymous_variant	0			AL833136	CCDS4048.1, CCDS75265.1, CCDS75266.1	5q14.1	2014-03-21			ENSG00000164329	ENSG00000164329			26776	protein-coding gene	gene with protein product	"""TUTase2"""	614121				12477932	Standard	NM_173797		Approved	FLJ38499, GLD2, TUT2	uc003kgb.2	Q6PIY7	OTTHUMG00000108163	ENST00000296783.3:c.918G>A	5.37:g.78944904G>A			Q86WZ2|Q8N927	Silent	SNP	pfam_PAP_assoc	p.P306	ENST00000296783.3	37	c.918	CCDS4048.1	5																																																																																			PAPD4	-	NULL	ENSG00000164329		0.378	PAPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPD4	HGNC	protein_coding	OTTHUMT00000226967.1	-	0.00	137	0	G	NM_173797		78944904	+1	tier1	-	no_errors	ENST00000296783	ensembl	human	known	74_37	silent	67.29	35	72	SNP	0.005	A
PAPD5	64282	genome.wustl.edu	37	16	50264337	50264337	+	3'UTR	SNP	C	C	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:50264337C>G	ENST00000436909.3	+	0	3230				PAPD5_ENST00000573002.1_3'UTR|PAPD5_ENST00000357464.3_3'UTR	NM_001040284.2|NM_001040285.2	NP_001035374.2|NP_001035375.2	Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5						histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		TTTCTCATCTCTTATTCTTTT	0.363																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000436909.3:c.*1098C>G	16.37:g.50264337C>G			B4DV38|Q9NW67|Q9Y6C0	RNA	SNP	-	NULL	ENST00000436909.3	37	NULL	CCDS54006.1	16																																																																																			PAPD5	-	-	ENSG00000121274		0.363	PAPD5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAPD5	HGNC	protein_coding	OTTHUMT00000423149.2	-	0.00	41	0	C	NM_022447		50264337	+1	tier1	-	no_errors	ENST00000573002	ensembl	human	known	74_37	rna	35.00	39	21	SNP	0.315	G
PARL	55486	genome.wustl.edu	37	3	183551536	183551538	+	In_Frame_Del	DEL	CGG	CGG	-	rs149824069	byFrequency	TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	CGG	CGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:183551536_183551538delCGG	ENST00000317096.4	-	8	964_966	c.904_906delCCG	c.(904-906)ccgdel	p.P302del	PARL_ENST00000311101.5_In_Frame_Del_p.P252del|PARL_ENST00000435888.1_Intron	NM_018622.5	NP_061092.3	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like	302					membrane protein proteolysis (GO:0033619)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|proteolysis (GO:0006508)|regulation of protein targeting to mitochondrion (GO:1903214)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)	p.P302Q(1)		endometrium(2)|large_intestine(3)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	17	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			ACGTGAACATCGGAAGGAAAATA	0.463																																																	1	Substitution - Missense(1)	lung(1)																																								SO:0001651	inframe_deletion	0			AF116692	CCDS3248.1, CCDS33897.1	3q27.3	2008-02-05		2006-02-28	ENSG00000175193	ENSG00000175193			18253	protein-coding gene	gene with protein product	"""rhomboid 7 homolog 1 (Drosophila)"""	607858		PSARL			Standard	XM_005247587		Approved	PRO2207, PSARL1, RHBDS1	uc003fmd.3	Q9H300	OTTHUMG00000156890	ENST00000317096.4:c.904_906delCCG	3.37:g.183551536_183551538delCGG	ENSP00000325421:p.Pro302del		Q96CQ4|Q9BTJ6|Q9P1E3	In_Frame_Del	DEL	pfam_Peptidase_S54_rhomboid_dom	p.P302in_frame_del	ENST00000317096.4	37	c.906_904	CCDS3248.1	3																																																																																			PARL	-	pfam_Peptidase_S54_rhomboid_dom	ENSG00000175193		0.463	PARL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARL	HGNC	protein_coding	OTTHUMT00000346465.1		0.00	68	0	CGG	NM_018622		183551538	-1			no_errors	ENST00000317096	ensembl	human	known	74_37	in_frame_del	9.57	85	9	DEL	0.275:1.000:1.000	0
PARL	55486	genome.wustl.edu	37	3	183551540	183551547	+	Frame_Shift_Del	DEL	AGGAAAAT	AGGAAAAT	-			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	AGGAAAAT	AGGAAAAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:183551540_183551547delAGGAAAAT	ENST00000317096.4	-	8	955_962	c.895_902delATTTTCCT	c.(895-903)attttccttfs	p.IFL299fs	PARL_ENST00000311101.5_Frame_Shift_Del_p.IFL249fs|PARL_ENST00000435888.1_Intron	NM_018622.5	NP_061092.3	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like	299					membrane protein proteolysis (GO:0033619)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|proteolysis (GO:0006508)|regulation of protein targeting to mitochondrion (GO:1903214)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(3)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	17	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GAACATCGGAAGGAAAATAATGGCAAGC	0.466																																																	0																																										SO:0001589	frameshift_variant	0			AF116692	CCDS3248.1, CCDS33897.1	3q27.3	2008-02-05		2006-02-28	ENSG00000175193	ENSG00000175193			18253	protein-coding gene	gene with protein product	"""rhomboid 7 homolog 1 (Drosophila)"""	607858		PSARL			Standard	XM_005247587		Approved	PRO2207, PSARL1, RHBDS1	uc003fmd.3	Q9H300	OTTHUMG00000156890	ENST00000317096.4:c.895_902delATTTTCCT	3.37:g.183551540_183551547delAGGAAAAT	ENSP00000325421:p.Ile299fs		Q96CQ4|Q9BTJ6|Q9P1E3	Frame_Shift_Del	DEL	pfam_Peptidase_S54_rhomboid_dom	p.I299fs	ENST00000317096.4	37	c.902_895	CCDS3248.1	3																																																																																			PARL	-	pfam_Peptidase_S54_rhomboid_dom	ENSG00000175193		0.466	PARL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARL	HGNC	protein_coding	OTTHUMT00000346465.1		0.00	70	0	AGGAAAAT	NM_018622		183551547	-1			no_errors	ENST00000317096	ensembl	human	known	74_37	frame_shift_del	9.89	82	9	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	0
PCCA	5095	genome.wustl.edu	37	13	100962086	100962086	+	Splice_Site	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr13:100962086G>T	ENST00000376285.1	+	16	1391		c.e16-1		PCCA_ENST00000376286.4_Splice_Site|PCCA_ENST00000376279.3_Splice_Site	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide						biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	CTTGTTTTTAGCTAATCACAT	0.289																																																	0													83.0	80.0	81.0					13																	100962086		2203	4300	6503	SO:0001630	splice_region_variant	0			X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.1354-1G>T	13.37:g.100962086G>T			B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Splice_Site	SNP	-	e16-1	ENST00000376285.1	37	c.1354-1	CCDS9496.2	13	.	.	.	.	.	.	.	.	.	.	G	21.7	4.181401	0.78677	.	.	ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285;ENST00000443601;ENST00000376254	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6493	0.95794	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PCCA	99760087	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	8.433000	0.90291	2.638000	0.89438	0.650000	0.86243	.	PCCA	-	-	ENSG00000175198		0.289	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCCA	HGNC	protein_coding	OTTHUMT00000045627.2		0.00	49	0	G		Intron	100962086	+1			no_errors	ENST00000376285	ensembl	human	known	74_37	splice_site	6.67	55	4	SNP	1.000	T
PCNT	5116	genome.wustl.edu	37	21	47786900	47786900	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr21:47786900A>G	ENST00000359568.5	+	15	3118	c.3011A>G	c.(3010-3012)aAg>aGg	p.K1004R	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1004					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CTGTGGAAAAAGGACTCTCTT	0.502																																																	0													120.0	130.0	126.0					21																	47786900		2203	4300	6503	SO:0001583	missense	0			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.3011A>G	21.37:g.47786900A>G	ENSP00000352572:p.Lys1004Arg		O43152|Q7Z7C9	Missense_Mutation	SNP	pfam_PACT_domain	p.K1004R	ENST00000359568.5	37	c.3011	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	A	11.91	1.779804	0.31502	.	.	ENSG00000160299	ENST00000359568	T	0.26518	1.73	5.15	1.38	0.22167	.	.	.	.	.	T	0.21590	0.0520	M	0.63843	1.955	0.09310	N	1	B;B	0.20459	0.009;0.045	B;B	0.17098	0.017;0.012	T	0.33292	-0.9874	9	0.20046	T	0.44	.	4.6571	0.12622	0.6681:0.1628:0.1691:0.0	.	886;1004	O95613-2;O95613	.;PCNT_HUMAN	R	1004	ENSP00000352572:K1004R	ENSP00000352572:K1004R	K	+	2	0	PCNT	46611328	0.997000	0.39634	0.004000	0.12327	0.004000	0.04260	1.630000	0.37081	0.000000	0.14550	0.454000	0.30748	AAG	PCNT	-	NULL	ENSG00000160299		0.502	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	-	0.00	45	0	A	NM_006031		47786900	+1	tier1	-	no_errors	ENST00000359568	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.093	G
PDE3A	5139	genome.wustl.edu	37	12	20774228	20774228	+	Splice_Site	SNP	A	A	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr12:20774228A>C	ENST00000359062.3	+	5	1464		c.e5-1		PDE3A_ENST00000544307.1_Splice_Site	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	TGGTGCTTTTAGTCCTGATTC	0.368																																																	0													84.0	76.0	78.0					12																	20774228		2203	4299	6502	SO:0001630	splice_region_variant	0				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.1425-1A>C	12.37:g.20774228A>C			O60865|Q13348|Q17RD1	Splice_Site	SNP	-	e5-2	ENST00000359062.3	37	c.1425-2	CCDS31754.1	12	.	.	.	.	.	.	.	.	.	.	A	11.78	1.739568	0.30774	.	.	ENSG00000172572	ENST00000359062	.	.	.	5.42	0.0699	0.14376	.	.	.	.	.	.	.	.	.	.	.	0.20074	N	0.999932	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.3693	0.04326	0.5297:0.1368:0.0714:0.2621	.	.	.	.	.	-1	.	.	.	+	.	.	PDE3A	20665495	0.001000	0.12720	0.016000	0.15963	0.904000	0.53231	0.420000	0.21263	-0.224000	0.09928	0.482000	0.46254	.	PDE3A	-	-	ENSG00000172572		0.368	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE3A	HGNC	protein_coding	OTTHUMT00000401756.2	-	0.00	56	0	A		Intron	20774228	+1	tier1	-	no_errors	ENST00000359062	ensembl	human	known	74_37	splice_site	21.79	61	17	SNP	0.001	C
PDIA5	10954	genome.wustl.edu	37	3	122842926	122842926	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:122842926T>C	ENST00000316218.7	+	9	718	c.623T>C	c.(622-624)aTg>aCg	p.M208T		NM_006810.3	NP_006801.1	Q14554	PDIA5_HUMAN	protein disulfide isomerase family A, member 5	208	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	oxidoreductase activity (GO:0016491)|protein disulfide isomerase activity (GO:0003756)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	21				GBM - Glioblastoma multiforme(114;0.0427)		CTGGCCGGGATGAATGTCTAC	0.567																																																	0													53.0	50.0	51.0					3																	122842926		2203	4300	6503	SO:0001583	missense	0			AK054963	CCDS3020.1	3q21.1	2009-11-20	2005-06-29		ENSG00000065485	ENSG00000065485	5.3.4.1	"""Protein disulfide isomerases"""	24811	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 5"""			7556671	Standard	NM_006810		Approved	PDIR, FLJ30401	uc003egc.2	Q14554	OTTHUMG00000159558	ENST00000316218.7:c.623T>C	3.37:g.122842926T>C	ENSP00000323313:p.Met208Thr		D3DN95|Q9BV43	Missense_Mutation	SNP	pfam_Thioredoxin_domain,pfam_AhpC/TSA,superfamily_Thioredoxin-like_fold,prints_Thioredoxin	p.M208T	ENST00000316218.7	37	c.623	CCDS3020.1	3	.	.	.	.	.	.	.	.	.	.	T	19.33	3.807820	0.70797	.	.	ENSG00000065485	ENST00000316218	T	0.22336	1.96	5.27	5.27	0.74061	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.000000	0.85682	D	0.000000	T	0.46737	0.1408	M	0.84219	2.685	0.80722	D	1	D	0.56746	0.977	P	0.61940	0.896	T	0.51180	-0.8738	10	0.59425	D	0.04	.	13.9334	0.64010	0.0:0.0:0.0:1.0	.	208	Q14554	PDIA5_HUMAN	T	208	ENSP00000323313:M208T	ENSP00000323313:M208T	M	+	2	0	PDIA5	124325616	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.872000	0.75536	2.209000	0.71365	0.533000	0.62120	ATG	PDIA5	-	pfam_Thioredoxin_domain,pfam_AhpC/TSA,superfamily_Thioredoxin-like_fold	ENSG00000065485		0.567	PDIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIA5	HGNC	protein_coding	OTTHUMT00000356192.1		0.00	78	0	T	NM_006810		122842926	+1			no_errors	ENST00000316218	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	C
PER3	8863	genome.wustl.edu	37	1	7887202	7887202	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:7887202G>A	ENST00000361923.2	+	17	2364	c.2189G>A	c.(2188-2190)cGg>cAg	p.R730Q	PER3_ENST00000377532.3_Missense_Mutation_p.R738Q|RP3-467L1.4_ENST00000451646.1_RNA	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	730	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		AAGCAGACGCGGTCGGCCGGC	0.552																																																	0													14.0	18.0	17.0					1																	7887202		2067	4135	6202	SO:0001583	missense	0			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2189G>A	1.37:g.7887202G>A	ENSP00000355031:p.Arg730Gln		Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,superfamily_PAS,smart_PAS,pfscan_PAS	p.R730Q	ENST00000361923.2	37	c.2189	CCDS89.1	1	.	.	.	.	.	.	.	.	.	.	G	7.268	0.606624	0.14002	.	.	ENSG00000049246	ENST00000377532;ENST00000361923	T;T	0.09723	2.95;2.95	4.52	1.38	0.22167	.	1.884860	0.02939	N	0.140214	T	0.09642	0.0237	L	0.47716	1.5	0.09310	N	1	P;P;P;P	0.43662	0.814;0.607;0.549;0.814	B;B;B;B	0.32724	0.151;0.087;0.134;0.151	T	0.41716	-0.9493	10	0.15066	T	0.55	.	9.2625	0.37621	0.1681:0.1583:0.6736:0.0	.	730;738;738;730	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	Q	738;730	ENSP00000366755:R738Q;ENSP00000355031:R730Q	ENSP00000355031:R730Q	R	+	2	0	PER3	7809789	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.142000	0.16096	0.175000	0.19841	-1.134000	0.01955	CGG	PER3	-	NULL	ENSG00000049246		0.552	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PER3	HGNC	protein_coding	OTTHUMT00000003607.1		0.00	42	0	G	NM_016831		7887202	+1			no_errors	ENST00000361923	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.000	A
PEX2	5828	genome.wustl.edu	37	8	77896250	77896250	+	Silent	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr8:77896250C>T	ENST00000419564.2	-	4	629	c.165G>A	c.(163-165)gaG>gaA	p.E55E	PEX2_ENST00000522527.1_Silent_p.E55E|PEX2_ENST00000357039.4_Silent_p.E55E|PEX2_ENST00000520103.1_Silent_p.E55E	NM_001172087.1	NP_001165558.1	P28328	PEX2_HUMAN	peroxisomal biogenesis factor 2	55			E -> K (in PBD5B; infantile Refsum disease). {ECO:0000269|PubMed:10528859}.		bile acid biosynthetic process (GO:0006699)|cholesterol homeostasis (GO:0042632)|fatty acid beta-oxidation (GO:0006635)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein destabilization (GO:0031648)|protein import into peroxisome matrix (GO:0016558)|regulation of cholesterol biosynthetic process (GO:0045540)|very long-chain fatty acid metabolic process (GO:0000038)	Cdc73/Paf1 complex (GO:0016593)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	14						ACGCTTTCACCTCTGGCTCAA	0.433																																																	0													69.0	69.0	69.0					8																	77896250		2203	4300	6503	SO:0001819	synonymous_variant	0			M86852	CCDS6221.1	8q21.11	2010-02-09	2010-01-25	2010-01-25		ENSG00000164751		"""RING-type (C3HC4) zinc fingers"""	9717	protein-coding gene	gene with protein product	"""Zellweger syndrome"", ""peroxin 2"""	170993	"""peroxisomal membrane protein 3 (35kD, Zellweger syndrome)"", ""peroxisomal membrane protein 3, 35kDa"""	PXMP3		1546315, 8858157	Standard	NM_000318		Approved	PMP35, PAF-1, RNF72, ZWS3	uc022awf.1	P28328		ENST00000419564.2:c.165G>A	8.37:g.77896250C>T			Q567S6|Q9BW41	Silent	SNP	pfam_Pex_N,smart_Znf_RING,pfscan_Znf_RING	p.E55	ENST00000419564.2	37	c.165	CCDS6221.1	8																																																																																			PEX2	-	pfam_Pex_N	ENSG00000164751		0.433	PEX2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX2	HGNC	protein_coding	OTTHUMT00000379122.1	-	0.00	92	0	C	NM_000318		77896250	-1	tier1	-	no_errors	ENST00000357039	ensembl	human	known	74_37	silent	16.67	95	19	SNP	0.996	T
PHC2	1912	genome.wustl.edu	37	1	33796985	33796985	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:33796985C>T	ENST00000257118.5	-	11	2020	c.1967G>A	c.(1966-1968)cGt>cAt	p.R656H	PHC2_ENST00000373422.3_Missense_Mutation_p.R262H|PHC2_ENST00000373418.3_Missense_Mutation_p.R121H|PHC2_ENST00000419414.2_Missense_Mutation_p.R657H|PHC2_ENST00000373416.1_Missense_Mutation_p.R121H|PHC2_ENST00000431992.1_Missense_Mutation_p.R627H|PHC2_ENST00000485928.1_5'UTR|MIR3605_ENST00000583214.1_RNA	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	656					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GCGCTTGGAACGCTTGAACTT	0.522																																																	0													124.0	133.0	130.0					1																	33796985		2203	4300	6503	SO:0001583	missense	0			AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.1967G>A	1.37:g.33796985C>T	ENSP00000257118:p.Arg656His		A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.R657H	ENST00000257118.5	37	c.1970	CCDS378.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.682738	0.96774	.	.	ENSG00000134686	ENST00000431992;ENST00000257118;ENST00000373422;ENST00000373418;ENST00000307890;ENST00000419414;ENST00000373416	T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79	5.85	5.85	0.93711	Zinc finger, FCS-type (1);	0.117635	0.64402	D	0.000008	T	0.68851	0.3046	M	0.82193	2.58	0.53688	D	0.999975	D;D;D;D	0.76494	0.999;0.999;0.999;0.992	P;P;P;P	0.59221	0.854;0.854;0.854;0.736	T	0.72871	-0.4161	10	0.72032	D	0.01	-11.7522	17.6714	0.88218	0.0:1.0:0.0:0.0	.	657;628;656;71	A8KA40;B7ZLY0;Q8IXK0;Q8IXK0-3	.;.;PHC2_HUMAN;.	H	627;656;262;121;234;657;121	ENSP00000389436:R627H;ENSP00000257118:R656H;ENSP00000362521:R262H;ENSP00000362517:R121H;ENSP00000391440:R657H;ENSP00000362515:R121H	ENSP00000257118:R656H	R	-	2	0	PHC2	33569572	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.343000	0.79319	2.771000	0.95319	0.561000	0.74099	CGT	PHC2	-	pfscan_Znf_FCS	ENSG00000134686		0.522	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHC2	HGNC	protein_coding	OTTHUMT00000011895.1	-	0.00	92	0	C	NM_198040		33796985	-1	tier1	-	no_errors	ENST00000419414	ensembl	human	known	74_37	missense	26.60	69	25	SNP	1.000	T
PHKB	5257	genome.wustl.edu	37	16	47699944	47699944	+	Intron	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:47699944G>A	ENST00000323584.5	+	25	2451				PHKB_ENST00000299167.8_Splice_Site|PHKB_ENST00000566044.1_Splice_Site|PHKB_ENST00000455779.1_Intron	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta						carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				GGGCAAACAGGTAAGTATTTG	0.463																																																	0													86.0	86.0	86.0					16																	47699944		1861	4102	5963	SO:0001627	intron_variant	0				CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.2427+1058G>A	16.37:g.47699944G>A			Q8N4T5	Splice_Site	SNP	-	e25+1	ENST00000323584.5	37	c.2427+1	CCDS10729.1	16	.	.	.	.	.	.	.	.	.	.	G	25.5	4.646005	0.87958	.	.	ENSG00000102893	ENST00000299167	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.125	0.93378	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PHKB	46257445	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.535000	0.98064	2.572000	0.86782	0.650000	0.86243	.	PHKB	-	-	ENSG00000102893		0.463	PHKB-002	KNOWN	basic|CCDS	protein_coding	PHKB	HGNC	protein_coding	OTTHUMT00000430413.1	-	0.00	60	0	G			47699944	+1	tier1	-	no_errors	ENST00000299167	ensembl	human	known	74_37	splice_site	5.00	76	4	SNP	1.000	A
PIGT	51604	genome.wustl.edu	37	20	44045206	44045206	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr20:44045206G>T	ENST00000279036.6	+	2	317	c.237G>T	c.(235-237)aaG>aaT	p.K79N	PIGT_ENST00000341555.5_Intron|PIGT_ENST00000279035.9_Intron|PIGT_ENST00000543458.2_Missense_Mutation_p.K79N|PIGT_ENST00000372689.5_Missense_Mutation_p.K79N|PIGT_ENST00000545755.1_Intron|PIGT_ENST00000535404.1_5'UTR	NM_015937.5	NP_057021.2	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class T	79					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|post-translational protein modification (GO:0043687)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)	p.K79K(2)		breast(1)|endometrium(2)|kidney(5)|large_intestine(4)|lung(7)|pancreas(1)|skin(1)|stomach(1)	22		Myeloproliferative disorder(115;0.0122)				TGATCTCCAAGTATTCTCTAC	0.597																																																	2	Substitution - coding silent(2)	breast(2)											38.0	38.0	38.0					20																	44045206		2203	4300	6503	SO:0001583	missense	0				CCDS13353.1, CCDS54464.1, CCDS54465.1, CCDS54466.1	20q12-q13.12	2013-02-26	2006-06-28		ENSG00000124155	ENSG00000124155		"""Phosphatidylinositol glycan anchor biosynthesis"""	14938	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610272	"""phosphatidylinositol glycan, class T"""			15713669	Standard	NM_015937		Approved		uc002xoh.3	Q969N2	OTTHUMG00000032574	ENST00000279036.6:c.237G>T	20.37:g.44045206G>T	ENSP00000279036:p.Lys79Asn		B2RND5|B7Z3N1|B7Z7I8|E1P622|G8JLF5|Q2NL69|Q7Z3N7|Q9BQY7|Q9BQY8|Q9UJG6|Q9Y2Z5	Missense_Mutation	SNP	pfam_PIG-T	p.K79N	ENST00000279036.6	37	c.237	CCDS13353.1	20	.	.	.	.	.	.	.	.	.	.	G	24.0	4.483889	0.84854	.	.	ENSG00000124155	ENST00000543458;ENST00000372689;ENST00000279036	T;T;T	0.46451	0.87;0.87;0.87	5.94	4.99	0.66335	.	0.099543	0.64402	D	0.000003	T	0.56688	0.2002	L	0.60455	1.87	0.80722	D	1	D;P;D	0.69078	0.997;0.792;0.984	D;P;P	0.67231	0.95;0.542;0.855	T	0.54814	-0.8237	10	0.35671	T	0.21	-28.028	12.1106	0.53838	0.1422:0.0:0.8578:0.0	.	79;79;79	B7Z3N1;B7Z7C5;Q969N2	.;.;PIGT_HUMAN	N	79	ENSP00000441577:K79N;ENSP00000361774:K79N;ENSP00000279036:K79N	ENSP00000279036:K79N	K	+	3	2	PIGT	43478620	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.868000	0.56055	1.516000	0.48900	0.557000	0.71058	AAG	PIGT	-	pfam_PIG-T	ENSG00000124155		0.597	PIGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGT	HGNC	protein_coding	OTTHUMT00000079434.2	-	0.00	61	0	G	NM_015937		44045206	+1	tier1	-	no_errors	ENST00000279036	ensembl	human	known	74_37	missense	18.57	57	13	SNP	1.000	T
PITRM1	10531	genome.wustl.edu	37	10	3208496	3208496	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr10:3208496G>T	ENST00000224949.4	-	4	377	c.343C>A	c.(343-345)Cag>Aag	p.Q115K	PITRM1-AS1_ENST00000598280.1_RNA|PITRM1-AS1_ENST00000601046.1_RNA|PITRM1_ENST00000380989.2_Missense_Mutation_p.Q115K|PITRM1_ENST00000451104.2_Missense_Mutation_p.Q83K			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	115					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						GGATATTTCTGAGACCCACAA	0.493																																																	0													163.0	165.0	164.0					10																	3208496		1984	4161	6145	SO:0001583	missense	0			AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.343C>A	10.37:g.3208496G>T	ENSP00000224949:p.Gln115Lys		B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	pfam_Peptidase_M16C_assoc,pfam_Peptidase_M16_C,pfam_Pept_M16_N,superfamily_Metalloenz_LuxS/M16	p.Q115K	ENST00000224949.4	37	c.343	CCDS59208.1	10	.	.	.	.	.	.	.	.	.	.	g	2.196	-0.384211	0.04966	.	.	ENSG00000107959	ENST00000224949;ENST00000380980;ENST00000380989;ENST00000451104	T;T;T	0.23754	1.89;1.89;1.89	5.55	0.922	0.19408	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);Peptidase M16, N-terminal (1);	0.601162	0.19063	N	0.123703	T	0.09113	0.0225	N	0.01761	-0.735	0.09310	N	0.999998	B;B;B;B;B;B	0.06786	0.0;0.001;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.12156	0.001;0.007;0.001;0.002;0.002;0.004	T	0.34104	-0.9842	10	0.23302	T	0.38	.	10.9398	0.47266	0.0:0.1186:0.5138:0.3676	.	108;83;115;115;115;108	E9PDX6;E7ES23;Q5JRX3-2;C9JSL2;Q5JRX3;B4DH07	.;.;.;.;PREP_HUMAN;.	K	115;108;115;83	ENSP00000224949:Q115K;ENSP00000370377:Q115K;ENSP00000401201:Q83K	ENSP00000224949:Q115K	Q	-	1	0	PITRM1	3198496	0.980000	0.34600	0.897000	0.35233	0.051000	0.14879	1.615000	0.36922	0.655000	0.30866	0.456000	0.33151	CAG	PITRM1	-	pfam_Pept_M16_N,superfamily_Metalloenz_LuxS/M16	ENSG00000107959		0.493	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PITRM1	HGNC	protein_coding	OTTHUMT00000046469.2	-	0.00	72	0	G			3208496	-1	tier1	-	no_errors	ENST00000380989	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.176	T
PIK3AP1	118788	genome.wustl.edu	37	10	98469469	98469469	+	Silent	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr10:98469469C>T	ENST00000339364.5	-	2	404	c.285G>A	c.(283-285)ccG>ccA	p.P95P		NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	95	Necessary and sufficent to mediate inhibition of NF-kappa-B downstream of activated TLRs; may mediate interaction with MYD88 and TIRAP. {ECO:0000250}.				negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		CCACGCGGTGCGGAGGATGGA	0.637																																																	0													60.0	60.0	60.0					10																	98469469		2203	4300	6503	SO:0001819	synonymous_variant	0			AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.285G>A	10.37:g.98469469C>T			Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Silent	SNP	superfamily_Ankyrin_rpt-contain_dom	p.P95	ENST00000339364.5	37	c.285	CCDS31259.1	10																																																																																			PIK3AP1	-	NULL	ENSG00000155629		0.637	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3AP1	HGNC	protein_coding	OTTHUMT00000049619.2	-	0.00	50	0	C	NM_152309		98469469	-1	tier1	-	no_errors	ENST00000339364	ensembl	human	known	74_37	silent	19.23	42	10	SNP	0.001	T
PLEKHM3	389072	genome.wustl.edu	37	2	208842214	208842214	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:208842214G>A	ENST00000427836.2	-	3	1196	c.707C>T	c.(706-708)tCa>tTa	p.S236L	PLEKHM3_ENST00000457206.1_Missense_Mutation_p.S236L|PLEKHM3_ENST00000389247.4_Missense_Mutation_p.S236L	NM_001080475.2	NP_001073944.1	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M, member 3	236	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GTTGTAAGGTGAAAGTTCTGC	0.428																																																	0													237.0	226.0	229.0					2																	208842214		1939	4141	6080	SO:0001583	missense	0			AK057612	CCDS42808.1	2q33.3	2013-01-10	2008-04-03	2008-04-03	ENSG00000178385	ENSG00000178385		"""Pleckstrin homology (PH) domain containing"""	34006	protein-coding gene	gene with protein product	"""differentiation associated protein"""		"""pleckstrin homology domain containing, family M, member 1-like"""	PLEKHM1L		19028694	Standard	NM_001080475		Approved	DAPR	uc002vcl.2	Q6ZWE6	OTTHUMG00000154781	ENST00000427836.2:c.707C>T	2.37:g.208842214G>A	ENSP00000417003:p.Ser236Leu		B9EKV2|Q8WW68	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S236L	ENST00000427836.2	37	c.707	CCDS42808.1	2	.	.	.	.	.	.	.	.	.	.	G	26.8	4.768232	0.90020	.	.	ENSG00000178385	ENST00000427836;ENST00000389247;ENST00000457206	T;T;T	0.29397	1.57;1.57;1.57	5.96	5.96	0.96718	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.073632	0.53938	D	0.000042	T	0.41396	0.1157	L	0.27053	0.805	0.58432	D	0.999996	D;D	0.60575	0.988;0.988	P;P	0.57204	0.815;0.761	T	0.22871	-1.0204	10	0.87932	D	0	-0.9034	20.4116	0.99017	0.0:0.0:1.0:0.0	.	236;236	C9J119;Q6ZWE6	.;PKHM3_HUMAN	L	236	ENSP00000417003:S236L;ENSP00000373899:S236L;ENSP00000400150:S236L	ENSP00000373899:S236L	S	-	2	0	PLEKHM3	208550459	1.000000	0.71417	0.580000	0.28601	0.838000	0.47535	9.230000	0.95299	2.827000	0.97445	0.655000	0.94253	TCA	PLEKHM3	-	smart_Pleckstrin_homology	ENSG00000178385		0.428	PLEKHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM3	HGNC	protein_coding	OTTHUMT00000337036.1	-	0.00	64	0	G	NM_001080475		208842214	-1	tier1	-	no_errors	ENST00000427836	ensembl	human	known	74_37	missense	18.52	88	20	SNP	0.994	A
POMP	51371	genome.wustl.edu	37	13	29242660	29242660	+	Silent	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr13:29242660G>A	ENST00000380842.4	+	4	294	c.213G>A	c.(211-213)caG>caA	p.Q71Q	POMP_ENST00000460403.1_3'UTR	NM_015932.5	NP_057016.1	Q9Y244	POMP_HUMAN	proteasome maturation protein	71					proteasome assembly (GO:0043248)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				endometrium(2)|kidney(1)|large_intestine(1)	4		Lung SC(185;0.0367)		all cancers(112;0.141)|OV - Ovarian serous cystadenocarcinoma(117;0.216)		GAAACATTCAGGGTCTATTTG	0.373																																																	0													115.0	109.0	111.0					13																	29242660		2203	4300	6503	SO:0001819	synonymous_variant	0			AF077200	CCDS9331.1	13q12.13	2013-11-11	2006-07-04	2006-07-04	ENSG00000132963	ENSG00000132963			20330	protein-coding gene	gene with protein product	"""proteassemblin"""	613386	"""chromosome 13 open reading frame 12"""	C13orf12		11042152	Standard	NM_015932		Approved	HSPC014, UMP1	uc001usf.3	Q9Y244	OTTHUMG00000016652	ENST00000380842.4:c.213G>A	13.37:g.29242660G>A			A5HKJ2|D6MXU3|Q9HB69	Silent	SNP	pfam_UMP1	p.Q71	ENST00000380842.4	37	c.213	CCDS9331.1	13																																																																																			POMP	-	pfam_UMP1	ENSG00000132963		0.373	POMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMP	HGNC	protein_coding	OTTHUMT00000044327.1	-	0.00	68	0	G	NM_015932		29242660	+1	tier1	-	no_errors	ENST00000380842	ensembl	human	known	74_37	silent	17.86	46	10	SNP	1.000	A
HNRNPM	4670	genome.wustl.edu	37	19	8555253	8555253	+	IGR	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr19:8555253C>T	ENST00000325495.4	+	0	2494				PRAM1_ENST00000423345.4_Silent_p.E648E|PRAM1_ENST00000255612.3_Silent_p.E647E	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						ACACCTCCGTCTCCCTGGCAG	0.672																																																	0													61.0	66.0	64.0					19																	8555253		2165	4259	6424	SO:0001628	intergenic_variant	0			L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383		19.37:g.8555253C>T			Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Silent	SNP	superfamily_SH3_domain	p.E648	ENST00000325495.4	37	c.1944	CCDS12203.1	19																																																																																			PRAM1	-	NULL	ENSG00000133246		0.672	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRAM1	HGNC	protein_coding	OTTHUMT00000460894.1	-	0.00	64	0	C			8555253	-1	tier1	-	no_errors	ENST00000423345	ensembl	human	known	74_37	silent	31.91	32	15	SNP	1.000	T
PRB3	5544	genome.wustl.edu	37	12	11420400	11420400	+	Silent	SNP	T	T	C	rs528598166	byFrequency	TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr12:11420400T>C	ENST00000279573.7	-	3	918	c.783A>G	c.(781-783)ccA>ccG	p.P261P	PRB3_ENST00000538488.1_Silent_p.P219P|PRB3_ENST00000440870.3_Intron|PRB3_ENST00000381842.3_Silent_p.P219P			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	198	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			CTGGACGAGGTGGGGGACCTT	0.597													t|||	14	0.00279553	0.003	0.0	5008	,	,		13596	0.0089		0.0	False		,,,				2504	0.001																0													168.0	170.0	170.0					12																	11420400		2162	4258	6420	SO:0001819	synonymous_variant	0					12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.783A>G	12.37:g.11420400T>C			Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Silent	SNP	NULL	p.P219	ENST00000279573.7	37	c.657		12																																																																																			PRB3	-	NULL	ENSG00000197870		0.597	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	PRB3	HGNC	protein_coding	OTTHUMT00000402119.5	-	0.00	117	0	T	NM_006249		11420400	-1	tier1	-	no_errors	ENST00000381842	ensembl	human	known	74_37	silent	26.53	108	39	SNP	0.004	C
PSME3	10197	genome.wustl.edu	37	17	40990730	40990730	+	Intron	SNP	A	A	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr17:40990730A>G	ENST00000590720.1	+	7	638				PSME3_ENST00000545225.1_Intron|PSME3_ENST00000293362.3_Missense_Mutation_p.I143V|PSME3_ENST00000592169.1_Intron|PSME3_ENST00000441946.2_Intron|PSME3_ENST00000541124.1_Intron			P61289	PSME3_HUMAN	proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)			NS(1)|cervix(1)|large_intestine(3)|lung(1)	6		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		AGGTCCTCATATATGTTTTGA	0.463																																																	0													76.0	78.0	77.0					17																	40990730		2203	4300	6503	SO:0001627	intron_variant	0			U11292	CCDS11442.1, CCDS45689.1, CCDS59290.1	17q12-q21	2004-02-17				ENSG00000131467		"""Proteasome (prosome, macropain) subunits"""	9570	protein-coding gene	gene with protein product		605129				7951316	Standard	NM_005789		Approved	Ki, PA28-gamma, REG-GAMMA, PA28G	uc002ibq.4	P61289		ENST00000590720.1:c.406-18A>G	17.37:g.40990730A>G			A8K9A3|O35563|P97373|Q12920|Q13172|Q9BQD9	Missense_Mutation	SNP	pfam_Proteasome_activ_pa28_C,pfam_Proteasome_activ_pa28_N,superfamily_Proteasome_activ_pa28	p.I143V	ENST00000590720.1	37	c.427	CCDS45689.1	17	.	.	.	.	.	.	.	.	.	.	A	2.111	-0.403685	0.04832	.	.	ENSG00000131467	ENST00000293362	T	0.20881	2.04	4.49	-0.215	0.13157	.	4.036170	0.01265	N	0.009294	T	0.08358	0.0208	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22906	-1.0203	9	0.06099	T	0.92	-7.1679	3.6424	0.08172	0.4314:0.0:0.2423:0.3264	.	143	P61289-2	.	V	143	ENSP00000293362:I143V	ENSP00000293362:I143V	I	+	1	0	PSME3	38244256	0.000000	0.05858	0.001000	0.08648	0.364000	0.29643	-0.509000	0.06336	0.035000	0.15519	0.533000	0.62120	ATA	PSME3	-	pfam_Proteasome_activ_pa28_C,superfamily_Proteasome_activ_pa28	ENSG00000131467		0.463	PSME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME3	HGNC	protein_coding	OTTHUMT00000452430.1	-	0.00	43	0	A	NM_176863		40990730	+1	tier1	-	no_errors	ENST00000293362	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.000	G
PTH2	113091	genome.wustl.edu	37	19	49926531	49926533	+	In_Frame_Del	DEL	CAG	CAG	-	rs200733272|rs371950649	byFrequency	TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr19:49926531_49926533delCAG	ENST00000270631.1	-	1	165_167	c.64_66delCTG	c.(64-66)ctgdel	p.L22del	CTD-3148I10.1_ENST00000576655.1_5'Flank	NM_178449.3	NP_848544.1	Q96A98	TIP39_HUMAN	parathyroid hormone 2	22					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.L22V(2)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)		AGGGCACCACcagcagcagcagc	0.69																																																	2	Substitution - Missense(2)	endometrium(2)																																								SO:0001651	inframe_deletion	0			AY037555	CCDS12763.1	19q13.33	2013-02-28				ENSG00000142538		"""Endogenous ligands"""	30828	protein-coding gene	gene with protein product	"""tuberoinfundibular 39 residues"""	608386				11861531	Standard	NM_178449		Approved	TIP39	uc002pnn.1	Q96A98		ENST00000270631.1:c.64_66delCTG	19.37:g.49926540_49926542delCAG	ENSP00000270631:p.Leu22del		Q96DJ4	In_Frame_Del	DEL	NULL	p.L22in_frame_del	ENST00000270631.1	37	c.66_64	CCDS12763.1	19																																																																																			PTH2	-	NULL	ENSG00000142538		0.690	PTH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH2	HGNC	protein_coding	OTTHUMT00000465366.1		0.00	125	0	CAG	NM_178449		49926533	-1			no_errors	ENST00000270631	ensembl	human	known	74_37	in_frame_del	5.65	117	7	DEL	0.016:0.132:0.132	0
PURG	29942	genome.wustl.edu	37	8	30889849	30889849	+	Silent	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr8:30889849C>T	ENST00000475541.1	-	1	1382	c.450G>A	c.(448-450)caG>caA	p.Q150Q	WRN_ENST00000298139.5_5'Flank|PURG_ENST00000339382.2_Silent_p.Q150Q	NM_013357.2	NP_037489.1	Q9UJV8	PURG_HUMAN	purine-rich element binding protein G	150						nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)		CCGAGTGCTTCTGCCTCCTTC	0.557																																																	0													79.0	84.0	82.0					8																	30889849		2203	4300	6503	SO:0001819	synonymous_variant	0			AF195513	CCDS34878.1, CCDS6081.1	8p11	2004-02-09			ENSG00000172733	ENSG00000172733			17930	protein-coding gene	gene with protein product						12034829	Standard	NM_013357		Approved	PURG-A, PURG-B	uc003xin.3	Q9UJV8	OTTHUMG00000157357	ENST00000475541.1:c.450G>A	8.37:g.30889849C>T			Q8TE64	Silent	SNP	pfam_PUR_DNA_RNA-bd,smart_PUR_DNA_RNA-bd	p.Q150	ENST00000475541.1	37	c.450	CCDS6081.1	8																																																																																			PURG	-	pfam_PUR_DNA_RNA-bd	ENSG00000172733		0.557	PURG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PURG	HGNC	protein_coding	OTTHUMT00000348565.1	-	0.00	25	0	C	NM_013357		30889849	-1	tier1	-	no_errors	ENST00000475541	ensembl	human	known	74_37	silent	31.25	22	10	SNP	0.169	T
QRFPR	84109	genome.wustl.edu	37	4	122250821	122250821	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr4:122250821G>A	ENST00000394427.2	-	6	1355	c.944C>T	c.(943-945)gCt>gTt	p.A315V	Y_RNA_ENST00000384419.1_RNA|QRFPR_ENST00000334383.5_3'UTR	NM_198179.2	NP_937822.2	Q96P65	QRFPR_HUMAN	pyroglutamylated RFamide peptide receptor	315					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(2)|skin(3)|stomach(1)	28						TTGCACGATAGCAAAAATCAT	0.274																																																	0													33.0	34.0	34.0					4																	122250821		2202	4299	6501	SO:0001583	missense	0			AF411117	CCDS3719.1	4q27	2012-08-10	2008-12-18	2008-12-18	ENSG00000186867	ENSG00000186867		"""GPCR / Class A : RF amide peptide receptors"""	15565	protein-coding gene	gene with protein product		606925	"""G protein-coupled receptor 103"""	GPR103		11574155	Standard	NM_198179		Approved		uc010inj.1	Q96P65	OTTHUMG00000133036	ENST00000394427.2:c.944C>T	4.37:g.122250821G>A	ENSP00000377948:p.Ala315Val			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NPFF_rcpt	p.A315V	ENST00000394427.2	37	c.944	CCDS3719.1	4	.	.	.	.	.	.	.	.	.	.	G	22.3	4.273412	0.80580	.	.	ENSG00000186867	ENST00000394427	T	0.36157	1.27	5.47	4.57	0.56435	GPCR, rhodopsin-like superfamily (1);	0.050711	0.85682	D	0.000000	T	0.50000	0.1590	L	0.48986	1.54	0.80722	D	1	D	0.76494	0.999	D	0.70227	0.968	T	0.28396	-1.0045	10	0.15952	T	0.53	.	15.1062	0.72324	0.0:0.2513:0.7487:0.0	.	315	Q96P65	QRFPR_HUMAN	V	315	ENSP00000377948:A315V	ENSP00000377948:A315V	A	-	2	0	QRFPR	122470271	1.000000	0.71417	0.977000	0.42913	0.972000	0.66771	5.311000	0.65786	2.569000	0.86673	0.491000	0.48974	GCT	QRFPR	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000186867		0.274	QRFPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QRFPR	HGNC	protein_coding	OTTHUMT00000256641.2	-	0.00	68	0	G	NM_198179		122250821	-1	tier1	-	no_errors	ENST00000394427	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.996	A
RAET1G	353091	genome.wustl.edu	37	6	150240472	150240472	+	Intron	SNP	A	A	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:150240472A>G	ENST00000367360.2	-	3	417				RAET1G_ENST00000479265.1_Intron|RP11-244K5.8_ENST00000606915.1_RNA|RAET1E-AS1_ENST00000446954.2_RNA|RAET1E-AS1_ENST00000605899.1_RNA	NM_001001788.2	NP_001001788.2			retinoic acid early transcript 1G											NS(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|urinary_tract(1)	13		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.73e-12)		TGCCCCCATCAAAGAGAGATC	0.552																																																	0													98.0	95.0	96.0					6																	150240472		2203	4300	6503	SO:0001627	intron_variant	0			AY172579	CCDS43514.1	6q24.1-25.1	2009-04-29	2004-11-22		ENSG00000203722	ENSG00000203722			16795	protein-coding gene	gene with protein product		609244	"""retinoic acid early transcript 1G pseudogene"""			11827464, 15240696	Standard	NM_001001788		Approved	ULBP5	uc010kii.1	Q6H3X3	OTTHUMG00000015802	ENST00000367360.2:c.350-12T>C	6.37:g.150240472A>G				RNA	SNP	-	NULL	ENST00000367360.2	37	NULL	CCDS43514.1	6																																																																																			RAET1E-AS1	-	-	ENSG00000223701		0.552	RAET1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAET1E-AS1	HGNC	protein_coding	OTTHUMT00000042668.2	-	0.00	89	0	A			150240472	+1	tier1	-	no_errors	ENST00000446954	ensembl	human	known	74_37	rna	11.11	48	6	SNP	0.000	G
ROBO4	54538	genome.wustl.edu	37	11	124761271	124761271	+	Silent	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:124761271G>A	ENST00000306534.3	-	12	2357	c.1872C>T	c.(1870-1872)ctC>ctT	p.L624L	RP11-664I21.6_ENST00000524433.1_5'UTR|ROBO4_ENST00000533054.1_Silent_p.L479L	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	624					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		TGCGGCTGCAGAGGCTGTCTG	0.637																																																	0													30.0	33.0	32.0					11																	124761271		2201	4299	6500	SO:0001819	synonymous_variant	0			AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.1872C>T	11.37:g.124761271G>A			A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L624	ENST00000306534.3	37	c.1872	CCDS8455.1	11																																																																																			ROBO4	-	NULL	ENSG00000154133		0.637	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO4	HGNC	protein_coding	OTTHUMT00000387111.1	-	0.00	99	0	G	NM_019055		124761271	-1	tier1	-	no_errors	ENST00000306534	ensembl	human	known	74_37	silent	49.41	43	42	SNP	1.000	A
RTN1	6252	genome.wustl.edu	37	14	60193766	60193766	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr14:60193766C>A	ENST00000267484.5	-	3	1971	c.1636G>T	c.(1636-1638)Gag>Tag	p.E546*		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	546					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		ATGGGCGTCTCAGGCTCCAGG	0.692																																																	0													21.0	25.0	24.0					14																	60193766		2203	4300	6503	SO:0001587	stop_gained	0			L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.1636G>T	14.37:g.60193766C>A	ENSP00000267484:p.Glu546*		Q16800|Q16801|Q5BKZ4|Q9BQ59	Nonsense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.E546*	ENST00000267484.5	37	c.1636	CCDS9740.1	14	.	.	.	.	.	.	.	.	.	.	C	39	7.557301	0.98358	.	.	ENSG00000139970	ENST00000432103;ENST00000267484;ENST00000433623	.	.	.	4.89	0.304	0.15796	.	0.935084	0.09036	N	0.857985	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	4.6341	0.12516	0.0:0.3971:0.3411:0.2617	.	.	.	.	X	126;546;472	.	ENSP00000267484:E546X	E	-	1	0	RTN1	59263519	0.017000	0.18338	0.010000	0.14722	0.009000	0.06853	0.806000	0.27126	0.450000	0.26774	0.563000	0.77884	GAG	RTN1	-	NULL	ENSG00000139970		0.692	RTN1-001	KNOWN	basic|CCDS	protein_coding	RTN1	HGNC	protein_coding	OTTHUMT00000072278.2	-	0.00	109	0	C			60193766	-1	tier1	-	no_errors	ENST00000267484	ensembl	human	known	74_37	nonsense	36.76	43	25	SNP	0.001	A
SARM1	23098	genome.wustl.edu	37	17	26708470	26708470	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr17:26708470C>A	ENST00000457710.3	+	2	1088	c.617C>A	c.(616-618)gCg>gAg	p.A206E	SARM1_ENST00000379061.4_3'UTR|CTB-96E2.3_ENST00000591482.1_RNA|TMEM199_ENST00000509083.1_Silent_p.G260G	NM_015077.2	NP_055892.2	Q6SZW1	SARM1_HUMAN	sterile alpha and TIR motif containing 1	240					innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of apoptotic process (GO:0042981)|regulation of dendrite morphogenesis (GO:0048814)|regulation of neuron death (GO:1901214)|response to glucose (GO:0009749)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of mitochondrial outer membrane (GO:0031315)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|synapse (GO:0045202)				cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	12	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		GGGGGCCAGGCGGTGCAGCGA	0.716																																																	0													5.0	6.0	5.0					17																	26708470		2084	4111	6195	SO:0001583	missense	0			AB011096		17q11	2013-01-10			ENSG00000004139	ENSG00000004139		"""Sterile alpha motif (SAM) domain containing"""	17074	protein-coding gene	gene with protein product		607732				9628581	Standard	NM_015077		Approved	SARM, SAMD2, KIAA0524	uc010crl.1	Q6SZW1	OTTHUMG00000132499	ENST00000457710.3:c.617C>A	17.37:g.26708470C>A	ENSP00000406738:p.Ala206Glu		O60277|Q7LGG3|Q9NXY5	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_ARM-type_fold,superfamily_TIR_dom,superfamily_SAM/pointed,smart_SAM,smart_TIR_dom,pfscan_SAM	p.A206E	ENST00000457710.3	37	c.617		17	.	.	.	.	.	.	.	.	.	.	C	10.30	1.312360	0.23908	.	.	ENSG00000004139	ENST00000457710;ENST00000003834	.	.	.	5.22	2.92	0.33932	Armadillo-like helical (1);Armadillo-type fold (1);	0.347413	0.30011	N	0.010637	T	0.12987	0.0315	.	.	.	0.23043	N	0.998389	B	0.12630	0.006	B	0.15052	0.012	T	0.34675	-0.9819	8	0.02654	T	1	-4.1794	5.79	0.18355	0.118:0.4624:0.3413:0.0783	.	240	Q6SZW1	SARM1_HUMAN	E	238;206	.	ENSP00000003834:A206E	A	+	2	0	SARM1	23732597	1.000000	0.71417	0.993000	0.49108	0.990000	0.78478	1.541000	0.36126	0.417000	0.25871	0.563000	0.77884	GCG	SARM1	-	superfamily_ARM-type_fold	ENSG00000004139		0.716	SARM1-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	SARM1	HGNC	protein_coding	OTTHUMT00000255679.3		0.00	20	0	C	NM_015077		26708470	+1			no_errors	ENST00000457710	ensembl	human	novel	74_37	missense	31.25	11	5	SNP	0.980	A
SCAF11	9169	genome.wustl.edu	37	12	46318804	46318804	+	Missense_Mutation	SNP	T	T	C	rs150376258		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr12:46318804T>C	ENST00000369367.3	-	12	3846	c.3613A>G	c.(3613-3615)Ata>Gta	p.I1205V	SCAF11_ENST00000419565.2_Missense_Mutation_p.I1205V|SCAF11_ENST00000550629.1_5'Flank|SCAF11_ENST00000465950.1_Missense_Mutation_p.I890V|SCAF11_ENST00000549162.1_Missense_Mutation_p.I1013V	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	1205					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						ATCATATTTATAGGTAGCTGA	0.368																																																	0								T	VAL/ILE	0,4406		0,0,2203	145.0	138.0	140.0		3613	-3.6	0.1	12	dbSNP_134	140	1,8599	1.2+/-3.3	0,1,4299	no	missense	SCAF11	NM_004719.2	29	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign	1205/1464	46318804	1,13005	2203	4300	6503	SO:0001583	missense	0			Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.3613A>G	12.37:g.46318804T>C	ENSP00000358374:p.Ile1205Val		A6NEU9|A6NLW5|Q8IW59	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.I1205V	ENST00000369367.3	37	c.3613	CCDS8748.2	12	.	.	.	.	.	.	.	.	.	.	T	7.851	0.723971	0.15439	0.0	1.16E-4	ENSG00000139218	ENST00000465950;ENST00000369367;ENST00000549162;ENST00000419565	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.01	-3.62	0.04543	.	0.618598	0.15980	N	0.235321	T	0.19485	0.0468	N	0.21448	0.665	0.21445	N	0.999689	B	0.09022	0.002	B	0.04013	0.001	T	0.37337	-0.9710	10	0.02654	T	1	-0.6999	9.4266	0.38583	0.0:0.4868:0.116:0.3972	.	1205	Q99590	SCAFB_HUMAN	V	890;1205;1013;1205	ENSP00000449812:I890V;ENSP00000358374:I1205V;ENSP00000448864:I1013V;ENSP00000413036:I1205V	ENSP00000358374:I1205V	I	-	1	0	SCAF11	44605071	0.923000	0.31300	0.105000	0.21289	0.987000	0.75469	-0.166000	0.09954	-0.876000	0.04017	0.383000	0.25322	ATA	SCAF11	-	NULL	ENSG00000139218		0.368	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF11	HGNC	protein_coding	OTTHUMT00000313992.2	-	0.00	138	0	T	NM_004719		46318804	-1	tier1	rs150376258	no_errors	ENST00000369367	ensembl	human	known	74_37	missense	18.67	122	28	SNP	0.840	C
SCUBE3	222663	genome.wustl.edu	37	6	35211895	35211895	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:35211895T>A	ENST00000274938.7	+	17	2227	c.2227T>A	c.(2227-2229)Tgt>Agt	p.C743S	SCUBE3_ENST00000394681.1_Missense_Mutation_p.C759S	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						CTTCCAAGACTGTGACACCAA	0.572																																																	0													81.0	72.0	75.0					6																	35211895		2203	4300	6503	SO:0001583	missense	0			AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.2227T>A	6.37:g.35211895T>A	ENSP00000274938:p.Cys743Ser			Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EG-like_dom,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom,prints_Thrombomodulin	p.C759S	ENST00000274938.7	37	c.2275	CCDS4800.1	6	.	.	.	.	.	.	.	.	.	.	T	20.5	4.008063	0.75046	.	.	ENSG00000146197	ENST00000394681;ENST00000274938	D;D	0.86865	-2.18;-2.18	5.75	5.75	0.90469	Tyrosine-protein kinase ephrin type A/B receptor-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.95965	0.8686	H	0.98276	4.19	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.80764	0.99;0.994	D	0.97732	1.0203	10	0.87932	D	0	.	16.0545	0.80788	0.0:0.0:0.0:1.0	.	759;743	Q8IX30-2;Q8IX30	.;SCUB3_HUMAN	S	759;743	ENSP00000378174:C759S;ENSP00000274938:C743S	ENSP00000274938:C743S	C	+	1	0	SCUBE3	35319873	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.195000	0.70347	0.533000	0.62120	TGT	SCUBE3	-	pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom	ENSG00000146197		0.572	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE3	HGNC	protein_coding	OTTHUMT00000040275.1	-	0.00	44	0	T	NM_152753		35211895	+1	tier1	-	no_errors	ENST00000394681	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	A
SEMA6D	80031	genome.wustl.edu	37	15	48062933	48062933	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr15:48062933G>T	ENST00000316364.5	+	19	2612	c.2173G>T	c.(2173-2175)Gtc>Ttc	p.V725F	SEMA6D_ENST00000558816.1_3'UTR|SEMA6D_ENST00000558014.1_Missense_Mutation_p.V663F|SEMA6D_ENST00000358066.4_Missense_Mutation_p.V663F|SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000389428.3_Missense_Mutation_p.V650F|SEMA6D_ENST00000536845.2_Missense_Mutation_p.V725F|SEMA6D_ENST00000389432.2_Missense_Mutation_p.V682F|SEMA6D_ENST00000537942.1_Missense_Mutation_p.V663F|SEMA6D_ENST00000354744.4_Missense_Mutation_p.V669F|SEMA6D_ENST00000389433.2_Missense_Mutation_p.V706F	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	725					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TGACAGCCCTGTCAAGGAATA	0.438																																																	0													81.0	77.0	78.0					15																	48062933		2198	4297	6495	SO:0001583	missense	0			AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.2173G>T	15.37:g.48062933G>T	ENSP00000324857:p.Val725Phe		A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.V725F	ENST00000316364.5	37	c.2173	CCDS32225.1	15	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506919	0.64410	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428	T;T;T;T;T;T;T;T	0.18502	2.21;2.25;2.25;2.24;2.22;2.22;2.21;2.22	5.76	5.76	0.90799	.	0.059007	0.64402	D	0.000002	T	0.37812	0.1017	L	0.44542	1.39	0.80722	D	1	D;D;D;D	0.89917	0.989;0.989;1.0;0.989	P;P;D;P	0.85130	0.831;0.888;0.997;0.831	T	0.02307	-1.1179	10	0.56958	D	0.05	.	19.962	0.97255	0.0:0.0:1.0:0.0	.	650;669;725;663	Q8NFY4-3;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;SEM6D_HUMAN;.	F	663;725;725;706;682;669;663;650	ENSP00000442040:V663F;ENSP00000446152:V725F;ENSP00000324857:V725F;ENSP00000374084:V706F;ENSP00000374083:V682F;ENSP00000346786:V669F;ENSP00000350770:V663F;ENSP00000374079:V650F	ENSP00000324857:V725F	V	+	1	0	SEMA6D	45850225	1.000000	0.71417	0.899000	0.35326	0.822000	0.46500	7.637000	0.83313	2.705000	0.92388	0.655000	0.94253	GTC	SEMA6D	-	NULL	ENSG00000137872		0.438	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA6D	HGNC	protein_coding	OTTHUMT00000416868.1	-	0.00	21	0	G	NM_024966		48062933	+1	tier1	-	no_errors	ENST00000316364	ensembl	human	known	74_37	missense	46.15	14	12	SNP	1.000	T
SGTA	6449	genome.wustl.edu	37	19	2762546	2762546	+	Silent	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr19:2762546G>A	ENST00000221566.2	-	7	755	c.594C>T	c.(592-594)aaC>aaT	p.N198N		NM_003021.3	NP_003012.1	O43765	SGTA_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha	198					viral process (GO:0016032)	cytoplasm (GO:0005737)				endometrium(2)|large_intestine(2)|lung(2)|ovary(1)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTATCTTGAGGTTGGACTTGT	0.642																																																	0													122.0	115.0	117.0					19																	2762546		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ223828	CCDS12094.1	19p13	2013-01-10	2003-11-24	2003-11-26		ENSG00000104969		"""Tetratricopeptide (TTC) repeat domain containing"""	10819	protein-coding gene	gene with protein product		603419	"""small glutamine-rich tetratricopeptide repeat (TPR)-containing"""	SGT		9740675, 12735788	Standard	NM_003021		Approved		uc002lwi.1	O43765		ENST00000221566.2:c.594C>T	19.37:g.2762546G>A			D6W610|Q6FIA9|Q9BTZ9	Silent	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.N198	ENST00000221566.2	37	c.594	CCDS12094.1	19																																																																																			SGTA	-	NULL	ENSG00000104969		0.642	SGTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGTA	HGNC	protein_coding	OTTHUMT00000451448.2	-	0.00	23	0	G	NM_003021		2762546	-1	tier1	-	no_errors	ENST00000221566	ensembl	human	known	74_37	silent	32.00	17	8	SNP	1.000	A
SLC16A3	9123	genome.wustl.edu	37	17	80193919	80193919	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr17:80193919G>T	ENST00000581287.1	+	1	2357	c.35G>T	c.(34-36)gGc>gTc	p.G12V	SLC16A3_ENST00000584781.1_3'UTR|SLC16A3_ENST00000392341.1_Missense_Mutation_p.G12V|SLC16A3_ENST00000582743.1_Missense_Mutation_p.G12V|SLC16A3_ENST00000392339.1_Missense_Mutation_p.G12V	NM_001206951.1|NM_001206952.1	NP_001193880.1|NP_001193881.1	O15427	MOT4_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 3	12					blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|leukocyte migration (GO:0050900)|monocarboxylic acid transport (GO:0015718)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|poly(A) RNA binding (GO:0044822)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	Breast(20;0.00285)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0149)		Gamma Hydroxybutyric Acid(DB01440)|Niacin(DB00627)|Pyruvic acid(DB00119)	GGCCCCACAGGCGTCAAGGCC	0.667																																					Pancreas(52;652 1135 19190 37282 52456)												0													44.0	39.0	40.0					17																	80193919		2201	4297	6498	SO:0001583	missense	0			U81800	CCDS11804.1	17q25.3	2013-07-18	2013-07-18		ENSG00000141526	ENSG00000141526		"""Solute carriers"""	10924	protein-coding gene	gene with protein product		603877	"""solute carrier family 16 (monocarboxylic acid transporters), member 3"", ""solute carrier family 16, member 3 (monocarboxylic acid transporter 4)"""			9425115	Standard	NM_004207		Approved	MCT3, MCT4	uc021ufm.1	O15427	OTTHUMG00000178832	ENST00000581287.1:c.35G>T	17.37:g.80193919G>T	ENSP00000463978:p.Gly12Val		B3KXG8|Q2M1P8	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.G12V	ENST00000581287.1	37	c.35	CCDS11804.1	17	.	.	.	.	.	.	.	.	.	.	G	12.11	1.840479	0.32513	.	.	ENSG00000141526	ENST00000392341;ENST00000392339	T;T	0.58210	0.35;0.35	5.2	5.2	0.72013	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.64402	D	0.000001	T	0.49098	0.1537	L	0.45698	1.435	0.80722	D	1	B;P	0.49307	0.248;0.922	B;B	0.42625	0.103;0.393	T	0.44787	-0.9305	10	0.25751	T	0.34	.	17.7274	0.88369	0.0:0.0:1.0:0.0	.	12;12	Q53G91;O15427	.;MOT4_HUMAN	V	12	ENSP00000376152:G12V;ENSP00000376150:G12V	ENSP00000376150:G12V	G	+	2	0	SLC16A3	77787208	1.000000	0.71417	0.204000	0.23530	0.127000	0.20565	6.519000	0.73768	2.416000	0.81992	0.563000	0.77884	GGC	SLC16A3	-	superfamily_MFS_dom_general_subst_transpt,tigrfam_Monocarb_transpt	ENSG00000141526		0.667	SLC16A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A3	HGNC	protein_coding	OTTHUMT00000443498.1		0.00	80	0	G	NM_004207		80193919	+1			no_errors	ENST00000392339	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.999	T
CAPN1	823	genome.wustl.edu	37	11	64981506	64981506	+	IGR	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:64981506G>A	ENST00000527323.1	+	0	3086				SLC22A20_ENST00000525437.1_RNA			P07384	CAN1_HUMAN	calpain 1, (mu/I) large subunit						extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)|receptor catabolic process (GO:0032801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		CCGGGGCCCTGCCAACCACAC	0.706																																																	0													9.0	14.0	12.0					11																	64981506		1920	4106	6026	SO:0001628	intergenic_variant	0			X04366	CCDS44644.1	11q13	2013-01-10			ENSG00000014216	ENSG00000014216	3.4.22.52	"""EF-hand domain containing"""	1476	protein-coding gene	gene with protein product		114220				3017764, 2209092	Standard	NM_005186		Approved	muCANP, muCL, CANP, CANPL1	uc009yqd.2	P07384	OTTHUMG00000165614		11.37:g.64981506G>A			Q2TTR0|Q6DHV4	RNA	SNP	-	NULL	ENST00000527323.1	37	NULL	CCDS44644.1	11																																																																																			SLC22A20	-	-	ENSG00000197847		0.706	CAPN1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC22A20	HGNC	protein_coding	OTTHUMT00000385325.1		0.00	106	0	G			64981506	+1			no_errors	ENST00000525264	ensembl	human	known	74_37	rna	5.21	90	5	SNP	0.002	A
SLC30A10	55532	genome.wustl.edu	37	1	220101732	220101732	+	Silent	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:220101732G>T	ENST00000366926.3	-	1	212	c.51C>A	c.(49-51)ctC>ctA	p.L17L	SLC30A10_ENST00000536992.1_Silent_p.L17L|SLC30A10_ENST00000536446.1_Intron	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	17					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		AGGCGACGGTGAGCACCAGCA	0.687																																					Colon(76;360 1614 43677 51136)												0													39.0	45.0	43.0					1																	220101732		2203	4298	6501	SO:0001819	synonymous_variant	0			AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.51C>A	1.37:g.220101732G>T			Q49AL9|Q9NPW0	Silent	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.L17	ENST00000366926.3	37	c.51	CCDS31026.1	1																																																																																			SLC30A10	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000196660		0.687	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A10	HGNC	protein_coding	OTTHUMT00000357709.1	-	0.00	32	0	G	NM_018713		220101732	-1	tier1	-	no_errors	ENST00000366926	ensembl	human	known	74_37	silent	8.33	44	4	SNP	1.000	T
SLC30A9	10463	genome.wustl.edu	37	4	42072671	42072671	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr4:42072671C>T	ENST00000264451.7	+	15	1561	c.1381C>T	c.(1381-1383)Cgg>Tgg	p.R461W		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	461					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						ACAAGTACAACGGCTCACTGA	0.448																																																	0													151.0	125.0	134.0					4																	42072671		2203	4300	6503	SO:0001583	missense	0			AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.1381C>T	4.37:g.42072671C>T	ENSP00000264451:p.Arg461Trp		Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Missense_Mutation	SNP	pfam_Cation_efflux,superfamily_DNA-bd_dom_put,tigrfam_Cation_efflux	p.R461W	ENST00000264451.7	37	c.1381	CCDS3465.1	4	.	.	.	.	.	.	.	.	.	.	C	14.84	2.656294	0.47467	.	.	ENSG00000014824	ENST00000264451;ENST00000536881	T	0.63913	-0.07	5.25	3.42	0.39159	.	0.117157	0.64402	D	0.000020	T	0.60183	0.2249	M	0.70595	2.14	0.48236	D	0.999615	B	0.32693	0.38	B	0.28139	0.086	T	0.62946	-0.6746	10	0.87932	D	0	-7.9561	14.0334	0.64629	0.2761:0.7239:0.0:0.0	.	461	Q6PML9	ZNT9_HUMAN	W	461;289	ENSP00000264451:R461W	ENSP00000264451:R461W	R	+	1	2	SLC30A9	41767428	1.000000	0.71417	0.895000	0.35142	0.785000	0.44390	3.120000	0.50430	0.622000	0.30249	0.655000	0.94253	CGG	SLC30A9	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000014824		0.448	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A9	HGNC	protein_coding	OTTHUMT00000216842.3	-	0.00	56	0	C			42072671	+1	tier1	-	no_errors	ENST00000264451	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.999	T
SLC3A1	6519	genome.wustl.edu	37	2	44513196	44513196	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:44513196G>C	ENST00000260649.6	+	4	867	c.791G>C	c.(790-792)tGg>tCg	p.W264S	SLC3A1_ENST00000410056.3_Missense_Mutation_p.W264S|SLC3A1_ENST00000409380.1_5'UTR|SLC3A1_ENST00000409741.1_Missense_Mutation_p.W264S|SLC3A1_ENST00000409229.3_Missense_Mutation_p.W264S|SLC3A1_ENST00000409387.1_Missense_Mutation_p.W264S	NM_000341.3	NP_000332.2	Q07837	SLC31_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 1	264					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|basic amino acid transport (GO:0015802)|carbohydrate metabolic process (GO:0005975)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|vacuolar membrane (GO:0005774)	amino acid transmembrane transporter activity (GO:0015171)|basic amino acid transmembrane transporter activity (GO:0015174)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|L-cystine transmembrane transporter activity (GO:0015184)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(3)	26		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	AACTCCAGTTGGCACTTTGAC	0.378																																																	0													168.0	161.0	163.0					2																	44513196		2203	4300	6503	SO:0001583	missense	0				CCDS1819.1	2p16.3	2013-07-19	2013-07-19		ENSG00000138079	ENSG00000138079		"""Solute carriers"""	11025	protein-coding gene	gene with protein product		104614	"""solute carrier family 3 (cystine, dibasic and neutral amino acid transporters, activator of cystine, dibasic and neutral amino acid transport), member 1"""			8486766, 9186880	Standard	NM_000341		Approved	CSNU1, D2H, RBAT, ATR1, NBAT	uc002ruc.4	Q07837	OTTHUMG00000128759	ENST00000260649.6:c.791G>C	2.37:g.44513196G>C	ENSP00000260649:p.Trp264Ser		A8K0S1|O00658|Q15295|Q4J6B4|Q4J6B5|Q4J6B6|Q4J6B7|Q4J6B8|Q4J6B9|Q52M92|Q52M94	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	p.W264S	ENST00000260649.6	37	c.791	CCDS1819.1	2	.	.	.	.	.	.	.	.	.	.	G	22.3	4.270599	0.80469	.	.	ENSG00000138079	ENST00000260649;ENST00000409387;ENST00000540334;ENST00000410056;ENST00000409741;ENST00000409229;ENST00000541289;ENST00000427285	D;D;D;D;D;D	0.98792	-5.14;-5.14;-5.14;-5.14;-5.14;-5.14	4.98	4.98	0.66077	Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99563	0.9843	H	0.98721	4.31	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;0.997	D	0.97612	1.0130	10	0.87932	D	0	-10.2983	18.2507	0.90002	0.0:0.0:1.0:0.0	.	264;264;264;264;264	Q07837;B8ZZK1;Q4J6B5;Q4J6B6;Q4J6B8	SLC31_HUMAN;.;.;.;.	S	264;264;200;264;264;264;264;42	ENSP00000260649:W264S;ENSP00000387308:W264S;ENSP00000387337:W264S;ENSP00000386954:W264S;ENSP00000386620:W264S;ENSP00000391642:W42S	ENSP00000260649:W264S	W	+	2	0	SLC3A1	44366700	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.269000	0.95684	2.301000	0.77427	0.591000	0.81541	TGG	SLC3A1	-	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	ENSG00000138079		0.378	SLC3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC3A1	HGNC	protein_coding	OTTHUMT00000250676.1	-	0.00	45	0	G	NM_000341		44513196	+1	tier1	-	no_errors	ENST00000260649	ensembl	human	known	74_37	missense	10.81	66	8	SNP	1.000	C
SLC48A1	55652	genome.wustl.edu	37	12	48173962	48173962	+	Silent	SNP	C	C	T	rs200530736	byFrequency	TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr12:48173962C>T	ENST00000442218.2	+	3	436	c.339C>T	c.(337-339)agC>agT	p.S113S	SLC48A1_ENST00000442892.2_Silent_p.S56S|SLC48A1_ENST00000547002.1_Silent_p.S56S	NM_017842.2	NP_060312.2	Q6P1K1	HRG1_HUMAN	solute carrier family 48 (heme transporter), member 1	113					heme transport (GO:0015886)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	heme transporter activity (GO:0015232)			large_intestine(1)|lung(3)|urinary_tract(1)	5						ACCTCTCCAGCGTCTGGAGCT	0.597													C|||	2	0.000399361	0.0015	0.0	5008	,	,		19309	0.0		0.0	False		,,,				2504	0.0																0													22.0	25.0	24.0					12																	48173962		2202	4299	6501	SO:0001819	synonymous_variant	0				CCDS8755.2	12q13.11	2013-05-22			ENSG00000211584	ENSG00000211584		"""Solute carriers"""	26035	protein-coding gene	gene with protein product		612187				18418376	Standard	NM_017842		Approved	FLJ20489, hHRG-1, HRG1	uc001rqd.3	Q6P1K1	OTTHUMG00000156983	ENST00000442218.2:c.339C>T	12.37:g.48173962C>T			Q9BUB3|Q9NX17	Silent	SNP	NULL	p.S113	ENST00000442218.2	37	c.339	CCDS8755.2	12																																																																																			SLC48A1	-	NULL	ENSG00000211584		0.597	SLC48A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC48A1	HGNC	protein_coding	OTTHUMT00000346966.1		0.00	62	0	C	NM_017842		48173962	+1			no_errors	ENST00000442218	ensembl	human	known	74_37	silent	5.33	71	4	SNP	0.761	T
SLC5A10	125206	genome.wustl.edu	37	17	18916758	18916758	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr17:18916758C>T	ENST00000395645.3	+	10	1036	c.1018C>T	c.(1018-1020)Cgg>Tgg	p.R340W	SLC5A10_ENST00000395642.1_Missense_Mutation_p.R273W|SLC5A10_ENST00000417251.2_Intron|SLC5A10_ENST00000317977.6_Missense_Mutation_p.R273W|SLC5A10_ENST00000395643.2_Missense_Mutation_p.R313W|SLC5A10_ENST00000395647.2_Missense_Mutation_p.R356W	NM_001042450.2	NP_001035915.1	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 10	340					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(3)|ovary(3)|prostate(3)|skin(3)	24						CGAGTGCCTGCGGGCCTGCGG	0.627																																																	0													62.0	54.0	57.0					17																	18916758		2203	4300	6503	SO:0001583	missense	0				CCDS11201.2, CCDS42275.1, CCDS59277.1, CCDS59278.1, CCDS74008.1	17p11.2	2013-07-19	2013-07-19		ENSG00000154025	ENSG00000154025		"""Solute carriers"""	23155	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 10"""				Standard	NM_152351		Approved	SGLT5	uc002gut.2	A0PJK1	OTTHUMG00000178143	ENST00000395645.3:c.1018C>T	17.37:g.18916758C>T	ENSP00000379007:p.Arg340Trp		A8MUC9|B4DPI0|B7WPR4|Q6P5X0|Q8IXM4|Q96LQ1	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.R356W	ENST00000395645.3	37	c.1066	CCDS42275.1	17	.	.	.	.	.	.	.	.	.	.	C	16.34	3.095605	0.56075	.	.	ENSG00000154025	ENST00000317977;ENST00000395647;ENST00000395642;ENST00000395645;ENST00000395643	D;D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46;-2.46	4.04	2.99	0.34606	.	0.284419	0.34002	N	0.004360	D	0.93291	0.7862	M	0.84846	2.72	0.45307	D	0.998307	D;D;D;D	0.71674	0.997;0.997;0.997;0.998	P;P;P;D	0.66716	0.761;0.846;0.888;0.946	D	0.93250	0.6634	10	0.87932	D	0	.	9.1701	0.37076	0.1604:0.6835:0.1561:0.0	.	313;340;356;273	A0PJK1-2;A0PJK1;A0PJK1-4;A0PJK1-3	.;SC5AA_HUMAN;.;.	W	273;356;273;340;313	ENSP00000324346:R273W;ENSP00000379008:R356W;ENSP00000379004:R273W;ENSP00000379007:R340W;ENSP00000379005:R313W	ENSP00000324346:R273W	R	+	1	2	SLC5A10	18857483	0.002000	0.14202	1.000000	0.80357	0.423000	0.31445	0.370000	0.20433	1.978000	0.57642	0.313000	0.20887	CGG	SLC5A10	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000154025		0.627	SLC5A10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A10	HGNC	protein_coding	OTTHUMT00000132129.2	-	0.00	53	0	C	NM_152351		18916758	+1	tier1	-	no_errors	ENST00000395647	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
SLC6A17	388662	genome.wustl.edu	37	1	110709554	110709554	+	Start_Codon_SNP	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:110709554G>T	ENST00000331565.4	+	2	488	c.3G>T	c.(1-3)atG>atT	p.M1I	RP5-1028L10.1_ENST00000443008.1_RNA|RP5-1028L10.1_ENST00000418579.1_RNA|RP5-1028L10.1_ENST00000430098.1_RNA	NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17	1					alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		TGGCATCAATGCCGAAGAACA	0.577																																																	0													47.0	44.0	45.0					1																	110709554		2203	4300	6503	SO:0001582	initiator_codon_variant	0				CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.3G>T	1.37:g.110709554G>T	ENSP00000330199:p.Met1Ile		A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.M1I	ENST00000331565.4	37	c.3	CCDS30799.1	1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.840577	0.91197	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	T	0.74002	-0.8	4.31	4.31	0.51392	.	0.000000	0.85682	D	0.000000	D	0.82742	0.5103	.	.	.	0.80722	D	1	D	0.65815	0.995	D	0.65323	0.934	D	0.85636	0.1273	9	0.72032	D;D	0.01;0.01	.	16.9598	0.86269	0.0:0.0:1.0:0.0	.	1	Q9H1V8	S6A17_HUMAN	I	1	ENSP00000330199:M1I	ENSP00000330199:M1I;ENSP00000330199:M1I	M	+	3	0	SLC6A17	110511077	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.657000	0.98554	2.221000	0.72209	0.563000	0.77884	ATG	SLC6A17	-	NULL	ENSG00000197106		0.577	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A17	HGNC	protein_coding	OTTHUMT00000032550.2		0.00	28	0	G	XM_371280	Missense_Mutation	110709554	+1			no_errors	ENST00000331565	ensembl	human	known	74_37	missense	26.67	11	4	SNP	1.000	T
SLC8A1	6546	genome.wustl.edu	37	2	40656660	40656660	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:40656660C>A	ENST00000403092.1	-	2	794	c.761G>T	c.(760-762)aGg>aTg	p.R254M	SLC8A1_ENST00000405269.1_Missense_Mutation_p.R254M|SLC8A1_ENST00000405901.3_Missense_Mutation_p.R254M|SLC8A1_ENST00000406785.2_Missense_Mutation_p.R254M|SLC8A1_ENST00000332839.4_Missense_Mutation_p.R254M|SLC8A1_ENST00000406391.2_Missense_Mutation_p.R254M|SLC8A1_ENST00000542756.1_Missense_Mutation_p.R254M|SLC8A1_ENST00000542024.1_Missense_Mutation_p.R254M|SLC8A1_ENST00000402441.1_Missense_Mutation_p.R254M|SLC8A1_ENST00000408028.2_Missense_Mutation_p.R254M			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	254	Calmodulin-binding. {ECO:0000255}.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CAGAAGTCTCCTATCCGCTAC	0.448																																																	0													97.0	98.0	98.0					2																	40656660		2203	4300	6503	SO:0001583	missense	0				CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.761G>T	2.37:g.40656660C>A	ENSP00000384763:p.Arg254Met		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,pfscan_DnaJ_domain,prints_Na_Ca_Ex,prints_NaCa_exhngr1,tigrfam_Na_Ca_Ex	p.R254M	ENST00000403092.1	37	c.761	CCDS1806.1	2	.	.	.	.	.	.	.	.	.	.	C	12.29	1.892285	0.33442	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.32023	1.49;1.52;1.52;1.52;1.49;1.49;1.52;1.47;1.49;1.49	5.96	5.09	0.68999	.	0.044679	0.85682	D	0.000000	T	0.61022	0.2314	M	0.89095	3.005	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.997;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.997;0.996;0.982;0.992	T	0.68780	-0.5318	10	0.72032	D	0.01	.	12.9583	0.58442	0.0:0.9223:0.0:0.0777	.	254;254;254;254;254	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	M	254	ENSP00000383886:R254M;ENSP00000440727:R254M;ENSP00000384763:R254M;ENSP00000385678:R254M;ENSP00000385188:R254M;ENSP00000385535:R254M;ENSP00000332931:R254M;ENSP00000384908:R254M;ENSP00000385811:R254M;ENSP00000443515:R254M	ENSP00000332931:R254M	R	-	2	0	SLC8A1	40510164	1.000000	0.71417	0.977000	0.42913	0.098000	0.18820	7.663000	0.83820	1.540000	0.49301	0.655000	0.94253	AGG	SLC8A1	-	tigrfam_Na_Ca_Ex	ENSG00000183023		0.448	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A1	HGNC	protein_coding	OTTHUMT00000326065.1	-	0.00	47	0	C	NM_021097		40656660	-1	tier1	-	no_errors	ENST00000332839	ensembl	human	known	74_37	missense	11.11	72	9	SNP	1.000	A
SLCO1C1	53919	genome.wustl.edu	37	12	20874792	20874792	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr12:20874792G>C	ENST00000266509.2	+	8	1198	c.830G>C	c.(829-831)gGc>gCc	p.G277A	SLCO1C1_ENST00000545102.1_Missense_Mutation_p.G159A|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.G228A|SLCO1C1_ENST00000381552.1_Missense_Mutation_p.G277A|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.G277A	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	277					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	TGGTGGCTTGGCTATCTAATA	0.428																																																	0													77.0	76.0	77.0					12																	20874792		2203	4300	6503	SO:0001583	missense	0			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.830G>C	12.37:g.20874792G>C	ENSP00000266509:p.Gly277Ala		B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.G277A	ENST00000266509.2	37	c.830	CCDS8683.1	12	.	.	.	.	.	.	.	.	.	.	G	24.2	4.509396	0.85282	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.56444	0.46;0.46;0.46;0.46;0.46	4.63	4.63	0.57726	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.78898	0.4356	M	0.91920	3.255	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.97110	1.0;0.996;0.998;0.998	D	0.84403	0.0561	10	0.87932	D	0	.	18.0443	0.89327	0.0:0.0:1.0:0.0	.	159;228;277;277	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	A	277;228;277;277;159	ENSP00000444149:G277A;ENSP00000438665:G228A;ENSP00000266509:G277A;ENSP00000370964:G277A;ENSP00000444527:G159A	ENSP00000266509:G277A	G	+	2	0	SLCO1C1	20766059	1.000000	0.71417	0.971000	0.41717	0.970000	0.65996	9.169000	0.94788	2.555000	0.86185	0.467000	0.42956	GGC	SLCO1C1	-	pfam_OA_transporter,pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000139155		0.428	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1C1	HGNC	protein_coding	OTTHUMT00000401765.1	-	0.00	76	0	G	NM_017435		20874792	+1	tier1	-	no_errors	ENST00000381552	ensembl	human	known	74_37	missense	18.18	54	12	SNP	1.000	C
SLCO3A1	28232	genome.wustl.edu	37	15	92706515	92706516	+	3'UTR	INS	-	-	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr15:92706515_92706516insT	ENST00000318445.6	+	0	2497_2498				SLCO3A1_ENST00000555549.1_3'UTR|RP11-24J19.1_ENST00000557683.1_RNA|SLCO3A1_ENST00000424469.2_Intron|RP11-152L20.3_ENST00000561674.1_RNA	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1						sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	CGACTTTGTCCTTTTTCTCAGC	0.48																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.*151->T	15.37:g.92706520_92706520dupT			A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	RNA	INS	-	NULL	ENST00000318445.6	37	NULL	CCDS10371.1	15																																																																																			SLCO3A1	-	-	ENSG00000176463		0.480	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO3A1	HGNC	protein_coding	OTTHUMT00000313529.1		0.00	42	0	-	NM_013272		92706516	+1	tier1		no_errors	ENST00000555549	ensembl	human	known	74_37	rna	5.56	34	2	INS	0.996:0.998	T
SLMAP	7871	genome.wustl.edu	37	3	57743485	57743485	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:57743485G>A	ENST00000428312.1	+	1	201	c.107G>A	c.(106-108)cGc>cAc	p.R36H	SLMAP_ENST00000449503.2_Missense_Mutation_p.R36H|SLMAP_ENST00000295952.3_Missense_Mutation_p.R36H|SLMAP_ENST00000295951.3_Missense_Mutation_p.R36H|SLMAP_ENST00000383718.3_Missense_Mutation_p.R36H|SLMAP_ENST00000416870.1_De_novo_Start_OutOfFrame			Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	36	FHA. {ECO:0000255|PROSITE- ProRule:PRU00086}.|Necessary for targeting to centrosomes. {ECO:0000250}.				muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|smooth endoplasmic reticulum (GO:0005790)				endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(2)	18				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		TCAGTGGCCCGCTGTCGACCA	0.547																																																	0													70.0	63.0	65.0					3																	57743485		2203	4300	6503	SO:0001583	missense	0			AF100750	CCDS33774.1	3p21.2-p14.3	2008-07-18			ENSG00000163681	ENSG00000163681			16643	protein-coding gene	gene with protein product	"""Sarcolemmal-associated protein"""	602701				9405447, 11042152	Standard	NM_007159		Approved	SLAP, KIAA1601	uc003djd.1	Q14BN4	OTTHUMG00000133764	ENST00000428312.1:c.107G>A	3.37:g.57743485G>A	ENSP00000398661:p.Arg36His		Q14C95|Q6AI54|Q6UXC9|Q6ZVQ8|Q8NCW9|Q9H297|Q9HCH1|Q9Y681	Missense_Mutation	SNP	pfam_FHA_dom,pfam_PFD_beta-like,superfamily_SMAD_FHA_domain,superfamily_Prefoldin,smart_FHA_dom,pfscan_FHA_dom	p.R36H	ENST00000428312.1	37	c.107		3	.	.	.	.	.	.	.	.	.	.	G	34	5.396895	0.96009	.	.	ENSG00000163681	ENST00000295951;ENST00000295952;ENST00000383718;ENST00000428312;ENST00000449503	T;T;T;T;T	0.53857	1.22;1.22;0.6;1.2;1.23	5.61	5.61	0.85477	Forkhead-associated (FHA) domain (4);SMAD/FHA domain (1);	0.000000	0.85682	D	0.000000	T	0.72953	0.3525	M	0.66439	2.03	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.997;0.998;0.989;0.996	T	0.74702	-0.3576	10	0.87932	D	0	-3.5469	19.6271	0.95682	0.0:0.0:1.0:0.0	.	36;36;36;36	Q14BN4-2;Q14BN4;Q14BN4-3;Q14BN4-6	.;SLMAP_HUMAN;.;.	H	36	ENSP00000295951:R36H;ENSP00000295952:R36H;ENSP00000373224:R36H;ENSP00000398661:R36H;ENSP00000412945:R36H	ENSP00000295951:R36H	R	+	2	0	SLMAP	57718525	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.804000	0.99143	2.645000	0.89757	0.591000	0.81541	CGC	SLMAP	-	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	ENSG00000163681		0.547	SLMAP-013	KNOWN	basic	protein_coding	SLMAP	HGNC	protein_coding	OTTHUMT00000351584.1		0.00	37	0	G	NM_007159		57743485	+1			no_errors	ENST00000428312	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	A
SLX4	84464	genome.wustl.edu	37	16	3656556	3656556	+	Missense_Mutation	SNP	C	C	T	rs147872182	byFrequency	TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:3656556C>T	ENST00000294008.3	-	3	1319	c.679G>A	c.(679-681)Gct>Act	p.A227T		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	227	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)	p.A227T(1)		breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						TCTTCTGAAGCGTGTCTCAAA	0.542								Direct reversal of damage																																									1	Substitution - Missense(1)	endometrium(1)						C	THR/ALA	3,4391	6.2+/-15.9	0,3,2194	222.0	221.0	221.0		679	0.3	0.0	16	dbSNP_134	221	0,8600		0,0,4300	no	missense	SLX4	NM_032444.2	58	0,3,6494	TT,TC,CC		0.0,0.0683,0.0231	probably-damaging	227/1835	3656556	3,12991	2197	4300	6497	SO:0001583	missense	0			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.679G>A	16.37:g.3656556C>T	ENSP00000294008:p.Ala227Thr		Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.A227T	ENST00000294008.3	37	c.679	CCDS10506.2	16	.	.	.	.	.	.	.	.	.	.	C	11.03	1.519860	0.27211	6.83E-4	0.0	ENSG00000188827	ENST00000294008	T	0.01172	5.23	5.16	0.307	0.15811	.	0.828114	0.10825	N	0.629986	T	0.00724	0.0024	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.46830	-0.9163	10	0.16420	T	0.52	.	6.9685	0.24637	0.0:0.4325:0.0:0.5675	.	227	Q8IY92	SLX4_HUMAN	T	227	ENSP00000294008:A227T	ENSP00000294008:A227T	A	-	1	0	SLX4	3596557	0.000000	0.05858	0.004000	0.12327	0.098000	0.18820	-0.425000	0.07017	0.268000	0.21939	-0.137000	0.14449	GCT	SLX4	-	NULL	ENSG00000188827		0.542	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLX4	HGNC	protein_coding	OTTHUMT00000157301.3	-	0.00	63	0	C	NM_032444		3656556	-1	tier1	rs147872182	no_errors	ENST00000294008	ensembl	human	known	74_37	missense	48.15	28	26	SNP	0.015	T
SNTB1	6641	genome.wustl.edu	37	8	121644774	121644774	+	Silent	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr8:121644774G>T	ENST00000395601.3	-	4	1320	c.906C>A	c.(904-906)acC>acA	p.T302T	SNTB1_ENST00000519177.1_5'UTR|SNTB1_ENST00000517992.1_Silent_p.T302T	NM_021021.3	NP_066301.1	Q13884	SNTB1_HUMAN	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)	302					muscle contraction (GO:0006936)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|protein complex (GO:0043234)|synapse (GO:0045202)				NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(6)	24	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CAATCACTCGGGTCAGCAGGT	0.537																																																	0													109.0	92.0	98.0					8																	121644774		2203	4300	6503	SO:0001819	synonymous_variant	0			AF028828	CCDS6334.1	8q23-q24	2013-01-10	2002-08-29		ENSG00000172164	ENSG00000172164		"""Pleckstrin homology (PH) domain containing"""	11168	protein-coding gene	gene with protein product	"""tax interaction protein 43"""	600026	"""syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1)"""	SNT2B1		8183929, 9482110	Standard	NM_021021		Approved	59-DAP, A1B, BSYN2, TIP-43, SNT2	uc010mdg.3	Q13884	OTTHUMG00000165041	ENST00000395601.3:c.906C>A	8.37:g.121644774G>T			A8K9E0|O14912|Q4KMG8	Silent	SNP	pfam_PDZ,pfam_Pleckstrin_homology,superfamily_PDZ,smart_Pleckstrin_homology,smart_PDZ,pfscan_PDZ,pfscan_Pleckstrin_homology	p.T302	ENST00000395601.3	37	c.906	CCDS6334.1	8																																																																																			SNTB1	-	NULL	ENSG00000172164		0.537	SNTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTB1	HGNC	protein_coding	OTTHUMT00000381535.1	-	0.00	38	0	G	NM_021021		121644774	-1	tier1	-	no_errors	ENST00000395601	ensembl	human	known	74_37	silent	7.14	52	4	SNP	0.575	T
SOCS6	9306	genome.wustl.edu	37	18	67992415	67992415	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr18:67992415G>A	ENST00000397942.3	+	2	827	c.511G>A	c.(511-513)Gtc>Atc	p.V171I	SOCS6_ENST00000582322.1_Missense_Mutation_p.V171I	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	171					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)		p.V171I(1)		NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				CCTGAATGGCGTCCGGAAGGA	0.567																																					Melanoma(84;1024 1361 24382 36583 42651)												1	Substitution - Missense(1)	large_intestine(1)											62.0	54.0	57.0					18																	67992415		2203	4300	6503	SO:0001583	missense	0			AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.511G>A	18.37:g.67992415G>A	ENSP00000381034:p.Val171Ile		Q8WUM3	Missense_Mutation	SNP	pfam_SOCS_C,pfam_SH2,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2	p.V171I	ENST00000397942.3	37	c.511	CCDS11998.1	18	.	.	.	.	.	.	.	.	.	.	G	8.963	0.971131	0.18659	.	.	ENSG00000170677	ENST00000397942	T	0.28895	1.59	5.12	5.12	0.69794	.	0.220919	0.36893	N	0.002352	T	0.24509	0.0594	L	0.34521	1.04	0.51012	D	0.999901	B	0.31968	0.349	B	0.17722	0.019	T	0.03175	-1.1064	10	0.38643	T	0.18	-11.8366	18.5771	0.91159	0.0:0.0:1.0:0.0	.	171	O14544	SOCS6_HUMAN	I	171	ENSP00000381034:V171I	ENSP00000381034:V171I	V	+	1	0	SOCS6	66143395	1.000000	0.71417	0.041000	0.18516	0.005000	0.04900	4.990000	0.63876	2.371000	0.80710	0.561000	0.74099	GTC	SOCS6	-	NULL	ENSG00000170677		0.567	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS6	HGNC	protein_coding	OTTHUMT00000256270.2	-	0.00	38	0	G			67992415	+1	tier1	-	no_errors	ENST00000397942	ensembl	human	known	74_37	missense	46.55	31	27	SNP	0.993	A
SPATS2	65244	genome.wustl.edu	37	12	49919998	49919998	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr12:49919998G>A	ENST00000553127.1	+	15	2111	c.1598G>A	c.(1597-1599)cGc>cAc	p.R533H	SPATS2_ENST00000552918.1_Missense_Mutation_p.R533H|SPATS2_ENST00000321898.6_Missense_Mutation_p.R533H			Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	533						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.R533H(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|prostate(1)|urinary_tract(4)	21						CTCCCCCAGCGCAAACCCAGG	0.522																																																	1	Substitution - Missense(1)	breast(1)											48.0	49.0	49.0					12																	49919998		2203	4300	6503	SO:0001583	missense	0			AK023179	CCDS31794.1	12q13.12	2009-06-12							18650	protein-coding gene	gene with protein product		611667				11944913, 17989879	Standard	NM_023071		Approved	SPATA10, SCR59, FLJ13117	uc001rud.2	Q86XZ4		ENST00000553127.1:c.1598G>A	12.37:g.49919998G>A	ENSP00000448228:p.Arg533His		A8K8G9|Q9H7D4|Q9H8Y7|Q9H8Z8	Missense_Mutation	SNP	pfam_DUF1387,superfamily_UBA-like	p.R533H	ENST00000553127.1	37	c.1598	CCDS31794.1	12	.	.	.	.	.	.	.	.	.	.	G	26.6	4.749215	0.89753	.	.	ENSG00000123352	ENST00000553127;ENST00000321898;ENST00000552918;ENST00000395063	.	.	.	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.60444	0.2269	L	0.32530	0.975	0.80722	D	1	D	0.71674	0.998	P	0.56088	0.791	T	0.61681	-0.7013	9	0.49607	T	0.09	-1.7478	15.5728	0.76354	0.0:0.0:1.0:0.0	.	533	Q86XZ4	SPAS2_HUMAN	H	533	.	ENSP00000326841:R533H	R	+	2	0	SPATS2	48206265	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.785000	0.68998	2.635000	0.89317	0.585000	0.79938	CGC	SPATS2	-	NULL	ENSG00000123352		0.522	SPATS2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SPATS2	HGNC	protein_coding	OTTHUMT00000404023.1		0.00	71	0	G	NM_023071		49919998	+1			no_errors	ENST00000321898	ensembl	human	known	74_37	missense	5.43	87	5	SNP	1.000	A
SRPR	6734	genome.wustl.edu	37	11	126137496	126137499	+	Frame_Shift_Del	DEL	TTAA	TTAA	-			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	TTAA	TTAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:126137496_126137499delTTAA	ENST00000332118.6	-	3	464_467	c.310_313delTTAA	c.(310-315)ttaagtfs	p.LS104fs	SRPR_ENST00000530680.1_5'UTR|FOXRED1_ENST00000532125.1_5'Flank|FOXRED1_ENST00000263578.5_5'Flank|SRPR_ENST00000532259.1_Frame_Shift_Del_p.LS76fs|FOXRED1_ENST00000442061.2_5'Flank	NM_003139.3	NP_003130.2	P08240	SRPR_HUMAN	signal recognition particle receptor (docking protein)	104					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|signal recognition particle receptor complex (GO:0005785)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			endometrium(7)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)	21	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		TTTAATAAACTTAAAGCACTTTGC	0.412																																																	0																																										SO:0001589	frameshift_variant	0			BC001162	CCDS31717.1, CCDS53722.1	11q24-q25	2012-10-02	2008-10-29		ENSG00000182934	ENSG00000182934			11307	protein-coding gene	gene with protein product		182180	"""signal recognition particle receptor ('docking protein')"""			3340536, 1312991	Standard	NM_001177842		Approved	SRP-alpha, Sralpha	uc001qdh.3	P08240	OTTHUMG00000165826	ENST00000332118.6:c.310_313delTTAA	11.37:g.126137496_126137499delTTAA	ENSP00000328023:p.Leu104fs		A6NIB3|B2R5Z8|B4E0H3|E9PJS4|Q9BVJ4	Frame_Shift_Del	DEL	pfam_Sig_recog_particle_rcpt_asu_N,pfam_SRP54_GTPase_dom,pfam_ArgK,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,pfam_Signal_recog_particl_SRP54_hlx,superfamily_Longin-like_dom,superfamily_P-loop_NTPase,superfamily_Signal_recog_particl_SRP54_hlx,smart_Signal_recog_particl_SRP54_hlx,smart_AAA+_ATPase,smart_SRP54_GTPase_dom	p.L104fs	ENST00000332118.6	37	c.313_310	CCDS31717.1	11																																																																																			SRPR	-	pfam_Sig_recog_particle_rcpt_asu_N,superfamily_Longin-like_dom	ENSG00000182934		0.412	SRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPR	HGNC	protein_coding	OTTHUMT00000386425.2		0.00	60	0	TTAA	NM_003139		126137499	-1	tier1		no_errors	ENST00000332118	ensembl	human	known	74_37	frame_shift_del	26.19	31	11	DEL	0.997:0.975:0.976:0.759	-
SRRT	51593	genome.wustl.edu	37	7	100484427	100484427	+	Silent	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr7:100484427G>T	ENST00000347433.4	+	14	1817	c.1659G>T	c.(1657-1659)tcG>tcT	p.S553S	SRRT_ENST00000388793.4_Silent_p.S552S|SRRT_ENST00000432932.1_Silent_p.S552S|SRRT_ENST00000457580.2_Silent_p.S553S			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	553					cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						GCCTGCCCTCGCAAAACCCGA	0.572																																																	0													35.0	35.0	35.0					7																	100484427		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.1659G>T	7.37:g.100484427G>T			A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Silent	SNP	pfam_Arsenite-R_2,pfam_DUF3546	p.S552	ENST00000347433.4	37	c.1656	CCDS34709.1	7																																																																																			SRRT	-	NULL	ENSG00000087087		0.572	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	SRRT	HGNC	protein_coding	OTTHUMT00000347168.1	-	0.00	29	0	G	NM_015908		100484427	+1	tier1	-	no_errors	ENST00000388793	ensembl	human	known	74_37	silent	10.53	33	4	SNP	0.031	T
ST14	6768	genome.wustl.edu	37	11	130068269	130068269	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr11:130068269A>T	ENST00000278742.5	+	13	1944	c.1526A>T	c.(1525-1527)gAc>gTc	p.D509V		NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)	509	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	TGGGTCTGCGACAGTGTGAAC	0.667																																																	0													88.0	88.0	88.0					11																	130068269		2201	4297	6498	SO:0001583	missense	0			AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	ENST00000278742.5:c.1526A>T	11.37:g.130068269A>T	ENSP00000278742:p.Asp509Val		Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Missense_Mutation	SNP	pirsf_Peptidase_S1A_matripase,pfam_Peptidase_S1,pfam_LDrepeatLR_classA_rpt,pfam_CUB_dom,pfam_SEA_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1,prints_LDrepeatLR_classA_rpt,prints_Peptidase_S1A,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1	p.D509V	ENST00000278742.5	37	c.1526	CCDS8487.1	11	.	.	.	.	.	.	.	.	.	.	A	16.54	3.151323	0.57151	.	.	ENSG00000149418	ENST00000278742;ENST00000525779	D	0.98747	-5.11	5.0	5.0	0.66597	.	0.000000	0.40064	N	0.001183	D	0.99390	0.9785	H	0.96239	3.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98657	1.0682	10	0.54805	T	0.06	.	14.3782	0.66892	1.0:0.0:0.0:0.0	.	509	Q9Y5Y6	ST14_HUMAN	V	509;411	ENSP00000278742:D509V	ENSP00000278742:D509V	D	+	2	0	ST14	129573479	1.000000	0.71417	0.254000	0.24359	0.192000	0.23643	8.718000	0.91430	1.862000	0.54008	0.379000	0.24179	GAC	ST14	-	pirsf_Peptidase_S1A_matripase,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000149418		0.667	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST14	HGNC	protein_coding	OTTHUMT00000386119.1	-	0.00	91	0	A			130068269	+1	tier1	-	no_errors	ENST00000278742	ensembl	human	known	74_37	missense	47.54	32	29	SNP	0.998	T
STARD5	80765	genome.wustl.edu	37	15	81614790	81614790	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr15:81614790C>T	ENST00000302824.6	-	3	266	c.241G>A	c.(241-243)Gag>Aag	p.E81K	RP11-761I4.3_ENST00000559781.1_RNA|STARD5_ENST00000559913.1_5'UTR|RP11-761I4.3_ENST00000560973.1_RNA	NM_181900.2	NP_871629.1	Q9NSY2	STAR5_HUMAN	StAR-related lipid transfer (START) domain containing 5	81	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				C21-steroid hormone biosynthetic process (GO:0006700)|lipid transport (GO:0006869)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)	lipid binding (GO:0008289)			large_intestine(3)|ovary(1)|skin(1)|stomach(1)	6						GTCACATTCTCATCCCACTTC	0.493																																																	0													169.0	137.0	148.0					15																	81614790		2203	4300	6503	SO:0001583	missense	0			AF480304	CCDS10318.1	15q26	2011-09-12	2007-08-16		ENSG00000172345	ENSG00000172345		"""StAR-related lipid transfer (START) domain containing"""	18065	protein-coding gene	gene with protein product		607050	"""START domain containing 5"""			12011452	Standard	NM_181900		Approved	MGC10327	uc002bgm.3	Q9NSY2	OTTHUMG00000147342	ENST00000302824.6:c.241G>A	15.37:g.81614790C>T	ENSP00000304032:p.Glu81Lys		P59094	Missense_Mutation	SNP	pfam_START_lipid-bd_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom	p.E81K	ENST00000302824.6	37	c.241	CCDS10318.1	15	.	.	.	.	.	.	.	.	.	.	C	6.371	0.436506	0.12104	.	.	ENSG00000172345	ENST00000302824	T	0.78364	-1.17	5.51	4.54	0.55810	Lipid-binding START (3);START-like domain (1);	0.472101	0.22920	N	0.054027	T	0.56140	0.1965	N	0.17082	0.46	0.27582	N	0.949559	B	0.15719	0.014	B	0.09377	0.004	T	0.40175	-0.9577	10	0.02654	T	1	-1.4551	9.8193	0.40871	0.0:0.7019:0.2142:0.0839	.	81	Q9NSY2	STAR5_HUMAN	K	81	ENSP00000304032:E81K	ENSP00000304032:E81K	E	-	1	0	STARD5	79401845	0.996000	0.38824	1.000000	0.80357	0.922000	0.55478	1.287000	0.33284	2.741000	0.93983	0.650000	0.86243	GAG	STARD5	-	pfam_START_lipid-bd_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom	ENSG00000172345		0.493	STARD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD5	HGNC	protein_coding	OTTHUMT00000303950.2	-	0.00	66	0	C			81614790	-1	tier1	-	no_errors	ENST00000302824	ensembl	human	known	74_37	missense	66.67	14	28	SNP	0.990	T
STIL	6491	genome.wustl.edu	37	1	47746765	47746765	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:47746765C>A	ENST00000360380.3	-	13	1728	c.1365G>T	c.(1363-1365)ttG>ttT	p.L455F	STIL_ENST00000371877.3_Missense_Mutation_p.L455F|STIL_ENST00000396221.2_Missense_Mutation_p.L455F|STIL_ENST00000243182.6_Missense_Mutation_p.L455F|STIL_ENST00000337817.5_Missense_Mutation_p.L455F	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	455					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				AGTGGTTAATCAAAGGAGGAT	0.423																																																	0													137.0	135.0	135.0					1																	47746765		2203	4300	6503	SO:0001583	missense	0			M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.1365G>T	1.37:g.47746765C>A	ENSP00000353544:p.Leu455Phe		Q5T0C5|Q68CN9	Missense_Mutation	SNP	NULL	p.L455F	ENST00000360380.3	37	c.1365	CCDS548.1	1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.595688	0.46318	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182;ENST00000447475	T;T;T;T;T;T	0.49139	2.14;2.14;2.15;2.13;2.14;0.79	5.05	3.04	0.35103	.	0.784338	0.11241	N	0.584655	T	0.46367	0.1389	L	0.34521	1.04	0.09310	N	1	D;D;D;D;D	0.67145	0.989;0.996;0.989;0.989;0.989	P;P;P;P;P	0.61201	0.885;0.885;0.885;0.885;0.885	T	0.31166	-0.9953	10	0.24483	T	0.36	-0.2908	2.6913	0.05121	0.3891:0.3656:0.0:0.2454	.	455;408;455;455;455	E9PSF2;Q5T0C7;B7ZLW5;Q15468-2;Q15468	.;.;.;.;STIL_HUMAN	F	455;455;455;455;455;408	ENSP00000353544:L455F;ENSP00000337367:L455F;ENSP00000360944:L455F;ENSP00000379523:L455F;ENSP00000243182:L455F;ENSP00000411664:L408F	ENSP00000243182:L455F	L	-	3	2	STIL	47519352	0.000000	0.05858	0.158000	0.22627	0.948000	0.59901	-0.323000	0.07997	1.364000	0.46038	0.591000	0.81541	TTG	STIL	-	NULL	ENSG00000123473		0.423	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	STIL	HGNC	protein_coding	OTTHUMT00000021649.2	-	0.00	77	0	C	NM_003035		47746765	-1	tier1	-	no_errors	ENST00000371877	ensembl	human	known	74_37	missense	32.22	61	29	SNP	0.000	A
SUPT16H	11198	genome.wustl.edu	37	14	21825402	21825402	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr14:21825402T>C	ENST00000216297.2	-	22	2952	c.2614A>G	c.(2614-2616)Aac>Gac	p.N872D		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	872					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		GGAATGGCGTTGATCATGGTC	0.453																																																	0													212.0	157.0	175.0					14																	21825402		2203	4300	6503	SO:0001583	missense	0			AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.2614A>G	14.37:g.21825402T>C	ENSP00000216297:p.Asn872Asp		Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Missense_Mutation	SNP	pfam_FACT_Spt16p,pfam_Pept_M24_structural-domain,pfam_DUF1747,superfamily_Pept_M24_structural-domain	p.N872D	ENST00000216297.2	37	c.2614	CCDS9569.1	14	.	.	.	.	.	.	.	.	.	.	T	29.7	5.032528	0.93575	.	.	ENSG00000092201	ENST00000216297	.	.	.	5.62	5.62	0.85841	Translation elongation factor EFG/EF2, C-terminal (1);Domain of unknown function DUF1747, eukaryote (1);	0.000000	0.85682	D	0.000000	T	0.67088	0.2856	L	0.48260	1.515	0.80722	D	1	D	0.60160	0.987	D	0.67725	0.953	T	0.62364	-0.6870	9	0.20519	T	0.43	-25.2562	14.805	0.69945	0.0:0.0:0.0:1.0	.	872	Q9Y5B9	SP16H_HUMAN	D	872	.	ENSP00000216297:N872D	N	-	1	0	SUPT16H	20895242	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.228000	0.78079	2.138000	0.66242	0.533000	0.62120	AAC	SUPT16H	-	pfam_DUF1747	ENSG00000092201		0.453	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPT16H	HGNC	protein_coding	OTTHUMT00000074025.2		0.00	93	0	T			21825402	-1			no_errors	ENST00000216297	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	C
SYNE2	23224	genome.wustl.edu	37	14	64491122	64491122	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr14:64491122T>C	ENST00000344113.4	+	39	5997	c.5785T>C	c.(5785-5787)Tcc>Ccc	p.S1929P	SYNE2_ENST00000358025.3_Missense_Mutation_p.S1929P|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.S1929P	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	1929					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAAAATGGAGTCCATATGCCA	0.433																																																	0													80.0	79.0	80.0					14																	64491122		1932	4140	6072	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.5785T>C	14.37:g.64491122T>C	ENSP00000341781:p.Ser1929Pro		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.S1929P	ENST00000344113.4	37	c.5785	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	T	15.27	2.782561	0.49891	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.36157	1.27;1.27;1.27	5.14	3.97	0.46021	.	0.125344	0.36519	N	0.002556	T	0.40862	0.1134	L	0.29908	0.895	0.58432	D	0.999999	D;D	0.69078	0.994;0.997	P;D	0.65010	0.855;0.931	T	0.10776	-1.0615	10	0.29301	T	0.29	.	9.8164	0.40856	0.0:0.0806:0.0:0.9194	.	1929;1929	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	P	1929	ENSP00000350719:S1929P;ENSP00000341781:S1929P;ENSP00000452570:S1929P	ENSP00000261678:S1929P	S	+	1	0	SYNE2	63560875	1.000000	0.71417	0.978000	0.43139	0.996000	0.88848	2.355000	0.44107	1.932000	0.55993	0.477000	0.44152	TCC	SYNE2	-	NULL	ENSG00000054654		0.433	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	-	0.00	54	0	T	NM_182914		64491122	+1	tier1	-	no_errors	ENST00000358025	ensembl	human	known	74_37	missense	34.21	25	13	SNP	0.659	C
SYT6	148281	genome.wustl.edu	37	1	114640468	114640468	+	Missense_Mutation	SNP	G	G	T	rs150717431		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:114640468G>T	ENST00000610222.1	-	6	1542	c.1396C>A	c.(1396-1398)Cgt>Agt	p.R466S	SYT6_ENST00000607941.1_Missense_Mutation_p.R381S|SYT6_ENST00000393296.1_Missense_Mutation_p.R466S|SYT6_ENST00000609117.1_Missense_Mutation_p.R381S|SYT6_ENST00000369547.1_Missense_Mutation_p.R381S			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	466	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATCCCCACACGACAGACTCCT	0.582																																																	0													97.0	88.0	91.0					1																	114640468		2203	4300	6503	SO:0001583	missense	0				CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.1396C>A	1.37:g.114640468G>T	ENSP00000476396:p.Arg466Ser		B1AMB8|B3KPK1	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_dom	p.R466S	ENST00000610222.1	37	c.1396		1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.201046	0.58234	.	.	ENSG00000134207	ENST00000369547;ENST00000393296;ENST00000369546;ENST00000369545	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	5.37	4.43	0.53597	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.62877	0.2464	N	0.21583	0.68	0.80722	D	1	D;D	0.65815	0.995;0.988	D;P	0.70716	0.97;0.839	T	0.62826	-0.6772	10	0.21014	T	0.42	.	14.9431	0.71009	0.0:0.0:0.8517:0.1483	.	466;381	Q5T7P8;Q5T7P8-2	SYT6_HUMAN;.	S	381;466;381;466	ENSP00000358560:R381S;ENSP00000376974:R466S;ENSP00000358559:R381S;ENSP00000358558:R466S	ENSP00000358558:R466S	R	-	1	0	SYT6	114441991	1.000000	0.71417	0.920000	0.36463	0.828000	0.46876	4.453000	0.60061	1.192000	0.43071	0.462000	0.41574	CGT	SYT6	-	superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000134207		0.582	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SYT6	HGNC	protein_coding	OTTHUMT00000314819.2		0.00	73	0	G	NM_205848		114640468	-1			no_errors	ENST00000393296	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.997	T
TACC2	10579	genome.wustl.edu	37	10	123844509	123844509	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr10:123844509C>T	ENST00000369005.1	+	4	2834	c.2494C>T	c.(2494-2496)Cca>Tca	p.P832S	TACC2_ENST00000515273.1_Missense_Mutation_p.P832S|TACC2_ENST00000334433.3_Missense_Mutation_p.P832S|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000453444.2_Missense_Mutation_p.P832S|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000515603.1_Missense_Mutation_p.P832S	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	832					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				GCATCTCCAGCCATCCCAGGC	0.552																																																	0													128.0	129.0	129.0					10																	123844509		2203	4300	6503	SO:0001583	missense	0			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.2494C>T	10.37:g.123844509C>T	ENSP00000358001:p.Pro832Ser		Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	pfam_TACC	p.P832S	ENST00000369005.1	37	c.2494	CCDS7626.1	10	.	.	.	.	.	.	.	.	.	.	C	10.19	1.281176	0.23392	.	.	ENSG00000138162	ENST00000369005;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000453444;ENST00000340076	T;T;T;T;T	0.02916	4.14;4.11;4.11;4.14;4.11	5.66	-3.15	0.05233	.	0.462317	0.16270	N	0.221817	T	0.01489	0.0048	N	0.17082	0.46	0.09310	N	1	B;B;B	0.13594	0.008;0.008;0.008	B;B;B	0.09377	0.004;0.004;0.004	T	0.41963	-0.9479	10	0.42905	T	0.14	-0.5177	1.8151	0.03099	0.3403:0.2999:0.2221:0.1377	.	832;832;832	E9PBC6;E7EMZ9;O95359	.;.;TACC2_HUMAN	S	832;832;832;832;832;822	ENSP00000358001:P832S;ENSP00000424467:P832S;ENSP00000427618:P832S;ENSP00000334280:P832S;ENSP00000395048:P832S	ENSP00000334280:P832S	P	+	1	0	TACC2	123834499	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-2.059000	0.01393	-0.542000	0.06249	-0.283000	0.09986	CCA	TACC2	-	NULL	ENSG00000138162		0.552	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	HGNC	protein_coding	OTTHUMT00000090004.1	-	0.00	64	0	C			123844509	+1	tier1	-	no_errors	ENST00000334433	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.000	T
TADA1	117143	genome.wustl.edu	37	1	166831610	166831610	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:166831610G>A	ENST00000367874.4	-	5	463	c.370C>T	c.(370-372)Caa>Taa	p.Q124*	TADA1_ENST00000467021.1_5'UTR	NM_053053.3	NP_444281.1	Q96BN2	TADA1_HUMAN	transcriptional adaptor 1	124					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	11						GCCACAAATTGCTGGGCTCCT	0.413																																																	0													110.0	100.0	103.0					1																	166831610		2203	4300	6503	SO:0001587	stop_gained	0			BC015401	CCDS1255.1	1q24.1	2009-10-02	2009-10-02	2009-10-02	ENSG00000152382	ENSG00000152382			30631	protein-coding gene	gene with protein product		612763	"""transcriptional adaptor 1 (HFI1 homolog, yeast)-like"", ""transcriptional adaptor 1 (HFI1 homolog, yeast)"""	TADA1L		11564863	Standard	NM_053053		Approved	STAF42, ADA1, hADA1, HFI1	uc001gdw.3	Q96BN2	OTTHUMG00000034321	ENST00000367874.4:c.370C>T	1.37:g.166831610G>A	ENSP00000356848:p.Gln124*		A8K4J9	Nonsense_Mutation	SNP	superfamily_Histone-fold	p.Q124*	ENST00000367874.4	37	c.370	CCDS1255.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.409770	0.97546	.	.	ENSG00000152382	ENST00000367874	.	.	.	6.16	5.25	0.73442	.	0.116646	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-5.0763	15.5252	0.75898	0.0:0.1383:0.8617:0.0	.	.	.	.	X	124	.	ENSP00000356848:Q124X	Q	-	1	0	TADA1	165098234	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.377000	0.79668	1.615000	0.50252	0.650000	0.86243	CAA	TADA1	-	NULL	ENSG00000152382		0.413	TADA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA1	HGNC	protein_coding	OTTHUMT00000082881.1	-	0.00	78	0	G	NM_053053		166831610	-1	tier1	-	no_errors	ENST00000367874	ensembl	human	known	74_37	nonsense	15.19	67	12	SNP	1.000	A
TADA3	10474	genome.wustl.edu	37	3	9825821	9825821	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:9825821G>T	ENST00000301964.2	-	8	1555	c.997C>A	c.(997-999)Cgc>Agc	p.R333S	TADA3_ENST00000440161.1_Missense_Mutation_p.R333S|TADA3_ENST00000343450.2_Missense_Mutation_p.R333S	NM_006354.2	NP_006345.1	O75528	TADA3_HUMAN	transcriptional adaptor 3	333					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|intracellular estrogen receptor signaling pathway (GO:0030520)|mitotic nuclear division (GO:0007067)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of histone deacetylation (GO:0031063)|regulation of protein phosphorylation (GO:0001932)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of tubulin deacetylation (GO:0090043)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|intracellular (GO:0005622)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16						TCTGCGGGGCGGTCCTCAGAC	0.612																																																	0													54.0	49.0	51.0					3																	9825821		2203	4300	6503	SO:0001583	missense	0			AF069733	CCDS2583.1, CCDS2584.1	3p25.3	2010-08-13	2009-10-02	2009-10-02	ENSG00000171148	ENSG00000171148			19422	protein-coding gene	gene with protein product		602945	"""transcriptional adaptor 3 (NGG1 homolog, yeast)-like"""	TADA3L		9674425, 11707411	Standard	NM_006354		Approved	FLJ20221, FLJ21329, ADA3, hADA3, NGG1	uc010hcn.2	O75528	OTTHUMG00000128440	ENST00000301964.2:c.997C>A	3.37:g.9825821G>T	ENSP00000307684:p.Arg333Ser		Q6FI83|Q9UFS2	Missense_Mutation	SNP	pfam_Histone_AcTrfase_su3	p.R333S	ENST00000301964.2	37	c.997	CCDS2583.1	3	.	.	.	.	.	.	.	.	.	.	G	5.375	0.254463	0.10185	.	.	ENSG00000171148	ENST00000301964;ENST00000440161;ENST00000343450	.	.	.	6.17	4.23	0.50019	.	0.000000	0.85682	D	0.000000	T	0.29652	0.0740	N	0.08118	0	0.58432	D	0.999992	P;P	0.43519	0.809;0.809	P;P	0.45377	0.478;0.478	T	0.06826	-1.0805	9	0.08381	T	0.77	-20.9201	12.9378	0.58325	0.0651:0.0:0.8116:0.1233	.	333;333	O75528;A8K899	TADA3_HUMAN;.	S	333	.	ENSP00000307684:R333S	R	-	1	0	TADA3	9800821	1.000000	0.71417	1.000000	0.80357	0.429000	0.31625	5.934000	0.70138	1.633000	0.50488	0.655000	0.94253	CGC	TADA3	-	pfam_Histone_AcTrfase_su3	ENSG00000171148		0.612	TADA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA3	HGNC	protein_coding	OTTHUMT00000250236.1		0.00	48	0	G			9825821	-1			no_errors	ENST00000301964	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	T
TAF7	6879	genome.wustl.edu	37	5	140698912	140698912	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr5:140698912C>A	ENST00000313368.5	-	1	1418	c.700G>T	c.(700-702)Gat>Tat	p.D234Y		NM_005642.2	NP_005633.2	Q15545	TAF7_HUMAN	TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa	234					DNA-templated transcription, initiation (GO:0006352)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of histone acetylation (GO:0035067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermine transport (GO:0000296)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	histone acetyltransferase binding (GO:0035035)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|vitamin D receptor binding (GO:0042809)			central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGGTCTCATCTTCATCCTCA	0.453																																																	0													190.0	180.0	184.0					5																	140698912		2203	4300	6503	SO:0001583	missense	0			AF349038	CCDS4259.1	5q31	2008-02-05	2002-08-29	2001-12-07	ENSG00000178913	ENSG00000178913			11541	protein-coding gene	gene with protein product		600573	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, F, 55kD"""	TAF2F		7824954	Standard	NM_005642		Approved	TAFII55	uc003ljg.3	Q15545	OTTHUMG00000129628	ENST00000313368.5:c.700G>T	5.37:g.140698912C>A	ENSP00000312709:p.Asp234Tyr		B2RBV9|Q13036	Missense_Mutation	SNP	pfam_TAFII55_prot_cons_reg	p.D234Y	ENST00000313368.5	37	c.700	CCDS4259.1	5	.	.	.	.	.	.	.	.	.	.	C	19.90	3.912690	0.72983	.	.	ENSG00000178913	ENST00000313368	T	0.28255	1.62	4.5	4.5	0.54988	.	0.104106	0.64402	D	0.000004	T	0.42426	0.1202	M	0.75264	2.295	0.58432	D	0.999999	D	0.56521	0.976	P	0.47744	0.556	T	0.49283	-0.8956	10	0.59425	D	0.04	-19.2376	15.1915	0.73047	0.0:1.0:0.0:0.0	.	234	Q15545	TAF7_HUMAN	Y	234	ENSP00000312709:D234Y	ENSP00000312709:D234Y	D	-	1	0	TAF7	140679096	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.824000	0.75288	2.532000	0.85374	0.650000	0.86243	GAT	TAF7	-	NULL	ENSG00000178913		0.453	TAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF7	HGNC	protein_coding	OTTHUMT00000251823.2	-	0.00	33	0	C	NM_005642		140698912	-1	tier1	-	no_errors	ENST00000313368	ensembl	human	known	74_37	missense	64.00	9	16	SNP	1.000	A
TBC1D25	4943	genome.wustl.edu	37	X	48417663	48417663	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chrX:48417663G>A	ENST00000376771.4	+	5	975	c.634G>A	c.(634-636)Ggc>Agc	p.G212S	TBC1D25_ENST00000476141.1_3'UTR|snoU13_ENST00000459609.1_RNA|TBC1D25_ENST00000537536.1_5'UTR	NM_002536.2	NP_002527.1	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	212					autophagy (GO:0006914)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of autophagic vacuole maturation (GO:1901096)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						GAACCACGAGGGCCAGCTCTC	0.587																																																	0													88.0	66.0	73.0					X																	48417663		2203	4300	6503	SO:0001583	missense	0			L08240	CCDS35242.1	Xp11.23	2014-01-28	2007-01-12	2007-01-12	ENSG00000068354	ENSG00000068354			8092	protein-coding gene	gene with protein product		311240	"""ornithine aminotransferase-like 1"""	OATL1		21383079	Standard	NM_002536		Approved		uc004dka.1	Q3MII6	OTTHUMG00000024123	ENST00000376771.4:c.634G>A	X.37:g.48417663G>A	ENSP00000365962:p.Gly212Ser		Q08AN9|Q3MII4|Q8TAR9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.G212S	ENST00000376771.4	37	c.634	CCDS35242.1	X	.	.	.	.	.	.	.	.	.	.	G	23.1	4.372179	0.82573	.	.	ENSG00000068354	ENST00000376771;ENST00000418627	T	0.04454	3.62	5.7	5.7	0.88788	Rab-GAP/TBC domain (1);	0.000000	0.85682	D	0.000000	T	0.23133	0.0559	M	0.77820	2.39	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.00235	-1.1892	10	0.87932	D	0	-16.8436	16.0726	0.80946	0.0:0.0:1.0:0.0	.	216;154;212	B4DF03;B4DGU3;Q3MII6	.;.;TBC25_HUMAN	S	212;228	ENSP00000365962:G212S	ENSP00000365962:G212S	G	+	1	0	TBC1D25	48302607	1.000000	0.71417	0.999000	0.59377	0.574000	0.36063	9.037000	0.93765	2.397000	0.81536	0.529000	0.55759	GGC	TBC1D25	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000068354		0.587	TBC1D25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D25	HGNC	protein_coding	OTTHUMT00000060764.2	-	0.00	28	0	G	NM_002536		48417663	+1	tier1	-	no_errors	ENST00000376771	ensembl	human	known	74_37	missense	83.33	3	15	SNP	1.000	A
TDRD6	221400	genome.wustl.edu	37	6	46657521	46657521	+	Silent	SNP	T	T	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr6:46657521T>C	ENST00000316081.6	+	1	1656	c.1656T>C	c.(1654-1656)taT>taC	p.Y552Y	RP11-446F17.3_ENST00000571590.1_RNA|RP11-446F17.3_ENST00000422284.2_RNA|RP11-446F17.3_ENST00000434329.2_RNA|TDRD6_ENST00000544460.1_Silent_p.Y552Y	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	552	Tudor 3. {ECO:0000255|PROSITE- ProRule:PRU00211}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			AAAATGGTTATTATAGGGCCA	0.428																																																	0													149.0	151.0	150.0					6																	46657521		2203	4300	6503	SO:0001819	synonymous_variant	0			AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.1656T>C	6.37:g.46657521T>C			B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Silent	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.Y552	ENST00000316081.6	37	c.1656	CCDS34470.1	6																																																																																			TDRD6	-	pfam_Tudor,smart_Tudor,pfscan_Tudor	ENSG00000180113		0.428	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD6	HGNC	protein_coding	OTTHUMT00000040800.1	-	0.00	146	0	T	XM_166443		46657521	+1	tier1	-	no_errors	ENST00000316081	ensembl	human	known	74_37	silent	42.47	107	79	SNP	0.979	C
TENM1	10178	genome.wustl.edu	37	X	123680763	123680763	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chrX:123680763C>T	ENST00000371130.3	-	15	2675	c.2612G>A	c.(2611-2613)aGt>aAt	p.S871N	TENM1_ENST00000422452.2_Missense_Mutation_p.S871N	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	871					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GACATGAGTACTGTCCTTGCC	0.393																																																	0													129.0	117.0	121.0					X																	123680763		2203	4300	6503	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.2612G>A	X.37:g.123680763C>T	ENSP00000360171:p.Ser871Asn		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD	p.S871N	ENST00000371130.3	37	c.2612	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	28.3	4.908353	0.92107	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.89123	-2.47;-2.44	5.21	5.21	0.72293	.	0.104716	0.64402	D	0.000005	D	0.93949	0.8063	M	0.83384	2.64	0.58432	D	0.999999	P;D;D	0.63046	0.915;0.958;0.992	P;P;P	0.58970	0.475;0.475;0.849	D	0.94734	0.7912	10	0.72032	D	0.01	.	17.789	0.88547	0.0:1.0:0.0:0.0	.	870;871;871	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	N	871	ENSP00000360171:S871N;ENSP00000403954:S871N	ENSP00000360171:S871N	S	-	2	0	ODZ1	123508444	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.541000	0.67212	2.389000	0.81357	0.594000	0.82650	AGT	TENM1	-	NULL	ENSG00000009694		0.393	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM1	HGNC	protein_coding	OTTHUMT00000058985.1	-	0.00	37	0	C	NM_014253		123680763	-1	tier1	-	no_errors	ENST00000422452	ensembl	human	known	74_37	missense	88.00	3	22	SNP	1.000	T
THRB	7068	genome.wustl.edu	37	3	24231691	24231691	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:24231691G>T	ENST00000356447.4	-	4	441	c.157C>A	c.(157-159)Cag>Aag	p.Q53K	THRB_ENST00000396671.2_Missense_Mutation_p.Q53K|THRB_ENST00000416420.1_Missense_Mutation_p.Q53K	NM_000461.4|NM_001128177.1	NP_000452.2|NP_001121649.1	P10828	THB_HUMAN	thyroid hormone receptor, beta	53	Modulating.				female courtship behavior (GO:0008050)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of female receptivity (GO:0007621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|sensory perception of sound (GO:0007605)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(2)|prostate(1)|skin(3)	19					Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GGCGACGACTGTTCATTTTTC	0.502																																					Melanoma(21;896 1043 15021 37958)												0													242.0	228.0	233.0					3																	24231691		2203	4300	6503	SO:0001583	missense	0				CCDS2641.1	3p24.2	2013-01-16	2011-05-19		ENSG00000151090	ENSG00000151090		"""Nuclear hormone receptors"""	11799	protein-coding gene	gene with protein product	"""avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2"", ""oncogene ERBA2"", ""generalized resistance to thyroid hormone"", ""thyroid hormone receptor beta 1"""	190160	"""thyroid hormone receptor, beta (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2)"", ""pituitary resistance to thyroid hormone"", ""thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)"""	ERBA2, PRTH		1973914, 8040303	Standard	NM_000461		Approved	THRB1, THRB2, NR1A2, THR1, ERBA-BETA, GRTH	uc003ccy.4	P10828	OTTHUMG00000130478	ENST00000356447.4:c.157C>A	3.37:g.24231691G>T	ENSP00000348827:p.Gln53Lys		B3KU79|P37243|Q13986|Q3KP35|Q6WGL2|Q9UD41	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ThyrH_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.Q53K	ENST00000356447.4	37	c.157	CCDS2641.1	3	.	.	.	.	.	.	.	.	.	.	G	12.23	1.875377	0.33162	.	.	ENSG00000151090	ENST00000396671;ENST00000356447;ENST00000416420;ENST00000413780;ENST00000415021;ENST00000447875;ENST00000453729;ENST00000431815;ENST00000447414;ENST00000428492;ENST00000418247	D;D;D;D	0.96459	-3.15;-3.15;-3.15;-4.02	5.93	4.12	0.48240	.	.	.	.	.	D	0.88720	0.6513	N	0.08118	0	0.22610	N	0.998933	B	0.13594	0.008	B	0.12156	0.007	T	0.73789	-0.3872	9	0.05833	T	0.94	.	11.5132	0.50504	0.0672:0.1266:0.8062:0.0	.	53	P10828	THB_HUMAN	K	53;53;53;22;53;53;53;53;53;53;53	ENSP00000379904:Q53K;ENSP00000348827:Q53K;ENSP00000414444:Q53K;ENSP00000414100:Q22K	ENSP00000348827:Q53K	Q	-	1	0	THRB	24206695	1.000000	0.71417	0.995000	0.50966	0.234000	0.25298	3.926000	0.56491	1.499000	0.48617	0.655000	0.94253	CAG	THRB	-	NULL	ENSG00000151090		0.502	THRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	THRB	HGNC	protein_coding	OTTHUMT00000252877.3		0.00	45	0	G	NM_000461		24231691	-1			no_errors	ENST00000356447	ensembl	human	known	74_37	missense	5.00	57	3	SNP	0.984	T
TIGD2	166815	genome.wustl.edu	37	4	90034798	90034798	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr4:90034798C>T	ENST00000317005.2	+	1	831	c.673C>T	c.(673-675)Ctt>Ttt	p.L225F	FAM13A_ENST00000502459.1_5'Flank|RP11-84C13.1_ENST00000603357.1_lincRNA	NM_145715.2	NP_663761.1	Q4W5G0	TIGD2_HUMAN	tigger transposable element derived 2	225	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	14		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.86e-05)		CAAACTTAATCTTTGTGTTGT	0.428																																																	0													68.0	70.0	70.0					4																	90034798		2203	4300	6503	SO:0001583	missense	0			AK027653	CCDS3633.1	4q21.3	2013-02-21			ENSG00000180346	ENSG00000180346			18333	protein-coding gene	gene with protein product		612973					Standard	NM_145715		Approved		uc003hsk.3	Q4W5G0	OTTHUMG00000130946	ENST00000317005.2:c.673C>T	4.37:g.90034798C>T	ENSP00000317170:p.Leu225Phe			Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.L225F	ENST00000317005.2	37	c.673	CCDS3633.1	4	.	.	.	.	.	.	.	.	.	.	c	14.02	2.409356	0.42715	.	.	ENSG00000180346	ENST00000317005	T	0.51071	0.72	3.97	3.97	0.46021	.	0.000000	0.35151	U	0.003403	T	0.68622	0.3021	M	0.83312	2.635	0.30403	N	0.779797	D	0.89917	1.0	D	0.85130	0.997	T	0.69075	-0.5241	10	0.37606	T	0.19	-3.6107	13.666	0.62396	0.0:1.0:0.0:0.0	.	225	Q4W5G0	TIGD2_HUMAN	F	225	ENSP00000317170:L225F	ENSP00000317170:L225F	L	+	1	0	TIGD2	90253821	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.481000	0.45215	2.070000	0.61991	0.546000	0.68486	CTT	TIGD2	-	pfam_DDE_SF_endonuclease_CENPB-like	ENSG00000180346		0.428	TIGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD2	HGNC	protein_coding	OTTHUMT00000253545.2		0.00	85	0	C	NM_145715		90034798	+1			no_errors	ENST00000317005	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
TMEM159	57146	genome.wustl.edu	37	16	21181911	21181911	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:21181911G>A	ENST00000233047.4	+	3	718	c.250G>A	c.(250-252)Gtc>Atc	p.V84I	TMEM159_ENST00000574092.1_3'UTR|TMEM159_ENST00000261388.3_Missense_Mutation_p.V84I|TMEM159_ENST00000451578.2_Missense_Mutation_p.V108I|TMEM159_ENST00000572258.1_Missense_Mutation_p.V84I|TMEM159_ENST00000572599.1_Missense_Mutation_p.V84I			Q96B96	TM159_HUMAN	transmembrane protein 159	84						integral component of membrane (GO:0016021)				large_intestine(3)|lung(2)|ovary(1)	6				GBM - Glioblastoma multiforme(48;0.0972)		TCTGCTGGGGGTCATAATATT	0.448																																																	0													175.0	145.0	155.0					16																	21181911		2200	4300	6500	SO:0001583	missense	0			AF070596	CCDS10595.1	16p12.2	2008-02-05			ENSG00000011638	ENSG00000011638			30136	protein-coding gene	gene with protein product		611304				8619474, 9110174, 15589683	Standard	NM_020422		Approved	promethin	uc002dif.4	Q96B96	OTTHUMG00000131559	ENST00000233047.4:c.250G>A	16.37:g.21181911G>A	ENSP00000233047:p.Val84Ile		A6NMA9|B4DEC1|O00323	Missense_Mutation	SNP	NULL	p.V108I	ENST00000233047.4	37	c.322	CCDS10595.1	16	.	.	.	.	.	.	.	.	.	.	G	13.00	2.106616	0.37145	.	.	ENSG00000011638	ENST00000233047;ENST00000261388;ENST00000451578	T;T;T	0.23147	1.92;1.92;1.92	5.48	5.48	0.80851	.	0.158356	0.41097	D	0.000950	T	0.40743	0.1129	M	0.72894	2.215	0.38106	D	0.937417	B;D	0.55385	0.319;0.971	B;P	0.50049	0.067;0.629	T	0.43491	-0.9388	10	0.51188	T	0.08	-0.083	16.8534	0.86000	0.0:0.0:1.0:0.0	.	108;84	B4DEC1;Q96B96	.;TM159_HUMAN	I	84;84;108	ENSP00000233047:V84I;ENSP00000261388:V84I;ENSP00000409879:V108I	ENSP00000233047:V84I	V	+	1	0	TMEM159	21089412	1.000000	0.71417	1.000000	0.80357	0.171000	0.22731	4.109000	0.57824	2.559000	0.86315	0.655000	0.94253	GTC	TMEM159	-	NULL	ENSG00000011638		0.448	TMEM159-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM159	HGNC	protein_coding	OTTHUMT00000254421.1	-	0.00	73	0	G	NM_020422		21181911	+1	tier1	-	no_errors	ENST00000573487	ensembl	human	known	74_37	missense	23.96	73	23	SNP	1.000	A
TMEM230	29058	genome.wustl.edu	37	20	5093572	5093572	+	5'UTR	SNP	G	G	C	rs565592529	byFrequency	TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr20:5093572G>C	ENST00000379286.2	-	0	116				TMEM230_ENST00000379283.2_5'UTR|TMEM230_ENST00000379279.2_5'UTR|TMEM230_ENST00000379277.2_5'Flank|TMEM230_ENST00000342308.5_Intron|Y_RNA_ENST00000516558.1_RNA|TMEM230_ENST00000202834.7_Intron|TMEM230_ENST00000492419.1_5'UTR	NM_001009924.1	NP_001009924.1	Q96A57	TM230_HUMAN	transmembrane protein 230							integral component of membrane (GO:0016021)											CCGAGAGGACGGTTCTGTCCC	0.711													G|||	13	0.00259585	0.0098	0.0	5008	,	,		12022	0.0		0.0	False		,,,				2504	0.0																0													6.0	7.0	7.0					20																	5093572		1881	3608	5489	SO:0001623	5_prime_UTR_variant	0			AF161392	CCDS13086.1, CCDS33438.1	20p13	2012-03-16	2012-03-16	2012-03-16	ENSG00000089063	ENSG00000089063			15876	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 30"""	C20orf30			Standard	XM_005260713		Approved	HSPC274	uc002wlk.3	Q96A57	OTTHUMG00000031796	ENST00000379286.2:c.-305C>G	20.37:g.5093572G>C			B2RDM8|D3DVZ9|Q0VGC8|Q5TDS5|Q96ES2|Q9P0A7	RNA	SNP	-	NULL	ENST00000379286.2	37	NULL	CCDS13086.1	20																																																																																			TMEM230	-	-	ENSG00000089063		0.711	TMEM230-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM230	HGNC	protein_coding	OTTHUMT00000077846.1	-	0.00	18	0	G			5093572	-1	tier1	-	no_errors	ENST00000492419	ensembl	human	known	74_37	rna	50.00	10	10	SNP	0.001	C
TP53	7157	genome.wustl.edu	37	17	7578427	7578427	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr17:7578427T>C	ENST00000269305.4	-	5	692	c.503A>G	c.(502-504)cAc>cGc	p.H168R	TP53_ENST00000455263.2_Missense_Mutation_p.H168R|TP53_ENST00000420246.2_Missense_Mutation_p.H168R|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.H168R|TP53_ENST00000413465.2_Missense_Mutation_p.H168R|TP53_ENST00000359597.4_Missense_Mutation_p.H168R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	168	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> V (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|H -> Y (in sporadic cancers; somatic mutation).|HM -> LI (in a sporadic cancer; somatic mutation).|QH -> HD (in a sporadic cancer; somatic mutation).|QH -> YL (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H168R(12)|p.H168P(10)|p.0?(8)|p.H168L(8)|p.V157_C176del20(1)|p.H36L(1)|p.Q167_H168>YL(1)|p.H168fs*69(1)|p.Y163fs*1(1)|p.Q167fs*12(1)|p.P151_V173del23(1)|p.H168fs*2(1)|p.H168fs*3(1)|p.H168fs*4(1)|p.Q165_M169delQSQHM(1)|p.H168_M169>LI(1)|p.H168fs*13(1)|p.S149fs*72(1)|p.H75L(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTCCGTCATGTGCTGTGACTG	0.652		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	53	Substitution - Missense(32)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(3)|Complex - compound substitution(2)|Insertion - Frameshift(1)	lung(10)|breast(8)|large_intestine(7)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|stomach(3)|central_nervous_system(3)|oesophagus(3)|upper_aerodigestive_tract(2)|liver(2)|skin(2)|ovary(2)|vulva(1)|soft_tissue(1)|endometrium(1)											54.0	54.0	54.0					17																	7578427		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.503A>G	17.37:g.7578427T>C	ENSP00000269305:p.His168Arg		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.H168R	ENST00000269305.4	37	c.503	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	14.51	2.556919	0.45590	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99800	-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8	5.59	0.619	0.17630	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.433617	0.26390	N	0.024660	D	0.99563	0.9843	M	0.88105	2.93	0.40329	D	0.978904	D;D;B;D;P;P;D	0.62365	0.964;0.974;0.442;0.98;0.865;0.905;0.991	P;D;B;D;D;P;P	0.64506	0.781;0.924;0.277;0.918;0.926;0.896;0.851	D	0.98366	1.0551	10	0.72032	D	0.01	-5.8035	1.5779	0.02628	0.1555:0.1517:0.1294:0.5634	.	129;168;168;75;168;168;168	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	168;168;168;168;168;168;157;75;36;75;36	ENSP00000410739:H168R;ENSP00000352610:H168R;ENSP00000269305:H168R;ENSP00000398846:H168R;ENSP00000391127:H168R;ENSP00000391478:H168R;ENSP00000425104:H36R;ENSP00000423862:H75R	ENSP00000269305:H168R	H	-	2	0	TP53	7519152	1.000000	0.71417	0.001000	0.08648	0.147000	0.21601	5.155000	0.64900	-0.137000	0.11455	-0.256000	0.11100	CAC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	45	0	T	NM_000546		7578427	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	62.96	10	17	SNP	0.995	C
TRPC1	7220	genome.wustl.edu	37	3	142521063	142521063	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:142521063T>G	ENST00000476941.1	+	10	2120	c.1634T>G	c.(1633-1635)cTt>cGt	p.L545R	RNU7-47P_ENST00000515978.1_RNA|TRPC1_ENST00000273482.6_Missense_Mutation_p.L511R	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	545					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						GGGATGTTTCTTCTTGTTTTG	0.343																																																	0													102.0	103.0	103.0					3																	142521063		2203	4300	6503	SO:0001583	missense	0			X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.1634T>G	3.37:g.142521063T>G	ENSP00000419313:p.Leu545Arg		Q14CE4	Missense_Mutation	SNP	pfam_TRP_dom,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC1_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.L545R	ENST00000476941.1	37	c.1634	CCDS58856.1	3	.	.	.	.	.	.	.	.	.	.	T	23.8	4.460773	0.84317	.	.	ENSG00000144935	ENST00000476941;ENST00000273482;ENST00000416210	D;D	0.98926	-5.24;-5.24	5.47	5.47	0.80525	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98617	0.9537	L	0.50333	1.59	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.997	D;D;P	0.71184	0.959;0.972;0.879	D	0.99827	1.1051	10	0.54805	T	0.06	-2.223	15.8584	0.79005	0.0:0.0:0.0:1.0	.	511;545;511	A7VJS2;P48995;P48995-2	.;TRPC1_HUMAN;.	R	545;511;64	ENSP00000419313:L545R;ENSP00000273482:L511R	ENSP00000273482:L511R	L	+	2	0	TRPC1	144003753	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.956000	0.87863	2.201000	0.70794	0.528000	0.53228	CTT	TRPC1	-	pfam_Ion_trans_dom,tigrfam_TRP_channel	ENSG00000144935		0.343	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC1	HGNC	protein_coding	OTTHUMT00000354520.1	-	0.00	122	0	T	NM_003304		142521063	+1	tier1	-	no_errors	ENST00000476941	ensembl	human	known	74_37	missense	15.54	163	30	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179411010	179411010	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr2:179411010C>A	ENST00000591111.1	-	292	90349	c.90125G>T	c.(90124-90126)aGt>aTt	p.S30042I	TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S22743I|TTN_ENST00000460472.2_Missense_Mutation_p.S22618I|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.S29115I|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.S22810I|RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S31683I			Q8WZ42	TITIN_HUMAN	titin	30042	Ig-like 136.		S -> G. {ECO:0000269|PubMed:17344846}.		adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTATTTTCCACTGTCACTTCT	0.433																																																	0													211.0	204.0	207.0					2																	179411010		1955	4143	6098	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.90125G>T	2.37:g.179411010C>A	ENSP00000465570:p.Ser30042Ile		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S29115I	ENST00000591111.1	37	c.87344		2	.	.	.	.	.	.	.	.	.	.	C	12.39	1.923982	0.34002	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41	5.66	4.79	0.61399	Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.82623	0.5077	M	0.87038	2.855	0.35072	D	0.762559	D;D;D;D	0.61080	0.989;0.989;0.989;0.989	P;P;P;P	0.59357	0.814;0.814;0.814;0.856	D	0.89600	0.3834	9	0.87932	D	0	.	17.7236	0.88359	0.0:0.6656:0.3344:0.0	.	22618;22743;22810;30042	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	29115;22618;22810;22743;22615	ENSP00000343764:S29115I;ENSP00000434586:S22618I;ENSP00000340554:S22810I;ENSP00000352154:S22743I	ENSP00000340554:S22810I	S	-	2	0	TTN	179119256	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	3.468000	0.53086	0.749000	0.32854	-0.795000	0.03280	AGT	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.433	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	53	0	C	NM_133378		179411010	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	37.80	51	31	SNP	1.000	A
TUBGCP3	10426	genome.wustl.edu	37	13	113140238	113140238	+	3'UTR	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr13:113140238G>A	ENST00000261965.3	-	0	2979					NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3						G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					CCTGCAGGACGTCAATGGGAA	0.627																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.*69C>T	13.37:g.113140238G>A			O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	RNA	SNP	-	NULL	ENST00000261965.3	37	NULL	CCDS9525.1	13																																																																																			TUBGCP3	-	-	ENSG00000126216		0.627	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP3	HGNC	protein_coding	OTTHUMT00000045825.2	-	0.00	30	0	G	NM_006322		113140238	-1	tier1	-	no_errors	ENST00000469302	ensembl	human	known	74_37	rna	17.86	23	5	SNP	0.000	A
TXNIP	10628	genome.wustl.edu	37	1	145440123	145440123	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:145440123G>T	ENST00000369317.4	+	4	891	c.557G>T	c.(556-558)aGa>aTa	p.R186I	TXNIP_ENST00000475171.1_Intron	NM_006472.3	NP_006463.3	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	186					cell cycle (GO:0007049)|cellular response to tumor cell (GO:0071228)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|negative regulation of cell division (GO:0051782)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|protein import into nucleus (GO:0006606)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	21	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CGAATTGACAGAAAAGGATTC	0.458																																																	0													141.0	154.0	150.0					1																	145440123		2203	4300	6503	SO:0001583	missense	0			S73591	CCDS72876.1	1q11	2008-07-18			ENSG00000117289	ENSG00000265972			16952	protein-coding gene	gene with protein product	"""upregulated by 1,25-dihydroxyvitamin D-3"", ""thioredoxin binding protein 2"""	606599				8086474	Standard	NM_006472		Approved	VDUP1, EST01027, HHCPA78, THIF	uc001enn.4	Q9H3M7	OTTHUMG00000013755	ENST00000369317.4:c.557G>T	1.37:g.145440123G>T	ENSP00000358323:p.Arg186Ile		B4E3D3|Q16226|Q6PML0|Q9BXG9	Missense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.R186I	ENST00000369317.4	37	c.557	CCDS913.1	1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.614248	0.46631	.	.	ENSG00000117289	ENST00000369317;ENST00000425134	T;T	0.21031	2.03;2.03	5.17	4.26	0.50523	Immunoglobulin E-set (1);Arrestin-like, C-terminal (1);	0.052617	0.64402	D	0.000001	T	0.13927	0.0337	L	0.43923	1.385	0.80722	D	1	P;B	0.44260	0.83;0.229	P;B	0.46940	0.532;0.104	T	0.01574	-1.1321	10	0.51188	T	0.08	-13.5966	11.6599	0.51341	0.0861:0.0:0.9139:0.0	.	131;186	B4E3D3;Q9H3M7	.;TXNIP_HUMAN	I	186;131	ENSP00000358323:R186I;ENSP00000396322:R131I	ENSP00000358323:R186I	R	+	2	0	TXNIP	144151480	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.091000	0.76923	1.418000	0.47098	-0.156000	0.13503	AGA	TXNIP	-	pfam_Arrestin_C-like,superfamily_Ig_E-set	ENSG00000117289		0.458	TXNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNIP	HGNC	protein_coding	OTTHUMT00000038547.1	-	0.00	63	0	G	NM_006472		145440123	+1	tier1	-	no_errors	ENST00000369317	ensembl	human	known	74_37	missense	5.00	95	5	SNP	1.000	T
UBE2D3	7323	genome.wustl.edu	37	4	103720600	103720600	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr4:103720600G>A	ENST00000453744.2	-	7	875	c.362C>T	c.(361-363)cCa>cTa	p.P121L	UBE2D3_ENST00000349311.8_Missense_Mutation_p.P121L|UBE2D3_ENST00000350435.7_Missense_Mutation_p.P115L|UBE2D3_ENST00000321805.7_Missense_Mutation_p.P121L|UBE2D3_ENST00000394804.2_Missense_Mutation_p.P121L|UBE2D3_ENST00000338145.3_Missense_Mutation_p.P121L|UBE2D3_ENST00000507845.1_Missense_Mutation_p.P92L|UBE2D3_ENST00000357194.6_Missense_Mutation_p.P123L|UBE2D3_ENST00000394803.5_Missense_Mutation_p.P121L|UBE2D3_ENST00000502404.1_Missense_Mutation_p.P92L|UBE2D3_ENST00000505207.1_Missense_Mutation_p.P92L|UBE2D3_ENST00000394801.4_Missense_Mutation_p.P121L|UBE2D3_ENST00000343106.5_Missense_Mutation_p.P121L|UBE2D3_ENST00000504211.1_Missense_Mutation_p.P92L	NM_181891.1	NP_871620.1	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3	121					apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|lung(3)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		TGCAATCTCTGGCACTAGGGG	0.353																																																	0													63.0	64.0	63.0					4																	103720600		2203	4299	6502	SO:0001583	missense	0			U39318	CCDS3659.1, CCDS3660.1, CCDS3661.1, CCDS75172.1	4q24	2011-05-19	2011-05-19		ENSG00000109332	ENSG00000109332		"""Ubiquitin-conjugating enzymes E2"""	12476	protein-coding gene	gene with protein product		602963	"""ubiquitin-conjugating enzyme E2D 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181886		Approved	UbcH5C	uc003hwl.3	P61077	OTTHUMG00000131119	ENST00000453744.2:c.362C>T	4.37:g.103720600G>A	ENSP00000396901:p.Pro121Leu		A6NJ93|A6NJB1|A6NM99|P47986|Q6IB88|Q6NXS4|Q8N924	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.P123L	ENST00000453744.2	37	c.368	CCDS3660.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.552095	0.96501	.	.	ENSG00000109332	ENST00000453744;ENST00000394801;ENST00000394803;ENST00000394804;ENST00000343106;ENST00000321805;ENST00000350435;ENST00000338145;ENST00000349311;ENST00000504211;ENST00000357194;ENST00000505207;ENST00000507845;ENST00000502404	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22	5.89	5.89	0.94794	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.57740	0.2074	L	0.54965	1.715	0.80722	D	1	P;P;D	0.69078	0.502;0.945;0.997	B;P;D	0.66716	0.273;0.753;0.946	T	0.56685	-0.7938	10	0.87932	D	0	.	20.2361	0.98357	0.0:0.0:1.0:0.0	.	123;121;121	P61077-3;P61077;P61077-2	.;UB2D3_HUMAN;.	L	121;121;121;121;121;121;115;121;121;92;123;92;92;92	ENSP00000396901:P121L;ENSP00000378280:P121L;ENSP00000378282:P121L;ENSP00000378283:P121L;ENSP00000345285:P121L;ENSP00000318494:P121L;ENSP00000337262:P115L;ENSP00000337208:P121L;ENSP00000344069:P121L;ENSP00000426620:P92L;ENSP00000349722:P123L;ENSP00000426586:P92L;ENSP00000424359:P92L;ENSP00000421904:P92L	ENSP00000318494:P121L	P	-	2	0	UBE2D3	103939712	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.611000	0.98342	2.791000	0.96007	0.591000	0.81541	CCA	UBE2D3	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000109332		0.353	UBE2D3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UBE2D3	HGNC	protein_coding	OTTHUMT00000253791.2	-	0.00	66	0	G	NM_181893		103720600	-1	tier1	-	no_errors	ENST00000357194	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	A
UFC1	51506	genome.wustl.edu	37	1	161123890	161123890	+	Nonsense_Mutation	SNP	G	G	T	rs182746901		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr1:161123890G>T	ENST00000368003.5	+	1	349	c.103G>T	c.(103-105)Gaa>Taa	p.E35*	UFC1_ENST00000473766.1_3'UTR|RP11-297K8.2_ENST00000420498.1_RNA	NM_016406.3	NP_057490.2	Q9Y3C8	UFC1_HUMAN	ubiquitin-fold modifier conjugating enzyme 1	35					protein ufmylation (GO:0071569)|response to endoplasmic reticulum stress (GO:0034976)	extracellular vesicular exosome (GO:0070062)	UFM1 conjugating enzyme activity (GO:0071568)			endometrium(1)|lung(9)	10	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			ACTGAAGGAGGAATATCAGTC	0.537																																																	0													183.0	159.0	167.0					1																	161123890		2203	4300	6503	SO:0001587	stop_gained	0			AF161504	CCDS1220.1	1q23.3	2008-02-05			ENSG00000143222	ENSG00000143222			26941	protein-coding gene	gene with protein product		610554				15071506, 11042152	Standard	NM_016406		Approved	HSPC155	uc001fyd.4	Q9Y3C8	OTTHUMG00000033155	ENST00000368003.5:c.103G>T	1.37:g.161123890G>T	ENSP00000356982:p.Glu35*		A8K9R1|D3DVF9|Q549X0|Q5VTX1|Q9BS96|Q9P009	Nonsense_Mutation	SNP	pfam_Ufc1,superfamily_UBQ-conjugating_enzyme/RWD,pirsf_Ufc1	p.E35*	ENST00000368003.5	37	c.103	CCDS1220.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.643173	0.98406	.	.	ENSG00000143222	ENST00000368003	.	.	.	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-18.5876	19.289	0.94090	0.0:0.0:1.0:0.0	.	.	.	.	X	35	.	ENSP00000356982:E35X	E	+	1	0	UFC1	159390514	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	8.715000	0.91416	2.852000	0.98041	0.644000	0.83932	GAA	UFC1	-	pfam_Ufc1,superfamily_UBQ-conjugating_enzyme/RWD,pirsf_Ufc1	ENSG00000143222		0.537	UFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFC1	HGNC	protein_coding	OTTHUMT00000080810.1	-	0.00	93	0	G	NM_016406		161123890	+1	tier1	-	no_errors	ENST00000368003	ensembl	human	known	74_37	nonsense	58.49	43	62	SNP	1.000	T
USP13	8975	genome.wustl.edu	37	3	179481948	179481948	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:179481948C>T	ENST00000263966.3	+	18	2722	c.2251C>T	c.(2251-2253)Cga>Tga	p.R751*	USP13_ENST00000496897.1_Nonsense_Mutation_p.R686*	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)	751	UBA 2. {ECO:0000255|PROSITE- ProRule:PRU00212}.|USP.				autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			TCAGGCACTACGAGCAACGGT	0.448																																																	0													107.0	93.0	98.0					3																	179481948		2203	4300	6503	SO:0001587	stop_gained	0			U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.2251C>T	3.37:g.179481948C>T	ENSP00000263966:p.Arg751*		A8K2S3|B4DYF3|D3DNS2|Q96B25	Nonsense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_UBA/Ts_N,pfam_Znf_UBP,superfamily_UBA-like,smart_Znf_UBP,smart_UBA/transl_elong_EF1B_N_euk,pirsf_Ubiquitinyl_hydrolase,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.R751*	ENST00000263966.3	37	c.2251	CCDS3235.1	3	.	.	.	.	.	.	.	.	.	.	C	44	10.633320	0.99441	.	.	ENSG00000058056	ENST00000263966;ENST00000496897	.	.	.	5.69	3.69	0.42338	.	0.127918	0.51477	D	0.000084	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	-4.0578	13.4221	0.61005	0.4312:0.5688:0.0:0.0	.	.	.	.	X	751;686	.	ENSP00000263966:R751X	R	+	1	2	USP13	180964642	0.928000	0.31464	0.829000	0.32907	0.940000	0.58332	2.191000	0.42640	1.358000	0.45922	0.655000	0.94253	CGA	USP13	-	pfam_Peptidase_C19/C67,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pirsf_Ubiquitinyl_hydrolase,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19/C67	ENSG00000058056		0.448	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP13	HGNC	protein_coding	OTTHUMT00000349617.1	-	0.00	37	0	C			179481948	+1	tier1	-	no_errors	ENST00000263966	ensembl	human	known	74_37	nonsense	9.09	40	4	SNP	0.909	T
VCAN	1462	genome.wustl.edu	37	5	82834775	82834775	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr5:82834775G>T	ENST00000265077.3	+	8	6518	c.5953G>T	c.(5953-5955)Gac>Tac	p.D1985Y	VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.D998Y|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000342785.4_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1985	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TCACATATCTGACTCAGAAGG	0.502																																																	0													104.0	95.0	98.0					5																	82834775		2203	4300	6503	SO:0001583	missense	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.5953G>T	5.37:g.82834775G>T	ENSP00000265077:p.Asp1985Tyr		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EG-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Link,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.D1985Y	ENST00000265077.3	37	c.5953	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	G	11.42	1.633477	0.29068	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	D;D;T	0.89343	-2.46;-2.5;2.51	5.97	1.13	0.20643	.	0.378221	0.25478	N	0.030384	D	0.88934	0.6572	M	0.72894	2.215	0.18873	N	0.999986	D;P	0.53462	0.96;0.933	P;P	0.51550	0.673;0.473	T	0.81439	-0.0932	10	0.72032	D	0.01	.	6.3338	0.21285	0.1979:0.2443:0.5579:0.0	.	998;1985	P13611-2;P13611	.;CSPG2_HUMAN	Y	1985;998;998	ENSP00000265077:D1985Y;ENSP00000340062:D998Y;ENSP00000426251:D998Y	ENSP00000265077:D1985Y	D	+	1	0	VCAN	82870531	0.053000	0.20554	0.011000	0.14972	0.061000	0.15899	2.059000	0.41384	-0.069000	0.12931	-0.274000	0.10170	GAC	VCAN	-	NULL	ENSG00000038427		0.502	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	-	0.00	39	0	G	NM_004385		82834775	+1	tier1	-	no_errors	ENST00000265077	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.106	T
VPS13B	157680	genome.wustl.edu	37	8	100286546	100286546	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr8:100286546G>T	ENST00000358544.2	+	18	2747	c.2636G>T	c.(2635-2637)tGt>tTt	p.C879F	VPS13B_ENST00000395996.1_Missense_Mutation_p.C879F|VPS13B_ENST00000357162.2_Missense_Mutation_p.C879F	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	879					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ATAAAAATTTGTGCCAAAGCC	0.448																																					Colon(161;2205 2542 7338 31318)												0													88.0	93.0	91.0					8																	100286546		2203	4300	6503	SO:0001583	missense	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.2636G>T	8.37:g.100286546G>T	ENSP00000351346:p.Cys879Phe		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.C879F	ENST00000358544.2	37	c.2636	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	G	13.44	2.236673	0.39498	.	.	ENSG00000132549	ENST00000357162;ENST00000358544;ENST00000395996	T;T;T	0.67698	-0.28;-0.28;0.02	5.65	5.65	0.86999	.	0.066374	0.64402	D	0.000005	T	0.64148	0.2572	L	0.29908	0.895	0.53688	D	0.999979	P;P;P;P	0.51537	0.946;0.892;0.828;0.83	P;P;B;P	0.50825	0.651;0.518;0.319;0.651	T	0.56353	-0.7993	10	0.09590	T	0.72	.	20.0822	0.97779	0.0:0.0:1.0:0.0	.	879;879;879;879	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3	.;.;VP13B_HUMAN;.	F	879	ENSP00000349685:C879F;ENSP00000351346:C879F;ENSP00000379318:C879F	ENSP00000349685:C879F	C	+	2	0	VPS13B	100355722	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.418000	0.80167	2.826000	0.97356	0.563000	0.77884	TGT	VPS13B	-	NULL	ENSG00000132549		0.448	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	-	0.00	139	0	G	NM_184042		100286546	+1	tier1	-	no_errors	ENST00000358544	ensembl	human	known	74_37	missense	24.40	127	41	SNP	1.000	T
WASH6P	653440	genome.wustl.edu	37	X	155251329	155251329	+	RNA	SNP	G	G	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chrX:155251329G>C	ENST00000461007.1	+	0	337				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										CAGCCTCTGTGATCTTCTCCA	0.617																																																	0																																												0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155251329G>C			A6NGF1|Q8N305	RNA	SNP	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			WASH6P	-	-	ENSG00000182484		0.617	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	HGNC	pseudogene	OTTHUMT00000058840.1	-	0.00	43	0	G	NG_008380		155251329	+1	tier1	-	no_errors	ENST00000461007	ensembl	human	known	74_37	rna	26.53	36	13	SNP	0.899	C
WDR41	55255	genome.wustl.edu	37	5	76736675	76736675	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr5:76736675T>C	ENST00000296679.4	-	9	1220	c.845A>G	c.(844-846)aAt>aGt	p.N282S	WDR41_ENST00000414719.2_Missense_Mutation_p.N28S|WDR41_ENST00000507029.1_Missense_Mutation_p.N227S	NM_018268.2	NP_060738.2	Q9HAD4	WDR41_HUMAN	WD repeat domain 41	282						lysosomal membrane (GO:0005765)				NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)	14		all_lung(232;0.000961)|Lung NSC(167;0.0011)|Ovarian(174;0.0105)|Prostate(461;0.059)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-50)|Epithelial(54;2.04e-44)|all cancers(79;6.84e-40)		AGAAATGTCATTTGATTTTTG	0.378																																																	0													115.0	115.0	115.0					5																	76736675		2203	4300	6503	SO:0001583	missense	0			AF115511	CCDS4038.1	5q14	2013-01-09			ENSG00000164253	ENSG00000164253		"""WD repeat domain containing"""	25601	protein-coding gene	gene with protein product						12477932	Standard	NM_018268		Approved	FLJ10904	uc003kff.1	Q9HAD4	OTTHUMG00000102169	ENST00000296679.4:c.845A>G	5.37:g.76736675T>C	ENSP00000296679:p.Asn282Ser		B4DT55|Q7Z792|Q8IWG3|Q8IXA9|Q8NDA7|Q9NV62	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.N282S	ENST00000296679.4	37	c.845	CCDS4038.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.68|10.68	1.416939|1.416939	0.25552|0.25552	.|.	.|.	ENSG00000164253|ENSG00000164253	ENST00000511630|ENST00000296679;ENST00000414719;ENST00000515253;ENST00000507029;ENST00000507654;ENST00000511791	.|T;T;T;T;T;T	.|0.64803	.|-0.12;-0.12;-0.12;-0.12;0.1;2.38	5.8|5.8	4.62|4.62	0.57501|0.57501	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.|0.177809	.|0.64402	.|D	.|0.000010	T|T	0.48409|0.48409	0.1498|0.1498	L|L	0.46157|0.46157	1.445|1.445	0.31254|0.31254	N|N	0.69372|0.69372	.|B;B;B	.|0.12013	.|0.001;0.001;0.005	.|B;B;B	.|0.08055	.|0.002;0.002;0.003	T|T	0.46527|0.46527	-0.9185|-0.9185	5|10	.|0.09084	.|T	.|0.74	-7.4712|-7.4712	8.1758|8.1758	0.31281|0.31281	0.0:0.0693:0.136:0.7947|0.0:0.0693:0.136:0.7947	.|.	.|227;28;282	.|B4DT55;B4E2L4;Q9HAD4	.|.;.;WDR41_HUMAN	V|S	108|282;28;217;227;53;74	.|ENSP00000296679:N282S;ENSP00000392931:N28S;ENSP00000426499:N217S;ENSP00000424287:N227S;ENSP00000427291:N53S;ENSP00000423540:N74S	.|ENSP00000296679:N282S	M|N	-|-	1|2	0|0	WDR41|WDR41	76772431|76772431	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.989000|0.989000	0.77384|0.77384	1.924000|1.924000	0.40065|0.40065	0.994000|0.994000	0.38892|0.38892	0.528000|0.528000	0.53228|0.53228	ATG|AAT	WDR41	-	superfamily_WD40_repeat_dom	ENSG00000164253		0.378	WDR41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR41	HGNC	protein_coding	OTTHUMT00000220014.2	-	0.00	68	0	T	NM_018268		76736675	-1	tier1	-	no_errors	ENST00000296679	ensembl	human	known	74_37	missense	56.86	22	29	SNP	1.000	C
XKR4	114786	genome.wustl.edu	37	8	56015428	56015428	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr8:56015428G>A	ENST00000327381.6	+	1	480	c.380G>A	c.(379-381)gGc>gAc	p.G127D		NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	127						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			GCGGACGTGGGCACAGACGTC	0.682																																																	0													53.0	47.0	49.0					8																	56015428		2201	4298	6499	SO:0001583	missense	0			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.380G>A	8.37:g.56015428G>A	ENSP00000328326:p.Gly127Asp		Q96PZ8	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.G127D	ENST00000327381.6	37	c.380	CCDS34893.1	8	.	.	.	.	.	.	.	.	.	.	G	24.0	4.478076	0.84747	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	T	0.67523	-0.27	5.09	4.22	0.49857	.	0.453978	0.21957	N	0.066651	T	0.74291	0.3697	M	0.79614	2.46	0.49915	D	0.999833	P	0.41420	0.749	P	0.48368	0.575	T	0.76465	-0.2949	10	0.56958	D	0.05	-5.7183	13.3546	0.60621	0.0769:0.0:0.9231:0.0	.	127	Q5GH76	XKR4_HUMAN	D	127	ENSP00000328326:G127D	ENSP00000328326:G127D	G	+	2	0	XKR4	56177982	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	8.850000	0.92190	1.134000	0.42165	0.650000	0.86243	GGC	XKR4	-	pfam_Transport_prot_XK	ENSG00000206579		0.682	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR4	HGNC	protein_coding	OTTHUMT00000378129.2	-	0.00	23	0	G	NM_052898		56015428	+1	tier1	-	no_errors	ENST00000327381	ensembl	human	known	74_37	missense	16.00	21	4	SNP	1.000	A
YY1	7528	genome.wustl.edu	37	14	100728689	100728689	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr14:100728689T>C	ENST00000262238.4	+	2	988	c.728T>C	c.(727-729)aTt>aCt	p.I243T	RP11-638I2.2_ENST00000555212.1_RNA	NM_003403.3	NP_003394.1	P25490	TYY1_HUMAN	YY1 transcription factor	243					anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|cell differentiation (GO:0030154)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromosome organization (GO:0051276)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to prostaglandin F (GO:0034696)|response to UV-C (GO:0010225)|RNA localization (GO:0006403)|spermatogenesis (GO:0007283)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|four-way junction DNA binding (GO:0000400)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(1)|prostate(4)|skin(1)	11		Melanoma(154;0.152)				GAACAGATCATTGGAGAGAAC	0.368																																																	0													80.0	81.0	81.0					14																	100728689		2203	4300	6503	SO:0001583	missense	0			BC020324	CCDS9957.1	14q	2013-01-08			ENSG00000100811	ENSG00000100811		"""INO80 complex subunits"", ""Zinc fingers, C2H2-type"""	12856	protein-coding gene	gene with protein product	"""INO80 complex subunit S"", ""Yin and Yang 1 protein"""	600013				1655281, 7912122	Standard	NM_003403		Approved	NF-E1, DELTA, UCRBP, YIN-YANG-1, INO80S	uc001ygy.2	P25490	OTTHUMG00000150479	ENST00000262238.4:c.728T>C	14.37:g.100728689T>C	ENSP00000262238:p.Ile243Thr		Q14935	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pirsf_TF_Yin_yang,pfscan_Znf_C2H2	p.I243T	ENST00000262238.4	37	c.728	CCDS9957.1	14	.	.	.	.	.	.	.	.	.	.	T	12.18	1.860785	0.32884	.	.	ENSG00000100811	ENST00000262238	T	0.10477	2.87	5.69	5.69	0.88448	.	0.138046	0.48286	U	0.000193	T	0.07458	0.0188	N	0.14661	0.345	0.44899	D	0.997919	B	0.17852	0.024	B	0.10450	0.005	T	0.34329	-0.9833	10	0.13470	T	0.59	.	16.298	0.82784	0.0:0.0:0.0:1.0	.	243	P25490	TYY1_HUMAN	T	243	ENSP00000262238:I243T	ENSP00000262238:I243T	I	+	2	0	YY1	99798442	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	4.997000	0.63921	2.310000	0.77875	0.449000	0.29647	ATT	YY1	-	pirsf_TF_Yin_yang	ENSG00000100811		0.368	YY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YY1	HGNC	protein_coding	OTTHUMT00000318277.1		0.00	107	0	T	NM_003403		100728689	+1			no_errors	ENST00000262238	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	C
ZFP90	146198	genome.wustl.edu	37	16	68598471	68598471	+	Missense_Mutation	SNP	C	C	A	rs375588905		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:68598471C>A	ENST00000570495.1	+	5	2073	c.1781C>A	c.(1780-1782)aCc>aAc	p.T594N	ZFP90_ENST00000398253.2_Missense_Mutation_p.T594N|ZFP90_ENST00000563169.2_Missense_Mutation_p.T594N			Q8TF47	ZFP90_HUMAN	ZFP90 zinc finger protein	594					negative regulation of DNA binding (GO:0043392)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00233)|Epithelial(162;0.0184)|all cancers(182;0.0946)		CGAAAAAAAACCAACCTGCAT	0.408																																																	0																																										SO:0001583	missense	0			AK074332	CCDS42183.1	16q22.1	2013-01-08	2012-11-27			ENSG00000184939		"""Zinc fingers, C2H2-type"", ""-"""	23329	protein-coding gene	gene with protein product		609451	"""zinc finger protein 90 homolog (mouse)"""			7576184	Standard	NM_133458		Approved	KIAA1954, NK10, ZNF756	uc002ewc.3	Q8TF47		ENST00000570495.1:c.1781C>A	16.37:g.68598471C>A	ENSP00000460547:p.Thr594Asn		B2RU00|B3KVE7|Q49AD1|Q96MQ6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T594N	ENST00000570495.1	37	c.1781	CCDS42183.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.927|9.927	1.213675|1.213675	0.22289|0.22289	.|.	.|.	ENSG00000184939|ENSG00000184939	ENST00000327567|ENST00000398253	.|T	.|0.07444	.|3.19	5.64|5.64	4.68|4.68	0.58851|0.58851	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|.	.|.	.|.	.|.	T|T	0.05960|0.05960	0.0155|0.0155	N|N	0.20304|0.20304	0.555|0.555	0.09310|0.09310	N|N	1|1	.|B	.|0.26483	.|0.15	.|B	.|0.19946	.|0.027	T|T	0.16689|0.16689	-1.0394|-1.0394	6|9	0.22109|0.66056	T|D	0.4|0.02	-8.22|-8.22	7.5237|7.5237	0.27643|0.27643	0.0:0.7446:0.1688:0.0866|0.0:0.7446:0.1688:0.0866	.|.	.|594	.|Q8TF47	.|ZFP90_HUMAN	T|N	67|594	.|ENSP00000381304:T594N	ENSP00000329859:P67T|ENSP00000381304:T594N	P|T	+|+	1|2	0|0	ZFP90|ZFP90	67155972|67155972	0.000000|0.000000	0.05858|0.05858	1.000000|1.000000	0.80357|0.80357	0.948000|0.948000	0.59901|0.59901	0.030000|0.030000	0.13688|0.13688	2.833000|2.833000	0.97629|0.97629	0.555000|0.555000	0.69702|0.69702	CCA|ACC	ZFP90	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000184939		0.408	ZFP90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP90	HGNC	protein_coding	OTTHUMT00000436217.3	-	0.00	60	0	C	XM_085375		68598471	+1	tier1	-	no_errors	ENST00000398253	ensembl	human	known	74_37	missense	27.84	70	27	SNP	0.003	A
ZIC1	7545	genome.wustl.edu	37	3	147130385	147130385	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr3:147130385G>C	ENST00000282928.4	+	2	1792	c.1063G>C	c.(1063-1065)Gtg>Ctg	p.V355L		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	355					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						GCACATGCACGTGCACACGAG	0.557																																																	0													148.0	117.0	128.0					3																	147130385		2203	4300	6503	SO:0001583	missense	0			D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.1063G>C	3.37:g.147130385G>C	ENSP00000282928:p.Val355Leu		Q2M3N1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V355L	ENST00000282928.4	37	c.1063	CCDS3136.1	3	.	.	.	.	.	.	.	.	.	.	G	25.7	4.665230	0.88251	.	.	ENSG00000152977	ENST00000282928	T	0.07567	3.18	4.01	4.01	0.46588	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	U	0.000001	T	0.08223	0.0205	N	0.21142	0.635	0.80722	D	1	B	0.10296	0.003	B	0.22880	0.042	T	0.20042	-1.0287	10	0.87932	D	0	.	16.1243	0.81382	0.0:0.0:1.0:0.0	.	355	Q15915	ZIC1_HUMAN	L	355	ENSP00000282928:V355L	ENSP00000282928:V355L	V	+	1	0	ZIC1	148613075	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.926000	0.87569	1.772000	0.52199	0.462000	0.41574	GTG	ZIC1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000152977		0.557	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC1	HGNC	protein_coding	OTTHUMT00000355497.1	-	0.00	89	0	G	NM_003412		147130385	+1	tier1	-	no_errors	ENST00000282928	ensembl	human	known	74_37	missense	15.13	101	18	SNP	1.000	C
ZMIZ2	83637	genome.wustl.edu	37	7	44798936	44798936	+	Missense_Mutation	SNP	G	G	T	rs377637200		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr7:44798936G>T	ENST00000309315.4	+	7	993	c.870G>T	c.(868-870)caG>caT	p.Q290H	ZMIZ2_ENST00000441627.1_Missense_Mutation_p.Q290H|ZMIZ2_ENST00000433667.1_Missense_Mutation_p.Q258H|ZMIZ2_ENST00000413916.1_Missense_Mutation_p.Q258H|ZMIZ2_ENST00000265346.7_Missense_Mutation_p.Q290H	NM_031449.3	NP_113637.3	Q8NF64	ZMIZ2_HUMAN	zinc finger, MIZ-type containing 2	290	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|zinc ion binding (GO:0008270)	p.Q290H(1)		breast(3)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						GCACCGCCCAGTTTGCGCCCA	0.637																																					NSCLC(20;604 852 1948 16908 50522)												1	Substitution - Missense(1)	endometrium(1)											76.0	88.0	84.0					7																	44798936		2059	4176	6235	SO:0001583	missense	0			AK090415	CCDS43576.1, CCDS43577.1, CCDS75591.1	7p13	2009-11-06			ENSG00000122515	ENSG00000122515		"""Zinc fingers, MIZ-type"""	22229	protein-coding gene	gene with protein product		611196					Standard	XM_005249866		Approved	KIAA1886, hZIMP7, ZIMP7, DKFZp761I2123, NET27	uc003tlr.3	Q8NF64	OTTHUMG00000155817	ENST00000309315.4:c.870G>T	7.37:g.44798936G>T	ENSP00000311778:p.Gln290His		A4D2K7|D3DVL1|O94790|Q0VGB4|Q659A8|Q6JKL5|Q8WTX8|Q96Q01|Q9BQH7	Missense_Mutation	SNP	pfam_Znf_MIZ,pfscan_Znf_MIZ	p.Q290H	ENST00000309315.4	37	c.870	CCDS43576.1	7	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354802	0.61293	.	.	ENSG00000122515	ENST00000413916;ENST00000309315;ENST00000441627;ENST00000433667;ENST00000265346;ENST00000414051	T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57	4.28	3.3	0.37823	.	0.000000	0.50627	D	0.000112	T	0.49525	0.1562	M	0.75777	2.31	0.51233	D	0.999914	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.998;0.971;0.998	T	0.51450	-0.8704	10	0.87932	D	0	-7.0134	6.6087	0.22739	0.274:0.0:0.726:0.0	.	290;290;258	Q8NF64-2;Q8NF64;Q8NF64-3	.;ZMIZ2_HUMAN;.	H	258;290;290;258;290;290	ENSP00000409648:Q258H;ENSP00000311778:Q290H;ENSP00000414723:Q290H;ENSP00000396601:Q258H;ENSP00000265346:Q290H	ENSP00000265346:Q290H	Q	+	3	2	ZMIZ2	44765461	1.000000	0.71417	0.992000	0.48379	0.983000	0.72400	1.754000	0.38369	2.198000	0.70561	0.462000	0.41574	CAG	ZMIZ2	-	NULL	ENSG00000122515		0.637	ZMIZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMIZ2	HGNC	protein_coding	OTTHUMT00000341790.1		0.00	39	0	G	NM_031449		44798936	+1			no_errors	ENST00000309315	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
ZNF236	7776	genome.wustl.edu	37	18	74583664	74583664	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr18:74583664A>T	ENST00000253159.8	+	5	742	c.544A>T	c.(544-546)Agt>Tgt	p.S182C	ZNF236_ENST00000583095.1_Intron|ZNF236_ENST00000320610.9_Missense_Mutation_p.S184C	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	182					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		TAGGGTATCAAGTACAAGGTC	0.413																																																	0													138.0	121.0	126.0					18																	74583664		1891	4112	6003	SO:0001583	missense	0			AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.544A>T	18.37:g.74583664A>T	ENSP00000253159:p.Ser182Cys		B2RTX9|Q9UL37	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S182C	ENST00000253159.8	37	c.544	CCDS42447.1	18	.	.	.	.	.	.	.	.	.	.	A	14.39	2.521196	0.44866	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.12465	2.68;2.81	4.64	-5.33	0.02713	.	0.515810	0.21843	N	0.068286	T	0.08044	0.0201	N	0.19112	0.55	0.20703	N	0.999861	B;P	0.51791	0.049;0.948	B;B	0.43155	0.023;0.41	T	0.18178	-1.0345	10	0.66056	D	0.02	.	11.9588	0.52997	0.473:0.0:0.527:0.0	.	182;182	Q9NWI2;Q9UL36	.;ZN236_HUMAN	C	182	ENSP00000253159:S182C;ENSP00000444524:S182C	ENSP00000253159:S182C	S	+	1	0	ZNF236	72712652	0.989000	0.36119	0.073000	0.20177	0.633000	0.38033	2.690000	0.47001	-1.218000	0.02601	-0.376000	0.06991	AGT	ZNF236	-	NULL	ENSG00000130856		0.413	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF236	HGNC	protein_coding	OTTHUMT00000445776.1	-	0.00	105	0	A			74583664	+1	tier1	-	no_errors	ENST00000253159	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.962	T
ZNF257	113835	genome.wustl.edu	37	19	22272088	22272088	+	Silent	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr19:22272088G>A	ENST00000594947.1	+	4	1680	c.1536G>A	c.(1534-1536)gaG>gaA	p.E512E		NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	512					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATACTGGAGAGAAACCCTACA	0.398																																																	0													38.0	42.0	41.0					19																	22272088		2116	4251	6367	SO:0001819	synonymous_variant	0			AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.1536G>A	19.37:g.22272088G>A			B3KPS4|E9PG34|Q8NE34	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E512	ENST00000594947.1	37	c.1536	CCDS46030.1	19																																																																																			ZNF257	-	pfscan_Znf_C2H2	ENSG00000197134		0.398	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF257	HGNC	protein_coding	OTTHUMT00000464382.1	-	0.00	84	0	G			22272088	+1	tier1	-	no_errors	ENST00000594947	ensembl	human	known	74_37	silent	14.29	108	18	SNP	1.000	A
ZNF33A	7581	genome.wustl.edu	37	10	38345270	38345270	+	Nonsense_Mutation	SNP	C	C	T	rs267602486		TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr10:38345270C>T	ENST00000458705.2	+	5	2373	c.2215C>T	c.(2215-2217)Cag>Tag	p.Q739*	ZNF33A_ENST00000432900.2_Nonsense_Mutation_p.Q746*|ZNF33A_ENST00000307441.9_Nonsense_Mutation_p.Q739*|ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000374618.3_Nonsense_Mutation_p.Q740*			Q06730	ZN33A_HUMAN	zinc finger protein 33A	739					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q739*(1)		cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						TGCTCAACATCAGAGATCACA	0.388																																																	1	Substitution - Nonsense(1)	skin(1)											105.0	100.0	102.0					10																	38345270		2203	4300	6503	SO:0001587	stop_gained	0			D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.2215C>T	10.37:g.38345270C>T	ENSP00000387713:p.Gln739*		A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q746*	ENST00000458705.2	37	c.2236	CCDS31182.1	10	.	.	.	.	.	.	.	.	.	.	C	16.11	3.028792	0.54790	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000307441	.	.	.	1.92	1.92	0.25849	.	0.000000	0.32343	N	0.006233	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	9.4078	0.38473	0.0:1.0:0.0:0.0	.	.	.	.	X	740;746;739;739	.	ENSP00000304268:Q739X	Q	+	1	0	ZNF33A	38385276	0.000000	0.05858	0.993000	0.49108	0.337000	0.28794	0.276000	0.18716	1.044000	0.40200	0.313000	0.20887	CAG	ZNF33A	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000189180		0.388	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF33A	HGNC	protein_coding	OTTHUMT00000047614.1	-	0.00	104	0	C	NM_006974		38345270	+1	tier1	-	no_errors	ENST00000432900	ensembl	human	known	74_37	nonsense	15.32	105	19	SNP	0.852	T
ZNF57	126295	genome.wustl.edu	37	19	2917842	2917842	+	Missense_Mutation	SNP	G	G	A	rs149690257	byFrequency	TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr19:2917842G>A	ENST00000306908.5	+	4	1371	c.1223G>A	c.(1222-1224)cGa>cAa	p.R408Q	ZNF57_ENST00000523428.1_Missense_Mutation_p.R376Q|AC006277.2_ENST00000520090.2_RNA	NM_173480.2	NP_775751.1	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	408					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		AGATCATTCCGAGGTCATTTG	0.428													G|||	2	0.000399361	0.0	0.0	5008	,	,		22693	0.0		0.0	False		,,,				2504	0.002				NSCLC(150;910 1964 4303 10464 26498)												0													95.0	86.0	89.0					19																	2917842		2203	4300	6503	SO:0001583	missense	0			M88368	CCDS12098.1	19p13.3	2013-01-08			ENSG00000171970	ENSG00000171970		"""Zinc fingers, C2H2-type"", ""-"""	13125	protein-coding gene	gene with protein product			"""zinc finger protein 424"""	ZNF424		1505991	Standard	NM_173480		Approved		uc002lwr.3	Q68EA5	OTTHUMG00000164485	ENST00000306908.5:c.1223G>A	19.37:g.2917842G>A	ENSP00000303696:p.Arg408Gln		Q8N6R9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R408Q	ENST00000306908.5	37	c.1223	CCDS12098.1	19	.	.	.	.	.	.	.	.	.	.	G	2.637	-0.285137	0.05605	.	.	ENSG00000171970	ENST00000306908;ENST00000395204;ENST00000523428	T;T	0.04275	3.66;3.66	2.25	-4.5	0.03493	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01976	0.0062	N	0.05050	-0.12	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47368	-0.9123	9	0.20046	T	0.44	.	5.4761	0.16695	0.2484:0.0:0.5675:0.1841	.	408	Q68EA5	ZNF57_HUMAN	Q	408;410;376	ENSP00000303696:R408Q;ENSP00000430223:R376Q	ENSP00000303696:R408Q	R	+	2	0	ZNF57	2868842	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-1.935000	0.01550	-1.296000	0.02353	-0.514000	0.04452	CGA	ZNF57	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171970		0.428	ZNF57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF57	HGNC	protein_coding	OTTHUMT00000378969.1		0.00	91	0	G	NM_173480		2917842	+1			no_errors	ENST00000306908	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.000	A
ZNF557	79230	genome.wustl.edu	37	19	7083472	7083472	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr19:7083472A>T	ENST00000439035.2	+	8	1229	c.989A>T	c.(988-990)cAg>cTg	p.Q330L	ZNF557_ENST00000414706.1_Missense_Mutation_p.Q337L|ZNF557_ENST00000252840.6_Missense_Mutation_p.Q337L			Q8N988	ZN557_HUMAN	zinc finger protein 557	330					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17				Lung(535;0.179)		AATCTGACACAGCACATAAGA	0.428																																																	0													97.0	106.0	103.0					19																	7083472		2186	4287	6473	SO:0001583	missense	0			AK095524	CCDS42485.1, CCDS45945.1	19p13.2	2013-09-20			ENSG00000130544	ENSG00000130544		"""Zinc fingers, C2H2-type"", ""-"""	28632	protein-coding gene	gene with protein product						12477932	Standard	NM_024341		Approved	MGC4054	uc002mgc.3	Q8N988	OTTHUMG00000181977	ENST00000439035.2:c.989A>T	19.37:g.7083472A>T	ENSP00000398965:p.Gln330Leu		Q6PEJ3|Q9BTZ1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q337L	ENST00000439035.2	37	c.1010	CCDS45945.1	19	.	.	.	.	.	.	.	.	.	.	A	0.049	-1.255311	0.01457	.	.	ENSG00000130544	ENST00000252840;ENST00000414706;ENST00000439035	T;T;T	0.07688	3.17;3.17;3.17	1.32	0.0813	0.14424	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04679	0.0127	N	0.21324	0.655	0.09310	N	1	B;B	0.17465	0.022;0.018	B;B	0.17979	0.02;0.012	T	0.44205	-0.9343	9	0.27082	T	0.32	.	2.1241	0.03734	0.407:0.2977:0.0:0.2953	.	330;337	Q8N988;Q8N988-2	ZN557_HUMAN;.	L	337;337;330	ENSP00000252840:Q337L;ENSP00000404065:Q337L;ENSP00000398965:Q330L	ENSP00000252840:Q337L	Q	+	2	0	ZNF557	7034472	0.000000	0.05858	0.001000	0.08648	0.020000	0.10135	-2.409000	0.01041	-0.020000	0.14032	0.260000	0.18958	CAG	ZNF557	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000130544		0.428	ZNF557-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF557	HGNC	protein_coding	OTTHUMT00000458502.1	-	0.00	90	0	A	NM_024341		7083472	+1	tier1	-	no_errors	ENST00000252840	ensembl	human	known	74_37	missense	20.22	71	18	SNP	0.000	T
ZNF646	9726	genome.wustl.edu	37	16	31088964	31088964	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr16:31088964C>T	ENST00000394979.2	+	1	1742	c.1319C>T	c.(1318-1320)cCa>cTa	p.P440L	ZNF646_ENST00000300850.5_Missense_Mutation_p.P440L			O15015	ZN646_HUMAN	zinc finger protein 646	440					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						TCAGTCCCACCAGCTCCCCTG	0.592																																																	0													57.0	67.0	64.0					16																	31088964		2197	4299	6496	SO:0001583	missense	0			AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.1319C>T	16.37:g.31088964C>T	ENSP00000378429:p.Pro440Leu		Q8IVD8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P440L	ENST00000394979.2	37	c.1319		16	.	.	.	.	.	.	.	.	.	.	C	1.327	-0.597852	0.03771	.	.	ENSG00000167395	ENST00000300850;ENST00000394979	T;T	0.10573	2.86;2.9	5.21	2.21	0.28008	.	.	.	.	.	T	0.05914	0.0154	N	0.12182	0.205	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.42275	-0.9461	9	0.27785	T	0.31	3.7704	7.8645	0.29528	0.0:0.6693:0.0:0.3307	.	440	O15015-2	.	L	440	ENSP00000300850:P440L;ENSP00000378429:P440L	ENSP00000300850:P440L	P	+	2	0	ZNF646	30996465	0.001000	0.12720	0.002000	0.10522	0.071000	0.16799	1.257000	0.32932	0.226000	0.20979	0.655000	0.94253	CCA	ZNF646	-	NULL	ENSG00000167395		0.592	ZNF646-003	KNOWN	basic	protein_coding	ZNF646	HGNC	protein_coding	OTTHUMT00000108510.2	-	0.00	64	0	C	NM_014699		31088964	+1	tier1	-	no_errors	ENST00000300850	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.000	T
ZNF750	79755	genome.wustl.edu	37	17	80790167	80790167	+	Nonsense_Mutation	SNP	A	A	C			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr17:80790167A>C	ENST00000269394.3	-	2	997	c.164T>G	c.(163-165)tTa>tGa	p.L55*	TBCD_ENST00000397466.2_Intron|TBCD_ENST00000355528.4_Intron|ZNF750_ENST00000572562.1_Intron|TBCD_ENST00000539345.2_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	55					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CTCTGATACTAAAGTAATCGA	0.438																																																	0													119.0	108.0	111.0					17																	80790167		2203	4300	6503	SO:0001587	stop_gained	0			AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.164T>G	17.37:g.80790167A>C	ENSP00000269394:p.Leu55*		Q9H899	Nonsense_Mutation	SNP	NULL	p.L55*	ENST00000269394.3	37	c.164	CCDS11819.1	17	.	.	.	.	.	.	.	.	.	.	A	40	8.312349	0.98754	.	.	ENSG00000141579	ENST00000269394	.	.	.	5.59	5.59	0.84812	.	0.139418	0.28533	N	0.015014	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.0451	14.9439	0.71014	1.0:0.0:0.0:0.0	.	.	.	.	X	55	.	.	L	-	2	0	ZNF750	78383456	0.986000	0.35501	0.008000	0.14137	0.219000	0.24729	9.160000	0.94734	2.120000	0.65058	0.533000	0.62120	TTA	ZNF750	-	NULL	ENSG00000141579		0.438	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF750	HGNC	protein_coding	OTTHUMT00000439074.2	-	0.00	63	0	A	NM_024702		80790167	-1	tier1	-	no_errors	ENST00000269394	ensembl	human	known	74_37	nonsense	72.00	21	54	SNP	0.159	C
ZNF850	342892	genome.wustl.edu	37	19	37252549	37252549	+	Silent	SNP	G	G	A			TCGA-IG-A8O2-01A-11D-A36J-09	TCGA-IG-A8O2-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2122239f-6b34-4f6e-a711-e565169172b3	0e29cd53-4d6f-41dc-8e26-f769aa78f35e	g.chr19:37252549G>A	ENST00000591344.1	-	4	389	c.231C>T	c.(229-231)tgC>tgT	p.C77C	ZNF850_ENST00000589390.1_Silent_p.C77C	NM_001193552.1|NM_001267779.1	NP_001180481.1|NP_001254708.1	A8MQ14	ZN850_HUMAN	zinc finger protein 850	77	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										ACTCACCTCGGCACCATCCTC	0.522																																																	0																																										SO:0001819	synonymous_variant	0			BC052603	CCDS59379.1, CCDS74350.1	19q13.12	2013-01-08	2010-08-02	2010-08-02		ENSG00000267041		"""Zinc fingers, C2H2-type"", ""-"""	27994	protein-coding gene	gene with protein product			"""zinc finger protein 850 pseudogene"", ""zinc finger protein 850 (pseudogene)"""	ZNF850P		12477932	Standard	NM_001193552		Approved		uc010efc.3	A8MQ14		ENST00000591344.1:c.231C>T	19.37:g.37252549G>A				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C77	ENST00000591344.1	37	c.231	CCDS59379.1	19																																																																																			ZNF850	-	pfscan_Krueppel-associated_box	ENSG00000267041		0.522	ZNF850-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF850	HGNC	protein_coding	OTTHUMT00000453557.1	-	0.00	62	0	G	XM_001720258		37252549	-1	tier1	-	no_errors	ENST00000591344	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.015	A
