#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCB5	340273	genome.wustl.edu	37	7	20744391	20744391	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr7:20744391G>C	ENST00000404938.2	+	20	3034	c.2382G>C	c.(2380-2382)ttG>ttC	p.L794F	ABCB5_ENST00000258738.6_Missense_Mutation_p.L349F	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	794	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						CAGGAGGCTTGACAACAATAT	0.333																																																	0													152.0	143.0	146.0					7																	20744391		2203	4300	6503	SO:0001583	missense	0			U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2382G>C	7.37:g.20744391G>C	ENSP00000384881:p.Leu794Phe		A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.L349F	ENST00000404938.2	37	c.1047	CCDS55090.1	7	.	.	.	.	.	.	.	.	.	.	G	11.88	1.769337	0.31320	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	D;D	0.93811	-3.29;-3.29	4.66	0.367	0.16140	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.46145	D	0.000317	D	0.96769	0.8945	H	0.94964	3.605	0.39778	D	0.972258	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95277	0.8382	10	0.87932	D	0	.	7.941	0.29959	0.4379:0.0:0.5621:0.0	.	794;349	A7BKA4;Q2M3G0	.;ABCB5_HUMAN	F	794;349	ENSP00000384881:L794F;ENSP00000258738:L349F	ENSP00000258738:L349F	L	+	3	2	ABCB5	20710916	1.000000	0.71417	0.998000	0.56505	0.147000	0.21601	0.847000	0.27696	0.172000	0.19760	0.462000	0.41574	TTG	ABCB5	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000004846		0.333	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	ABCB5	HGNC	protein_coding	OTTHUMT00000326736.2	-	0.00	25	0	G	NM_178559		20744391	+1	tier1	-	no_errors	ENST00000258738	ensembl	human	known	74_37	missense	23.53	52	16	SNP	0.998	C
ACSM3	6296	genome.wustl.edu	37	16	20787193	20787193	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr16:20787193G>T	ENST00000289416.5	+	3	727	c.252G>T	c.(250-252)tgG>tgT	p.W84C	ACSM3_ENST00000440284.2_Missense_Mutation_p.W84C|ACSM3_ENST00000450120.2_Missense_Mutation_p.W39C	NM_005622.3	NP_005613.2	Q53FZ2	ACSM3_HUMAN	acyl-CoA synthetase medium-chain family member 3	84					cholesterol homeostasis (GO:0042632)|fatty acid biosynthetic process (GO:0006633)|regulation of blood pressure (GO:0008217)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	21						CAGCCTTCTGGTGGATCAACA	0.423																																																	0													118.0	129.0	125.0					16																	20787193		2201	4300	6501	SO:0001583	missense	0			D16350	CCDS10589.1, CCDS45435.1	16p13.11	2006-02-08	2005-09-08	2005-09-08	ENSG00000005187	ENSG00000005187		"""Acyl-CoA synthetase family"""	10522	protein-coding gene	gene with protein product		145505	"""SA (rat hypertension-associated) homolog"", ""SA hypertension-associated homolog (rat)"""	SAH		7843754, 7907320, 11470804	Standard	NM_005622		Approved	SA	uc002dhr.3	Q53FZ2	OTTHUMG00000131552	ENST00000289416.5:c.252G>T	16.37:g.20787193G>T	ENSP00000289416:p.Trp84Cys		O60363|Q13732|Q15425|Q7KYM6|Q9BUA2	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.W84C	ENST00000289416.5	37	c.252	CCDS10589.1	16	.	.	.	.	.	.	.	.	.	.	G	22.5	4.303722	0.81136	.	.	ENSG00000005187	ENST00000289416;ENST00000440284;ENST00000450120	T;T;T	0.40225	1.04;1.04;1.04	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.61362	0.2341	L	0.46157	1.445	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.998;0.999	T	0.58233	-0.7672	10	0.54805	T	0.06	-9.3119	20.3151	0.98650	0.0:0.0:1.0:0.0	.	39;84;84	E7ETR5;Q53FZ2;Q53FZ2-2	.;ACSM3_HUMAN;.	C	84;84;39	ENSP00000289416:W84C;ENSP00000394565:W84C;ENSP00000395297:W39C	ENSP00000289416:W84C	W	+	3	0	ACSM3	20694694	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.158000	0.89649	2.809000	0.96659	0.467000	0.42956	TGG	ACSM3	-	NULL	ENSG00000005187		0.423	ACSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM3	HGNC	protein_coding	OTTHUMT00000254414.2	-	0.00	62	0	G	NM_005622		20787193	+1	tier1	-	no_errors	ENST00000289416	ensembl	human	known	74_37	missense	9.09	50	5	SNP	1.000	T
ACTN2	88	genome.wustl.edu	37	1	236889280	236889280	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:236889280G>T	ENST00000366578.4	+	5	662	c.496G>T	c.(496-498)Gct>Tct	p.A166S	ACTN2_ENST00000542672.1_Missense_Mutation_p.A166S|ACTN2_ENST00000492634.1_3'UTR	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	166	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GAGGAAAACTGCTCCTTATAG	0.483																																																	0													136.0	141.0	140.0					1																	236889280		2203	4300	6503	SO:0001583	missense	0			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.496G>T	1.37:g.236889280G>T	ENSP00000355537:p.Ala166Ser		B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.A166S	ENST00000366578.4	37	c.496	CCDS1613.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.099628	0.94197	.	.	ENSG00000077522	ENST00000542672;ENST00000366578	T;T	0.60672	0.17;0.17	5.68	5.68	0.88126	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	T	0.79563	0.4467	M	0.76002	2.32	0.80722	D	1	B;P	0.40332	0.424;0.713	P;D	0.72625	0.748;0.978	T	0.79193	-0.1904	10	0.87932	D	0	.	19.79	0.96453	0.0:0.0:1.0:0.0	.	166;166	B2RCS5;P35609	.;ACTN2_HUMAN	S	166	ENSP00000443495:A166S;ENSP00000355537:A166S	ENSP00000355537:A166S	A	+	1	0	ACTN2	234955903	1.000000	0.71417	0.792000	0.32020	0.890000	0.51754	9.832000	0.99423	2.654000	0.90174	0.655000	0.94253	GCT	ACTN2	-	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000077522		0.483	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACTN2	HGNC	protein_coding	OTTHUMT00000096628.1	-	0.00	43	0	G	NM_001103		236889280	+1	tier1	-	no_errors	ENST00000366578	ensembl	human	known	74_37	missense	33.93	37	19	SNP	1.000	T
ALKBH2	121642	genome.wustl.edu	37	12	109526157	109526157	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:109526157C>T	ENST00000429722.2	-	4	1003	c.640G>A	c.(640-642)Gtc>Atc	p.V214I	ALKBH2_ENST00000440112.2_Nonsense_Mutation_p.W147*|ALKBH2_ENST00000343075.3_Missense_Mutation_p.V214I	NM_001145374.1	NP_001138846.1	Q6NS38	ALKB2_HUMAN	alkB, alkylation repair homolog 2 (E. coli)	214	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|oxidative demethylation (GO:0070989)|oxidative DNA demethylation (GO:0035511)	nucleoplasm (GO:0005654)	cytosine C-5 DNA demethylase activity (GO:0051747)|DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)			endometrium(1)|kidney(3)|large_intestine(1)|lung(3)	8					Vitamin C(DB00126)	GGCAGCCTGACCACCGCCACC	0.597								Direct reversal of damage																																									0													92.0	95.0	94.0					12																	109526157		2203	4300	6503	SO:0001583	missense	0			AY754389	CCDS31897.1, CCDS55883.1	12q24.11	2008-04-24			ENSG00000189046	ENSG00000189046		"""Alkylation repair homologs"""	32487	protein-coding gene	gene with protein product		610602					Standard	NM_001145374		Approved	MGC90512, ABH2	uc010sxj.1	Q6NS38	OTTHUMG00000169246	ENST00000429722.2:c.640G>A	12.37:g.109526157C>T	ENSP00000398181:p.Val214Ile		A4PET2|Q5XLE3	Nonsense_Mutation	SNP	NULL	p.W147*	ENST00000429722.2	37	c.441	CCDS31897.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.63|15.63	2.889431|2.889431	0.52014|0.52014	.|.	.|.	ENSG00000189046|ENSG00000189046	ENST00000429722;ENST00000343075;ENST00000435370|ENST00000440112	T;T|.	0.14022|.	2.54;2.54|.	5.67|5.67	3.86|3.86	0.44501|0.44501	Oxoglutarate/iron-dependent oxygenase (2);|.	0.113655|.	0.64402|.	N|.	0.000015|.	T|.	0.63153|.	0.2487|.	.|.	.|.	.|.	0.54753|0.54753	D|D	0.999982|0.999982	P|.	0.34562|.	0.457|.	B|.	0.31614|.	0.133|.	T|.	0.62101|.	-0.6925|.	9|.	0.34782|0.52906	T|T	0.22|0.07	-22.0881|-22.0881	9.2249|9.2249	0.37400|0.37400	0.0:0.7562:0.0:0.2438|0.0:0.7562:0.0:0.2438	.|.	214|.	Q6NS38|.	ALKB2_HUMAN|.	I|X	214|147	ENSP00000398181:V214I;ENSP00000343021:V214I|.	ENSP00000343021:V214I|ENSP00000399820:W147X	V|W	-|-	1|3	0|0	ALKBH2|ALKBH2	108010540|108010540	0.716000|0.716000	0.27956|0.27956	0.841000|0.841000	0.33234|0.33234	0.528000|0.528000	0.34623|0.34623	1.356000|1.356000	0.34079|0.34079	0.755000|0.755000	0.32990|0.32990	0.563000|0.563000	0.77884|0.77884	GTC|TGG	ALKBH2	-	NULL	ENSG00000189046		0.597	ALKBH2-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ALKBH2	HGNC	protein_coding	OTTHUMT00000403063.2	-	0.00	53	0	C	NM_001001655		109526157	-1	tier1	-	no_errors	ENST00000440112	ensembl	human	novel	74_37	nonsense	82.05	14	64	SNP	0.996	T
AMZ2	51321	genome.wustl.edu	37	17	66246240	66246240	+	5'UTR	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:66246240G>T	ENST00000577985.1	+	0	900				AMZ2_ENST00000585050.1_Intron|AMZ2_ENST00000359904.3_Intron|AMZ2_ENST00000577866.1_Intron|RP11-147L13.2_ENST00000577698.1_RNA|AMZ2_ENST00000392720.2_Intron|AMZ2_ENST00000359783.4_Intron|AMZ2_ENST00000580753.1_Intron|AMZ2_ENST00000577273.1_5'Flank			Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2								metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			TCACTCTAGGGAGAAATCAGA	0.323																																																	0																																										SO:0001623	5_prime_UTR_variant	0			CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000577985.1:c.-89G>T	17.37:g.66246240G>T			A6NLD9|B3KR44|Q5XKF1|Q9NZE2	RNA	SNP	-	NULL	ENST00000577985.1	37	NULL	CCDS11674.1	17																																																																																			AMZ2	-	-	ENSG00000196704		0.323	AMZ2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ2	HGNC	protein_coding	OTTHUMT00000448268.1	-	0.00	22	0	G	NM_016627		66246240	+1	tier1	-	no_errors	ENST00000582430	ensembl	human	known	74_37	rna	14.29	24	4	SNP	0.004	T
ANK2	287	genome.wustl.edu	37	4	114253158	114253158	+	Silent	SNP	A	A	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr4:114253158A>C	ENST00000357077.4	+	28	3209	c.3156A>C	c.(3154-3156)ccA>ccC	p.P1052P	ANK2_ENST00000264366.6_Intron|ANK2_ENST00000506722.1_Silent_p.P1043P|ANK2_ENST00000394537.3_Silent_p.P1052P|ANK2_ENST00000509550.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1052	Interaction with SPTBN1.|ZU5 1. {ECO:0000255|PROSITE- ProRule:PRU00485}.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTCCTCCCCCACTTAATGAGG	0.478																																																	0													124.0	136.0	132.0					4																	114253158		2203	4300	6503	SO:0001819	synonymous_variant	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.3156A>C	4.37:g.114253158A>C			Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.P1052	ENST00000357077.4	37	c.3156	CCDS3702.1	4																																																																																			ANK2	-	pfam_ZU5,smart_ZU5,pfscan_ZU5	ENSG00000145362		0.478	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2		0.00	62	0	A	NM_001148		114253158	+1			no_errors	ENST00000357077	ensembl	human	known	74_37	silent	7.14	52	4	SNP	1.000	C
ANK2	287	genome.wustl.edu	37	4	114275857	114275857	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr4:114275857G>T	ENST00000357077.4	+	38	6136	c.6083G>T	c.(6082-6084)cGg>cTg	p.R2028L	ANK2_ENST00000264366.6_Missense_Mutation_p.R1995L|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2028					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GGTAAAGTTCGGGTAGAAAAA	0.458																																																	0													40.0	47.0	44.0					4																	114275857		2201	4298	6499	SO:0001583	missense	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.6083G>T	4.37:g.114275857G>T	ENSP00000349588:p.Arg2028Leu		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.R2028L	ENST00000357077.4	37	c.6083	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	G	6.349	0.432501	0.12045	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.67171	-0.24;-0.25	5.53	4.68	0.58851	.	0.129029	0.35013	N	0.003515	T	0.55737	0.1939	L	0.48362	1.52	0.38381	D	0.945133	P;P	0.47191	0.826;0.891	B;B	0.41374	0.194;0.355	T	0.58578	-0.7612	9	.	.	.	.	7.7277	0.28769	0.1386:0.1593:0.702:0.0	.	1995;2028	Q01484;Q01484-4	ANK2_HUMAN;.	L	2028;1995	ENSP00000349588:R2028L;ENSP00000264366:R1995L	.	R	+	2	0	ANK2	114495306	0.057000	0.20700	0.117000	0.21633	0.129000	0.20672	1.667000	0.37471	2.746000	0.94184	0.563000	0.77884	CGG	ANK2	-	NULL	ENSG00000145362		0.458	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	-	0.00	39	0	G	NM_001148		114275857	+1	tier1	-	no_errors	ENST00000357077	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.114	T
ANKH	56172	genome.wustl.edu	37	5	14769140	14769140	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr5:14769140G>A	ENST00000284268.6	-	2	587	c.257C>T	c.(256-258)gCc>gTc	p.A86V		NM_054027.4	NP_473368.1	Q9HCJ1	ANKH_HUMAN	ANKH inorganic pyrophosphate transport regulator	86					locomotory behavior (GO:0007626)|regulation of bone mineralization (GO:0030500)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	inorganic diphosphate transmembrane transporter activity (GO:0030504)|inorganic phosphate transmembrane transporter activity (GO:0005315)|phosphate ion transmembrane transporter activity (GO:0015114)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						ACACAGGACGGCTTTGGTCCT	0.552																																																	0													92.0	85.0	87.0					5																	14769140		2203	4300	6503	SO:0001583	missense	0			AF274753	CCDS3885.1	5p15.2	2013-06-19	2013-06-19		ENSG00000154122	ENSG00000154122			15492	protein-coding gene	gene with protein product		605145	"""ankylosis, progressive (mouse) homolog"", ""craniometaphyseal dysplasia, Jackson type (dominant)"", ""ankylosis, progressive homolog (mouse)"""	CCAL2, CMDJ		10894769, 12297989, 11326338	Standard	NM_054027		Approved	HANK, ANK, CPPDD	uc003jfm.4	Q9HCJ1	OTTHUMG00000090539	ENST00000284268.6:c.257C>T	5.37:g.14769140G>A	ENSP00000284268:p.Ala86Val		B2RCA7|B3KMG4|D3DTD4|Q9NQW2	Missense_Mutation	SNP	pfam_ANKH	p.A86V	ENST00000284268.6	37	c.257	CCDS3885.1	5	.	.	.	.	.	.	.	.	.	.	G	19.77	3.888627	0.72524	.	.	ENSG00000154122	ENST00000284268	D	0.95885	-3.84	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.95664	0.8590	L	0.39633	1.23	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	D	0.92017	0.5623	10	0.02654	T	1	0.0061	18.4196	0.90586	0.0:0.0:1.0:0.0	.	86	Q9HCJ1	ANKH_HUMAN	V	86	ENSP00000284268:A86V	ENSP00000284268:A86V	A	-	2	0	ANKH	14822140	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	9.869000	0.99810	2.588000	0.87417	0.650000	0.86243	GCC	ANKH	-	pfam_ANKH	ENSG00000154122		0.552	ANKH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKH	HGNC	protein_coding	OTTHUMT00000207063.1	-	0.00	46	0	G	NM_054027		14769140	-1	tier1	-	no_errors	ENST00000284268	ensembl	human	known	74_37	missense	58.18	23	32	SNP	1.000	A
ANKRD30A	91074	genome.wustl.edu	37	10	37506700	37506700	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr10:37506700G>A	ENST00000602533.1	+	33	3092	c.2993G>A	c.(2992-2994)aGa>aAa	p.R998K	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.R1117K|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.R998K			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1054					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GAATTAGGAAGAATCGAAGAG	0.323																																																	0													63.0	64.0	64.0					10																	37506700		1811	4064	5875	SO:0001583	missense	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2993G>A	10.37:g.37506700G>A	ENSP00000473551:p.Arg998Lys		Q5W025	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R998K	ENST00000602533.1	37	c.2993		10	.	.	.	.	.	.	.	.	.	.	g	0.029	-1.347534	0.01266	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.16324	2.35;2.35	2.82	-0.331	0.12679	.	.	.	.	.	T	0.09024	0.0223	L	0.41824	1.3	0.20196	N	0.999925	B	0.29862	0.259	B	0.25759	0.063	T	0.37865	-0.9687	9	0.02654	T	1	.	4.189	0.10413	0.2482:0.193:0.5588:0.0	.	1054	Q9BXX3	AN30A_HUMAN	K	998;1117	ENSP00000354432:R998K;ENSP00000363792:R1117K	ENSP00000354432:R998K	R	+	2	0	ANKRD30A	37546706	0.168000	0.22989	0.000000	0.03702	0.002000	0.02628	-0.273000	0.08548	-0.376000	0.07943	-0.347000	0.07816	AGA	ANKRD30A	-	NULL	ENSG00000148513		0.323	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	-	0.00	51	0	G	NM_052997		37506700	+1	tier1	-	no_errors	ENST00000361713	ensembl	human	known	74_37	missense	65.71	12	23	SNP	0.671	A
APOC3	345	genome.wustl.edu	37	11	116703479	116703479	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:116703479G>T	ENST00000227667.3	+	4	241		c.e4-1		APOC3_ENST00000375345.1_Splice_Site	NM_000040.1	NP_000031.1	P02656	APOC3_HUMAN	apolipoprotein C-III						cellular response to glucose stimulus (GO:0071333)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle remodeling (GO:0034375)|inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of cholesterol import (GO:0060621)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of high-density lipoprotein particle clearance (GO:0010987)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of triglyceride catabolic process (GO:0010897)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|triglyceride metabolic process (GO:0006641)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	cholesterol binding (GO:0015485)|enzyme regulator activity (GO:0030234)|high-density lipoprotein particle receptor binding (GO:0070653)|lipase inhibitor activity (GO:0055102)|phospholipid binding (GO:0005543)			endometrium(1)|lung(6)	7	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		GACTGATTTAGGGGCTGGGTG	0.552																																					GBM(81;259 1650 7161 35190)												0													145.0	133.0	137.0					11																	116703479		2201	4295	6496	SO:0001630	splice_region_variant	0			X01388	CCDS8377.1	11q23.3	2013-01-24			ENSG00000110245	ENSG00000110245		"""Apolipoproteins"""	610	protein-coding gene	gene with protein product		107720					Standard	NM_000040		Approved		uc001ppt.1	P02656	OTTHUMG00000046115	ENST00000227667.3:c.180-1G>T	11.37:g.116703479G>T			Q08E83|Q6Q786	Splice_Site	SNP	-	e3-1	ENST00000227667.3	37	c.180-1	CCDS8377.1	11	.	.	.	.	.	.	.	.	.	.	G	12.41	1.930654	0.34096	.	.	ENSG00000110245	ENST00000227667;ENST00000375345	.	.	.	5.04	3.14	0.36123	.	.	.	.	.	.	.	.	.	.	.	0.54753	D	0.999989	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.0851	0.19962	0.0951:0.0:0.7192:0.1856	.	.	.	.	.	-1	.	.	.	+	.	.	APOC3	116208689	0.997000	0.39634	0.106000	0.21319	0.302000	0.27658	4.235000	0.58666	0.687000	0.31509	0.555000	0.69702	.	APOC3	-	-	ENSG00000110245		0.552	APOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOC3	HGNC	protein_coding	OTTHUMT00000106284.2	-	0.00	65	0	G	NM_000040	Intron	116703479	+1	tier1	-	no_errors	ENST00000227667	ensembl	human	known	74_37	splice_site	5.06	75	4	SNP	0.456	T
AR	367	genome.wustl.edu	37	X	66765279	66765279	+	Silent	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chrX:66765279C>A	ENST00000374690.3	+	1	815	c.291C>A	c.(289-291)ccC>ccA	p.P97P	AR_ENST00000396044.3_Silent_p.P97P|AR_ENST00000513847.1_3'UTR|AR_ENST00000504326.1_Silent_p.P97P	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	95	Modulating.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	ATGGTTCTCCCCAAGCCCATC	0.637									Androgen Insensitivity Syndrome																																								0													23.0	17.0	19.0					X																	66765279		2193	4294	6487	SO:0001819	synonymous_variant	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.291C>A	X.37:g.66765279C>A			A2RUN2|B1AKD7|Q9UD95	Silent	SNP	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt	p.P97	ENST00000374690.3	37	c.291	CCDS14387.1	X																																																																																			AR	-	pfam_Andrgn_rcpt	ENSG00000169083		0.637	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	HGNC	protein_coding	OTTHUMT00000057007.1		0.00	22	0	C	NM_000044		66765279	+1			no_errors	ENST00000374690	ensembl	human	known	74_37	silent	5.19	73	4	SNP	0.194	A
ARID1A	8289	genome.wustl.edu	37	1	27088764	27088764	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:27088764C>A	ENST00000324856.7	+	7	2744	c.2373C>A	c.(2371-2373)aaC>aaA	p.N791K	ARID1A_ENST00000374152.2_Missense_Mutation_p.N408K|RN7SL501P_ENST00000578818.1_RNA|ARID1A_ENST00000457599.2_Missense_Mutation_p.N791K	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	791					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		ACCAGCAGAACTCCATGGGGA	0.577			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0													61.0	64.0	63.0					1																	27088764		2203	4300	6503	SO:0001583	missense	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2373C>A	1.37:g.27088764C>A	ENSP00000320485:p.Asn791Lys		D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.N791K	ENST00000324856.7	37	c.2373	CCDS285.1	1	.	.	.	.	.	.	.	.	.	.	C	19.76	3.886591	0.72410	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	T;T;T	0.19938	2.11;2.11;4.06	5.43	3.58	0.41010	.	0.000000	0.85682	D	0.000000	T	0.39682	0.1087	M	0.66939	2.045	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.997	D;D;D	0.80764	0.986;0.994;0.986	T	0.11227	-1.0596	10	0.51188	T	0.08	-13.5573	8.3171	0.32106	0.0:0.7118:0.0:0.2882	.	791;791;445	O14497;O14497-2;Q4LE49	ARI1A_HUMAN;.;.	K	791;791;408	ENSP00000320485:N791K;ENSP00000387636:N791K;ENSP00000363267:N408K	ENSP00000320485:N791K	N	+	3	2	ARID1A	26961351	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.482000	0.35486	0.866000	0.35629	0.655000	0.94253	AAC	ARID1A	-	NULL	ENSG00000117713		0.577	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	-	0.00	71	0	C	NM_139135		27088764	+1	tier1	-	no_errors	ENST00000324856	ensembl	human	known	74_37	missense	41.18	70	49	SNP	1.000	A
ARID4A	5926	genome.wustl.edu	37	14	58831520	58831520	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr14:58831520G>C	ENST00000355431.3	+	20	3086	c.2713G>C	c.(2713-2715)Gaa>Caa	p.E905Q	ARID4A_ENST00000348476.3_Missense_Mutation_p.E905Q|ARID4A_ENST00000395168.3_Missense_Mutation_p.E905Q|ARID4A_ENST00000431317.2_Missense_Mutation_p.E905Q	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	905					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						ACAGCACTTTGAAAGAGAAAA	0.363																																																	0													74.0	72.0	73.0					14																	58831520		2203	4299	6502	SO:0001583	missense	0			S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.2713G>C	14.37:g.58831520G>C	ENSP00000347602:p.Glu905Gln		Q15991|Q15992|Q15993	Missense_Mutation	SNP	pfam_RBB1NT,pfam_ARID/BRIGHT_DNA-bd,pfam_Tudor-knot,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Chromodomain-like,smart_Tudor,smart_ARID/BRIGHT_DNA-bd,smart_Chromo_domain/shadow,pfscan_ARID/BRIGHT_DNA-bd	p.E905Q	ENST00000355431.3	37	c.2713	CCDS9732.1	14	.	.	.	.	.	.	.	.	.	.	G	10.29	1.310445	0.23821	.	.	ENSG00000032219	ENST00000355431;ENST00000348476;ENST00000395168;ENST00000431317;ENST00000417477	T;T;T;T;T	0.17854	2.31;2.29;2.31;2.29;2.25	5.59	5.59	0.84812	.	0.560643	0.19978	N	0.101831	T	0.13243	0.0321	L	0.47716	1.5	0.28064	N	0.932854	P;P;P	0.41848	0.763;0.501;0.763	B;B;B	0.39840	0.311;0.086;0.178	T	0.09751	-1.0660	10	0.10636	T	0.68	-13.1928	6.5014	0.22170	0.1149:0.1814:0.7037:0.0	.	905;905;905	P29374-3;P29374;P29374-2	.;ARI4A_HUMAN;.	Q	905;905;905;905;583	ENSP00000347602:E905Q;ENSP00000344556:E905Q;ENSP00000378597:E905Q;ENSP00000397368:E905Q;ENSP00000416053:E583Q	ENSP00000344556:E905Q	E	+	1	0	ARID4A	57901273	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	4.088000	0.57678	2.638000	0.89438	0.650000	0.86243	GAA	ARID4A	-	NULL	ENSG00000032219		0.363	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID4A	HGNC	protein_coding	OTTHUMT00000276927.2	-	0.00	50	0	G	NM_023001		58831520	+1	tier1	-	no_errors	ENST00000355431	ensembl	human	known	74_37	missense	39.39	39	26	SNP	1.000	C
ATP6V0A2	23545	genome.wustl.edu	37	12	124241401	124241401	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:124241401G>T	ENST00000330342.3	+	19	2581	c.2333G>T	c.(2332-2334)gGc>gTc	p.G778V	ATP6V0A2_ENST00000544833.1_Missense_Mutation_p.G60V|ATP6V0A2_ENST00000543687.1_3'UTR	NM_012463.3	NP_036595.2	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a2	778					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		ATGCGCGTGGGCCTCCGCGTT	0.547																																																	0													209.0	165.0	180.0					12																	124241401		2203	4300	6503	SO:0001583	missense	0			AF112972	CCDS9254.1	12q24.31	2010-04-21	2006-01-20		ENSG00000185344	ENSG00000185344		"""ATPases / V-type"""	18481	protein-coding gene	gene with protein product	"""infantile malignant osteopetrosis"""	611716	"""infantile malignant osteopetrosis"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 2"", ""ATPase, H+ transporting, lysosomal V0 subunit A2"""			2247090, 18157129	Standard	NM_012463		Approved	TJ6, a2, TJ6s, TJ6M, ATP6a2, J6B7, ATP6N1D, Vph1, Stv1	uc001ufr.3	Q9Y487	OTTHUMG00000168723	ENST00000330342.3:c.2333G>T	12.37:g.124241401G>T	ENSP00000332247:p.Gly778Val		A8K026|Q6NUM0	Missense_Mutation	SNP	pfam_V-ATPase_116kDa_su	p.G778V	ENST00000330342.3	37	c.2333	CCDS9254.1	12	.	.	.	.	.	.	.	.	.	.	G	16.26	3.073478	0.55646	.	.	ENSG00000185344	ENST00000330342;ENST00000534943;ENST00000544833	D;D;D	0.86097	-2.07;-2.07;-2.07	5.71	4.81	0.61882	.	0.045304	0.85682	D	0.000000	D	0.91399	0.7286	M	0.84082	2.675	0.80722	D	1	P	0.51147	0.942	P	0.56648	0.803	D	0.92718	0.6189	10	0.87932	D	0	-14.8466	16.6992	0.85344	0.0:0.1296:0.8704:0.0	.	778	Q9Y487	VPP2_HUMAN	V	778;58;60	ENSP00000332247:G778V;ENSP00000443726:G58V;ENSP00000441143:G60V	ENSP00000332247:G778V	G	+	2	0	ATP6V0A2	122807354	1.000000	0.71417	0.995000	0.50966	0.172000	0.22775	6.354000	0.73036	1.392000	0.46585	-0.175000	0.13238	GGC	ATP6V0A2	-	pfam_V-ATPase_116kDa_su	ENSG00000185344		0.547	ATP6V0A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0A2	HGNC	protein_coding	OTTHUMT00000400765.2		0.00	49	0	G	NM_012463		124241401	+1			no_errors	ENST00000330342	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
ATP8B4	79895	genome.wustl.edu	37	15	50226248	50226248	+	Silent	SNP	G	G	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr15:50226248G>C	ENST00000284509.6	-	15	1560	c.1419C>G	c.(1417-1419)ctC>ctG	p.L473L	ATP8B4_ENST00000559829.1_Silent_p.L473L	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	473						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		CAGTGTGGCAGAGAGCAAGTA	0.383																																																	0													132.0	123.0	126.0					15																	50226248		2196	4295	6491	SO:0001819	synonymous_variant	0			AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.1419C>G	15.37:g.50226248G>C			Q9H727	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.L473	ENST00000284509.6	37	c.1419	CCDS32238.1	15																																																																																			ATP8B4	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000104043		0.383	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B4	HGNC	protein_coding	OTTHUMT00000418100.1	-	0.00	35	0	G	NM_024837		50226248	-1	tier1	-	no_errors	ENST00000284509	ensembl	human	known	74_37	silent	18.42	31	7	SNP	0.979	C
ATRNL1	26033	genome.wustl.edu	37	10	117607467	117607467	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr10:117607467G>T	ENST00000355044.3	+	28	4109	c.3983G>T	c.(3982-3984)cGa>cTa	p.R1328L	ATRNL1_ENST00000423111.2_Missense_Mutation_p.R379L|ATRNL1_ENST00000303745.7_Missense_Mutation_p.R121L	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1328					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TGTCTACCACGAGGATCATCA	0.473																																																	0													126.0	113.0	117.0					10																	117607467		2203	4300	6503	SO:0001583	missense	0			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3983G>T	10.37:g.117607467G>T	ENSP00000347152:p.Arg1328Leu		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_Plexin_repeat,pfam_CUB_dom,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_CUB_dom,superfamily_Plexin-like_fold,smart_EG-like_dom,smart_CUB_dom,smart_Plexin-like_fold,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.R1328L	ENST00000355044.3	37	c.3983	CCDS7592.1	10	.	.	.	.	.	.	.	.	.	.	G	15.53	2.860794	0.51482	.	.	ENSG00000107518	ENST00000355044;ENST00000423111;ENST00000303745	T;T;T	0.51325	0.71;0.71;0.71	5.57	4.67	0.58626	.	0.300125	0.29273	N	0.012624	T	0.45637	0.1352	L	0.57536	1.79	0.39819	D	0.972802	B;P	0.38827	0.253;0.649	B;B	0.37550	0.066;0.253	T	0.48163	-0.9059	10	0.39692	T	0.17	-5.447	14.4066	0.67086	0.0712:0.0:0.9288:0.0	.	379;1328	B4DH41;Q5VV63	.;ATRN1_HUMAN	L	1328;379;121	ENSP00000347152:R1328L;ENSP00000409624:R379L;ENSP00000307660:R121L	ENSP00000307660:R121L	R	+	2	0	ATRNL1	117597457	1.000000	0.71417	0.907000	0.35723	0.992000	0.81027	4.547000	0.60712	1.362000	0.46000	-0.237000	0.12165	CGA	ATRNL1	-	NULL	ENSG00000107518		0.473	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	HGNC	protein_coding	OTTHUMT00000050507.3	-	0.00	48	0	G	XM_049349		117607467	+1	tier1	-	no_errors	ENST00000355044	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.997	T
AURKC	6795	genome.wustl.edu	37	19	57744878	57744878	+	Silent	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:57744878G>A	ENST00000302804.7	+	5	672	c.486G>A	c.(484-486)gtG>gtA	p.V162V	AURKC_ENST00000599062.1_Silent_p.V159V|AURKC_ENST00000598785.1_Silent_p.V128V|AURKC_ENST00000415300.2_Silent_p.V143V|AURKC_ENST00000448930.1_Silent_p.V128V	NM_001015878.1	NP_001015878.1	Q9UQB9	AURKC_HUMAN	aurora kinase C	162	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|cytokinesis (GO:0000910)|histone modification (GO:0016570)|meiotic nuclear division (GO:0007126)|positive regulation of cytokinesis (GO:0032467)|protein phosphorylation (GO:0006468)|spindle midzone assembly involved in mitosis (GO:0051256)	chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(1)|endometrium(1)|large_intestine(9)|lung(9)|ovary(3)|prostate(1)|stomach(1)	25		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)		ACAAGAAAGTGATTCACAGAG	0.507																																																	0													119.0	112.0	114.0					19																	57744878		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33128.1, CCDS46205.1, CCDS46206.1	19q13.43	2013-09-19	2003-07-21	2003-07-23	ENSG00000105146	ENSG00000105146			11391	protein-coding gene	gene with protein product		603495	"""serine/threonine kinase 13 (aurora/IPL1-like)"""	STK13		9799611	Standard	XR_430209		Approved	AurC, ARK3	uc002qoe.3	Q9UQB9	OTTHUMG00000183106	ENST00000302804.7:c.486G>A	19.37:g.57744878G>A			O60681|O75442|Q6AZY8|Q6DLZ0|Q9UPK5	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V162	ENST00000302804.7	37	c.486	CCDS33128.1	19																																																																																			AURKC	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000105146		0.507	AURKC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AURKC	HGNC	protein_coding	OTTHUMT00000465089.1	-	0.00	53	0	G	NM_003160		57744878	+1	tier1	-	no_errors	ENST00000302804	ensembl	human	known	74_37	silent	36.36	35	20	SNP	1.000	A
B4GALNT3	283358	genome.wustl.edu	37	12	661313	661313	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:661313G>A	ENST00000266383.5	+	12	1205	c.1192G>A	c.(1192-1194)Gcc>Acc	p.A398T		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	398					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			CCAGGAAAACGCCTACTACCA	0.532																																																	0													100.0	94.0	96.0					12																	661313		2203	4300	6503	SO:0001583	missense	0			AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.1192G>A	12.37:g.661313G>A	ENSP00000266383:p.Ala398Thr		Q6ZNC1|Q8N7T6	Missense_Mutation	SNP	pfam_PA14,pfam_Chond_GalNAc,smart_PA14	p.A398T	ENST00000266383.5	37	c.1192	CCDS8504.1	12	.	.	.	.	.	.	.	.	.	.	G	11.73	1.726536	0.30593	.	.	ENSG00000139044	ENST00000266383;ENST00000322843	T;T	0.71817	-0.6;-0.6	5.0	-2.65	0.06095	.	0.772340	0.12658	N	0.449888	T	0.46964	0.1420	N	0.19112	0.55	0.09310	N	1	B;B	0.16396	0.017;0.004	B;B	0.08055	0.003;0.002	T	0.32561	-0.9902	10	0.59425	D	0.04	-4.2299	3.4149	0.07372	0.0988:0.1811:0.4172:0.3028	.	300;398	E9PHD9;Q6L9W6	.;B4GN3_HUMAN	T	398;300	ENSP00000266383:A398T;ENSP00000322953:A300T	ENSP00000266383:A398T	A	+	1	0	B4GALNT3	531574	0.000000	0.05858	0.350000	0.25708	0.976000	0.68499	-0.169000	0.09911	-0.122000	0.11766	0.655000	0.94253	GCC	B4GALNT3	-	NULL	ENSG00000139044		0.532	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT3	HGNC	protein_coding	OTTHUMT00000251406.2	-	0.00	48	0	G	NM_173593		661313	+1	tier1	-	no_errors	ENST00000266383	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.037	A
BAI3	577	genome.wustl.edu	37	6	69653738	69653738	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr6:69653738G>T	ENST00000370598.1	+	6	1868	c.1047G>T	c.(1045-1047)gaG>gaT	p.E349D		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	349	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GAGTATGGGAGGAATGGTCAC	0.398																																																	0													223.0	183.0	196.0					6																	69653738		2203	4300	6503	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1047G>T	6.37:g.69653738G>T	ENSP00000359630:p.Glu349Asp		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.E349D	ENST00000370598.1	37	c.1047	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	G	11.14	1.549888	0.27652	.	.	ENSG00000135298	ENST00000370598	T	0.60548	0.18	5.16	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.37404	0.1002	N	0.12746	0.255	0.80722	D	1	D	0.69078	0.997	P	0.62885	0.908	T	0.26503	-1.0101	10	0.12430	T	0.62	.	11.6607	0.51345	0.1474:0.0:0.8526:0.0	.	349	O60242	BAI3_HUMAN	D	349	ENSP00000359630:E349D	ENSP00000359630:E349D	E	+	3	2	BAI3	69710459	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.774000	0.47694	1.391000	0.46566	0.650000	0.86243	GAG	BAI3	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000135298		0.398	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	-	0.00	58	0	G			69653738	+1	tier1	-	no_errors	ENST00000370598	ensembl	human	known	74_37	missense	5.81	81	5	SNP	1.000	T
BATF	10538	genome.wustl.edu	37	14	75991427	75991427	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr14:75991427G>T	ENST00000286639.6	+	2	322	c.64G>T	c.(64-66)Gac>Tac	p.D22Y	BATF_ENST00000555795.1_3'UTR|BATF_ENST00000555504.1_Splice_Site_p.D22Y	NM_006399.3	NP_006390.1	Q16520	BATF_HUMAN	basic leucine zipper transcription factor, ATF-like	22					cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hematopoietic stem cell differentiation (GO:0060218)|isotype switching (GO:0045190)|lymphoid progenitor cell differentiation (GO:0002320)|myeloid dendritic cell differentiation (GO:0043011)|T-helper 17 cell differentiation (GO:0072539)|T-helper 17 cell lineage commitment (GO:0072540)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|ovary(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.028)		TGCTTCCCAGGACTCATCTGA	0.547																																																	0													62.0	57.0	58.0					14																	75991427		2203	4300	6503	SO:0001630	splice_region_variant	0			AF016898	CCDS9843.1	14q24	2013-01-10				ENSG00000156127		"""basic leucine zipper proteins"""	958	protein-coding gene	gene with protein product	"""activating transcription factor B"", ""SF-HT-activated gene 2"""	612476				8570175, 8630063	Standard	NM_006399		Approved	B-ATF, SFA-2, BATF1	uc001xrr.3	Q16520		ENST00000286639.6:c.64-1G>T	14.37:g.75991427G>T				Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.D22Y	ENST00000286639.6	37	c.64	CCDS9843.1	14	.	.	.	.	.	.	.	.	.	.	G	21.8	4.200332	0.79015	.	.	ENSG00000156127	ENST00000286639;ENST00000555504	T	0.78707	-1.2	5.71	5.71	0.89125	.	0.112644	0.64402	D	0.000010	T	0.79281	0.4419	L	0.48642	1.525	0.80722	D	1	D	0.56968	0.978	P	0.49140	0.601	T	0.77446	-0.2585	9	.	.	.	-11.3682	19.8677	0.96824	0.0:0.0:1.0:0.0	.	22	Q16520	BATF_HUMAN	Y	22	ENSP00000286639:D22Y	.	D	+	1	0	BATF	75061180	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.194000	0.77789	2.709000	0.92574	0.655000	0.94253	GAC	BATF	-	prints_Leuzip_Fos	ENSG00000156127		0.547	BATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BATF	HGNC	protein_coding	OTTHUMT00000413669.1		0.00	50	0	G	NM_006399	Missense_Mutation	75991427	+1			no_errors	ENST00000286639	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
BCKDHB	594	genome.wustl.edu	37	6	80878608	80878608	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr6:80878608C>T	ENST00000320393.6	+	5	541	c.494C>T	c.(493-495)gCc>gTc	p.A165V	BCKDHB_ENST00000369760.4_Missense_Mutation_p.A165V|BCKDHB_ENST00000356489.5_Missense_Mutation_p.A165V|BCKDHB_ENST00000545529.1_Missense_Mutation_p.A165V	NM_183050.2	NP_898871.1	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1, beta polypeptide	165					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(1)	15		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		AATGAAGCTGCCAAGTATCGC	0.517																																																	0													166.0	157.0	160.0					6																	80878608		2203	4300	6503	SO:0001583	missense	0			M55575	CCDS4994.1	6q14.1	2008-07-31	2008-07-31		ENSG00000083123	ENSG00000083123			987	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	248611					Standard	NM_183050		Approved		uc003pje.2	P21953	OTTHUMG00000016430	ENST00000320393.6:c.494C>T	6.37:g.80878608C>T	ENSP00000318351:p.Ala165Val		Q5T2J3|Q9BQL0	Missense_Mutation	SNP	pfam_Transketolase-like_Pyr-bd,pfam_Transketolase_C,superfamily_Transketo_C/Pyr-ferredox_oxred,smart_Transketolase-like_Pyr-bd	p.A165V	ENST00000320393.6	37	c.494	CCDS4994.1	6	.	.	.	.	.	.	.	.	.	.	C	27.9	4.871548	0.91587	.	.	ENSG00000083123	ENST00000369760;ENST00000320393;ENST00000356489;ENST00000545529;ENST00000541767	D;D;D;D	0.95307	-3.67;-3.67;-3.67;-3.67	5.1	5.1	0.69264	Transketolase-like, pyrimidine-binding domain (2);	0.092868	0.85682	D	0.000000	D	0.98548	0.9515	H	0.98786	4.33	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.99850	1.1070	10	0.87932	D	0	-2.5005	17.5522	0.87879	0.0:1.0:0.0:0.0	.	165	P21953	ODBB_HUMAN	V	165;165;165;165;95	ENSP00000358775:A165V;ENSP00000318351:A165V;ENSP00000348880:A165V;ENSP00000443564:A165V	ENSP00000318351:A165V	A	+	2	0	BCKDHB	80935327	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	7.399000	0.79935	2.372000	0.80975	0.579000	0.79373	GCC	BCKDHB	-	pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd	ENSG00000083123		0.517	BCKDHB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	BCKDHB	HGNC	protein_coding	OTTHUMT00000043911.2	-	0.00	101	0	C	NM_000056		80878608	+1	tier1	-	no_errors	ENST00000320393	ensembl	human	known	74_37	missense	50.35	70	71	SNP	1.000	T
BEX1	55859	genome.wustl.edu	37	X	102317850	102317850	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chrX:102317850T>G	ENST00000372728.3	-	3	592	c.353A>C	c.(352-354)cAt>cCt	p.H118P		NM_018476.3	NP_060946.3	Q9HBH7	BEX1_HUMAN	brain expressed, X-linked 1	118					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II activating transcription factor binding (GO:0001102)			endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	12						AAACTCATCATGATGGTCATG	0.483																																																	0													170.0	138.0	149.0					X																	102317850		2203	4300	6503	SO:0001583	missense	0				CCDS35354.1	Xq22.1	2014-03-21			ENSG00000133169	ENSG00000133169			1036	protein-coding gene	gene with protein product		300690				16221301	Standard	NM_018476		Approved		uc004ejt.1	Q9HBH7	OTTHUMG00000022708	ENST00000372728.3:c.353A>C	X.37:g.102317850T>G	ENSP00000361813:p.His118Pro		A0AVN1|A8K4J3|Q9NZ33	Missense_Mutation	SNP	pfam_TF_A-like/BEX-like,pirsf_BEX	p.H118P	ENST00000372728.3	37	c.353	CCDS35354.1	X	.	.	.	.	.	.	.	.	.	.	T	15.58	2.875642	0.51695	.	.	ENSG00000133169	ENST00000372728	T	0.11495	2.77	3.21	3.21	0.36854	.	0.290766	0.24978	N	0.034082	T	0.19765	0.0475	M	0.80847	2.515	0.30372	N	0.782824	P	0.50819	0.939	P	0.49192	0.602	T	0.11792	-1.0573	10	0.87932	D	0	.	7.2111	0.25935	0.0:0.0:0.0:1.0	.	118	Q9HBH7	BEX1_HUMAN	P	118	ENSP00000361813:H118P	ENSP00000361813:H118P	H	-	2	0	BEX1	102204506	0.982000	0.34865	0.820000	0.32676	0.900000	0.52787	0.312000	0.19397	1.512000	0.48834	0.483000	0.47432	CAT	BEX1	-	pfam_TF_A-like/BEX-like,pirsf_BEX	ENSG00000133169		0.483	BEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEX1	HGNC	protein_coding	OTTHUMT00000058925.1	-	0.00	41	0	T	NM_018476		102317850	-1	tier1	-	no_errors	ENST00000372728	ensembl	human	known	74_37	missense	46.67	48	42	SNP	0.819	G
BIK	638	genome.wustl.edu	37	22	43525244	43525245	+	In_Frame_Ins	INS	-	-	GCT	rs542081559		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr22:43525244_43525245insGCT	ENST00000216115.2	+	5	479_480	c.416_417insGCT	c.(415-420)gcgctg>gcGCTgctg	p.144_145insL		NM_001197.4	NP_001188.1	Q13323	BIK_HUMAN	BCL2-interacting killer (apoptosis-inducing)	144	Leucine-zipper. {ECO:0000255}.				apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|male gonad development (GO:0008584)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)				breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|urinary_tract(1)	5		Ovarian(80;0.0694)				Gtgctgctggcgctgctgctgc	0.723																																																	0																																										SO:0001652	inframe_insertion	0			U34584	CCDS14044.1	22q13.31	2014-03-07			ENSG00000100290	ENSG00000100290			1051	protein-coding gene	gene with protein product		603392				7478623, 10591208	Standard	NM_001197		Approved	NBK	uc003bdk.3	Q13323	OTTHUMG00000150703	ENST00000216115.2:c.429_431dupGCT	22.37:g.43525251_43525253dupGCT	ENSP00000216115:p.Leu147_Leu148dup		Q16582|Q6FH93	In_Frame_Ins	INS	pfam_Bcl2-int_killer	p.143in_frame_insL	ENST00000216115.2	37	c.416_417	CCDS14044.1	22																																																																																			BIK	-	pfam_Bcl2-int_killer	ENSG00000100290		0.723	BIK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIK	HGNC	protein_coding	OTTHUMT00000319676.1		0.00	30	0	-	NM_001197		43525245	+1	tier1		no_errors	ENST00000216115	ensembl	human	known	74_37	in_frame_ins	26.32	28	10	INS	0.000:0.001	GCT
BRCA2	675	genome.wustl.edu	37	13	32906495	32906495	+	Nonsense_Mutation	SNP	G	G	T	rs397508009		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr13:32906495G>T	ENST00000380152.3	+	10	1113	c.880G>T	c.(880-882)Gaa>Taa	p.E294*	BRCA2_ENST00000544455.1_Nonsense_Mutation_p.E294*			P51587	BRCA2_HUMAN	breast cancer 2, early onset	294					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		CCTAGAAGATGAAGTATATGA	0.299			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)		yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	0													58.0	60.0	60.0					13																	32906495		2202	4295	6497	SO:0001587	stop_gained	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.880G>T	13.37:g.32906495G>T	ENSP00000369497:p.Glu294*		O00183|O15008|Q13879|Q5TBJ7	Nonsense_Mutation	SNP	pfam_DNA_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_DNA_recomb/repair_BRCA2_hlx,superfamily_NA-bd_OB-fold,pirsf_BRCA2,pfscan_BRCA2_repeat	p.E294*	ENST00000380152.3	37	c.880	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	G	20.3	3.966917	0.74131	.	.	ENSG00000139618	ENST00000380152;ENST00000544455;ENST00000530893	.	.	.	5.6	3.88	0.44766	.	0.205982	0.33457	N	0.004886	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	9.8754	0.41200	0.1576:0.0:0.8424:0.0	.	.	.	.	X	294;294;292	.	ENSP00000369497:E294X	E	+	1	0	BRCA2	31804495	1.000000	0.71417	0.136000	0.22124	0.204000	0.24138	1.458000	0.35223	0.729000	0.32403	-0.140000	0.14226	GAA	BRCA2	-	pirsf_BRCA2	ENSG00000139618		0.299	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding	OTTHUMT00000046000.2	-	0.00	110	0	G	NM_000059		32906495	+1	tier1	-	no_errors	ENST00000380152	ensembl	human	known	74_37	nonsense	40.91	117	81	SNP	0.814	T
C11orf58	10944	genome.wustl.edu	37	11	16769814	16769814	+	Intron	SNP	A	A	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:16769814A>G	ENST00000228136.4	+	3	586				C11orf58_ENST00000422258.2_Intron|C11orf58_ENST00000527893.1_3'UTR|C11orf58_ENST00000525684.1_Intron			O00193	SMAP_HUMAN	chromosome 11 open reading frame 58											NS(1)|endometrium(1)|lung(3)|prostate(1)|skin(1)	7						aattattaaaatattataatt	0.358																																																	0																																										SO:0001627	intron_variant	0			BC007103	CCDS7822.1	11p15.1	2012-05-30			ENSG00000110696	ENSG00000110696			16990	protein-coding gene	gene with protein product	"""small acidic protein"""					9263035	Standard	NM_014267		Approved	SMAP	uc001mmk.2	O00193	OTTHUMG00000165910	ENST00000228136.4:c.208+110A>G	11.37:g.16769814A>G			B2RD28	RNA	SNP	-	NULL	ENST00000228136.4	37	NULL	CCDS7822.1	11																																																																																			C11orf58	-	-	ENSG00000110696		0.358	C11orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf58	HGNC	protein_coding	OTTHUMT00000387023.2	-	0.00	29	0	A	NM_014267		16769814	+1	tier1	-	no_errors	ENST00000527893	ensembl	human	known	74_37	rna	63.64	8	14	SNP	0.001	G
C15orf41	84529	genome.wustl.edu	37	15	37101143	37101143	+	3'UTR	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr15:37101143G>A	ENST00000566621.1	+	0	1585				C15orf41_ENST00000565792.1_3'UTR|C15orf41_ENST00000338183.4_3'UTR|C15orf41_ENST00000437989.2_3'UTR|C15orf41_ENST00000563167.1_3'UTR|C15orf41_ENST00000567389.1_3'UTR|CSNK1A1P1_ENST00000430593.3_RNA	NM_001130010.1	NP_001123482.1	Q9Y2V0	CO041_HUMAN	chromosome 15 open reading frame 41											kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)		ATAATCTAGCGCAAACCTAGG	0.498																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC006254	CCDS45215.1, CCDS45216.1	15q14	2012-05-31			ENSG00000186073	ENSG00000186073			26929	protein-coding gene	gene with protein product		615626					Standard	XM_005254719		Approved	HH114, MGC11326, FLJ22851	uc001zje.4	Q9Y2V0	OTTHUMG00000172659	ENST00000566621.1:c.*489G>A	15.37:g.37101143G>A			B2RD87	RNA	SNP	-	NULL	ENST00000566621.1	37	NULL	CCDS45215.1	15																																																																																			C15orf41	-	-	ENSG00000186073		0.498	C15orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf41	HGNC	protein_coding	OTTHUMT00000419741.1	-	0.00	28	0	G	NM_032499		37101143	+1	tier1	-	no_errors	ENST00000565792	ensembl	human	known	74_37	rna	38.89	11	7	SNP	0.000	A
CCDC185	164127	genome.wustl.edu	37	1	223567258	223567258	+	Silent	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:223567258G>T	ENST00000366875.3	+	1	544	c.441G>T	c.(439-441)ccG>ccT	p.P147P		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		147	Pro-rich.									breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		ACTCGCCCCCGCCTTGCCCCG	0.687																																																	0													13.0	16.0	15.0					1																	223567258		2191	4296	6487	SO:0001819	synonymous_variant	0																														ENST00000366875.3:c.441G>T	1.37:g.223567258G>T			Q8N746|Q8NA93	Silent	SNP	NULL	p.P147	ENST00000366875.3	37	c.441	CCDS1537.1	1																																																																																			C1orf65	-	NULL	ENSG00000178395		0.687	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf65	HGNC	protein_coding	OTTHUMT00000092718.1		0.00	17	0	G			223567258	+1			no_errors	ENST00000366875	ensembl	human	known	74_37	silent	10.00	18	2	SNP	0.708	T
STKLD1	169436	genome.wustl.edu	37	9	136260761	136260761	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr9:136260761G>A	ENST00000371957.3	+	9	844	c.737G>A	c.(736-738)cGc>cAc	p.R246H	C9orf96_ENST00000371955.1_5'UTR	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		246	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		AAGTCCCTCCGCCAGAGCCCA	0.557																																																	0													68.0	69.0	68.0					9																	136260761		2203	4300	6503	SO:0001583	missense	0																														ENST00000371957.3:c.737G>A	9.37:g.136260761G>A	ENSP00000361025:p.Arg246His		Q5T8U8|Q6ZMP6|Q6ZMQ5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R246H	ENST00000371957.3	37	c.737	CCDS35169.1	9	.	.	.	.	.	.	.	.	.	.	G	13.05	2.120536	0.37436	.	.	ENSG00000198870	ENST00000371957	T	0.65364	-0.15	4.86	2.96	0.34315	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.081178	0.48767	N	0.000171	T	0.69142	0.3078	M	0.63169	1.94	0.23192	N	0.99814	D	0.69078	0.997	D	0.63192	0.912	T	0.59257	-0.7488	10	0.62326	D	0.03	-31.7113	6.0042	0.19537	0.0992:0.0:0.7132:0.1877	.	246	Q8NE28	SGK71_HUMAN	H	246	ENSP00000361025:R246H	ENSP00000361025:R246H	R	+	2	0	C9orf96	135250582	0.790000	0.28787	0.313000	0.25210	0.117000	0.20001	3.057000	0.49931	0.538000	0.28769	0.462000	0.41574	CGC	C9orf96	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000198870		0.557	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf96	HGNC	protein_coding	OTTHUMT00000054855.1	-	0.00	39	0	G			136260761	+1	tier1	-	no_errors	ENST00000371957	ensembl	human	known	74_37	missense	46.43	29	26	SNP	0.127	A
CABS1	85438	genome.wustl.edu	37	4	71201456	71201456	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr4:71201456C>G	ENST00000273936.5	+	1	774	c.700C>G	c.(700-702)Ctt>Gtt	p.L234V		NM_033122.3	NP_149113.3	Q96KC9	CABS1_HUMAN	calcium-binding protein, spermatid-specific 1	234					spermatogenesis (GO:0007283)	mitochondrial inner membrane (GO:0005743)|motile cilium (GO:0031514)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(4)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CATAACTGCCCTTGAAGAAGA	0.433																																																	0													96.0	99.0	98.0					4																	71201456		2203	4300	6503	SO:0001583	missense	0			AF380838	CCDS3539.1	4q13.3	2013-10-11	2011-01-25	2011-01-25	ENSG00000145309	ENSG00000145309			30710	protein-coding gene	gene with protein product	"""casein-like phosphoprotein"""		"""chromosome 4 open reading frame 35"""	C4orf35		19208547, 19271754	Standard	NM_033122		Approved	NYD-SP26, FLJ32897, CLPH	uc003hff.3	Q96KC9	OTTHUMG00000129405	ENST00000273936.5:c.700C>G	4.37:g.71201456C>G	ENSP00000273936:p.Leu234Val		B2RCB5|Q86UE0|Q96M17	Missense_Mutation	SNP	NULL	p.L234V	ENST00000273936.5	37	c.700	CCDS3539.1	4	.	.	.	.	.	.	.	.	.	.	C	0.203	-1.042861	0.01997	.	.	ENSG00000145309	ENST00000273936	T	0.26957	1.7	4.57	-0.376	0.12505	.	1.128570	0.06857	N	0.798383	T	0.09818	0.0241	N	0.11560	0.145	0.09310	N	1	B	0.21753	0.06	B	0.23419	0.046	T	0.28490	-1.0042	10	0.02654	T	1	-23.8753	1.7855	0.03040	0.1521:0.3737:0.2963:0.178	.	234	Q96KC9	CABS1_HUMAN	V	234	ENSP00000273936:L234V	ENSP00000273936:L234V	L	+	1	0	CABS1	71236045	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.192000	0.09587	-0.230000	0.09840	0.655000	0.94253	CTT	CABS1	-	NULL	ENSG00000145309		0.433	CABS1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	CABS1	HGNC	protein_coding	OTTHUMT00000251561.3	-	0.00	24	0	C	NM_033122		71201456	+1	tier1	-	no_errors	ENST00000273936	ensembl	human	known	74_37	missense	30.43	16	7	SNP	0.000	G
CAD	790	genome.wustl.edu	37	2	27459359	27459359	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr2:27459359A>G	ENST00000403525.1	+	25	4237	c.4093A>G	c.(4093-4095)Atc>Gtc	p.I1365V	CAD_ENST00000264705.4_Missense_Mutation_p.I1428V			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCCCCTAATCATCGATATCAA	0.572																																																	0													61.0	62.0	62.0					2																	27459359		2203	4300	6503	SO:0001583	missense	0			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.4093A>G	2.37:g.27459359A>G	ENSP00000384510:p.Ile1365Val		O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_Asp/Orn_carbamoyltranf_P-bd,pfam_GATASE,pfam_Asp_carbamoyltransf_Asp/Orn-bd,pfam_CarbamoylP_synth_lsu_oligo,pfam_CarbamoylP_synth_lsu_N,pfam_ATP-grasp_carboxylate-amine,pfam_MGS-like_dom,pfam_Dala_Dala_lig_C,pfam_Amidohydro_1,superfamily_Asp/Orn_carbamoylTrfase,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_dom,superfamily_MGS-like_dom,superfamily_Metal-dep_hydrolase_composite,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,prints_Asp_carbamoyltransf,prints_Asp/Orn_carbamoylTrfase,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu,tigrfam_Asp_carbamoyltransf	p.I1428V	ENST00000403525.1	37	c.4282		2	.	.	.	.	.	.	.	.	.	.	A	17.92	3.506440	0.64410	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.85629	-2.01;-2.01	5.03	5.03	0.67393	Methylglyoxal synthase-like domain (3);	0.045424	0.85682	D	0.000000	T	0.81103	0.4753	L	0.36672	1.1	0.47441	D	0.999429	B;B	0.25351	0.099;0.124	B;B	0.31442	0.096;0.13	T	0.80042	-0.1548	10	0.72032	D	0.01	-2.0686	13.8621	0.63566	1.0:0.0:0.0:0.0	.	1365;1428	F8VPD4;P27708	.;PYR1_HUMAN	V	1428;1365	ENSP00000264705:I1428V;ENSP00000384510:I1365V	ENSP00000264705:I1428V	I	+	1	0	CAD	27312863	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	8.472000	0.90407	2.009000	0.58944	0.459000	0.35465	ATC	CAD	-	superfamily_MGS-like_dom,smart_MGS-like_dom,tigrfam_CarbamoylP_synth_lsu	ENSG00000084774		0.572	CAD-002	NOVEL	basic|exp_conf	protein_coding	CAD	HGNC	protein_coding	OTTHUMT00000324970.1	-	0.00	26	0	A			27459359	+1	tier1	-	no_errors	ENST00000264705	ensembl	human	known	74_37	missense	38.71	19	12	SNP	1.000	G
CADPS	8618	genome.wustl.edu	37	3	62535709	62535709	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr3:62535709C>T	ENST00000383710.4	-	11	2184	c.1835G>A	c.(1834-1836)cGc>cAc	p.R612H	CADPS_ENST00000283269.9_Missense_Mutation_p.R612H|CADPS_ENST00000357948.3_Missense_Mutation_p.R612H	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	612	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)	p.R612L(2)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CCACAGGATGCGGTCTTGTTC	0.557																																																	2	Substitution - Missense(2)	lung(2)											164.0	146.0	152.0					3																	62535709		2203	4300	6503	SO:0001583	missense	0			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.1835G>A	3.37:g.62535709C>T	ENSP00000373215:p.Arg612His		A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	pfam_Ca-dep_secretion_activator,superfamily_C2_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R612H	ENST00000383710.4	37	c.1835	CCDS46858.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.5|28.5	4.925806|4.925806	0.92319|0.92319	.|.	.|.	ENSG00000163618|ENSG00000163618	ENST00000478434|ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269;ENST00000542833	.|T;T;T;T	.|0.78126	.|0.62;0.58;0.59;-1.15	4.71|4.71	4.71|4.71	0.59529|0.59529	.|Pleckstrin homology-type (1);Pleckstrin homology domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.87152|0.87152	0.6106|0.6106	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|0.999;0.997;1.0;1.0	.|D;P;D;D	.|0.83275	.|0.977;0.881;0.996;0.989	D|D	0.88162|0.88162	0.2858|0.2858	5|10	.|0.66056	.|D	.|0.02	.|.	18.2011|18.2011	0.89838|0.89838	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|612;612;612;612	.|Q9ULU8-2;Q9ULU8-3;Q9ULU8;Q9ULU8-4	.|.;.;CAPS1_HUMAN;.	T|H	43|612;612;612;612;107	.|ENSP00000373215:R612H;ENSP00000350632:R612H;ENSP00000283269:R612H;ENSP00000439528:R107H	.|ENSP00000283269:R612H	A|R	-|-	1|2	0|0	CADPS|CADPS	62510749|62510749	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	7.609000|7.609000	0.82925|0.82925	2.612000|2.612000	0.88384|0.88384	0.585000|0.585000	0.79938|0.79938	GCA|CGC	CADPS	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000163618		0.557	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CADPS	HGNC	protein_coding	OTTHUMT00000351951.5		0.00	60	0	C	NM_003716, NM_183393, NM_183394		62535709	-1			no_errors	ENST00000383710	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
CAPZA1	829	genome.wustl.edu	37	1	113202208	113202208	+	Intron	DEL	C	C	-	rs3013438|rs200009640|rs199887112	byFrequency	TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:113202208delC	ENST00000263168.3	+	7	1178				CAPZA1_ENST00000476936.1_Intron	NM_006135.2	NP_006126.1	P52907	CAZA1_HUMAN	capping protein (actin filament) muscle Z-line, alpha 1						actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|WASH complex (GO:0071203)	actin binding (GO:0003779)			breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTCTCTCTCTCTTTTTTTTTT	0.398																																																	0																																										SO:0001627	intron_variant	0			U56637	CCDS30805.1	1p13.2	2014-05-09			ENSG00000116489	ENSG00000116489			1488	protein-coding gene	gene with protein product		601580				7665558, 9119363	Standard	NM_006135		Approved		uc001ecj.1	P52907	OTTHUMG00000011769	ENST00000263168.3:c.507-115C>-	1.37:g.113202208delC			Q53FQ6|Q6FHD5	RNA	DEL	-	NULL	ENST00000263168.3	37	NULL	CCDS30805.1	1																																																																																			CAPZA1	-	-	ENSG00000116489		0.398	CAPZA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPZA1	HGNC	protein_coding	OTTHUMT00000032567.2		0.00	31	0	C	NM_006135		113202208	+1	tier1		no_errors	ENST00000466066	ensembl	human	known	74_37	rna	19.44	29	7	DEL	0.021	-
CARD11	84433	genome.wustl.edu	37	7	2968322	2968323	+	Frame_Shift_Ins	INS	-	-	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr7:2968322_2968323insG	ENST00000396946.4	-	13	2066_2067	c.1663_1664insC	c.(1663-1665)cggfs	p.R555fs		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	555					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.R548L(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		GCTGCGGCTCCGGGGGGGCTGC	0.589			Mis		DLBCL																																			Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	1	Substitution - Missense(1)	lung(1)																																								SO:0001589	frameshift_variant	0			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1664dupC	7.37:g.2968329_2968329dupG	ENSP00000380150:p.Arg555fs		A4D1Z7|Q2NKN7|Q548H3	Frame_Shift_Ins	INS	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,superfamily_PDZ,pfscan_CARD	p.R555fs	ENST00000396946.4	37	c.1664_1663	CCDS5336.2	7																																																																																			CARD11	-	NULL	ENSG00000198286		0.589	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD11	HGNC	protein_coding	OTTHUMT00000059344.4		0.00	51	0	-	NM_032415		2968323	-1	tier1		no_errors	ENST00000396946	ensembl	human	known	74_37	frame_shift_ins	14.86	126	22	INS	0.395:0.080	G
CC2D2B	387707	genome.wustl.edu	37	10	97786972	97786972	+	Intron	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr10:97786972C>T	ENST00000344386.3	+	9	944				ENTPD1-AS1_ENST00000454638.1_RNA|CC2D2B_ENST00000371198.2_Nonsense_Mutation_p.R133*|RP11-690P14.4_ENST00000475252.2_3'UTR|ENTPD1-AS1_ENST00000452728.1_RNA|ENTPD1-AS1_ENST00000449197.1_RNA|CC2D2B_ENST00000410012.2_Silent_p.I281I|ENTPD1-AS1_ENST00000451364.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1-AS1_ENST00000458228.1_RNA	NM_001001732.3	NP_001001732.2	Q6DHV5	C2D2B_HUMAN	coiled-coil and C2 domain containing 2B											large_intestine(1)|lung(7)|ovary(1)|urinary_tract(1)	10		Colorectal(252;0.158)		Epithelial(162;7.08e-08)|all cancers(201;2.71e-06)		ACCTTAGGATCGAAAGGACTC	0.343																																																	0													129.0	104.0	111.0					10																	97786972		692	1591	2283	SO:0001627	intron_variant	0			BC075861	CCDS41555.1, CCDS53560.1	10q23.33	2008-11-06	2007-10-19	2007-10-19	ENSG00000188649	ENSG00000188649			31666	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 130"""	C10orf130			Standard	NM_001001732		Approved	bA248J23.4	uc010qop.2	Q6DHV5	OTTHUMG00000018820	ENST00000344386.3:c.781-4605C>T	10.37:g.97786972C>T			A2A3E9|B4DYD4|E9PCC3|Q5VUS0	Nonsense_Mutation	SNP	superfamily_C2_dom	p.R133*	ENST00000344386.3	37	c.397	CCDS41555.1	10	.	.	.	.	.	.	.	.	.	.	C	43	10.461201	0.99409	.	.	ENSG00000188649	ENST00000371198	.	.	.	5.46	-1.22	0.09494	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.8059	0.13319	0.1378:0.3286:0.0:0.5336	.	.	.	.	X	133	.	ENSP00000360241:R133X	R	+	1	2	CC2D2B	97776962	0.973000	0.33851	0.997000	0.53966	0.790000	0.44656	-0.021000	0.12504	-0.186000	0.10533	-0.484000	0.04775	CGA	CC2D2B	-	NULL	ENSG00000188649		0.343	CC2D2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CC2D2B	HGNC	protein_coding	OTTHUMT00000049573.3	-	0.00	95	0	C	NM_001001732		97786972	+1	tier1	-	no_errors	ENST00000371198	ensembl	human	known	74_37	nonsense	73.75	21	59	SNP	0.998	T
CCDC106	29903	genome.wustl.edu	37	19	56162797	56162797	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:56162797G>T	ENST00000586790.1	+	4	1366	c.462G>T	c.(460-462)caG>caT	p.Q154H	CCDC106_ENST00000591578.1_Missense_Mutation_p.Q154H|CCDC106_ENST00000591241.1_Missense_Mutation_p.Q119H|CCDC106_ENST00000308964.3_Missense_Mutation_p.Q154H|U2AF2_ENST00000450554.2_5'Flank|CCDC106_ENST00000588740.1_Missense_Mutation_p.Q154H			Q9BWC9	CC106_HUMAN	coiled-coil domain containing 106	154						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(2)|large_intestine(3)|lung(5)|skin(1)	11		Colorectal(82;0.00403)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		GGAGGCGGCAGAAGCAGAAGG	0.711																																																	0													30.0	26.0	27.0					19																	56162797		2194	4300	6494	SO:0001583	missense	0			AF054984	CCDS33118.1	19q13.42	2013-09-20			ENSG00000173581	ENSG00000173581			30181	protein-coding gene	gene with protein product		613478				8619474, 9110174	Standard	XM_005258827		Approved	HSU79303	uc002qlr.3	Q9BWC9	OTTHUMG00000180907	ENST00000586790.1:c.462G>T	19.37:g.56162797G>T	ENSP00000465757:p.Gln154His		B3KUF9|D3K183|Q99786	Missense_Mutation	SNP	NULL	p.Q154H	ENST00000586790.1	37	c.462	CCDS33118.1	19	.	.	.	.	.	.	.	.	.	.	G	13.02	2.111040	0.37242	.	.	ENSG00000173581	ENST00000308964	.	.	.	4.3	3.25	0.37280	.	0.226751	0.37095	N	0.002250	T	0.34250	0.0891	N	0.22421	0.69	0.38702	D	0.953003	P	0.47677	0.899	P	0.44990	0.466	T	0.26744	-1.0094	9	0.66056	D	0.02	-0.879	6.7254	0.23353	0.2889:0.0:0.7111:0.0	.	154	Q9BWC9	CC106_HUMAN	H	154	.	ENSP00000309681:Q154H	Q	+	3	2	CCDC106	60854609	1.000000	0.71417	1.000000	0.80357	0.108000	0.19459	2.197000	0.42696	0.931000	0.37242	0.655000	0.94253	CAG	CCDC106	-	NULL	ENSG00000173581		0.711	CCDC106-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CCDC106	HGNC	protein_coding	OTTHUMT00000453593.1	-	0.00	45	0	G	NM_013301		56162797	+1	tier1	-	no_errors	ENST00000308964	ensembl	human	known	74_37	missense	40.91	26	18	SNP	1.000	T
SOHLH2	54937	genome.wustl.edu	37	13	36748661	36748661	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr13:36748661T>A	ENST00000379881.3	-	8	921	c.833A>T	c.(832-834)cAa>cTa	p.Q278L	SOHLH2_ENST00000554962.1_Missense_Mutation_p.Q355L|CCDC169-SOHLH2_ENST00000511166.1_Missense_Mutation_p.Q355L	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	278					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		GGGTGTTTGTTGTTTCTTACA	0.393																																																	0													212.0	207.0	209.0					13																	36748661		2203	4300	6503	SO:0001583	missense	0			AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.833A>T	13.37:g.36748661T>A	ENSP00000369210:p.Gln278Leu		B4DX90|Q5EGC3|Q8TC74|Q96QX4	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.Q355L	ENST00000379881.3	37	c.1064	CCDS9355.1	13	.	.	.	.	.	.	.	.	.	.	T	13.58	2.280857	0.40394	.	.	ENSG00000120669;ENSG00000120669;ENSG00000250709	ENST00000379881;ENST00000554962;ENST00000511166	T;T;T	0.35421	1.31;1.31;1.31	4.41	1.75	0.24633	Helix-loop-helix DNA-binding (1);	0.553031	0.17529	N	0.170922	T	0.27832	0.0685	L	0.53249	1.67	0.09310	N	0.999993	P;P	0.37781	0.608;0.608	B;B	0.34180	0.177;0.177	T	0.20338	-1.0278	10	0.87932	D	0	-13.3032	4.6329	0.12511	0.0:0.1059:0.1928:0.7013	.	355;278	B4DX90;Q9NX45	.;SOLH2_HUMAN	L	278;355;355	ENSP00000369210:Q278L;ENSP00000451542:Q355L;ENSP00000421868:Q355L	ENSP00000421868:Q355L	Q	-	2	0	CCDC169-SOHLH2;SOHLH2	35646661	0.953000	0.32496	0.118000	0.21660	0.493000	0.33554	1.657000	0.37366	0.076000	0.16826	0.528000	0.53228	CAA	CCDC169-SOHLH2	-	superfamily_bHLH_dom	ENSG00000250709		0.393	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC169-SOHLH2	HGNC	protein_coding	OTTHUMT00000044477.2	-	0.00	68	0	T	NM_017826		36748661	-1	tier1	-	no_errors	ENST00000511166	ensembl	human	known	74_37	missense	57.14	21	28	SNP	0.221	A
CCDC39	339829	genome.wustl.edu	37	3	180334633	180334633	+	Nonsense_Mutation	SNP	A	A	C	rs377454931		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr3:180334633A>C	ENST00000442201.2	-	17	2506	c.2387T>G	c.(2386-2388)tTa>tGa	p.L796*	CCDC39_ENST00000273654.4_3'UTR|TTC14_ENST00000382584.4_Intron	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	796					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CACTCTTTCTAATTTTGGCTT	0.308																																																	0													162.0	145.0	150.0					3																	180334633		1814	4067	5881	SO:0001587	stop_gained	0			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.2387T>G	3.37:g.180334633A>C	ENSP00000405708:p.Leu796*		B4E2H1	Nonsense_Mutation	SNP	superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.L796*	ENST00000442201.2	37	c.2387	CCDS46964.1	3	.	.	.	.	.	.	.	.	.	.	A	40	8.411174	0.98799	.	.	ENSG00000145075	ENST00000442201	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.7977	0.69889	1.0:0.0:0.0:0.0	.	.	.	.	X	796	.	ENSP00000405708:L796X	L	-	2	0	CCDC39	181817327	0.958000	0.32768	0.764000	0.31436	0.869000	0.49853	8.029000	0.88807	2.077000	0.62373	0.377000	0.23210	TTA	CCDC39	-	NULL	ENSG00000145075		0.308	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC39	HGNC	protein_coding	OTTHUMT00000349783.3	-	0.00	67	0	A	XM_291028		180334633	-1	tier1	-	no_errors	ENST00000442201	ensembl	human	known	74_37	nonsense	20.00	148	37	SNP	0.853	C
CEND1	51286	genome.wustl.edu	37	11	788361	788361	+	Silent	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:788361G>A	ENST00000330106.4	-	2	391	c.216C>T	c.(214-216)ctC>ctT	p.L72L	CEND1_ENST00000524587.1_5'UTR	NM_016564.3	NP_057648.2	Q8N111	CEND_HUMAN	cell cycle exit and neuronal differentiation 1	72					adult walking behavior (GO:0007628)|cerebellar granular layer maturation (GO:0021686)|cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|radial glia guided migration of cerebellar granule cell (GO:0021933)	integral component of membrane (GO:0016021)				prostate(1)	1		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGTGGTTGTTGAGAAGGGCAG	0.687																																																	0													44.0	49.0	48.0					11																	788361		2203	4299	6502	SO:0001819	synonymous_variant	0			AK074547	CCDS7714.1	11p15.5	2006-06-14			ENSG00000184524	ENSG00000184524			24153	protein-coding gene	gene with protein product		608213				11311134	Standard	NM_016564		Approved	FLJ90066, BM88	uc001lrh.1	Q8N111	OTTHUMG00000133308	ENST00000330106.4:c.216C>T	11.37:g.788361G>A			Q9NYM6	Silent	SNP	NULL	p.L72	ENST00000330106.4	37	c.216	CCDS7714.1	11																																																																																			CEND1	-	NULL	ENSG00000184524		0.687	CEND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEND1	HGNC	protein_coding	OTTHUMT00000257105.1	-	0.00	67	0	G	NM_016564		788361	-1	tier1	-	no_errors	ENST00000330106	ensembl	human	known	74_37	silent	54.35	42	50	SNP	1.000	A
CEP128	145508	genome.wustl.edu	37	14	81366373	81366373	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr14:81366373G>T	ENST00000555265.1	-	7	856	c.481C>A	c.(481-483)Ctt>Att	p.L161I	CEP128_ENST00000281129.3_Splice_Site_p.L161I|CEP128_ENST00000216517.6_Splice_Site_p.L161I|CEP128_ENST00000327841.2_Splice_Site_p.L101I			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	161						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						AAACCATGAAGCTAGCAAAGG	0.398																																																	0													66.0	69.0	68.0					14																	81366373		2203	4300	6503	SO:0001630	splice_region_variant	0			AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.481-1C>A	14.37:g.81366373G>T			B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	NULL	p.L161I	ENST00000555265.1	37	c.481	CCDS32130.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.38|16.38	3.106743|3.106743	0.56291|0.56291	.|.	.|.	ENSG00000100629|ENSG00000100629	ENST00000281129;ENST00000555265;ENST00000393619;ENST00000216517;ENST00000327841;ENST00000555529|ENST00000554827	T;T;T;T|.	0.54479|.	1.34;1.34;0.75;0.57|.	5.51|5.51	-1.01|-1.01	0.10169|0.10169	.|.	0.768751|.	0.11793|.	N|.	0.529017|.	T|T	0.24431|0.24431	0.0592|0.0592	N|N	0.20986|0.20986	0.625|0.625	0.32002|0.32002	N|N	0.603257|0.603257	P;P;P|.	0.51351|.	0.944;0.562;0.562|.	P;B;B|.	0.45276|.	0.475;0.275;0.275|.	T|T	0.34030|0.34030	-0.9845|-0.9845	10|5	0.22109|.	T|.	0.4|.	.|.	3.6597|3.6597	0.08234|0.08234	0.4164:0.0:0.306:0.2776|0.4164:0.0:0.306:0.2776	.|.	161;42;161|.	Q6ZU80-3;Q8N3Z7;Q6ZU80|.	.;.;CE128_HUMAN|.	I|R	161;161;161;161;101;161|39	ENSP00000281129:L161I;ENSP00000451162:L161I;ENSP00000216517:L161I;ENSP00000451137:L161I|.	ENSP00000216517:L161I|.	L|S	-|-	1|3	0|2	CEP128|CEP128	80436126|80436126	0.521000|0.521000	0.26258|0.26258	0.900000|0.900000	0.35374|0.35374	0.974000|0.974000	0.67602|0.67602	-0.514000|-0.514000	0.06298|0.06298	-0.533000|-0.533000	0.06323|0.06323	-0.225000|-0.225000	0.12378|0.12378	CTT|AGC	CEP128	-	NULL	ENSG00000100629		0.398	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP128	HGNC	protein_coding	OTTHUMT00000413415.1		0.00	34	0	G	NM_152446	Missense_Mutation	81366373	-1			no_errors	ENST00000281129	ensembl	human	known	74_37	missense	5.45	52	3	SNP	0.977	T
CHD1	1105	genome.wustl.edu	37	5	98194026	98194026	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr5:98194026G>T	ENST00000284049.3	-	34	4794	c.4645C>A	c.(4645-4647)Cac>Aac	p.H1549N		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	1549					chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	TGAGTTAAGTGTCTATCAGAG	0.353																																																	0													267.0	260.0	262.0					5																	98194026		2203	4300	6503	SO:0001583	missense	0			AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.4645C>A	5.37:g.98194026G>T	ENSP00000284049:p.His1549Asn		Q17RZ3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.H1549N	ENST00000284049.3	37	c.4645	CCDS34204.1	5	.	.	.	.	.	.	.	.	.	.	G	15.24	2.774927	0.49786	.	.	ENSG00000153922	ENST00000422663;ENST00000284049	D	0.90844	-2.74	5.31	5.31	0.75309	.	0.000000	0.34959	U	0.003549	D	0.93621	0.7963	L	0.59436	1.845	0.80722	D	1	P	0.45126	0.851	P	0.58391	0.838	D	0.92153	0.5730	10	0.35671	T	0.21	.	19.324	0.94254	0.0:0.0:1.0:0.0	.	1549	O14646	CHD1_HUMAN	N	139;1549	ENSP00000284049:H1549N	ENSP00000284049:H1549N	H	-	1	0	CHD1	98221926	1.000000	0.71417	1.000000	0.80357	0.461000	0.32589	9.173000	0.94815	2.635000	0.89317	0.555000	0.69702	CAC	CHD1	-	NULL	ENSG00000153922		0.353	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1	HGNC	protein_coding	OTTHUMT00000370295.1	-	0.00	51	0	G	NM_001270		98194026	-1	tier1	-	no_errors	ENST00000284049	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
CHRNA2	1135	genome.wustl.edu	37	8	27320896	27320896	+	Missense_Mutation	SNP	C	C	T	rs368791756		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr8:27320896C>T	ENST00000520933.2	-	5	1217	c.1064G>A	c.(1063-1065)cGc>cAc	p.R355H	CHRNA2_ENST00000240132.2_Missense_Mutation_p.R340H|CHRNA2_ENST00000407991.1_Missense_Mutation_p.R355H			Q15822	ACHA2_HUMAN	cholinergic receptor, nicotinic, alpha 2 (neuronal)	355					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transport (GO:0006811)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0208)|Epithelial(17;2.77e-10)|Colorectal(74;0.136)	Atracurium(DB00732)|Biperiden(DB00810)|Carbachol(DB00411)|Cisatracurium Besylate(DB00565)|Decamethonium(DB01245)|Dextromethorphan(DB00514)|Doxacurium chloride(DB01135)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Mecamylamine(DB00657)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicotine(DB00184)|Pancuronium(DB01337)|Pipecuronium(DB01338)|Procaine(DB00721)|Rocuronium(DB00728)|Tubocurarine(DB01199)|Vecuronium(DB01339)	GCTGGGGGAGCGGTGGTGCAC	0.647																																																	0								C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	90.0	75.0	80.0		1064	4.9	1.0	8		80	0,8600		0,0,4300	no	missense	CHRNA2	NM_000742.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	355/530	27320896	1,13005	2203	4300	6503	SO:0001583	missense	0			U62431	CCDS6059.1, CCDS64856.1	8p21	2012-02-11	2006-02-01		ENSG00000120903	ENSG00000120903		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1956	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 2 (neuronal)"""	118502	"""cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)"""			1505988	Standard	NM_000742		Approved		uc010lur.3	Q15822	OTTHUMG00000102083	ENST00000520933.2:c.1064G>A	8.37:g.27320896C>T	ENSP00000429616:p.Arg355His		A8KAX3|B4DK19|J3KMY9|Q9HAQ3	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.R355H	ENST00000520933.2	37	c.1064	CCDS6059.1	8	.	.	.	.	.	.	.	.	.	.	C	27.6	4.844230	0.91197	2.27E-4	0.0	ENSG00000120903	ENST00000407991;ENST00000520933;ENST00000240132	D;D;D	0.88741	-2.42;-2.42;-2.42	4.88	4.88	0.63580	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.95111	0.8416	M	0.88979	2.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95786	0.8821	10	0.87932	D	0	.	15.5505	0.76148	0.0:1.0:0.0:0.0	.	340;355	B4DK19;Q15822	.;ACHA2_HUMAN	H	355;355;340	ENSP00000385026:R355H;ENSP00000429616:R355H;ENSP00000240132:R340H	ENSP00000240132:R340H	R	-	2	0	CHRNA2	27376813	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.651000	0.83577	2.533000	0.85409	0.561000	0.74099	CGC	CHRNA2	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000120903		0.647	CHRNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA2	HGNC	protein_coding	OTTHUMT00000376125.4	-	0.00	28	0	C			27320896	-1	tier1	-	no_errors	ENST00000407991	ensembl	human	known	74_37	missense	80.00	3	12	SNP	1.000	T
CLIP1	6249	genome.wustl.edu	37	12	122763382	122763382	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:122763382C>A	ENST00000540338.1	-	22	3914	c.3873G>T	c.(3871-3873)gaG>gaT	p.E1291D	CLIP1_ENST00000302528.7_Missense_Mutation_p.E1280D|CLIP1_ENST00000358808.2_Missense_Mutation_p.E1280D|CLIP1_ENST00000537178.1_Missense_Mutation_p.E1245D|CLIP1_ENST00000361654.4_Missense_Mutation_p.E1169D|CLIP1_ENST00000536634.1_5'UTR|CLIP1_ENST00000540539.1_5'Flank|CLIP1_ENST00000545889.1_Missense_Mutation_p.E866D			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	1291					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TGAGTTGAAGCTCCAAGTTCT	0.537																																																	0													70.0	68.0	68.0					12																	122763382		2203	4300	6503	SO:0001583	missense	0				CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.3873G>T	12.37:g.122763382C>A	ENSP00000439093:p.Glu1291Asp		A0AVD3|Q17RS4|Q29RG0	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_Znf_CCHC,superfamily_Prefoldin,pfscan_CAP-Gly_domain	p.E1291D	ENST00000540338.1	37	c.3873	CCDS58285.1	12	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932404	0.73442	.	.	ENSG00000130779	ENST00000545889;ENST00000302528;ENST00000358808;ENST00000542885;ENST00000392458;ENST00000537178;ENST00000540338	T;T;T;T;T	0.14893	2.47;2.47;2.47;2.47;2.47	6.17	3.37	0.38596	.	0.166180	0.52532	D	0.000074	T	0.33673	0.0871	M	0.70275	2.135	0.54753	D	0.999987	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.996	T	0.17653	-1.0362	10	0.14656	T	0.56	-24.5874	8.7021	0.34332	0.0:0.6482:0.0:0.3518	.	1245;1280;1291	P30622-2;P30622-1;P30622	.;.;CLIP1_HUMAN	D	866;1280;1280;1010;322;1245;1291	ENSP00000438743:E866D;ENSP00000303585:E1280D;ENSP00000351665:E1280D;ENSP00000445531:E1245D;ENSP00000439093:E1291D	ENSP00000303585:E1280D	E	-	3	2	CLIP1	121329335	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.768000	0.38511	0.469000	0.27268	0.655000	0.94253	GAG	CLIP1	-	NULL	ENSG00000130779		0.537	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLIP1	HGNC	protein_coding	OTTHUMT00000401625.1	-	0.00	43	0	C	NM_002956		122763382	-1	tier1	-	no_errors	ENST00000540338	ensembl	human	known	74_37	missense	83.87	4	26	SNP	1.000	A
CLTC	1213	genome.wustl.edu	37	17	57758783	57758783	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:57758783T>C	ENST00000269122.3	+	20	3467	c.3193T>C	c.(3193-3195)Ttt>Ctt	p.F1065L	CLTC_ENST00000579456.1_Intron|CLTC_ENST00000393043.1_Missense_Mutation_p.F1065L	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	1065	Heavy chain arm.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					CAATGAGCTGTTTGAAGAAGC	0.393			T	"""ALK, TFE3"""	"""ALCL, renal """																																			Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	0													103.0	99.0	100.0					17																	57758783		2203	4300	6503	SO:0001583	missense	0			X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.3193T>C	17.37:g.57758783T>C	ENSP00000269122:p.Phe1065Leu		D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,pfam_Clathrin_H-chain_propeller_rpt,pfam_Clathrin_H-chain_linker_core,superfamily_Clathrin_H-chain_propeller_N,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	p.F1065L	ENST00000269122.3	37	c.3193	CCDS32696.1	17	.	.	.	.	.	.	.	.	.	.	T	22.5	4.294377	0.81025	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.18960	2.18;2.18	5.44	5.44	0.79542	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.046454	0.85682	D	0.000000	T	0.32704	0.0838	M	0.78223	2.4	0.80722	D	1	B;B	0.14012	0.009;0.003	B;B	0.28991	0.097;0.026	T	0.12656	-1.0539	10	0.56958	D	0.05	.	15.7856	0.78300	0.0:0.0:0.0:1.0	.	1065;1065	Q00610;Q00610-2	CLH1_HUMAN;.	L	1065	ENSP00000269122:F1065L;ENSP00000376763:F1065L	ENSP00000269122:F1065L	F	+	1	0	CLTC	55113565	1.000000	0.71417	0.927000	0.36925	0.972000	0.66771	7.997000	0.88414	2.186000	0.69663	0.455000	0.32223	TTT	CLTC	-	pfam_Clathrin_H-chain/VPS_repeat,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	ENSG00000141367		0.393	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLTC	HGNC	protein_coding	OTTHUMT00000258859.1	-	0.00	39	0	T	NM_004859		57758783	+1	tier1	-	no_errors	ENST00000269122	ensembl	human	known	74_37	missense	49.02	26	25	SNP	0.999	C
COL11A1	1301	genome.wustl.edu	37	1	103352542	103352542	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:103352542C>A	ENST00000370096.3	-	63	4991	c.4679G>T	c.(4678-4680)gGc>gTc	p.G1560V	COL11A1_ENST00000512756.1_Missense_Mutation_p.G1444V|COL11A1_ENST00000353414.4_Missense_Mutation_p.G1521V|COL11A1_ENST00000358392.2_Missense_Mutation_p.G1572V	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1560	Nonhelical region (C-terminal).				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TGCTTGCATGCCTTCAGTATG	0.398																																																	0													184.0	169.0	174.0					1																	103352542		2203	4300	6503	SO:0001583	missense	0			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4679G>T	1.37:g.103352542C>A	ENSP00000359114:p.Gly1560Val		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.G1572V	ENST00000370096.3	37	c.4715	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	C	10.22	1.291071	0.23564	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74	5.53	2.66	0.31614	.	0.961406	0.08730	N	0.902175	T	0.58018	0.2093	L	0.46157	1.445	0.35741	D	0.818662	B;B;B;B;B	0.17038	0.012;0.02;0.02;0.012;0.02	B;B;B;B;B	0.21360	0.015;0.034;0.034;0.018;0.028	T	0.40194	-0.9576	10	0.15499	T	0.54	.	5.0317	0.14413	0.0:0.4693:0.142:0.3887	.	1444;1521;1572;1560;780	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	V	1560;1572;1521;780;1444	ENSP00000359114:G1560V;ENSP00000351163:G1572V;ENSP00000302551:G1521V;ENSP00000426533:G1444V	ENSP00000302551:G1521V	G	-	2	0	COL11A1	103125130	0.946000	0.32159	0.923000	0.36655	0.968000	0.65278	0.348000	0.20031	0.306000	0.22856	0.313000	0.20887	GGC	COL11A1	-	NULL	ENSG00000060718		0.398	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1	-	0.00	78	0	C	NM_080630		103352542	-1	tier1	-	no_errors	ENST00000358392	ensembl	human	known	74_37	missense	40.48	50	34	SNP	0.486	A
COL18A1	80781	genome.wustl.edu	37	21	46897715	46897715	+	Missense_Mutation	SNP	C	C	T	rs369114408		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr21:46897715C>T	ENST00000359759.4	+	7	2323	c.2302C>T	c.(2302-2304)Cgg>Tgg	p.R768W	COL18A1_ENST00000400337.2_Missense_Mutation_p.R353W|COL18A1_ENST00000355480.5_Missense_Mutation_p.R533W			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	768	Triple-helical region 1 (COL1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CCCACCTGGCCGGGCAGGCCC	0.697													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15205	0.0		0.0	False		,,,				2504	0.0																0								C	TRP/ARG,TRP/ARG	4,3526		0,4,1761	8.0	10.0	9.0		1597,1057	1.8	0.3	21		9	0,7850		0,0,3925	no	missense,missense	COL18A1	NM_030582.3,NM_130445.2	101,101	0,4,5686	TT,TC,CC		0.0,0.1133,0.0351	probably-damaging,probably-damaging	533/1520,353/1340	46897715	4,11376	1765	3925	5690	SO:0001583	missense	0				CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.2302C>T	21.37:g.46897715C>T	ENSP00000352798:p.Arg768Trp		A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	pfam_Collagenase_NC10/endostatin,pfam_DUF959_COL18_N,pfam_Collagen,pfam_Frizzled_dom,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl_sf,superfamily_Frizzled_dom,smart_Frizzled_dom,smart_Laminin_G,pfscan_Frizzled_dom	p.R768W	ENST00000359759.4	37	c.2302		21	.	.	.	.	.	.	.	.	.	.	C	12.98	2.101613	0.37048	0.001133	0.0	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645	T;T;T	0.61742	0.08;0.08;0.08	2.84	1.84	0.25277	.	1.967240	0.02808	N	0.123966	T	0.66446	0.2790	M	0.74881	2.28	0.22142	N	0.999336	D;D;D	0.57899	0.967;0.981;0.981	B;P;P	0.49853	0.42;0.624;0.624	T	0.45308	-0.9270	10	0.37606	T	0.19	.	7.8654	0.29535	0.0:0.8525:0.0:0.1475	.	768;533;353	P39060;P39060-1;P39060-2	COIA1_HUMAN;.;.	W	353;353;533;768;768	ENSP00000383191:R353W;ENSP00000347665:R533W;ENSP00000352798:R768W	ENSP00000347665:R533W	R	+	1	2	COL18A1	45722143	0.068000	0.21057	0.290000	0.24890	0.008000	0.06430	0.623000	0.24447	0.218000	0.20820	-0.378000	0.06908	CGG	COL18A1	-	NULL	ENSG00000182871		0.697	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	COL18A1	HGNC	protein_coding	OTTHUMT00000206827.1	-	0.00	101	0	C			46897715	+1	tier1	-	no_errors	ENST00000359759	ensembl	human	known	74_37	missense	45.83	52	44	SNP	0.969	T
COL6A2	1292	genome.wustl.edu	37	21	47545377	47545377	+	Splice_Site	SNP	A	A	C	rs111697581		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr21:47545377A>C	ENST00000300527.4	+	25	1920		c.e25-1		COL6A2_ENST00000397763.1_Splice_Site|COL6A2_ENST00000310645.5_Splice_Site|COL6A2_ENST00000409416.1_Splice_Site|COL6A2_ENST00000357838.4_Splice_Site	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCACCCCCCCAGACTGTGAGA	0.622																																																	0													53.0	51.0	52.0					21																	47545377		2203	4300	6503	SO:0001630	splice_region_variant	0			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.1817-1A>C	21.37:g.47545377A>C			Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Splice_Site	SNP	-	e24-2	ENST00000300527.4	37	c.1817-2	CCDS13728.1	21	.	.	.	.	.	.	.	.	.	.	A	15.02	2.709496	0.48517	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763	.	.	.	4.07	4.07	0.47477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0364	0.58875	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL6A2	46369805	1.000000	0.71417	0.995000	0.50966	0.464000	0.32679	8.761000	0.91691	1.485000	0.48380	0.247000	0.18012	.	COL6A2	-	-	ENSG00000142173		0.622	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A2	HGNC	protein_coding	OTTHUMT00000206971.1		0.00	57	0	A		Intron	47545377	+1			no_errors	ENST00000300527	ensembl	human	known	74_37	splice_site	5.33	71	4	SNP	1.000	C
COPB1	1315	genome.wustl.edu	37	11	14491093	14491093	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:14491093G>T	ENST00000249923.3	-	15	2054	c.1754C>A	c.(1753-1755)gCt>gAt	p.A585D	COPB1_ENST00000439561.2_Missense_Mutation_p.A585D	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	585					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						GAGCAACATAGCCTCAGCAAC	0.383																																																	0													71.0	68.0	69.0					11																	14491093		2200	4294	6494	SO:0001583	missense	0			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.1754C>A	11.37:g.14491093G>T	ENSP00000249923:p.Ala585Asp		D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	pfam_Coatomer_bsu_C,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_COPB1	p.A585D	ENST00000249923.3	37	c.1754	CCDS7815.1	11	.	.	.	.	.	.	.	.	.	.	G	21.6	4.168836	0.78339	.	.	ENSG00000129083	ENST00000249923;ENST00000439561	T;T	0.51325	0.71;0.71	5.91	5.91	0.95273	Armadillo-like helical (1);Armadillo-type fold (1);	0.092556	0.85682	D	0.000000	T	0.58104	0.2099	M	0.64630	1.985	0.80722	D	1	B	0.23377	0.084	B	0.37508	0.252	T	0.56908	-0.7901	10	0.87932	D	0	-0.7094	20.2983	0.98569	0.0:0.0:1.0:0.0	.	585	P53618	COPB_HUMAN	D	585	ENSP00000249923:A585D;ENSP00000397873:A585D	ENSP00000249923:A585D	A	-	2	0	COPB1	14447669	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.500000	0.97977	2.802000	0.96397	0.655000	0.94253	GCT	COPB1	-	superfamily_ARM-type_fold,pirsf_COPB1	ENSG00000129083		0.383	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPB1	HGNC	protein_coding	OTTHUMT00000386410.1	-	0.00	36	0	G	NM_016451		14491093	-1	tier1	-	no_errors	ENST00000249923	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
CTDP1	9150	genome.wustl.edu	37	18	77473021	77473021	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr18:77473021G>A	ENST00000299543.7	+	7	1060	c.913G>A	c.(913-915)Gaa>Aaa	p.E305K	CTDP1_ENST00000075430.7_Missense_Mutation_p.E305K	NM_001202504.1|NM_004715.4	NP_001189433.1|NP_004706.3	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1	305	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.			E -> K (in Ref. 1; AAD42088). {ECO:0000305}.	exit from mitosis (GO:0010458)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein dephosphorylation (GO:0006470)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	CTD phosphatase activity (GO:0008420)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(2)|urinary_tract(1)	35		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		TGATGATCGAGAAGATGTCTG	0.393																																																	0													100.0	98.0	98.0					18																	77473021		2203	4300	6503	SO:0001583	missense	0			AF081287	CCDS12017.1, CCDS12018.1, CCDS74239.1	18q23	2014-09-17			ENSG00000060069	ENSG00000060069		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	2498	protein-coding gene	gene with protein product		604927				9405607, 9765293	Standard	NM_004715		Approved	FCP1	uc002lnh.2	Q9Y5B0	OTTHUMG00000132920	ENST00000299543.7:c.913G>A	18.37:g.77473021G>A	ENSP00000299543:p.Glu305Lys		A8MY97|Q7Z644|Q96BZ1|Q9Y6F5	Missense_Mutation	SNP	pfam_FCP1_C,pfam_NIF,superfamily_HAD-like_dom,superfamily_BRCT_dom,superfamily_Single_hybrid_motif,smart_NIF,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_NIF,tigrfam_FCP1_euk	p.E305K	ENST00000299543.7	37	c.913	CCDS12017.1	18	.	.	.	.	.	.	.	.	.	.	G	25.8	4.673904	0.88445	.	.	ENSG00000060069	ENST00000299543;ENST00000075430	T;T	0.16597	2.33;2.33	5.06	5.06	0.68205	NLI interacting factor (3);FCP1-like phosphatase, phosphatase domain (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.43188	0.1236	M	0.70595	2.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.20672	-1.0268	10	0.41790	T	0.15	-29.6338	18.7855	0.91952	0.0:0.0:1.0:0.0	.	186;305;305	Q9Y5B0-3;Q9Y5B0-4;Q9Y5B0	.;.;CTDP1_HUMAN	K	305	ENSP00000299543:E305K;ENSP00000075430:E305K	ENSP00000075430:E305K	E	+	1	0	CTDP1	75574009	1.000000	0.71417	0.934000	0.37439	0.490000	0.33462	8.822000	0.92013	2.480000	0.83734	0.655000	0.94253	GAA	CTDP1	-	pfam_NIF,superfamily_HAD-like_dom,smart_NIF,pfscan_NIF,tigrfam_FCP1_euk	ENSG00000060069		0.393	CTDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDP1	HGNC	protein_coding	OTTHUMT00000256432.1	-	0.00	40	0	G	NM_004715		77473021	+1	tier1	-	no_errors	ENST00000299543	ensembl	human	known	74_37	missense	42.59	31	23	SNP	1.000	A
CYP2B6	1555	genome.wustl.edu	37	19	41510046	41510046	+	Silent	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:41510046C>T	ENST00000324071.4	+	2	319	c.312C>T	c.(310-312)gtC>gtT	p.V104V	CYP2B6_ENST00000593831.1_Silent_p.V28V|CYP2B6_ENST00000598834.1_3'UTR|CYP2B6_ENST00000330446.5_Silent_p.V64V	NM_000767.4	NP_000758.1	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B, polypeptide 6	104					cellular ketone metabolic process (GO:0042180)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			NS(1)|breast(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(20;0.00322)		Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Antipyrine(DB01435)|Artemether(DB06697)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzphetamine(DB00865)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Brompheniramine(DB00835)|Bupropion(DB01156)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Citalopram(DB00215)|Clobazam(DB00349)|Clofibrate(DB00636)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Doxorubicin(DB00997)|Efavirenz(DB00625)|Enzalutamide(DB08899)|Epinastine(DB00751)|Erythromycin(DB00199)|Estrone(DB00655)|Ethanol(DB00898)|Ethylmorphine(DB01466)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Fosphenytoin(DB01320)|Halothane(DB01159)|Ifosfamide(DB01181)|Imipramine(DB00458)|Irinotecan(DB00762)|Isoflurane(DB00753)|Itraconazole(DB01167)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lidocaine(DB00281)|Loperamide(DB00836)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Malathion(DB00772)|Memantine(DB01043)|Methadone(DB00333)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyltestosterone(DB06710)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midazolam(DB00683)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nitric Oxide(DB00435)|Orphenadrine(DB01173)|Ospemifene(DB04938)|Paroxetine(DB00715)|Perhexiline(DB01074)|Permethrin(DB04930)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Prasugrel(DB06209)|Primidone(DB00794)|Promethazine(DB01069)|Propofol(DB00818)|Quinidine(DB00908)|Raloxifene(DB00481)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Ropivacaine(DB00296)|Roxithromycin(DB00778)|Selegiline(DB01037)|Sertraline(DB01104)|Sevoflurane(DB01236)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Temazepam(DB00231)|Testosterone(DB00624)|Thiotepa(DB04572)|Ticlopidine(DB00208)|Tramadol(DB00193)|Tretinoin(DB00755)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)	TCGCCATGGTCGACCCATTCT	0.617																																																	0													68.0	70.0	69.0					19																	41510046		2203	4300	6503	SO:0001819	synonymous_variant	0			AF182277	CCDS12570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000197408	ENSG00000197408		"""Cytochrome P450s"""	2615	protein-coding gene	gene with protein product		123930	"""cytochrome P450, subfamily IIB (phenobarbital-inducible), polypeptide 6"", ""cytochrome P450, family 2, subfamily B"", ""cytochrome P450, subfamily IIB (phenobarbital-inducible)"""	CYP2B		7668294, 15128046	Standard	NM_000767		Approved	CPB6, CYPIIB6	uc002opr.1	P20813	OTTHUMG00000182714	ENST00000324071.4:c.312C>T	19.37:g.41510046C>T			B4DWP3|Q2V565|Q9UK46	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2B-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I_CYP2A-like	p.V104	ENST00000324071.4	37	c.312	CCDS12570.1	19																																																																																			CYP2B6	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000197408		0.617	CYP2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2B6	HGNC	protein_coding	OTTHUMT00000463260.1	-	0.00	69	0	C	NM_000767		41510046	+1	tier1	-	no_errors	ENST00000324071	ensembl	human	known	74_37	silent	45.83	52	44	SNP	0.000	T
ACKR1	2532	genome.wustl.edu	37	1	159176230	159176231	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:159176230_159176231GC>AA	ENST00000368122.2	+	2	1680_1681	c.1001_1002GC>AA	c.(1000-1002)aGC>aAA	p.S334K	DARC_ENST00000368121.2_Missense_Mutation_p.S336K|DARC_ENST00000537147.1_Missense_Mutation_p.S334K|CTA-134P22.2_ENST00000609696.1_RNA	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		334					chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					ACCCTTGGAAGCAAATCCTAGT	0.535																																																	0																																										SO:0001583	missense	0																														Exception_encountered	1.37:g.159176230_159176231delinsAA	ENSP00000357104:p.Ser334Lys		A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Missense_Mutation	SNP	prints_Duffy_chemokine_rcpt	p.S336N|p.S336R	ENST00000368122.2	37	c.1007|c.1008	CCDS1183.1	1																																																																																			DARC	-	NULL	ENSG00000213088		0.535	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DARC	HGNC	protein_coding	OTTHUMT00000090338.2	-	0.00	46	0	G|C			159176230|159176231	+1	tier1	-	no_errors	ENST00000368121	ensembl	human	known	74_37	missense	25.00|25.64	60|58	20	SNP	0.130|0.305	A
DCHS1	8642	genome.wustl.edu	37	11	6648069	6648069	+	Silent	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:6648069G>T	ENST00000299441.3	-	14	6612	c.6201C>A	c.(6199-6201)cgC>cgA	p.R2067R		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2067	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCCGGGGAAAGCGGGGTCCAC	0.597																																																	0													27.0	28.0	28.0					11																	6648069		2201	4296	6497	SO:0001819	synonymous_variant	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.6201C>A	11.37:g.6648069G>T			O15098	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R2067	ENST00000299441.3	37	c.6201	CCDS7771.1	11																																																																																			DCHS1	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000166341		0.597	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1		0.00	71	0	G	NM_003737		6648069	-1			no_errors	ENST00000299441	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.997	T
DDX5	1655	genome.wustl.edu	37	17	62499111	62499111	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:62499111C>A	ENST00000225792.5	-	8	1317	c.916G>T	c.(916-918)Gaa>Taa	p.E306*	DDX5_ENST00000580026.1_5'Flank|DDX5_ENST00000578804.1_Nonsense_Mutation_p.E306*|DDX5_ENST00000450599.2_Nonsense_Mutation_p.E227*|MIR5047_ENST00000579212.1_RNA|MIR3064_ENST00000581130.1_RNA	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	306					cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			GCACTCAGTTCAAGTGCACCA	0.373			T	ETV4	prostate																																NSCLC(22;406 813 4871 19580 40307)			Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	0													129.0	124.0	126.0					17																	62499111		2203	4300	6503	SO:0001587	stop_gained	0			AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.916G>T	17.37:g.62499111C>A	ENSP00000225792:p.Glu306*		B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Nonsense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_P68HR,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.E306*	ENST00000225792.5	37	c.916	CCDS11659.1	17	.	.	.	.	.	.	.	.	.	.	C	37	6.247972	0.97412	.	.	ENSG00000108654	ENST00000540698;ENST00000450599;ENST00000225792	.	.	.	5.91	5.91	0.95273	.	0.094013	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-17.268	20.2985	0.98592	0.0:1.0:0.0:0.0	.	.	.	.	X	306;236;295	.	ENSP00000225792:E295X	E	-	1	0	DDX5	59929573	1.000000	0.71417	0.974000	0.42286	0.927000	0.56198	4.845000	0.62853	2.793000	0.96121	0.655000	0.94253	GAA	DDX5	-	superfamily_P-loop_NTPase,smart_Helicase_ATP-bd	ENSG00000108654		0.373	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX5	HGNC	protein_coding	OTTHUMT00000444030.1	-	0.00	40	0	C	NM_004396		62499111	-1	tier1	-	no_errors	ENST00000225792	ensembl	human	known	74_37	nonsense	51.95	36	40	SNP	1.000	A
DNAH1	25981	genome.wustl.edu	37	3	52378535	52378535	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr3:52378535G>T	ENST00000420323.2	+	9	1577	c.1316G>T	c.(1315-1317)aGa>aTa	p.R439I		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	439	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AGTCTTGCCAGAGAAGTGAGC	0.577																																																	0													108.0	112.0	111.0					3																	52378535		2073	4203	6276	SO:0001583	missense	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.1316G>T	3.37:g.52378535G>T	ENSP00000401514:p.Arg439Ile		B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase	p.R439I	ENST00000420323.2	37	c.1316	CCDS46842.1	3	.	.	.	.	.	.	.	.	.	.	G	11.96	1.793407	0.31685	.	.	ENSG00000114841	ENST00000420323	T	0.23552	1.9	5.04	-2.56	0.06268	.	0.664327	0.13652	N	0.372181	T	0.12220	0.0297	N	0.12182	0.205	0.18873	N	0.999986	B;B	0.12013	0.001;0.005	B;B	0.19666	0.003;0.026	T	0.22591	-1.0212	10	0.45353	T	0.12	.	7.6811	0.28513	0.7082:0.0:0.1556:0.1362	.	439;439	C9JXH6;Q9P2D7-3	.;.	I	439	ENSP00000401514:R439I	ENSP00000401514:R439I	R	+	2	0	DNAH1	52353575	0.695000	0.27747	0.115000	0.21578	0.994000	0.84299	0.576000	0.23744	-0.366000	0.08064	-0.150000	0.13652	AGA	DNAH1	-	NULL	ENSG00000114841		0.577	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	-	0.00	63	0	G	NM_015512		52378535	+1	tier1	-	no_errors	ENST00000420323	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.012	T
DNAH10	196385	genome.wustl.edu	37	12	124419180	124419180	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:124419180C>A	ENST00000409039.3	+	77	13161	c.13136C>A	c.(13135-13137)tCa>tAa	p.S4379*	CCDC92_ENST00000544798.1_Intron|DNAH10OS_ENST00000514254.2_5'UTR|RP11-380L11.3_ENST00000602292.1_RNA	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4379					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TGCTTTGTCTCAGGACTGTAC	0.527																																																	0													72.0	75.0	74.0					12																	124419180		2087	4224	6311	SO:0001587	stop_gained	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.13136C>A	12.37:g.124419180C>A	ENSP00000386770:p.Ser4379*		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.S4379*	ENST00000409039.3	37	c.13136	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	C	54	22.744072	0.99950	.	.	ENSG00000197653	ENST00000409039	.	.	.	4.97	4.97	0.65823	.	0.228678	0.37857	N	0.001903	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	18.1808	0.89777	0.0:1.0:0.0:0.0	.	.	.	.	X	4379	.	ENSP00000386770:S4379X	S	+	2	0	DNAH10	122985133	1.000000	0.71417	0.982000	0.44146	0.622000	0.37654	7.752000	0.85141	2.448000	0.82819	0.561000	0.74099	TCA	DNAH10	-	pfam_Dynein_heavy_dom	ENSG00000197653		0.527	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	-	0.00	47	0	C			124419180	+1	tier1	-	no_errors	ENST00000409039	ensembl	human	known	74_37	nonsense	6.78	55	4	SNP	1.000	A
DNMT1	1786	genome.wustl.edu	37	19	10254519	10254519	+	Silent	SNP	T	T	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:10254519T>C	ENST00000340748.4	-	28	3226	c.2991A>G	c.(2989-2991)aaA>aaG	p.K997K	DNMT1_ENST00000540357.1_Silent_p.K997K|DNMT1_ENST00000359526.4_Silent_p.K1013K|DNMT1_ENST00000589538.1_5'UTR			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	997	BAH 2. {ECO:0000255|PROSITE- ProRule:PRU00370}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	AGAAGATCTCTTTGATCCGGC	0.527																																																	0													256.0	245.0	249.0					19																	10254519		2203	4300	6503	SO:0001819	synonymous_variant	0			X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.2991A>G	19.37:g.10254519T>C			A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Silent	SNP	pirsf_DNA_C5-MeTrfase_1_euk,pfam_C5_MeTfrase,pfam_BAH_dom,pfam_Cytosine_MeTrfase1_RFD,pfam_DMAP1-bd,pfam_Znf_CXXC,smart_BAH_dom,prints_C5_MeTfrase,pfscan_BAH_dom,pfscan_Znf_CXXC	p.K1013	ENST00000340748.4	37	c.3039	CCDS12228.1	19																																																																																			DNMT1	-	pirsf_DNA_C5-MeTrfase_1_euk,pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	ENSG00000130816		0.527	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	DNMT1	HGNC	protein_coding	OTTHUMT00000451166.1	-	0.00	29	0	T	NM_001379		10254519	-1	tier1	-	no_errors	ENST00000359526	ensembl	human	known	74_37	silent	44.44	40	32	SNP	0.914	C
DUOX2	50506	genome.wustl.edu	37	15	45399110	45399110	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr15:45399110G>A	ENST00000603300.1	-	15	1953	c.1751C>T	c.(1750-1752)cCc>cTc	p.P584L	DUOX2_ENST00000389039.6_Missense_Mutation_p.P584L	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	584	Peroxidase-like; mediates peroxidase activity. {ECO:0000250}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		CACAGTCAGGGGTGCACACTG	0.582																																																	0													61.0	54.0	56.0					15																	45399110		2195	4295	6490	SO:0001583	missense	0			AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.1751C>T	15.37:g.45399110G>A	ENSP00000475084:p.Pro584Leu		A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF_hand_dom,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr,prints_Recoverin	p.P584L	ENST00000603300.1	37	c.1751	CCDS10117.1	15	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121368	0.37436	.	.	ENSG00000140279	ENST00000389039	.	.	.	4.99	4.05	0.47172	.	0.273076	0.41938	D	0.000783	T	0.57681	0.2070	M	0.71581	2.175	0.58432	D	0.999992	B;P	0.37548	0.311;0.599	B;B	0.38156	0.197;0.266	T	0.57590	-0.7785	9	0.33141	T	0.24	-6.2045	14.2831	0.66226	0.0:0.1498:0.8502:0.0	.	584;146	Q9NRD8;Q59GU9	DUOX2_HUMAN;.	L	584	.	ENSP00000373691:P584L	P	-	2	0	DUOX2	43186402	0.382000	0.25148	0.086000	0.20670	0.004000	0.04260	2.328000	0.43867	1.049000	0.40321	0.462000	0.41574	CCC	DUOX2	-	superfamily_Haem_peroxidase	ENSG00000140279		0.582	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DUOX2	HGNC	protein_coding		-	0.00	34	0	G	NM_014080		45399110	-1	tier1	-	no_errors	ENST00000389039	ensembl	human	known	74_37	missense	42.37	34	25	SNP	0.817	A
E2F8	79733	genome.wustl.edu	37	11	19259573	19259573	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:19259573G>T	ENST00000527884.1	-	3	354	c.122C>A	c.(121-123)cCt>cAt	p.P41H	E2F8_ENST00000250024.4_Missense_Mutation_p.P41H|RP11-428C19.4_ENST00000527978.1_RNA	NM_001256371.1|NM_001256372.1	NP_001243300.1|NP_001243301.1	A0AVK6	E2F8_HUMAN	E2F transcription factor 8	41					cell cycle comprising mitosis without cytokinesis (GO:0033301)|chorionic trophoblast cell differentiation (GO:0060718)|hepatocyte differentiation (GO:0070365)|negative regulation of cytokinesis (GO:0032466)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TGTGGTTAAAGGGCCAAAGTC	0.507																																																	0													130.0	130.0	130.0					11																	19259573		2199	4293	6492	SO:0001583	missense	0				CCDS7849.1	11p15	2008-02-05			ENSG00000129173	ENSG00000129173			24727	protein-coding gene	gene with protein product		612047				15722552	Standard	NM_024680		Approved	FLJ23311	uc001mpo.2	A0AVK6	OTTHUMG00000166102	ENST00000527884.1:c.122C>A	11.37:g.19259573G>T	ENSP00000434199:p.Pro41His		A8K9H3|Q2VPJ3|Q3C1U6|Q5BKY4|Q8N340|Q9H5M0	Missense_Mutation	SNP	pfam_E2F_TDP	p.P41H	ENST00000527884.1	37	c.122	CCDS7849.1	11	.	.	.	.	.	.	.	.	.	.	G	20.4	3.987610	0.74589	.	.	ENSG00000129173	ENST00000527884;ENST00000531809;ENST00000396159;ENST00000250024;ENST00000532666	T;T;T	0.47869	2.01;2.01;0.83	5.37	5.37	0.77165	.	0.180862	0.48767	D	0.000168	T	0.52468	0.1736	M	0.66939	2.045	0.47905	D	0.999547	P	0.49696	0.927	P	0.45946	0.498	T	0.58674	-0.7595	10	0.72032	D	0.01	-7.3435	13.9793	0.64295	0.0:0.0:0.8483:0.1517	.	41	A0AVK6	E2F8_HUMAN	H	41	ENSP00000434199:P41H;ENSP00000250024:P41H;ENSP00000437326:P41H	ENSP00000250024:P41H	P	-	2	0	E2F8	19216149	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	5.111000	0.64628	2.654000	0.90174	0.655000	0.94253	CCT	E2F8	-	NULL	ENSG00000129173		0.507	E2F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F8	HGNC	protein_coding	OTTHUMT00000387830.1	-	0.00	70	0	G	NM_024680		19259573	-1	tier1	-	no_errors	ENST00000250024	ensembl	human	known	74_37	missense	6.17	75	5	SNP	1.000	T
EFEMP1	2202	genome.wustl.edu	37	2	56097965	56097965	+	Missense_Mutation	SNP	T	T	A	rs567386311		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr2:56097965T>A	ENST00000394555.2	-	10	1645	c.1210A>T	c.(1210-1212)Agg>Tgg	p.R404W	EFEMP1_ENST00000355426.3_Missense_Mutation_p.R404W|EFEMP1_ENST00000424836.2_Missense_Mutation_p.R266W|EFEMP1_ENST00000394554.1_Missense_Mutation_p.R404W	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	404	Mediates interaction with TIMP3.				epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)			NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GGCACAGACCTATCAGATCGG	0.438																																					GBM(92;934 1319 7714 28760 40110)												0													110.0	106.0	107.0					2																	56097965		2203	4300	6503	SO:0001583	missense	0			U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.1210A>T	2.37:g.56097965T>A	ENSP00000378058:p.Arg404Trp		A8K3I4|B4DW75|D6W5D2|Q541U7	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	p.R404W	ENST00000394555.2	37	c.1210	CCDS1857.1	2	.	.	.	.	.	.	.	.	.	.	T	19.11	3.763599	0.69878	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000405693;ENST00000424836;ENST00000355426	D;D;T;D	0.84660	-1.88;-1.88;-1.36;-1.88	5.65	3.18	0.36537	.	0.000000	0.64402	D	0.000001	D	0.90625	0.7060	M	0.70595	2.14	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	D	0.89048	0.3453	10	0.44086	T	0.13	.	12.9478	0.58382	0.0:0.0:0.2546:0.7454	.	266;404	B4DW75;Q12805	.;FBLN3_HUMAN	W	404;404;260;266;404	ENSP00000378058:R404W;ENSP00000378057:R404W;ENSP00000399145:R266W;ENSP00000347596:R404W	ENSP00000347596:R404W	R	-	1	2	EFEMP1	55951469	0.991000	0.36638	0.825000	0.32803	0.911000	0.54048	1.946000	0.40283	0.458000	0.26988	-0.316000	0.08728	AGG	EFEMP1	-	NULL	ENSG00000115380		0.438	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFEMP1	HGNC	protein_coding	OTTHUMT00000251491.2	-	0.00	40	0	T			56097965	-1	tier1	-	no_errors	ENST00000355426	ensembl	human	known	74_37	missense	30.43	32	14	SNP	0.957	A
ELP4	26610	genome.wustl.edu	37	11	31616430	31616430	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:31616430G>T	ENST00000350638.5	+	4	530	c.495G>T	c.(493-495)caG>caT	p.Q165H	ELP4_ENST00000395934.2_Missense_Mutation_p.Q165H|ELP4_ENST00000379163.5_Missense_Mutation_p.Q165H	NM_019040.3	NP_061913.3	Q96EB1	ELP4_HUMAN	elongator acetyltransferase complex subunit 4	165					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)	20	Lung SC(675;0.225)					GGCGTTACCAGTTATTACCCA	0.303																																																	0													61.0	57.0	58.0					11																	31616430		1811	4060	5871	SO:0001583	missense	0			AJ276005	CCDS7875.2, CCDS73271.1, CCDS73272.1	11p13	2012-08-14	2012-08-08	2002-05-24	ENSG00000109911	ENSG00000109911		"""Elongator acetyltransferase complex subunits"""	1171	protein-coding gene	gene with protein product		606985	"""chromosome 11 open reading frame 19"", ""elongation protein 4 homolog (S. cerevisiae)"""	C11orf19		11889558, 11435442	Standard	XM_005252865		Approved	PAXNEB	uc001mtb.3	Q96EB1	OTTHUMG00000142919	ENST00000350638.5:c.495G>T	11.37:g.31616430G>T	ENSP00000298937:p.Gln165His		B4E3W0|E7EPZ6|Q9H4E8|Q9NX11	Missense_Mutation	SNP	pfam_Elongator_complex_protein_4,superfamily_P-loop_NTPase	p.Q165H	ENST00000350638.5	37	c.495	CCDS7875.2	11	.	.	.	.	.	.	.	.	.	.	G	17.07	3.295848	0.60086	.	.	ENSG00000109911	ENST00000350638;ENST00000379163;ENST00000395934	T;T;T	0.45668	0.89;0.89;0.89	5.12	2.83	0.33086	.	0.056868	0.64402	D	0.000001	T	0.65333	0.2681	M	0.88181	2.935	0.47123	D	0.999325	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.85130	0.997;0.991;0.995	T	0.68823	-0.5307	10	0.59425	D	0.04	-6.4092	9.0326	0.36269	0.2704:0.0:0.7296:0.0	.	165;165;165	B4E3W0;G5E9D4;Q96EB1	.;.;ELP4_HUMAN	H	165	ENSP00000298937:Q165H;ENSP00000368461:Q165H;ENSP00000379267:Q165H	ENSP00000298937:Q165H	Q	+	3	2	ELP4	31573006	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	2.807000	0.47955	1.285000	0.44548	0.460000	0.39030	CAG	ELP4	-	pfam_Elongator_complex_protein_4	ENSG00000109911		0.303	ELP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELP4	HGNC	protein_coding	OTTHUMT00000286640.1	-	0.00	41	0	G	NM_019040		31616430	+1	tier1	-	no_errors	ENST00000395934	ensembl	human	known	74_37	missense	41.38	34	24	SNP	0.997	T
ENPP3	5169	genome.wustl.edu	37	6	132059220	132059220	+	Silent	SNP	A	A	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr6:132059220A>G	ENST00000414305.1	+	24	2545	c.2217A>G	c.(2215-2217)gaA>gaG	p.E739E	ENPP3_ENST00000358229.5_3'UTR|ENPP3_ENST00000357639.3_Silent_p.E739E			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	739	Nuclease.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		ATGCCACAGAAAGAAATGGAG	0.313																																																	0													114.0	124.0	121.0					6																	132059220		2202	4298	6500	SO:0001819	synonymous_variant	0			AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.2217A>G	6.37:g.132059220A>G			Q5JTL3	Silent	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom	p.E739	ENST00000414305.1	37	c.2217	CCDS5148.1	6																																																																																			ENPP3	-	pfam_DNA/RNA_non-sp_Endonuclease,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A	ENSG00000154269		0.313	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP3	HGNC	protein_coding	OTTHUMT00000043627.2	-	0.00	90	0	A			132059220	+1	tier1	-	no_errors	ENST00000357639	ensembl	human	known	74_37	silent	36.72	81	47	SNP	0.997	G
RIMS2	9699	genome.wustl.edu	37	8	104863873	104863876	+	Intron	DEL	ACAC	ACAC	-	rs56306101|rs10529078|rs369439768|rs59712615	byFrequency	TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	ACAC	ACAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr8:104863873_104863876delACAC	ENST00000507740.1	+	1	358				RIMS2_ENST00000406091.3_Intron|RIMS2_ENST00000522174.1_Intron|AP001572.1_ENST00000401294.1_RNA|RIMS2_ENST00000262231.10_Intron	NM_014677.4	NP_055492.3	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AATGCTATGTacacacacacacac	0.363										HNSCC(12;0.0054)																																							0																																										SO:0001627	intron_variant	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000507740.1:c.122+32016ACAC>-	8.37:g.104863881_104863884delACAC			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	RNA	DEL	-	NULL	ENST00000507740.1	37	NULL	CCDS43761.1	8																																																																																			AP001572.1	-	-	ENSG00000216113		0.363	RIMS2-005	NOVEL	basic|CCDS	protein_coding	ENSG00000216113	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000367215.1		0.00	17	0	ACAC	NM_001100117		104863876	+1	tier1		no_errors	ENST00000401294	ensembl	human	novel	74_37	rna	10.00	18	2	DEL	0.000:0.000:0.000:0.000	-
SGMS1-AS1	104355295	genome.wustl.edu	37	10	52390924	52390924	+	RNA	SNP	A	A	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr10:52390924A>T	ENST00000443374.2	+	0	2113				RP11-50E11.3_ENST00000609579.1_RNA																							TAGACGTTGAACTCGGAGGCC	0.582																																																	0																																												0																															10.37:g.52390924A>T				RNA	SNP	-	NULL	ENST00000443374.2	37	NULL		10																																																																																			RP11-50E11.3	-	-	ENSG00000226200		0.582	RP11-50E11.3-001	KNOWN	basic	antisense	ENSG00000226200	Clone_based_vega_gene	antisense	OTTHUMT00000048071.2	-	0.00	86	0	A			52390924	+1	tier1	-	no_errors	ENST00000443374	ensembl	human	known	74_37	rna	55.56	92	115	SNP	1.000	T
CBLL1	79872	genome.wustl.edu	37	7	107384387	107384387	+	5'UTR	DEL	G	G	-			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr7:107384387delG	ENST00000440859.3	+	0	246				CBLL1_ENST00000222597.2_5'Flank|AC002467.7_ENST00000457510.2_RNA|AC002467.7_ENST00000609979.1_RNA|CBLL1_ENST00000415884.2_5'Flank|AC002467.7_ENST00000440971.2_RNA	NM_001284291.1|NM_024814.2	NP_001271220.1|NP_079090.2	Q75N03	HAKAI_HUMAN	Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase						negative regulation of cell adhesion (GO:0007162)|positive regulation of cell migration (GO:0030335)|positive regulation of endocytosis (GO:0045807)|protein ubiquitination (GO:0016567)|single organismal cell-cell adhesion (GO:0016337)	ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(3)	21						CCTCAATACCGAAGTTCTTCG	0.547																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK026762	CCDS5747.1, CCDS64754.1	7q22.3	2013-07-09	2013-07-09		ENSG00000105879	ENSG00000105879		"""RING-type (C3HC4) zinc fingers"""	21225	protein-coding gene	gene with protein product	"""Casitas B-lineage lymphoma-like"""	606872	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1"""			11836526, 11944035	Standard	NM_001284291		Approved	HAKAI, FLJ23109, RNF188	uc003veq.3	Q75N03	OTTHUMG00000154809	ENST00000440859.3:c.-222G>-	7.37:g.107384387delG			B7ZM03|Q8TAJ4|Q9H5S6	RNA	DEL	-	NULL	ENST00000440859.3	37	NULL	CCDS5747.1	7																																																																																			AC002467.7	-	-	ENSG00000241764		0.547	CBLL1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000241764	Clone_based_vega_gene	protein_coding	OTTHUMT00000337156.2		0.00	18	0	G	NM_024814		107384387	-1	tier1		no_errors	ENST00000609979	ensembl	human	known	74_37	rna	16.67	10	2	DEL	0.000	-
CTD-3187F8.11	0	genome.wustl.edu	37	19	51782531	51782531	+	lincRNA	SNP	T	T	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:51782531T>C	ENST00000594261.1	+	0	491																											CTGGGGCTGATGGCACTGCCA	0.562																																																	0																																												0																															19.37:g.51782531T>C				RNA	SNP	-	NULL	ENST00000594261.1	37	NULL		19																																																																																			CTD-3187F8.11	-	-	ENSG00000268318		0.562	CTD-3187F8.11-003	KNOWN	basic	lincRNA	ENSG00000268318	Clone_based_vega_gene	lincRNA	OTTHUMT00000465199.1	-	0.00	20	0	T			51782531	+1	tier1	-	no_errors	ENST00000594261	ensembl	human	known	74_37	rna	32.35	23	11	SNP	0.000	C
EYA4	2070	genome.wustl.edu	37	6	133849873	133849873	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr6:133849873C>T	ENST00000367895.5	+	20	2314	c.1850C>T	c.(1849-1851)cCc>cTc	p.P617L	RP3-323P13.2_ENST00000607033.1_RNA|EYA4_ENST00000431403.2_Missense_Mutation_p.P617L|EYA4_ENST00000531901.1_Missense_Mutation_p.P623L|EYA4_ENST00000430974.2_Intron|EYA4_ENST00000452339.2_Missense_Mutation_p.P563L|EYA4_ENST00000355167.3_Missense_Mutation_p.P617L|EYA4_ENST00000355286.6_Missense_Mutation_p.P594L|EYA4_ENST00000525849.1_Missense_Mutation_p.P594L	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	617					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)	p.P617H(2)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		CACAACATGCCCTTCTGGAGG	0.483																																					Melanoma(57;398 1237 3528 4702 7415)												2	Substitution - Missense(2)	lung(2)											303.0	281.0	289.0					6																	133849873		2203	4300	6503	SO:0001583	missense	0			Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.1850C>T	6.37:g.133849873C>T	ENSP00000356870:p.Pro617Leu		B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_EYA	p.P617L	ENST00000367895.5	37	c.1850	CCDS5165.1	6	.	.	.	.	.	.	.	.	.	.	C	23.6	4.436045	0.83885	.	.	ENSG00000112319	ENST00000452339;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	D;D;D;D;D;D;D	0.95482	-3.72;-3.72;-3.72;-3.72;-3.72;-3.72;-3.72	6.07	6.07	0.98685	EYA (1);	0.000000	0.85682	D	0.000000	D	0.98131	0.9383	M	0.86953	2.85	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.998	D	0.98168	1.0450	10	0.87932	D	0	-15.0494	20.6593	0.99626	0.0:1.0:0.0:0.0	.	623;563;594;617;617	F2Z2Y1;E7EN58;O95677-2;O95677-4;O95677	.;.;.;.;EYA4_HUMAN	L	563;617;617;594;623;594;617	ENSP00000395916:P563L;ENSP00000356870:P617L;ENSP00000347294:P617L;ENSP00000347434:P594L;ENSP00000432770:P623L;ENSP00000433219:P594L;ENSP00000404558:P617L	ENSP00000347294:P617L	P	+	2	0	EYA4	133891566	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.885000	0.99019	0.655000	0.94253	CCC	EYA4	-	superfamily_HAD-like_dom,tigrfam_EYA	ENSG00000112319		0.483	EYA4-001	KNOWN	basic|CCDS	protein_coding	EYA4	HGNC	protein_coding	OTTHUMT00000042282.2		0.00	24	0	C	NM_004100		133849873	+1			no_errors	ENST00000355167	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
FAM111A	63901	genome.wustl.edu	37	11	58920030	58920030	+	Missense_Mutation	SNP	G	G	T	rs369758756		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:58920030G>T	ENST00000528737.1	+	5	3707	c.889G>T	c.(889-891)Gtg>Ttg	p.V297L	FAM111A_ENST00000420244.1_Missense_Mutation_p.V297L|FAM111A_ENST00000533703.1_Missense_Mutation_p.V297L|FAM111A_ENST00000361723.3_Missense_Mutation_p.V297L|FAM111A_ENST00000531147.1_Missense_Mutation_p.V297L			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	297					defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				AGAACAAATCGTGGCTCAGTA	0.378																																																	0													38.0	42.0	41.0					11																	58920030		2201	4294	6495	SO:0001583	missense	0			AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.889G>T	11.37:g.58920030G>T	ENSP00000434435:p.Val297Leu		A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom	p.V297L	ENST00000528737.1	37	c.889	CCDS7973.1	11	.	.	.	.	.	.	.	.	.	.	G	12.47	1.948609	0.34377	.	.	ENSG00000166801	ENST00000528737;ENST00000420244;ENST00000361723;ENST00000533703;ENST00000531147	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97	5.65	-4.38	0.03622	.	1.097440	0.06870	N	0.800630	T	0.28234	0.0697	L	0.45581	1.43	0.09310	N	1	B	0.29552	0.248	B	0.30943	0.122	T	0.30149	-0.9988	10	0.30854	T	0.27	-6.5639	1.2375	0.01956	0.4316:0.1066:0.1908:0.271	.	297	Q96PZ2	F111A_HUMAN	L	297	ENSP00000434435:V297L;ENSP00000406683:V297L;ENSP00000355264:V297L;ENSP00000433154:V297L;ENSP00000431631:V297L	ENSP00000355264:V297L	V	+	1	0	FAM111A	58676606	0.001000	0.12720	0.000000	0.03702	0.007000	0.05969	-0.028000	0.12350	-0.455000	0.07054	0.650000	0.86243	GTG	FAM111A	-	NULL	ENSG00000166801		0.378	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM111A	HGNC	protein_coding	OTTHUMT00000393975.1	-	0.00	61	0	G	NM_022074		58920030	+1	tier1	-	no_errors	ENST00000361723	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.000	T
FAM170A	340069	genome.wustl.edu	37	5	118970255	118970255	+	Missense_Mutation	SNP	T	T	C	rs528739250		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr5:118970255T>C	ENST00000515256.1	+	3	984	c.812T>C	c.(811-813)aTg>aCg	p.M271T				A1A519	F170A_HUMAN	family with sequence similarity 170, member A	271					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	24						ACAGGCAACATGGAATCAGAG	0.542																																																	0													116.0	124.0	121.0					5																	118970255		2059	4218	6277	SO:0001583	missense	0			AF427126	CCDS43353.1, CCDS54889.1	5q23.1	2008-06-12			ENSG00000164334	ENSG00000164334			27963	protein-coding gene	gene with protein product						12477932	Standard	NM_182761		Approved		uc003ksn.3	A1A519	OTTHUMG00000162946	ENST00000515256.1:c.812T>C	5.37:g.118970255T>C	ENSP00000422684:p.Met271Thr		Q66LM8|Q7Z4V2|Q8IW94	Missense_Mutation	SNP	NULL	p.M271T	ENST00000515256.1	37	c.812		5	.	.	.	.	.	.	.	.	.	.	T	4.598	0.111134	0.08831	.	.	ENSG00000164334	ENST00000515256	T	0.29917	1.55	4.59	0.753	0.18404	.	1.045340	0.07539	N	0.913546	T	0.16642	0.0400	N	0.22421	0.69	0.09310	N	1	B;B	0.18863	0.031;0.016	B;B	0.14023	0.01;0.01	T	0.30736	-0.9968	9	.	.	.	-0.5111	1.4729	0.02420	0.1764:0.0966:0.1836:0.5434	.	224;271	D6RIE9;A1A519	.;F170A_HUMAN	T	271	ENSP00000422684:M271T	.	M	+	2	0	FAM170A	118998154	0.001000	0.12720	0.012000	0.15200	0.044000	0.14063	-0.196000	0.09532	0.129000	0.18514	0.533000	0.62120	ATG	FAM170A	-	NULL	ENSG00000164334		0.542	FAM170A-001	KNOWN	basic|appris_principal	protein_coding	FAM170A	HGNC	protein_coding	OTTHUMT00000371126.1	-	0.00	33	0	T	NM_182761		118970255	+1	tier1	-	no_errors	ENST00000515256	ensembl	human	known	74_37	missense	27.78	26	10	SNP	0.014	C
FAM217A	222826	genome.wustl.edu	37	6	4073518	4073518	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr6:4073518A>G	ENST00000274673.3	-	6	696	c.293T>C	c.(292-294)aTa>aCa	p.I98T	FAM217A_ENST00000380188.2_5'UTR	NM_173563.2	NP_775834.2	Q8IXS0	F217A_HUMAN	family with sequence similarity 217, member A	98																	CCTCTTCTCTATGGTACTTCC	0.318																																																	0													89.0	91.0	90.0					6																	4073518		2202	4300	6502	SO:0001583	missense	0			BC039349	CCDS4489.1	6p25.1	2012-02-07	2012-02-07	2012-02-07	ENSG00000145975	ENSG00000145975			21362	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 146"""	C6orf146			Standard	NM_173563		Approved	MGC43581	uc003mvx.3	Q8IXS0	OTTHUMG00000014159	ENST00000274673.3:c.293T>C	6.37:g.4073518A>G	ENSP00000274673:p.Ile98Thr		Q5JYK1	Missense_Mutation	SNP	NULL	p.I98T	ENST00000274673.3	37	c.293	CCDS4489.1	6	.	.	.	.	.	.	.	.	.	.	A	6.985	0.551734	0.13374	.	.	ENSG00000145975	ENST00000274673;ENST00000470599;ENST00000498677	T	0.18960	2.18	5.05	1.35	0.21983	.	1.106090	0.06835	N	0.794635	T	0.03095	0.0091	N	0.14661	0.345	0.09310	N	0.999999	B	0.13594	0.008	B	0.12156	0.007	T	0.44190	-0.9344	10	0.28530	T	0.3	-0.0035	2.6935	0.05127	0.5925:0.0:0.2151:0.1924	.	98	Q8IXS0	CF146_HUMAN	T	98;226;35	ENSP00000274673:I98T	ENSP00000274673:I98T	I	-	2	0	C6orf146	4018517	0.001000	0.12720	0.205000	0.23548	0.349000	0.29174	-0.095000	0.11077	0.080000	0.16959	0.383000	0.25322	ATA	FAM217A	-	NULL	ENSG00000145975		0.318	FAM217A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM217A	HGNC	protein_coding	OTTHUMT00000352577.2	-	0.00	60	0	A	NM_173563		4073518	-1	tier1	-	no_errors	ENST00000274673	ensembl	human	known	74_37	missense	28.71	72	29	SNP	0.405	G
FAM65A	79567	genome.wustl.edu	37	16	67577003	67577004	+	Frame_Shift_Ins	INS	-	-	T	rs541606600		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr16:67577003_67577004insT	ENST00000379312.3	+	13	2447_2448	c.2326_2327insT	c.(2326-2328)atgfs	p.M776fs	FAM65A_ENST00000540839.3_Frame_Shift_Ins_p.M792fs|CTD-2012K14.2_ENST00000567122.1_RNA|CTD-2012K14.3_ENST00000563083.1_RNA|FAM65A_ENST00000428437.2_Frame_Shift_Ins_p.M786fs|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000042381.4_Frame_Shift_Ins_p.M772fs|FAM65A_ENST00000422602.2_Frame_Shift_Ins_p.M792fs	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	776						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		TTGCCTGGCCATGGCTGTCCAG	0.644																																																	0																																										SO:0001589	frameshift_variant	0			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.2327dupT	16.37:g.67577004_67577004dupT	ENSP00000368614:p.Met776fs		B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Frame_Shift_Ins	INS	superfamily_ARM-type_fold,superfamily_HR1_rho-bd	p.M792fs	ENST00000379312.3	37	c.2374_2375	CCDS54028.1	16																																																																																			FAM65A	-	NULL	ENSG00000039523		0.644	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM65A	HGNC	protein_coding	OTTHUMT00000268866.3		0.00	83	0	-	NM_024519		67577004	+1	tier1		no_errors	ENST00000422602	ensembl	human	known	74_37	frame_shift_ins	41.84	57	41	INS	0.000:0.000	T
FBXO11	80204	genome.wustl.edu	37	2	48035283	48035283	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr2:48035283C>A	ENST00000403359.3	-	23	2830	c.2758G>T	c.(2758-2760)Gaa>Taa	p.E920*	MSH6_ENST00000234420.5_3'UTR|FBXO11_ENST00000434523.2_Nonsense_Mutation_p.E344*|FBXO11_ENST00000405808.1_Intron|FBXO11_ENST00000402508.1_Nonsense_Mutation_p.E836*|FBXO11_ENST00000316377.4_Nonsense_Mutation_p.E836*	NM_001190274.1	NP_001177203.1	Q86XK2	FBX11_HUMAN	F-box protein 11	920					cellular protein modification process (GO:0006464)|peptidyl-arginine N-methylation (GO:0035246)|protein ubiquitination (GO:0016567)|sensory perception of sound (GO:0007605)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	protein-arginine N-methyltransferase activity (GO:0016274)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.0?(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GTATTAGATTCTATAGGTGGA	0.373			"""Mis, F, D"""		DLBCL																																			Rec	yes		2	2p16.3	80204	F-box protein 11		L	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)											175.0	178.0	177.0					2																	48035283		2203	4300	6503	SO:0001587	stop_gained	0			AF174599	CCDS1837.1, CCDS54357.1	2p16.3	2014-01-29	2008-06-23	2008-06-23	ENSG00000138081	ENSG00000138081		"""Ubiquitin protein ligase E3 component n-recognins"", ""F-boxes /  ""other"""""	13590	protein-coding gene	gene with protein product	"""ubiquitin protein ligase E3 component n-recognin 6"""	607871	"""F-box only protein 11"""			10531035, 16487488, 18162545	Standard	NM_025133		Approved	FBX11, UBR6	uc002rwe.3	Q86XK2	OTTHUMG00000129130	ENST00000403359.3:c.2758G>T	2.37:g.48035283C>A	ENSP00000384823:p.Glu920*		A1L491|Q52ZP1|Q53EP7|Q53RT5|Q8IXG3|Q96E90|Q9H6V8|Q9H9L1|Q9NR14|Q9UFK1|Q9UHI1|Q9UKC2	Nonsense_Mutation	SNP	pfam_Znf_N-recognin,pfam_F-box_dom,superfamily_Pectin_lyase_fold/virulence,superfamily_F-box_dom,smart_F-box_dom,smart_PbH1,smart_Carb-bd_sugar_hydrolysis-dom,smart_Znf_N-recognin_met,pfscan_F-box_dom,pfscan_Znf_N-recognin,tigrfam_Para_beta_helix_rpt-2	p.E920*	ENST00000403359.3	37	c.2758	CCDS54357.1	2	.	.	.	.	.	.	.	.	.	.	C	39	7.857791	0.98528	.	.	ENSG00000138081	ENST00000402508;ENST00000403359;ENST00000316377;ENST00000434523	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-15.7027	19.9019	0.96988	0.0:1.0:0.0:0.0	.	.	.	.	X	836;920;836;344	.	ENSP00000323822:E836X	E	-	1	0	FBXO11	47888787	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.750000	0.85110	2.781000	0.95711	0.650000	0.86243	GAA	FBXO11	-	NULL	ENSG00000138081		0.373	FBXO11-001	KNOWN	basic|CCDS	protein_coding	FBXO11	HGNC	protein_coding	OTTHUMT00000251181.3	-	0.00	46	0	C	NM_012167, NM_018693, NM_025133		48035283	-1	tier1	-	no_errors	ENST00000403359	ensembl	human	known	74_37	nonsense	6.90	54	4	SNP	1.000	A
FCGBP	8857	genome.wustl.edu	37	19	40368702	40368702	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:40368702G>A	ENST00000221347.6	-	28	12653	c.12646C>T	c.(12646-12648)Ctc>Ttc	p.L4216F		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4216	VWFD 10. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TTACCGCAGAGCCCGCACACT	0.617																																																	0													223.0	225.0	224.0					19																	40368702		2203	4300	6503	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.12646C>T	19.37:g.40368702G>A	ENSP00000221347:p.Leu4216Phe		O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.L4216F	ENST00000221347.6	37	c.12646	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	G	16.20	3.055164	0.55325	.	.	ENSG00000090920	ENST00000221347	T	0.76186	-1.0	3.92	3.92	0.45320	von Willebrand factor, type D domain (3);	.	.	.	.	D	0.90082	0.6902	H	0.95950	3.745	0.33097	D	0.538701	D	0.89917	1.0	D	0.80764	0.994	D	0.94127	0.7385	9	0.66056	D	0.02	.	15.2045	0.73169	0.0:0.0:1.0:0.0	.	4216	Q9Y6R7	FCGBP_HUMAN	F	4216	ENSP00000221347:L4216F	ENSP00000221347:L4216F	L	-	1	0	FCGBP	45060542	1.000000	0.71417	1.000000	0.80357	0.224000	0.24922	5.436000	0.66538	2.201000	0.70794	0.305000	0.20034	CTC	FCGBP	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000090920		0.617	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	-	0.00	163	0	G	NM_003890		40368702	-1	tier1	-	no_errors	ENST00000221347	ensembl	human	known	74_37	missense	11.59	205	27	SNP	1.000	A
FER1L6	654463	genome.wustl.edu	37	8	124988147	124988147	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr8:124988147G>C	ENST00000522917.1	+	9	899	c.693G>C	c.(691-693)ttG>ttC	p.L231F	FER1L6_ENST00000399018.1_Missense_Mutation_p.L231F	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	231	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GGAACCTTTTGATCCCCAATG	0.433																																																	0													139.0	128.0	131.0					8																	124988147		1840	4092	5932	SO:0001583	missense	0			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.693G>C	8.37:g.124988147G>C	ENSP00000428280:p.Leu231Phe			Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,superfamily_ABC1_TM_dom,smart_C2_dom,pfscan_C2_dom	p.L231F	ENST00000522917.1	37	c.693	CCDS43767.1	8	.	.	.	.	.	.	.	.	.	.	G	15.63	2.890835	0.52014	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.89681	-2.55;-2.55	6.04	5.16	0.70880	FerIin domain (1);	0.000000	0.53938	U	0.000057	D	0.94318	0.8174	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94545	0.7748	10	0.54805	T	0.06	.	15.0632	0.71970	0.0675:0.0:0.9325:0.0	.	231	Q2WGJ9	FR1L6_HUMAN	F	231	ENSP00000428280:L231F;ENSP00000381982:L231F	ENSP00000381982:L231F	L	+	3	2	FER1L6	125057328	1.000000	0.71417	0.997000	0.53966	0.213000	0.24496	5.731000	0.68554	1.561000	0.49584	0.561000	0.74099	TTG	FER1L6	-	pfam_FerIin-domain	ENSG00000214814		0.433	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	HGNC	protein_coding	OTTHUMT00000381400.1	-	0.00	68	0	G	NM_001039112		124988147	+1	tier1	-	no_errors	ENST00000399018	ensembl	human	known	74_37	missense	42.35	49	36	SNP	1.000	C
FFAR3	2865	genome.wustl.edu	37	19	35849910	35849910	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:35849910G>A	ENST00000327809.4	+	2	319	c.118G>A	c.(118-120)Gtg>Atg	p.V40M	FFAR3_ENST00000594310.1_Missense_Mutation_p.V40M	NM_005304.3	NP_005295.1	O14843	FFAR3_HUMAN	free fatty acid receptor 3	40					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to fatty acid (GO:0071398)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|mucosal immune response (GO:0002385)|negative regulation of blood pressure (GO:0045776)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|regulation of hormone biosynthetic process (GO:0046885)|regulation of norepinephrine secretion (GO:0014061)|regulation of peptide hormone secretion (GO:0090276)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|stomach(1)	17	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			GGTGGTCTTCGTGGGCAAGCT	0.637																																					Esophageal Squamous(185;1742 2042 21963 24215 27871)												0													156.0	143.0	147.0					19																	35849910		2199	4295	6494	SO:0001583	missense	0			AF024688	CCDS12459.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000185897	ENSG00000185897		"""GPCR / Class A : Fatty acid receptors"""	4499	protein-coding gene	gene with protein product		603821	"""G protein-coupled receptor 41"""	GPR41		9344866, 22493486	Standard	NM_005304		Approved	FFA3R	uc002nzd.3	O14843	OTTHUMG00000172514	ENST00000327809.4:c.118G>A	19.37:g.35849910G>A	ENSP00000328230:p.Val40Met		B2RWM8|Q14CM7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_GPR40-rel_orph	p.V40M	ENST00000327809.4	37	c.118	CCDS12459.1	19	.	.	.	.	.	.	.	.	.	.	G	8.616	0.890227	0.17613	.	.	ENSG00000185897	ENST00000327809	T	0.38401	1.14	4.99	1.7	0.24286	GPCR, rhodopsin-like superfamily (1);	0.436148	0.23282	U	0.049897	T	0.26448	0.0646	L	0.55481	1.735	0.27046	N	0.963887	B	0.32573	0.376	B	0.27500	0.08	T	0.17379	-1.0371	10	0.54805	T	0.06	-10.9315	4.5439	0.12071	0.2624:0.1616:0.576:0.0	.	40	O14843	FFAR3_HUMAN	M	40	ENSP00000328230:V40M	ENSP00000328230:V40M	V	+	1	0	FFAR3	40541750	0.018000	0.18449	0.995000	0.50966	0.288000	0.27193	-0.011000	0.12721	0.296000	0.22592	-0.463000	0.05309	GTG	FFAR3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000185897		0.637	FFAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FFAR3	HGNC	protein_coding	OTTHUMT00000418873.2	-	0.00	83	0	G	NM_005304		35849910	+1	tier1	-	no_errors	ENST00000327809	ensembl	human	known	74_37	missense	16.67	105	21	SNP	0.964	A
FHAD1	114827	genome.wustl.edu	37	1	15654836	15654836	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:15654836C>A	ENST00000375998.4	+	12	1621	c.1621C>A	c.(1621-1623)Ctc>Atc	p.L541I	FHAD1_ENST00000358897.4_Missense_Mutation_p.L541I|FHAD1_ENST00000471347.1_3'UTR|RP3-467K16.2_ENST00000428747.1_RNA|FHAD1_ENST00000401090.2_Missense_Mutation_p.L211I|FHAD1_ENST00000375999.3_Missense_Mutation_p.L541I|FHAD1_ENST00000375995.3_Missense_Mutation_p.L146I|FHAD1_ENST00000417793.1_Missense_Mutation_p.L541I			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	541										skin(1)|stomach(1)	2						AAAGTGGACCCTCCAGAAAGA	0.473																																																	0													60.0	62.0	61.0					1																	15654836		692	1591	2283	SO:0001583	missense	0			AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.1621C>A	1.37:g.15654836C>A	ENSP00000365166:p.Leu541Ile		Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.L541I	ENST00000375998.4	37	c.1621		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.08|10.08	1.251629|1.251629	0.22880|0.22880	.|.	.|.	ENSG00000142621|ENSG00000142621	ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998;ENST00000524761;ENST00000375995;ENST00000401090|ENST00000375997	D;D;D;D;D;D;D|.	0.86030|.	-2.06;-2.06;-2.06;-2.06;-2.06;-2.06;-2.06|.	4.35|4.35	2.45|2.45	0.29901|0.29901	.|.	0.158801|.	0.29273|.	N|.	0.012630|.	T|T	0.26521|0.26521	0.0648|0.0648	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	0.999998|0.999998	B;B|.	0.33299|.	0.135;0.407|.	B;B|.	0.31290|.	0.06;0.127|.	T|T	0.20907|0.20907	-1.0261|-1.0261	10|5	0.44086|.	T|.	0.13|.	-7.1269|-7.1269	6.4707|6.4707	0.22007|0.22007	0.0:0.7143:0.1834:0.1023|0.0:0.7143:0.1834:0.1023	.|.	541;232|.	B1AJZ9;B1AJZ8|.	FHAD1_HUMAN;.|.	I|H	541;541;541;541;97;146;211|219	ENSP00000351770:L541I;ENSP00000407615:L541I;ENSP00000365167:L541I;ENSP00000365166:L541I;ENSP00000436559:L97I;ENSP00000365163:L146I;ENSP00000383868:L211I|.	ENSP00000351770:L541I|.	L|P	+|+	1|2	0|0	FHAD1|FHAD1	15527423|15527423	0.146000|0.146000	0.22672|0.22672	0.387000|0.387000	0.26183|0.26183	0.048000|0.048000	0.14542|0.14542	0.251000|0.251000	0.18257|0.18257	0.416000|0.416000	0.25844|0.25844	-0.155000|-0.155000	0.13514|0.13514	CTC|CCT	FHAD1	-	NULL	ENSG00000142621		0.473	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	FHAD1	HGNC	protein_coding	OTTHUMT00000393400.2		0.00	53	0	C	NM_052929		15654836	+1			no_errors	ENST00000375999	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.041	A
FILIP1	27145	genome.wustl.edu	37	6	76063299	76063299	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr6:76063299G>T	ENST00000237172.7	-	4	915	c.585C>A	c.(583-585)aaC>aaA	p.N195K	FILIP1_ENST00000370020.1_Missense_Mutation_p.N96K|FILIP1_ENST00000393004.2_Missense_Mutation_p.N195K	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	195										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						CGTCGCTCTTGTTCATGTAGT	0.532																																																	0													254.0	226.0	235.0					6																	76063299		2203	4300	6503	SO:0001583	missense	0			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.585C>A	6.37:g.76063299G>T	ENSP00000237172:p.Asn195Lys		B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	pfam_Cortactin-binding_p2_N,prints_Tropomyosin	p.N195K	ENST00000237172.7	37	c.585	CCDS4984.1	6	.	.	.	.	.	.	.	.	.	.	G	14.04	2.417632	0.42918	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.38887	1.11;1.11;1.11	5.79	5.79	0.91817	Cortactin-binding protein-2, N-terminal (1);	0.140446	0.64402	D	0.000006	T	0.15262	0.0368	N	0.15975	0.35	0.80722	D	1	P;B;B	0.43938	0.822;0.013;0.011	B;B;B	0.40825	0.341;0.014;0.008	T	0.06110	-1.0845	10	0.06625	T	0.88	-17.6189	20.0366	0.97561	0.0:0.0:1.0:0.0	.	195;195;195	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	K	195;195;96	ENSP00000376728:N195K;ENSP00000237172:N195K;ENSP00000359037:N96K	ENSP00000237172:N195K	N	-	3	2	FILIP1	76120019	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.519000	0.73768	2.736000	0.93811	0.561000	0.74099	AAC	FILIP1	-	pfam_Cortactin-binding_p2_N	ENSG00000118407		0.532	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FILIP1	HGNC	protein_coding	OTTHUMT00000041263.1	-	0.00	32	0	G	XM_029179		76063299	-1	tier1	-	no_errors	ENST00000237172	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
FOXG1	2290	genome.wustl.edu	37	14	29237215	29237215	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr14:29237215C>A	ENST00000313071.4	+	1	929	c.730C>A	c.(730-732)Cgc>Agc	p.R244S	RP11-966I7.1_ENST00000549487.1_RNA|FOXG1_ENST00000382535.3_Missense_Mutation_p.R244S|RP11-966I7.1_ENST00000546560.1_RNA|RP11-966I7.1_ENST00000551395.1_RNA	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	244			R -> C (in RTTCV; the mutant protein extensively, although not fully, localizes in nuclear speckles, while the wild-type is more widely dispersed throughout the nucleus). {ECO:0000269|PubMed:21280142}.		aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		GAAGGTGCCGCGCCACTACGA	0.617																																																	0													47.0	47.0	47.0					14																	29237215		2203	4300	6503	SO:0001583	missense	0				CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.730C>A	14.37:g.29237215C>A	ENSP00000339004:p.Arg244Ser		A6NFY2|P55315|Q14488|Q86XT7	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.R244S	ENST00000313071.4	37	c.730	CCDS9636.1	14	.	.	.	.	.	.	.	.	.	.	c	28.2	4.901819	0.92035	.	.	ENSG00000176165	ENST00000382535;ENST00000313071	D;D	0.96587	-4.06;-4.06	4.0	4.0	0.46444	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.066131	0.64402	U	0.000007	D	0.98801	0.9596	H	0.97265	3.97	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99712	1.1007	10	0.87932	D	0	.	15.749	0.77969	0.0:1.0:0.0:0.0	.	244	P55316	FOXG1_HUMAN	S	244	ENSP00000371975:R244S;ENSP00000339004:R244S	ENSP00000339004:R244S	R	+	1	0	FOXG1	28306966	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	5.846000	0.69444	1.769000	0.52152	0.299000	0.19835	CGC	FOXG1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000176165		0.617	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXG1	HGNC	protein_coding	OTTHUMT00000276559.3	-	0.00	63	0	C			29237215	+1	tier1	-	no_errors	ENST00000313071	ensembl	human	known	74_37	missense	79.10	14	53	SNP	1.000	A
FRMPD3	84443	genome.wustl.edu	37	X	106846480	106846480	+	Silent	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chrX:106846480G>A	ENST00000276185.4	+	16	5310	c.5310G>A	c.(5308-5310)caG>caA	p.Q1770Q				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	1770	Gln-rich.					cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						aacaacaacagcagcagcagc	0.582																																																	0													3.0	2.0	2.0					X																	106846480		690	1560	2250	SO:0001819	synonymous_variant	0			AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.5310G>A	X.37:g.106846480G>A			Q96JK8	Silent	SNP	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.Q1770	ENST00000276185.4	37	c.5310		X																																																																																			FRMPD3	-	NULL	ENSG00000147234		0.582	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	FRMPD3	HGNC	protein_coding		-	0.00	42	0	G	XM_042978		106846480	+1	tier1	-	no_errors	ENST00000276185	ensembl	human	known	74_37	silent	7.87	82	7	SNP	0.516	A
FRY	10129	genome.wustl.edu	37	13	32839672	32839672	+	Frame_Shift_Del	DEL	A	A	-			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr13:32839672delA	ENST00000380250.3	+	54	8361	c.7865delA	c.(7864-7866)gaafs	p.E2622fs	FRY_ENST00000542859.1_De_novo_Start_OutOfFrame	NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	2622						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		GCAGCTTTTGAATGCAGCGAC	0.512																																																	0													92.0	91.0	92.0					13																	32839672		1968	4153	6121	SO:0001589	frameshift_variant	0			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.7865delA	13.37:g.32839672delA	ENSP00000369600:p.Glu2622fs		Q9Y3N6	Frame_Shift_Del	DEL	superfamily_ARM-type_fold	p.E2622fs	ENST00000380250.3	37	c.7865	CCDS41875.1	13																																																																																			FRY	-	NULL	ENSG00000073910		0.512	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	HGNC	protein_coding	OTTHUMT00000044405.1		0.00	71	0	A	NM_023037		32839672	+1	tier1		no_errors	ENST00000380250	ensembl	human	known	74_37	frame_shift_del	41.18	70	49	DEL	0.997	-
FRYL	285527	genome.wustl.edu	37	4	48550804	48550804	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr4:48550804G>T	ENST00000503238.1	-	37	4790	c.4791C>A	c.(4789-4791)aaC>aaA	p.N1597K	FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000507873.2_5'UTR|FRYL_ENST00000358350.4_Missense_Mutation_p.N1597K|FRYL_ENST00000537810.1_Missense_Mutation_p.N1597K			O94915	FRYL_HUMAN	FRY-like	1597					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TCACTGCTATGTTACACCTAT	0.343																																																	0													73.0	68.0	70.0					4																	48550804		1868	4098	5966	SO:0001583	missense	0			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.4791C>A	4.37:g.48550804G>T	ENSP00000426064:p.Asn1597Lys		O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.N1597K	ENST00000503238.1	37	c.4791	CCDS43227.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.20|19.20	3.781479|3.781479	0.70222|0.70222	.|.	.|.	ENSG00000075539|ENSG00000075539	ENST00000514617|ENST00000503238;ENST00000358350;ENST00000537810	.|T;T;T	.|0.04406	.|3.63;3.63;3.63	5.32|5.32	4.46|4.46	0.54185|0.54185	.|Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.16896|0.16896	0.0406|0.0406	M|M	0.74881|0.74881	2.28|2.28	0.80722|0.80722	D|D	1|1	.|B;P;P	.|0.39520	.|0.193;0.676;0.625	.|B;P;P	.|0.56163	.|0.239;0.793;0.682	T|T	0.00015|0.00015	-1.2400|-1.2400	5|10	.|0.72032	.|D	.|0.01	.|.	10.9739|10.9739	0.47454|0.47454	0.1494:0.0:0.8506:0.0|0.1494:0.0:0.8506:0.0	.|.	.|428;1597;1597	.|Q6ZR29;O94915;F5GX82	.|.;FRYL_HUMAN;.	N|K	468|1597	.|ENSP00000426064:N1597K;ENSP00000351113:N1597K;ENSP00000441114:N1597K	.|ENSP00000351113:N1597K	H|N	-|-	1|3	0|2	FRYL|FRYL	48245561|48245561	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.910000|0.910000	0.53928|0.53928	1.251000|1.251000	0.32862|0.32862	2.644000|2.644000	0.89710|0.89710	0.561000|0.561000	0.74099|0.74099	CAT|AAC	FRYL	-	superfamily_ARM-type_fold	ENSG00000075539		0.343	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2	-	0.00	57	0	G			48550804	-1	tier1	-	no_errors	ENST00000358350	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
FRYL	285527	genome.wustl.edu	37	4	48597931	48597931	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr4:48597931G>T	ENST00000503238.1	-	11	1121	c.1122C>A	c.(1120-1122)agC>agA	p.S374R	FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000358350.4_Missense_Mutation_p.S374R|FRYL_ENST00000507711.1_Missense_Mutation_p.S374R|FRYL_ENST00000506685.1_Missense_Mutation_p.S80R|FRYL_ENST00000537810.1_Missense_Mutation_p.S374R			O94915	FRYL_HUMAN	FRY-like	374					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TTACAGTGTTGCTTTCACATT	0.274																																																	0													65.0	60.0	62.0					4																	48597931		1817	4071	5888	SO:0001583	missense	0			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.1122C>A	4.37:g.48597931G>T	ENSP00000426064:p.Ser374Arg		O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S374R	ENST00000503238.1	37	c.1122	CCDS43227.1	4	.	.	.	.	.	.	.	.	.	.	G	21.1	4.093183	0.76756	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711;ENST00000506685	T;T;T;T	0.65364	1.6;1.6;1.6;-0.15	5.92	5.92	0.95590	Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	T	0.79969	0.4538	M	0.76328	2.33	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.75020	0.985;0.978	T	0.77446	-0.2585	10	0.41790	T	0.15	.	20.3172	0.98658	0.0:0.0:1.0:0.0	.	374;374	F2Z2S2;O94915	.;FRYL_HUMAN	R	374;374;374;374;80	ENSP00000426064:S374R;ENSP00000351113:S374R;ENSP00000441114:S374R;ENSP00000421584:S374R	ENSP00000351113:S374R	S	-	3	2	FRYL	48292688	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.524000	0.53495	2.801000	0.96364	0.650000	0.86243	AGC	FRYL	-	superfamily_ARM-type_fold	ENSG00000075539		0.274	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2		0.00	72	0	G			48597931	-1			no_errors	ENST00000358350	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
FUT8	2530	genome.wustl.edu	37	14	66136012	66136012	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr14:66136012G>T	ENST00000360689.5	+	7	2376	c.649G>T	c.(649-651)Ggc>Tgc	p.G217C	FUT8_ENST00000557164.1_Missense_Mutation_p.G54C|FUT8_ENST00000554765.1_3'UTR|FUT8_ENST00000394585.1_Missense_Mutation_p.G217C|FUT8_ENST00000394586.2_Missense_Mutation_p.G217C|FUT8_ENST00000417683.1_5'Flank|FUT8_ENST00000358307.2_Missense_Mutation_p.G88C	NM_004480.4|NM_178155.2	NP_004471.4|NP_835368.1	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 (alpha (1,6) fucosyltransferase)	217	GT23. {ECO:0000255|PROSITE- ProRule:PRU00992}.				cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|GDP-L-fucose metabolic process (GO:0046368)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|L-fucose catabolic process (GO:0042355)|N-glycan fucosylation (GO:0036071)|N-glycan processing (GO:0006491)|oligosaccharide biosynthetic process (GO:0009312)|post-translational protein modification (GO:0043687)|protein glycosylation in Golgi (GO:0033578)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|receptor metabolic process (GO:0043112)|respiratory gaseous exchange (GO:0007585)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycoprotein 6-alpha-L-fucosyltransferase activity (GO:0008424)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		TATCAACAAAGGCTGTGGCTA	0.448																																																	0													122.0	109.0	113.0					14																	66136012		2203	4300	6503	SO:0001583	missense	0			AB049740	CCDS9775.1, CCDS9776.1, CCDS9776.2	14q24.3	2013-02-26			ENSG00000033170	ENSG00000033170		"""Fucosyltransferases"""	4019	protein-coding gene	gene with protein product		602589				9368041	Standard	NM_178155		Approved		uc001xio.3	Q9BYC5	OTTHUMG00000142818	ENST00000360689.5:c.649G>T	14.37:g.66136012G>T	ENSP00000353910:p.Gly217Cys		B4DFS7|G3V5N0|O00235|Q8IUA5|Q9BYC6|Q9P2U5|Q9P2U6	Missense_Mutation	SNP	superfamily_SH3_domain,smart_SH3_domain,pirsf_Alpha1_6FUT_euk	p.G217C	ENST00000360689.5	37	c.649	CCDS9775.1	14	.	.	.	.	.	.	.	.	.	.	G	32	5.138224	0.94560	.	.	ENSG00000033170	ENST00000360689;ENST00000394586;ENST00000557164;ENST00000394585;ENST00000358307	D;D;D;D;D	0.91792	-2.91;-2.91;-2.91;-2.91;-2.91	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.95281	0.8469	M	0.81497	2.545	0.80722	D	1	D;D	0.63880	0.99;0.993	P;P	0.56700	0.735;0.804	D	0.95490	0.8568	10	0.87932	D	0	-8.4026	17.6669	0.88205	0.0:0.0:1.0:0.0	.	88;217	G3XAD2;Q9BYC5	.;FUT8_HUMAN	C	217;217;54;217;88	ENSP00000353910:G217C;ENSP00000378087:G217C;ENSP00000452433:G54C;ENSP00000378086:G217C;ENSP00000351057:G88C	ENSP00000345865:G217C	G	+	1	0	FUT8	65205765	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.768000	0.95171	0.655000	0.94253	GGC	FUT8	-	pirsf_Alpha1_6FUT_euk	ENSG00000033170		0.448	FUT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT8	HGNC	protein_coding	OTTHUMT00000286406.1		0.00	69	0	G	NM_004480		66136012	+1			no_errors	ENST00000360689	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
GABRA1	2554	genome.wustl.edu	37	5	161300308	161300309	+	Missense_Mutation	DNP	GA	GA	AT	rs190024862		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G|A	G|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr5:161300308_161300309GA>AT	ENST00000428797.2	+	6	796_797	c.441_442GA>AT	c.(439-444)cgGAtc>cgATtc	p.I148F	GABRA1_ENST00000023897.6_Missense_Mutation_p.I148F|GABRA1_ENST00000393943.4_Missense_Mutation_p.I148F|GABRA1_ENST00000437025.2_Missense_Mutation_p.I148F|GABRA1_ENST00000444819.1_Missense_Mutation_p.I148F|GABRA1_ENST00000420560.1_Missense_Mutation_p.I148F	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	148					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	AACTCCTGCGGATCACAGAGGA	0.465																																																	0																																										SO:0001583	missense	0				CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	Exception_encountered	5.37:g.161300308_161300309delinsAT	ENSP00000393097:p.Ile148Phe		D3DQK6|Q8N629	Silent|Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa1_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.R147|p.I148F	ENST00000428797.2	37	c.441|c.442	CCDS4357.1	5																																																																																			GABRA1	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000022355		0.465	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA1	HGNC	protein_coding	OTTHUMT00000252702.2	-	0.00	55	0	G|A	NM_000806.5		161300308|161300309	+1	tier1	-	no_errors	ENST00000023897	ensembl	human	known	74_37	silent|missense	10.45|10.61	60|59	7	SNP	0.617|1.000	A|T
GDF5	8200	genome.wustl.edu	37	20	34021955	34021955	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr20:34021955C>T	ENST00000374372.1	-	4	1761	c.1258G>A	c.(1258-1260)Gca>Aca	p.A420T	GDF5OS_ENST00000374375.1_5'UTR|GDF5_ENST00000374369.3_Missense_Mutation_p.A420T			P43026	GDF5_HUMAN	growth differentiation factor 5	420					cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix organization (GO:0030198)|forelimb morphogenesis (GO:0035136)|growth (GO:0040007)|hindlimb morphogenesis (GO:0035137)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuron differentiation (GO:0045666)|regulation of multicellular organism growth (GO:0040014)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(9)|skin(3)	26	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			TCAAGGGGTGCGATGATCCAG	0.592																																																	0													128.0	112.0	117.0					20																	34021955		2203	4300	6503	SO:0001583	missense	0			X80915	CCDS13254.1	20q11.2	2008-05-22	2007-04-12		ENSG00000125965	ENSG00000125965			4220	protein-coding gene	gene with protein product	"""cartilage-derived morphogenetic protein-1"""	601146				9288091, 9288098	Standard	NM_000557		Approved	CDMP1, BMP14	uc002xck.1	P43026	OTTHUMG00000032341	ENST00000374372.1:c.1258G>A	20.37:g.34021955C>T	ENSP00000363492:p.Ala420Thr		E1P5Q2|Q96SB1	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C	p.A420T	ENST00000374372.1	37	c.1258	CCDS13254.1	20	.	.	.	.	.	.	.	.	.	.	C	26.7	4.766655	0.90020	.	.	ENSG00000125965	ENST00000374369;ENST00000374372	D;D	0.84730	-1.89;-1.89	4.4	4.4	0.53042	Transforming growth factor beta, conserved site (1);Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.95076	0.8405	H	0.97051	3.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.96980	0.9714	10	0.87932	D	0	.	17.1668	0.86818	0.0:1.0:0.0:0.0	.	420;420	F1T0J1;P43026	.;GDF5_HUMAN	T	420	ENSP00000363489:A420T;ENSP00000363492:A420T	ENSP00000363489:A420T	A	-	1	0	GDF5	33485369	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	7.651000	0.83577	2.266000	0.75297	0.462000	0.41574	GCA	GDF5	-	pfam_TGF-b_C,smart_TGF-b_C	ENSG00000125965		0.592	GDF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF5	HGNC	protein_coding	OTTHUMT00000078875.2		0.00	33	0	C			34021955	-1			no_errors	ENST00000374369	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
GGA3	23163	genome.wustl.edu	37	17	73235928	73235928	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:73235928C>A	ENST00000245541.6	-	13	1741	c.1525G>T	c.(1525-1527)Ggc>Tgc	p.G509C	GGA3_ENST00000582486.1_Missense_Mutation_p.G437C|GGA3_ENST00000351904.7_Missense_Mutation_p.G476C|GGA3_ENST00000578348.1_Missense_Mutation_p.G387C|GGA3_ENST00000582717.1_Missense_Mutation_p.G437C|GGA3_ENST00000538886.1_Missense_Mutation_p.G387C	NM_138619.2	NP_619525.1	Q9NZ52	GGA3_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 3	509	Unstructured hinge.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			breast(2)|endometrium(3)|large_intestine(4)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	20			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)			GCGCTGTTGCCCAACGCCAAG	0.617																																																	0													59.0	42.0	48.0					17																	73235928		2203	4298	6501	SO:0001583	missense	0			AF190864	CCDS11716.1, CCDS11717.1, CCDS54164.1, CCDS58597.1	17q25	2010-02-12	2010-02-12			ENSG00000125447			17079	protein-coding gene	gene with protein product		606006				10747089, 10749927	Standard	NR_033345		Approved	KIAA0154	uc002jni.2	Q9NZ52		ENST00000245541.6:c.1525G>T	17.37:g.73235928C>A	ENSP00000245541:p.Gly509Cys		B7Z7E2|B7Z7M9|J3KRN0|Q15017|Q6IS16|Q9UJY3	Missense_Mutation	SNP	pfam_VHS,pfam_GAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_Coatomer/clathrin_app_Ig-like,superfamily_ENTH_VHS,smart_VHS_subgr,smart_Clathrin_a/b/g-adaptin_app_Ig,pfscan_Clathrin_g-adaptin_app,pfscan_GAT,pfscan_VHS	p.G509C	ENST00000245541.6	37	c.1525	CCDS11717.1	17	.	.	.	.	.	.	.	.	.	.	C	2.451	-0.326407	0.05350	.	.	ENSG00000125447	ENST00000245541;ENST00000351904;ENST00000537584;ENST00000538886	T;T	0.48201	2.18;0.82	4.43	0.0169	0.14110	.	1.042900	0.07512	N	0.909070	T	0.28499	0.0705	N	0.14661	0.345	0.80722	D	1	B;B;B	0.15473	0.008;0.013;0.008	B;B;B	0.17433	0.013;0.018;0.008	T	0.12016	-1.0564	10	0.59425	D	0.04	-35.9812	4.01	0.09618	0.1318:0.5951:0.1275:0.1457	.	387;476;509	B7Z7E2;Q9NZ52-2;Q9NZ52	.;.;GGA3_HUMAN	C	509;476;437;387	ENSP00000245541:G509C;ENSP00000326575:G476C	ENSP00000245541:G509C	G	-	1	0	GGA3	70747523	0.248000	0.23930	0.002000	0.10522	0.002000	0.02628	0.730000	0.26043	-0.106000	0.12110	-0.140000	0.14226	GGC	GGA3	-	NULL	ENSG00000125447		0.617	GGA3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GGA3	HGNC	protein_coding	OTTHUMT00000446645.1	-	0.00	49	0	C	NM_138619		73235928	-1	tier1	-	no_errors	ENST00000245541	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.788	A
GIGYF2	26058	genome.wustl.edu	37	2	233671334	233671334	+	Silent	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr2:233671334C>A	ENST00000409547.1	+	17	2084	c.1773C>A	c.(1771-1773)ccC>ccA	p.P591P	GIGYF2_ENST00000409451.3_Silent_p.P612P|GIGYF2_ENST00000452341.2_Silent_p.P422P|GIGYF2_ENST00000373566.3_Silent_p.P613P|GIGYF2_ENST00000409480.1_Silent_p.P613P|GIGYF2_ENST00000373563.4_Silent_p.P591P|GIGYF2_ENST00000409196.3_Silent_p.P585P	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	591					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		GAAGGGTTCCCTTTTCTCCAG	0.443																																																	0													141.0	138.0	139.0					2																	233671334		2203	4300	6503	SO:0001819	synonymous_variant	0			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.1773C>A	2.37:g.233671334C>A			A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Silent	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.P613	ENST00000409547.1	37	c.1839	CCDS33401.1	2																																																																																			GIGYF2	-	superfamily_GYF	ENSG00000204120		0.443	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	GIGYF2	HGNC	protein_coding	OTTHUMT00000330316.2	-	0.00	47	0	C	NM_001103146		233671334	+1	tier1	-	no_errors	ENST00000373566	ensembl	human	known	74_37	silent	5.56	68	4	SNP	0.950	A
GLRX3	10539	genome.wustl.edu	37	10	131964815	131964815	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr10:131964815C>T	ENST00000368644.1	+	5	545	c.523C>T	c.(523-525)Cag>Tag	p.Q175*	GLRX3_ENST00000331244.5_Nonsense_Mutation_p.Q175*	NM_001199868.1	NP_001186797.1	O76003	GLRX3_HUMAN	glutaredoxin 3	175	Glutaredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00686}.				cell redox homeostasis (GO:0045454)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|regulation of the force of heart contraction (GO:0002026)	extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	electron carrier activity (GO:0009055)|iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(5)|lung(7)	13		all_cancers(35;9.59e-07)|all_epithelial(44;1.48e-06)|Lung NSC(174;0.00566)|all_lung(145;0.00949)|Colorectal(57;0.142)|all_neural(114;0.16)|Breast(234;0.173)|Glioma(114;0.222)		OV - Ovarian serous cystadenocarcinoma(35;0.00218)		ACATAATATTCAGTTTAGCAG	0.393																																																	0													124.0	122.0	123.0					10																	131964815		2203	4300	6503	SO:0001587	stop_gained	0			AJ010841	CCDS7661.1	10q26	2009-05-29	2007-08-16	2007-08-16	ENSG00000108010	ENSG00000108010			15987	protein-coding gene	gene with protein product	"""glutaredoxin 4"""	612754	"""thioredoxin-like 2"""	TXNL2		10636891, 11124703	Standard	NM_006541		Approved	PICOT, bA500G10.4, GRX3, GLRX4, GRX4	uc001lkm.2	O76003	OTTHUMG00000019267	ENST00000368644.1:c.523C>T	10.37:g.131964815C>T	ENSP00000357633:p.Gln175*		B3KMP7|B3KMQ5|D3DRG2|Q5JV01|Q96CE0|Q9P1B0|Q9P1B1	Nonsense_Mutation	SNP	pfam_Glutaredoxin,pfam_Thioredoxin_domain,pfam_mRNA_splic_U5,pfam_Phosducin_thioredoxin-like_dom,superfamily_Thioredoxin-like_fold,tigrfam_Monothiol_GRX-rel	p.Q175*	ENST00000368644.1	37	c.523	CCDS7661.1	10	.	.	.	.	.	.	.	.	.	.	C	25.3	4.623621	0.87460	.	.	ENSG00000108010	ENST00000331244;ENST00000368644	.	.	.	5.0	5.0	0.66597	.	0.128484	0.52532	D	0.000061	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.6284	8.9751	0.35930	0.0:0.7667:0.1511:0.0822	.	.	.	.	X	175	.	ENSP00000330836:Q175X	Q	+	1	0	GLRX3	131854805	0.993000	0.37304	1.000000	0.80357	0.797000	0.45037	2.340000	0.43974	2.323000	0.78572	0.655000	0.94253	CAG	GLRX3	-	pfam_Glutaredoxin,superfamily_Thioredoxin-like_fold	ENSG00000108010		0.393	GLRX3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	GLRX3	HGNC	protein_coding	OTTHUMT00000051021.1	-	0.00	33	0	C	NM_006541		131964815	+1	tier1	-	no_errors	ENST00000331244	ensembl	human	known	74_37	nonsense	64.71	6	11	SNP	0.998	T
GNL2	29889	genome.wustl.edu	37	1	38034505	38034505	+	Silent	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:38034505G>T	ENST00000373062.3	-	13	1913	c.1815C>A	c.(1813-1815)gcC>gcA	p.A605A	GNL2_ENST00000462812.1_5'UTR	NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	605					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				TCTGATATTTGGCAATCTTCT	0.408																																																	0													236.0	236.0	236.0					1																	38034505		2203	4300	6503	SO:0001819	synonymous_variant	0			L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.1815C>A	1.37:g.38034505G>T			Q9BWN7	Silent	SNP	pfam_NOG2_N_dom,pfam_GTP_binding_domain,superfamily_P-loop_NTPase,prints_GTP_binding_domain	p.A605	ENST00000373062.3	37	c.1815	CCDS421.1	1																																																																																			GNL2	-	NULL	ENSG00000134697		0.408	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL2	HGNC	protein_coding	OTTHUMT00000012478.1		0.00	80	0	G	NM_013285		38034505	-1			no_errors	ENST00000373062	ensembl	human	known	74_37	silent	5.19	73	4	SNP	0.002	T
GPRASP1	9737	genome.wustl.edu	37	X	101909994	101909994	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chrX:101909994G>A	ENST00000361600.5	+	5	1954	c.1153G>A	c.(1153-1155)Gcc>Acc	p.A385T	RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000415986.1_Missense_Mutation_p.A385T|GPRASP1_ENST00000537097.1_Missense_Mutation_p.A385T|GPRASP1_ENST00000444152.1_Missense_Mutation_p.A385T	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	385					endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						AAAGGAAGAGGCCAAAACCAA	0.527																																																	0													53.0	63.0	60.0					X																	101909994		2203	4300	6503	SO:0001583	missense	0			AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.1153G>A	X.37:g.101909994G>A	ENSP00000355146:p.Ala385Thr		O43168|Q96LA1	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.A385T	ENST00000361600.5	37	c.1153	CCDS35352.1	X	.	.	.	.	.	.	.	.	.	.	G	4.851	0.158225	0.09236	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.09817	2.94;2.94;2.94;2.94	1.96	-1.5	0.08691	.	.	.	.	.	T	0.05135	0.0137	N	0.22421	0.69	0.09310	N	1	B	0.28900	0.227	B	0.35039	0.194	T	0.39542	-0.9609	9	0.02654	T	1	-0.5783	1.6394	0.02749	0.1468:0.1981:0.4519:0.2032	.	385	Q5JY77	GASP1_HUMAN	T	385	ENSP00000393691:A385T;ENSP00000409420:A385T;ENSP00000355146:A385T;ENSP00000445683:A385T	ENSP00000355146:A385T	A	+	1	0	GPRASP1	101796650	0.008000	0.16893	0.000000	0.03702	0.003000	0.03518	0.338000	0.19858	-0.556000	0.06134	-0.393000	0.06486	GCC	GPRASP1	-	NULL	ENSG00000198932		0.527	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRASP1	HGNC	protein_coding	OTTHUMT00000057634.2		0.00	30	0	G	NM_014710		101909994	+1			no_errors	ENST00000361600	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.002	A
GRAMD1B	57476	genome.wustl.edu	37	11	123480972	123480972	+	Silent	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:123480972G>T	ENST00000529750.1	+	13	1743	c.1416G>T	c.(1414-1416)gtG>gtT	p.V472V	GRAMD1B_ENST00000456860.2_Silent_p.V479V|GRAMD1B_ENST00000322282.7_Silent_p.V472V|GRAMD1B_ENST00000450171.2_Silent_p.V163V	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	472						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		CCCACGACGTGCCCTACCATG	0.547																																																	0													123.0	122.0	122.0					11																	123480972		2068	4204	6272	SO:0001819	synonymous_variant	0			AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.1416G>T	11.37:g.123480972G>T			Q6UW85|Q9ULL9	Silent	SNP	pfam_GRAM,smart_GRAM	p.V472	ENST00000529750.1	37	c.1416	CCDS53720.1	11																																																																																			GRAMD1B	-	NULL	ENSG00000023171		0.547	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRAMD1B	HGNC	protein_coding	OTTHUMT00000387404.2	-	0.00	61	0	G	XM_370660		123480972	+1	tier1	-	no_errors	ENST00000322282	ensembl	human	known	74_37	silent	44.62	36	29	SNP	0.997	T
GRID2	2895	genome.wustl.edu	37	4	94376819	94376819	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr4:94376819G>C	ENST00000282020.4	+	11	1810	c.1552G>C	c.(1552-1554)Gac>Cac	p.D518H	GRID2_ENST00000510992.1_Missense_Mutation_p.D423H	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	518					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TCAGAGAGCCGACATAGGGAT	0.408																																																	0													62.0	63.0	63.0					4																	94376819		2203	4300	6503	SO:0001583	missense	0			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.1552G>C	4.37:g.94376819G>C	ENSP00000282020:p.Asp518His		E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.D518H	ENST00000282020.4	37	c.1552	CCDS3637.1	4	.	.	.	.	.	.	.	.	.	.	G	24.5	4.535053	0.85812	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	T;T	0.64260	-0.09;-0.09	5.73	5.73	0.89815	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.81650	0.4867	M	0.79693	2.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.83148	-0.0105	10	0.87932	D	0	.	19.9133	0.97031	0.0:0.0:1.0:0.0	.	423;518	E9PH24;O43424	.;GRID2_HUMAN	H	518;423	ENSP00000282020:D518H;ENSP00000421257:D423H	ENSP00000282020:D518H	D	+	1	0	GRID2	94595842	1.000000	0.71417	0.963000	0.40424	0.984000	0.73092	9.869000	0.99810	2.721000	0.93114	0.655000	0.94253	GAC	GRID2	-	pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000152208		0.408	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2	-	0.00	22	0	G			94376819	+1	tier1	-	no_errors	ENST00000282020	ensembl	human	known	74_37	missense	77.78	4	14	SNP	1.000	C
GRM1	2911	genome.wustl.edu	37	6	146708117	146708117	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr6:146708117G>T	ENST00000282753.1	+	6	1929	c.1694G>T	c.(1693-1695)tGt>tTt	p.C565F	GRM1_ENST00000355289.4_Missense_Mutation_p.C565F|GRM1_ENST00000361719.2_Missense_Mutation_p.C565F|GRM1_ENST00000507907.1_Missense_Mutation_p.C565F|GRM1_ENST00000492807.2_Missense_Mutation_p.C565F|GRM1_ENST00000392299.2_Missense_Mutation_p.C565F			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	565					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		TGCAAAGCTTGTGACTTGGGA	0.473																																																	0													181.0	169.0	173.0					6																	146708117		2203	4300	6503	SO:0001583	missense	0			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.1694G>T	6.37:g.146708117G>T	ENSP00000282753:p.Cys565Phe		B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Metabotropic_Glu_rcpt_Homer-bd,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3_mtglu_rcpt_1,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_5	p.C565F	ENST00000282753.1	37	c.1694	CCDS5209.1	6	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499836	0.85176	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.95821	-3.82;-3.82;-3.82;-3.82;-3.82;-3.82	5.42	5.42	0.78866	GPCR, family 3, conserved site (1);GPCR, family 3, nine cysteines domain (1);	0.000000	0.85682	D	0.000000	D	0.98764	0.9584	H	0.98005	4.125	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.80764	0.99;0.983;0.994	D	0.99737	1.1014	10	0.87932	D	0	.	18.8113	0.92058	0.0:0.0:1.0:0.0	.	565;565;565	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	F	565	ENSP00000354896:C565F;ENSP00000376119:C565F;ENSP00000424095:C565F;ENSP00000282753:C565F;ENSP00000347437:C565F;ENSP00000425599:C565F	ENSP00000282753:C565F	C	+	2	0	GRM1	146749810	1.000000	0.71417	0.987000	0.45799	0.988000	0.76386	9.132000	0.94455	2.517000	0.84864	0.585000	0.79938	TGT	GRM1	-	pfam_GPCR_3_9-Cys_dom	ENSG00000152822		0.473	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM1	HGNC	protein_coding	OTTHUMT00000042574.1	-	0.00	88	0	G	NM_000838		146708117	+1	tier1	-	no_errors	ENST00000282753	ensembl	human	known	74_37	missense	16.07	94	18	SNP	1.000	T
GRXCR1	389207	genome.wustl.edu	37	4	43022436	43022436	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr4:43022436G>T	ENST00000399770.2	+	3	693	c.693G>T	c.(691-693)gaG>gaT	p.E231D		NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	231	Glutaredoxin. {ECO:0000255|PROSITE- ProRule:PRU00686}.				auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)	p.E231D(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						CCAAAATTGAGGTAAATGTGC	0.333																																																	1	Substitution - Missense(1)	lung(1)											77.0	74.0	75.0					4																	43022436		1836	4077	5913	SO:0001630	splice_region_variant	0				CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.693+1G>T	4.37:g.43022436G>T				Missense_Mutation	SNP	pfam_Glutaredoxin,superfamily_Thioredoxin-like_fold,superfamily_HSP_DnaJ_Cys-rich_dom	p.E231D	ENST00000399770.2	37	c.693	CCDS43225.1	4	.	.	.	.	.	.	.	.	.	.	G	23.3	4.404740	0.83230	.	.	ENSG00000215203	ENST00000399770	T	0.38240	1.15	5.79	5.79	0.91817	Glutaredoxin (1);	0.000000	0.64402	U	0.000001	T	0.56031	0.1958	L	0.53249	1.67	0.80722	D	1	D	0.63880	0.993	D	0.70016	0.967	T	0.42599	-0.9442	10	0.30854	T	0.27	-21.8807	19.0179	0.92901	0.0:0.0:1.0:0.0	.	231	A8MXD5	GRCR1_HUMAN	D	231	ENSP00000382670:E231D	ENSP00000382670:E231D	E	+	3	2	GRXCR1	42717193	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.406000	0.97321	2.741000	0.93983	0.484000	0.47621	GAG	GRXCR1	-	NULL	ENSG00000215203		0.333	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRXCR1	HGNC	protein_coding	OTTHUMT00000360576.1		0.00	88	0	G	NM_001080476	Missense_Mutation	43022436	+1			no_errors	ENST00000399770	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	T
GTF2F1	2962	genome.wustl.edu	37	19	6380639	6380639	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:6380639G>T	ENST00000394456.5	-	12	1758	c.1294C>A	c.(1294-1296)Ctg>Atg	p.L432M	PSPN_ENST00000597721.1_5'Flank|GTF2F1_ENST00000429701.2_Missense_Mutation_p.L347M	NM_002096.2	NP_002087.2	P35269	T2FA_HUMAN	general transcription factor IIF, polypeptide 1, 74kDa	432					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cell junction (GO:0030054)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIF complex (GO:0005674)	catalytic activity (GO:0003824)|DNA binding (GO:0003677)|phosphatase activator activity (GO:0019211)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)	16						TTCCCAGACAGGCTCTGGGGT	0.652																																																	0													81.0	67.0	72.0					19																	6380639		2203	4300	6503	SO:0001583	missense	0				CCDS12165.1	19p13.3	2010-03-23	2002-08-29		ENSG00000125651	ENSG00000125651		"""General transcription factors"""	4652	protein-coding gene	gene with protein product		189968	"""general transcription factor IIF, polypeptide 1 (74kD subunit)"""			1734284	Standard	NM_002096		Approved	TFIIF, BTF4, RAP74, TF2F1	uc002meq.2	P35269	OTTHUMG00000168087	ENST00000394456.5:c.1294C>A	19.37:g.6380639G>T	ENSP00000377969:p.Leu432Met		B2RCS0|Q9BWN0	Missense_Mutation	SNP	pfam_TFIIF-alpha,superfamily_TFIIF_interaction	p.L432M	ENST00000394456.5	37	c.1294	CCDS12165.1	19	.	.	.	.	.	.	.	.	.	.	G	15.06	2.721779	0.48728	.	.	ENSG00000125651	ENST00000394456;ENST00000429701	T;T	0.44482	0.92;0.92	3.65	1.29	0.21616	.	0.280997	0.28778	N	0.014162	T	0.26011	0.0634	N	0.08118	0	0.26209	N	0.979335	P;P;P	0.49696	0.927;0.918;0.624	P;P;B	0.49752	0.616;0.621;0.425	T	0.06250	-1.0837	10	0.48119	T	0.1	-26.9737	5.9613	0.19301	0.1051:0.0:0.6174:0.2775	.	347;330;432	E7EUG6;B4DDB5;P35269	.;.;T2FA_HUMAN	M	432;347	ENSP00000377969:L432M;ENSP00000392107:L347M	ENSP00000377969:L432M	L	-	1	2	GTF2F1	6331639	.	.	0.999000	0.59377	0.698000	0.40448	.	.	0.880000	0.35969	0.655000	0.94253	CTG	GTF2F1	-	pfam_TFIIF-alpha	ENSG00000125651		0.652	GTF2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2F1	HGNC	protein_coding	OTTHUMT00000398033.1	-	0.00	46	0	G	NM_002096		6380639	-1	tier1	-	no_errors	ENST00000394456	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
GZMK	3003	genome.wustl.edu	37	5	54320606	54320606	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr5:54320606G>T	ENST00000231009.2	+	2	253	c.183G>T	c.(181-183)tgG>tgT	p.W61C	CTD-2313F11.1_ENST00000596137.1_RNA|CTD-2313F11.1_ENST00000596909.2_RNA|CTD-2313F11.1_ENST00000609699.1_RNA|ESM1_ENST00000598310.1_5'Flank|CTD-2313F11.1_ENST00000608929.1_RNA|CTD-2313F11.1_ENST00000607910.1_RNA|CTD-2313F11.1_ENST00000371487.3_RNA|CTD-2313F11.1_ENST00000595218.1_RNA|CTD-2313F11.1_ENST00000608466.1_RNA	NM_002104.2	NP_002095.1	P49863	GRAK_HUMAN	granzyme K (granzyme 3; tryptase II)	61	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)	15		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				ATCCACAGTGGGTGCTGACAG	0.473																																																	0													58.0	58.0	58.0					5																	54320606		2203	4300	6503	SO:0001583	missense	0			BC035802	CCDS3964.1	5q11.2	2008-05-15	2005-08-17		ENSG00000113088	ENSG00000113088			4711	protein-coding gene	gene with protein product		600784	"""granzyme K (serine protease, granzyme 3; tryptase II)"""			7758581	Standard	NM_002104		Approved	TRYP2, PRSS	uc003jpl.1	P49863	OTTHUMG00000097009	ENST00000231009.2:c.183G>T	5.37:g.54320606G>T	ENSP00000231009:p.Trp61Cys		B2R563	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.W61C	ENST00000231009.2	37	c.183	CCDS3964.1	5	.	.	.	.	.	.	.	.	.	.	G	15.01	2.707448	0.48412	.	.	ENSG00000113088	ENST00000231009	D	0.90900	-2.75	5.11	4.17	0.49024	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.96658	0.8909	H	0.95917	3.74	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97115	0.9807	10	0.87932	D	0	.	14.5615	0.68140	0.0:0.0:0.8532:0.1468	.	61	P49863	GRAK_HUMAN	C	61	ENSP00000231009:W61C	ENSP00000231009:W61C	W	+	3	0	GZMK	54356363	1.000000	0.71417	1.000000	0.80357	0.500000	0.33767	3.778000	0.55371	2.814000	0.96858	0.591000	0.81541	TGG	GZMK	-	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	ENSG00000113088		0.473	GZMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GZMK	HGNC	protein_coding	OTTHUMT00000214098.1		0.00	31	0	G	NM_002104		54320606	+1			no_errors	ENST00000231009	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
HECTD4	283450	genome.wustl.edu	37	12	112696393	112696393	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:112696393A>G	ENST00000430131.2	-	19	2884	c.1739T>C	c.(1738-1740)tTg>tCg	p.L580S	HECTD4_ENST00000550722.1_Missense_Mutation_p.L866S|HECTD4_ENST00000377560.5_Missense_Mutation_p.L830S|RP3-521E19.2_ENST00000547401.1_RNA			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	580					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TTTAAGCAGCAACGCCGTCTG	0.483																																																	0													120.0	111.0	114.0					12																	112696393		2203	4300	6503	SO:0001583	missense	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.1739T>C	12.37:g.112696393A>G	ENSP00000404379:p.Leu580Ser		L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.L830S	ENST00000430131.2	37	c.2489		12	.	.	.	.	.	.	.	.	.	.	A	17.84	3.488872	0.64074	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722;ENST00000547352	T;T;T	0.55760	0.5;0.51;0.51	5.31	5.31	0.75309	.	0.000000	0.64402	D	0.000001	T	0.59088	0.2168	N	0.19112	0.55	0.47905	D	0.999549	D;D;D	0.69078	0.997;0.995;0.997	D;D;D	0.75484	0.986;0.969;0.986	T	0.65150	-0.6238	10	0.72032	D	0.01	.	15.3028	0.73966	1.0:0.0:0.0:0.0	.	580;580;580	Q9Y4D8-2;Q9Y4D8;Q9Y4D8-3	.;K0614_HUMAN;.	S	830;580;866;74	ENSP00000366783:L830S;ENSP00000404379:L580S;ENSP00000449784:L866S	ENSP00000366783:L830S	L	-	2	0	C12orf51	111180776	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.925000	0.87563	2.012000	0.59069	0.533000	0.62120	TTG	HECTD4	-	NULL	ENSG00000173064		0.483	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		-	0.00	82	0	A	NM_173813		112696393	-1	tier1	-	no_errors	ENST00000377560	ensembl	human	known	74_37	missense	83.12	13	64	SNP	1.000	G
HERC2P3	283755	genome.wustl.edu	37	15	20663127	20663127	+	RNA	SNP	T	T	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr15:20663127T>C	ENST00000428453.1	-	0	1174							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						GCGACCGACCTCTTCCACGGG	0.458																																																	0													16.0	13.0	14.0					15																	20663127		2166	4214	6380			0			AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20663127T>C				RNA	SNP	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			HERC2P3	-	-	ENSG00000180229		0.458	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	HGNC	pseudogene	OTTHUMT00000347772.2	-	0.00	155	0	T	NG_008269		20663127	-1	tier1	-	no_errors	ENST00000428453	ensembl	human	known	74_37	rna	33.33	138	69	SNP	1.000	C
HIST1H2AI	8329	genome.wustl.edu	37	6	27775992	27775992	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr6:27775992C>A	ENST00000358739.3	+	1	94	c.5C>A	c.(4-6)tCt>tAt	p.S2Y	HIST1H3H_ENST00000369163.2_5'Flank|HIST1H2BL_ENST00000377401.2_5'Flank	NM_003509.2	NP_003500.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ai	2						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			lung(3)	3						TTTGCCATGTCTGGGCGTGGC	0.542																																																	0													65.0	76.0	72.0					6																	27775992		2202	4300	6502	SO:0001583	missense	0			Z83742	CCDS4626.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000196747	ENSG00000196747		"""Histones / Replication-dependent"""	4725	protein-coding gene	gene with protein product		602787	"""H2A histone family, member C"", ""histone 1, H2ai"""	H2AFC		9439656, 12408966	Standard	NM_003509		Approved	H2A/c		P0C0S8	OTTHUMG00000014484	ENST00000358739.3:c.5C>A	6.37:g.27775992C>A	ENSP00000351589:p.Ser2Tyr		P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.S2Y	ENST00000358739.3	37	c.5	CCDS4626.1	6	.	.	.	.	.	.	.	.	.	.	.	6.496	0.459770	0.12342	.	.	ENSG00000196747	ENST00000358739	D	0.92965	-3.14	4.34	4.34	0.51931	.	0.000000	0.39834	N	0.001245	D	0.92351	0.7573	.	.	.	0.29050	N	0.884567	.	.	.	.	.	.	D	0.89273	0.3606	7	0.87932	D	0	.	16.7792	0.85559	0.0:1.0:0.0:0.0	.	.	.	.	Y	2	ENSP00000351589:S2Y	ENSP00000351589:S2Y	S	+	2	0	HIST1H2AI	27883971	0.983000	0.35010	0.941000	0.38009	0.060000	0.15804	2.569000	0.45973	2.351000	0.79841	0.549000	0.68633	TCT	HIST1H2AI	-	superfamily_Histone-fold	ENSG00000196747		0.542	HIST1H2AI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AI	HGNC	protein_coding	OTTHUMT00000040152.1	-	0.00	66	0	C	NM_003509		27775992	+1	tier1	-	no_errors	ENST00000358739	ensembl	human	known	74_37	missense	21.57	80	22	SNP	0.975	A
HLCS	3141	genome.wustl.edu	37	21	38137447	38137447	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr21:38137447G>T	ENST00000399120.1	-	9	2776	c.1546C>A	c.(1546-1548)Cct>Act	p.P516T	HLCS_ENST00000336648.4_Missense_Mutation_p.P516T	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	516	BPL/LPL catalytic. {ECO:0000255|PROSITE- ProRule:PRU01067}.				biotin metabolic process (GO:0006768)|cell proliferation (GO:0008283)|histone biotinylation (GO:0071110)|histone modification (GO:0016570)|protein biotinylation (GO:0009305)|response to biotin (GO:0070781)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin-[acetyl-CoA-carboxylase] ligase activity (GO:0004077)|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity (GO:0004078)|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity (GO:0004079)|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity (GO:0004080)|biotin-protein ligase activity (GO:0018271)|enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	CATCCCACAGGGCTCAGCCAC	0.577																																																	0													156.0	121.0	133.0					21																	38137447		2203	4300	6503	SO:0001583	missense	0				CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267	6.3.4.9, 6.3.4.10, 6.3.4.11, 6.3.4.15		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""			7842009	Standard	NM_000411		Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.1546C>A	21.37:g.38137447G>T	ENSP00000382071:p.Pro516Thr		B2RAH1|D3DSG6|Q99451	Missense_Mutation	SNP	pfam_BPL_LipA_LipB,pfam_BPL_C,tigrfam_Biotin_CoA_COase_ligase	p.P516T	ENST00000399120.1	37	c.1546	CCDS13647.1	21	.	.	.	.	.	.	.	.	.	.	G	23.3	4.397189	0.83120	.	.	ENSG00000159267	ENST00000399120;ENST00000336648	D;D	0.95724	-3.79;-3.79	5.82	5.82	0.92795	Biotin/lipoate A/B protein ligase (1);	0.000000	0.85682	D	0.000000	D	0.98018	0.9347	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98342	1.0539	10	0.72032	D	0.01	.	19.7036	0.96065	0.0:0.0:1.0:0.0	.	516	P50747	BPL1_HUMAN	T	516	ENSP00000382071:P516T;ENSP00000338387:P516T	ENSP00000338387:P516T	P	-	1	0	HLCS	37059317	1.000000	0.71417	0.999000	0.59377	0.598000	0.36846	8.598000	0.90852	2.747000	0.94245	0.655000	0.94253	CCT	HLCS	-	pfam_BPL_LipA_LipB,tigrfam_Biotin_CoA_COase_ligase	ENSG00000159267		0.577	HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HLCS	HGNC	protein_coding	OTTHUMT00000194687.2	-	0.00	61	0	G			38137447	-1	tier1	-	no_errors	ENST00000336648	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
HNF1A	6927	genome.wustl.edu	37	12	121431999	121431999	+	Nonsense_Mutation	SNP	C	C	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:121431999C>G	ENST00000257555.6	+	4	972	c.746C>G	c.(745-747)tCa>tGa	p.S249*	HNF1A_ENST00000543427.1_Nonsense_Mutation_p.S132*|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000544413.1_Nonsense_Mutation_p.S249*|HNF1A_ENST00000402929.1_Nonsense_Mutation_p.S249*|HNF1A_ENST00000400024.2_Nonsense_Mutation_p.S249*|HNF1A_ENST00000541395.1_Nonsense_Mutation_p.S249*			P20823	HNF1A_HUMAN	HNF1 homeobox A	249					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GTGTCCCCATCACAGGCACAG	0.622									Hepatic Adenoma, Familial Clustering of																																								0			GRCh37	CI083391	HNF1A	I							37.0	38.0	37.0					12																	121431999		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.746C>G	12.37:g.121431999C>G	ENSP00000257555:p.Ser249*		A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Nonsense_Mutation	SNP	pfam_HNF1b_C,pfam_HNF-1_N,pfam_HNF1a_C,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_HNF1_dimer_dom,smart_Homeobox_dom,pfscan_Homeobox_dom	p.S249*	ENST00000257555.6	37	c.746	CCDS9209.1	12	.	.	.	.	.	.	.	.	.	.	C	35	5.521580	0.96416	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543427;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	.	.	.	4.84	4.84	0.62591	.	0.000000	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.0796	16.9721	0.86303	0.0:1.0:0.0:0.0	.	.	.	.	X	249;249;249;249;249;132;249;249;249;249;249	.	ENSP00000257555:S249X	S	+	2	0	HNF1A	119916382	1.000000	0.71417	0.997000	0.53966	0.950000	0.60333	7.421000	0.80204	2.245000	0.73994	0.409000	0.27619	TCA	HNF1A	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000135100		0.622	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1A	HGNC	protein_coding	OTTHUMT00000320957.5	-	0.00	42	0	C	NM_000545		121431999	+1	tier1	-	no_errors	ENST00000257555	ensembl	human	known	74_37	nonsense	51.61	29	32	SNP	1.000	G
HNF1A	6927	genome.wustl.edu	37	12	121432189	121432189	+	Silent	SNP	C	C	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:121432189C>G	ENST00000257555.6	+	4	1162	c.936C>G	c.(934-936)ctC>ctG	p.L312L	HNF1A_ENST00000543427.1_Silent_p.L195L|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000544413.1_Silent_p.L312L|HNF1A_ENST00000402929.1_Silent_p.L312L|HNF1A_ENST00000400024.2_Silent_p.L312L|HNF1A_ENST00000541395.1_Silent_p.L312L			P20823	HNF1A_HUMAN	HNF1 homeobox A	312					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CACCTGCCCTCTCCCCCAGTA	0.667									Hepatic Adenoma, Familial Clustering of																																								0													19.0	18.0	18.0					12																	121432189		2199	4294	6493	SO:0001819	synonymous_variant	0	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.936C>G	12.37:g.121432189C>G			A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	pfam_HNF-1_N,superfamily_Lambda_DNA-bd_dom,superfamily_HNF1_dimer_dom	p.S250C	ENST00000257555.6	37	c.749	CCDS9209.1	12																																																																																			HNF1A	-	NULL	ENSG00000135100		0.667	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1A	HGNC	protein_coding	OTTHUMT00000320957.5	-	0.00	40	0	C	NM_000545		121432189	+1	tier1	-	no_errors	ENST00000538646	ensembl	human	known	74_37	missense	41.03	23	16	SNP	0.997	G
IL10	3586	genome.wustl.edu	37	1	206943229	206943229	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:206943229A>G	ENST00000423557.1	-	4	447	c.389T>C	c.(388-390)cTt>cCt	p.L130P	IL10_ENST00000471071.1_5'UTR	NM_000572.2	NP_000563.1	P22301	IL10_HUMAN	interleukin 10	130					B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to lipopolysaccharide (GO:0071222)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|defense response to bacterium (GO:0042742)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|leukocyte chemotaxis (GO:0030595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of chronic inflammatory response to antigenic stimulus (GO:0002875)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interferon-alpha biosynthetic process (GO:0045355)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of myeloid dendritic cell activation (GO:0030886)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor biosynthetic process (GO:0032800)|regulation of gene expression (GO:0010468)|regulation of isotype switching (GO:0045191)|regulation of sensory perception of pain (GO:0051930)|response to activity (GO:0014823)|response to carbon monoxide (GO:0034465)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to inactivity (GO:0014854)|response to insulin (GO:0032868)|response to molecule of bacterial origin (GO:0002237)|type 2 immune response (GO:0042092)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-10 receptor binding (GO:0005141)			endometrium(1)|large_intestine(6)|lung(4)|prostate(1)	12	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			TTCACAGGGAAGAAATCGATG	0.507																																																	0													130.0	99.0	110.0					1																	206943229		2203	4300	6503	SO:0001583	missense	0			M57627	CCDS1467.1	1q31-q32	2011-07-14			ENSG00000136634	ENSG00000136634		"""Interleukins and interleukin receptors"""	5962	protein-coding gene	gene with protein product	"""cytokine synthesis inhibitory factor"", ""T-cell growth inhibitory factor"""	124092				9162098	Standard	NM_000572		Approved	CSIF, TGIF, IL10A, IL-10	uc001hen.1	P22301	OTTHUMG00000036386	ENST00000423557.1:c.389T>C	1.37:g.206943229A>G	ENSP00000412237:p.Leu130Pro			Missense_Mutation	SNP	pfam_IL-10/19/20/24/26_fam,superfamily_4_helix_cytokine-like_core,smart_IL-10/19/20/24/26_fam,prints_IL-10	p.L130P	ENST00000423557.1	37	c.389	CCDS1467.1	1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.141109	0.77775	.	.	ENSG00000136634	ENST00000423557	T	0.73363	-0.74	6.08	6.08	0.98989	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.225300	0.46442	D	0.000292	D	0.88168	0.6364	M	0.90019	3.08	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.90216	0.4268	10	0.87932	D	0	-15.8204	13.0356	0.58870	1.0:0.0:0.0:0.0	.	130	P22301	IL10_HUMAN	P	130	ENSP00000412237:L130P	ENSP00000412237:L130P	L	-	2	0	IL10	205009852	0.978000	0.34361	0.962000	0.40283	0.998000	0.95712	4.855000	0.62925	2.333000	0.79357	0.533000	0.62120	CTT	IL10	-	pfam_IL-10/19/20/24/26_fam,superfamily_4_helix_cytokine-like_core,smart_IL-10/19/20/24/26_fam,prints_IL-10	ENSG00000136634		0.507	IL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL10	HGNC	protein_coding	OTTHUMT00000088564.3	-	0.00	43	0	A	NM_000572		206943229	-1	tier1	-	no_errors	ENST00000423557	ensembl	human	known	74_37	missense	59.68	25	37	SNP	0.920	G
IP6K2	51447	genome.wustl.edu	37	3	48726077	48726077	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr3:48726077G>T	ENST00000328631.5	-	6	1133	c.910C>A	c.(910-912)Ctg>Atg	p.L304M	NCKIPSD_ENST00000294129.2_5'Flank|NCKIPSD_ENST00000341520.4_5'Flank|NCKIPSD_ENST00000416649.2_5'Flank	NM_001005909.2|NM_016291.3	NP_001005909.1|NP_057375.2	Q9UHH9	IP6K2_HUMAN	inositol hexakisphosphate kinase 2	304					cytokine-mediated signaling pathway (GO:0019221)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell growth (GO:0030308)|phosphate ion transport (GO:0006817)|phosphatidylinositol phosphorylation (GO:0046854)|positive regulation of apoptotic process (GO:0043065)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	15						ACAGGGCCCAGGAGTTCACGG	0.547																																																	0													107.0	95.0	99.0					3																	48726077		2203	4300	6503	SO:0001583	missense	0			AF177145	CCDS2777.1, CCDS33752.1, CCDS54579.1, CCDS54580.1, CCDS54581.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000068745	ENSG00000068745			17313	protein-coding gene	gene with protein product		606992	"""inositol hexaphosphate kinase 2"""	IHPK2		10574768	Standard	NM_016291		Approved		uc003cup.3	Q9UHH9	OTTHUMG00000133543	ENST00000328631.5:c.910C>A	3.37:g.48726077G>T	ENSP00000331103:p.Leu304Met		A8K3B1|B4E3G6|G8JLL6|Q6P0N8|Q9BSZ6|Q9BUW3|Q9H4P7|Q9NT63|Q9UFU6	Missense_Mutation	SNP	pfam_IPK	p.L304M	ENST00000328631.5	37	c.910	CCDS2777.1	3	.	.	.	.	.	.	.	.	.	.	G	18.49	3.634497	0.67130	.	.	ENSG00000068745	ENST00000328631	T	0.18960	2.18	5.54	4.55	0.56014	.	0.198965	0.45126	D	0.000393	T	0.33818	0.0876	M	0.86097	2.795	0.80722	D	1	P	0.47841	0.901	P	0.51742	0.678	T	0.35025	-0.9805	10	0.56958	D	0.05	-5.5457	2.4427	0.04499	0.1886:0.0:0.5024:0.309	.	304	Q9UHH9	IP6K2_HUMAN	M	304	ENSP00000331103:L304M	ENSP00000331103:L304M	L	-	1	2	IP6K2	48701081	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.573000	0.46007	2.615000	0.88500	0.655000	0.94253	CTG	IP6K2	-	pfam_IPK	ENSG00000068745		0.547	IP6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IP6K2	HGNC	protein_coding	OTTHUMT00000257521.2	-	0.00	74	0	G	NM_016291		48726077	-1	tier1	-	no_errors	ENST00000328631	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
IMPG2	50939	genome.wustl.edu	37	3	100963357	100963357	+	Silent	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr3:100963357C>T	ENST00000193391.7	-	13	2005	c.1818G>A	c.(1816-1818)ggG>ggA	p.G606G		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	606					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	CTACCTTTTGCCCAGACCCTG	0.453																																																	0													146.0	136.0	140.0					3																	100963357		2203	4300	6503	SO:0001819	synonymous_variant	0			AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.1818G>A	3.37:g.100963357C>T			A8MWT5|Q9UKD4|Q9UKK5	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.G606	ENST00000193391.7	37	c.1818	CCDS2940.1	3																																																																																			IMPG2	-	NULL	ENSG00000081148		0.453	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG2	HGNC	protein_coding	OTTHUMT00000353256.3	-	0.00	37	0	C			100963357	-1	tier1	-	no_errors	ENST00000193391	ensembl	human	known	74_37	silent	5.56	68	4	SNP	0.356	T
IPO4	79711	genome.wustl.edu	37	14	24655975	24655975	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr14:24655975C>T	ENST00000354464.6	-	9	955	c.779G>A	c.(778-780)gGc>gAc	p.G260D	RP11-468E2.2_ENST00000561419.1_3'UTR	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4	260					DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		TATCGCATTGCCCAGGGCCAC	0.517																																																	0													93.0	97.0	96.0					14																	24655975		2064	4213	6277	SO:0001583	missense	0			AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801	ENST00000354464.6:c.779G>A	14.37:g.24655975C>T	ENSP00000346453:p.Gly260Asp		B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Missense_Mutation	SNP	pfam_HEAT,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_HEAT_type_2,pfscan_Importin-beta_N	p.G260D	ENST00000354464.6	37	c.779	CCDS9616.1	14	.	.	.	.	.	.	.	.	.	.	C	8.366	0.834270	0.16820	.	.	ENSG00000196497	ENST00000354464	T	0.03413	3.94	4.96	4.96	0.65561	Armadillo-like helical (1);Armadillo-type fold (1);	0.124595	0.53938	D	0.000045	T	0.03053	0.0090	N	0.24115	0.695	0.40139	D	0.976811	B	0.17465	0.022	B	0.21360	0.034	T	0.46652	-0.9176	10	0.09084	T	0.74	-19.6983	13.2624	0.60113	0.0:0.8402:0.1597:0.0	.	260	Q8TEX9	IPO4_HUMAN	D	260	ENSP00000346453:G260D	ENSP00000346453:G260D	G	-	2	0	IPO4	23725815	0.875000	0.30112	0.885000	0.34714	0.418000	0.31294	4.185000	0.58330	2.733000	0.93635	0.655000	0.94253	GGC	IPO4	-	superfamily_ARM-type_fold	ENSG00000196497		0.517	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO4	HGNC	protein_coding	OTTHUMT00000071931.4	-	0.00	38	0	C	NM_024658		24655975	-1	tier1	-	no_errors	ENST00000354464	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.985	T
IRAK3	11213	genome.wustl.edu	37	12	66638728	66638728	+	Splice_Site	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:66638728G>A	ENST00000261233.4	+	10	1508	c.1087G>A	c.(1087-1089)Gta>Ata	p.V363I	IRAK3_ENST00000457197.2_Splice_Site_p.V302I	NM_007199.2	NP_009130.2			interleukin-1 receptor-associated kinase 3											breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)		TTCCTTGTAGGTAATAATGGA	0.323																																																	0													60.0	60.0	60.0					12																	66638728		2203	4300	6503	SO:0001630	splice_region_variant	0			AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376			17020	protein-coding gene	gene with protein product		604459				10383454	Standard	NM_001142523		Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.1087-1G>A	12.37:g.66638728G>A				Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,superfamily_Kinase-like_dom,superfamily_DEATH-like_dom,smart_Death_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Death_domain,pfscan_Prot_kinase_dom	p.V363I	ENST00000261233.4	37	c.1087	CCDS8975.1	12	.	.	.	.	.	.	.	.	.	.	G	16.15	3.041138	0.55003	.	.	ENSG00000090376	ENST00000261233;ENST00000457197	T;T	0.63913	-0.07;-0.07	6.03	5.13	0.70059	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.071181	0.53938	D	0.000042	T	0.66218	0.2767	M	0.68952	2.095	0.49130	D	0.99975	P;P	0.46784	0.859;0.884	P;P	0.49752	0.487;0.621	T	0.65602	-0.6128	9	.	.	.	-22.9366	10.2176	0.43177	0.0873:0.0:0.9127:0.0	.	302;363	Q9Y616-2;Q9Y616	.;IRAK3_HUMAN	I	363;302	ENSP00000261233:V363I;ENSP00000409852:V302I	.	V	+	1	0	IRAK3	64924995	1.000000	0.71417	0.996000	0.52242	0.027000	0.11550	3.696000	0.54757	2.861000	0.98227	0.655000	0.94253	GTA	IRAK3	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000090376		0.323	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK3	HGNC	protein_coding	OTTHUMT00000401908.1	-	0.00	37	0	G		Missense_Mutation	66638728	+1	tier1	-	no_errors	ENST00000261233	ensembl	human	known	74_37	missense	29.79	33	14	SNP	1.000	A
ITGAL	3683	genome.wustl.edu	37	16	30495433	30495433	+	Splice_Site	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr16:30495433G>A	ENST00000356798.6	+	9	1035		c.e9-1		RP11-297C4.3_ENST00000562525.1_RNA|RP11-297C4.2_ENST00000569459.1_RNA|ITGAL_ENST00000433423.2_Intron|ITGAL_ENST00000358164.5_Splice_Site|RNU7-61P_ENST00000515897.1_RNA|ITGAL_ENST00000454514.2_Splice_Site	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)						activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	CTCCCTCACAGATTGGAAAGC	0.483																																					NSCLC(110;1462 1641 3311 33990 49495)												0													114.0	111.0	112.0					16																	30495433		2197	4300	6497	SO:0001630	splice_region_variant	0				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.856-1G>A	16.37:g.30495433G>A			O43746|Q45H73|Q96HB1|Q9UBC8	Splice_Site	SNP	-	e9-1	ENST00000356798.6	37	c.856-1	CCDS32433.1	16	.	.	.	.	.	.	.	.	.	.	G	17.53	3.412359	0.62511	.	.	ENSG00000005844	ENST00000356798;ENST00000358164	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3303	0.87261	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ITGAL	30402934	1.000000	0.71417	0.997000	0.53966	0.739000	0.42172	5.535000	0.67173	2.835000	0.97688	0.591000	0.81541	.	ITGAL	-	-	ENSG00000005844		0.483	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAL	HGNC	protein_coding	OTTHUMT00000434508.2	-	0.00	49	0	G		Intron	30495433	+1	tier1	-	no_errors	ENST00000356798	ensembl	human	known	74_37	splice_site	30.00	35	15	SNP	1.000	A
ITGB3	3690	genome.wustl.edu	37	17	45364556	45364556	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:45364556C>T	ENST00000559488.1	+	6	914	c.898C>T	c.(898-900)Cat>Tat	p.H300Y	ITGB3_ENST00000560629.1_Missense_Mutation_p.S288L|ITGB3_ENST00000571680.1_Missense_Mutation_p.H300Y|ITGB3_ENST00000435993.2_Missense_Mutation_p.H253Y	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	300	VWFA.				activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	CGGGCAGTGTCATGTTGGTAG	0.488																																																	0													182.0	121.0	141.0					17																	45364556		2203	4300	6503	SO:0001583	missense	0				CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.898C>T	17.37:g.45364556C>T	ENSP00000452786:p.His300Tyr		A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt_dom,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	p.H300Y	ENST00000559488.1	37	c.898	CCDS11511.1	17	.	.	.	.	.	.	.	.	.	.	C	16.35	3.098395	0.56183	.	.	ENSG00000178852	ENST00000262017;ENST00000435993	D	0.94046	-3.34	5.16	5.16	0.70880	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);	0.094778	0.64402	D	0.000001	D	0.92485	0.7614	L	0.58101	1.795	0.80722	D	1	B;P	0.36282	0.105;0.546	B;B	0.38458	0.11;0.274	D	0.92973	0.6399	10	0.66056	D	0.02	.	17.7616	0.88466	0.0:1.0:0.0:0.0	.	300;300	P05106;Q2YFE1	ITB3_HUMAN;.	Y	300;253	ENSP00000407801:H253Y	ENSP00000262017:H300Y	H	+	1	0	C17orf57	42719555	1.000000	0.71417	0.952000	0.39060	0.986000	0.74619	4.892000	0.63193	2.562000	0.86427	0.561000	0.74099	CAT	ITGB3	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N	ENSG00000259207		0.488	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB3	HGNC	protein_coding	OTTHUMT00000416111.3	-	0.00	52	0	C	NM_000212		45364556	+1	tier1	-	no_errors	ENST00000559488	ensembl	human	known	74_37	missense	32.31	44	21	SNP	1.000	T
ITIH5	80760	genome.wustl.edu	37	10	7611724	7611724	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr10:7611724C>A	ENST00000256861.6	-	12	2134	c.2056G>T	c.(2056-2058)Gtg>Ttg	p.V686L	ITIH5_ENST00000397146.2_Intron|ITIH5_ENST00000298441.6_Missense_Mutation_p.V472L|ITIH5_ENST00000434980.1_5'Flank|ITIH5_ENST00000446830.2_Missense_Mutation_p.V468L	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	686					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						GGGAAATCCACAACAAAGTGG	0.502																																																	0													53.0	46.0	48.0					10																	7611724		2203	4300	6503	SO:0001583	missense	0					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2056G>T	10.37:g.7611724C>A	ENSP00000256861:p.Val686Leu		Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.V686L	ENST00000256861.6	37	c.2056		10	.	.	.	.	.	.	.	.	.	.	C	18.35	3.605008	0.66445	.	.	ENSG00000123243	ENST00000256861;ENST00000298441;ENST00000446830	T;T;T	0.03035	4.26;4.07;4.08	5.52	5.52	0.82312	.	0.054130	0.64402	D	0.000001	T	0.12603	0.0306	.	.	.	0.80722	D	1	D;D	0.63880	0.987;0.993	P;P	0.57468	0.666;0.821	T	0.00047	-1.2207	9	0.72032	D	0.01	-29.276	13.1649	0.59565	0.0:0.9168:0.0:0.0832	.	686;472	Q86UX2;Q86UX2-3	ITIH5_HUMAN;.	L	686;472;468	ENSP00000256861:V686L;ENSP00000298441:V472L;ENSP00000387969:V468L	ENSP00000256861:V686L	V	-	1	0	ITIH5	7651730	0.997000	0.39634	0.957000	0.39632	0.069000	0.16628	3.520000	0.53465	2.586000	0.87340	0.557000	0.71058	GTG	ITIH5	-	NULL	ENSG00000123243		0.502	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	ITIH5	HGNC	protein_coding	OTTHUMT00000046688.1	-	0.00	45	0	C	NM_030569		7611724	-1	tier1	-	no_errors	ENST00000256861	ensembl	human	known	74_37	missense	30.61	33	15	SNP	0.998	A
ITIH5	80760	genome.wustl.edu	37	10	7618752	7618752	+	Missense_Mutation	SNP	G	G	A	rs547413516		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr10:7618752G>A	ENST00000256861.6	-	10	1720	c.1642C>T	c.(1642-1644)Cgg>Tgg	p.R548W	ITIH5_ENST00000397146.2_Missense_Mutation_p.R548W|ITIH5_ENST00000397145.2_Missense_Mutation_p.R548W|ITIH5_ENST00000298441.6_Missense_Mutation_p.R334W|ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000446830.2_Missense_Mutation_p.R330W	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	548					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TTCTGAGGCCGCACAGGCACA	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		20788	0.001		0.0	False		,,,				2504	0.0																0													66.0	63.0	64.0					10																	7618752		2203	4300	6503	SO:0001583	missense	0					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1642C>T	10.37:g.7618752G>A	ENSP00000256861:p.Arg548Trp		Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.R548W	ENST00000256861.6	37	c.1642		10	.	.	.	.	.	.	.	.	.	.	C	21.6	4.173195	0.78452	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	T;T;T;T;T	0.12039	2.72;2.72;2.72;2.72;2.72	5.41	4.47	0.54385	.	0.880038	0.10177	N	0.706378	T	0.17534	0.0421	.	.	.	0.19775	N	0.99995	D;D;D	0.60160	0.961;0.987;0.972	B;B;P	0.45138	0.191;0.28;0.471	T	0.13308	-1.0514	9	0.87932	D	0	-14.6668	11.1572	0.48495	0.1438:0.7182:0.138:0.0	.	548;548;334	G5E9D8;Q86UX2;Q86UX2-3	.;ITIH5_HUMAN;.	W	548;548;334;330;548	ENSP00000256861:R548W;ENSP00000380333:R548W;ENSP00000298441:R334W;ENSP00000387969:R330W;ENSP00000380332:R548W	ENSP00000256861:R548W	R	-	1	2	ITIH5	7658758	0.569000	0.26643	0.810000	0.32431	0.029000	0.11900	0.932000	0.28884	1.281000	0.44480	-0.357000	0.07601	CGG	ITIH5	-	NULL	ENSG00000123243		0.587	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	ITIH5	HGNC	protein_coding	OTTHUMT00000046688.1	-	0.00	35	0	G	NM_030569		7618752	-1	tier1	-	no_errors	ENST00000256861	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.763	A
JSRP1	126306	genome.wustl.edu	37	19	2254447	2254447	+	Silent	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:2254447G>A	ENST00000300961.6	-	3	208	c.144C>T	c.(142-144)ccC>ccT	p.P48P	JSRP1_ENST00000586471.2_Silent_p.P48P	NM_144616.3	NP_653217.1	Q96MG2	JSPR1_HUMAN	junctional sarcoplasmic reticulum protein 1	48	Mediates interaction with CACNA1S. {ECO:0000250}.				protein localization to membrane (GO:0072657)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|skeletal muscle contraction (GO:0003009)	membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|pancreas(1)|urinary_tract(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TACTCACGTGGGGCACGCTGC	0.662																																																	0													42.0	39.0	40.0					19																	2254447		2200	4300	6500	SO:0001819	synonymous_variant	0			AK056978	CCDS12086.1	19p13.3	2010-03-23			ENSG00000167476	ENSG00000167476			24963	protein-coding gene	gene with protein product	"""homolog of mouse skeletal muscle sarcoplasmic reticulum protein JP-45"""	608743				12871958	Standard	NM_144616		Approved	JP-45, FLJ32416	uc002lvj.2	Q96MG2		ENST00000300961.6:c.144C>T	19.37:g.2254447G>A				Silent	SNP	NULL	p.P48	ENST00000300961.6	37	c.144	CCDS12086.1	19																																																																																			JSRP1	-	NULL	ENSG00000167476		0.662	JSRP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	JSRP1	HGNC	protein_coding	OTTHUMT00000451266.2	-	0.00	73	0	G	NM_144616		2254447	-1	tier1	-	no_errors	ENST00000300961	ensembl	human	known	74_37	silent	28.57	70	28	SNP	0.027	A
KDM1A	23028	genome.wustl.edu	37	1	23408804	23408804	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:23408804A>G	ENST00000356634.3	+	18	2467	c.2318A>G	c.(2317-2319)tAt>tGt	p.Y773C	KDM1A_ENST00000542151.1_Missense_Mutation_p.Y797C|KDM1A_ENST00000400181.4_Missense_Mutation_p.Y797C|RP1-184J9.2_ENST00000427154.1_RNA	NM_015013.3	NP_055828.2	O60341	KDM1A_HUMAN	lysine (K)-specific demethylase 1A	773	Demethylase activity.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|histone H3-K4 demethylation (GO:0034720)|histone H3-K9 demethylation (GO:0033169)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of DNA binding (GO:0043392)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein demethylation (GO:0006482)|regulation of primitive erythrocyte differentiation (GO:0010725)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|demethylase activity (GO:0032451)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-K4 specific) (GO:0032453)|histone demethylase activity (H3-K9 specific) (GO:0032454)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|MRF binding (GO:0043426)|oxidoreductase activity (GO:0016491)|p53 binding (GO:0002039)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(2)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						GGAAATGACTATGATTTAATG	0.517																																																	0													87.0	82.0	84.0					1																	23408804		2203	4300	6503	SO:0001583	missense	0			AL031428	CCDS30627.1, CCDS53278.1	1p36.12	2011-07-01	2009-09-29	2009-09-29	ENSG00000004487	ENSG00000004487		"""Chromatin-modifying enzymes / K-demethylases"""	29079	protein-coding gene	gene with protein product		609132	"""amine oxidase (flavin containing) domain 2"", ""lysine (K)-specific demethylase 1"""	AOF2, KDM1		9628581, 12493763	Standard	NM_015013		Approved	KIAA0601, BHC110, LSD1	uc001bgj.2	O60341	OTTHUMG00000003220	ENST00000356634.3:c.2318A>G	1.37:g.23408804A>G	ENSP00000349049:p.Tyr773Cys		A8MWP9|Q5TH94|Q5TH95|Q86VT7|Q8IXK4|Q8NDP6|Q8TAZ3|Q96AW4	Missense_Mutation	SNP	pfam_Amino_oxidase,pfam_SWIRM,pfam_FAD-dep_OxRdtase,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_FAD_bind_dom,superfamily_Homeodomain-like,pirsf_Hist_Lys-spec_deMease,pfscan_SWIRM	p.Y797C	ENST00000356634.3	37	c.2390	CCDS30627.1	1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.692304	0.88735	.	.	ENSG00000004487	ENST00000356634;ENST00000400181;ENST00000542151	D;D;D	0.93547	-3.24;-3.24;-3.24	5.79	5.79	0.91817	Amine oxidase (1);	0.000000	0.85682	D	0.000000	D	0.97334	0.9128	M	0.91872	3.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98194	1.0464	10	0.87932	D	0	-18.0187	15.3188	0.74105	1.0:0.0:0.0:0.0	.	797;773	O60341-2;O60341	.;KDM1A_HUMAN	C	773;797;797	ENSP00000349049:Y773C;ENSP00000383042:Y797C;ENSP00000439072:Y797C	ENSP00000349049:Y773C	Y	+	2	0	KDM1A	23281391	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.339000	0.96797	2.212000	0.71576	0.533000	0.62120	TAT	KDM1A	-	pfam_Amino_oxidase,pirsf_Hist_Lys-spec_deMease	ENSG00000004487		0.517	KDM1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KDM1A	HGNC	protein_coding	OTTHUMT00000008880.3	-	0.00	52	0	A	NM_015013		23408804	+1	tier1	-	no_errors	ENST00000542151	ensembl	human	known	74_37	missense	37.29	37	22	SNP	1.000	G
KDM4C	23081	genome.wustl.edu	37	9	6793132	6793132	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr9:6793132G>T	ENST00000381309.3	+	2	709	c.144G>T	c.(142-144)aaG>aaT	p.K48N	KDM4C_ENST00000401787.3_Splice_Site_p.K48N|KDM4C_ENST00000381306.3_Splice_Site_p.K48N|KDM4C_ENST00000442236.2_5'UTR|KDM4C_ENST00000489243.1_3'UTR|KDM4C_ENST00000535193.1_Splice_Site_p.K70N|KDM4C_ENST00000543771.1_Splice_Site_p.K48N|KDM4C_ENST00000536108.1_5'UTR	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	48	JmjN. {ECO:0000255|PROSITE- ProRule:PRU00537}.				histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						GTCTTGCAAAGGTGATTATCC	0.408																																																	0													76.0	73.0	74.0					9																	6793132		2203	4300	6503	SO:0001630	splice_region_variant	0			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.144+1G>T	9.37:g.6793132G>T			B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,superfamily_Chorismate_mutase_type_II,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.K48N	ENST00000381309.3	37	c.144	CCDS6471.1	9	.	.	.	.	.	.	.	.	.	.	G	19.32	3.805636	0.70682	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000401787;ENST00000381309;ENST00000381306	T;T;T;T;T	0.60797	0.16;0.16;0.16;0.16;0.16	5.58	5.58	0.84498	Transcription factor jumonji, JmjN (3);	0.000000	0.85682	D	0.000000	D	0.83348	0.5235	H	0.94925	3.6	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.998;0.996;0.996;0.997;0.999;0.998	D	0.87842	0.2652	10	0.87932	D	0	-9.181	18.3414	0.90307	0.0:0.0:1.0:0.0	.	48;48;48;70;48;48	F5H347;B4E1Y4;B0QZ60;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;.;KDM4C_HUMAN;.	N	70;48;48;48;48	ENSP00000442382:K70N;ENSP00000445427:K48N;ENSP00000383990:K48N;ENSP00000370710:K48N;ENSP00000370707:K48N	ENSP00000370707:K48N	K	+	3	2	KDM4C	6783132	1.000000	0.71417	1.000000	0.80357	0.459000	0.32528	6.978000	0.76147	2.597000	0.87782	0.655000	0.94253	AAG	KDM4C	-	pfam_TF_JmjN,smart_TF_JmjN,pfscan_TF_JmjN	ENSG00000107077		0.408	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1	-	0.00	75	0	G	NM_015061	Missense_Mutation	6793132	+1	tier1	-	no_errors	ENST00000381309	ensembl	human	known	74_37	missense	10.87	41	5	SNP	1.000	T
KIAA0825	285600	genome.wustl.edu	37	5	93856101	93856101	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr5:93856101G>T	ENST00000329378.7	-	5	1071	c.822C>A	c.(820-822)ttC>ttA	p.F274L	KIAA0825_ENST00000513200.3_Missense_Mutation_p.F274L|KIAA0825_ENST00000312498.7_Missense_Mutation_p.F274L|KIAA0825_ENST00000427991.2_Missense_Mutation_p.F274L	NM_173665.2	NP_775936.1	Q8IV33	K0825_HUMAN	KIAA0825	274										breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						TTTCTTTAATGAATTTCACCA	0.323																																																	0													48.0	50.0	49.0					5																	93856101		2203	4298	6501	SO:0001583	missense	0			BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000329378.7:c.822C>A	5.37:g.93856101G>T	ENSP00000331385:p.Phe274Leu		O94914|Q6ZNN2	Missense_Mutation	SNP	NULL	p.F274L	ENST00000329378.7	37	c.822	CCDS4070.1	5	.	.	.	.	.	.	.	.	.	.	G	17.88	3.498382	0.64298	.	.	ENSG00000185261	ENST00000513200;ENST00000427991;ENST00000312498;ENST00000329378	T;T;D;D	0.84516	0.75;0.75;-1.86;-1.86	5.34	5.34	0.76211	.	0.132854	0.56097	D	0.000032	D	0.89234	0.6657	M	0.64997	1.995	0.35418	D	0.792977	D;D	0.71674	0.996;0.998	D;D	0.80764	0.99;0.994	D	0.90713	0.4629	10	0.42905	T	0.14	.	8.2272	0.31575	0.1359:0.0:0.8641:0.0	.	274;274	Q8IV33;Q8IV33-2	K0825_HUMAN;.	L	274	ENSP00000424618:F274L;ENSP00000400288:F274L;ENSP00000312205:F274L;ENSP00000331385:F274L	ENSP00000312205:F274L	F	-	3	2	KIAA0825	93881857	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	2.370000	0.44240	2.501000	0.84356	0.460000	0.39030	TTC	KIAA0825	-	NULL	ENSG00000185261		0.323	KIAA0825-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0825	HGNC	protein_coding	OTTHUMT00000371180.2	-	0.00	49	0	G	NM_173665		93856101	-1	tier1	-	no_errors	ENST00000427991	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
KIF14	9928	genome.wustl.edu	37	1	200583511	200583511	+	Missense_Mutation	SNP	G	G	T	rs373701140		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:200583511G>T	ENST00000367350.4	-	4	1828	c.1390C>A	c.(1390-1392)Cca>Aca	p.P464T		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	464	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						ATTATTCCTGGTTCTTCACTA	0.333																																																	0								G	THR/PRO	0,4406		0,0,2203	67.0	70.0	69.0		1390	3.7	1.0	1		69	1,8599	1.2+/-3.3	0,1,4299	no	missense	KIF14	NM_014875.2	38	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	benign	464/1649	200583511	1,13005	2203	4300	6503	SO:0001583	missense	0			D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.1390C>A	1.37:g.200583511G>T	ENSP00000356319:p.Pro464Thr		Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.P464T	ENST00000367350.4	37	c.1390	CCDS30963.1	1	.	.	.	.	.	.	.	.	.	.	G	12.24	1.877636	0.33162	0.0	1.16E-4	ENSG00000118193	ENST00000367350	T	0.75154	-0.91	5.72	3.71	0.42584	Kinesin, motor domain (4);	0.654387	0.15572	N	0.255365	T	0.75258	0.3825	M	0.76328	2.33	0.29116	N	0.880524	B	0.28258	0.205	B	0.32022	0.139	T	0.68224	-0.5465	10	0.25106	T	0.35	.	16.0151	0.80430	0.0:0.2537:0.7463:0.0	.	464	Q15058	KIF14_HUMAN	T	464	ENSP00000356319:P464T	ENSP00000356319:P464T	P	-	1	0	KIF14	198850134	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.774000	0.38573	1.353000	0.45828	0.650000	0.86243	CCA	KIF14	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000118193		0.333	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF14	HGNC	protein_coding	OTTHUMT00000086878.1	-	0.00	46	0	G	NM_014875		200583511	-1	tier1	-	no_errors	ENST00000367350	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.989	T
KL	9365	genome.wustl.edu	37	13	33635154	33635154	+	Silent	SNP	A	A	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr13:33635154A>C	ENST00000380099.3	+	4	1946	c.1938A>C	c.(1936-1938)ggA>ggC	p.G646G	KL_ENST00000487852.1_3'UTR|KL_ENST00000426690.2_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	646	Glycosyl hydrolase-1 2.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)			breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		CGAACCAAGGACTGCCGCGCC	0.632																																																	0													49.0	50.0	50.0					13																	33635154		2203	4300	6503	SO:0001819	synonymous_variant	0			AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.1938A>C	13.37:g.33635154A>C			Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Silent	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.G646	ENST00000380099.3	37	c.1938	CCDS9347.1	13																																																																																			KL	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000133116		0.632	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KL	HGNC	protein_coding	OTTHUMT00000045987.1	-	0.00	27	0	A			33635154	+1	tier1	-	no_errors	ENST00000380099	ensembl	human	known	74_37	silent	36.00	16	9	SNP	0.151	C
KLHL40	131377	genome.wustl.edu	37	3	42727547	42727547	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr3:42727547C>T	ENST00000287777.4	+	1	537	c.437C>T	c.(436-438)gCg>gTg	p.A146V		NM_152393.2	NP_689606.2	Q2TBA0	KLH40_HUMAN	kelch-like family member 40	146	BACK.				multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)											CTCGACTGCGCGCGTCTCGCC	0.652																																																	0													75.0	78.0	77.0					3																	42727547		2203	4294	6497	SO:0001583	missense	0			AK056577	CCDS2703.1	3p21.33	2013-07-30	2013-02-22	2013-01-08	ENSG00000157119	ENSG00000157119		"""Kelch-like"", ""BTB/POZ domain containing"""	30372	protein-coding gene	gene with protein product	"""sarcosynapsin"", ""nemaline myopathy type 8"""	615340	"""kelch repeat and BTB (POZ) domain containing 5"", ""kelch-like 40 (Drosophila)"""	KBTBD5		23746549	Standard	NM_152393		Approved	SRYP, NEM8	uc003clv.1	Q2TBA0	OTTHUMG00000133045	ENST00000287777.4:c.437C>T	3.37:g.42727547C>T	ENSP00000287777:p.Ala146Val		Q86SI1|Q96MR2	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.A146V	ENST00000287777.4	37	c.437	CCDS2703.1	3	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890927	0.91889	.	.	ENSG00000157119	ENST00000287777	T	0.69040	-0.37	4.56	4.56	0.56223	BTB/Kelch-associated (2);	0.056407	0.64402	D	0.000001	T	0.52158	0.1717	N	0.17594	0.5	0.50467	D	0.999871	B	0.26483	0.15	B	0.26202	0.067	T	0.49093	-0.8975	10	0.27785	T	0.31	.	17.5196	0.87783	0.0:1.0:0.0:0.0	.	146	Q2TBA0	KBTB5_HUMAN	V	146	ENSP00000287777:A146V	ENSP00000287777:A146V	A	+	2	0	KBTBD5	42702551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.635000	0.83286	2.391000	0.81399	0.655000	0.94253	GCG	KLHL40	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000157119		0.652	KLHL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL40	HGNC	protein_coding	OTTHUMT00000256651.1	-	0.00	30	0	C	NM_152393		42727547	+1	tier1	-	no_errors	ENST00000287777	ensembl	human	known	74_37	missense	50.00	16	16	SNP	1.000	T
KLHL6	89857	genome.wustl.edu	37	3	183209898	183209898	+	Nonsense_Mutation	SNP	G	G	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr3:183209898G>C	ENST00000341319.3	-	7	1718	c.1683C>G	c.(1681-1683)taC>taG	p.Y561*		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	561					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			CGCCGGTGATGTAGAGCCGGT	0.667																																																	0													68.0	67.0	67.0					3																	183209898		2203	4299	6502	SO:0001587	stop_gained	0			AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1683C>G	3.37:g.183209898G>C	ENSP00000341342:p.Tyr561*		B2RB31|D3DNS8|Q8N5I1|Q8N892	Nonsense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.Y561*	ENST00000341319.3	37	c.1683	CCDS3245.2	3	.	.	.	.	.	.	.	.	.	.	G	37	6.400762	0.97537	.	.	ENSG00000172578	ENST00000341319	.	.	.	5.66	3.84	0.44239	.	0.047694	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.9689	0.47428	0.1526:0.0:0.8474:0.0	.	.	.	.	X	561	.	ENSP00000341342:Y561X	Y	-	3	2	KLHL6	184692592	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	1.692000	0.37731	1.368000	0.46115	0.491000	0.48974	TAC	KLHL6	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000172578		0.667	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL6	HGNC	protein_coding	OTTHUMT00000309024.1	-	0.00	89	0	G	NM_130446		183209898	-1	tier1	-	no_errors	ENST00000341319	ensembl	human	known	74_37	nonsense	31.10	144	65	SNP	1.000	C
KMT2B	9757	genome.wustl.edu	37	19	36211861	36211861	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:36211861C>T	ENST00000222270.7	+	3	1612	c.1612C>T	c.(1612-1614)Cgt>Tgt	p.R538C	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Missense_Mutation_p.R538C|KMT2B_ENST00000341701.1_Intron	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	538	Pro-rich.				chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CCGCTCCTCCCGTGTCATCAA	0.592																																																	0													29.0	33.0	32.0					19																	36211861		1943	4143	6086	SO:0001583	missense	0			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.1612C>T	19.37:g.36211861C>T	ENSP00000222270:p.Arg538Cys		O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	pirsf_MeTrfase_trithorax,pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.R538C	ENST00000222270.7	37	c.1612	CCDS46055.1	19	.	.	.	.	.	.	.	.	.	.	C	16.29	3.082045	0.55861	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	D;D	0.89746	-2.56;-2.56	4.62	4.62	0.57501	.	0.000000	0.41001	D	0.000977	D	0.89448	0.6718	N	0.14661	0.345	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.91702	0.5374	10	0.87932	D	0	.	16.3929	0.83545	0.0:1.0:0.0:0.0	.	538	Q9UMN6	MLL4_HUMAN	C	538	ENSP00000222270:R538C;ENSP00000398837:R538C	ENSP00000222270:R538C	R	+	1	0	AD000671.1	40903701	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.897000	0.75671	2.400000	0.81607	0.555000	0.69702	CGT	KMT2B	-	pirsf_MeTrfase_trithorax	ENSG00000272333		0.592	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2B	Uniprot_gn	protein_coding		-	0.00	41	0	C	NM_014727		36211861	+1	tier1	-	no_errors	ENST00000222270	ensembl	human	known	74_37	missense	44.19	24	19	SNP	1.000	T
KRIT1	889	genome.wustl.edu	37	7	91851268	91851268	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr7:91851268G>A	ENST00000340022.2	-	14	2529	c.1511C>T	c.(1510-1512)cCt>cTt	p.P504L	KRIT1_ENST00000394503.2_Missense_Mutation_p.P456L|KRIT1_ENST00000394505.2_Missense_Mutation_p.P504L|KRIT1_ENST00000412043.2_Missense_Mutation_p.P504L|KRIT1_ENST00000394507.1_Missense_Mutation_p.P504L	NM_004912.3|NM_194455.1	NP_004903.2|NP_919437.1	O00522	KRIT1_HUMAN	KRIT1, ankyrin repeat containing	504	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				angiogenesis (GO:0001525)|cell redox homeostasis (GO:0045454)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|positive regulation of protein binding (GO:0032092)|regulation of catalytic activity (GO:0050790)|regulation of establishment of cell polarity (GO:2000114)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(2)|stomach(1)	22	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AAAAAGCTGAGGTGTTTCCCT	0.383																																																	0													91.0	90.0	90.0					7																	91851268		2203	4300	6503	SO:0001583	missense	0			AJ294850	CCDS5624.1, CCDS34679.1	7q21.2	2014-09-17	2005-03-15	2005-03-17	ENSG00000001631	ENSG00000001631		"""Ankyrin repeat domain containing"""	1573	protein-coding gene	gene with protein product		604214	"""cerebral cavernous malformations 1"""	CCM1		7604043, 11342228	Standard	NM_194455		Approved	CAM	uc003ulu.1	O00522	OTTHUMG00000131187	ENST00000340022.2:c.1511C>T	7.37:g.91851268G>A	ENSP00000344668:p.Pro504Leu		A6NNU0|O43894|Q506L6|Q6U276|Q75N19|Q9H180|Q9H264|Q9HAX5	Missense_Mutation	SNP	pfam_FERM_central,superfamily_Ankyrin_rpt-contain_dom,superfamily_FERM_central,smart_Ankyrin_rpt,smart_Band_41_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_FERM_domain	p.P504L	ENST00000340022.2	37	c.1511	CCDS5624.1	7	.	.	.	.	.	.	.	.	.	.	G	20.5	4.002458	0.74932	.	.	ENSG00000001631	ENST00000394507;ENST00000340022;ENST00000412043;ENST00000394505;ENST00000394503;ENST00000415227	T;T;T;T;D	0.84730	-0.62;-0.62;-0.62;-0.62;-1.89	5.62	5.62	0.85841	Band 4.1 domain (1);FERM domain (1);	0.177014	0.50627	D	0.000116	D	0.85414	0.5691	M	0.67397	2.05	0.80722	D	1	B;P;B	0.39883	0.115;0.693;0.115	B;B;B	0.37387	0.076;0.248;0.076	D	0.87086	0.2169	10	0.87932	D	0	-1.0832	19.6508	0.95805	0.0:0.0:1.0:0.0	.	504;456;504	A4D1F7;A6NNU0;O00522	.;.;KRIT1_HUMAN	L	504;504;504;504;456;504	ENSP00000378015:P504L;ENSP00000344668:P504L;ENSP00000410909:P504L;ENSP00000378013:P504L;ENSP00000378011:P456L	ENSP00000344668:P504L	P	-	2	0	KRIT1	91689204	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	9.220000	0.95180	2.650000	0.89964	0.471000	0.43371	CCT	KRIT1	-	smart_Band_41_domain,pfscan_FERM_domain	ENSG00000001631		0.383	KRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRIT1	HGNC	protein_coding	OTTHUMT00000253910.1	-	0.00	92	0	G			91851268	-1	tier1	-	no_errors	ENST00000340022	ensembl	human	known	74_37	missense	22.63	147	43	SNP	1.000	A
KRT6B	3854	genome.wustl.edu	37	12	52841743	52841743	+	Missense_Mutation	SNP	G	G	T	rs556860047		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:52841743G>T	ENST00000252252.3	-	7	1290	c.1243C>A	c.(1243-1245)Cgt>Agt	p.R415S		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	415	Coil 2.|Rod.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)	p.R415C(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		ATCTCCCCACGCTGCTCAGCA	0.557																																																	1	Substitution - Missense(1)	endometrium(1)											93.0	86.0	88.0					12																	52841743		2203	4300	6503	SO:0001583	missense	0			BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.1243C>A	12.37:g.52841743G>T	ENSP00000252252:p.Arg415Ser		P48669	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.R415S	ENST00000252252.3	37	c.1243	CCDS8828.1	12	.	.	.	.	.	.	.	.	.	.	G	16.93	3.256849	0.59321	.	.	ENSG00000185479	ENST00000252252;ENST00000544607	D	0.89939	-2.59	2.65	0.716	0.18191	Filament (1);	0.000000	0.64402	D	0.000012	D	0.94401	0.8199	M	0.93507	3.425	0.42008	D	0.990924	D	0.76494	0.999	D	0.76575	0.988	D	0.92489	0.5999	10	0.87932	D	0	.	7.4426	0.27192	0.0999:0.1694:0.7307:0.0	.	415	P04259	K2C6B_HUMAN	S	415;375	ENSP00000252252:R415S	ENSP00000252252:R415S	R	-	1	0	KRT6B	51128010	1.000000	0.71417	0.994000	0.49952	0.766000	0.43426	3.617000	0.54181	0.188000	0.20168	0.305000	0.20034	CGT	KRT6B	-	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	ENSG00000185479		0.557	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6B	HGNC	protein_coding	OTTHUMT00000404969.1	-	0.00	81	0	G	NM_005555		52841743	-1	tier1	-	no_errors	ENST00000252252	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
LINC00052	145978	genome.wustl.edu	37	15	88121415	88121416	+	lincRNA	DEL	CA	CA	-			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr15:88121415_88121416delCA	ENST00000560153.1	+	0	284_285				RP11-648K4.2_ENST00000560439.1_lincRNA	NR_026869.1		Q96N35	TMM83_HUMAN	long intergenic non-protein coding RNA 52							integral component of membrane (GO:0016021)											AGAAAAAtctcagtctccctcc	0.381																																																	0																																												0			AK056023		15q25.3	2012-10-12	2011-08-10	2011-08-10		ENSG00000259527		"""Long non-coding RNAs"""	26455	non-coding RNA	RNA, long non-coding			"""transmembrane protein 83"", ""non-protein coding RNA 52"""	TMEM83, NCRNA00052			Standard	NR_026869		Approved	FLJ31461	uc002bmc.1	Q96N35			15.37:g.88121415_88121416delCA				RNA	DEL	-	NULL	ENST00000560153.1	37	NULL		15																																																																																			LINC00052	-	-	ENSG00000259527		0.381	LINC00052-002	KNOWN	basic	lincRNA	LINC00052	HGNC	lincRNA	OTTHUMT00000416151.1		0.00	31	0	CA	XR_017978		88121416	+1	tier1		no_errors	ENST00000560153	ensembl	human	known	74_37	rna	31.25	22	10	DEL	0.017:0.015	-
LINC00665	100506930	genome.wustl.edu	37	19	36806598	36806598	+	IGR	SNP	A	A	G	rs200746265		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:36806598A>G								CTD-3162L10.1 (3034 upstream) : LINC00665 (9240 downstream)																							ATGTTCACATAAACATTTATC	0.398																																																	0																																										SO:0001628	intergenic_variant	0																															19.37:g.36806598A>G				RNA	SNP	-	NULL		37	NULL		19																																																																																			LINC00665	-	-	ENSG00000232677	0	0.398					LINC00665	HGNC			-	0.00	21	0	A			36806598	-1	tier1	rs200746265	no_errors	ENST00000427868	ensembl	human	known	74_37	rna	18.37	40	9	SNP	0.011	G
LRFN2	57497	genome.wustl.edu	37	6	40360135	40360135	+	Frame_Shift_Del	DEL	G	G	-			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr6:40360135delG	ENST00000338305.6	-	3	2459	c.1917delC	c.(1915-1917)cccfs	p.P639fs		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	639						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					GGATCCTCCAGGGGGCCCGTC	0.706																																																	0													4.0	6.0	5.0					6																	40360135		2075	4121	6196	SO:0001589	frameshift_variant	0			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1917delC	6.37:g.40360135delG	ENSP00000345985:p.Pro639fs		A5PKU3|Q5SYP9	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.W640fs	ENST00000338305.6	37	c.1917	CCDS34443.1	6																																																																																			LRFN2	-	NULL	ENSG00000156564		0.706	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN2	HGNC	protein_coding	OTTHUMT00000040488.1		0.00	11	0	G	XM_166372		40360135	-1			no_errors	ENST00000338305	ensembl	human	known	74_37	frame_shift_del	33.33	4	2	DEL	0.998	0
LRP6	4040	genome.wustl.edu	37	12	12317415	12317415	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:12317415G>T	ENST00000261349.4	-	9	1920	c.1844C>A	c.(1843-1845)cCt>cAt	p.P615H	LRP6_ENST00000543091.1_Missense_Mutation_p.P615H	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	615	EGF-like 2.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				AAAGCCAATAGGGCAAGCACA	0.463																																																	0													120.0	113.0	115.0					12																	12317415		2203	4300	6503	SO:0001583	missense	0			AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.1844C>A	12.37:g.12317415G>T	ENSP00000261349:p.Pro615His		Q17RZ2	Missense_Mutation	SNP	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.P615H	ENST00000261349.4	37	c.1844	CCDS8647.1	12	.	.	.	.	.	.	.	.	.	.	G	29.9	5.042722	0.93685	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.97303	-4.33;-4.33	5.65	5.65	0.86999	Epidermal growth factor-like (1);	0.000000	0.64402	D	0.000009	D	0.98457	0.9486	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99023	1.0818	10	0.72032	D	0.01	.	20.0965	0.97849	0.0:0.0:1.0:0.0	.	615;615	F5H7J9;O75581	.;LRP6_HUMAN	H	615	ENSP00000261349:P615H;ENSP00000442472:P615H	ENSP00000261349:P615H	P	-	2	0	LRP6	12208682	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.729000	0.98795	2.824000	0.97209	0.655000	0.94253	CCT	LRP6	-	pirsf_Low_density_Lipo_rcpt-rel_p5/6,smart_EG-like_dom	ENSG00000070018		0.463	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP6	HGNC	protein_coding	OTTHUMT00000400137.1	-	0.00	66	0	G			12317415	-1	tier1	-	no_errors	ENST00000261349	ensembl	human	known	74_37	missense	6.33	74	5	SNP	1.000	T
MAN1B1	11253	genome.wustl.edu	37	9	139998356	139998356	+	Intron	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr9:139998356C>A	ENST00000371589.4	+	9	1327				MAN1B1_ENST00000474902.1_Intron|MAN1B1_ENST00000540391.1_3'UTR	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1						cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		CTGTTGCAGGCATGCAGGTCG	0.532																																																	0																																										SO:0001627	intron_variant	0			AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1255-2221C>A	9.37:g.139998356C>A			Q5VSG3|Q9BRS9|Q9Y5K7	RNA	SNP	-	NULL	ENST00000371589.4	37	NULL	CCDS7029.1	9																																																																																			MAN1B1	-	-	ENSG00000177239		0.532	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1B1	HGNC	protein_coding	OTTHUMT00000055294.2	-	0.00	62	0	C	NM_016219		139998356	+1	tier1	-	no_errors	ENST00000540391	ensembl	human	known	74_37	rna	5.80	65	4	SNP	0.595	A
MAP1B	4131	genome.wustl.edu	37	5	71489749	71489749	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr5:71489749C>A	ENST00000296755.7	+	5	865	c.567C>A	c.(565-567)ttC>ttA	p.F189L		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	189					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TAACCCTGTTCTGTCCTGAAG	0.418																																					Melanoma(17;367 822 11631 31730 47712)												0													79.0	76.0	77.0					5																	71489749		2203	4300	6503	SO:0001583	missense	0			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.567C>A	5.37:g.71489749C>A	ENSP00000296755:p.Phe189Leu		A2BDK5	Missense_Mutation	SNP	pfam_MAP1B_neuraxin	p.F189L	ENST00000296755.7	37	c.567	CCDS4012.1	5	.	.	.	.	.	.	.	.	.	.	C	15.63	2.891435	0.52014	.	.	ENSG00000131711	ENST00000296755;ENST00000511641;ENST00000504492	T;T;T	0.03745	3.82;3.82;3.82	6.08	4.31	0.51392	.	0.000000	0.64402	D	0.000001	T	0.09335	0.0230	L	0.56769	1.78	0.58432	D	0.99999	D;D	0.60575	0.988;0.988	P;P	0.54759	0.76;0.76	T	0.03268	-1.1054	10	0.52906	T	0.07	-18.0585	9.4848	0.38922	0.0:0.7909:0.0:0.2091	.	63;189	A2BDK6;P46821	.;MAP1B_HUMAN	L	189;206;63	ENSP00000296755:F189L;ENSP00000423444:F206L;ENSP00000423416:F63L	ENSP00000296755:F189L	F	+	3	2	MAP1B	71525505	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.313000	0.33585	1.590000	0.49995	0.591000	0.81541	TTC	MAP1B	-	NULL	ENSG00000131711		0.418	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6		0.00	77	0	C	NM_005909		71489749	+1			no_errors	ENST00000296755	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	A
MCM3	4172	genome.wustl.edu	37	6	52134018	52134018	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr6:52134018G>T	ENST00000229854.7	-	13	1910	c.1834C>A	c.(1834-1836)Cca>Aca	p.P612T	MCM3_ENST00000596288.1_Missense_Mutation_p.P657T|MCM3_ENST00000419835.2_Missense_Mutation_p.P566T			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	612					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					GCTGTAACTGGAGATGTCTAG	0.512																																																	0													88.0	86.0	87.0					6																	52134018		2203	4300	6503	SO:0001583	missense	0			X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.1834C>A	6.37:g.52134018G>T	ENSP00000229854:p.Pro612Thr		B4DWW4|Q92660|Q9BTR3|Q9NUE7	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_Mcm3	p.P657T	ENST00000229854.7	37	c.1969		6	.	.	.	.	.	.	.	.	.	.	G	23.3	4.395287	0.83011	.	.	ENSG00000112118	ENST00000229854;ENST00000340349;ENST00000419835;ENST00000421471	T;T;T	0.12774	2.65;2.65;2.65	5.4	4.54	0.55810	.	0.102803	0.64402	D	0.000002	T	0.30823	0.0777	M	0.83603	2.65	0.80722	D	1	D;D	0.89917	0.975;1.0	P;D	0.97110	0.823;1.0	T	0.25916	-1.0118	10	0.87932	D	0	-11.7198	14.1011	0.65056	0.0716:0.0:0.9284:0.0	.	566;612	B4DUQ9;P25205	.;MCM3_HUMAN	T	612;109;566;107	ENSP00000229854:P612T;ENSP00000388647:P566T;ENSP00000407651:P107T	ENSP00000229854:P612T	P	-	1	0	MCM3	52241977	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.239000	0.95389	1.509000	0.48786	0.655000	0.94253	CCA	MCM3	-	pfam_MCM_DNA-dep_ATPase,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase	ENSG00000112118		0.512	MCM3-006	KNOWN	basic|appris_principal	protein_coding	MCM3	HGNC	protein_coding	OTTHUMT00000470784.1	-	0.00	65	0	G			52134018	-1	tier1	-	no_errors	ENST00000596288	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
MDN1	23195	genome.wustl.edu	37	6	90384069	90384069	+	Frame_Shift_Del	DEL	A	A	-			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr6:90384069delA	ENST00000369393.3	-	79	13116	c.13001delT	c.(13000-13002)ctgfs	p.L4334fs	MDN1_ENST00000428876.1_Frame_Shift_Del_p.L4334fs|MDN1_ENST00000468568.1_5'Flank|RP1-122O8.7_ENST00000438877.1_RNA			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4334					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TGGTCCTTCCAGGCAGGGGCC	0.577																																																	0													87.0	81.0	83.0					6																	90384069		2203	4300	6503	SO:0001589	frameshift_variant	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.13001delT	6.37:g.90384069delA	ENSP00000358400:p.Leu4334fs		O15019|Q5T794	Frame_Shift_Del	DEL	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.L4334fs	ENST00000369393.3	37	c.13001	CCDS5024.1	6																																																																																			MDN1	-	pirsf_Midasin	ENSG00000112159		0.577	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2		0.00	28	0	A			90384069	-1			no_errors	ENST00000369393	ensembl	human	known	74_37	frame_shift_del	10.91	49	6	DEL	0.011	0
MED10	84246	genome.wustl.edu	37	5	6372690	6372690	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr5:6372690C>T	ENST00000255764.3	-	4	444	c.334G>A	c.(334-336)Gaa>Aaa	p.E112K		NM_032286.2	NP_115662.2	Q9BTT4	MED10_HUMAN	mediator complex subunit 10	112					gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	RNA polymerase II transcription cofactor activity (GO:0001104)			kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|urinary_tract(1)	5						TTAGAAAGTTCTTGAATCAAC	0.398																																																	0													78.0	84.0	82.0					5																	6372690		2203	4300	6503	SO:0001583	missense	0				CCDS34134.1	5p15.31	2008-02-05	2007-07-30		ENSG00000133398	ENSG00000133398			28760	protein-coding gene	gene with protein product	"""NUT2 homolog (S. cerevisiae)"""	612382	"""mediator of RNA polymerase II transcription, subunit 10 homolog (NUT2, S. cerevisiae)"""			15657623, 15175163	Standard	NM_032286		Approved	TRG20, L6, MGC5309, NUT2	uc003jdo.3	Q9BTT4	OTTHUMG00000161682	ENST00000255764.3:c.334G>A	5.37:g.6372690C>T	ENSP00000255764:p.Glu112Lys		C6G491	Missense_Mutation	SNP	pfam_Mediator_Med10	p.E112K	ENST00000255764.3	37	c.334	CCDS34134.1	5	.	.	.	.	.	.	.	.	.	.	C	36	5.607618	0.96626	.	.	ENSG00000133398	ENST00000255764	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.77778	0.4181	M	0.65975	2.015	0.80722	D	1	D	0.57257	0.979	D	0.71414	0.973	T	0.72221	-0.4356	9	0.29301	T	0.29	-31.994	19.4269	0.94746	0.0:1.0:0.0:0.0	.	112	Q9BTT4	MED10_HUMAN	K	112	.	ENSP00000255764:E112K	E	-	1	0	MED10	6425690	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	6.133000	0.71682	2.836000	0.97738	0.655000	0.94253	GAA	MED10	-	pfam_Mediator_Med10	ENSG00000133398		0.398	MED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED10	HGNC	protein_coding	OTTHUMT00000365714.1	-	0.00	74	0	C	NM_032286		6372690	-1	tier1	-	no_errors	ENST00000255764	ensembl	human	known	74_37	missense	27.82	96	37	SNP	1.000	T
MGEA5	10724	genome.wustl.edu	37	10	103567558	103567558	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr10:103567558G>T	ENST00000361464.3	-	5	976	c.581C>A	c.(580-582)gCc>gAc	p.A194D	MGEA5_ENST00000419011.2_3'UTR|MGEA5_ENST00000439817.1_Missense_Mutation_p.A194D|MGEA5_ENST00000357797.5_Missense_Mutation_p.A194D|MGEA5_ENST00000370094.3_Missense_Mutation_p.A194D	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	194					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		GGAGACTTGGGCATGAGCAAA	0.388																																																	0													160.0	164.0	163.0					10																	103567558		2203	4300	6503	SO:0001583	missense	0			AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.581C>A	10.37:g.103567558G>T	ENSP00000354850:p.Ala194Asp		B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Missense_Mutation	SNP	pfam_Beta-N-acetylglucosaminidase,superfamily_Glycoside_hydrolase_SF,superfamily_Acyl_CoA_acyltransferase	p.A194D	ENST00000361464.3	37	c.581	CCDS7520.1	10	.	.	.	.	.	.	.	.	.	.	G	34	5.305735	0.95601	.	.	ENSG00000198408	ENST00000439817;ENST00000361464;ENST00000357797;ENST00000370094;ENST00000429860	T;T;T;T	0.39229	1.19;1.12;1.21;1.09	5.35	5.35	0.76521	Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.71178	0.3309	M	0.86740	2.835	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.76302	-0.3009	10	0.87932	D	0	-10.7062	19.4145	0.94689	0.0:0.0:1.0:0.0	.	194;194;194;194	E9PGF9;O60502-2;O60502-3;O60502	.;.;.;NCOAT_HUMAN	D	194;194;194;194;142	ENSP00000409973:A194D;ENSP00000354850:A194D;ENSP00000350445:A194D;ENSP00000359112:A194D	ENSP00000350445:A194D	A	-	2	0	MGEA5	103557548	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.669000	0.90835	0.585000	0.79938	GCC	MGEA5	-	pfam_Beta-N-acetylglucosaminidase,superfamily_Glycoside_hydrolase_SF	ENSG00000198408		0.388	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MGEA5	HGNC	protein_coding	OTTHUMT00000049987.1		0.00	99	0	G	NM_012215		103567558	-1			no_errors	ENST00000361464	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	T
MIPOL1	145282	genome.wustl.edu	37	14	37777689	37777689	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr14:37777689G>T	ENST00000327441.7	+	10	1259	c.793G>T	c.(793-795)Gca>Tca	p.A265S	MIPOL1_ENST00000396294.2_Missense_Mutation_p.A265S|MIPOL1_ENST00000556451.1_Missense_Mutation_p.A234S|MIPOL1_ENST00000537471.1_Missense_Mutation_p.A265S|MIPOL1_ENST00000539062.2_Missense_Mutation_p.A234S|MIPOL1_ENST00000536774.1_Missense_Mutation_p.A84S|MIPOL1_ENST00000545536.1_Missense_Mutation_p.A234S	NM_001195296.1|NM_001195297.1|NM_138731.6	NP_001182225.1|NP_001182226.1|NP_620059.1	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1	265						nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		AGAAATGAGTGCACTAATAGA	0.353																																																	0													121.0	120.0	120.0					14																	37777689		2203	4300	6503	SO:0001583	missense	0			AY059470	CCDS9664.1	14q13.3	2010-05-25			ENSG00000151338	ENSG00000151338			21460	protein-coding gene	gene with protein product		606850				11954550, 19667180	Standard	NM_001195296		Approved		uc001wuc.3	Q8TD10	OTTHUMG00000140252	ENST00000327441.7:c.793G>T	14.37:g.37777689G>T	ENSP00000333539:p.Ala265Ser		D3DSA4|Q7Z3J0|Q8IV14	Missense_Mutation	SNP	NULL	p.A265S	ENST00000327441.7	37	c.793	CCDS9664.1	14	.	.	.	.	.	.	.	.	.	.	G	17.43	3.386741	0.61956	.	.	ENSG00000151338	ENST00000327441;ENST00000536774;ENST00000539062;ENST00000556451;ENST00000396294;ENST00000537471;ENST00000545536	T;T;T;T;T;T	0.59906	0.28;0.28;0.23;0.28;0.28;0.23	5.65	4.75	0.60458	.	0.110450	0.64402	D	0.000009	T	0.67144	0.2862	M	0.69823	2.125	0.36075	D	0.842395	P;P	0.52842	0.956;0.956	P;P	0.53102	0.718;0.671	T	0.73760	-0.3881	10	0.39692	T	0.17	-10.1181	14.8533	0.70316	0.0701:0.0:0.9298:0.0	.	265;234	Q8TD10;Q49AL5	MIPO1_HUMAN;.	S	265;84;234;234;265;265;234	ENSP00000333539:A265S;ENSP00000438319:A234S;ENSP00000450479:A234S;ENSP00000379589:A265S;ENSP00000444254:A265S;ENSP00000442529:A234S	ENSP00000333539:A265S	A	+	1	0	MIPOL1	36847440	1.000000	0.71417	0.996000	0.52242	0.951000	0.60555	3.436000	0.52856	2.662000	0.90505	0.591000	0.81541	GCA	MIPOL1	-	NULL	ENSG00000151338		0.353	MIPOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIPOL1	HGNC	protein_coding	OTTHUMT00000276734.1	-	0.00	38	0	G	NM_138731		37777689	+1	tier1	-	no_errors	ENST00000327441	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.999	T
MKI67	4288	genome.wustl.edu	37	10	129902137	129902137	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr10:129902137G>T	ENST00000368654.3	-	13	8342	c.7967C>A	c.(7966-7968)cCa>cAa	p.P2656Q	MKI67_ENST00000368653.3_Missense_Mutation_p.P2296Q	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2656	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.P2656Q(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CTCTTCTACTGGGTTTGGTTT	0.512																																																	1	Substitution - Missense(1)	lung(1)											164.0	170.0	168.0					10																	129902137		2203	4300	6503	SO:0001583	missense	0			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.7967C>A	10.37:g.129902137G>T	ENSP00000357643:p.Pro2656Gln		Q5VWH2	Missense_Mutation	SNP	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.P2656Q	ENST00000368654.3	37	c.7967	CCDS7659.1	10	.	.	.	.	.	.	.	.	.	.	G	12.96	2.095654	0.36952	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.02301	4.35;4.35	3.68	1.68	0.24146	.	1.067000	0.07404	N	0.891193	T	0.08935	0.0221	L	0.57536	1.79	0.09310	N	1	P;D;D	0.76494	0.851;0.994;0.999	B;P;D	0.75020	0.32;0.81;0.985	T	0.36311	-0.9753	10	0.42905	T	0.14	.	8.2901	0.31952	0.0:0.0:0.5693:0.4307	.	2655;2296;2656	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	Q	2656;2296;2655	ENSP00000357643:P2656Q;ENSP00000357642:P2296Q	ENSP00000357642:P2296Q	P	-	2	0	MKI67	129792127	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.129000	0.15830	0.286000	0.22352	-0.309000	0.09137	CCA	MKI67	-	pfam_K167R	ENSG00000148773		0.512	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1		0.00	49	0	G	NM_002417		129902137	-1			no_errors	ENST00000368654	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.000	T
MON2	23041	genome.wustl.edu	37	12	62861090	62861090	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:62861090G>T	ENST00000393632.2	+	1	494	c.103G>T	c.(103-105)Gtc>Ttc	p.V35F	MON2_ENST00000393629.2_Missense_Mutation_p.V35F|MON2_ENST00000393630.3_Missense_Mutation_p.V35F|MON2_ENST00000552738.1_Missense_Mutation_p.V35F|MON2_ENST00000280379.6_Missense_Mutation_p.V35F|MON2_ENST00000552115.1_Missense_Mutation_p.V35F|MON2_ENST00000549378.1_3'UTR|MON2_ENST00000546600.1_Missense_Mutation_p.V35F	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	35					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		ATTCCCACCTGTCAAAGAGGT	0.547																																																	0													65.0	65.0	65.0					12																	62861090		2203	4300	6503	SO:0001583	missense	0				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.103G>T	12.37:g.62861090G>T	ENSP00000377252:p.Val35Phe		A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	pfam_DUF1981_Sec7_assoc,superfamily_ARM-type_fold	p.V35F	ENST00000393632.2	37	c.103	CCDS31849.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.532040	0.96446	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629;ENST00000552115	T;T;T;T;T;T;T	0.66638	-0.21;-0.21;-0.22;-0.21;-0.21;-0.21;-0.19	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.81578	0.4852	M	0.74647	2.275	0.80722	D	1	D;D;D;D	0.76494	0.997;0.996;0.996;0.999	D;D;D;D	0.71870	0.924;0.965;0.965;0.975	T	0.81079	-0.1095	9	.	.	.	-9.4158	18.5326	0.90997	0.0:0.0:1.0:0.0	.	35;35;35;35	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-4	.;.;.;.	F	35	ENSP00000377252:V35F;ENSP00000377250:V35F;ENSP00000280379:V35F;ENSP00000447407:V35F;ENSP00000449215:V35F;ENSP00000377249:V35F;ENSP00000446635:V35F	.	V	+	1	0	MON2	61147357	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.742000	0.91588	2.732000	0.93576	0.650000	0.86243	GTC	MON2	-	superfamily_ARM-type_fold	ENSG00000061987		0.547	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON2	HGNC	protein_coding	OTTHUMT00000406767.3	-	0.00	37	0	G	NM_015026		62861090	+1	tier1	-	no_errors	ENST00000393630	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	T
MOXD2P	100289017	genome.wustl.edu	37	7	141942747	141942747	+	RNA	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr7:141942747G>T	ENST00000477615.1	-	0	314							A6NHM9	MOXD2_HUMAN	monooxygenase, DBH-like 2, pseudogene								copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)										TGGGTGTGTAGCAGGTAGCCA	0.493																																																	0																																												0					7q34	2010-09-24	2010-09-24	2010-09-24	ENSG00000240268	ENSG00000240268			33605	pseudogene	pseudogene			"""monooxygenase, DBH-like 2 pseudogene"""	MOXD2			Standard	NR_024346		Approved		uc022amw.1	A6NHM9	OTTHUMG00000158566		7.37:g.141942747G>T				RNA	SNP	-	NULL	ENST00000477615.1	37	NULL		7																																																																																			MOXD2P	-	-	ENSG00000240268		0.493	MOXD2P-002	KNOWN	basic	processed_transcript	MOXD2P	HGNC	pseudogene	OTTHUMT00000351330.2	-	0.00	29	0	G	NR_024346		141942747	-1	tier1	-	no_errors	ENST00000477615	ensembl	human	known	74_37	rna	35.14	24	13	SNP	1.000	T
MT-ND1	4535	genome.wustl.edu	37	M	1142	1142	+	5'Flank	SNP	A	A	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chrM:1142A>C	ENST00000361390.2	+	0	0				MT-TV_ENST00000387342.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TF_ENST00000387314.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GCTCGCCAGAACACTACGAGC	0.458																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.1142A>C	Exception_encountered		C0JKH6|Q37523	RNA	SNP	-	NULL	ENST00000361390.2	37	NULL		MT																																																																																			MT-RNR1	-	-	ENSG00000211459		0.458	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR1	HGNC	protein_coding		-	0.00	11	0	A	YP_003024026		1142	+1	tier1	-	no_errors	ENST00000389680	ensembl	human	known	74_37	rna	33.33	16	8	SNP	NULL	C
MTIF2	4528	genome.wustl.edu	37	2	55476622	55476622	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr2:55476622G>T	ENST00000263629.4	-	9	1205	c.890C>A	c.(889-891)cCt>cAt	p.P297H	MTIF2_ENST00000403721.1_Missense_Mutation_p.P297H|MTIF2_ENST00000394600.3_Missense_Mutation_p.P297H	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	297	tr-type G.				formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						CACTTTCTCAGGATCAGCCTC	0.418																																																	0													238.0	208.0	218.0					2																	55476622		2203	4300	6503	SO:0001583	missense	0			L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.890C>A	2.37:g.55476622G>T	ENSP00000263629:p.Pro297His		D6W5D0	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_TIF_IF2_dom3,pfam_Transl_elong_EFTu/EF1A_2,pfam_MIRO-like,pfam_GTP_binding_domain,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,superfamily_P-loop_NTPase,superfamily_TIF_IF2_dom3,superfamily_Transl_B-barrel,tigrfam_Small_GTP-bd_dom	p.P297H	ENST00000263629.4	37	c.890	CCDS1853.1	2	.	.	.	.	.	.	.	.	.	.	G	28.4	4.915007	0.92178	.	.	ENSG00000085760	ENST00000403721;ENST00000263629;ENST00000394600;ENST00000418823;ENST00000535023	T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55	5.9	5.9	0.94986	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	D	0.86879	0.6039	M	0.84511	2.7	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87741	0.2585	10	0.87932	D	0	-14.9106	20.282	0.98514	0.0:0.0:1.0:0.0	.	297	P46199	IF2M_HUMAN	H	297;297;297;17;297	ENSP00000384481:P297H;ENSP00000263629:P297H;ENSP00000378099:P297H;ENSP00000403492:P17H	ENSP00000263629:P297H	P	-	2	0	MTIF2	55330126	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.476000	0.97823	2.786000	0.95864	0.563000	0.77884	CCT	MTIF2	-	pfam_EF_GTP-bd_dom,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,superfamily_P-loop_NTPase,tigrfam_Small_GTP-bd_dom	ENSG00000085760		0.418	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTIF2	HGNC	protein_coding	OTTHUMT00000251486.4	-	0.00	58	0	G	NM_002453		55476622	-1	tier1	-	no_errors	ENST00000263629	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
MYH3	4621	genome.wustl.edu	37	17	10550536	10550536	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:10550536G>T	ENST00000583535.1	-	10	948	c.861C>A	c.(859-861)ttC>ttA	p.F287L	MYH3_ENST00000226209.7_Missense_Mutation_p.F287L	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	287	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						GAATCTGGTAGAAGATGTGGT	0.448																																																	0													105.0	103.0	104.0					17																	10550536		2203	4300	6503	SO:0001583	missense	0				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.861C>A	17.37:g.10550536G>T	ENSP00000464317:p.Phe287Leu		Q15492	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F287L	ENST00000583535.1	37	c.861	CCDS11157.1	17	.	.	.	.	.	.	.	.	.	.	G	24.3	4.514187	0.85389	.	.	ENSG00000109063	ENST00000226209	D	0.83837	-1.77	5.11	5.11	0.69529	Myosin head, motor domain (2);	.	.	.	.	D	0.93562	0.7945	H	0.98068	4.14	0.40521	D	0.980839	D	0.89917	1.0	D	0.75484	0.986	D	0.94374	0.7598	9	0.87932	D	0	.	9.2637	0.37627	0.1625:0.0:0.8374:0.0	.	287	P11055	MYH3_HUMAN	L	287	ENSP00000226209:F287L	ENSP00000226209:F287L	F	-	3	2	MYH3	10491261	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.223000	0.51231	2.821000	0.97095	0.555000	0.69702	TTC	MYH3	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000109063		0.448	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	HGNC	protein_coding	OTTHUMT00000252734.2	-	0.00	52	0	G	NM_002470		10550536	-1	tier1	-	no_errors	ENST00000226209	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
MYCBPAP	84073	genome.wustl.edu	37	17	48597123	48597123	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:48597123G>T	ENST00000323776.5	+	7	1182	c.1020G>T	c.(1018-1020)aaG>aaT	p.K340N	MYCBPAP_ENST00000468821.1_3'UTR|MYCBPAP_ENST00000436259.2_Missense_Mutation_p.K303N	NM_032133.4	NP_115509.4			MYCBP associated protein											breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			ACATCAGGAAGCCCCACTCCA	0.582																																																	0													69.0	58.0	62.0					17																	48597123		2203	4300	6503	SO:0001583	missense	0			BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.1020G>T	17.37:g.48597123G>T	ENSP00000323184:p.Lys340Asn			Missense_Mutation	SNP	NULL	p.K340N	ENST00000323776.5	37	c.1020	CCDS32680.2	17	.	.	.	.	.	.	.	.	.	.	G	14.49	2.549667	0.45383	.	.	ENSG00000136449	ENST00000323776;ENST00000436259	T;T	0.46063	0.88;0.88	5.75	4.78	0.61160	.	0.054130	0.64402	D	0.000001	T	0.61236	0.2331	M	0.80847	2.515	0.40522	D	0.980841	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.61753	-0.6998	10	0.38643	T	0.18	-37.3882	8.1715	0.31258	0.2496:0.0:0.7504:0.0	.	303;340	Q8TBZ2;B4DZQ1	MYBPP_HUMAN;.	N	340;303	ENSP00000323184:K340N;ENSP00000397209:K303N	ENSP00000323184:K340N	K	+	3	2	MYCBPAP	45952122	1.000000	0.71417	1.000000	0.80357	0.066000	0.16364	2.828000	0.48120	2.717000	0.92951	0.563000	0.77884	AAG	MYCBPAP	-	NULL	ENSG00000136449		0.582	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYCBPAP	HGNC	protein_coding	OTTHUMT00000347814.1	-	0.00	39	0	G	NM_032133		48597123	+1	tier1	-	no_errors	ENST00000323776	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
MYOM2	9172	genome.wustl.edu	37	8	2046754	2046754	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr8:2046754G>T	ENST00000262113.4	+	19	2522	c.2381G>T	c.(2380-2382)gGg>gTg	p.G794V	MYOM2_ENST00000523438.1_Missense_Mutation_p.G219V	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	794	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GCCGGCATCGGGGAGCCCTCA	0.577																																																	0													31.0	29.0	30.0					8																	2046754		2203	4300	6503	SO:0001583	missense	0				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.2381G>T	8.37:g.2046754G>T	ENSP00000262113:p.Gly794Val		Q7Z3Y2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G794V	ENST00000262113.4	37	c.2381	CCDS5957.1	8	.	.	.	.	.	.	.	.	.	.	G	19.88	3.909888	0.72983	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.66995	-0.24;-0.24	5.5	5.5	0.81552	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.88702	0.6508	H	0.97158	3.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92216	0.5780	10	0.87932	D	0	.	19.3978	0.94614	0.0:0.0:1.0:0.0	.	794	P54296	MYOM2_HUMAN	V	794;219	ENSP00000262113:G794V;ENSP00000428396:G219V	ENSP00000262113:G794V	G	+	2	0	MYOM2	2034161	1.000000	0.71417	0.970000	0.41538	0.250000	0.25880	9.119000	0.94362	2.583000	0.87209	0.561000	0.74099	GGG	MYOM2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000036448		0.577	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	-	0.00	80	0	G	NM_003970		2046754	+1	tier1	-	no_errors	ENST00000262113	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
MYRF	745	genome.wustl.edu	37	11	61545851	61545851	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:61545851G>T	ENST00000278836.5	+	14	1999		c.e14-1		MYRF_ENST00000265460.5_Splice_Site|MYRF_ENST00000389602.4_Splice_Site|TMEM258_ENST00000535042.1_Intron|MYRF_ENST00000327797.1_Splice_Site	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor						central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CCTGCCCCCAGGTGTCATCGC	0.537																																																	0													94.0	92.0	93.0					11																	61545851		2202	4299	6501	SO:0001630	splice_region_variant	0				CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.1904-1G>T	11.37:g.61545851G>T			O43582|Q9P1Q6	Splice_Site	SNP	-	e14-1	ENST00000278836.5	37	c.1904-1	CCDS44622.1	11	.	.	.	.	.	.	.	.	.	.	G	17.94	3.511827	0.64522	.	.	ENSG00000124920	ENST00000278836;ENST00000265460;ENST00000327797;ENST00000389602	.	.	.	4.5	4.5	0.54988	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6145	0.88064	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C11orf9	61302427	1.000000	0.71417	0.999000	0.59377	0.707000	0.40811	9.350000	0.97070	2.239000	0.73571	0.561000	0.74099	.	MYRF	-	-	ENSG00000124920		0.537	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYRF	HGNC	protein_coding	OTTHUMT00000398519.2		0.00	73	0	G	NM_013279	Intron	61545851	+1			no_errors	ENST00000278836	ensembl	human	known	74_37	splice_site	5.41	70	4	SNP	1.000	T
NAA35	60560	genome.wustl.edu	37	9	88631475	88631475	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr9:88631475C>A	ENST00000361671.5	+	18	1723	c.1590C>A	c.(1588-1590)taC>taA	p.Y530*		NM_024635.3	NP_078911.3	Q5VZE5	NAA35_HUMAN	N(alpha)-acetyltransferase 35, NatC auxiliary subunit	530					negative regulation of apoptotic process (GO:0043066)|smooth muscle cell proliferation (GO:0048659)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	25						AATTCCTTTACGCATGGTTGA	0.373																																																	0													118.0	109.0	112.0					9																	88631475		2203	4300	6503	SO:0001587	stop_gained	0			AK025266	CCDS6673.1	9q22.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000135040	ENSG00000135040		"""N(alpha)-acetyltransferase subunits"""	24340	protein-coding gene	gene with protein product			"""MAK10 homolog, amino-acid N-acetyltransferase subunit (S. cerevisiae)"""	MAK10		14702039, 19660095	Standard	NM_024635		Approved	FLJ21613, FLJ22643, bA379P1.1	uc004aoi.4	Q5VZE5	OTTHUMG00000020131	ENST00000361671.5:c.1590C>A	9.37:g.88631475C>A	ENSP00000354972:p.Tyr530*		Q5VZE6|Q9H631|Q9H703	Nonsense_Mutation	SNP	pfam_NatC_AcTrfase_Mak10	p.Y530*	ENST00000361671.5	37	c.1590	CCDS6673.1	9	.	.	.	.	.	.	.	.	.	.	C	36	5.728400	0.96856	.	.	ENSG00000135040	ENST00000361671	.	.	.	5.4	-1.99	0.07457	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.9262	11.7476	0.51830	0.0:0.2526:0.0:0.7474	.	.	.	.	X	530	.	ENSP00000354972:Y530X	Y	+	3	2	NAA35	87821295	0.992000	0.36948	0.994000	0.49952	0.899000	0.52679	0.229000	0.17833	-0.218000	0.10018	-1.671000	0.00744	TAC	NAA35	-	NULL	ENSG00000135040		0.373	NAA35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA35	HGNC	protein_coding	OTTHUMT00000052906.1		0.00	36	0	C	NM_024635		88631475	+1			no_errors	ENST00000361671	ensembl	human	known	74_37	nonsense	6.45	29	2	SNP	0.999	A
NAALADL2	254827	genome.wustl.edu	37	3	174814895	174814895	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr3:174814895G>A	ENST00000454872.1	+	2	487	c.359G>A	c.(358-360)tGc>tAc	p.C120Y	NAALADL2_ENST00000473253.1_3'UTR|NAALADL2-AS3_ENST00000453180.1_RNA	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	120						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		AGCAATCGCTGCAACTTTTGC	0.378																																																	0													95.0	96.0	96.0					3																	174814895		1856	4098	5954	SO:0001583	missense	0				CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.359G>A	3.37:g.174814895G>A	ENSP00000404705:p.Cys120Tyr		Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Missense_Mutation	SNP	superfamily_TFR-like_dimer_dom	p.C120Y	ENST00000454872.1	37	c.359	CCDS46960.1	3	.	.	.	.	.	.	.	.	.	.	G	9.864	1.197161	0.22037	.	.	ENSG00000177694	ENST00000434257;ENST00000454872	T;T	0.31769	1.52;1.48	5.57	4.68	0.58851	.	0.447823	0.21331	N	0.076297	T	0.20981	0.0505	L	0.27053	0.805	0.22968	N	0.998496	P;P	0.47604	0.898;0.498	B;B	0.40165	0.321;0.166	T	0.09015	-1.0694	10	0.52906	T	0.07	-3.6155	9.3398	0.38074	0.0719:0.0:0.7828:0.1453	.	103;120	Q58DX5-2;Q58DX5	.;NADL2_HUMAN	Y	103;120	ENSP00000409858:C103Y;ENSP00000404705:C120Y	ENSP00000409858:C103Y	C	+	2	0	NAALADL2	176297589	1.000000	0.71417	0.777000	0.31699	0.593000	0.36681	3.386000	0.52492	1.415000	0.47037	0.650000	0.86243	TGC	NAALADL2	-	NULL	ENSG00000177694		0.378	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALADL2	HGNC	protein_coding	OTTHUMT00000347390.2	-	0.00	59	0	G	NM_207015		174814895	+1	tier1	-	no_errors	ENST00000454872	ensembl	human	known	74_37	missense	11.29	110	14	SNP	0.913	A
NCKAP5	344148	genome.wustl.edu	37	2	133618158	133618158	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr2:133618158C>A	ENST00000409261.1	-	11	1087	c.714G>T	c.(712-714)ttG>ttT	p.L238F	NCKAP5_ENST00000405974.3_Missense_Mutation_p.L238F|NCKAP5_ENST00000409213.1_Missense_Mutation_p.L238F|NCKAP5_ENST00000317721.6_Missense_Mutation_p.L238F	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	238								p.L77F(1)|p.L238F(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CTCTTGTTTTCAACTTCACAC	0.393																																																	2	Substitution - Missense(2)	lung(2)											153.0	141.0	145.0					2																	133618158		1917	4118	6035	SO:0001583	missense	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.714G>T	2.37:g.133618158C>A	ENSP00000387128:p.Leu238Phe		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	NULL	p.L238F	ENST00000409261.1	37	c.714	CCDS46418.1	2	.	.	.	.	.	.	.	.	.	.	C	26.1	4.703323	0.88924	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661	T;T;T;T	0.70399	1.44;-0.48;1.44;-0.48	5.78	5.78	0.91487	.	0.000000	0.25543	U	0.029942	T	0.82130	0.4970	L	0.55481	1.735	0.41098	D	0.985642	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.83170	-0.0094	10	0.87932	D	0	.	18.1945	0.89817	0.0:1.0:0.0:0.0	.	238;238	O14513-2;O14513	.;NCKP5_HUMAN	F	238	ENSP00000387128:L238F;ENSP00000386952:L238F;ENSP00000380603:L238F;ENSP00000385692:L238F	ENSP00000380603:L238F	L	-	3	2	NCKAP5	133334628	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.562000	0.45914	2.724000	0.93272	0.563000	0.77884	TTG	NCKAP5	-	NULL	ENSG00000176771		0.393	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1		0.00	50	0	C	NM_207481		133618158	-1			no_errors	ENST00000317721	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	A
NEBL	10529	genome.wustl.edu	37	10	21097518	21097518	+	Silent	SNP	T	T	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr10:21097518T>A	ENST00000377122.4	-	26	3078	c.2682A>T	c.(2680-2682)ggA>ggT	p.G894G	NEBL_ENST00000377159.4_Intron|NEBL_ENST00000417816.2_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	894	Linker.				cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						ACCTGTCGTCTCCGAGACCTG	0.458																																																	0													138.0	128.0	131.0					10																	21097518		2203	4300	6503	SO:0001819	synonymous_variant	0			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.2682A>T	10.37:g.21097518T>A			B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_SH3_domain	p.G894	ENST00000377122.4	37	c.2682	CCDS7134.1	10																																																																																			NEBL	-	NULL	ENSG00000078114		0.458	NEBL-004	KNOWN	basic|CCDS	protein_coding	NEBL	HGNC	protein_coding	OTTHUMT00000047113.1	-	0.00	63	0	T	NM_006393		21097518	-1	tier1	-	no_errors	ENST00000377122	ensembl	human	known	74_37	silent	50.85	29	30	SNP	0.929	A
NEFM	4741	genome.wustl.edu	37	8	24776021	24776021	+	Nonsense_Mutation	SNP	G	G	T	rs150229714		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr8:24776021G>T	ENST00000221166.5	+	3	3435	c.2653G>T	c.(2653-2655)Gag>Tag	p.E885*	NEFM_ENST00000521540.1_3'UTR|NEFM_ENST00000433454.2_Nonsense_Mutation_p.E509*|NEFM_ENST00000437366.2_Nonsense_Mutation_p.E846*|NEFM_ENST00000518131.1_Nonsense_Mutation_p.E667*			P07197	NFM_HUMAN	neurofilament, medium polypeptide	885	Tail.				axon cargo transport (GO:0008088)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|regulation of axon diameter (GO:0031133)	axon (GO:0030424)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)|neuromuscular junction (GO:0031594)	microtubule binding (GO:0008017)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|endometrium(7)|kidney(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|urinary_tract(1)	36		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		AAAGGTTGAAGAGCATGAAGA	0.428																																																	0													102.0	103.0	103.0					8																	24776021		2203	4300	6503	SO:0001587	stop_gained	0			BC002421	CCDS6046.1, CCDS47831.1	8p21	2013-01-16	2008-09-19	2006-11-20	ENSG00000104722	ENSG00000104722		"""Intermediate filaments type IV"""	7734	protein-coding gene	gene with protein product		162250	"""neurofilament, medium polypeptide 150kDa"""	NEF3		1348579	Standard	NM_001105541		Approved	NFM, NF-M	uc003xed.4	P07197	OTTHUMG00000131990	ENST00000221166.5:c.2653G>T	8.37:g.24776021G>T	ENSP00000221166:p.Glu885*		B4DGN2|E9PBF7|Q4QRK6	Nonsense_Mutation	SNP	pfam_IF,pfam_Intermed_filament_DNA-bd,superfamily_Prefoldin,prints_Keratin_I	p.E885*	ENST00000221166.5	37	c.2653	CCDS6046.1	8	.	.	.	.	.	.	.	.	.	.	G	38	6.669636	0.97751	.	.	ENSG00000104722	ENST00000221166;ENST00000518131;ENST00000437366;ENST00000433454	.	.	.	5.0	3.2	0.36748	.	0.000000	0.45361	D	0.000371	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.4869	0.44729	0.0735:0.1341:0.7925:0.0	.	.	.	.	X	885;667;846;509	.	ENSP00000221166:E885X	E	+	1	0	NEFM	24831926	1.000000	0.71417	0.999000	0.59377	0.634000	0.38068	6.254000	0.72460	0.522000	0.28464	-0.373000	0.07131	GAG	NEFM	-	NULL	ENSG00000104722		0.428	NEFM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEFM	HGNC	protein_coding	OTTHUMT00000254954.2		0.00	44	0	G	NM_005382		24776021	+1			no_errors	ENST00000221166	ensembl	human	known	74_37	nonsense	5.26	36	2	SNP	1.000	T
NELL1	4745	genome.wustl.edu	37	11	21592425	21592425	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:21592425G>A	ENST00000357134.5	+	18	2248	c.2096G>A	c.(2095-2097)gGt>gAt	p.G699D	NELL1_ENST00000325319.5_Missense_Mutation_p.G642D|NELL1_ENST00000298925.5_Missense_Mutation_p.G727D|NELL1_ENST00000532434.1_Missense_Mutation_p.G652D|NELL1_ENST00000529218.1_3'UTR	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	699	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						GACCAAAATGGTCACAAGCTG	0.473																																																	0													195.0	179.0	184.0					11																	21592425		2203	4300	6503	SO:0001583	missense	0			AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.2096G>A	11.37:g.21592425G>A	ENSP00000349654:p.Gly699Asp		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_VWF_C	p.G699D	ENST00000357134.5	37	c.2096	CCDS7855.1	11	.	.	.	.	.	.	.	.	.	.	G	24.8	4.566873	0.86439	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	6.16	5.25	0.73442	von Willebrand factor, type C (3);	0.000000	0.85682	D	0.000000	T	0.75554	0.3865	L	0.51422	1.61	0.58432	D	0.999999	D;D;D;D;D	0.89917	0.997;0.998;0.998;1.0;0.998	D;D;D;D;D	0.87578	0.934;0.961;0.961;0.998;0.937	T	0.77122	-0.2704	10	0.54805	T	0.06	-9.952	17.6643	0.88200	0.0:0.1229:0.8771:0.0	.	642;727;244;652;699	F5H6I3;B3KXR2;Q8N9Z6;Q92832-2;Q92832	.;.;.;.;NELL1_HUMAN	D	727;699;642;652	ENSP00000298925:G727D;ENSP00000349654:G699D;ENSP00000317837:G642D;ENSP00000437170:G652D	ENSP00000298925:G727D	G	+	2	0	NELL1	21549001	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.410000	0.73294	1.611000	0.50210	0.650000	0.86243	GGT	NELL1	-	pfam_VWF_C,smart_VWC_out,smart_VWF_C,pfscan_VWF_C	ENSG00000165973		0.473	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL1	HGNC	protein_coding	OTTHUMT00000387588.1	-	0.00	82	0	G	NM_006157		21592425	+1	tier1	-	no_errors	ENST00000357134	ensembl	human	known	74_37	missense	35.90	25	14	SNP	1.000	A
NF1	4763	genome.wustl.edu	37	17	29670040	29670040	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:29670040T>C	ENST00000358273.4	+	48	7459	c.7076T>C	c.(7075-7077)gTa>gCa	p.V2359A	NF1_ENST00000444181.2_Missense_Mutation_p.V152A|NF1_ENST00000356175.3_Missense_Mutation_p.V2338A|NF1_ENST00000417592.2_Missense_Mutation_p.V72A	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2359					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CCAGAGGAAGTATTTATGGCA	0.373			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)											95.0	98.0	97.0					17																	29670040		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.7076T>C	17.37:g.29670040T>C	ENSP00000351015:p.Val2359Ala		O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.V2359A	ENST00000358273.4	37	c.7076	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	T	27.3	4.821199	0.90873	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735;ENST00000444181;ENST00000417592	T;T;T;T	0.64085	2.88;3.02;2.71;-0.08	5.53	5.53	0.82687	Armadillo-type fold (2);	0.065085	0.64402	D	0.000011	T	0.77778	0.4181	M	0.74881	2.28	0.58432	D	0.999998	P;B	0.52577	0.954;0.138	D;B	0.67900	0.954;0.064	T	0.77378	-0.2610	10	0.38643	T	0.18	.	15.6743	0.77303	0.0:0.0:0.0:1.0	.	2338;2359	P21359-2;P21359	.;NF1_HUMAN	A	2359;2338;2004;152;72	ENSP00000351015:V2359A;ENSP00000348498:V2338A;ENSP00000389907:V2004A;ENSP00000396481:V152A	ENSP00000348498:V2338A	V	+	2	0	NF1	26694166	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.333000	0.79214	2.115000	0.64714	0.460000	0.39030	GTA	NF1	-	superfamily_ARM-type_fold	ENSG00000196712		0.373	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	-	0.00	38	0	T	NM_000267		29670040	+1	tier1	-	no_errors	ENST00000358273	ensembl	human	known	74_37	missense	80.00	12	52	SNP	1.000	C
NKAIN3	286183	genome.wustl.edu	37	8	63877990	63877990	+	Intron	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr8:63877990C>T	ENST00000523211.1	+	6	664				NKAIN3_ENST00000328472.5_Intron|NKAIN3_ENST00000519049.1_3'UTR	NM_173688.2	NP_775959.1	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(3)|large_intestine(2)|lung(8)	13	Breast(64;0.127)	Lung NSC(129;0.187)				ATTGACTGCGCGCCTCGGTGG	0.488																																																	0																																										SO:0001627	intron_variant	0			AK096949	CCDS55239.1	8q12.3	2014-08-12	2007-10-04	2007-10-04	ENSG00000185942	ENSG00000185942		"""Na+/K+ transporting ATPase interacting"""	26829	protein-coding gene	gene with protein product		612872	"""family with sequence similarity 77, member D"""	FAM77D		17606467	Standard	NM_173688		Approved	FLJ39630	uc010lyq.1	Q8N8D7	OTTHUMG00000164361	ENST00000523211.1:c.533-24737C>T	8.37:g.63877990C>T				RNA	SNP	-	NULL	ENST00000523211.1	37	NULL	CCDS55239.1	8																																																																																			NKAIN3	-	-	ENSG00000185942		0.488	NKAIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAIN3	HGNC	protein_coding	OTTHUMT00000378447.2	-	0.00	30	0	C	NM_173688		63877990	+1	tier1	-	no_errors	ENST00000519049	ensembl	human	known	74_37	rna	45.45	24	20	SNP	0.000	T
NKD2	85409	genome.wustl.edu	37	5	1038447	1038449	+	In_Frame_Del	DEL	CAC	CAC	-	rs3840989		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	CAC	CAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr5:1038447_1038449delCAC	ENST00000296849.5	+	10	1544_1546	c.1315_1317delCAC	c.(1315-1317)cacdel	p.H447del	NKD2_ENST00000274150.4_3'UTR|NKD2_ENST00000382730.2_In_Frame_Del_p.P86del	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	447	His-rich.				exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			ccaccacgagcaccaccaccacc	0.69																																																	0																																										SO:0001651	inframe_deletion	0			AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.1315_1317delCAC	5.37:g.1038456_1038458delCAC	ENSP00000296849:p.His447del		Q96EK8|Q9BSN0	In_Frame_Del	DEL	pfscan_EF_hand_dom	p.H442in_frame_del	ENST00000296849.5	37	c.1315_1317	CCDS3859.1	5																																																																																			NKD2	-	NULL	ENSG00000145506		0.690	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NKD2	HGNC	protein_coding	OTTHUMT00000206720.2		0.00	45	0	CAC	NM_033120		1038449	+1	tier1		no_errors	ENST00000296849	ensembl	human	known	74_37	in_frame_del	9.76	37	4	DEL	1.000:1.000:1.000	-
NLRP3	114548	genome.wustl.edu	37	1	247588309	247588309	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:247588309C>A	ENST00000336119.3	+	3	2310	c.1564C>A	c.(1564-1566)Cac>Aac	p.H522N	NLRP3_ENST00000391828.3_Missense_Mutation_p.H522N|NLRP3_ENST00000391827.2_Missense_Mutation_p.H522N|NLRP3_ENST00000348069.2_Missense_Mutation_p.H522N|NLRP3_ENST00000366496.2_Missense_Mutation_p.H522N|NLRP3_ENST00000366497.2_Missense_Mutation_p.H522N|NLRP3_ENST00000474792.1_3'UTR	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	522	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CAGCTTCATCCACATGACTTT	0.507																																																	0													69.0	63.0	65.0					1																	247588309		2203	4300	6503	SO:0001583	missense	0			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1564C>A	1.37:g.247588309C>A	ENSP00000337383:p.His522Asn		B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.H522N	ENST00000336119.3	37	c.1564	CCDS1632.1	1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.128957	0.77549	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35;-2.35;-2.35	4.17	4.17	0.49024	NACHT nucleoside triphosphatase (1);	0.000000	0.56097	D	0.000031	D	0.95677	0.8594	H	0.95402	3.665	0.47659	D	0.999481	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.995;1.0;0.998;0.994	D	0.95966	0.8966	10	0.72032	D	0.01	.	12.2773	0.54744	0.0:1.0:0.0:0.0	.	522;522;522;522;522	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	N	522	ENSP00000375704:H522N;ENSP00000355453:H522N;ENSP00000337383:H522N;ENSP00000294752:H522N;ENSP00000355452:H522N;ENSP00000375703:H522N	ENSP00000337383:H522N	H	+	1	0	NLRP3	245654932	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.757000	0.74924	2.612000	0.88384	0.655000	0.94253	CAC	NLRP3	-	pfscan_NACHT_NTPase	ENSG00000162711		0.507	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP3	HGNC	protein_coding	OTTHUMT00000097740.1		0.00	46	0	C	NM_004895		247588309	+1			no_errors	ENST00000336119	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	A
NLRP4	147945	genome.wustl.edu	37	19	56370074	56370074	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:56370074C>G	ENST00000301295.6	+	3	1737	c.1315C>G	c.(1315-1317)Ctg>Gtg	p.L439V	NLRP4_ENST00000346986.5_Missense_Mutation_p.L439V|NLRP4_ENST00000587891.1_Missense_Mutation_p.L364V	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	439	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CAAGATACTTCTGAAGTACGG	0.527																																																	0													128.0	124.0	125.0					19																	56370074		2203	4300	6503	SO:0001583	missense	0			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.1315C>G	19.37:g.56370074C>G	ENSP00000301295:p.Leu439Val		Q86W87|Q96AY6	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L439V	ENST00000301295.6	37	c.1315	CCDS12936.1	19	.	.	.	.	.	.	.	.	.	.	C	0.794	-0.757728	0.03019	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	D;D	0.83914	-1.78;-1.78	3.47	1.15	0.20763	.	.	.	.	.	T	0.67306	0.2879	N	0.19112	0.55	0.09310	N	1	B;B;B	0.31227	0.203;0.314;0.172	B;B;B	0.29176	0.099;0.046;0.015	T	0.53401	-0.8444	9	0.29301	T	0.29	.	6.6498	0.22955	0.1867:0.4182:0.3951:0.0	.	439;364;439	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	V	439	ENSP00000301295:L439V;ENSP00000344787:L439V	ENSP00000301295:L439V	L	+	1	2	NLRP4	61061886	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.288000	0.18939	0.244000	0.21351	-0.165000	0.13383	CTG	NLRP4	-	NULL	ENSG00000160505		0.527	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP4	HGNC	protein_coding	OTTHUMT00000457367.2	-	0.00	51	0	C	NM_134444		56370074	+1	tier1	-	no_errors	ENST00000301295	ensembl	human	known	74_37	missense	34.33	44	23	SNP	0.000	G
NLRP8	126205	genome.wustl.edu	37	19	56467321	56467321	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:56467321G>T	ENST00000291971.3	+	3	1968	c.1897G>T	c.(1897-1899)Gtc>Ttc	p.V633F	NLRP8_ENST00000590542.1_Missense_Mutation_p.V633F	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	633					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TCATAAAGTTGTCTTGAGAAT	0.463																																																	0													124.0	116.0	119.0					19																	56467321		2203	4300	6503	SO:0001583	missense	0			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.1897G>T	19.37:g.56467321G>T	ENSP00000291971:p.Val633Phe		Q7RTR4	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.V633F	ENST00000291971.3	37	c.1897	CCDS12937.1	19	.	.	.	.	.	.	.	.	.	.	G	10.66	1.413205	0.25465	.	.	ENSG00000179709	ENST00000291971	D	0.87571	-2.27	2.03	-3.94	0.04130	.	.	.	.	.	T	0.81631	0.4863	L	0.46157	1.445	0.09310	N	1	P;B	0.42785	0.79;0.08	P;B	0.44990	0.466;0.029	T	0.72481	-0.4280	9	0.54805	T	0.06	.	4.7461	0.13038	0.2735:0.2128:0.5137:0.0	.	633;633	Q86W28-2;Q86W28	.;NALP8_HUMAN	F	633	ENSP00000291971:V633F	ENSP00000291971:V633F	V	+	1	0	NLRP8	61159133	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.168000	0.00574	-1.137000	0.02888	-0.507000	0.04495	GTC	NLRP8	-	NULL	ENSG00000179709		0.463	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP8	HGNC	protein_coding	OTTHUMT00000457462.1	-	0.00	97	0	G	NM_176811		56467321	+1	tier1	-	no_errors	ENST00000291971	ensembl	human	known	74_37	missense	8.89	82	8	SNP	0.000	T
NOS1	4842	genome.wustl.edu	37	12	117718602	117718602	+	Silent	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:117718602G>A	ENST00000338101.4	-	7	1456	c.1452C>T	c.(1450-1452)ctC>ctT	p.L484L	NOS1_ENST00000317775.6_Silent_p.L484L|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		CGTAGCGGATGAGCTGGGAGT	0.627																																					Esophageal Squamous(162;1748 2599 51982 52956)												0													60.0	70.0	67.0					12																	117718602		2106	4251	6357	SO:0001819	synonymous_variant	0				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.1452C>T	12.37:g.117718602G>A				Silent	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,pfam_PDZ,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,superfamily_PDZ,smart_PDZ,pirsf_NOS_euk,pfscan_PDZ,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.L484	ENST00000338101.4	37	c.1452	CCDS55890.1	12																																																																																			NOS1	-	pfam_NO_synthase_oxygenase_dom,superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_euk	ENSG00000089250		0.627	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	HGNC	protein_coding	OTTHUMT00000268053.1	-	0.00	108	0	G			117718602	-1	tier1	-	no_errors	ENST00000317775	ensembl	human	known	74_37	silent	34.96	80	43	SNP	1.000	A
NOTCH3	4854	genome.wustl.edu	37	19	15300201	15300201	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:15300201G>T	ENST00000263388.2	-	7	1150	c.1075C>A	c.(1075-1077)Ccc>Acc	p.P359T		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	359	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			TCGTGGCAGGGGTTGCTGACA	0.592																																																	0													91.0	96.0	94.0					19																	15300201		2203	4300	6503	SO:0001583	missense	0			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.1075C>A	19.37:g.15300201G>T	ENSP00000263388:p.Pro359Thr		Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.P359T	ENST00000263388.2	37	c.1075	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	G	22.1	4.242065	0.79912	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.95171	-3.63	4.68	4.68	0.58851	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.97841	0.9291	M	0.92077	3.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99146	1.0857	9	0.87932	D	0	.	16.4553	0.84011	0.0:0.0:1.0:0.0	.	362;359	Q59FL3;Q9UM47	.;NOTC3_HUMAN	T	359;361	ENSP00000263388:P359T	ENSP00000263388:P359T	P	-	1	0	NOTCH3	15161201	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	9.280000	0.95786	2.175000	0.68902	0.306000	0.20318	CCC	NOTCH3	-	pirsf_Notch,pfam_EG-like_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000074181		0.592	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	-	0.00	32	0	G	NM_000435		15300201	-1	tier1	-	no_errors	ENST00000263388	ensembl	human	known	74_37	missense	44.64	31	25	SNP	1.000	T
NPLOC4	55666	genome.wustl.edu	37	17	79580153	79580154	+	Intron	INS	-	-	AAA	rs56233095|rs142821788|rs151110419|rs530668692	byFrequency	TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:79580153_79580154insAAA	ENST00000331134.6	-	4	602				NPLOC4_ENST00000574344.1_Intron|NPLOC4_ENST00000539314.1_Intron|NPLOC4_ENST00000374747.5_Intron	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)						ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			GATAAAAAGCTAAAAAAAAAAA	0.322														1812	0.361821	0.3926	0.3588	5008	,	,		19111	0.4663		0.1948	False		,,,				2504	0.3865																0																																										SO:0001627	intron_variant	0			AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.386+189->TTT	17.37:g.79580160_79580162dupAAA			Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Splice_Site	INS	-	NULL	ENST00000331134.6	37	c.NULL	CCDS45812.1	17																																																																																			NPLOC4	-	-	ENSG00000182446		0.322	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPLOC4	HGNC	protein_coding	OTTHUMT00000440140.1		0.00	16	0	-			79580154	-1	tier1		no_errors	ENST00000571562	ensembl	human	known	74_37	splice_site_ins	42.86	8	6	INS	0.011:0.010	AAA
NUFIP1	26747	genome.wustl.edu	37	13	45523907	45523907	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr13:45523907G>T	ENST00000379161.4	-	8	1134	c.1088C>A	c.(1087-1089)tCa>tAa	p.S363*		NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1	363					box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		ACTCATTAGTGAGCATAGGGC	0.438																																																	0													237.0	201.0	213.0					13																	45523907		2203	4300	6503	SO:0001587	stop_gained	0			AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.1088C>A	13.37:g.45523907G>T	ENSP00000368459:p.Ser363*		Q8WVM5|Q96SG1	Nonsense_Mutation	SNP	pfam_NUFIP1_cons_dom,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S363*	ENST00000379161.4	37	c.1088	CCDS9393.1	13	.	.	.	.	.	.	.	.	.	.	G	36	5.651339	0.96714	.	.	ENSG00000083635	ENST00000379161	.	.	.	5.9	4.88	0.63580	.	0.208569	0.42821	D	0.000655	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.4541	10.8484	0.46757	0.098:0.0:0.902:0.0	.	.	.	.	X	363	.	ENSP00000368459:S363X	S	-	2	0	NUFIP1	44421907	0.999000	0.42202	0.974000	0.42286	0.869000	0.49853	3.145000	0.50623	2.808000	0.96608	0.632000	0.83419	TCA	NUFIP1	-	NULL	ENSG00000083635		0.438	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUFIP1	HGNC	protein_coding	OTTHUMT00000044755.2		0.00	63	0	G	NM_012345		45523907	-1			no_errors	ENST00000379161	ensembl	human	known	74_37	nonsense	5.71	66	4	SNP	0.916	T
NYAP2	57624	genome.wustl.edu	37	2	226447490	226447490	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr2:226447490A>G	ENST00000272907.6	+	4	1770	c.1357A>G	c.(1357-1359)Agg>Ggg	p.R453G	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	453	Pro-rich.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GAGCCTCAAAAGGCCTCCCCC	0.622																																																	0													43.0	48.0	46.0					2																	226447490		2043	4199	6242	SO:0001583	missense	0			AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.1357A>G	2.37:g.226447490A>G	ENSP00000272907:p.Arg453Gly		A2RRN4|Q96NL2	Missense_Mutation	SNP	NULL	p.R453G	ENST00000272907.6	37	c.1357	CCDS46529.1	2	.	.	.	.	.	.	.	.	.	.	A	16.86	3.238846	0.58995	.	.	ENSG00000144460	ENST00000272907	T	0.34275	1.37	5.19	2.74	0.32292	.	0.000000	0.85682	D	0.000000	T	0.46756	0.1409	L	0.40543	1.245	0.80722	D	1	D	0.69078	0.997	D	0.79784	0.993	T	0.14337	-1.0476	10	0.30078	T	0.28	-28.398	11.9835	0.53133	0.7084:0.2916:0.0:0.0	.	453	Q9P242	K1486_HUMAN	G	453	ENSP00000272907:R453G	ENSP00000272907:R453G	R	+	1	2	KIAA1486	226155734	1.000000	0.71417	0.982000	0.44146	0.989000	0.77384	2.398000	0.44486	0.276000	0.22118	0.460000	0.39030	AGG	NYAP2	-	NULL	ENSG00000144460		0.622	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYAP2	HGNC	protein_coding	OTTHUMT00000331258.1	-	0.00	68	0	A	NM_020864		226447490	+1	tier1	-	no_errors	ENST00000272907	ensembl	human	known	74_37	missense	6.85	68	5	SNP	0.999	G
OR10Z1	128368	genome.wustl.edu	37	1	158576363	158576363	+	Silent	SNP	T	T	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:158576363T>A	ENST00000361284.1	+	1	135	c.135T>A	c.(133-135)atT>atA	p.I45I		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	45						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					ATGTCTTCATTATCATAGCCA	0.498																																																	0													239.0	227.0	231.0					1																	158576363		2203	4300	6503	SO:0001819	synonymous_variant	0			AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.135T>A	1.37:g.158576363T>A			Q5VYL0|Q6IFR7	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I45	ENST00000361284.1	37	c.135	CCDS30901.1	1																																																																																			OR10Z1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000198967		0.498	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Z1	HGNC	protein_coding	OTTHUMT00000051853.1	-	0.00	42	0	T	NM_001004478		158576363	+1	tier1	-	no_errors	ENST00000361284	ensembl	human	known	74_37	silent	31.25	33	15	SNP	0.398	A
OR13A1	79290	genome.wustl.edu	37	10	45799654	45799654	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr10:45799654G>A	ENST00000553795.1	-	4	525	c.217C>T	c.(217-219)Ctc>Ttc	p.L73F	OR13A1_ENST00000374401.2_Missense_Mutation_p.L73F|OR13A1_ENST00000536058.1_Missense_Mutation_p.L73F	NM_001004297.2	NP_001004297.2	Q8NGR1	O13A1_HUMAN	olfactory receptor, family 13, subfamily A, member 1	73						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)|urinary_tract(1)	19						GGAGCGTGGAGCCCAGGGTTG	0.512																																																	0													96.0	106.0	103.0					10																	45799654		2203	4300	6503	SO:0001583	missense	0			AB065728	CCDS31188.1	10q11.21	2012-10-03			ENSG00000256574	ENSG00000256574		"""GPCR / Class A : Olfactory receptors"""	14772	protein-coding gene	gene with protein product							Standard	NM_001004297		Approved		uc001jcc.1	Q8NGR1	OTTHUMG00000018080	ENST00000553795.1:c.217C>T	10.37:g.45799654G>A	ENSP00000451950:p.Leu73Phe		Q2M3M4|Q5VV57|Q6IFH5|Q6ZMN6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L73F	ENST00000553795.1	37	c.217	CCDS31188.1	10	.	.	.	.	.	.	.	.	.	.	g	17.46	3.394468	0.62066	.	.	ENSG00000256574	ENST00000553795;ENST00000536058;ENST00000374401	T;T;T	0.14391	2.51;2.51;2.51	5.14	5.14	0.70334	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37348	N	0.002137	T	0.42154	0.1190	M	0.89715	3.055	0.41672	D	0.989246	D	0.89917	1.0	D	0.97110	1.0	T	0.47018	-0.9149	10	0.72032	D	0.01	-83.0042	10.075	0.42355	0.0924:0.0:0.9076:0.0	.	73	Q8NGR1	O13A1_HUMAN	F	73	ENSP00000451950:L73F;ENSP00000438657:L73F;ENSP00000363522:L73F	ENSP00000311379:L73F	L	-	1	0	OR13A1	45119660	1.000000	0.71417	0.132000	0.22025	0.622000	0.37654	7.624000	0.83124	2.556000	0.86216	0.644000	0.83932	CTC	OR13A1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000256574		0.512	OR13A1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OR13A1	HGNC	protein_coding	OTTHUMT00000047779.2	-	0.00	55	0	G	NM_001004297		45799654	-1	tier1	-	no_errors	ENST00000374401	ensembl	human	known	74_37	missense	57.58	56	76	SNP	0.998	A
OR2F2	135948	genome.wustl.edu	37	7	143633228	143633228	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr7:143633228G>A	ENST00000408955.2	+	1	970	c.903G>A	c.(901-903)tgG>tgA	p.W301*		NM_001004685.1	NP_001004685.1	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F, member 2	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(19)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	32	Melanoma(164;0.0903)					AGGGGGCCTGGCATAAACTAT	0.418																																																	0													51.0	51.0	51.0					7																	143633228		2027	4227	6254	SO:0001587	stop_gained	0				CCDS43666.1	7q33-q35	2012-08-09			ENSG00000221910	ENSG00000221910		"""GPCR / Class A : Olfactory receptors"""	8247	protein-coding gene	gene with protein product							Standard	NM_001004685		Approved	OR7-1	uc011ktv.2	O95006	OTTHUMG00000157768	ENST00000408955.2:c.903G>A	7.37:g.143633228G>A	ENSP00000386222:p.Trp301*		A4D2G0|Q6IFP8	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.W301*	ENST00000408955.2	37	c.903	CCDS43666.1	7	.	.	.	.	.	.	.	.	.	.	G	11.26	1.585839	0.28268	.	.	ENSG00000221910	ENST00000408955	.	.	.	3.78	0.926	0.19430	.	0.000000	0.45361	D	0.000368	.	.	.	.	.	.	0.40535	D	0.980961	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-12.1698	3.2394	0.06776	0.2284:0.0:0.565:0.2066	.	.	.	.	X	301	.	ENSP00000386222:W301X	W	+	3	0	OR2F2	143264161	0.200000	0.23398	0.049000	0.19019	0.201000	0.24016	1.404000	0.34623	0.068000	0.16574	0.491000	0.48974	TGG	OR2F2	-	NULL	ENSG00000221910		0.418	OR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2F2	HGNC	protein_coding	OTTHUMT00000349570.1		0.00	33	0	G			143633228	+1			no_errors	ENST00000408955	ensembl	human	known	74_37	nonsense	5.88	48	3	SNP	0.697	A
OR6P1	128366	genome.wustl.edu	37	1	158532952	158532952	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:158532952G>T	ENST00000334632.1	-	1	442	c.443C>A	c.(442-444)tCt>tAt	p.S148Y		NM_001160325.1	NP_001153797.1	Q8NGX9	OR6P1_HUMAN	olfactory receptor, family 6, subfamily P, member 1	148						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|lung(1)	6						ACTGCCCCAAGAGGCAGCAGC	0.493																																																	0													51.0	49.0	50.0					1																	158532952		692	1591	2283	SO:0001583	missense	0			BK004193	CCDS53391.1	1q23.1	2012-08-09			ENSG00000186440	ENSG00000186440		"""GPCR / Class A : Olfactory receptors"""	15036	protein-coding gene	gene with protein product							Standard	NM_001160325		Approved		uc010pim.2	Q8NGX9	OTTHUMG00000019633	ENST00000334632.1:c.443C>A	1.37:g.158532952G>T	ENSP00000334721:p.Ser148Tyr		Q6IFR9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S148Y	ENST00000334632.1	37	c.443	CCDS53391.1	1	.	.	.	.	.	.	.	.	.	.	G	12.96	2.094624	0.36952	.	.	ENSG00000186440	ENST00000334632	T	0.39056	1.1	5.11	5.11	0.69529	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46145	D	0.000302	T	0.67915	0.2944	H	0.95043	3.615	0.37035	D	0.89685	D	0.76494	0.999	D	0.69824	0.966	T	0.77728	-0.2479	10	0.66056	D	0.02	.	13.2177	0.59869	0.0:0.1602:0.8398:0.0	.	148	Q8NGX9	OR6P1_HUMAN	Y	148	ENSP00000334721:S148Y	ENSP00000334721:S148Y	S	-	2	0	OR6P1	156799576	0.987000	0.35691	0.984000	0.44739	0.054000	0.15201	4.936000	0.63506	2.657000	0.90304	0.591000	0.81541	TCT	OR6P1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000186440		0.493	OR6P1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6P1	HGNC	protein_coding	OTTHUMT00000051848.1	-	0.00	39	0	G			158532952	-1	tier1	-	no_errors	ENST00000334632	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.958	T
OR8H1	219469	genome.wustl.edu	37	11	56058051	56058051	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:56058051C>G	ENST00000313022.2	-	1	515	c.488G>C	c.(487-489)aGc>aCc	p.S163T		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	163						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					ATGCAGTCTGCTCATCCAAAC	0.443																																																	0													93.0	85.0	88.0					11																	56058051		2201	4296	6497	SO:0001583	missense	0			AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.488G>C	11.37:g.56058051C>G	ENSP00000323595:p.Ser163Thr		B2RNI7|Q6IFC5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S163T	ENST00000313022.2	37	c.488	CCDS31526.1	11	.	.	.	.	.	.	.	.	.	.	C	10.72	1.428447	0.25726	.	.	ENSG00000181693	ENST00000313022;ENST00000395186	T	0.00123	8.7	3.64	-5.23	0.02798	GPCR, rhodopsin-like superfamily (1);	1.046160	0.07449	N	0.898620	T	0.00109	0.0003	L	0.37561	1.115	0.09310	N	1	B	0.14438	0.01	B	0.24974	0.057	T	0.14868	-1.0457	10	0.87932	D	0	.	4.5452	0.12078	0.307:0.2817:0.0:0.4113	.	163	Q8NGG4	OR8H1_HUMAN	T	163;159	ENSP00000323595:S163T	ENSP00000323595:S163T	S	-	2	0	OR8H1	55814627	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-1.500000	0.02283	-0.799000	0.04439	0.446000	0.29264	AGC	OR8H1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181693		0.443	OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H1	HGNC	protein_coding	OTTHUMT00000370019.1	-	0.00	35	0	C	NM_001005199		56058051	-1	tier1	-	no_errors	ENST00000313022	ensembl	human	known	74_37	missense	44.44	29	24	SNP	0.000	G
PCNX	22990	genome.wustl.edu	37	14	71495426	71495426	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr14:71495426G>T	ENST00000304743.2	+	16	3922	c.3476G>T	c.(3475-3477)aGc>aTc	p.S1159I	PCNX_ENST00000238570.5_Missense_Mutation_p.S1159I|PCNX_ENST00000439984.3_Missense_Mutation_p.S1048I	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1159						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GCCACTACAAGCCTGCTTGCA	0.303																																																	0													118.0	107.0	110.0					14																	71495426		2203	4300	6503	SO:0001583	missense	0			AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.3476G>T	14.37:g.71495426G>T	ENSP00000304192:p.Ser1159Ile		B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	pfam_Pecanex	p.S1159I	ENST00000304743.2	37	c.3476	CCDS9806.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.6|20.6	4.015523|4.015523	0.75161|0.75161	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000554691|ENST00000304743;ENST00000238570;ENST00000439984	.|T;T;T	.|0.13196	.|3.0;2.93;2.61	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.42743|0.42743	0.1216|0.1216	M|M	0.81497|0.81497	2.545|2.545	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.71674	.|0.997;0.997;0.998	.|D;D;D	.|0.80764	.|0.994;0.92;0.991	T|T	0.40175|0.40175	-0.9577|-0.9577	5|10	.|0.87932	.|D	.|0	.|.	19.2986|19.2986	0.94134|0.94134	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1159;1048;1159	.|Q96RV3-3;B2RTR6;Q96RV3	.|.;.;PCX1_HUMAN	S|I	218|1159;1159;1048	.|ENSP00000304192:S1159I;ENSP00000238570:S1159I;ENSP00000396617:S1048I	.|ENSP00000238570:S1159I	A|S	+|+	1|2	0|0	PCNX|PCNX	70565179|70565179	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.532000|0.532000	0.34746|0.34746	9.298000|9.298000	0.96132|0.96132	2.643000|2.643000	0.89663|0.89663	0.655000|0.655000	0.94253|0.94253	GCC|AGC	PCNX	-	NULL	ENSG00000100731		0.303	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNX	HGNC	protein_coding	OTTHUMT00000412479.1	-	0.00	63	0	G	NM_014982		71495426	+1	tier1	-	no_errors	ENST00000304743	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
PDCD4	27250	genome.wustl.edu	37	10	112644975	112644976	+	Intron	INS	-	-	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr10:112644975_112644976insT	ENST00000280154.7	+	5	715				PDCD4_ENST00000393104.2_Intron|PDCD4_ENST00000481353.1_3'UTR	NM_001199492.1|NM_014456.4	NP_001186421.1|NP_055271.2	Q53EL6	PDCD4_HUMAN	programmed cell death 4 (neoplastic transformation inhibitor)						apoptotic process (GO:0006915)|cell aging (GO:0007569)|negative regulation of cell cycle (GO:0045786)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	13		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		TTTGCATTTTGTTTTTTATAAC	0.327																																					Ovarian(115;1498 1603 9363 40056 40885)												0																																										SO:0001627	intron_variant	0			U83908	CCDS7567.1, CCDS44478.1	10q24	2008-08-01			ENSG00000150593	ENSG00000150593			8763	protein-coding gene	gene with protein product	"""nuclear antigen H731"""	608610				9759869	Standard	NM_014456		Approved	H731	uc001kzh.3	Q53EL6	OTTHUMG00000019048	ENST00000280154.7:c.442-35->T	10.37:g.112644981_112644981dupT			B2RCV4|B5ME91|O15501|Q5VZS6|Q6PJI5|Q8TAR5|Q99834	RNA	INS	-	NULL	ENST00000280154.7	37	NULL	CCDS7567.1	10																																																																																			PDCD4	-	-	ENSG00000150593		0.327	PDCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD4	HGNC	protein_coding	OTTHUMT00000050361.1		0.00	41	0	-	NM_014456		112644976	+1	tier1		no_errors	ENST00000481353	ensembl	human	known	74_37	rna	5.71	33	2	INS	0.088:0.102	T
PDE2A	5138	genome.wustl.edu	37	11	72301270	72301270	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:72301270T>C	ENST00000334456.5	-	9	967	c.722A>G	c.(721-723)gAt>gGt	p.D241G	RP11-169D4.2_ENST00000545254.1_RNA|PDE2A_ENST00000418754.2_Missense_Mutation_p.D126G|PDE2A_ENST00000376450.3_Intron|PDE2A_ENST00000444035.2_Missense_Mutation_p.D232G|PDE2A_ENST00000540345.1_Missense_Mutation_p.D232G|PDE2A_ENST00000544570.1_Missense_Mutation_p.D234G	NM_002599.4	NP_002590.1	O00408	PDE2A_HUMAN	phosphodiesterase 2A, cGMP-stimulated	241	GAF 1.				blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to drug (GO:0035690)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to mechanical stimulus (GO:0071260)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP catabolic process (GO:0046069)|cGMP-mediated signaling (GO:0019934)|establishment of endothelial barrier (GO:0061028)|metabolic process (GO:0008152)|monocyte differentiation (GO:0030224)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vascular permeability (GO:0043116)|positive regulation of inflammatory response (GO:0050729)|positive regulation of vascular permeability (GO:0043117)|protein targeting to mitochondrion (GO:0006626)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel activity (GO:0005262)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|drug binding (GO:0008144)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	36			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Caffeine(DB00201)|Tofisopam(DB08811)	GGAAGAGGCATCCAGGTCGTA	0.687											OREG0021197	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													47.0	42.0	44.0					11																	72301270		1900	3655	5555	SO:0001583	missense	0			U67733	CCDS8216.1, CCDS44670.1, CCDS53678.1, CCDS73345.1	11q13.1-q14.1	2008-05-14			ENSG00000186642	ENSG00000186642	3.1.4.17	"""Phosphodiesterases"""	8777	protein-coding gene	gene with protein product		602658				9210593	Standard	NM_002599		Approved		uc010rrc.2	O00408	OTTHUMG00000102045	ENST00000334456.5:c.722A>G	11.37:g.72301270T>C	ENSP00000334910:p.Asp241Gly	1136	B2R646|B3KRV5|E9PGI1|F6W5Z0|Q5J791|Q5J792|Q5J793|Q6ZMR1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.D241G	ENST00000334456.5	37	c.722	CCDS8216.1	11	.	.	.	.	.	.	.	.	.	.	T	22.8	4.334650	0.81801	.	.	ENSG00000186642	ENST00000334456;ENST00000444035;ENST00000429363;ENST00000544570;ENST00000418754;ENST00000540345;ENST00000475807	T;T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71;-0.71	4.43	4.43	0.53597	GAF (1);	1.297390	0.05474	N	0.553581	T	0.81884	0.4917	M	0.61703	1.905	0.39632	D	0.970187	B;D;D;P;D	0.64830	0.448;0.992;0.984;0.669;0.994	B;P;P;B;D	0.64237	0.13;0.887;0.664;0.313;0.923	T	0.72727	-0.4206	10	0.87932	D	0	.	10.303	0.43663	0.0:0.0:0.0:1.0	.	126;241;232;234;241	E9PEF1;O00408;E9PGI1;F6W5Z0;B2R646	.;PDE2A_HUMAN;.;.;.	G	241;232;310;234;126;232;65	ENSP00000334910:D241G;ENSP00000411657:D232G;ENSP00000442256:D234G;ENSP00000410310:D126G;ENSP00000446399:D232G;ENSP00000439077:D65G	ENSP00000334910:D241G	D	-	2	0	PDE2A	71978918	0.997000	0.39634	0.999000	0.59377	0.998000	0.95712	3.024000	0.49674	2.002000	0.58637	0.477000	0.44152	GAT	PDE2A	-	smart_GAF	ENSG00000186642		0.687	PDE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE2A	HGNC	protein_coding	OTTHUMT00000219839.2	-	0.00	36	0	T	NM_002599		72301270	-1	tier1	-	no_errors	ENST00000334456	ensembl	human	known	74_37	missense	50.82	30	31	SNP	1.000	C
KIF4A	24137	genome.wustl.edu	37	X	69510283	69510283	+	Intron	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chrX:69510283C>T	ENST00000374403.3	+	2	61				PDZD11_ENST00000374454.1_5'Flank|PDZD11_ENST00000239666.4_5'Flank|PDZD11_ENST00000473667.1_5'Flank|KIF4A_ENST00000485406.1_Intron|KIF4A_ENST00000374388.3_Intron	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A						anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						TTTTCCCCCTCGCAGAGACGG	0.577																																																	0													58.0	55.0	56.0					X																	69510283		2203	4300	6503	SO:0001627	intron_variant	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.-21-5C>T	X.37:g.69510283C>T			B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	RNA	SNP	-	NULL	ENST00000374403.3	37	NULL	CCDS14401.1	X																																																																																			PDZD11	-	-	ENSG00000120509		0.577	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD11	HGNC	protein_coding	OTTHUMT00000057068.1	-	0.00	26	0	C	NM_012310		69510283	-1	tier1	-	no_errors	ENST00000486461	ensembl	human	known	74_37	rna	92.86	5	65	SNP	0.000	T
PDZD4	57595	genome.wustl.edu	37	X	153095904	153095904	+	5'UTR	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chrX:153095904G>A	ENST00000164640.4	-	0	41				PDZD4_ENST00000475140.1_5'Flank|PDZD4_ENST00000544474.1_5'Flank|PDZD4_ENST00000393758.2_5'Flank	NM_032512.2	NP_115901.2	Q76G19	PDZD4_HUMAN	PDZ domain containing 4							cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(5)|lung(13)|skin(1)	23	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCACGCCCCCGAGGTGGGGGC	0.781																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK091444	CCDS14732.1	Xq28	2008-02-05		2006-01-24	ENSG00000067840	ENSG00000067840			21167	protein-coding gene	gene with protein product		300634		PDZK4		10819331, 15077175	Standard	NM_032512		Approved	KIAA1444, LU1, FLJ34125, PDZRN4L	uc004fiz.1	Q76G19	OTTHUMG00000024209	ENST00000164640.4:c.-151C>T	X.37:g.153095904G>A			B3KXB1|B7ZKY3|Q8NB75|Q9BUH9|Q9P284	RNA	SNP	-	NULL	ENST00000164640.4	37	NULL	CCDS14732.1	X																																																																																			PDZD4	-	-	ENSG00000067840		0.781	PDZD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD4	HGNC	protein_coding	OTTHUMT00000061013.3	-	0.00	10	0	G	NM_032512		153095904	-1	tier1	-	no_errors	ENST00000480418	ensembl	human	known	74_37	rna	78.57	3	11	SNP	0.556	A
PDZK1IP1	10158	genome.wustl.edu	37	1	47653002	47653002	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:47653002G>T	ENST00000294338.2	-	2	287	c.165C>A	c.(163-165)tgC>tgA	p.C55*	PDZK1IP1_ENST00000491793.1_5'Flank|PDZK1IP1_ENST00000371885.1_Nonsense_Mutation_p.C55*	NM_005764.3	NP_005755.1	Q13113	PDZ1I_HUMAN	PDZK1 interacting protein 1	55						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|lung(1)|prostate(1)	3						GCTCCTCCTGGCACCAGAAGT	0.617																																																	0													50.0	44.0	46.0					1																	47653002		2203	4299	6502	SO:0001587	stop_gained	0			U21049	CCDS546.1	1p33	2008-02-05			ENSG00000162366	ENSG00000162366			16887	protein-coding gene	gene with protein product		607178				9815914, 8701988, 12754212, 12837682	Standard	NM_005764		Approved	DD96, MAP17, SPAP	uc001cqw.3	Q13113	OTTHUMG00000007852	ENST00000294338.2:c.165C>A	1.37:g.47653002G>T	ENSP00000294338:p.Cys55*		Q6ICT9|Q96EI1	Nonsense_Mutation	SNP	NULL	p.C55*	ENST00000294338.2	37	c.165	CCDS546.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.305024	0.95601	.	.	ENSG00000162366	ENST00000294338;ENST00000371885	.	.	.	4.48	2.59	0.31030	.	0.000000	0.51477	D	0.000086	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.0437	6.7462	0.23462	0.2152:0.0:0.7848:0.0	.	.	.	.	X	55	.	ENSP00000294338:C55X	C	-	3	2	PDZK1IP1	47425589	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	0.557000	0.23454	0.612000	0.30071	0.563000	0.77884	TGC	PDZK1IP1	-	NULL	ENSG00000162366		0.617	PDZK1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZK1IP1	HGNC	protein_coding	OTTHUMT00000021655.1		0.00	76	0	G	NM_005764		47653002	-1			no_errors	ENST00000294338	ensembl	human	known	74_37	nonsense	5.00	95	5	SNP	1.000	T
PEMT	10400	genome.wustl.edu	37	17	17412098	17412098	+	Intron	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:17412098G>T	ENST00000395783.1	-	5	647				RP11-524F11.1_ENST00000582325.1_RNA|PEMT_ENST00000484838.2_Intron|PEMT_ENST00000395781.2_Intron|PEMT_ENST00000255389.5_Intron|PEMT_ENST00000395782.1_Intron|PEMT_ENST00000435340.2_Intron	NM_007169.2	NP_009100.2	Q9UBM1	PEMT_HUMAN	phosphatidylethanolamine N-methyltransferase						cell proliferation (GO:0008283)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	phosphatidyl-N-dimethylethanolamine N-methyltransferase activity (GO:0080101)|phosphatidyl-N-methylethanolamine N-methyltransferase activity (GO:0000773)|phosphatidylethanolamine N-methyltransferase activity (GO:0004608)			endometrium(1)|kidney(1)|large_intestine(2)|prostate(3)	7				Colorectal(2;0.0157)|READ - Rectum adenocarcinoma(2;0.0891)		GCAGTTCTAGGCTTCCCTCAT	0.632																																																	0																																										SO:0001627	intron_variant	0			AF176806	CCDS11186.1, CCDS11187.1, CCDS58520.1	17p11.2	2008-02-05			ENSG00000133027	ENSG00000133027	2.1.1.17		8830	protein-coding gene	gene with protein product		602391				9989271, 17881348	Standard	NM_148173		Approved	PEMPT, PEMT2	uc002grl.4	Q9UBM1	OTTHUMG00000059290	ENST00000395783.1:c.467+649C>A	17.37:g.17412098G>T			A8MZ66|B4DY41|D3DXC3|Q6IAQ5|Q86VL3|Q9BW86|Q9UHY6|Q9Y6V9	RNA	SNP	-	NULL	ENST00000395783.1	37	NULL	CCDS11187.1	17																																																																																			PEMT	-	-	ENSG00000133027		0.632	PEMT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PEMT	HGNC	protein_coding	OTTHUMT00000131657.1	-	0.00	51	0	G	NM_007169		17412098	-1	tier1	-	no_errors	ENST00000421096	ensembl	human	known	74_37	rna	5.80	65	4	SNP	0.007	T
PENK	5179	genome.wustl.edu	37	8	57354245	57354245	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr8:57354245C>G	ENST00000314922.3	-	2	466	c.390G>C	c.(388-390)gaG>gaC	p.E130D	PENK_ENST00000451791.2_Missense_Mutation_p.E130D|PENK_ENST00000523274.1_5'UTR	NM_006211.3	NP_006202.1	P01210	PENK_HUMAN	proenkephalin	130					aggressive behavior (GO:0002118)|behavioral fear response (GO:0001662)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|startle response (GO:0001964)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	21		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			TGGCGAGGATCTCACTTCCAT	0.502																																																	0													118.0	107.0	111.0					8																	57354245		2203	4300	6503	SO:0001583	missense	0				CCDS6168.1	8q23-q24	2013-02-26				ENSG00000181195		"""Endogenous ligands"""	8831	protein-coding gene	gene with protein product	"""preproenkephalin"""	131330				6281660	Standard	NM_006211		Approved		uc003xsz.2	P01210		ENST00000314922.3:c.390G>C	8.37:g.57354245C>G	ENSP00000324248:p.Glu130Asp		B2RC23|Q6FHC6|Q6FHE6	Missense_Mutation	SNP	pfam_Opioid_neupept,prints_Proenkphlin_A,prints_Opioid_neupept	p.E130D	ENST00000314922.3	37	c.390	CCDS6168.1	8	.	.	.	.	.	.	.	.	.	.	C	12.08	1.831078	0.32329	.	.	ENSG00000181195	ENST00000539312;ENST00000314922;ENST00000451791	T;T	0.19938	2.11;2.11	5.71	-9.3	0.00649	.	0.186474	0.47455	D	0.000222	T	0.17195	0.0413	L	0.49126	1.545	0.54753	D	0.999981	B	0.25390	0.125	B	0.24701	0.055	T	0.03630	-1.1018	10	0.46703	T	0.11	-29.7905	18.9436	0.92613	0.0:0.7255:0.0857:0.1888	.	130	P01210	PENK_HUMAN	D	130	ENSP00000324248:E130D;ENSP00000400894:E130D	ENSP00000324248:E130D	E	-	3	2	PENK	57516799	0.010000	0.17322	0.001000	0.08648	0.840000	0.47671	-1.477000	0.02331	-1.489000	0.01844	-0.302000	0.09304	GAG	PENK	-	prints_Proenkphlin_A	ENSG00000181195		0.502	PENK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PENK	HGNC	protein_coding	OTTHUMT00000378645.1	-	0.00	85	0	C			57354245	-1	tier1	-	no_errors	ENST00000314922	ensembl	human	known	74_37	missense	31.11	62	28	SNP	0.000	G
PHF20L1	51105	genome.wustl.edu	37	8	133844636	133844636	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr8:133844636G>T	ENST00000395386.2	+	15	2200	c.1901G>T	c.(1900-1902)aGt>aTt	p.S634I	PHF20L1_ENST00000395390.2_Missense_Mutation_p.S609I|PHF20L1_ENST00000220847.7_Missense_Mutation_p.S21I	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	634							zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			GTTGATCTTAGTGGTGAAAGT	0.393																																																	0													123.0	111.0	115.0					8																	133844636		1885	4105	5990	SO:0001583	missense	0			AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.1901G>T	8.37:g.133844636G>T	ENSP00000378784:p.Ser634Ile		A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD	p.S21I	ENST00000395386.2	37	c.62	CCDS6367.2	8	.	.	.	.	.	.	.	.	.	.	G	20.9	4.066770	0.76301	.	.	ENSG00000129292	ENST00000395386;ENST00000220847;ENST00000395390	T;T	0.33438	1.41;1.41	5.77	5.77	0.91146	.	0.651897	0.14981	N	0.287274	T	0.43831	0.1265	L	0.44542	1.39	0.41863	D	0.990235	D;D	0.58268	0.982;0.969	P;P	0.58780	0.845;0.704	T	0.04153	-1.0973	10	0.38643	T	0.18	-16.633	14.8889	0.70590	0.0:0.1429:0.8571:0.0	.	609;634	F8W9L8;A8MW92	.;P20L1_HUMAN	I	634;21;609	ENSP00000378784:S634I;ENSP00000378788:S609I	ENSP00000220847:S21I	S	+	2	0	PHF20L1	133913818	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.269000	0.65542	2.890000	0.99128	0.650000	0.86243	AGT	PHF20L1	-	NULL	ENSG00000129292		0.393	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	PHF20L1	HGNC	protein_coding	OTTHUMT00000308949.3	-	0.00	62	0	G	NM_016018		133844636	+1	tier1	-	no_errors	ENST00000220847	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
PI4KA	5297	genome.wustl.edu	37	22	21161744	21161744	+	Silent	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr22:21161744G>T	ENST00000572273.1	-	10	1130	c.900C>A	c.(898-900)gcC>gcA	p.A300A	PI4KA_ENST00000255882.6_Silent_p.A358A			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	300					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.A300A(2)		breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			CACTGGGGTTGGCCTGCAGGG	0.527																																					GBM(136;1332 1831 3115 23601 50806)												2	Substitution - coding silent(2)	prostate(2)											142.0	100.0	114.0					22																	21161744		2203	4300	6503	SO:0001819	synonymous_variant	0			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.900C>A	22.37:g.21161744G>T			Q7Z625|Q9UPG2	Silent	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.A358	ENST00000572273.1	37	c.1074		22																																																																																			PI4KA	-	superfamily_ARM-type_fold	ENSG00000241973		0.527	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	PI4KA	HGNC	protein_coding		-	0.00	46	0	G	NM_058004		21161744	-1	tier1	-	no_errors	ENST00000255882	ensembl	human	known	74_37	silent	6.56	57	4	SNP	0.999	T
PIGN	23556	genome.wustl.edu	37	18	59806282	59806282	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr18:59806282G>T	ENST00000357637.5	-	13	1465	c.1050C>A	c.(1048-1050)aaC>aaA	p.N350K	PIGN_ENST00000400334.3_Missense_Mutation_p.N350K	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	350					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				GATCAGTGTTGTTAAGATAAT	0.348																																																	0													57.0	53.0	54.0					18																	59806282		1822	4084	5906	SO:0001583	missense	0			AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.1050C>A	18.37:g.59806282G>T	ENSP00000350263:p.Asn350Lys		Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	pfam_GPI_EtnP_transferase_1_C,pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.N350K	ENST00000357637.5	37	c.1050	CCDS45879.1	18	.	.	.	.	.	.	.	.	.	.	G	14.93	2.681292	0.47991	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.26373	1.74;1.74	5.77	2.97	0.34412	.	0.000000	0.85682	D	0.000000	T	0.24353	0.0590	L	0.60455	1.87	0.58432	D	0.999998	P;P	0.38617	0.454;0.64	B;B	0.39379	0.235;0.298	T	0.01879	-1.1255	9	.	.	.	-17.9003	7.7818	0.29070	0.4124:0.0:0.5876:0.0	.	350;350	B2RCI8;O95427	.;PIGN_HUMAN	K	350	ENSP00000350263:N350K;ENSP00000383188:N350K	.	N	-	3	2	PIGN	57957262	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	0.950000	0.29122	0.343000	0.23821	-0.237000	0.12165	AAC	PIGN	-	pfam_Sulfatase	ENSG00000197563		0.348	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	PIGN	HGNC	protein_coding	OTTHUMT00000449757.2		0.00	50	0	G	NM_176787		59806282	-1			no_errors	ENST00000357637	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
PIK3R2	5296	genome.wustl.edu	37	19	18273933	18273933	+	Silent	SNP	C	C	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:18273933C>G	ENST00000593731.1	+	10	1826	c.1266C>G	c.(1264-1266)ctC>ctG	p.L422L	PIK3R2_ENST00000222254.8_Silent_p.L422L			O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	422	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	phosphatidylinositol 3-kinase regulator activity (GO:0035014)|receptor tyrosine kinase binding (GO:0030971)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(3)|pancreas(1)|stomach(1)	24					Isoprenaline(DB01064)	CACGGCTCCTCTACCCTGTGT	0.607																																																	0													92.0	75.0	80.0					19																	18273933		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12371.1	19p13.11	2013-03-28	2008-02-04		ENSG00000105647	ENSG00000105647		"""SH2 domain containing"""	8980	protein-coding gene	gene with protein product		603157				1314371	Standard	NM_005027		Approved	P85B, p85	uc002nia.2	O00459	OTTHUMG00000183383	ENST00000593731.1:c.1266C>G	19.37:g.18273933C>G			Q5EAT5|Q9UPH9	Silent	SNP	pfam_SH2,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_SH3_domain,smart_RhoGAP_dom,smart_SH2,pfscan_SH2,pfscan_SH3_domain,pfscan_RhoGAP_dom,prints_PI3kinase_P85,prints_SH2	p.L422	ENST00000593731.1	37	c.1266	CCDS12371.1	19																																																																																			PIK3R2	-	pfscan_SH2,prints_PI3kinase_P85	ENSG00000105647		0.607	PIK3R2-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	PIK3R2	HGNC	protein_coding	OTTHUMT00000466386.2	-	0.00	48	0	C	NM_005027		18273933	+1	tier1	-	no_errors	ENST00000222254	ensembl	human	known	74_37	silent	39.13	28	18	SNP	0.987	G
PLB1	151056	genome.wustl.edu	37	2	28805347	28805347	+	Missense_Mutation	SNP	G	G	T	rs377534411	byFrequency	TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr2:28805347G>T	ENST00000327757.5	+	25	1752	c.1708G>T	c.(1708-1710)Gtc>Ttc	p.V570F	PLB1_ENST00000329020.6_Missense_Mutation_p.V258F|PLB1_ENST00000422425.2_Missense_Mutation_p.V559F	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	570	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					GGAGAAAAAAGTCTACTGCCC	0.502																																																	0													66.0	58.0	60.0					2																	28805347		2203	4300	6503	SO:0001583	missense	0				CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.1708G>T	2.37:g.28805347G>T	ENSP00000330442:p.Val570Phe		A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	pfam_Lipase_GDSL	p.V559F	ENST00000327757.5	37	c.1675	CCDS33168.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.32|15.32	2.798840|2.798840	0.50208|0.50208	.|.	.|.	ENSG00000163803|ENSG00000163803	ENST00000404858|ENST00000327757;ENST00000422425;ENST00000436544;ENST00000329020	T|T;T;T;T	0.49432|0.15834	0.78|2.67;2.39;2.68;2.69	5.51|5.51	3.68|3.68	0.42216|0.42216	.|Esterase, SGNH hydrolase-type (1);Lipase, GDSL (1);	.|0.343207	.|0.26991	.|N	.|0.021474	T|T	0.27063|0.27063	0.0663|0.0663	L|L	0.50993|0.50993	1.605|1.605	0.09310|0.09310	N|N	1|1	.|D;D;P;D	.|0.67145	.|0.981;0.996;0.9;0.983	.|P;D;P;D	.|0.65684	.|0.876;0.937;0.673;0.926	T|T	0.07986|0.07986	-1.0744|-1.0744	7|10	0.30854|0.10902	T|T	0.27|0.67	-15.2064|-15.2064	9.6633|9.6633	0.39969|0.39969	0.1678:0.0:0.8322:0.0|0.1678:0.0:0.8322:0.0	.|.	.|559;570;258;570	.|Q6P1J6-3;Q6P1J6-4;Q6P1J6-2;Q6P1J6	.|.;.;.;PLB1_HUMAN	N|F	557|570;559;280;258	ENSP00000384187:K557N|ENSP00000330442:V570F;ENSP00000416440:V559F;ENSP00000392493:V280F;ENSP00000330729:V258F	ENSP00000384187:K557N|ENSP00000330442:V570F	K|V	+|+	3|1	2|0	PLB1|PLB1	28658851|28658851	0.000000|0.000000	0.05858|0.05858	0.004000|0.004000	0.12327|0.12327	0.441000|0.441000	0.31987|0.31987	-0.127000|-0.127000	0.10547|0.10547	1.317000|1.317000	0.45149|0.45149	0.561000|0.561000	0.74099|0.74099	AAG|GTC	PLB1	-	pfam_Lipase_GDSL	ENSG00000163803		0.502	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PLB1	HGNC	protein_coding	OTTHUMT00000353348.2		0.00	45	0	G			28805347	+1			no_errors	ENST00000422425	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.001	T
PLCL1	5334	genome.wustl.edu	37	2	198949560	198949560	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr2:198949560G>T	ENST00000428675.1	+	2	1717	c.1319G>T	c.(1318-1320)cGa>cTa	p.R440L	PLCL1_ENST00000437704.2_Missense_Mutation_p.R342L	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	440	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	ATGGGCTGTCGAAGCGTTGAA	0.408																																																	0													62.0	60.0	61.0					2																	198949560		2203	4300	6503	SO:0001583	missense	0			D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.1319G>T	2.37:g.198949560G>T	ENSP00000402861:p.Arg440Leu		Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.R440L	ENST00000428675.1	37	c.1319	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.068466	0.76301	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.81415	-1.49;-1.49	5.94	5.94	0.96194	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.000000	0.53938	D	0.000051	D	0.93871	0.8039	H	0.96861	3.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95042	0.8179	9	.	.	.	.	20.3632	0.98871	0.0:0.0:1.0:0.0	.	440;366	Q15111;B4DYZ4	PLCL1_HUMAN;.	L	440;342	ENSP00000402861:R440L;ENSP00000414138:R342L	.	R	+	2	0	PLCL1	198657805	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	9.855000	0.99526	2.826000	0.97356	0.561000	0.74099	CGA	PLCL1	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom,prints_Pinositol_PLipase_C	ENSG00000115896		0.408	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	HGNC	protein_coding	OTTHUMT00000340210.1		0.00	41	0	G	NM_006226		198949560	+1			no_errors	ENST00000428675	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
PLP2	5355	genome.wustl.edu	37	X	49028406	49028406	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chrX:49028406C>T	ENST00000376327.5	+	1	134	c.59C>T	c.(58-60)tCg>tTg	p.S20L	PLP2_ENST00000376322.3_Missense_Mutation_p.S20L	NM_002668.2	NP_002659.1	Q04941	PLP2_HUMAN	proteolipid protein 2 (colonic epithelium-enriched)	20	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chemokine binding (GO:0019956)|ion transmembrane transporter activity (GO:0015075)			endometrium(3)|large_intestine(1)|lung(6)|urinary_tract(3)	13						ACCAACTTCTCGCGCACTCGA	0.637																																																	0													47.0	35.0	39.0					X																	49028406		2203	4300	6503	SO:0001583	missense	0			L09604	CCDS14319.1	Xp11.23	2008-08-01			ENSG00000102007	ENSG00000102007			9087	protein-coding gene	gene with protein product	"""A4 differentiation-dependent protein"""	300112				8470895, 7622043	Standard	NM_002668		Approved	A4, A4-LSB, MGC126187	uc004dmx.3	Q04941	OTTHUMG00000021513	ENST00000376327.5:c.59C>T	X.37:g.49028406C>T	ENSP00000365505:p.Ser20Leu		A6NDT7|Q32MM8	Missense_Mutation	SNP	pfam_Marvel	p.S20L	ENST00000376327.5	37	c.59	CCDS14319.1	X	.	.	.	.	.	.	.	.	.	.	C	4.138	0.023997	0.08006	.	.	ENSG00000102007	ENST00000376322;ENST00000376327	T;T	0.25749	1.8;1.78	5.08	-2.08	0.07254	Marvel (1);	1.145400	0.06437	N	0.725171	T	0.08891	0.0220	N	0.03268	-0.37	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.32903	-0.9889	10	0.07175	T	0.84	-0.007	5.868	0.18786	0.1306:0.2863:0.4986:0.0845	.	20	Q04941	PLP2_HUMAN	L	20	ENSP00000365500:S20L;ENSP00000365505:S20L	ENSP00000365500:S20L	S	+	2	0	PLP2	48915350	0.007000	0.16637	0.004000	0.12327	0.927000	0.56198	-0.549000	0.06041	-0.565000	0.06061	0.506000	0.49869	TCG	PLP2	-	NULL	ENSG00000102007		0.637	PLP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLP2	HGNC	protein_coding	OTTHUMT00000056540.1	-	0.00	73	0	C	NM_002668		49028406	+1	tier1	-	no_errors	ENST00000376327	ensembl	human	known	74_37	missense	72.63	26	69	SNP	0.001	T
POMGNT2	84892	genome.wustl.edu	37	3	43121238	43121238	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr3:43121238G>T	ENST00000344697.2	-	2	2031	c.1686C>A	c.(1684-1686)tgC>tgA	p.C562*	POMGNT2_ENST00000441964.1_Nonsense_Mutation_p.C562*	NM_032806.5	NP_116195.2	Q8NAT1	PMGT2_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)	562	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein O-GlcNAc transferase activity (GO:0097363)										TGTTGAAGATGCAGCGGACCC	0.582																																																	0													86.0	71.0	76.0					3																	43121238		2203	4300	6503	SO:0001587	stop_gained	0			AK092147	CCDS2709.1	3p22.1	2014-07-15	2013-08-22	2013-08-22	ENSG00000144647	ENSG00000144647			25902	protein-coding gene	gene with protein product		614828	"""chromosome 3 open reading frame 39"", ""glycosyltransferase-like domain containing 2"""	C3orf39, GTDC2		12477932	Standard	NM_032806		Approved	FLJ14566, AGO61	uc003cmr.2	Q8NAT1	OTTHUMG00000133038	ENST00000344697.2:c.1686C>A	3.37:g.43121238G>T	ENSP00000344125:p.Cys562*		B3KWC3|Q96SY3	Nonsense_Mutation	SNP	pfam_Glycosyltransferase_AER61,superfamily_Fibronectin_type3	p.C562*	ENST00000344697.2	37	c.1686	CCDS2709.1	3	.	.	.	.	.	.	.	.	.	.	G	38	7.157617	0.98103	.	.	ENSG00000144647	ENST00000441964;ENST00000344697	.	.	.	5.57	4.68	0.58851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-42.2816	13.956	0.64150	0.074:0.0:0.926:0.0	.	.	.	.	X	562	.	ENSP00000344125:C562X	C	-	3	2	C3orf39	43096242	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.777000	0.68931	1.320000	0.45209	0.655000	0.94253	TGC	POMGNT2	-	superfamily_Fibronectin_type3	ENSG00000144647		0.582	POMGNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMGNT2	HGNC	protein_coding	OTTHUMT00000256643.1		0.00	26	0	G	NM_032806		43121238	-1			no_errors	ENST00000344697	ensembl	human	known	74_37	nonsense	7.41	50	4	SNP	1.000	T
PRAMEF6	440561	genome.wustl.edu	37	1	13001128	13001128	+	Silent	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:13001128C>T	ENST00000376189.1	-	3	654	c.555G>A	c.(553-555)ctG>ctA	p.L185L	PRAMEF6_ENST00000415464.2_Silent_p.L185L|PRAMEF6_ENST00000376192.5_Intron	NM_001010889.2	NP_001010889.1	Q5VXH4	PRAM6_HUMAN	PRAME family member 6	185					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|kidney(1)|lung(5)|urinary_tract(2)	9	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCAAAATTTTCAGCTTCTTAC	0.458																																																	0													10.0	17.0	15.0					1																	13001128		1002	2193	3195	SO:0001819	synonymous_variant	0				CCDS30594.1	1p36.21	2013-01-17				ENSG00000232423		"""-"""	30583	protein-coding gene	gene with protein product							Standard	NM_001010889		Approved		uc001auq.2	Q5VXH4	OTTHUMG00000001984	ENST00000376189.1:c.555G>A	1.37:g.13001128C>T			A0AUJ9	Silent	SNP	NULL	p.L185	ENST00000376189.1	37	c.555	CCDS30594.1	1																																																																																			PRAMEF6	-	NULL	ENSG00000232423		0.458	PRAMEF6-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRAMEF6	HGNC	protein_coding		-	0.00	91	0	C	NM_001010889		13001128	-1	tier1	-	no_errors	ENST00000355096	ensembl	human	known	74_37	silent	31.58	39	18	SNP	0.002	T
PRIM2	5558	genome.wustl.edu	37	6	57512478	57512478	+	3'UTR	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr6:57512478G>A	ENST00000389488.2	+	0	1393				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ACAGGTGGGTGATTGTGGCTT	0.318																																																	0													208.0	174.0	185.0					6																	57512478		1924	4141	6065	SO:0001624	3_prime_UTR_variant	0				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1390G>A	6.37:g.57512478G>A			Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	SNP	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			PRIM2	-	-	ENSG00000146143		0.318	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	HGNC	protein_coding	OTTHUMT00000043468.3	-	0.00	110	0	G	NM_000947		57512478	+1	tier1	-	no_errors	ENST00000389488	ensembl	human	known	74_37	rna	11.03	121	15	SNP	1.000	A
PRDM1	639	genome.wustl.edu	37	6	106553478	106553478	+	Silent	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr6:106553478G>A	ENST00000369096.4	+	5	1677	c.1443G>A	c.(1441-1443)ccG>ccA	p.P481P	PRDM1_ENST00000369089.3_Silent_p.P347P|PRDM1_ENST00000369091.2_Silent_p.P445P	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	481					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E446fs*30(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		TGCTCCAGCCGGAGCATCCCA	0.677			"""D, N, Mis, F, S"""		DLBCL																																			Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	1	Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)											37.0	46.0	43.0					6																	106553478		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.1443G>A	6.37:g.106553478G>A			B2REA6|E1P5E0|Q86WM7	Silent	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pirsf_Znf_PRDM1,pfscan_SET_dom,pfscan_Znf_C2H2	p.P481	ENST00000369096.4	37	c.1443	CCDS5054.2	6																																																																																			PRDM1	-	pirsf_Znf_PRDM1	ENSG00000057657		0.677	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM1	HGNC	protein_coding	OTTHUMT00000041661.3	-	0.00	51	0	G			106553478	+1	tier1	-	no_errors	ENST00000369096	ensembl	human	known	74_37	silent	73.53	9	25	SNP	0.000	A
PRKAG1	5571	genome.wustl.edu	37	12	49396786	49396786	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:49396786G>T	ENST00000548065.1	-	12	1348	c.892C>A	c.(892-894)Cac>Aac	p.H298N	PRKAG1_ENST00000547306.1_Missense_Mutation_p.H247N|RP11-386G11.5_ENST00000547395.1_RNA|RP11-386G11.5_ENST00000552933.1_RNA|RP11-386G11.5_ENST00000552284.1_RNA|PRKAG1_ENST00000395170.3_Missense_Mutation_p.H214N|PRKAG1_ENST00000552212.1_Missense_Mutation_p.H266N|PRKAG1_ENST00000316299.5_Missense_Mutation_p.H307N|RP11-386G11.5_ENST00000547866.1_RNA			P54619	AAKG1_HUMAN	protein kinase, AMP-activated, gamma 1 non-catalytic subunit	298	CBS 4. {ECO:0000255|PROSITE- ProRule:PRU00703}.				cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|insulin receptor signaling pathway (GO:0008286)|membrane organization (GO:0061024)|positive regulation of gene expression (GO:0010628)|positive regulation of protein kinase activity (GO:0045860)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of glycolytic process (GO:0006110)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	9					Acetylsalicylic acid(DB00945)	ACAAGTCGGTGAACCTGGCAC	0.542																																																	0													147.0	121.0	130.0					12																	49396786		2203	4300	6503	SO:0001583	missense	0			U42412	CCDS8777.1, CCDS55824.1, CCDS55825.1	12q12-q14	1998-07-16				ENSG00000181929			9385	protein-coding gene	gene with protein product		602742				8557660, 8621499	Standard	NM_002733		Approved		uc001rsz.3	P54619	OTTHUMG00000170406	ENST00000548065.1:c.892C>A	12.37:g.49396786G>T	ENSP00000447433:p.His298Asn		B4DDT7|Q8N7V9	Missense_Mutation	SNP	pfam_CBS_dom,smart_CBS_dom	p.H298N	ENST00000548065.1	37	c.892	CCDS8777.1	12	.	.	.	.	.	.	.	.	.	.	G	15.71	2.913388	0.52439	.	.	ENSG00000181929	ENST00000548362;ENST00000395170;ENST00000547306;ENST00000316299;ENST00000548065;ENST00000552212;ENST00000551770;ENST00000551696	D;D;D;D;D;D;D;D	0.92595	-3.07;-3.07;-3.07;-3.07;-3.07;-3.07;-3.07;-3.07	5.18	5.18	0.71444	Aldolase-type TIM barrel (1);Cystathionine beta-synthase, core (3);	0.000000	0.85682	D	0.000000	D	0.95720	0.8608	M	0.75777	2.31	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.73380	0.955;0.98	D	0.95716	0.8762	10	0.62326	D	0.03	-13.4702	17.6229	0.88087	0.0:0.0:1.0:0.0	.	307;298	Q8N7V9;P54619	.;AAKG1_HUMAN	N	63;214;247;307;298;266;218;192	ENSP00000446987:H63N;ENSP00000378599:H214N;ENSP00000448873:H247N;ENSP00000323867:H307N;ENSP00000447433:H298N;ENSP00000448972:H266N;ENSP00000449121:H218N;ENSP00000447671:H192N	ENSP00000323867:H307N	H	-	1	0	PRKAG1	47683053	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.556000	0.98127	2.698000	0.92095	0.655000	0.94253	CAC	PRKAG1	-	pfam_CBS_dom,smart_CBS_dom	ENSG00000181929		0.542	PRKAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAG1	HGNC	protein_coding	OTTHUMT00000408946.1		0.00	43	0	G	NM_002733		49396786	-1			no_errors	ENST00000548065	ensembl	human	known	74_37	missense	5.56	67	4	SNP	1.000	T
PRPF3	9129	genome.wustl.edu	37	1	150315726	150315726	+	Intron	SNP	T	T	A	rs374394798|rs200239014|rs149908445|rs58514816|rs56860451|rs66790680	byFrequency	TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:150315726T>A	ENST00000324862.6	+	10	1447				PRPF3_ENST00000543398.1_Intron|PRPF3_ENST00000467329.1_Intron|PRPF3_ENST00000414970.2_Intron	NM_004698.2	NP_004689.1	O43395	PRPF3_HUMAN	pre-mRNA processing factor 3						mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 x U5 tri-snRNP complex (GO:0046540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		aaaaaaaaaaTATATATATAT	0.398																																					Ovarian(168;1070 2670 5178 20729)												0																																										SO:0001627	intron_variant	0			AF001947	CCDS951.1	1q21.1	2013-07-16	2013-06-10		ENSG00000117360	ENSG00000117360			17348	protein-coding gene	gene with protein product		607301	"""retinitis pigmentosa 18 (autosomal dominant)"", ""PRP3 pre-mRNA processing factor 3 homolog (yeast)"", ""PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)"""	RP18			Standard	NM_004698		Approved	Prp3, hPrp3, SNRNP90	uc001eum.4	O43395	OTTHUMG00000012807	ENST00000324862.6:c.1283-59T>A	1.37:g.150315726T>A			B4DSY9|O43446|Q5VT54	RNA	SNP	-	NULL	ENST00000324862.6	37	NULL	CCDS951.1	1																																																																																			PRPF3	-	-	ENSG00000117360		0.398	PRPF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF3	HGNC	protein_coding	OTTHUMT00000035836.1	-	0.00	35	0	T	NM_004698		150315726	+1	tier1	rs149908445	no_errors	ENST00000493553	ensembl	human	known	74_37	rna	7.69	48	4	SNP	0.001	A
PRR5L	79899	genome.wustl.edu	37	11	36397655	36397655	+	5'UTR	SNP	A	A	T	rs566629655		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:36397655A>T	ENST00000378867.3	+	0	101				PRR5L_ENST00000311599.5_5'UTR|PRR5L_ENST00000389693.3_3'UTR|PRR5L_ENST00000530639.1_Intron	NM_024841.4	NP_079117.3	Q6MZQ0	PRR5L_HUMAN	proline rich 5 like						negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|regulation of fibroblast migration (GO:0010762)|TORC2 signaling (GO:0038203)	mitochondrion (GO:0005739)|TORC2 complex (GO:0031932)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)	19						CTCCTCGGCAATTTTTTTTTT	0.562																																																	0													22.0	24.0	24.0					11																	36397655		692	1591	2283	SO:0001623	5_prime_UTR_variant	0				CCDS31463.1, CCDS53617.1	11p13-p12	2009-07-09				ENSG00000135362			25878	protein-coding gene	gene with protein product	"""protein observed with Rictor-2"""	611728				17461779	Standard	NM_024841		Approved	FLJ14213, PROTOR-2	uc001mwp.3	Q6MZQ0		ENST00000378867.3:c.-255A>T	11.37:g.36397655A>T			A4QN22|E9PKY1|Q96H46|Q9H7V4	RNA	SNP	-	NULL	ENST00000378867.3	37	NULL	CCDS31463.1	11																																																																																			PRR5L	-	-	ENSG00000135362		0.562	PRR5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRR5L	HGNC	protein_coding	OTTHUMT00000389209.1	-	0.00	67	0	A	NM_024841		36397655	+1	tier1	-	no_errors	ENST00000389693	ensembl	human	known	74_37	rna	5.26	90	5	SNP	0.025	T
PTCH1	5727	genome.wustl.edu	37	9	98278926	98278926	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr9:98278926G>C	ENST00000375274.2	-	1	321	c.177C>G	c.(175-177)gaC>gaG	p.D59E	PTCH1_ENST00000437951.1_5'UTR|PTCH1_ENST00000468211.2_5'UTR|RP11-435O5.4_ENST00000604650.1_RNA|PTCH1_ENST00000430669.2_5'UTR			Q13635	PTC1_HUMAN	patched 1	0					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				GGGTCTCTTTGTCTCCCCTGT	0.547																																																	0													141.0	138.0	139.0					9																	98278926		1904	4109	6013	SO:0001583	missense	0			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000375274.2:c.177C>G	9.37:g.98278926G>C	ENSP00000364423:p.Asp59Glu		A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.D59E	ENST00000375274.2	37	c.177	CCDS47995.1	9	.	.	.	.	.	.	.	.	.	.	g	4.915	0.169938	0.09339	.	.	ENSG00000185920	ENST00000375274	D	0.89552	-2.53	2.94	1.9	0.25705	.	.	.	.	.	T	0.77624	0.4158	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.68830	-0.5305	8	0.22706	T	0.39	.	4.9972	0.14245	0.0:0.2313:0.5319:0.2368	.	59	Q13635-2	.	E	59	ENSP00000364423:D59E	ENSP00000364423:D59E	D	-	3	2	PTCH1	97318747	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	1.063000	0.30567	1.659000	0.50751	0.299000	0.19835	GAC	PTCH1	-	NULL	ENSG00000185920		0.547	PTCH1-007	KNOWN	basic|CCDS	protein_coding	PTCH1	HGNC	protein_coding	OTTHUMT00000406923.1	-	0.00	43	0	G	NM_000264		98278926	-1	tier1	-	no_errors	ENST00000375274	ensembl	human	known	74_37	missense	77.08	11	37	SNP	0.996	C
PTPRR	5801	genome.wustl.edu	37	12	71148030	71148030	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:71148030C>A	ENST00000283228.2	-	5	1131	c.679G>T	c.(679-681)Gga>Tga	p.G227*	PTPRR_ENST00000440835.2_De_novo_Start_OutOfFrame|PTPRR_ENST00000549308.1_De_novo_Start_OutOfFrame|PTPRR_ENST00000378778.1_Nonsense_Mutation_p.G21*|PTPRR_ENST00000342084.4_Nonsense_Mutation_p.G115*	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	227					ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.G227R(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		GCATAAAATCCTTCTTTGCTC	0.353																																																	1	Substitution - Missense(1)	lung(1)											140.0	135.0	137.0					12																	71148030		2203	4299	6502	SO:0001587	stop_gained	0			D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.679G>T	12.37:g.71148030C>A	ENSP00000283228:p.Gly227*		B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Nonsense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.G227*	ENST00000283228.2	37	c.679	CCDS8998.1	12	.	.	.	.	.	.	.	.	.	.	C	40	8.036078	0.98621	.	.	ENSG00000153233	ENST00000283228;ENST00000378778;ENST00000342084	.	.	.	5.86	5.86	0.93980	.	0.000000	0.47455	U	0.000225	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-19.3999	20.1784	0.98192	0.0:1.0:0.0:0.0	.	.	.	.	X	227;21;115	.	ENSP00000283228:G227X	G	-	1	0	PTPRR	69434297	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.678000	0.61641	2.771000	0.95319	0.643000	0.83706	GGA	PTPRR	-	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5	ENSG00000153233		0.353	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRR	HGNC	protein_coding	OTTHUMT00000404485.1		0.00	21	0	C	NM_002849		71148030	-1			no_errors	ENST00000283228	ensembl	human	known	74_37	nonsense	7.69	24	2	SNP	1.000	A
QSOX2	169714	genome.wustl.edu	37	9	139103122	139103122	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr9:139103122C>T	ENST00000358701.5	-	11	1574	c.1537G>A	c.(1537-1539)Ggc>Agc	p.G513S		NM_181701.3	NP_859052.3	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2	513	ERV/ALR sulfhydryl oxidase. {ECO:0000255|PROSITE-ProRule:PRU00654}.				cell redox homeostasis (GO:0045454)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	thiol oxidase activity (GO:0016972)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		GCCAGGCGGCCGTTCACCATA	0.617																																																	0													90.0	76.0	81.0					9																	139103122		2203	4300	6503	SO:0001583	missense	0			AJ318051	CCDS35178.1	9q34.3	2008-02-05	2007-04-23	2007-04-23	ENSG00000165661	ENSG00000165661			30249	protein-coding gene	gene with protein product		612860	"""quiescin Q6-like 1"""	QSCN6L1		12176051	Standard	NM_181701		Approved	SOXN, DKFZp762A2013	uc010nbi.2	Q6ZRP7	OTTHUMG00000020923	ENST00000358701.5:c.1537G>A	9.37:g.139103122C>T	ENSP00000351536:p.Gly513Ser		A2CEE0|A6NLB0|Q5TB37|Q7Z7B6|Q86VV7|Q8N3G2	Missense_Mutation	SNP	pfam_ERV/ALR_sulphydryl_oxidase,pfam_Thioredoxin_domain,superfamily_ERV/ALR_sulphydryl_oxidase,superfamily_Thioredoxin-like_fold	p.G513S	ENST00000358701.5	37	c.1537	CCDS35178.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.424|2.424	-0.332498|-0.332498	0.05314|0.05314	.|.	.|.	ENSG00000165661|ENSG00000165661	ENST00000358701;ENST00000389471|ENST00000455222	T|.	0.15718|.	2.4|.	4.72|4.72	-0.874|-0.874	0.10631|0.10631	Erv1/Alr (3);ERV/ALR sulphydryl oxidase (1);|.	0.641055|.	0.16933|.	N|.	0.193563|.	T|T	0.07458|0.07458	0.0188|0.0188	N|N	0.00841|0.00841	-1.15|-1.15	0.22989|0.22989	N|N	0.998465|0.998465	B|.	0.15719|.	0.014|.	B|.	0.10450|.	0.005|.	T|T	0.37079|0.37079	-0.9721|-0.9721	10|5	0.09590|.	T|.	0.72|.	-11.4533|-11.4533	4.4231|4.4231	0.11490|0.11490	0.1354:0.2336:0.0:0.631|0.1354:0.2336:0.0:0.631	.|.	513|.	Q6ZRP7|.	QSOX2_HUMAN|.	S|Q	513;312|280	ENSP00000351536:G513S|.	ENSP00000351536:G513S|.	G|R	-|-	1|2	0|0	QSOX2|QSOX2	138242943|138242943	0.965000|0.965000	0.33210|0.33210	0.989000|0.989000	0.46669|0.46669	0.068000|0.068000	0.16541|0.16541	0.181000|0.181000	0.16880|0.16880	-0.010000|-0.010000	0.14271|0.14271	-0.888000|-0.888000	0.02935|0.02935	GGC|CGG	QSOX2	-	pfam_ERV/ALR_sulphydryl_oxidase,superfamily_ERV/ALR_sulphydryl_oxidase	ENSG00000165661		0.617	QSOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSOX2	HGNC	protein_coding	OTTHUMT00000055046.2	-	0.00	43	0	C	NM_181701		139103122	-1	tier1	-	no_errors	ENST00000358701	ensembl	human	known	74_37	missense	11.90	37	5	SNP	0.991	T
RASIP1	54922	genome.wustl.edu	37	19	49228078	49228078	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:49228078T>C	ENST00000222145.4	-	9	2471	c.2267A>G	c.(2266-2268)gAg>gGg	p.E756G		NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	756	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		GCTGGTCAGCTCCAAGGCTGC	0.607																																																	0													86.0	88.0	87.0					19																	49228078		2203	4300	6503	SO:0001583	missense	0			BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.2267A>G	19.37:g.49228078T>C	ENSP00000222145:p.Glu756Gly		Q6U676	Missense_Mutation	SNP	pfam_Dil_domain,pfam_Ras-assoc,superfamily_SMAD_FHA_domain,smart_Ras-assoc,pfscan_Dilute,pfscan_Ras-assoc	p.E756G	ENST00000222145.4	37	c.2267	CCDS12731.1	19	.	.	.	.	.	.	.	.	.	.	T	23.2	4.383354	0.82792	.	.	ENSG00000105538	ENST00000222145	T	0.24908	1.83	5.13	5.13	0.70059	Dilute (1);	0.276068	0.35179	N	0.003394	T	0.21468	0.0517	L	0.38175	1.15	0.35648	D	0.811579	P	0.37864	0.61	B	0.34824	0.19	T	0.32402	-0.9908	10	0.72032	D	0.01	-5.8023	13.2479	0.60033	0.0:0.0:0.0:1.0	.	756	Q5U651	RAIN_HUMAN	G	756	ENSP00000222145:E756G	ENSP00000222145:E756G	E	-	2	0	RASIP1	53919890	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	4.452000	0.60054	2.088000	0.63022	0.529000	0.55759	GAG	RASIP1	-	pfscan_Dilute	ENSG00000105538		0.607	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASIP1	HGNC	protein_coding	OTTHUMT00000466185.1	-	0.00	45	0	T	NM_017805		49228078	-1	tier1	-	no_errors	ENST00000222145	ensembl	human	known	74_37	missense	35.06	49	27	SNP	0.999	C
RASSF5	83593	genome.wustl.edu	37	1	206760161	206760162	+	Frame_Shift_Ins	INS	-	-	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:206760161_206760162insA	ENST00000355294.4	+	6	1165_1166	c.1108_1109insA	c.(1108-1110)gatfs	p.D370fs	RASSF5_ENST00000304534.8_Frame_Shift_Ins_p.D217fs|RASSF5_ENST00000491368.1_3'UTR|RASSF5_ENST00000367117.3_Frame_Shift_Ins_p.C332fs|EIF2D_ENST00000472709.2_Intron	NM_182663.2	NP_872604.1	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family member 5	370	SARAH. {ECO:0000255|PROSITE- ProRule:PRU00310}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein localization to nucleus (GO:1900180)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	8	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			CTCACAGTGGGATGCCTTCTCC	0.48																																					GBM(162;656 1984 11916 22872 31529)												0																																										SO:0001589	frameshift_variant	0			BC004270	CCDS1463.1, CCDS1464.1, CCDS30998.1	1q31	2014-04-10	2008-02-22		ENSG00000136653	ENSG00000266094			17609	protein-coding gene	gene with protein product		607020				11978988, 11965544	Standard	NM_182663		Approved	Maxp1, NORE1, RAPL	uc001hed.3	Q8WWW0	OTTHUMG00000184616	ENST00000355294.4:c.1109dupA	1.37:g.206760162_206760162dupA	ENSP00000347443:p.Asp370fs		A8K1E6|Q5SY32|Q8WWV9|Q8WXF4|Q9BT99	Frame_Shift_Ins	INS	pfam_Ras-assoc,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SARAH_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.D370fs	ENST00000355294.4	37	c.1108_1109	CCDS30998.1	1																																																																																			RASSF5	-	pfscan_SARAH_dom	ENSG00000136653		0.480	RASSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF5	HGNC	protein_coding	OTTHUMT00000088469.1		0.00	38	0	-	NM_031437		206760162	+1	tier1		no_errors	ENST00000355294	ensembl	human	known	74_37	frame_shift_ins	27.91	31	12	INS	1.000:0.999	A
RASSF5	83593	genome.wustl.edu	37	1	206761653	206761653	+	IGR	SNP	T	T	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:206761653T>A	ENST00000355294.4	+	0	2048				RASSF5_ENST00000304534.8_3'UTR|RASSF5_ENST00000491368.1_3'UTR|EIF2D_ENST00000472709.2_Intron	NM_182663.2	NP_872604.1	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family member 5						apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein localization to nucleus (GO:1900180)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	8	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			CAATCAGTGATACCAGACCAC	0.473																																					GBM(162;656 1984 11916 22872 31529)												0																																										SO:0001628	intergenic_variant	0			BC004270	CCDS1463.1, CCDS1464.1, CCDS30998.1	1q31	2014-04-10	2008-02-22		ENSG00000136653	ENSG00000266094			17609	protein-coding gene	gene with protein product		607020				11978988, 11965544	Standard	NM_182663		Approved	Maxp1, NORE1, RAPL	uc001hed.3	Q8WWW0	OTTHUMG00000184616		1.37:g.206761653T>A			A8K1E6|Q5SY32|Q8WWV9|Q8WXF4|Q9BT99	RNA	SNP	-	NULL	ENST00000355294.4	37	NULL	CCDS30998.1	1																																																																																			RASSF5	-	-	ENSG00000136653		0.473	RASSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF5	HGNC	protein_coding	OTTHUMT00000088469.1	-	0.00	11	0	T	NM_031437		206761653	+1	tier1	-	no_errors	ENST00000481486	ensembl	human	putative	74_37	rna	44.44	5	4	SNP	0.000	A
RHNO1	83695	genome.wustl.edu	37	12	2997454	2997454	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:2997454C>A	ENST00000489288.2	+	3	698	c.546C>A	c.(544-546)tgC>tgA	p.C182*	RHNO1_ENST00000464682.2_3'UTR|RHNO1_ENST00000461997.2_Nonsense_Mutation_p.C168*|TULP3_ENST00000397132.2_5'Flank|TULP3_ENST00000448120.2_5'Flank	NM_001252499.2|NM_001257097.1|NM_001257098.1	NP_001239428.1|NP_001244026.1|NP_001244027.1	Q9BSD3	RHNO1_HUMAN	RAD9-HUS1-RAD1 interacting nuclear orphan 1	182					cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|positive regulation of G0 to G1 transition (GO:0070318)|recombinational repair (GO:0000725)	chromosome (GO:0005694)|nucleus (GO:0005634)											TTCTAAGCTGCACTCTTCACA	0.488																																																	0													115.0	107.0	109.0					12																	2997454		2203	4300	6503	SO:0001587	stop_gained	0			AK021945	CCDS8518.1, CCDS58199.1	12p13.33	2012-08-23	2012-08-23	2012-08-23	ENSG00000171792	ENSG00000171792			28206	protein-coding gene	gene with protein product	"""Rad9, Rad1, Hus1 interacting nuclear orphan"""	614085	"""chromosome 12 open reading frame 32"""	C12orf32		20811708, 21659603	Standard	NM_001252499		Approved	HKMT1188, MGC13204, RHINO	uc031qfq.1	Q9BSD3	OTTHUMG00000158557	ENST00000489288.2:c.546C>A	12.37:g.2997454C>A	ENSP00000438590:p.Cys182*		B7Z989	Nonsense_Mutation	SNP	NULL	p.C182*	ENST00000489288.2	37	c.546	CCDS8518.1	12	.	.	.	.	.	.	.	.	.	.	C	13.18	2.160249	0.38119	.	.	ENSG00000171792	ENST00000461997;ENST00000489288	.	.	.	5.21	-1.01	0.10169	.	0.906878	0.09663	N	0.772141	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	0.3649	6.3373	0.21302	0.0:0.4459:0.1223:0.4318	.	.	.	.	X	168;182	.	ENSP00000438828:C168X	C	+	3	2	C12orf32	2867715	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.685000	0.05167	-0.433000	0.07286	0.655000	0.94253	TGC	RHNO1	-	NULL	ENSG00000171792		0.488	RHNO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHNO1	HGNC	protein_coding	OTTHUMT00000351286.2	-	0.00	62	0	C	NM_031465		2997454	+1	tier1	-	no_errors	ENST00000489288	ensembl	human	known	74_37	nonsense	5.71	66	4	SNP	0.000	A
RNY5	6090	genome.wustl.edu	37	7	148638591	148638591	+	RNA	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr7:148638591G>T	ENST00000516501.1	+	0	12					NR_001571.2				RNA, Ro-associated Y5																		gttggtccgagtgttgtgggt	0.423																																																	0													189.0	167.0	174.0					7																	148638591		692	1591	2283			0			U64824		7q36	2013-05-03	2008-03-26		ENSG00000252310			"""Y RNAs (Ro-associated)"""	10248	non-coding RNA	RNA, Y		601824	"""RNA, Y5 small cytoplasmic (associated with Ro protein)"""			7520568	Standard	NR_001571		Approved		uc010slc.1				7.37:g.148638591G>T				RNA	SNP	-	NULL	ENST00000516501.1	37	NULL		7																																																																																			RNY5	-	-	ENSG00000252310		0.423	RNY5-201	KNOWN	basic	misc_RNA	RNY5	HGNC	misc_RNA		-	0.00	34	0	G	NR_001571		148638591	+1	tier1	-	no_errors	ENST00000516501	ensembl	human	known	74_37	rna	29.58	50	21	SNP	0.018	T
RSPH6A	81492	genome.wustl.edu	37	19	46299318	46299318	+	Missense_Mutation	SNP	C	C	T	rs145529811		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:46299318C>T	ENST00000221538.3	-	6	2105	c.1963G>A	c.(1963-1965)Gag>Aag	p.E655K	RSPH6A_ENST00000597055.1_Silent_p.P653P|RSPH6A_ENST00000600188.1_Missense_Mutation_p.E391K	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	655	Glu-rich.					intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						TTGAAGCTCTCGGGGCTGTAC	0.557																																																	0								C	LYS/GLU	2,4404	4.2+/-10.8	0,2,2201	89.0	98.0	95.0		1963	4.2	0.2	19	dbSNP_134	95	0,8600		0,0,4300	no	missense	RSPH6A	NM_030785.3	56	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	655/718	46299318	2,13004	2203	4300	6503	SO:0001583	missense	0			AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1963G>A	19.37:g.46299318C>T	ENSP00000221538:p.Glu655Lys		Q53FE2|Q6PEZ9	Missense_Mutation	SNP	pfam_Radial_spoke	p.E655K	ENST00000221538.3	37	c.1963	CCDS12675.1	19	.	.	.	.	.	.	.	.	.	.	c	16.22	3.062308	0.55432	4.54E-4	0.0	ENSG00000104941	ENST00000221538	T	0.18016	2.24	4.25	4.25	0.50352	.	0.175637	0.47852	D	0.000206	T	0.20047	0.0482	M	0.71036	2.16	0.32614	N	0.52426	P	0.52061	0.95	B	0.42798	0.398	T	0.21449	-1.0245	10	0.09590	T	0.72	-13.0483	14.6161	0.68549	0.0:1.0:0.0:0.0	.	655	Q9H0K4	RSH6A_HUMAN	K	655	ENSP00000221538:E655K	ENSP00000221538:E655K	E	-	1	0	RSPH6A	50991158	0.989000	0.36119	0.241000	0.24154	0.806000	0.45545	4.300000	0.59079	2.382000	0.81193	0.551000	0.68910	GAG	RSPH6A	-	pfam_Radial_spoke	ENSG00000104941		0.557	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH6A	HGNC	protein_coding	OTTHUMT00000461657.1	-	0.00	68	0	C			46299318	-1	tier1	rs145529811	no_errors	ENST00000221538	ensembl	human	known	74_37	missense	45.45	71	60	SNP	0.920	T
SALL3	27164	genome.wustl.edu	37	18	76752159	76752159	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr18:76752159C>G	ENST00000537592.2	+	2	168	c.168C>G	c.(166-168)tgC>tgG	p.C56W	SALL3_ENST00000575389.2_Missense_Mutation_p.C56W|SALL3_ENST00000572928.1_3'UTR|SALL3_ENST00000536229.3_5'UTR	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	56					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GCGAGAAATGCTGCGCCGAGT	0.706																																																	0													32.0	35.0	34.0					18																	76752159		2199	4299	6498	SO:0001583	missense	0			AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.168C>G	18.37:g.76752159C>G	ENSP00000441823:p.Cys56Trp		Q9UGH1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C56W	ENST00000537592.2	37	c.168	CCDS12013.1	18	.	.	.	.	.	.	.	.	.	.	C	15.58	2.874462	0.51695	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.54279	0.58	4.44	4.44	0.53790	Zinc finger, C2H2-like (1);	0.000000	0.64402	D	0.000010	T	0.76608	0.4011	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.82478	-0.0437	10	0.87932	D	0	-33.1153	17.457	0.87610	0.0:1.0:0.0:0.0	.	56	Q9BXA9	SALL3_HUMAN	W	56	ENSP00000441823:C56W	ENSP00000299466:C56W	C	+	3	2	SALL3	74853147	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.979000	0.49313	2.197000	0.70478	0.561000	0.74099	TGC	SALL3	-	smart_Znf_C2H2-like	ENSG00000256463		0.706	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SALL3	HGNC	protein_coding	OTTHUMT00000256397.1	-	0.00	58	0	C	NM_171999		76752159	+1	tier1	-	no_errors	ENST00000537592	ensembl	human	known	74_37	missense	34.29	46	24	SNP	1.000	G
SDCCAG3	10807	genome.wustl.edu	37	9	139298600	139298600	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr9:139298600C>T	ENST00000357365.3	-	9	1244	c.1115G>A	c.(1114-1116)gGc>gAc	p.G372D	SDCCAG3_ENST00000461693.1_5'UTR|SDCCAG3_ENST00000298537.7_Missense_Mutation_p.G349D|SDCCAG3_ENST00000371725.3_Missense_Mutation_p.G299D	NM_001039707.1	NP_001034796.1	Q96C92	SDCG3_HUMAN	serologically defined colon cancer antigen 3	372						cytoplasm (GO:0005737)				NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)	16		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)		GGCACCCTGGCCGCACCGCAG	0.632																																																	0													90.0	99.0	96.0					9																	139298600		2002	4153	6155	SO:0001583	missense	0			AF039688	CCDS6999.2, CCDS43903.1, CCDS43904.1	9q34.3	2010-10-27			ENSG00000165689	ENSG00000165689			10667	protein-coding gene	gene with protein product						9610721	Standard	XM_005266050		Approved	NY-CO-3	uc004chi.3	Q96C92	OTTHUMG00000020928	ENST00000357365.3:c.1115G>A	9.37:g.139298600C>T	ENSP00000349929:p.Gly372Asp		A6NCP1|O60525|Q5SXN1|Q5SXN2|Q5SXN3|Q5SXN4|Q5SXN8|Q6V704|Q9NVY5	Missense_Mutation	SNP	NULL	p.G372D	ENST00000357365.3	37	c.1115	CCDS43904.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.77|16.77	3.214403|3.214403	0.58452|0.58452	.|.	.|.	ENSG00000165689|ENSG00000165689	ENST00000417512|ENST00000357365;ENST00000298537;ENST00000371725	.|T;T;T	.|0.27720	.|1.65;2.09;1.65	4.66|4.66	4.66|4.66	0.58398|0.58398	.|.	.|0.280456	.|0.35407	.|N	.|0.003233	T|T	0.54806|0.54806	0.1881|0.1881	M|M	0.68952|0.68952	2.095|2.095	0.51233|0.51233	D|D	0.999914|0.999914	.|D;D;D	.|0.89917	.|1.0;0.996;0.991	.|D;D;P	.|0.91635	.|0.999;0.941;0.851	T|T	0.59193|0.59193	-0.7500|-0.7500	5|10	.|0.66056	.|D	.|0.02	-9.8055|-9.8055	16.92|16.92	0.86161|0.86161	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|299;349;372	.|Q96C92-4;Q96C92-2;Q96C92	.|.;.;SDCG3_HUMAN	T|D	104|372;349;299	.|ENSP00000349929:G372D;ENSP00000298537:G349D;ENSP00000360790:G299D	.|ENSP00000298537:G349D	A|G	-|-	1|2	0|0	SDCCAG3|SDCCAG3	138418421|138418421	1.000000|1.000000	0.71417|0.71417	0.978000|0.978000	0.43139|0.43139	0.038000|0.038000	0.13279|0.13279	4.932000|4.932000	0.63476|0.63476	2.281000|2.281000	0.76405|0.76405	0.655000|0.655000	0.94253|0.94253	GCC|GGC	SDCCAG3	-	NULL	ENSG00000165689		0.632	SDCCAG3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SDCCAG3	HGNC	protein_coding	OTTHUMT00000055060.2	-	0.00	43	0	C	NM_006643		139298600	-1	tier1	-	no_errors	ENST00000357365	ensembl	human	known	74_37	missense	52.94	16	18	SNP	0.997	T
SECISBP2L	9728	genome.wustl.edu	37	15	49319599	49319599	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr15:49319599C>G	ENST00000559471.1	-	7	1261	c.998G>C	c.(997-999)aGa>aCa	p.R333T	SECISBP2L_ENST00000261847.3_Missense_Mutation_p.R333T	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	333							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						CCTTCCACCTCTAGAAAATGT	0.328																																																	0													123.0	122.0	122.0					15																	49319599		2197	4294	6491	SO:0001583	missense	0			BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.998G>C	15.37:g.49319599C>G	ENSP00000453854:p.Arg333Thr		Q8N767	Missense_Mutation	SNP	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	p.R333T	ENST00000559471.1	37	c.998	CCDS53942.1	15	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095376	0.76870	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	D;T	0.89050	-2.46;-0.97	5.95	5.01	0.66863	.	0.043826	0.85682	D	0.000000	D	0.92802	0.7711	M	0.61703	1.905	0.47547	D	0.999457	D;D	0.89917	0.999;1.0	D;D	0.85130	0.994;0.997	D	0.91565	0.5267	10	0.31617	T	0.26	.	14.3124	0.66424	0.0:0.9263:0.0:0.0737	.	333;333	Q93073;Q93073-2	SBP2L_HUMAN;.	T	333	ENSP00000261847:R333T;ENSP00000370314:R333T	ENSP00000261847:R333T	R	-	2	0	SECISBP2L	47106891	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.381000	0.59587	1.460000	0.47911	0.655000	0.94253	AGA	SECISBP2L	-	NULL	ENSG00000138593		0.328	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SECISBP2L	HGNC	protein_coding	OTTHUMT00000417277.1	-	0.00	71	0	C	NM_014701		49319599	-1	tier1	-	no_errors	ENST00000559471	ensembl	human	known	74_37	missense	43.02	49	37	SNP	1.000	G
SENP1	29843	genome.wustl.edu	37	12	48468515	48468515	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:48468515T>C	ENST00000004980.5	-	7	1092	c.614A>G	c.(613-615)cAg>cGg	p.Q205R	SENP1_ENST00000551330.1_Missense_Mutation_p.Q205R|SENP1_ENST00000549518.1_Missense_Mutation_p.Q205R|SENP1_ENST00000448372.1_Missense_Mutation_p.Q205R|SENP1_ENST00000549595.1_Missense_Mutation_p.Q205R|SENP1_ENST00000339976.6_3'UTR			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1	205					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)			large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				TATAGTAAACTGTTTCCCTGT	0.328																																																	0													179.0	165.0	169.0					12																	48468515		1870	4098	5968	SO:0001583	missense	0			AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896	ENST00000004980.5:c.614A>G	12.37:g.48468515T>C	ENSP00000004980:p.Gln205Arg		A8K7P5|Q86XC8	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.Q205R	ENST00000004980.5	37	c.614	CCDS44868.2	12	.	.	.	.	.	.	.	.	.	.	T	12.50	1.957991	0.34565	.	.	ENSG00000079387	ENST00000004980;ENST00000448372;ENST00000551330;ENST00000549595;ENST00000549518	T;T;T;T;T	0.15834	2.39;2.39;2.39;2.39;2.39	5.04	3.88	0.44766	.	0.202341	0.34268	N	0.004107	T	0.08758	0.0217	N	0.24115	0.695	0.80722	D	1	P;P	0.38677	0.51;0.642	B;B	0.32090	0.066;0.14	T	0.14144	-1.0483	10	0.07990	T	0.79	-7.7751	11.0905	0.48113	0.0:0.0:0.2959:0.7041	.	205;205	Q9P0U3;Q9P0U3-2	SENP1_HUMAN;.	R	205	ENSP00000004980:Q205R;ENSP00000394791:Q205R;ENSP00000446681:Q205R;ENSP00000450076:Q205R;ENSP00000447328:Q205R	ENSP00000004980:Q205R	Q	-	2	0	SENP1	46754782	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.285000	0.33261	1.043000	0.40175	-0.291000	0.09656	CAG	SENP1	-	NULL	ENSG00000079387		0.328	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP1	HGNC	protein_coding	OTTHUMT00000406471.1	-	0.00	53	0	T	NM_014554		48468515	-1	tier1	-	no_errors	ENST00000004980	ensembl	human	known	74_37	missense	6.06	61	4	SNP	1.000	C
SEPT4	5414	genome.wustl.edu	37	17	56602457	56602457	+	Missense_Mutation	SNP	G	G	A	rs140251087		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:56602457G>A	ENST00000317268.3	-	5	820	c.644C>T	c.(643-645)gCa>gTa	p.A215V	SEPT4_ENST00000457347.2_Missense_Mutation_p.A230V|SEPT4_ENST00000583114.1_Missense_Mutation_p.A68V|SEPT4_ENST00000580809.1_Missense_Mutation_p.A97V|SEPT4_ENST00000412945.3_Missense_Mutation_p.A207V|RP11-112H10.4_ENST00000580769.1_RNA|SEPT4_ENST00000579371.1_Missense_Mutation_p.A116V|SEPT4_ENST00000580844.1_Missense_Mutation_p.A116V|RP11-112H10.4_ENST00000580589.1_RNA|SEPT4_ENST00000393086.1_Missense_Mutation_p.A196V|SEPT4_ENST00000317256.6_Missense_Mutation_p.A196V|SEPT4_ENST00000580791.1_5'Flank|RP11-112H10.4_ENST00000578022.1_RNA|SEPT4_ENST00000426861.1_Missense_Mutation_p.A196V	NM_004574.3	NP_004565.1	O43236	SEPT4_HUMAN	septin 4	215	Septin-type G.				apoptotic process (GO:0006915)|brain development (GO:0007420)|cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein ubiquitination (GO:0031398)|regulation of apoptotic process (GO:0042981)|sperm capacitation (GO:0048240)|sperm mitochondrion organization (GO:0030382)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm annulus (GO:0097227)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	18	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GTTGTTGACTGCATCCCCAAA	0.512																																																	0								G	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	364.0	290.0	315.0		620,644,587,587	5.1	1.0	17	dbSNP_134	315	0,8600		0,0,4300	no	missense,missense,missense,missense	SEPT4	NM_001198713.1,NM_004574.3,NM_080415.2,NM_080416.2	64,64,64,64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	207/471,215/479,196/275,196/460	56602457	1,13005	2203	4300	6503	SO:0001583	missense	0			AF073312	CCDS11609.1, CCDS11610.1, CCDS45743.1, CCDS56041.1, CCDS58581.1, CCDS58582.1	17q22	2013-01-21	2005-01-11	2005-01-12	ENSG00000108387	ENSG00000108387		"""Septins"""	9165	protein-coding gene	gene with protein product	"""bradeoin"", ""septin-M"""	603696	"""peanut-like 2 (Drosophila)"""	PNUTL2		9889007	Standard	NM_001198713		Approved	H5, CE5B3, hucep-7, ARTS, hCDCREL-2, MART	uc002iwm.2	O43236		ENST00000317268.3:c.644C>T	17.37:g.56602457G>A	ENSP00000321674:p.Ala215Val		B2RD42|B3KSX9|B4DXC6|B4DXV5|Q6IAP3|Q9H315|Q9UM58	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase	p.A230V	ENST00000317268.3	37	c.689	CCDS11610.1	17	.	.	.	.	.	.	.	.	.	.	G	15.04	2.714849	0.48622	2.27E-4	0.0	ENSG00000108387	ENST00000412945;ENST00000457347;ENST00000317256;ENST00000317268;ENST00000393086;ENST00000426861	T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63	5.09	5.09	0.68999	.	0.125154	0.52532	D	0.000062	T	0.65533	0.2700	M	0.89601	3.045	0.80722	D	1	P;P;D;P;P;B;P	0.56287	0.795;0.666;0.975;0.823;0.795;0.274;0.829	P;B;P;P;P;B;P	0.49799	0.61;0.14;0.509;0.458;0.488;0.224;0.622	T	0.75121	-0.3429	10	0.66056	D	0.02	.	16.343	0.83101	0.0:0.0:1.0:0.0	.	207;230;68;196;196;68;215	O43236-3;O43236-4;B3KR63;O43236-6;O43236-2;O43236-5;O43236	.;.;.;.;.;.;SEPT4_HUMAN	V	207;229;196;215;196;196	ENSP00000414779:A207V;ENSP00000321071:A196V;ENSP00000321674:A215V;ENSP00000376801:A196V;ENSP00000402348:A196V	ENSP00000321071:A196V	A	-	2	0	SEPT4	53957456	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	9.772000	0.98984	2.521000	0.84997	0.650000	0.86243	GCA	SEPT4	-	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase	ENSG00000108387		0.512	SEPT4-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEPT4	HGNC	protein_coding	OTTHUMT00000445420.1		0.00	25	0	G	NM_080417		56602457	-1			no_errors	ENST00000457347	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	A
SFT2D2	375035	genome.wustl.edu	37	1	168200751	168200751	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:168200751G>T	ENST00000271375.4	+	2	135		c.e2-1		SFT2D2_ENST00000367825.3_Splice_Site|SFT2D2_ENST00000367829.1_Splice_Site|SFT2D2_ENST00000471981.1_Splice_Site	NM_199344.2	NP_955376.1			SFT2 domain containing 2											lung(3)|skin(1)	4	all_hematologic(923;0.215)					TTCAATTTTAGGTTGTTGAGG	0.348																																																	0													151.0	149.0	149.0					1																	168200751		2203	4300	6503	SO:0001630	splice_region_variant	0			AL035297	CCDS1271.1	1q24.2	2008-02-05			ENSG00000213064	ENSG00000213064			25140	protein-coding gene	gene with protein product							Standard	NM_199344		Approved	UNQ512, dJ747L4.C1.2	uc001gfi.4	O95562	OTTHUMG00000034650	ENST00000271375.4:c.64-1G>T	1.37:g.168200751G>T				Splice_Site	SNP	-	e2-1	ENST00000271375.4	37	c.64-1	CCDS1271.1	1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.414319	0.62511	.	.	ENSG00000213064	ENST00000367829;ENST00000271375;ENST00000367825	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1722	0.81825	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SFT2D2	166467375	1.000000	0.71417	0.910000	0.35882	0.875000	0.50365	5.574000	0.67424	2.606000	0.88127	0.650000	0.86243	.	SFT2D2	-	-	ENSG00000213064		0.348	SFT2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFT2D2	HGNC	protein_coding	OTTHUMT00000083827.2	-	0.00	41	0	G	NM_199344	Intron	168200751	+1	tier1	-	no_errors	ENST00000271375	ensembl	human	known	74_37	splice_site	8.00	46	4	SNP	1.000	T
SHROOM3	57619	genome.wustl.edu	37	4	77661188	77661188	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr4:77661188G>A	ENST00000296043.6	+	5	2815	c.1862G>A	c.(1861-1863)aGg>aAg	p.R621K		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	621					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)		p.S619fs*25(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			AGATCTTCCAGGCTCTCAGAG	0.572																																																	1	Deletion - Frameshift(1)	ovary(1)											123.0	131.0	128.0					4																	77661188		2203	4300	6503	SO:0001583	missense	0			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.1862G>A	4.37:g.77661188G>A	ENSP00000296043:p.Arg621Lys		Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R621K	ENST00000296043.6	37	c.1862	CCDS3579.2	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.880|9.880	1.201395|1.201395	0.22121|0.22121	.|.	.|.	ENSG00000138771|ENSG00000138771	ENST00000380735|ENST00000296043	.|T	.|0.28255	.|1.62	5.64|5.64	4.79|4.79	0.61399|0.61399	.|.	.|0.752143	.|0.12670	.|N	.|0.448847	T|T	0.19287|0.19287	0.0463|0.0463	L|L	0.47716|0.47716	1.5|1.5	0.09310|0.09310	N|N	1|1	.|B;P;P	.|0.38922	.|0.435;0.651;0.651	.|B;B;B	.|0.29598	.|0.104;0.057;0.057	T|T	0.11916|0.11916	-1.0568|-1.0568	6|10	0.20046|0.11485	T|T	0.44|0.65	-4.0378|-4.0378	5.5155|5.5155	0.16904|0.16904	0.1205:0.0:0.6706:0.2089|0.1205:0.0:0.6706:0.2089	.|.	.|445;621;399	.|B4E244;Q8TF72;B3KY47	.|.;SHRM3_HUMAN;.	S|K	161|621	.|ENSP00000296043:R621K	ENSP00000370111:G161S|ENSP00000296043:R621K	G|R	+|+	1|2	0|0	SHROOM3|SHROOM3	77880212|77880212	0.129000|0.129000	0.22400|0.22400	0.182000|0.182000	0.23118|0.23118	0.319000|0.319000	0.28217|0.28217	1.622000|1.622000	0.36997|0.36997	1.350000|1.350000	0.45770|0.45770	0.462000|0.462000	0.41574|0.41574	GGC|AGG	SHROOM3	-	NULL	ENSG00000138771		0.572	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	HGNC	protein_coding	OTTHUMT00000252408.2	-	0.00	34	0	G	NM_020859		77661188	+1	tier1	-	no_errors	ENST00000296043	ensembl	human	known	74_37	missense	24.44	34	11	SNP	0.083	A
SIK1	150094	genome.wustl.edu	37	21	44840162	44840162	+	Silent	SNP	C	C	T	rs199738681	byFrequency	TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr21:44840162C>T	ENST00000270162.6	-	8	1056	c.924G>A	c.(922-924)gcG>gcA	p.A308A		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	308	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	TGATACCCAGCGCCTGCTCAT	0.687													C|||	3	0.000599042	0.0	0.0	5008	,	,		16399	0.003		0.0	False		,,,				2504	0.0																0													49.0	47.0	47.0					21																	44840162		2203	4300	6503	SO:0001819	synonymous_variant	0			BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.924G>A	21.37:g.44840162C>T			A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kinase_SIK1/2,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A308	ENST00000270162.6	37	c.924	CCDS33575.1	21																																																																																			SIK1	-	pirsf_Ser/Thr_kinase_SIK1/2,pfscan_UBA/transl_elong_EF1B_N_euk	ENSG00000142178		0.687	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIK1	HGNC	protein_coding	OTTHUMT00000195654.1		0.00	36	0	C	NM_173354		44840162	-1			no_errors	ENST00000270162	ensembl	human	known	74_37	silent	6.35	59	4	SNP	0.970	T
SLC17A2	10246	genome.wustl.edu	37	6	25913642	25913642	+	3'UTR	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr6:25913642G>A	ENST00000265425.3	-	0	1395				SLC17A2_ENST00000377850.3_Missense_Mutation_p.S447F|SLC17A2_ENST00000360488.3_Silent_p.L398L			O00624	NPT3_HUMAN	solute carrier family 17, member 2						phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	31						GACTGCAGCAGACAGGAAAAA	0.448																																																	0													103.0	93.0	96.0					6																	25913642		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			U90544	CCDS4567.1, CCDS69060.1	6p22.2	2013-07-18	2013-07-18		ENSG00000112337	ENSG00000112337		"""Solute carriers"""	10930	protein-coding gene	gene with protein product		611049	"""solute carrier family 17 (sodium phosphate), member 2"""			9149941	Standard	NM_001286123		Approved	NPT3	uc003nfl.3	O00624	OTTHUMG00000014413	ENST00000265425.3:c.*55C>T	6.37:g.25913642G>A			A6NK81|A6NLD6|Q5TB84|Q76P85	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S447F	ENST00000265425.3	37	c.1340		6	.	.	.	.	.	.	.	.	.	.	G	11.64	1.699156	0.30142	.	.	ENSG00000112337	ENST00000377850	T	0.64260	-0.09	4.65	3.79	0.43588	.	0.216928	0.33382	N	0.004974	T	0.48519	0.1504	.	.	.	0.35348	D	0.78706	P	0.36465	0.554	B	0.43386	0.418	T	0.58719	-0.7587	9	0.87932	D	0	.	8.9271	0.35648	0.0988:0.0:0.9012:0.0	.	447	A6NK81	.	F	447	ENSP00000367081:S447F	ENSP00000367081:S447F	S	-	2	0	SLC17A2	26021621	0.999000	0.42202	0.886000	0.34754	0.044000	0.14063	4.635000	0.61332	1.591000	0.50007	-0.142000	0.14014	TCT	SLC17A2	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000112337		0.448	SLC17A2-002	KNOWN	basic|appris_principal	protein_coding	SLC17A2	HGNC	protein_coding	OTTHUMT00000040075.1	-	0.00	56	0	G			25913642	-1	tier1	-	no_errors	ENST00000377850	ensembl	human	known	74_37	missense	28.87	69	28	SNP	0.944	A
SLC39A8	64116	genome.wustl.edu	37	4	103184318	103184318	+	Silent	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr4:103184318C>T	ENST00000394833.2	-	8	1742	c.1266G>A	c.(1264-1266)aaG>aaA	p.K422K	SLC39A8_ENST00000424970.2_Splice_Site_p.K422K|SLC39A8_ENST00000356736.4_Silent_p.K422K	NM_001135148.1|NM_022154.5	NP_001128620.1|NP_071437.3	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter), member 8	422					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)|plasma membrane (GO:0005886)	metal ion transmembrane transporter activity (GO:0046873)			large_intestine(1)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		TTCCAGTTACCTTTTCTCTCA	0.383																																																	0													138.0	131.0	133.0					4																	103184318		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS3656.1, CCDS47117.1	4q22-q24	2013-05-22			ENSG00000138821	ENSG00000138821		"""Solute carriers"""	20862	protein-coding gene	gene with protein product		608732	"""solute carrier family 39 (metal ion transporter), member 8"""			12504855, 12659941	Standard	NM_001135146		Approved	BIGM103	uc003hwc.2	Q9C0K1	OTTHUMG00000131120	ENST00000394833.2:c.1266G>A	4.37:g.103184318C>T			B4E2H3|Q96SM9|Q9BVC0|Q9NSA4	Silent	SNP	pfam_ZIP	p.K422	ENST00000394833.2	37	c.1266	CCDS3656.1	4																																																																																			SLC39A8	-	pfam_ZIP	ENSG00000138821		0.383	SLC39A8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC39A8	HGNC	protein_coding	OTTHUMT00000253798.1	-	0.00	67	0	C	NM_022154		103184318	-1	tier1	-	no_errors	ENST00000356736	ensembl	human	known	74_37	silent	67.44	14	29	SNP	0.993	T
SLC8A1	6546	genome.wustl.edu	37	2	40656143	40656143	+	Silent	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr2:40656143G>T	ENST00000403092.1	-	2	1311	c.1278C>A	c.(1276-1278)gcC>gcA	p.A426A	SLC8A1_ENST00000408028.2_Silent_p.A426A|SLC8A1_ENST00000405269.1_Silent_p.A426A|SLC8A1_ENST00000332839.4_Silent_p.A426A|SLC8A1_ENST00000406391.2_Silent_p.A426A|SLC8A1_ENST00000542756.1_Silent_p.A426A|SLC8A1_ENST00000405901.3_Silent_p.A426A|SLC8A1_ENST00000406785.2_Silent_p.A426A|SLC8A1_ENST00000402441.1_Silent_p.A426A|SLC8A1_ENST00000542024.1_Silent_p.A426A			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	426	Calx-beta 1.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.A426A(1)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TAATGGTAAGGGCCACAGTAC	0.438																																																	1	Substitution - coding silent(1)	lung(1)											105.0	88.0	94.0					2																	40656143		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1278C>A	2.37:g.40656143G>T			A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Silent	SNP	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,pfscan_DnaJ_domain,prints_Na_Ca_Ex,prints_NaCa_exhngr1,tigrfam_Na_Ca_Ex	p.A426	ENST00000403092.1	37	c.1278	CCDS1806.1	2																																																																																			SLC8A1	-	pfam_Calx_beta,smart_Calx_beta,tigrfam_Na_Ca_Ex	ENSG00000183023		0.438	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A1	HGNC	protein_coding	OTTHUMT00000326065.1		0.00	38	0	G	NM_021097		40656143	-1			no_errors	ENST00000332839	ensembl	human	known	74_37	silent	9.09	30	3	SNP	0.998	T
SLITRK3	22865	genome.wustl.edu	37	3	164907755	164907755	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr3:164907755C>A	ENST00000475390.1	-	2	1307	c.864G>T	c.(862-864)gaG>gaT	p.E288D	SLITRK3_ENST00000241274.3_Missense_Mutation_p.E288D			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	288					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						TAGCCTCTACCTCAGAGTCAG	0.463										HNSCC(40;0.11)																																							0													98.0	103.0	101.0					3																	164907755		2203	4300	6503	SO:0001583	missense	0			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.864G>T	3.37:g.164907755C>A	ENSP00000420091:p.Glu288Asp		Q1RMY6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.E288D	ENST00000475390.1	37	c.864	CCDS3197.1	3	.	.	.	.	.	.	.	.	.	.	C	8.227	0.803833	0.16467	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.44083	0.93;0.93	5.61	3.82	0.43975	.	0.000000	0.34750	N	0.003713	T	0.39064	0.1064	N	0.25245	0.725	0.41065	D	0.9854	D	0.58970	0.984	D	0.65443	0.935	T	0.41431	-0.9509	10	0.02654	T	1	-17.9326	8.5873	0.33666	0.0:0.7097:0.0:0.2903	.	288	O94933	SLIK3_HUMAN	D	288	ENSP00000420091:E288D;ENSP00000241274:E288D	ENSP00000241274:E288D	E	-	3	2	SLITRK3	166390449	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	0.832000	0.27490	0.736000	0.32559	-0.137000	0.14449	GAG	SLITRK3	-	NULL	ENSG00000121871		0.463	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLITRK3	HGNC	protein_coding	OTTHUMT00000350126.1	-	0.00	75	0	C	NM_014926		164907755	-1	tier1	-	no_errors	ENST00000241274	ensembl	human	known	74_37	missense	49.61	65	64	SNP	1.000	A
SNRNP70	6625	genome.wustl.edu	37	19	49604727	49604727	+	Splice_Site	SNP	C	C	T	rs373191644		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:49604727C>T	ENST00000598441.1	+	7	698	c.474C>T	c.(472-474)caC>caT	p.H158H	SNRNP70_ENST00000221448.5_Splice_Site_p.H158H			P08621	RU17_HUMAN	small nuclear ribonucleoprotein 70kDa (U1)	158	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|skin(2)	12						GAGACATGCACTGTGAGTACC	0.617																																																	0								C		2,4404	4.2+/-10.8	0,2,2201	115.0	80.0	92.0		474	0.4	1.0	19		92	0,8600		0,0,4300	no	coding-synonymous-near-splice	SNRNP70	NM_003089.4		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		158/438	49604727	2,13004	2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS12756.1, CCDS74417.1	19q13.3	2013-02-12	2008-10-29	2008-10-29		ENSG00000104852		"""RNA binding motif (RRM) containing"""	11150	protein-coding gene	gene with protein product		180740	"""small nuclear ribonucleoprotein 70kDa (RNP antigen)"""	RNPU1Z, RPU1, SNRP70			Standard	XM_005259177		Approved	U1-70K, Snp1	uc021uxh.1	P08621		ENST00000598441.1:c.475+1C>T	19.37:g.49604727C>T			B3KUA3|P78493|P78494|Q15364|Q15686|Q15687|Q15689|Q99377|Q9UE45|Q9UE46|Q9UE47|Q9UE48|Q9UFQ6	Silent	SNP	pfam_U1snRNP70_N,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.H158	ENST00000598441.1	37	c.474	CCDS12756.1	19																																																																																			SNRNP70	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000104852		0.617	SNRNP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP70	HGNC	protein_coding	OTTHUMT00000466266.1	-	0.00	129	0	C	NM_003089	Silent	49604727	+1	tier1	-	no_errors	ENST00000598441	ensembl	human	known	74_37	silent	41.72	95	68	SNP	1.000	T
SOX7	83595	genome.wustl.edu	37	8	10584106	10584106	+	Silent	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr8:10584106C>T	ENST00000304501.1	-	2	387	c.309G>A	c.(307-309)ctG>ctA	p.L103L	CTD-2135J3.3_ENST00000519568.1_RNA|SOX7_ENST00000553390.1_Silent_p.L155L|SOX7_ENST00000554914.1_Silent_p.L155L|CTD-2135J3.3_ENST00000506149.2_RNA	NM_031439.2	NP_113627.1	Q9BT81	SOX7_HUMAN	SRY (sex determining region Y)-box 7	103					endoderm formation (GO:0001706)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|regulation of canonical Wnt signaling pathway (GO:0060828)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20				COAD - Colon adenocarcinoma(149;0.0732)		GCATGTGCTGCAGGCGCAGCC	0.642																																																	0													43.0	47.0	46.0					8																	10584106		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ409320	CCDS5977.1	8p22	2013-01-25			ENSG00000171056	ENSG00000171056		"""SRY (sex determining region Y)-boxes"""	18196	protein-coding gene	gene with protein product		612202				11691915	Standard	NM_031439		Approved		uc003wtf.3	Q9BT81	OTTHUMG00000090585	ENST00000304501.1:c.309G>A	8.37:g.10584106C>T			B4DKV0|Q53YD0	Silent	SNP	pfam_Sox_C_TAD,pfam_G_patch_dom,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_G_patch_dom,pfscan_G_patch_dom,pfscan_HMG_box_dom	p.L155	ENST00000304501.1	37	c.465	CCDS5977.1	8																																																																																			SOX7	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,pfscan_HMG_box_dom	ENSG00000171056		0.642	SOX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX7	HGNC	protein_coding	OTTHUMT00000207131.1	-	0.00	37	0	C			10584106	-1	tier1	-	no_errors	ENST00000553390	ensembl	human	known	74_37	silent	15.00	17	3	SNP	1.000	T
SPDL1	54908	genome.wustl.edu	37	5	169015564	169015564	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr5:169015564G>T	ENST00000265295.4	+	2	423	c.144G>T	c.(142-144)atG>atT	p.M48I	SPDL1_ENST00000510751.1_3'UTR	NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1																		GTAATGAAATGATGACCATGA	0.383																																																	0													117.0	114.0	115.0					5																	169015564		2203	4300	6503	SO:0001583	missense	0			BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	ENST00000265295.4:c.144G>T	5.37:g.169015564G>T	ENSP00000265295:p.Met48Ile			Missense_Mutation	SNP	NULL	p.M48I	ENST00000265295.4	37	c.144	CCDS4370.1	5	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400591	0.62177	.	.	ENSG00000040275	ENST00000265295;ENST00000274631;ENST00000506574;ENST00000515224;ENST00000508247;ENST00000513941;ENST00000513795	T	0.31247	1.5	5.6	1.58	0.23477	.	0.126811	0.64402	D	0.000001	T	0.21227	0.0511	L	0.47190	1.495	0.38056	D	0.935932	B	0.16603	0.018	B	0.16722	0.016	T	0.07385	-1.0775	10	0.27082	T	0.32	-5.0149	4.7975	0.13279	0.1821:0.1102:0.5947:0.113	.	48	Q96EA4	SPDLY_HUMAN	I	48	ENSP00000265295:M48I	ENSP00000265295:M48I	M	+	3	0	CCDC99	168948142	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	2.077000	0.41557	0.828000	0.34709	0.655000	0.94253	ATG	SPDL1	-	NULL	ENSG00000040275		0.383	SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPDL1	HGNC	protein_coding	OTTHUMT00000252829.2		0.00	50	0	G	NM_017785		169015564	+1			no_errors	ENST00000265295	ensembl	human	known	74_37	missense	6.38	44	3	SNP	0.996	T
SSH2	85464	genome.wustl.edu	37	17	27958092	27958092	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:27958092C>G	ENST00000269033.3	-	15	4190	c.4039G>C	c.(4039-4041)Gcc>Ccc	p.A1347P	RP11-68I3.2_ENST00000581474.1_RNA|SSH2_ENST00000540801.1_Missense_Mutation_p.A1374P	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	1347					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AATTCTTTGGCATACTGCACA	0.517																																																	0													78.0	69.0	72.0					17																	27958092		2203	4300	6503	SO:0001583	missense	0			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.4039G>C	17.37:g.27958092C>G	ENSP00000269033:p.Ala1347Pro		Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.A1347P	ENST00000269033.3	37	c.4039	CCDS11253.1	17	.	.	.	.	.	.	.	.	.	.	C	17.26	3.343919	0.61073	.	.	ENSG00000141298	ENST00000269033;ENST00000540801	T;T	0.71341	-0.56;-0.56	6.17	5.2	0.72013	.	0.391887	0.26911	N	0.021862	T	0.81098	0.4752	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.74674	0.984;0.933	T	0.82559	-0.0397	10	0.72032	D	0.01	-15.0276	11.1392	0.48392	0.1298:0.8048:0.0:0.0654	.	1374;1347	F5H527;Q76I76	.;SSH2_HUMAN	P	1347;1374	ENSP00000269033:A1347P;ENSP00000444743:A1374P	ENSP00000269033:A1347P	A	-	1	0	SSH2	24982218	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.700000	0.54786	1.606000	0.50161	-0.182000	0.12963	GCC	SSH2	-	NULL	ENSG00000141298		0.517	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH2	HGNC	protein_coding	OTTHUMT00000256116.1	-	0.00	25	0	C	NM_033389		27958092	-1	tier1	-	no_errors	ENST00000269033	ensembl	human	known	74_37	missense	30.00	28	12	SNP	1.000	G
SSUH2	51066	genome.wustl.edu	37	3	8677492	8677492	+	5'UTR	DEL	T	T	-			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr3:8677492delT	ENST00000317371.4	-	0	1093				SSUH2_ENST00000415132.1_5'UTR|SSUH2_ENST00000341795.3_5'UTR|SSUH2_ENST00000544814.1_Frame_Shift_Del_p.E27fs			Q9Y2M2	SSUH2_HUMAN	ssu-2 homolog (C. elegans)							cytoplasm (GO:0005737)											CTCCAGGAGCTCTGTGGGGGG	0.587																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AB024705	CCDS2568.1, CCDS58815.1	3p25.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000125046	ENSG00000125046			24809	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 32"""	C3orf32		20205943	Standard	NM_001256748		Approved	fls485, ssu-2	uc011atg.3	Q9Y2M2	OTTHUMG00000122075	ENST00000317371.4:c.-133A>-	3.37:g.8677492delT			A6NFA9|B3KS84|B7Z6E3|F5H2S5|Q7Z7K4	Frame_Shift_Del	DEL	superfamily_HSP_DnaJ_Cys-rich_dom	p.E27fs	ENST00000317371.4	37	c.80	CCDS2568.1	3																																																																																			SSUH2	-	NULL	ENSG00000125046		0.587	SSUH2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SSUH2	HGNC	protein_coding	OTTHUMT00000337900.1		0.00	60	0	T	NM_015931		8677492	-1	tier1		no_errors	ENST00000544814	ensembl	human	known	74_37	frame_shift_del	40.43	28	19	DEL	0.512	-
SSUH2	51066	genome.wustl.edu	37	3	8677463	8677463	+	5'UTR	SNP	A	A	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr3:8677463A>T	ENST00000317371.4	-	0	1122				SSUH2_ENST00000415132.1_5'UTR|SSUH2_ENST00000341795.3_5'UTR|SSUH2_ENST00000544814.1_Missense_Mutation_p.W37R			Q9Y2M2	SSUH2_HUMAN	ssu-2 homolog (C. elegans)							cytoplasm (GO:0005737)											TGAAGAAGCCAGTCATAGCTG	0.567																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AB024705	CCDS2568.1, CCDS58815.1	3p25.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000125046	ENSG00000125046			24809	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 32"""	C3orf32		20205943	Standard	NM_001256748		Approved	fls485, ssu-2	uc011atg.3	Q9Y2M2	OTTHUMG00000122075	ENST00000317371.4:c.-104T>A	3.37:g.8677463A>T			A6NFA9|B3KS84|B7Z6E3|F5H2S5|Q7Z7K4	Missense_Mutation	SNP	superfamily_HSP_DnaJ_Cys-rich_dom	p.W37R	ENST00000317371.4	37	c.109	CCDS2568.1	3	.	.	.	.	.	.	.	.	.	.	A	12.75	2.031982	0.35893	.	.	ENSG00000125046	ENST00000544814;ENST00000427408	T;T	0.41065	1.04;1.01	5.27	4.12	0.48240	.	.	.	.	.	T	0.41903	0.1179	.	.	.	0.25917	N	0.983161	P	0.36837	0.571	B	0.43386	0.418	T	0.37267	-0.9713	8	0.72032	D	0.01	.	7.6628	0.28413	0.904:0.0:0.096:0.0	.	37	F5H2S5	.	R	37	ENSP00000439378:W37R;ENSP00000401289:W37R	ENSP00000388845:W37R	W	-	1	0	C3orf32	8652463	1.000000	0.71417	0.998000	0.56505	0.846000	0.48090	2.685000	0.46959	0.857000	0.35407	0.438000	0.28831	TGG	SSUH2	-	NULL	ENSG00000125046		0.567	SSUH2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SSUH2	HGNC	protein_coding	OTTHUMT00000337900.1		0.00	61	0	A	NM_015931		8677463	-1			no_errors	ENST00000544814	ensembl	human	known	74_37	missense	50.00	23	23	SNP	1.000	T
SSUH2	51066	genome.wustl.edu	37	3	8677488	8677488	+	5'UTR	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr3:8677488G>A	ENST00000317371.4	-	0	1097				SSUH2_ENST00000415132.1_5'UTR|SSUH2_ENST00000341795.3_5'UTR|SSUH2_ENST00000544814.1_Silent_p.L28L			Q9Y2M2	SSUH2_HUMAN	ssu-2 homolog (C. elegans)							cytoplasm (GO:0005737)											GTCTCTCCAGGAGCTCTGTGG	0.582																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AB024705	CCDS2568.1, CCDS58815.1	3p25.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000125046	ENSG00000125046			24809	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 32"""	C3orf32		20205943	Standard	NM_001256748		Approved	fls485, ssu-2	uc011atg.3	Q9Y2M2	OTTHUMG00000122075	ENST00000317371.4:c.-129C>T	3.37:g.8677488G>A			A6NFA9|B3KS84|B7Z6E3|F5H2S5|Q7Z7K4	Silent	SNP	superfamily_HSP_DnaJ_Cys-rich_dom	p.L28	ENST00000317371.4	37	c.84	CCDS2568.1	3																																																																																			SSUH2	-	NULL	ENSG00000125046		0.582	SSUH2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SSUH2	HGNC	protein_coding	OTTHUMT00000337900.1		0.00	60	0	G	NM_015931		8677488	-1			no_errors	ENST00000544814	ensembl	human	known	74_37	silent	45.24	22	19	SNP	0.994	A
SSUH2	51066	genome.wustl.edu	37	3	8677492	8677492	+	5'UTR	SNP	T	T	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr3:8677492T>C	ENST00000317371.4	-	0	1093				SSUH2_ENST00000415132.1_5'UTR|SSUH2_ENST00000341795.3_5'UTR|SSUH2_ENST00000544814.1_Missense_Mutation_p.E27G			Q9Y2M2	SSUH2_HUMAN	ssu-2 homolog (C. elegans)							cytoplasm (GO:0005737)											CTCCAGGAGCTCTGTGGGGGG	0.587																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AB024705	CCDS2568.1, CCDS58815.1	3p25.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000125046	ENSG00000125046			24809	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 32"""	C3orf32		20205943	Standard	NM_001256748		Approved	fls485, ssu-2	uc011atg.3	Q9Y2M2	OTTHUMG00000122075	ENST00000317371.4:c.-133A>G	3.37:g.8677492T>C			A6NFA9|B3KS84|B7Z6E3|F5H2S5|Q7Z7K4	Missense_Mutation	SNP	superfamily_HSP_DnaJ_Cys-rich_dom	p.E27G	ENST00000317371.4	37	c.80	CCDS2568.1	3	.	.	.	.	.	.	.	.	.	.	T	16.33	3.093226	0.56075	.	.	ENSG00000125046	ENST00000544814;ENST00000427408	T;T	0.49139	0.82;0.79	5.27	5.27	0.74061	.	.	.	.	.	T	0.50309	0.1608	.	.	.	0.22552	N	0.998993	P	0.44139	0.827	P	0.46758	0.526	T	0.48937	-0.8990	8	0.72032	D	0.01	.	11.592	0.50951	0.0:0.0:0.0:1.0	.	27	F5H2S5	.	G	27	ENSP00000439378:E27G;ENSP00000401289:E27G	ENSP00000388845:E27G	E	-	2	0	C3orf32	8652492	0.947000	0.32204	0.358000	0.25811	0.612000	0.37316	3.915000	0.56409	1.993000	0.58246	0.438000	0.28831	GAG	SSUH2	-	NULL	ENSG00000125046		0.587	SSUH2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SSUH2	HGNC	protein_coding	OTTHUMT00000337900.1		0.00	60	0	T	NM_015931		8677492	-1			no_errors	ENST00000544814	ensembl	human	known	74_37	missense	14.89	21	7	SNP	0.512	C
STK31	56164	genome.wustl.edu	37	7	23872024	23872025	+	3'UTR	INS	-	-	TTTG	rs56362098|rs113133971|rs397773231|rs66912813		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr7:23872024_23872025insTTTG	ENST00000355870.3	+	0	3218_3219				STK31_ENST00000428484.1_3'UTR|STK31_ENST00000405627.3_3'UTR|STK31_ENST00000354639.3_3'UTR|STK31_ENST00000433467.2_3'UTR	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31							acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TTTTTAAAAACTTTGGTTTGGT	0.322																																																	0									,,	3640,590		1595,450,70					,,	-3.8	0.0		dbSNP_130	23	5883,2315		2137,1609,353	no	utr-3,utr-3,utr-3	STK31	NM_032944.2,NM_031414.3,NM_001122833.1	,,	3732,2059,423	A1A1,A1R,RR		28.2386,13.948,23.3746	,,	,,		9523,2905				SO:0001624	3_prime_UTR_variant	0			AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.*40->TTTG	7.37:g.23872025_23872028dupTTTG			B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	RNA	INS	-	NULL	ENST00000355870.3	37	NULL	CCDS5386.1	7																																																																																			STK31	-	-	ENSG00000196335		0.322	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK31	HGNC	protein_coding	OTTHUMT00000214036.2		0.00	11	0	-	NM_031414		23872025	+1	tier1		no_errors	ENST00000405627	ensembl	human	known	74_37	rna	53.85	6	7	INS	0.000:0.017	TTTG
ST7-OT4	338069	genome.wustl.edu	37	7	116596724	116596724	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr7:116596724T>C	ENST00000397750.3	+	4	858	c.317T>C	c.(316-318)cTc>cCc	p.L106P	ST7_ENST00000393446.2_Intron|ST7_ENST00000393451.3_Intron|ST7-OT4_ENST00000466018.1_Intron|ST7-AS1_ENST00000456775.1_RNA|ST7_ENST00000265437.5_Intron|ST7_ENST00000393449.1_Intron|ST7-OT4_ENST00000397751.1_Missense_Mutation_p.L106P|ST7_ENST00000323984.3_Intron					ST7 overlapping transcript 4																		TGGTATCTTCTCAATATCTTG	0.388																																																	0																																										SO:0001583	missense	0			BM413623		7q31.2	2013-03-06	2013-03-06	2011-08-19	ENSG00000214188	ENSG00000214188		"""Long non-coding RNAs"", ""-"""	18835	other	unknown	"""non-protein coding RNA 42"""		"""ST7 overlapping transcript 4 (non-protein coding)"""	ST7OT4		12213198	Standard	NR_002329		Approved	NCRNA00042	uc003vip.1		OTTHUMG00000063631	ENST00000397750.3:c.317T>C	7.37:g.116596724T>C	ENSP00000380858:p.Leu106Pro			Missense_Mutation	SNP	NULL	p.L106P	ENST00000397750.3	37	c.317		7	.	.	.	.	.	.	.	.	.	.	T	6.374	0.437041	0.12104	.	.	ENSG00000214188	ENST00000397750;ENST00000397751	.	.	.	2.78	1.62	0.23740	.	.	.	.	.	T	0.30386	0.0763	.	.	.	0.09310	N	1	B	0.24317	0.101	B	0.24974	0.057	T	0.31336	-0.9947	7	0.87932	D	0	.	4.63	0.12496	0.0:0.1539:0.0:0.8461	.	106	A8MTU0	.	P	106	.	ENSP00000380858:L106P	L	+	2	0	ST7OT4	116383960	0.004000	0.15560	0.001000	0.08648	0.004000	0.04260	0.556000	0.23438	0.491000	0.27793	-0.451000	0.05528	CTC	ST7-OT4	-	NULL	ENSG00000214188		0.388	ST7-OT4-001	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	ST7-OT4	HGNC	protein_coding	OTTHUMT00000137763.3	-	0.00	44	0	T	NR_002329		116596724	+1	tier1	-	no_errors	ENST00000397750	ensembl	human	putative	74_37	missense	60.47	17	26	SNP	0.001	C
STXBP3	6814	genome.wustl.edu	37	1	109351459	109351459	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:109351459A>G	ENST00000370008.3	+	19	1789	c.1739A>G	c.(1738-1740)aAt>aGt	p.N580S		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	580					blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		AAGATGCTGAATAAACCCAAG	0.323																																																	0													141.0	155.0	150.0					1																	109351459		2203	4300	6503	SO:0001583	missense	0			D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.1739A>G	1.37:g.109351459A>G	ENSP00000359025:p.Asn580Ser		A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.N580S	ENST00000370008.3	37	c.1739	CCDS790.1	1	.	.	.	.	.	.	.	.	.	.	A	4.581	0.107862	0.08780	.	.	ENSG00000116266	ENST00000370008	T	0.79352	-1.26	5.08	3.73	0.42828	.	0.196490	0.53938	D	0.000046	T	0.27169	0.0666	N	0.05230	-0.09	0.31468	N	0.668662	B	0.02656	0.0	B	0.01281	0.0	T	0.13872	-1.0493	10	0.02654	T	1	-29.6721	6.7763	0.23621	0.643:0.2679:0.0891:0.0	.	580	O00186	STXB3_HUMAN	S	580	ENSP00000359025:N580S	ENSP00000359025:N580S	N	+	2	0	STXBP3	109152982	0.951000	0.32395	1.000000	0.80357	0.942000	0.58702	0.206000	0.17375	1.913000	0.55393	0.482000	0.46254	AAT	STXBP3	-	superfamily_Sec1-like	ENSG00000116266		0.323	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP3	HGNC	protein_coding	OTTHUMT00000030591.1	-	0.00	82	0	A	NM_007269		109351459	+1	tier1	-	no_errors	ENST00000370008	ensembl	human	known	74_37	missense	36.00	64	36	SNP	0.995	G
STRIP1	85369	genome.wustl.edu	37	1	110589335	110589335	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:110589335C>T	ENST00000369795.3	+	13	1472	c.1450C>T	c.(1450-1452)Cag>Tag	p.Q484*	STRIP1_ENST00000369796.1_Nonsense_Mutation_p.Q389*	NM_033088.3	NP_149079.2	Q5VSL9	STRP1_HUMAN	striatin interacting protein 1	484					cortical actin cytoskeleton organization (GO:0030866)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)											GGTCCAGGCACAGATGGAGGA	0.577																																																	0													174.0	172.0	172.0					1																	110589335		2203	4300	6503	SO:0001587	stop_gained	0			AK027649	CCDS30798.1, CCDS59197.1	1p13.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000143093	ENSG00000143093			25916	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog A (yeast)"""		"""family with sequence similarity 40, member A"""	FAM40A		11214970, 12588993, 22782902, 22298706, 18782753	Standard	NM_033088		Approved	FLJ14743, KIAA1761, FAR11A	uc001dza.2	Q5VSL9	OTTHUMG00000170607	ENST00000369795.3:c.1450C>T	1.37:g.110589335C>T	ENSP00000358810:p.Gln484*		Q0V925|Q5VSL8|Q658K2|Q6ZV31|Q8N598|Q96SN2|Q9C0A2	Nonsense_Mutation	SNP	pfam_DUF3402,pfam_N1221	p.Q484*	ENST00000369795.3	37	c.1450	CCDS30798.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.507521	0.96386	.	.	ENSG00000143093	ENST00000369796;ENST00000369795	.	.	.	5.83	5.83	0.93111	.	0.277916	0.38381	N	0.001718	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-28.2584	19.7288	0.96175	0.0:1.0:0.0:0.0	.	.	.	.	X	389;484	.	ENSP00000358810:Q484X	Q	+	1	0	FAM40A	110390858	0.908000	0.30866	0.990000	0.47175	0.865000	0.49528	1.824000	0.39072	2.775000	0.95449	0.650000	0.86243	CAG	STRIP1	-	pfam_DUF3402	ENSG00000143093		0.577	STRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRIP1	HGNC	protein_coding	OTTHUMT00000032213.1	-	0.00	91	0	C	NM_033088		110589335	+1	tier1	-	no_errors	ENST00000369795	ensembl	human	known	74_37	nonsense	40.74	80	55	SNP	0.963	T
SYT8	90019	genome.wustl.edu	37	11	1853118	1853118	+	5'Flank	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:1853118G>T	ENST00000381968.3	+	0	0				SYT8_ENST00000535046.1_Missense_Mutation_p.G146W|SYT8_ENST00000436964.2_Intron|SYT8_ENST00000341958.3_5'Flank	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII						acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AGGAAGTGGTGGGCGTCAGGT	0.637																																																	0																																										SO:0001631	upstream_gene_variant	0			AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026		11.37:g.1853118G>T	Exception_encountered		A6NFJ4|Q9NSV9	Missense_Mutation	SNP	NULL	p.G146W	ENST00000381968.3	37	c.436	CCDS7726.2	11	.	.	.	.	.	.	.	.	.	.	g	13.62	2.291691	0.40594	.	.	ENSG00000149043	ENST00000535046	T	0.28895	1.59	3.11	-3.41	0.04839	.	.	.	.	.	T	0.25680	0.0625	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37174	-0.9717	6	0.72032	D	0.01	.	4.2351	0.10621	0.4536:0.3305:0.2159:0.0	.	.	.	.	W	146	ENSP00000443325:G146W	ENSP00000443325:G146W	G	+	1	0	SYT8	1809694	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.996000	0.03709	-0.764000	0.04651	0.313000	0.20887	GGG	SYT8	-	NULL	ENSG00000149043		0.637	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT8	HGNC	protein_coding	OTTHUMT00000025013.4	-	0.00	61	0	G			1853118	+1	tier1	-	no_errors	ENST00000535046	ensembl	human	known	74_37	missense	8.62	53	5	SNP	0.000	T
TBC1D12	23232	genome.wustl.edu	37	10	96269860	96269860	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr10:96269860C>T	ENST00000225235.4	+	8	1723	c.1613C>T	c.(1612-1614)gCt>gTt	p.A538V	TBC1D12_ENST00000485048.1_3'UTR	NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	538	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				GTATCTGTTGCTGATCGAGAG	0.388																																																	0													172.0	161.0	164.0					10																	96269860		1850	4105	5955	SO:0001583	missense	0			AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.1613C>T	10.37:g.96269860C>T	ENSP00000225235:p.Ala538Val		Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.A538V	ENST00000225235.4	37	c.1613	CCDS41553.1	10	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062597	0.76187	.	.	ENSG00000108239	ENST00000225235	T	0.12147	2.71	5.11	5.11	0.69529	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.15825	0.0381	L	0.33668	1.02	0.58432	D	0.999999	B	0.28470	0.213	B	0.37989	0.262	T	0.08207	-1.0733	10	0.32370	T	0.25	-9.121	16.0637	0.80856	0.0:1.0:0.0:0.0	.	538	O60347	TBC12_HUMAN	V	538	ENSP00000225235:A538V	ENSP00000225235:A538V	A	+	2	0	TBC1D12	96259850	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.038000	0.64177	2.645000	0.89757	0.591000	0.81541	GCT	TBC1D12	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000108239		0.388	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D12	HGNC	protein_coding	OTTHUMT00000049482.2		0.00	53	0	C			96269860	+1			no_errors	ENST00000225235	ensembl	human	known	74_37	missense	5.45	52	3	SNP	1.000	T
TBCD	6904	genome.wustl.edu	37	17	80847552	80847552	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:80847552C>A	ENST00000355528.4	+	16	1672	c.1542C>A	c.(1540-1542)ttC>ttA	p.F514L	TBCD_ENST00000397466.2_Missense_Mutation_p.F128L|TBCD_ENST00000539345.2_Missense_Mutation_p.F514L	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	514					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			AGGCCGCCTTCCAGGAGAATG	0.498																																																	0													103.0	103.0	103.0					17																	80847552		1986	4164	6150	SO:0001583	missense	0			BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.1542C>A	17.37:g.80847552C>A	ENSP00000347719:p.Phe514Leu		O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	pfam_Tubulin_specific_chaperoneD_C,superfamily_ARM-type_fold	p.F514L	ENST00000355528.4	37	c.1542	CCDS45818.1	17	.	.	.	.	.	.	.	.	.	.	c	25.7	4.661875	0.88251	.	.	ENSG00000141556	ENST00000355528;ENST00000334614;ENST00000397466;ENST00000536182	T;T	0.58210	0.35;0.35	4.7	4.7	0.59300	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.66218	0.2767	L	0.46947	1.48	0.54753	D	0.99998	D;D;P	0.89917	0.999;1.0;0.854	D;D;P	0.91635	0.979;0.999;0.664	T	0.64613	-0.6366	9	.	.	.	.	16.9901	0.86351	0.0:1.0:0.0:0.0	.	514;514;514	Q9BTW9;Q9BTW9-4;F5H8C7	TBCD_HUMAN;.;.	L	514;265;128;514	ENSP00000347719:F514L;ENSP00000380608:F128L	.	F	+	3	2	TBCD	78440841	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.959000	0.49153	2.327000	0.79052	0.479000	0.44913	TTC	TBCD	-	superfamily_ARM-type_fold	ENSG00000141556		0.498	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCD	HGNC	protein_coding	OTTHUMT00000439415.1	-	0.00	57	0	C	NM_005993		80847552	+1	tier1	-	no_errors	ENST00000355528	ensembl	human	known	74_37	missense	27.18	75	28	SNP	1.000	A
P2RX6	9127	genome.wustl.edu	37	22	21363916	21363916	+	IGR	SNP	A	A	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr22:21363916A>G	ENST00000591411.1	+	0	0				THAP7-AS1_ENST00000452284.1_RNA|TUBA3FP_ENST00000422086.1_RNA|THAP7-AS1_ENST00000436079.1_RNA			O15547	P2RX6_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 6						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|channel activity (GO:0015267)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)										ATCTATGCACAAATCACCACG	0.443																																																	0																																										SO:0001628	intergenic_variant	0				CCDS13788.2, CCDS54504.1	22q11.21	2012-01-17	2008-03-28	2008-03-28	ENSG00000099957	ENSG00000099957		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8538	protein-coding gene	gene with protein product		608077	"""purinergic receptor P2X-like 1, orphan receptor"""	P2RXL1		9242461, 10591208, 8786426	Standard	NM_005446		Approved	P2XM, MGC129625, P2X6	uc010gsu.1	O15547	OTTHUMG00000150689		22.37:g.21363916A>G			F6V3D7|Q32MB6|Q58F04|Q6IC33|Q9UL50	RNA	SNP	-	NULL	ENST00000591411.1	37	NULL		22																																																																																			THAP7-AS1	-	-	ENSG00000230513		0.443	P2RX6-009	KNOWN	basic	processed_transcript	THAP7-AS1	HGNC	protein_coding	OTTHUMT00000459956.1	-	0.00	21	0	A	NM_005446		21363916	+1	tier1	-	no_errors	ENST00000436079	ensembl	human	known	74_37	rna	46.67	16	14	SNP	0.000	G
TLE2	7089	genome.wustl.edu	37	19	3025060	3025060	+	Silent	SNP	C	C	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:3025060C>G	ENST00000262953.6	-	5	514	c.252G>C	c.(250-252)ctG>ctC	p.L84L	TLE2_ENST00000590536.1_Silent_p.L84L|TLE2_ENST00000591529.1_Silent_p.L97L|TLE2_ENST00000443826.3_Silent_p.L29L|TLE2_ENST00000426948.2_Silent_p.L97L|TLE2_ENST00000447365.2_5'UTR|TLE2_ENST00000455444.2_Silent_p.L29L|TLE2_ENST00000586422.1_Silent_p.L29L	NM_003260.4	NP_003251.2	Q04725	TLE2_HUMAN	transducin-like enhancer of split 2	84	Gln-rich.				negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGATACCGCTCAGACGCTTCA	0.627																																																	0													38.0	37.0	37.0					19																	3025060		1861	4100	5961	SO:0001819	synonymous_variant	0			M99436	CCDS45911.1, CCDS45912.1, CCDS45913.1, CCDS74255.1	19p13.3	2014-03-07	2014-03-07					"""WD repeat domain containing"""	11838	protein-coding gene	gene with protein product	"""enhancer of split groucho 2"""	601041	"""transducin-like enhancer of split 2, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)"""			8808280	Standard	NM_003260		Approved	ESG2, GRG2, ESG, FLJ41188	uc002lww.3	Q04725		ENST00000262953.6:c.252G>C	19.37:g.3025060C>G			B4DE03|E9PEV7|F8WCH2|Q8WVY0|Q9Y6S0	Silent	SNP	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Groucho_enhance,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L84	ENST00000262953.6	37	c.252	CCDS45911.1	19																																																																																			TLE2	-	pfam_Groucho/TLE_N	ENSG00000065717		0.627	TLE2-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	TLE2	HGNC	protein_coding	OTTHUMT00000452194.2	-	0.00	70	0	C	NM_003260		3025060	-1	tier1	-	no_errors	ENST00000262953	ensembl	human	known	74_37	silent	47.71	57	52	SNP	0.998	G
TMC5	79838	genome.wustl.edu	37	16	19501731	19501731	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr16:19501731C>T	ENST00000396229.2	+	18	3337	c.2588C>T	c.(2587-2589)gCt>gTt	p.A863V	TMC5_ENST00000561503.1_Missense_Mutation_p.A504V|TMC5_ENST00000542583.2_Missense_Mutation_p.A863V|TMC5_ENST00000219821.5_Missense_Mutation_p.A617V|TMC5_ENST00000381414.4_Intron|TMC5_ENST00000564959.1_Missense_Mutation_p.A546V|TMC5_ENST00000541464.1_Missense_Mutation_p.A811V|CTA-363E6.6_ENST00000561762.1_RNA	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	863					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						AAGCCTTCAGCTGACTGTGGC	0.502																																																	0													188.0	164.0	172.0					16																	19501731		2197	4300	6497	SO:0001583	missense	0			AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.2588C>T	16.37:g.19501731C>T	ENSP00000379531:p.Ala863Val		Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	pfam_TMC	p.A863V	ENST00000396229.2	37	c.2588	CCDS45431.1	16	.	.	.	.	.	.	.	.	.	.	C	15.12	2.739323	0.49045	.	.	ENSG00000103534	ENST00000541464;ENST00000396229;ENST00000542583;ENST00000219821;ENST00000440743	T;T;T;T	0.69306	-0.17;-0.26;-0.26;-0.39	5.41	0.491	0.16867	.	.	.	.	.	T	0.61311	0.2337	L	0.38531	1.155	0.09310	N	1	D;B;P;P;P	0.57257	0.979;0.147;0.929;0.883;0.938	P;B;P;B;B	0.53313	0.723;0.048;0.479;0.379;0.428	T	0.51537	-0.8693	9	0.25106	T	0.35	-2.2668	7.6725	0.28468	0.5078:0.4022:0.0:0.09	.	811;546;617;617;863	F5GYU8;E7EU57;Q6UXY8-3;B3KUQ8;Q6UXY8	.;.;.;.;TMC5_HUMAN	V	811;863;863;617;546	ENSP00000441227:A811V;ENSP00000379531:A863V;ENSP00000446274:A863V;ENSP00000219821:A617V	ENSP00000219821:A617V	A	+	2	0	TMC5	19409232	0.001000	0.12720	0.058000	0.19502	0.758000	0.43043	0.610000	0.24253	0.566000	0.29273	-0.367000	0.07326	GCT	TMC5	-	NULL	ENSG00000103534		0.502	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC5	HGNC	protein_coding	OTTHUMT00000435888.1	-	0.00	63	0	C	NM_024780		19501731	+1	tier1	-	no_errors	ENST00000396229	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.006	T
TNN	63923	genome.wustl.edu	37	1	175096207	175096207	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:175096207G>C	ENST00000239462.4	+	13	3144	c.3031G>C	c.(3031-3033)Gat>Cat	p.D1011H		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	1011	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CCAGTTCCCAGATGGCACAGT	0.517																																																	0													185.0	170.0	175.0					1																	175096207		2203	4300	6503	SO:0001583	missense	0			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.3031G>C	1.37:g.175096207G>C	ENSP00000239462:p.Asp1011His		B9EGP3|Q5R360	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.D1011H	ENST00000239462.4	37	c.3031	CCDS30943.1	1	.	.	.	.	.	.	.	.	.	.	G	12.50	1.956862	0.34565	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.59364	0.27	5.14	3.12	0.35913	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.201369	0.50627	D	0.000101	T	0.69504	0.3118	M	0.74467	2.265	0.48395	D	0.999645	P	0.50528	0.936	D	0.66351	0.943	T	0.67369	-0.5688	10	0.66056	D	0.02	.	5.9678	0.19334	0.4344:0.0:0.5656:0.0	.	1011	Q9UQP3	TENN_HUMAN	H	1011;834	ENSP00000239462:D1011H	ENSP00000239462:D1011H	D	+	1	0	TNN	173362830	1.000000	0.71417	0.587000	0.28692	0.112000	0.19704	3.758000	0.55220	0.410000	0.25675	0.563000	0.77884	GAT	TNN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000120332		0.517	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNN	HGNC	protein_coding	OTTHUMT00000084422.1	-	0.00	86	0	G	XM_040527		175096207	+1	tier1	-	no_errors	ENST00000239462	ensembl	human	known	74_37	missense	33.33	54	28	SNP	0.969	C
TNRC18	84629	genome.wustl.edu	37	7	5414008	5414008	+	Silent	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr7:5414008C>A	ENST00000430969.1	-	10	3255	c.2907G>T	c.(2905-2907)ggG>ggT	p.G969G	TNRC18_ENST00000399537.4_Silent_p.G969G	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	969	Pro-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GCGGCAGCAGCCCGGGGCCGG	0.761																																																	0													2.0	3.0	2.0					7																	5414008		1205	2780	3985	SO:0001819	synonymous_variant	0			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.2907G>T	7.37:g.5414008C>A			A8MX41|Q96JH1|Q96K91	Silent	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.G969	ENST00000430969.1	37	c.2907	CCDS47534.1	7																																																																																			TNRC18	-	NULL	ENSG00000182095		0.761	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding			0.00	17	0	C			5414008	-1			no_errors	ENST00000399537	ensembl	human	known	74_37	silent	13.89	31	5	SNP	0.994	A
TP53	7157	genome.wustl.edu	37	17	7578257	7578257	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:7578257C>A	ENST00000269305.4	-	6	781	c.592G>T	c.(592-594)Gaa>Taa	p.E198*	TP53_ENST00000413465.2_Nonsense_Mutation_p.E198*|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.E198*|TP53_ENST00000420246.2_Nonsense_Mutation_p.E198*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E198*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E198*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	198	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> D (in a sporadic cancer; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E198*(27)|p.0?(8)|p.E198K(5)|p.?(5)|p.P191_E198>Q(3)|p.E105*(3)|p.E66*(3)|p.E198fs*11(2)|p.E198Q(2)|p.E198fs*7(1)|p.E198fs*49(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AAATTTCCTTCCACTCGGATA	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	64	Substitution - Nonsense(33)|Whole gene deletion(8)|Substitution - Missense(7)|Complex - deletion inframe(5)|Unknown(5)|Insertion - Frameshift(2)|Deletion - Frameshift(2)|Deletion - In frame(1)|Complex - frameshift(1)	urinary_tract(9)|breast(7)|ovary(7)|upper_aerodigestive_tract(5)|biliary_tract(5)|lung(5)|prostate(5)|bone(4)|central_nervous_system(3)|oesophagus(3)|skin(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|liver(2)|stomach(1)|soft_tissue(1)											112.0	100.0	104.0					17																	7578257		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.592G>T	17.37:g.7578257C>A	ENSP00000269305:p.Glu198*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E198*	ENST00000269305.4	37	c.592	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	15.84	2.950903	0.53186	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-10.9371	16.7921	0.85592	0.0:1.0:0.0:0.0	.	.	.	.	X	198;198;198;198;198;198;187;105;66;105;66	.	ENSP00000269305:E198X	E	-	1	0	TP53	7518982	1.000000	0.71417	1.000000	0.80357	0.024000	0.10985	7.775000	0.85489	2.634000	0.89283	0.563000	0.77884	GAA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	86	0	C	NM_000546		7578257	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	81.89	23	104	SNP	1.000	A
TRIM60	166655	genome.wustl.edu	37	4	165962177	165962177	+	Missense_Mutation	SNP	G	G	T	rs535129175		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr4:165962177G>T	ENST00000512596.1	+	3	1169	c.953G>T	c.(952-954)cGa>cTa	p.R318L	TRIM60_ENST00000508504.1_Missense_Mutation_p.R318L|TRIM60_ENST00000341062.5_Missense_Mutation_p.R318L	NM_152620.2	NP_689833.1	Q495X7	TRI60_HUMAN	tripartite motif containing 60	318	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.R318Q(1)		NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	29	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		AAAGCTGTGCGATATGAAAGA	0.413																																																	1	Substitution - Missense(1)	NS(1)											94.0	96.0	96.0					4																	165962177		2203	4300	6503	SO:0001583	missense	0			AK093201	CCDS3808.1	4q32.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000176979	ENSG00000176979		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21162	protein-coding gene	gene with protein product			"""ring finger protein 129"", ""tripartite motif-containing 60"""	RNF129, RNF33			Standard	NM_152620		Approved	FLJ35882	uc003iqy.1	Q495X7	OTTHUMG00000161262	ENST00000512596.1:c.953G>T	4.37:g.165962177G>T	ENSP00000421142:p.Arg318Leu		Q8NA35	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R318L	ENST00000512596.1	37	c.953	CCDS3808.1	4	.	.	.	.	.	.	.	.	.	.	G	3.825	-0.037027	0.07497	.	.	ENSG00000176979	ENST00000512596;ENST00000508504;ENST00000341062	T;T;T	0.03982	3.74;3.74;3.74	2.49	-4.98	0.03019	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	7.611780	0.01049	U	0.004427	T	0.07143	0.0181	M	0.77313	2.365	0.09310	N	1	B	0.12630	0.006	B	0.17433	0.018	T	0.35500	-0.9786	10	0.35671	T	0.21	.	1.5093	0.02493	0.3203:0.35:0.1973:0.1324	.	318	Q495X7	TRI60_HUMAN	L	318	ENSP00000421142:R318L;ENSP00000426496:R318L;ENSP00000343765:R318L	ENSP00000343765:R318L	R	+	2	0	TRIM60	166181627	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-3.039000	0.00633	-1.687000	0.01437	-0.140000	0.14226	CGA	TRIM60	-	superfamily_ConA-like_lec_gl_sf,smart_PRY,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000176979		0.413	TRIM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM60	HGNC	protein_coding	OTTHUMT00000364325.1	-	0.00	63	0	G	NM_152620		165962177	+1	tier1	-	no_errors	ENST00000341062	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.000	T
TRPM1	4308	genome.wustl.edu	37	15	31334235	31334235	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr15:31334235T>G	ENST00000256552.6	-	17	2153	c.2006A>C	c.(2005-2007)aAg>aCg	p.K669T	TRPM1_ENST00000542188.1_Missense_Mutation_p.K686T|TRPM1_ENST00000397795.2_Missense_Mutation_p.K647T|RP11-348B17.1_ENST00000561299.1_RNA	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CTTGTAGAGCTTGCAGGCCAC	0.562																																																	0													68.0	73.0	71.0					15																	31334235		2182	4293	6475	SO:0001583	missense	0			AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.2006A>C	15.37:g.31334235T>G	ENSP00000256552:p.Lys669Thr			Missense_Mutation	SNP	pfam_Ion_trans_dom	p.K686T	ENST00000256552.6	37	c.2057	CCDS58346.1	15	.	.	.	.	.	.	.	.	.	.	T	25.2	4.615250	0.87359	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.71579	-0.58;-0.58;-0.58	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	D	0.84133	0.5405	M	0.81682	2.555	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.993	D	0.86795	0.1988	10	0.87932	D	0	-29.6931	14.5002	0.67716	0.0:0.0:0.0:1.0	.	641;647	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	T	647;686;669;647	ENSP00000380897:K647T;ENSP00000437849:K686T;ENSP00000256552:K669T	ENSP00000256552:K669T	K	-	2	0	TRPM1	29121527	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.974000	0.88039	1.869000	0.54173	0.533000	0.62120	AAG	TRPM1	-	NULL	ENSG00000134160		0.562	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	TRPM1	HGNC	protein_coding	OTTHUMT00000417166.2	-	0.00	46	0	T	NM_002420		31334235	-1	tier1	-	no_errors	ENST00000542188	ensembl	human	known	74_37	missense	46.15	42	36	SNP	1.000	G
TRPM2	7226	genome.wustl.edu	37	21	45820225	45820225	+	Silent	SNP	G	G	T	rs148173972		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr21:45820225G>T	ENST00000397928.1	+	15	2737	c.2292G>T	c.(2290-2292)ccG>ccT	p.P764P	TRPM2_ENST00000300481.9_Silent_p.P744P|TRPM2_ENST00000397932.2_Silent_p.P764P|TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000300482.5_Silent_p.P764P	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	764					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						TGGCCTTCCCGCTGCTCCTCA	0.697																																																	0													95.0	68.0	77.0					21																	45820225		2202	4300	6502	SO:0001819	synonymous_variant	0			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.2292G>T	21.37:g.45820225G>T			D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Silent	SNP	pfam_Ion_trans_dom,superfamily_NUDIX_hydrolase_dom-like	p.P764	ENST00000397928.1	37	c.2292	CCDS13710.1	21																																																																																			TRPM2	-	NULL	ENSG00000142185		0.697	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	HGNC	protein_coding	OTTHUMT00000098086.1		0.00	22	0	G	NM_003307		45820225	+1			no_errors	ENST00000300482	ensembl	human	known	74_37	silent	9.52	19	2	SNP	0.699	T
TTC39B	158219	genome.wustl.edu	37	9	15307166	15307166	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr9:15307166C>G	ENST00000512701.2	-	1	192	c.156G>C	c.(154-156)gaG>gaC	p.E52D	TTC39B_ENST00000297615.5_Missense_Mutation_p.E52D|TTC39B_ENST00000541445.1_5'UTR|TTC39B_ENST00000355694.2_5'UTR|TTC39B_ENST00000380850.4_Missense_Mutation_p.E52D			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	52										NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						AAGCAGGGAACTCAGAGCCGA	0.667																																																	0													24.0	23.0	23.0					9																	15307166		2203	4297	6500	SO:0001583	missense	0			AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.156G>C	9.37:g.15307166C>G	ENSP00000422496:p.Glu52Asp		A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Missense_Mutation	SNP	pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat	p.E52D	ENST00000512701.2	37	c.156	CCDS6477.2	9	.	.	.	.	.	.	.	.	.	.	C	14.55	2.568014	0.45798	.	.	ENSG00000155158	ENST00000380850;ENST00000297615;ENST00000512701;ENST00000506891	T;T;T	0.48836	1.47;0.8;1.47	3.93	3.93	0.45458	.	.	.	.	.	T	0.37265	0.0997	N	0.22421	0.69	0.53688	D	0.999975	.	.	.	.	.	.	T	0.07927	-1.0747	7	0.14656	T	0.56	.	11.617	0.51096	0.0:1.0:0.0:0.0	.	.	.	.	D	52;52;52;14	ENSP00000370231:E52D;ENSP00000297615:E52D;ENSP00000422496:E52D	ENSP00000297615:E52D	E	-	3	2	TTC39B	15297166	0.621000	0.27077	0.007000	0.13788	0.052000	0.14988	3.197000	0.51028	2.185000	0.69588	0.313000	0.20887	GAG	TTC39B	-	NULL	ENSG00000155158		0.667	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC39B	HGNC	protein_coding	OTTHUMT00000051758.3	-	0.00	66	0	C	NM_152574		15307166	-1	tier1	-	no_errors	ENST00000512701	ensembl	human	known	74_37	missense	65.22	16	30	SNP	0.009	G
TSC1	7248	genome.wustl.edu	37	9	135782727	135782727	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr9:135782727G>C	ENST00000298552.3	-	13	1515	c.1294C>G	c.(1294-1296)Cta>Gta	p.L432V	TSC1_ENST00000440111.2_Missense_Mutation_p.L432V|TSC1_ENST00000545250.1_Missense_Mutation_p.L381V	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	432					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		TGTCTGTGTAGACATGGTCTT	0.378			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																														yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	1	Unknown(1)	bone(1)											150.0	130.0	137.0					9																	135782727		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.1294C>G	9.37:g.135782727G>C	ENSP00000298552:p.Leu432Val		B7Z897|Q5VVN5	Missense_Mutation	SNP	pfam_Hamartin,superfamily_ARM-type_fold	p.L432V	ENST00000298552.3	37	c.1294	CCDS6956.1	9	.	.	.	.	.	.	.	.	.	.	G	17.32	3.358759	0.61403	.	.	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250	D;D;D	0.86497	-2.13;-2.13;-2.13	5.44	5.44	0.79542	.	0.138320	0.50627	D	0.000116	D	0.90601	0.7053	L	0.43701	1.375	0.80722	D	1	B;P;D	0.89917	0.327;0.819;1.0	B;B;D	0.91635	0.206;0.429;0.999	D	0.89494	0.3759	10	0.37606	T	0.19	-5.2626	15.9736	0.80040	0.0:0.0:1.0:0.0	.	381;431;432	B7Z897;Q32NF0;Q92574	.;.;TSC1_HUMAN	V	432;432;381	ENSP00000298552:L432V;ENSP00000394524:L432V;ENSP00000444017:L381V	ENSP00000298552:L432V	L	-	1	2	TSC1	134772548	0.927000	0.31430	0.180000	0.23079	0.920000	0.55202	2.244000	0.43124	2.548000	0.85928	0.585000	0.79938	CTA	TSC1	-	pfam_Hamartin	ENSG00000165699		0.378	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSC1	HGNC	protein_coding	OTTHUMT00000054799.1	-	0.00	27	0	G			135782727	-1	tier1	-	no_errors	ENST00000298552	ensembl	human	known	74_37	missense	43.28	38	29	SNP	0.919	C
TUBA1B	10376	genome.wustl.edu	37	12	49521825	49521825	+	Silent	SNP	A	A	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:49521825A>G	ENST00000336023.5	-	4	1366	c.1272T>C	c.(1270-1272)gaT>gaC	p.D424D	RP11-386G11.10_ENST00000548149.1_RNA|RP11-386G11.10_ENST00000552893.1_RNA|RP11-386G11.10_ENST00000547387.1_RNA	NM_006082.2	NP_006073.2	P68363	TBA1B_HUMAN	tubulin, alpha 1b	424					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(4)	12						GGGCAGCCATATCTTCACGGG	0.493																																																	0													141.0	149.0	146.0					12																	49521825		2203	4300	6503	SO:0001819	synonymous_variant	0			AF081484	CCDS31792.1	12q13.12	2007-02-12				ENSG00000123416		"""Tubulins"""	18809	protein-coding gene	gene with protein product	"""tubulin, alpha, ubiquitous"""	602530				12054644, 6646120	Standard	NM_006082		Approved	K-ALPHA-1	uc001rtm.3	P68363	OTTHUMG00000170410	ENST00000336023.5:c.1272T>C	12.37:g.49521825A>G			P04687|P05209|Q27I68|Q8WU19	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Beta_tubulin,prints_Delta_tubulin	p.D424	ENST00000336023.5	37	c.1272	CCDS31792.1	12																																																																																			TUBA1B	-	superfamily_Tub_FtsZ_C,prints_Alpha_tubulin	ENSG00000123416		0.493	TUBA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA1B	HGNC	protein_coding	OTTHUMT00000409005.1	-	0.00	138	0	A	NM_006082		49521825	-1	tier1	-	no_errors	ENST00000336023	ensembl	human	known	74_37	silent	21.89	132	37	SNP	1.000	G
TUBA1B	10376	genome.wustl.edu	37	12	49521828	49521828	+	Silent	SNP	T	T	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr12:49521828T>C	ENST00000336023.5	-	4	1363	c.1269A>G	c.(1267-1269)gaA>gaG	p.E423E	RP11-386G11.10_ENST00000548149.1_RNA|RP11-386G11.10_ENST00000552893.1_RNA|RP11-386G11.10_ENST00000547387.1_RNA	NM_006082.2	NP_006073.2	P68363	TBA1B_HUMAN	tubulin, alpha 1b	423					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(4)	12						CAGCCATATCTTCACGGGCCT	0.502																																																	0													137.0	145.0	142.0					12																	49521828		2203	4300	6503	SO:0001819	synonymous_variant	0			AF081484	CCDS31792.1	12q13.12	2007-02-12				ENSG00000123416		"""Tubulins"""	18809	protein-coding gene	gene with protein product	"""tubulin, alpha, ubiquitous"""	602530				12054644, 6646120	Standard	NM_006082		Approved	K-ALPHA-1	uc001rtm.3	P68363	OTTHUMG00000170410	ENST00000336023.5:c.1269A>G	12.37:g.49521828T>C			P04687|P05209|Q27I68|Q8WU19	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Beta_tubulin,prints_Delta_tubulin	p.E423	ENST00000336023.5	37	c.1269	CCDS31792.1	12																																																																																			TUBA1B	-	superfamily_Tub_FtsZ_C,prints_Alpha_tubulin	ENSG00000123416		0.502	TUBA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA1B	HGNC	protein_coding	OTTHUMT00000409005.1	-	0.00	145	0	T	NM_006082		49521828	-1	tier1	-	no_errors	ENST00000336023	ensembl	human	known	74_37	silent	23.67	129	40	SNP	1.000	C
TUBB2A	7280	genome.wustl.edu	37	6	3154692	3154692	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr6:3154692G>A	ENST00000333628.3	-	4	805	c.743C>T	c.(742-744)gCa>gTa	p.A248V	RP1-40E16.11_ENST00000447644.1_RNA|TUBB2A_ENST00000489942.1_5'Flank	NM_001069.2	NP_001060.1	Q13885	TBB2A_HUMAN	tubulin, beta 2A class IIa	248			A -> V (in CDCBM5; reduces coassembly with tubulin subunits and incorporation into the microtubule polymer network). {ECO:0000269|PubMed:24702957}.		'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|large_intestine(4)|lung(2)|skin(1)	9	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				GCGCAGGTCTGCGTTCAGCTG	0.677																																																	0													11.0	10.0	10.0					6																	3154692		2170	4204	6374	SO:0001583	missense	0			AY159127	CCDS4484.1	6p25.2	2012-10-02	2011-10-10	2005-11-03	ENSG00000137267	ENSG00000137267		"""Tubulins"""	12412	protein-coding gene	gene with protein product	"""class IIa beta-tubulin"""	615101	"""tubulin, beta polypeptide"", ""tubulin, beta 2"", ""tubulin, beta 2A"""	TUBB, TUBB2		14574404	Standard	NM_001069		Approved	dJ40E16.7	uc003mvc.3	Q13885	OTTHUMG00000014135	ENST00000333628.3:c.743C>T	6.37:g.3154692G>A	ENSP00000369703:p.Ala248Val		Q6FGZ8|Q8IWR2	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.A248V	ENST00000333628.3	37	c.743	CCDS4484.1	6	.	.	.	.	.	.	.	.	.	.	G	14.69	2.609924	0.46527	.	.	ENSG00000137267	ENST00000333628;ENST00000392362	D	0.83163	-1.69	4.97	4.97	0.65823	Tubulin/FtsZ, 2-layer sandwich domain (1);Tubulin/FtsZ, GTPase domain (1);Tubulin/FtsZ, C-terminal (1);	0.000000	0.53938	U	0.000054	T	0.69033	0.3066	L	0.32530	0.975	0.80722	D	1	B;B;B	0.30236	0.068;0.008;0.274	B;B;B	0.24701	0.022;0.006;0.055	T	0.73550	-0.3947	10	0.87932	D	0	.	18.6621	0.91474	0.0:0.0:1.0:0.0	.	248;248;248	B2R6L0;Q13885;Q8N6N5	.;TBB2A_HUMAN;.	V	248;158	ENSP00000369703:A248V	ENSP00000369703:A248V	A	-	2	0	TUBB2A	3099691	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	9.591000	0.98241	2.487000	0.83934	0.644000	0.83932	GCA	TUBB2A	-	superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Gamma_tubulin	ENSG00000137267		0.677	TUBB2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB2A	HGNC	protein_coding	OTTHUMT00000039662.1	-	0.00	16	0	G	NM_001069		3154692	-1	tier1	-	no_errors	ENST00000333628	ensembl	human	known	74_37	missense	22.22	21	6	SNP	1.000	A
TUBGCP5	114791	genome.wustl.edu	37	15	22846926	22846926	+	Missense_Mutation	SNP	G	G	C	rs549962518		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr15:22846926G>C	ENST00000283645.4	+	8	931	c.801G>C	c.(799-801)gaG>gaC	p.E267D	TUBGCP5_ENST00000453949.2_Missense_Mutation_p.E267D	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	267					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		TGGTTACTGAGACTCAGGTTA	0.353																																																	0													137.0	118.0	124.0					15																	22846926		2203	4300	6503	SO:0001583	missense	0			AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.801G>C	15.37:g.22846926G>C	ENSP00000283645:p.Glu267Asp		E9PB12|Q6IQ52|Q96PY8	Missense_Mutation	SNP	pfam_TUBGCP	p.E267D	ENST00000283645.4	37	c.801	CCDS10008.1	15	.	.	.	.	.	.	.	.	.	.	.	18.96	3.734379	0.69189	.	.	ENSG00000153575	ENST00000283645;ENST00000453949	T;T	0.67865	-0.29;-0.27	4.79	1.57	0.23409	.	0.058995	0.64402	D	0.000003	T	0.52917	0.1764	L	0.34521	1.04	0.50632	D	0.999889	P;P	0.50819	0.939;0.939	P;P	0.45167	0.472;0.472	T	0.51996	-0.8634	10	0.72032	D	0.01	-25.2648	5.5673	0.17177	0.6162:0.0:0.3838:0.0	.	267;267	Q96RT8;E9PB12	GCP5_HUMAN;.	D	267	ENSP00000283645:E267D;ENSP00000409217:E267D	ENSP00000283645:E267D	E	+	3	2	TUBGCP5	20398367	1.000000	0.71417	0.973000	0.42090	0.989000	0.77384	2.374000	0.44274	0.585000	0.29608	0.655000	0.94253	GAG	TUBGCP5	-	NULL	ENSG00000153575		0.353	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP5	HGNC	protein_coding	OTTHUMT00000250998.2	-	0.00	86	0	G	NM_052903		22846926	+1	tier1	-	no_errors	ENST00000283645	ensembl	human	known	74_37	missense	34.29	69	36	SNP	1.000	C
SH2B1	25970	genome.wustl.edu	37	16	28855330	28855330	+	5'Flank	DEL	G	G	-			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr16:28855330delG	ENST00000322610.8	+	0	0				TUFM_ENST00000313511.3_Frame_Shift_Del_p.R339fs|MIR4721_ENST00000577590.1_RNA			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1						blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						ACCAGGCCCCGCCGCAAGTCC	0.647																																																	0													28.0	33.0	31.0					16																	28855330		2197	4300	6497	SO:0001631	upstream_gene_variant	0			AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2			16.37:g.28855330delG	Exception_encountered		A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Frame_Shift_Del	DEL	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_B-barrel,prints_EF_GTP-bd_dom,tigrfam_Transl_elong_EFTu/EF1A_bac/org	p.R339fs	ENST00000322610.8	37	c.1015	CCDS53996.1	16																																																																																			TUFM	-	pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_B-barrel,tigrfam_Transl_elong_EFTu/EF1A_bac/org	ENSG00000178952		0.647	SH2B1-001	KNOWN	basic|CCDS	protein_coding	TUFM	HGNC	protein_coding	OTTHUMT00000432666.1		0.00	119	0	G	NM_015503		28855330	-1	tier1		no_errors	ENST00000313511	ensembl	human	known	74_37	frame_shift_del	28.87	138	56	DEL	1.000	-
TULP4	56995	genome.wustl.edu	37	6	158735106	158735106	+	Silent	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr6:158735106C>T	ENST00000367097.3	+	1	1415	c.58C>T	c.(58-60)Ctg>Ttg	p.L20L	TULP4_ENST00000367094.2_Silent_p.L20L|RP11-732M18.3_ENST00000432358.1_lincRNA	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	20					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		CATCCTGTGCCTGTCCTGGAA	0.517																																																	0													91.0	83.0	86.0					6																	158735106		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.58C>T	6.37:g.158735106C>T			Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Silent	SNP	pfam_Tubby_C,pfam_SOCS_C,pfam_WD40_repeat,superfamily_Tubby_C-like,superfamily_WD40_repeat_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_WD40_repeat,smart_SOCS_C,pfscan_SOCS_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L20	ENST00000367097.3	37	c.58	CCDS34561.1	6																																																																																			TULP4	-	superfamily_WD40_repeat_dom	ENSG00000130338		0.517	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP4	HGNC	protein_coding	OTTHUMT00000042869.1	-	0.00	38	0	C	NM_020245		158735106	+1	tier1	-	no_errors	ENST00000367097	ensembl	human	known	74_37	silent	37.84	23	14	SNP	1.000	T
UBBP4	23666	genome.wustl.edu	37	17	21731158	21731158	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:21731158C>A	ENST00000578713.1	+	1	464	c.460C>A	c.(460-462)Cag>Aag	p.Q154K	UBBP4_ENST00000583708.1_3'UTR|UBBP4_ENST00000584755.1_Missense_Mutation_p.Q154K|UBBP4_ENST00000584398.1_3'UTR					ubiquitin B pseudogene 4											endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						AGGTGGTATGCAGATCTTCGT	0.527																																																	0																																										SO:0001583	missense	0			X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000578713.1:c.460C>A	17.37:g.21731158C>A	ENSP00000464265:p.Gln154Lys			Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	p.Q154K	ENST00000578713.1	37	c.460		17																																																																																			UBBP4	-	pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	ENSG00000263563		0.527	UBBP4-004	PUTATIVE	basic|appris_principal	protein_coding	UBBP4	HGNC	protein_coding	OTTHUMT00000444589.2	-	0.00	115	0	C			21731158	+1	tier1	-	no_errors	ENST00000578713	ensembl	human	putative	74_37	missense	12.69	117	17	SNP	1.000	A
UBBP4	23666	genome.wustl.edu	37	17	21731342	21731342	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:21731342G>A	ENST00000584755.1	+	2	1041	c.644G>A	c.(643-645)aGg>aAg	p.R215K	UBBP4_ENST00000583708.1_3'UTR|UBBP4_ENST00000578713.1_Intron					ubiquitin B pseudogene 4											endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						ACATCCAGAAGGAGTCGACCC	0.542																																																	0																																										SO:0001583	missense	0			X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000584755.1:c.644G>A	17.37:g.21731342G>A	ENSP00000463647:p.Arg215Lys			Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	p.R215K	ENST00000584755.1	37	c.644		17																																																																																			UBBP4	-	NULL	ENSG00000263563		0.542	UBBP4-001	NOVEL	basic	protein_coding	UBBP4	HGNC	protein_coding	OTTHUMT00000444585.1	-	0.00	125	0	G			21731342	+1	tier1	-	no_errors	ENST00000584755	ensembl	human	novel	74_37	missense	19.05	85	20	SNP	1.000	A
UBBP4	23666	genome.wustl.edu	37	17	21731357	21731357	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:21731357C>T	ENST00000584755.1	+	2	1056	c.659C>T	c.(658-660)aCc>aTc	p.T220I	UBBP4_ENST00000583708.1_3'UTR|UBBP4_ENST00000578713.1_Intron					ubiquitin B pseudogene 4											endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						CGACCCTGCACCTGGTCCTGC	0.552																																																	0																																										SO:0001583	missense	0			X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000584755.1:c.659C>T	17.37:g.21731357C>T	ENSP00000463647:p.Thr220Ile			Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	p.T220I	ENST00000584755.1	37	c.659		17																																																																																			UBBP4	-	NULL	ENSG00000263563		0.552	UBBP4-001	NOVEL	basic	protein_coding	UBBP4	HGNC	protein_coding	OTTHUMT00000444585.1	-	0.00	105	0	C			21731357	+1	tier1	-	no_errors	ENST00000584755	ensembl	human	novel	74_37	missense	25.22	86	29	SNP	1.000	T
UBR1	197131	genome.wustl.edu	37	15	43351345	43351345	+	Frame_Shift_Del	DEL	G	G	-			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr15:43351345delG	ENST00000290650.4	-	9	1109	c.1031delC	c.(1030-1032)cctfs	p.P344fs	UBR1_ENST00000382177.2_Frame_Shift_Del_p.P344fs	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	344					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		CTCCGAGTCAGGTTCTTCTCT	0.388																																																	0													78.0	77.0	77.0					15																	43351345		2203	4299	6502	SO:0001589	frameshift_variant	0				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.1031delC	15.37:g.43351345delG	ENSP00000290650:p.Pro344fs		O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Frame_Shift_Del	DEL	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.P344fs	ENST00000290650.4	37	c.1031	CCDS10091.1	15																																																																																			UBR1	-	NULL	ENSG00000159459		0.388	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR1	HGNC	protein_coding	OTTHUMT00000253202.1		0.00	28	0	G	NM_174916		43351345	-1	tier1		no_errors	ENST00000290650	ensembl	human	known	74_37	frame_shift_del	5.00	38	2	DEL	0.996	-
UCHL3	7347	genome.wustl.edu	37	13	76179918	76179918	+	Silent	SNP	A	A	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr13:76179918A>G	ENST00000377595.3	+	9	693	c.663A>G	c.(661-663)agA>agG	p.R221R	RP11-173B14.5_ENST00000568302.1_RNA|RP11-29G8.3_ENST00000563635.1_RNA|RP11-173B14.5_ENST00000568735.1_RNA|UCHL3_ENST00000606347.1_3'UTR	NM_001270952.1|NM_006002.4	NP_001257881.1|NP_005993.1	P15374	UCHL3_HUMAN	ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)	221	Interaction with ubiquitin.				protein catabolic process (GO:0030163)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(2)|lung(3)|skin(1)	7				GBM - Glioblastoma multiforme(99;0.0125)		ATGAACTAAGATTTAATGCGA	0.348																																																	0													147.0	145.0	146.0					13																	76179918		2203	4300	6503	SO:0001819	synonymous_variant	0			M30496	CCDS9453.1, CCDS73586.1	13q21.33	2008-02-05			ENSG00000118939	ENSG00000118939	3.2.1.15		12515	protein-coding gene	gene with protein product		603090				2530630	Standard	NM_001270952		Approved		uc001vjq.4	P15374	OTTHUMG00000017090	ENST00000377595.3:c.663A>G	13.37:g.76179918A>G			B2R970|Q5TBK8|Q6IBE9	Silent	SNP	pfam_Peptidase_C12,prints_Peptidase_C12	p.R221	ENST00000377595.3	37	c.663	CCDS9453.1	13																																																																																			UCHL3	-	NULL	ENSG00000118939		0.348	UCHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCHL3	HGNC	protein_coding	OTTHUMT00000045292.2	-	0.00	31	0	A	NM_006002		76179918	+1	tier1	-	no_errors	ENST00000377595	ensembl	human	known	74_37	silent	65.79	13	25	SNP	1.000	G
UNC5D	137970	genome.wustl.edu	37	8	35631843	35631843	+	Missense_Mutation	SNP	C	C	A	rs545516301		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr8:35631843C>A	ENST00000404895.2	+	16	2833	c.2505C>A	c.(2503-2505)ttC>ttA	p.F835L	UNC5D_ENST00000420357.1_Missense_Mutation_p.F768L|UNC5D_ENST00000287272.2_Missense_Mutation_p.F766L|UNC5D_ENST00000453357.2_Missense_Mutation_p.F830L|UNC5D_ENST00000449677.1_Missense_Mutation_p.F411L|UNC5D_ENST00000416672.1_Missense_Mutation_p.F840L	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	835					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TCACTTTCTTCGCACAAGAGG	0.433																																																	0													137.0	132.0	134.0					8																	35631843		2203	4300	6503	SO:0001583	missense	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2505C>A	8.37:g.35631843C>A	ENSP00000385143:p.Phe835Leu		Q8WYP7	Missense_Mutation	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death_domain,pfam_Immunoglobulin,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.F835L	ENST00000404895.2	37	c.2505	CCDS6093.2	8	.	.	.	.	.	.	.	.	.	.	c	3.186	-0.166861	0.06461	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.49720	0.8;1.25;1.25;0.8;0.77;2.72	5.95	0.84	0.18912	.	0.094996	0.85682	D	0.000000	T	0.27765	0.0683	N	0.20986	0.625	0.46203	D	0.998924	B;B;B	0.21905	0.053;0.062;0.037	B;B;B	0.24155	0.019;0.051;0.023	T	0.14476	-1.0471	10	0.06625	T	0.88	-10.3903	11.3329	0.49487	0.0:0.1908:0.0:0.8092	.	411;830;835	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	L	835;768;766;840;830;411	ENSP00000385143:F835L;ENSP00000392739:F768L;ENSP00000287272:F766L;ENSP00000412652:F840L;ENSP00000394303:F830L;ENSP00000397211:F411L	ENSP00000287272:F766L	F	+	3	2	UNC5D	35751385	1.000000	0.71417	0.998000	0.56505	0.459000	0.32528	0.865000	0.27940	-0.056000	0.13221	-2.187000	0.00313	TTC	UNC5D	-	NULL	ENSG00000156687		0.433	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2		0.00	58	0	C			35631843	+1			no_errors	ENST00000404895	ensembl	human	known	74_37	missense	9.09	30	3	SNP	1.000	A
USH2A	7399	genome.wustl.edu	37	1	216073502	216073502	+	Silent	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr1:216073502G>A	ENST00000307340.3	-	40	7895	c.7509C>T	c.(7507-7509)taC>taT	p.Y2503Y	RP5-1111A8.3_ENST00000414995.1_RNA|USH2A_ENST00000366943.2_Silent_p.Y2503Y	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2503	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TATACTCTGTGTACGGTTGGA	0.418										HNSCC(13;0.011)																																							0													136.0	113.0	121.0					1																	216073502		2203	4300	6503	SO:0001819	synonymous_variant	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7509C>T	1.37:g.216073502G>A			Q5VVM9|Q6S362|Q9NS27	Silent	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.Y2503	ENST00000307340.3	37	c.7509	CCDS31025.1	1																																																																																			USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.418	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	-	0.00	58	0	G	NM_007123		216073502	-1	tier1	-	no_errors	ENST00000366943	ensembl	human	known	74_37	silent	42.55	27	20	SNP	0.990	A
WDFY3	23001	genome.wustl.edu	37	4	85731437	85731437	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr4:85731437C>T	ENST00000295888.4	-	14	2355	c.1948G>A	c.(1948-1950)Gga>Aga	p.G650R	WDFY3_ENST00000322366.6_Missense_Mutation_p.G650R|WDFY3-AS1_ENST00000510449.1_RNA	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	650					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TACACAAATCCTCCAACTTTC	0.418																																																	0													59.0	53.0	55.0					4																	85731437		2203	4300	6503	SO:0001583	missense	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.1948G>A	4.37:g.85731437C>T	ENSP00000295888:p.Gly650Arg		Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl_sf,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G650R	ENST00000295888.4	37	c.1948	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	C	34	5.348970	0.95807	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.52983	0.64;0.64	5.73	5.73	0.89815	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.71213	0.3313	M	0.74467	2.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.73219	-0.4052	10	0.87932	D	0	.	19.8807	0.96899	0.0:1.0:0.0:0.0	.	650;650	E2QRK8;Q8IZQ1	.;WDFY3_HUMAN	R	650	ENSP00000318466:G650R;ENSP00000295888:G650R	ENSP00000295888:G650R	G	-	1	0	WDFY3	85950461	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.380000	0.79704	2.692000	0.91855	0.591000	0.81541	GGA	WDFY3	-	superfamily_ARM-type_fold	ENSG00000163625		0.418	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	-	0.00	24	0	C	NM_014991		85731437	-1	tier1	-	no_errors	ENST00000295888	ensembl	human	known	74_37	missense	36.36	21	12	SNP	1.000	T
WNK4	65266	genome.wustl.edu	37	17	40940199	40940199	+	Frame_Shift_Del	DEL	G	G	-	rs61755602		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr17:40940199delG	ENST00000246914.5	+	9	1936	c.1915delG	c.(1915-1917)gggfs	p.G639fs	WNK4_ENST00000587705.1_3'UTR	NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	639					chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)	p.G639W(1)|p.G627W(1)		NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		CTTTTCCCCCGGGGACAGGTA	0.537																																					Esophageal Squamous(6;201 374 4964 23855 42828)												2	Substitution - Missense(2)	lung(2)											177.0	181.0	179.0					17																	40940199		2203	4300	6503	SO:0001589	frameshift_variant	0			AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.1915delG	17.37:g.40940199delG	ENSP00000246914:p.Gly639fs		B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Frame_Shift_Del	DEL	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D640fs	ENST00000246914.5	37	c.1915	CCDS11439.1	17																																																																																			WNK4	-	NULL	ENSG00000126562		0.537	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK4	HGNC	protein_coding	OTTHUMT00000452389.1		0.00	41	0	G			40940199	+1	tier1		no_errors	ENST00000246914	ensembl	human	known	74_37	frame_shift_del	6.45	29	2	DEL	0.994	-
WT1	7490	genome.wustl.edu	37	11	32439125	32439125	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:32439125C>A	ENST00000379079.2	-	4	585	c.312G>T	c.(310-312)aaG>aaT	p.K104N	WT1_ENST00000448076.3_Missense_Mutation_p.K316N|WT1_ENST00000332351.3_Missense_Mutation_p.K316N|WT1_ENST00000530998.1_Missense_Mutation_p.K104N	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	248					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.G249fs*11(1)	EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			AACCTTACCCCTTTAAGGTGG	0.373			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																														yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	1	Insertion - Frameshift(1)	kidney(1)											119.0	107.0	111.0					11																	32439125		2202	4299	6501	SO:0001583	missense	0	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.312G>T	11.37:g.32439125C>A	ENSP00000368370:p.Lys104Asn		A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	pfam_Wilms_tumour_N,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2,prints_Wilms_tumour	p.K316N	ENST00000379079.2	37	c.948	CCDS55751.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.16|19.16	3.774469|3.774469	0.70107|0.70107	.|.	.|.	ENSG00000184937|ENSG00000184937	ENST00000527882|ENST00000379079;ENST00000332351;ENST00000530998;ENST00000452863;ENST00000448076;ENST00000527775	.|D;D;D;D;D;D	.|0.89050	.|-2.46;-2.46;-2.46;-2.46;-2.46;-2.46	6.17|6.17	0.079|0.079	0.14414|0.14414	.|Wilm&apos (1);s tumour protein, N-terminal (1);	.|0.000000	.|0.64402	.|U	.|0.000001	D|D	0.90642|0.90642	0.7065|0.7065	L|L	0.49778|0.49778	1.585|1.585	0.44862|0.44862	D|D	0.997874|0.997874	.|D;D;D;D;D	.|0.76494	.|0.999;0.998;0.999;0.969;0.999	.|D;D;D;P;D	.|0.69307	.|0.963;0.946;0.963;0.835;0.933	D|D	0.88602|0.88602	0.3150|0.3150	5|10	.|0.62326	.|D	.|0.03	.|.	11.2794|11.2794	0.49186|0.49186	0.0:0.4339:0.0:0.5661|0.0:0.4339:0.0:0.5661	.|.	.|321;248;321;104;104	.|P19544-8;P19544;P19544-7;B3KSA5;P19544-6	.|.;WT1_HUMAN;.;.;.	W|N	7|104;316;104;316;316;67	.|ENSP00000368370:K104N;ENSP00000331327:K316N;ENSP00000435307:K104N;ENSP00000415516:K316N;ENSP00000413452:K316N;ENSP00000435351:K67N	.|ENSP00000331327:K316N	G|K	-|-	1|3	0|2	WT1|WT1	32395701|32395701	0.996000|0.996000	0.38824|0.38824	0.989000|0.989000	0.46669|0.46669	0.993000|0.993000	0.82548|0.82548	0.359000|0.359000	0.20233|0.20233	-0.017000|-0.017000	0.14103|0.14103	0.655000|0.655000	0.94253|0.94253	GGG|AAG	WT1	-	pfam_Wilms_tumour_N	ENSG00000184937		0.373	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WT1	HGNC	protein_coding	OTTHUMT00000095434.1	-	0.00	67	0	C	NM_000378		32439125	-1	tier1	-	no_errors	ENST00000332351	ensembl	human	known	74_37	missense	39.25	65	42	SNP	0.992	A
YEATS2	55689	genome.wustl.edu	37	3	183472028	183472029	+	Frame_Shift_Ins	INS	-	-	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr3:183472028_183472029insT	ENST00000305135.5	+	11	1460_1461	c.1265_1266insT	c.(1264-1269)catggcfs	p.G423fs		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	423					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TTTTGTTCCCATGGCAATTCAG	0.441																																																	0																																										SO:0001589	frameshift_variant	0			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.1266dupT	3.37:g.183472029_183472029dupT	ENSP00000306983:p.Gly423fs		A7E2B9|D3DNS9|Q641P6|Q9NW96	Frame_Shift_Ins	INS	pfam_YEATS,pfscan_YEATS	p.G423fs	ENST00000305135.5	37	c.1265_1266	CCDS43175.1	3																																																																																			YEATS2	-	NULL	ENSG00000163872		0.441	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2	HGNC	protein_coding	OTTHUMT00000346507.2		0.00	58	0	-	NM_018023		183472029	+1	tier1		no_errors	ENST00000305135	ensembl	human	known	74_37	frame_shift_ins	14.49	118	20	INS	1.000:1.000	T
ZAR1L	646799	genome.wustl.edu	37	13	32885527	32885527	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr13:32885527T>C	ENST00000533490.2	-	3	954	c.536A>G	c.(535-537)gAg>gGg	p.E179G	ZAR1L_ENST00000345108.6_Missense_Mutation_p.E179G			A6NP61	ZAR1L_HUMAN	zygote arrest 1-like	179						cytoplasm (GO:0005737)				NS(1)|kidney(1)	2						CCCGGGCTCCTCCTGCCTGTC	0.701																																																	0													11.0	14.0	13.0					13																	32885527		692	1591	2283	SO:0001583	missense	0				CCDS45023.1	13q13.1	2014-02-20			ENSG00000189167	ENSG00000189167			37116	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 7"""					18442940	Standard	NM_001136571		Approved	Z3CXXC7	uc010abc.1	A6NP61	OTTHUMG00000016694	ENST00000533490.2:c.536A>G	13.37:g.32885527T>C	ENSP00000437289:p.Glu179Gly		B2RV03|B7ZBU2	Missense_Mutation	SNP	NULL	p.E179G	ENST00000533490.2	37	c.536	CCDS45023.1	13	.	.	.	.	.	.	.	.	.	.	t	10.55	1.381478	0.24944	.	.	ENSG00000189167	ENST00000345108	.	.	.	4.82	2.27	0.28462	.	1.384170	0.04699	N	0.415511	T	0.43787	0.1263	L	0.53249	1.67	0.09310	N	1	B	0.15473	0.013	B	0.12156	0.007	T	0.23976	-1.0173	9	0.29301	T	0.29	-7.7398	6.8409	0.23963	0.0:0.0771:0.2893:0.6336	.	179	A6NP61	ZAR1L_HUMAN	G	179	.	ENSP00000344616:E179G	E	-	2	0	ZAR1L	31783527	0.000000	0.05858	0.006000	0.13384	0.022000	0.10575	0.433000	0.21477	0.313000	0.23062	0.524000	0.50904	GAG	ZAR1L	-	NULL	ENSG00000189167		0.701	ZAR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAR1L	HGNC	protein_coding	OTTHUMT00000044403.5	-	0.00	42	0	T			32885527	-1	tier1	-	no_errors	ENST00000345108	ensembl	human	known	74_37	missense	47.73	23	21	SNP	0.006	C
ZBED5	58486	genome.wustl.edu	37	11	10874919	10874919	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr11:10874919T>A	ENST00000432999.2	-	3	2072	c.1574A>T	c.(1573-1575)gAt>gTt	p.D525V	ZBED5_ENST00000525350.1_Intron|ZBED5_ENST00000413761.2_Missense_Mutation_p.D525V	NM_001143667.1|NM_021211.3	NP_001137139.1|NP_067034.2	Q49AG3	ZBED5_HUMAN	zinc finger, BED-type containing 5	525							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)	4						aggaaaacaatcaaagttttc	0.353																																																	0													19.0	19.0	19.0					11																	10874919		692	1591	2283	SO:0001583	missense	0			AF205601		11p15.3	2013-05-03			ENSG00000236287	ENSG00000236287		"""Zinc fingers, BED-type"""	30803	protein-coding gene	gene with protein product		615251				10607616, 23533661	Standard	NM_021211		Approved	Buster1	uc009ygh.3	Q49AG3	OTTHUMG00000150341	ENST00000432999.2:c.1574A>T	11.37:g.10874919T>A	ENSP00000398106:p.Asp525Val		B2RCC1|Q05D82|Q86WW3|Q9NT24|Q9UBJ4	Missense_Mutation	SNP	superfamily_RNaseH-like_dom,pfscan_Znf_BED_prd	p.D525V	ENST00000432999.2	37	c.1574		11	.	.	.	.	.	.	.	.	.	.	T	9.273	1.046292	0.19748	.	.	ENSG00000236287	ENST00000432999;ENST00000413761	T;T	0.42900	0.96;0.96	3.64	3.64	0.41730	Ribonuclease H-like (1);	.	.	.	.	T	0.38054	0.1026	L	0.57536	1.79	0.49051	D	0.999747	P	0.45672	0.864	B	0.43867	0.434	T	0.11227	-1.0596	9	0.18710	T	0.47	.	8.9349	0.35693	0.0:0.0:0.0:1.0	.	525	Q49AG3	ZBED5_HUMAN	V	525	ENSP00000398106:D525V;ENSP00000415939:D525V	ENSP00000415939:D525V	D	-	2	0	ZBED5	10831495	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.671000	0.46842	1.882000	0.54519	0.477000	0.44152	GAT	ZBED5	-	superfamily_RNaseH-like_dom	ENSG00000236287		0.353	ZBED5-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	ZBED5	HGNC	protein_coding	OTTHUMT00000317691.1	-	0.00	33	0	T	NM_021211		10874919	-1	tier1	-	no_errors	ENST00000413761	ensembl	human	putative	74_37	missense	39.47	23	15	SNP	1.000	A
ZBP1	81030	genome.wustl.edu	37	20	56179817	56179817	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr20:56179817G>A	ENST00000371173.3	-	8	1279	c.1102C>T	c.(1102-1104)Ccc>Tcc	p.P368S	ZBP1_ENST00000340462.4_Missense_Mutation_p.P345S|ZBP1_ENST00000395822.3_Missense_Mutation_p.P293S	NM_001160417.1|NM_030776.2	NP_001153889.1|NP_110403.2	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1	368					innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|left-handed Z-DNA binding (GO:0003692)|RNA binding (GO:0003723)			large_intestine(11)|lung(8)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	27	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			GTGTCTGCGGGACGACGACCT	0.562																																																	0													148.0	115.0	126.0					20																	56179817		2203	4300	6503	SO:0001583	missense	0			AJ300575	CCDS13461.1, CCDS54477.1, CCDS54478.1	20q13.31	2009-08-21	2002-07-25	2002-07-26	ENSG00000124256	ENSG00000124256			16176	protein-coding gene	gene with protein product	"""DNA-dependent activator of IRFs"""	606750	"""chromosome 20 open reading frame 183"""	C20orf183		11842111	Standard	NM_030776		Approved	dJ718J7.3, DLM1, DLM-1, DAI	uc002xyo.3	Q9H171	OTTHUMG00000032824	ENST00000371173.3:c.1102C>T	20.37:g.56179817G>A	ENSP00000360215:p.Pro368Ser		A2A2F7|B3KVA1|F5GYT1|Q5JY39|Q9BYW4	Missense_Mutation	SNP	pfam_dsRNA_A_deaminase,smart_dsRNA_A_deaminase	p.P368S	ENST00000371173.3	37	c.1102	CCDS13461.1	20	.	.	.	.	.	.	.	.	.	.	G	0.020	-1.445177	0.01089	.	.	ENSG00000124256	ENST00000371173;ENST00000395822;ENST00000340462;ENST00000357677	T;T;T	0.10192	3.27;2.9;3.27	2.5	-2.06	0.07298	.	.	.	.	.	T	0.03739	0.0106	N	0.04508	-0.205	0.09310	N	1	B;B;B	0.17465	0.011;0.022;0.022	B;B;B	0.11329	0.003;0.006;0.006	T	0.47032	-0.9148	9	0.10902	T	0.67	.	6.5282	0.22312	0.4499:0.0:0.5501:0.0	.	368;293;368	A2RRL9;A2A2F7;Q9H171	.;.;ZBP1_HUMAN	S	368;293;345;368	ENSP00000360215:P368S;ENSP00000379167:P293S;ENSP00000344954:P345S	ENSP00000344954:P345S	P	-	1	0	ZBP1	55613223	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.277000	0.02812	-0.479000	0.06813	0.514000	0.50259	CCC	ZBP1	-	NULL	ENSG00000124256		0.562	ZBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZBP1	HGNC	protein_coding	OTTHUMT00000079849.1	-	0.00	56	0	G	NM_030776		56179817	-1	tier1	-	no_errors	ENST00000371173	ensembl	human	known	74_37	missense	49.59	62	61	SNP	0.000	A
ZBTB5	9925	genome.wustl.edu	37	9	37440551	37440551	+	Silent	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr9:37440551G>T	ENST00000307750.4	-	2	2186	c.1998C>A	c.(1996-1998)cgC>cgA	p.R666R		NM_014872.2	NP_055687.1	O15062	ZBTB5_HUMAN	zinc finger and BTB domain containing 5	666					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8				GBM - Glioblastoma multiforme(29;0.00733)|Lung(182;0.226)		TGCTCTGCCAGCGCAGGCAGG	0.498																																																	0													78.0	74.0	75.0					9																	37440551		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002352	CCDS6610.1	9p13.1	2013-01-09			ENSG00000168795	ENSG00000168795		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23836	protein-coding gene	gene with protein product						9205841	Standard	NM_014872		Approved	KIAA0354	uc003zzx.3	O15062	OTTHUMG00000019918	ENST00000307750.4:c.1998C>A	9.37:g.37440551G>T				Silent	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R666	ENST00000307750.4	37	c.1998	CCDS6610.1	9																																																																																			ZBTB5	-	pfscan_Znf_C2H2	ENSG00000168795		0.498	ZBTB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB5	HGNC	protein_coding	OTTHUMT00000052462.1	-	0.00	59	0	G	NM_014872		37440551	-1	tier1	-	no_errors	ENST00000307750	ensembl	human	known	74_37	silent	5.71	66	4	SNP	1.000	T
ZFHX4	79776	genome.wustl.edu	37	8	77618141	77618141	+	Silent	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr8:77618141C>T	ENST00000521891.2	+	2	2266	c.1818C>T	c.(1816-1818)gaC>gaT	p.D606D	ZFHX4_ENST00000050961.6_Silent_p.D606D|ZFHX4_ENST00000455469.2_Silent_p.D606D|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000518282.1_Silent_p.D606D	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	606					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.D606E(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CTGGAGGAGACGGCTCACCGG	0.567										HNSCC(33;0.089)																																							1	Substitution - Missense(1)	breast(1)											71.0	78.0	76.0					8																	77618141		2098	4204	6302	SO:0001819	synonymous_variant	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1818C>T	8.37:g.77618141C>T			G3V138|Q18PS0|Q6ZN20	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.D606	ENST00000521891.2	37	c.1818	CCDS47878.2	8																																																																																			ZFHX4	-	NULL	ENSG00000091656		0.567	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2		0.00	35	0	C	NM_024721		77618141	+1			no_errors	ENST00000521891	ensembl	human	known	74_37	silent	5.26	54	3	SNP	0.013	T
ZNF416	55659	genome.wustl.edu	37	19	58084334	58084334	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:58084334A>G	ENST00000196489.3	-	4	1160	c.938T>C	c.(937-939)cTc>cCc	p.L313P		NM_017879.1	NP_060349.1	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	313					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|large_intestine(5)|lung(12)|prostate(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		ATGTTTAATGAGGGTGGCTCT	0.443																																																	0													87.0	86.0	86.0					19																	58084334		2203	4300	6503	SO:0001583	missense	0			BC000130	CCDS12954.1	19q13.4	2013-01-08				ENSG00000083817		"""Zinc fingers, C2H2-type"", ""-"""	20645	protein-coding gene	gene with protein product							Standard	NM_017879		Approved	FLJ20557	uc002qpf.3	Q9BWM5		ENST00000196489.3:c.938T>C	19.37:g.58084334A>G	ENSP00000196489:p.Leu313Pro		Q9NWW8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L313P	ENST00000196489.3	37	c.938	CCDS12954.1	19	.	.	.	.	.	.	.	.	.	.	A	24.8	4.565873	0.86439	.	.	ENSG00000083817	ENST00000196489	T	0.53857	0.6	3.74	3.74	0.42951	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.78201	0.4246	H	0.94658	3.565	0.35935	D	0.832792	D	0.89917	1.0	D	0.91635	0.999	D	0.86923	0.2068	9	0.87932	D	0	.	11.8584	0.52451	1.0:0.0:0.0:0.0	.	313	Q9BWM5	ZN416_HUMAN	P	313	ENSP00000196489:L313P	ENSP00000196489:L313P	L	-	2	0	ZNF416	62776146	0.507000	0.26146	0.006000	0.13384	0.952000	0.60782	5.012000	0.64017	1.701000	0.51217	0.482000	0.46254	CTC	ZNF416	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000083817		0.443	ZNF416-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF416	HGNC	protein_coding	OTTHUMT00000466787.1		0.00	71	0	A	NM_017879		58084334	-1			no_errors	ENST00000196489	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.105	G
ZNF516	9658	genome.wustl.edu	37	18	74154846	74154846	+	Silent	SNP	C	C	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr18:74154846C>T	ENST00000443185.2	-	3	482	c.165G>A	c.(163-165)aaG>aaA	p.K55K	ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	55					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		CGCCCGTGTGCTTGCGCATGT	0.632																																																	0													45.0	53.0	50.0					18																	74154846		2190	4297	6487	SO:0001819	synonymous_variant	0			D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.165G>A	18.37:g.74154846C>T				Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K55	ENST00000443185.2	37	c.165		18																																																																																			ZNF516	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000101493		0.632	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	ZNF516	HGNC	protein_coding		-	0.00	33	0	C	NM_014643		74154846	-1	tier1	-	no_errors	ENST00000443185	ensembl	human	known	74_37	silent	22.58	24	7	SNP	1.000	T
ZNF766	90321	genome.wustl.edu	37	19	52794070	52794070	+	Silent	SNP	C	C	A			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:52794070C>A	ENST00000439461.1	+	4	1069	c.1026C>A	c.(1024-1026)ctC>ctA	p.L342L	ZNF766_ENST00000593612.1_Silent_p.L357L|CTD-2525I3.5_ENST00000594865.1_RNA|ZNF766_ENST00000359102.4_Silent_p.L357L|ZNF766_ENST00000599581.1_3'UTR	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766	342					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		ATTCAAGCCTCACCACCCATC	0.393																																																	0													32.0	34.0	34.0					19																	52794070		2131	4274	6405	SO:0001819	synonymous_variant	0			AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.1026C>A	19.37:g.52794070C>A			B2RNE0|Q7Z326	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L357	ENST00000439461.1	37	c.1071	CCDS46163.1	19																																																																																			ZNF766	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196214		0.393	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF766	HGNC	protein_coding	OTTHUMT00000462764.1	-	0.00	49	0	C	NM_001010851		52794070	+1	tier1	-	no_errors	ENST00000359102	ensembl	human	known	74_37	silent	7.94	58	5	SNP	0.000	A
ZNF528	84436	genome.wustl.edu	37	19	52919235	52919235	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:52919235G>T	ENST00000360465.3	+	7	1556	c.1130G>T	c.(1129-1131)gGa>gTa	p.G377V	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	377					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		ATTCACACTGGAAGGAAACCT	0.418																																																	0													85.0	83.0	83.0					19																	52919235		2203	4300	6503	SO:0001583	missense	0			AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.1130G>T	19.37:g.52919235G>T	ENSP00000353652:p.Gly377Val		B3KPN4|Q86T88|Q96JK0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G377V	ENST00000360465.3	37	c.1130	CCDS33091.1	19	.	.	.	.	.	.	.	.	.	.	G	14.88	2.668381	0.47677	.	.	ENSG00000167555	ENST00000360465	T	0.23552	1.9	2.08	0.987	0.19790	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.48840	0.1522	M	0.85710	2.77	0.47276	D	0.999377	D	0.89917	1.0	D	0.81914	0.995	T	0.46816	-0.9164	9	0.87932	D	0	.	7.5351	0.27706	0.146:0.0:0.854:0.0	.	377	Q3MIS6	ZN528_HUMAN	V	377	ENSP00000353652:G377V	ENSP00000353652:G377V	G	+	2	0	ZNF528	57611047	1.000000	0.71417	0.007000	0.13788	0.018000	0.09664	5.672000	0.68102	0.193000	0.20303	0.655000	0.94253	GGA	ZNF528	-	pfscan_Znf_C2H2	ENSG00000167555		0.418	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF528	HGNC	protein_coding	OTTHUMT00000344336.1		0.00	41	0	G	NM_032423		52919235	+1			no_errors	ENST00000360465	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
ZNF804A	91752	genome.wustl.edu	37	2	185803054	185803054	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr2:185803054G>C	ENST00000302277.6	+	4	3525	c.2931G>C	c.(2929-2931)gaG>gaC	p.E977D		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	977							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AACTGGCTGAGGCCCTTCCAC	0.403																																																	0													102.0	97.0	98.0					2																	185803054		2203	4300	6503	SO:0001583	missense	0			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2931G>C	2.37:g.185803054G>C	ENSP00000303252:p.Glu977Asp		A7E253|Q6ZN26	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.E977D	ENST00000302277.6	37	c.2931	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	G	11.59	1.685245	0.29872	.	.	ENSG00000170396	ENST00000302277	T	0.07688	3.17	5.14	1.36	0.22044	.	0.118731	0.37348	N	0.002130	T	0.16854	0.0405	L	0.57536	1.79	0.27750	N	0.944189	D	0.61080	0.989	P	0.59221	0.854	T	0.03221	-1.1059	10	0.48119	T	0.1	-10.1567	8.946	0.35758	0.1797:0.0:0.8203:0.0	.	977	Q7Z570	Z804A_HUMAN	D	977	ENSP00000303252:E977D	ENSP00000303252:E977D	E	+	3	2	ZNF804A	185511299	0.993000	0.37304	0.990000	0.47175	0.463000	0.32649	0.233000	0.17911	-0.032000	0.13758	0.467000	0.42956	GAG	ZNF804A	-	NULL	ENSG00000170396		0.403	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	HGNC	protein_coding	OTTHUMT00000255871.1	-	0.00	51	0	G	NM_194250		185803054	+1	tier1	-	no_errors	ENST00000302277	ensembl	human	known	74_37	missense	63.83	17	30	SNP	1.000	C
ZNF90	7643	genome.wustl.edu	37	19	20228938	20228938	+	Missense_Mutation	SNP	A	A	T			TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:20228938A>T	ENST00000418063.2	+	4	687	c.575A>T	c.(574-576)aAg>aTg	p.K192M	ZNF90_ENST00000474284.1_Intron	NM_007138.1	NP_009069.1	Q03938	ZNF90_HUMAN	zinc finger protein 90	192					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|lung(2)|ovary(1)|skin(1)	5						GCTACACATAAGAAAATTCAT	0.373																																																	0													27.0	25.0	26.0					19																	20228938		692	1591	2283	SO:0001583	missense	0			M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000418063.2:c.575A>T	19.37:g.20228938A>T	ENSP00000410466:p.Lys192Met		B9EH87	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K192M	ENST00000418063.2	37	c.575	CCDS46028.1	19	.	.	.	.	.	.	.	.	.	.	A	11.87	1.767131	0.31320	.	.	ENSG00000213988	ENST00000418063	T	0.14640	2.49	1.18	-0.254	0.12992	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08980	0.0222	N	0.01446	-0.86	0.19945	N	0.999944	D	0.89917	1.0	D	0.85130	0.997	T	0.20672	-1.0268	8	.	.	.	.	1.5997	0.02672	0.4599:0.0:0.2426:0.2975	.	192	Q03938	ZNF90_HUMAN	M	192	ENSP00000410466:K192M	.	K	+	2	0	ZNF90	20089938	0.003000	0.15002	0.053000	0.19242	0.052000	0.14988	0.175000	0.16762	0.251000	0.21505	0.248000	0.18094	AAG	ZNF90	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213988		0.373	ZNF90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF90	HGNC	protein_coding	OTTHUMT00000350101.1	-	0.00	67	0	A	NM_007138		20228938	+1	tier1	-	no_errors	ENST00000418063	ensembl	human	known	74_37	missense	37.84	46	28	SNP	0.583	T
ZNF83	55769	genome.wustl.edu	37	19	53116855	53116855	+	Silent	SNP	C	C	T	rs7247359		TCGA-JY-A6FA-01A-11D-A33E-09	TCGA-JY-A6FA-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	fff8ee7e-c79b-4582-a3cd-8f14880cc386	22c94c5a-44cc-4265-95f6-3b6cef088293	g.chr19:53116855C>T	ENST00000597597.1	-	2	3216	c.963G>A	c.(961-963)gaG>gaA	p.E321E	ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000545872.1_Silent_p.E321E|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000301096.3_Silent_p.E321E|ZNF83_ENST00000544146.1_Silent_p.E321E|ZNF83_ENST00000541777.2_Silent_p.E321E|ZNF83_ENST00000391789.4_Silent_p.E293E|ZNF83_ENST00000536937.1_Silent_p.E321E			P51522	ZNF83_HUMAN	zinc finger protein 83	321					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		CCTTGCCACACTCATTACATT	0.408																																																	0													100.0	105.0	103.0					19																	53116855		2203	4300	6503	SO:0001819	synonymous_variant	0			M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.963G>A	19.37:g.53116855C>T			A8MT75|Q3ZCX0|Q6PI08	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E321	ENST00000597597.1	37	c.963	CCDS12854.1	19																																																																																			ZNF83	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167766		0.408	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF83	HGNC	protein_coding	OTTHUMT00000463700.1	-	0.00	54	0	C	NM_018300		53116855	-1	tier1	rs7247359	no_errors	ENST00000301096	ensembl	human	known	74_37	silent	10.94	57	7	SNP	0.415	T
