#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCC5	10057	genome.wustl.edu	37	3	183681223	183681223	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:183681223G>A	ENST00000334444.6	-	15	2425	c.2185C>T	c.(2185-2187)Cgg>Tgg	p.R729W	ABCC5_ENST00000265586.6_Missense_Mutation_p.R729W	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	729	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	AGATGTTTCCGGATAGCACTA	0.507																																																	0													165.0	173.0	170.0					3																	183681223		1918	4132	6050	SO:0001583	missense	0			AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.2185C>T	3.37:g.183681223G>A	ENSP00000333926:p.Arg729Trp		B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.R729W	ENST00000334444.6	37	c.2185	CCDS43176.1	3	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288029	0.80803	.	.	ENSG00000114770	ENST00000334444;ENST00000382495;ENST00000265586	T;T	0.80304	-1.36;-1.36	5.6	3.62	0.41486	ABC transporter, transmembrane domain, type 1 (1);ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.147461	0.64402	D	0.000011	D	0.82486	0.5047	M	0.78637	2.42	0.45403	D	0.998381	P;D	0.58268	0.905;0.982	P;P	0.46144	0.453;0.505	D	0.86068	0.1536	10	0.66056	D	0.02	-7.0526	14.668	0.68924	0.0:0.0:0.7414:0.2586	.	729;729	Q86UX3;O15440	.;MRP5_HUMAN	W	729;665;729	ENSP00000333926:R729W;ENSP00000265586:R729W	ENSP00000265586:R729W	R	-	1	2	ABCC5	185163917	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.412000	0.59787	2.644000	0.89710	0.655000	0.94253	CGG	ABCC5	-	superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000114770		0.507	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC5	HGNC	protein_coding	OTTHUMT00000346350.1		0.00	69	0	G	NM_005688		183681223	-1			no_errors	ENST00000334444	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	A
ABCF2	10061	genome.wustl.edu	37	7	150912711	150912711	+	Silent	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr7:150912711G>A	ENST00000287844.2	-	13	1618	c.1509C>T	c.(1507-1509)taC>taT	p.Y503Y	ABCF2_ENST00000473874.1_5'Flank|ABCF2_ENST00000222388.2_Silent_p.Y503Y	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	503	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)	p.Y503*(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGTGAGACCGTATCGCCCAA	0.517																																																	1	Substitution - Nonsense(1)	ovary(1)											320.0	280.0	294.0					7																	150912711		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.1509C>T	7.37:g.150912711G>A			O60864|Q75MJ0|Q75MJ1|Q96TE8	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.Y503	ENST00000287844.2	37	c.1509	CCDS5923.1	7																																																																																			ABCF2	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000033050		0.517	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF2	HGNC	protein_coding	OTTHUMT00000336086.1		0.00	54	0	G	NM_005692		150912711	-1			no_errors	ENST00000222388	ensembl	human	known	74_37	silent	6.45	29	2	SNP	0.180	A
ACAP3	116983	genome.wustl.edu	37	1	1238596	1238596	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:1238596G>C	ENST00000354700.5	-	3	373	c.171C>G	c.(169-171)ttC>ttG	p.F57L	ACAP3_ENST00000353662.3_Missense_Mutation_p.F15L	NM_030649.2	NP_085152.2	Q96P50	ACAP3_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 3	57					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			endometrium(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	14						CGCCGCTCACGAAAAGCCTGC	0.662																																																	0													73.0	53.0	60.0					1																	1238596		2192	4283	6475	SO:0001583	missense	0			AF411981	CCDS19.2	1p36	2013-01-10	2008-09-22	2008-09-22	ENSG00000131584	ENSG00000131584		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16754	protein-coding gene	gene with protein product			"""centaurin, beta 5"""	CENTB5			Standard	NM_030649		Approved	KIAA1716	uc001aeb.2	Q96P50	OTTHUMG00000002235	ENST00000354700.5:c.171C>G	1.37:g.1238596G>C	ENSP00000346733:p.Phe57Leu		B1AMF5|Q5TA42|Q5TA43|Q86UT3|Q9BSR9|Q9C0E7	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Ankyrin_rpt,pfam_Pleckstrin_homology,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.F15L	ENST00000354700.5	37	c.45	CCDS19.2	1	.	.	.	.	.	.	.	.	.	.	G	14.52	2.559251	0.45590	.	.	ENSG00000131584	ENST00000354700;ENST00000353662	T;T	0.04603	3.59;3.59	3.33	-1.22	0.09494	IRSp53/MIM homology domain (IMD) (1);	0.000000	0.85682	D	0.000000	T	0.14056	0.0340	M	0.67953	2.075	0.35692	D	0.814912	P;D;D	0.76494	0.937;0.999;0.996	D;D;D	0.77004	0.927;0.989;0.988	T	0.02173	-1.1201	10	0.59425	D	0.04	.	8.9386	0.35715	0.7085:0.0:0.2915:0.0	.	97;57;15	Q5TA40;Q96P50;Q96P50-1	.;ACAP3_HUMAN;.	L	57;15	ENSP00000346733:F57L;ENSP00000321139:F15L	ENSP00000321139:F15L	F	-	3	2	ACAP3	1228459	0.481000	0.25941	0.990000	0.47175	0.621000	0.37620	-0.289000	0.08365	-0.250000	0.09555	-0.439000	0.05793	TTC	ACAP3	-	NULL	ENSG00000131584		0.662	ACAP3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAP3	HGNC	protein_coding	OTTHUMT00000006366.2		0.00	18	0	G	NM_030649		1238596	-1			no_errors	ENST00000353662	ensembl	human	known	74_37	missense	15.38	11	2	SNP	0.997	C
ADAM10	102	genome.wustl.edu	37	15	58925538	58925538	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr15:58925538C>A	ENST00000260408.3	-	9	1476	c.1033G>T	c.(1033-1035)Gaa>Taa	p.E345*	ADAM10_ENST00000396140.2_Nonsense_Mutation_p.E44*|ADAM10_ENST00000561288.1_Intron|ADAM10_ENST00000402627.1_Nonsense_Mutation_p.E44*	NM_001110.2	NP_001101.1	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10	345	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell death (GO:0008219)|cell-cell signaling (GO:0007267)|collagen catabolic process (GO:0030574)|constitutive protein ectodomain proteolysis (GO:0051089)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|negative regulation of cell adhesion (GO:0007162)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell chemotaxis (GO:0010820)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|tetraspanin-enriched microdomain (GO:0097197)	endopeptidase activity (GO:0004175)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(5)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(3)	27				GBM - Glioblastoma multiforme(80;0.202)		TTACTTTTTTCACATATTCCT	0.358																																																	0													89.0	89.0	89.0					15																	58925538		2192	4292	6484	SO:0001587	stop_gained	0			AF009615	CCDS10167.1	15q2	2006-09-25	2005-08-18		ENSG00000137845	ENSG00000137845		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	188	protein-coding gene	gene with protein product		602192	"""a disintegrin and metalloproteinase domain 10"""			9344679, 9441766	Standard	XM_005254117		Approved	kuz, MADM, HsT18717, CD156c	uc002afd.1	O14672	OTTHUMG00000132633	ENST00000260408.3:c.1033G>T	15.37:g.58925538C>A	ENSP00000260408:p.Glu345*		B4DU28|Q10742|Q92650	Nonsense_Mutation	SNP	pfam_Blood-coag_inhib_Disintegrin,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.E345*	ENST00000260408.3	37	c.1033	CCDS10167.1	15	.	.	.	.	.	.	.	.	.	.	C	31	5.090773	0.94149	.	.	ENSG00000137845	ENST00000260408;ENST00000402627;ENST00000396136;ENST00000396140	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-27.661	19.879	0.96888	0.0:1.0:0.0:0.0	.	.	.	.	X	345;44;164;44	.	ENSP00000260408:E345X	E	-	1	0	ADAM10	56712830	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.731000	0.68554	2.695000	0.91970	0.655000	0.94253	GAA	ADAM10	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000137845		0.358	ADAM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM10	HGNC	protein_coding	OTTHUMT00000255880.2	-	0.00	48	0	C	NM_001110		58925538	-1	tier1	-	no_errors	ENST00000260408	ensembl	human	known	74_37	nonsense	23.53	39	12	SNP	1.000	A
ADCK1	57143	genome.wustl.edu	37	14	78399710	78399710	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr14:78399710C>T	ENST00000238561.5	+	11	1647	c.1548C>T	c.(1546-1548)tgC>tgT	p.C516C	ADCK1_ENST00000341211.5_Silent_p.C448C|ADCK1_ENST00000556560.1_3'UTR	NM_020421.3	NP_065154.2	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1	523						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(2)	25			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		CCCTAATATGCTGGCTGTTCC	0.567																																																	0													144.0	132.0	136.0					14																	78399710		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096919	CCDS9869.1, CCDS45144.1	14q24	2005-10-30							19038	protein-coding gene	gene with protein product						12471243	Standard	NM_020421		Approved	FLJ39600	uc001xui.3	Q86TW2		ENST00000238561.5:c.1548C>T	14.37:g.78399710C>T			B3KUD5|Q6PD65|Q9UIE6	Silent	SNP	pfam_UbiB_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom	p.C516	ENST00000238561.5	37	c.1548	CCDS9869.1	14																																																																																			ADCK1	-	NULL	ENSG00000063761		0.567	ADCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK1	HGNC	protein_coding	OTTHUMT00000413864.1		0.00	48	0	C	NM_020421		78399710	+1			no_errors	ENST00000238561	ensembl	human	known	74_37	silent	6.38	44	3	SNP	0.989	T
AFG3L2	10939	genome.wustl.edu	37	18	12353077	12353077	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr18:12353077C>T	ENST00000269143.3	-	10	1476	c.1245G>A	c.(1243-1245)aaG>aaA	p.K415K		NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	415					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)	p.K415N(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	CTCTTCCTCTCTTCCTTCCCA	0.502																																																	1	Substitution - Missense(1)	lung(1)											218.0	166.0	184.0					18																	12353077		2203	4300	6503	SO:0001819	synonymous_variant	0			Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.1245G>A	18.37:g.12353077C>T			Q6P1L0	Silent	SNP	pfam_Peptidase_M41,pfam_ATPase_AAA_core,pfam_Pept_M41_FtsH_extracell,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_FtsH	p.K415	ENST00000269143.3	37	c.1245	CCDS11859.1	18																																																																																			AFG3L2	-	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_FtsH	ENSG00000141385		0.502	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFG3L2	HGNC	protein_coding	OTTHUMT00000254603.2	-	0.00	25	0	C	NM_006796		12353077	-1	tier1	-	no_errors	ENST00000269143	ensembl	human	known	74_37	silent	17.07	34	7	SNP	1.000	T
AGTPBP1	23287	genome.wustl.edu	37	9	88257808	88257808	+	Silent	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr9:88257808C>A	ENST00000357081.3	-	13	1380	c.1236G>T	c.(1234-1236)ccG>ccT	p.P412P	AGTPBP1_ENST00000432218.1_Silent_p.P250P|AGTPBP1_ENST00000376083.3_Silent_p.P372P|AGTPBP1_ENST00000337006.4_3'UTR|AGTPBP1_ENST00000376109.3_Silent_p.P424P			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	412					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.P372P(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						TTGTTCGTCCCGGTTCTTGCT	0.294																																																	1	Substitution - coding silent(1)	lung(1)											126.0	135.0	132.0					9																	88257808		2203	4298	6501	SO:0001819	synonymous_variant	0			AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.1236G>T	9.37:g.88257808C>A			B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Silent	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.P424	ENST00000357081.3	37	c.1272		9																																																																																			AGTPBP1	-	NULL	ENSG00000135049		0.294	AGTPBP1-004	KNOWN	basic	protein_coding	AGTPBP1	HGNC	protein_coding	OTTHUMT00000052893.1	-	0.00	63	0	C	NM_015239		88257808	-1	tier1	-	no_errors	ENST00000376109	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.998	A
AMOT	154796	genome.wustl.edu	37	X	112058941	112058941	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:112058941G>T	ENST00000524145.1	-	3	1111	c.1037C>A	c.(1036-1038)tCa>tAa	p.S346*	AMOT_ENST00000304758.1_5'UTR|AMOT_ENST00000371958.1_Nonsense_Mutation_p.S114*|AMOT_ENST00000371962.1_Nonsense_Mutation_p.S114*|AMOT_ENST00000371959.3_Nonsense_Mutation_p.S346*			Q4VCS5	AMOT_HUMAN	angiomotin	346					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						CAGGTGAGCTGAATGGTCTCC	0.582																																																	0													88.0	78.0	81.0					X																	112058941		692	1591	2283	SO:0001587	stop_gained	0			AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1037C>A	X.37:g.112058941G>T	ENSP00000429013:p.Ser346*		Q504X5|Q9HD27|Q9UPT1	Nonsense_Mutation	SNP	pfam_Angiomotin_C,superfamily_Prefoldin,prints_Angiomotin	p.S346*	ENST00000524145.1	37	c.1037	CCDS48154.1	X	.	.	.	.	.	.	.	.	.	.	G	34	5.382733	0.95967	.	.	ENSG00000126016	ENST00000371959;ENST00000371962;ENST00000524145;ENST00000371958	.	.	.	5.31	2.36	0.29203	.	0.672939	0.14090	N	0.342050	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.1746	7.7535	0.28911	0.0834:0.0:0.5423:0.3743	.	.	.	.	X	346;114;346;114	.	ENSP00000361026:S114X	S	-	2	0	AMOT	111945597	0.999000	0.42202	0.213000	0.23690	0.978000	0.69477	4.524000	0.60552	0.626000	0.30322	0.529000	0.55759	TCA	AMOT	-	NULL	ENSG00000126016		0.582	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMOT	HGNC	protein_coding	OTTHUMT00000378570.1		0.00	84	0	G	NM_133265		112058941	-1			no_errors	ENST00000371959	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	0.000	T
ANAPC1	64682	genome.wustl.edu	37	2	112529998	112529998	+	Nonsense_Mutation	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:112529998G>C	ENST00000341068.3	-	47	6411	c.5639C>G	c.(5638-5640)tCa>tGa	p.S1880*	MIR4771-1_ENST00000577758.1_RNA	NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	1880					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						GCTCAGCTGTGATTCCTCCAA	0.527																																																	0													31.0	30.0	30.0					2																	112529998		2202	4279	6481	SO:0001587	stop_gained	0			AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.5639C>G	2.37:g.112529998G>C	ENSP00000339109:p.Ser1880*		Q2M3H8|Q9BSE6|Q9H8D0	Nonsense_Mutation	SNP	NULL	p.S1880*	ENST00000341068.3	37	c.5639	CCDS2093.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	50|50	17.133714|17.133714	0.99880|0.99880	.|.	.|.	ENSG00000153107|ENSG00000153107	ENST00000427997|ENST00000341068	.|.	.|.	.|.	4.27|4.27	4.27|4.27	0.50696|0.50696	.|.	.|0.320610	.|0.20462	.|N	.|0.091863	T|.	0.70307|.	0.3209|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.73827|.	-0.3860|.	3|.	.|0.34782	.|T	.|0.22	-5.6659|-5.6659	16.6794|16.6794	0.85288|0.85288	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	M|X	1414|1880	.|.	.|ENSP00000339109:S1880X	I|S	-|-	3|2	3|0	ANAPC1|ANAPC1	112246469|112246469	0.988000|0.988000	0.35896|0.35896	0.257000|0.257000	0.24404|0.24404	0.817000|0.817000	0.46193|0.46193	8.025000|8.025000	0.88777|0.88777	1.907000|1.907000	0.55213|0.55213	0.561000|0.561000	0.74099|0.74099	ATC|TCA	ANAPC1	-	NULL	ENSG00000153107		0.527	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC1	HGNC	protein_coding	OTTHUMT00000254045.2	-	0.00	17	0	G	NM_022662		112529998	-1	tier1	-	no_errors	ENST00000341068	ensembl	human	known	74_37	nonsense	33.33	10	5	SNP	0.985	C
ANKRD26	22852	genome.wustl.edu	37	10	27355272	27355275	+	Intron	DEL	ATTA	ATTA	-	rs3060820|rs553388195	byFrequency	TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	ATTA	ATTA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:27355272_27355275delATTA	ENST00000376087.4	-	11	1435				ANKRD26_ENST00000436985.2_Intron	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26						glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						CACATACTTTATTAATTATGAACT	0.289														2072	0.413738	0.1755	0.5	5008	,	,		16924	0.4405		0.6044	False		,,,				2504	0.4509																0																																										SO:0001627	intron_variant	0			AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.1269+140TAAT>-	10.37:g.27355276_27355279delATTA			A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	RNA	DEL	-	NULL	ENST00000376087.4	37	NULL	CCDS41499.1	10																																																																																			ANKRD26	-	-	ENSG00000107890		0.289	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD26	HGNC	protein_coding	OTTHUMT00000047296.1		0.00	10	0	ATTA			27355275	-1	tier1		no_errors	ENST00000473304	ensembl	human	known	74_37	rna	42.86	4	3	DEL	0.000:0.000:0.000:0.000	-
ANKRD28	23243	genome.wustl.edu	37	3	15778589	15778589	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:15778589C>A	ENST00000399451.2	-	5	780	c.413G>T	c.(412-414)cGa>cTa	p.R138L	ANKRD28_ENST00000383777.1_Missense_Mutation_p.R171L|ANKRD28_ENST00000497037.1_5'UTR|RN7SL4P_ENST00000584058.1_RNA	NM_001195098.1|NM_001195099.1|NM_015199.3	NP_001182027.1|NP_001182028.1|NP_056014.2	O15084	ANR28_HUMAN	ankyrin repeat domain 28	138						nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|prostate(1)	6						CCTCCCTGCTCGATCAGATAC	0.438																																																	0													157.0	151.0	153.0					3																	15778589		1969	4148	6117	SO:0001583	missense	0			AY367056	CCDS46769.1, CCDS74908.1	3p25.1	2013-01-10			ENSG00000206560	ENSG00000206560		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	29024	protein-coding gene	gene with protein product	"""phosphatase interactor targeting K protein"", ""protein phosphatase 6 ankyrin repeat subunit A"", ""protein phosphatase 1, regulatory subunit 65"""	611122				9205841	Standard	NM_015199		Approved	KIAA0379, PITK, PP6-ARS-A, PPP1R65	uc003caj.1	O15084	OTTHUMG00000155379	ENST00000399451.2:c.413G>T	3.37:g.15778589C>A	ENSP00000382379:p.Arg138Leu		B4DES5|Q1WWL4|Q29RW6|Q3B857|Q6ULS0|Q6ZT57	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R171L	ENST00000399451.2	37	c.512	CCDS46769.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.486960	0.96323	.	.	ENSG00000206560	ENST00000399451;ENST00000383777;ENST00000412318	T;T;T	0.15603	2.41;2.41;2.41	5.37	5.37	0.77165	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.40767	0.1130	L	0.60012	1.86	0.80722	D	1	D;P;P	0.89917	1.0;0.851;0.95	D;P;P	0.77004	0.989;0.611;0.618	T	0.09907	-1.0653	10	0.52906	T	0.07	.	19.1023	0.93279	0.0:1.0:0.0:0.0	.	171;168;138	O15084-1;O15084-4;O15084	.;.;ANR28_HUMAN	L	138;171;138	ENSP00000382379:R138L;ENSP00000373287:R171L;ENSP00000397341:R138L	ENSP00000373287:R171L	R	-	2	0	ANKRD28	15753593	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.776000	0.85560	2.513000	0.84729	0.650000	0.86243	CGA	ANKRD28	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000206560		0.438	ANKRD28-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	ANKRD28	HGNC	protein_coding	OTTHUMT00000339758.1		0.00	35	0	C	NM_015199		15778589	-1			no_errors	ENST00000383777	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	A
ANKRD30BP2	149992	genome.wustl.edu	37	21	14417863	14417863	+	RNA	SNP	G	G	T	rs9968011		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr21:14417863G>T	ENST00000507941.1	+	0	475				RNU6-614P_ENST00000384369.1_RNA					ankyrin repeat domain 30B pseudogene 2																		AGCTAAAGTGGTTCTGTATTA	0.244																																																	0																																												0			AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14417863G>T				RNA	SNP	-	NULL	ENST00000507941.1	37	NULL		21																																																																																			ANKRD30BP2	-	-	ENSG00000224309		0.244	ANKRD30BP2-004	KNOWN	basic	processed_transcript	ANKRD30BP2	HGNC	pseudogene	OTTHUMT00000372094.1	-	0.00	8	0	G	NR_026916		14417863	+1	tier1	rs9968011	no_errors	ENST00000507941	ensembl	human	known	74_37	rna	54.55	5	6	SNP	0.014	T
AP3B1	8546	genome.wustl.edu	37	5	77330193	77330193	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:77330193G>T	ENST00000255194.6	-	24	3061	c.2886C>A	c.(2884-2886)ttC>ttA	p.F962L	AP3B1_ENST00000519295.1_Missense_Mutation_p.F913L|AP3B1_ENST00000523204.1_5'UTR	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	962					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		ACCACAACTGGAAACTGGCAG	0.353									Hermansky-Pudlak syndrome																																								0													73.0	76.0	75.0					5																	77330193		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.2886C>A	5.37:g.77330193G>T	ENSP00000255194:p.Phe962Leu		E5RJ68|O00580|Q7Z393|Q9HD66	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_beta	p.F962L	ENST00000255194.6	37	c.2886	CCDS4041.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.39|15.39	2.818683|2.818683	0.50633|0.50633	.|.	.|.	ENSG00000132842|ENSG00000132842	ENST00000255194;ENST00000519295|ENST00000522901	T;T|.	0.59502|.	0.26;0.29|.	5.75|5.75	3.93|3.93	0.45458|0.45458	.|.	0.049062|.	0.85682|.	D|.	0.000000|.	T|T	0.62196|0.62196	0.2408|0.2408	L|L	0.55990|0.55990	1.75|1.75	0.48040|0.48040	D|D	0.999579|0.999579	B|.	0.21520|.	0.057|.	B|.	0.18871|.	0.023|.	T|T	0.60900|0.60900	-0.7171|-0.7171	10|5	0.24483|.	T|.	0.36|.	-7.2301|-7.2301	12.5379|12.5379	0.56152|0.56152	0.1366:0.0:0.8634:0.0|0.1366:0.0:0.8634:0.0	.|.	962|.	O00203|.	AP3B1_HUMAN|.	L|Y	962;913|62	ENSP00000255194:F962L;ENSP00000430597:F913L|.	ENSP00000255194:F962L|.	F|S	-|-	3|2	2|0	AP3B1|AP3B1	77365949|77365949	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.038000|2.038000	0.41184|0.41184	1.544000|1.544000	0.49359|0.49359	0.650000|0.650000	0.86243|0.86243	TTC|TCC	AP3B1	-	pirsf_AP3_beta	ENSG00000132842		0.353	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B1	HGNC	protein_coding	OTTHUMT00000225548.2	-	0.00	40	0	G			77330193	-1	tier1	-	no_errors	ENST00000255194	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
AP4E1	23431	genome.wustl.edu	37	15	51291343	51291343	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr15:51291343G>T	ENST00000261842.5	+	19	3085	c.2979G>T	c.(2977-2979)caG>caT	p.Q993H	AP4E1_ENST00000560508.1_Missense_Mutation_p.Q918H|AP4E1_ENST00000561397.1_Intron	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	993					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		ATAGTGTGCAGATAGAAAAAC	0.358																																																	0													94.0	90.0	91.0					15																	51291343		2196	4294	6490	SO:0001583	missense	0			AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.2979G>T	15.37:g.51291343G>T	ENSP00000261842:p.Gln993His		A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Coatomer_bsu_C,superfamily_ARM-type_fold,pirsf_AP4_complex_esu	p.Q993H	ENST00000261842.5	37	c.2979	CCDS32240.1	15	.	.	.	.	.	.	.	.	.	.	G	16.18	3.051664	0.55218	.	.	ENSG00000081014	ENST00000261842	T	0.18502	2.21	5.04	-0.61	0.11604	Coatomer, beta subunit, C-terminal (1);	0.487586	0.23347	N	0.049171	T	0.15392	0.0371	L	0.47716	1.5	0.31164	N	0.704008	P	0.49696	0.927	P	0.48488	0.579	T	0.13202	-1.0518	10	0.41790	T	0.15	-1.0291	3.5542	0.07858	0.2608:0.0:0.4486:0.2906	.	993	Q9UPM8	AP4E1_HUMAN	H	993	ENSP00000261842:Q993H	ENSP00000261842:Q993H	Q	+	3	2	AP4E1	49078635	0.980000	0.34600	0.986000	0.45419	0.996000	0.88848	0.178000	0.16820	-0.014000	0.14175	0.655000	0.94253	CAG	AP4E1	-	pfam_Coatomer_bsu_C,pirsf_AP4_complex_esu	ENSG00000081014		0.358	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	AP4E1	HGNC	protein_coding	OTTHUMT00000418656.1	-	0.00	32	0	G			51291343	+1	tier1	-	no_errors	ENST00000261842	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.994	T
APOB	338	genome.wustl.edu	37	2	21250902	21250902	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:21250902G>T	ENST00000233242.1	-	14	1992	c.1865C>A	c.(1864-1866)tCt>tAt	p.S622Y	APOB_ENST00000399256.4_Missense_Mutation_p.S622Y	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	622	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.S622Y(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGAAGTTGAGATTCTTTCAG	0.388																																																	1	Substitution - Missense(1)	large_intestine(1)											115.0	119.0	118.0					2																	21250902		2203	4300	6503	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1865C>A	2.37:g.21250902G>T	ENSP00000233242:p.Ser622Tyr		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.S622Y	ENST00000233242.1	37	c.1865	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195534	0.58126	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	T;T	0.05649	5.69;3.41	5.85	4.97	0.65823	Lipid transport protein, N-terminal (1);Vitellinogen, superhelical (2);	0.338930	0.28072	N	0.016701	T	0.20700	0.0498	M	0.76838	2.35	0.28834	N	0.897008	D	0.67145	0.996	P	0.61328	0.887	T	0.05784	-1.0864	10	0.72032	D	0.01	.	10.1204	0.42616	0.0721:0.0:0.7615:0.1665	.	622	P04114	APOB_HUMAN	Y	622	ENSP00000233242:S622Y;ENSP00000382200:S622Y	ENSP00000233242:S622Y	S	-	2	0	APOB	21104407	0.880000	0.30214	0.976000	0.42696	0.898000	0.52572	1.127000	0.31357	1.636000	0.50526	-0.136000	0.14681	TCT	APOB	-	superfamily_Vitellinogen_superhlx,pfscan_Lipid_transpt_N	ENSG00000084674		0.388	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1		0.00	33	0	G			21250902	-1			no_errors	ENST00000233242	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.887	T
ARAP2	116984	genome.wustl.edu	37	4	36230811	36230811	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:36230811G>A	ENST00000303965.4	-	2	787	c.298C>T	c.(298-300)Cag>Tag	p.Q100*		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	100					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						CAGATATTCTGATCAGAAGAT	0.363																																																	0													96.0	92.0	93.0					4																	36230811		2203	4300	6503	SO:0001587	stop_gained	0			AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.298C>T	4.37:g.36230811G>A	ENSP00000302895:p.Gln100*		Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_SAM_2,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.Q100*	ENST00000303965.4	37	c.298	CCDS3441.1	4	.	.	.	.	.	.	.	.	.	.	G	19.69	3.875504	0.72180	.	.	ENSG00000047365	ENST00000303965	.	.	.	5.8	0.626	0.17670	.	1.489770	0.04026	N	0.300576	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	5.5221	0.16938	0.0637:0.3198:0.3922:0.2243	.	.	.	.	X	100	.	ENSP00000302895:Q100X	Q	-	1	0	ARAP2	35907206	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	0.336000	0.19823	0.043000	0.15746	0.650000	0.86243	CAG	ARAP2	-	NULL	ENSG00000047365		0.363	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP2	HGNC	protein_coding	OTTHUMT00000215074.2	-	0.00	33	0	G	NM_015230		36230811	-1	tier1	-	no_errors	ENST00000303965	ensembl	human	known	74_37	nonsense	21.21	26	7	SNP	0.000	A
ARHGAP35	2909	genome.wustl.edu	37	19	47423066	47423066	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:47423066G>T	ENST00000404338.3	+	1	1134	c.1134G>T	c.(1132-1134)aaG>aaT	p.K378N		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	378	FF 2.				axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										AATTCTTGAAGTGGTTTGTTG	0.418																																																	0													84.0	80.0	82.0					19																	47423066		1878	4119	5997	SO:0001583	missense	0			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.1134G>T	19.37:g.47423066G>T	ENSP00000385720:p.Lys378Asn		A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Small_GTPase,pfam_FF_domain,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.K378N	ENST00000404338.3	37	c.1134	CCDS46127.1	19	.	.	.	.	.	.	.	.	.	.	G	10.04	1.242633	0.22796	.	.	ENSG00000160007	ENST00000317082;ENST00000501576;ENST00000404338	T	0.07908	3.15	5.74	4.65	0.58169	.	0.151472	0.64402	D	0.000012	T	0.06735	0.0172	L	0.29908	0.895	0.48571	D	0.999676	P	0.36909	0.573	B	0.37731	0.257	T	0.37244	-0.9714	10	0.27082	T	0.32	-37.201	8.767	0.34708	0.08:0.1532:0.7667:0.0	.	378	Q9NRY4-2	.	N	378	ENSP00000385720:K378N	ENSP00000324820:K378N	K	+	3	2	ARHGAP35	52114906	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.932000	0.28884	2.708000	0.92522	0.585000	0.79938	AAG	ARHGAP35	-	smart_FF_domain	ENSG00000160007		0.418	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP35	HGNC	protein_coding	OTTHUMT00000466652.1		0.00	56	0	G	NM_004491		47423066	+1			no_errors	ENST00000404338	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
ARID2	196528	genome.wustl.edu	37	12	46299067	46299067	+	3'UTR	DEL	A	A	-			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:46299067delA	ENST00000334344.6	+	0	5886				ARID2_ENST00000457135.1_3'UTR|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000444670.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)						chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		aagaaaaaggaaaaaaaaaaa	0.358			"""N, S, F"""		hepatocellular carcinoma																																			Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.*206A>-	12.37:g.46299067delA			Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	RNA	DEL	-	NULL	ENST00000334344.6	37	NULL	CCDS31783.1	12																																																																																			ARID2	-	-	ENSG00000189079		0.358	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	HGNC	protein_coding	OTTHUMT00000318380.2		0.00	12	0	A	XM_350875		46299067	+1	tier1		no_errors	ENST00000479608	ensembl	human	known	74_37	rna	25.00	12	4	DEL	0.911	-
ARMCX4	100131755	genome.wustl.edu	37	X	100748828	100748828	+	Frame_Shift_Del	DEL	A	A	-			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:100748828delA	ENST00000423738.3	+	2	5454	c.5252delA	c.(5251-5253)gaafs	p.E1751fs		NM_001256155.1	NP_001243084.1	Q5H9R4	ARMX4_HUMAN	armadillo repeat containing, X-linked 4	0						integral component of membrane (GO:0016021)				lung(1)	1						TGGACAGAGGAAAAAGCTGAT	0.512																																																	0																																										SO:0001589	frameshift_variant	0			AK096955	CCDS59170.1	Xq22	2014-03-21	2009-11-26		ENSG00000196440	ENSG00000196440		"""Armadillo repeat containing"""	28615	protein-coding gene	gene with protein product			"""chromosome X open reading frame 35"", ""armadillo repeat containing, X-linked 4 pseudogene"""	CXorf35		16221301, 22569362	Standard	NR_028407		Approved	MGC40053, GASP4	uc031tkc.1	Q5H9R4	OTTHUMG00000022030	ENST00000423738.3:c.5252delA	X.37:g.100748828delA	ENSP00000404304:p.Glu1751fs		A8K928|B3KXA4|Q5H9K8|Q8N8D6	Frame_Shift_Del	DEL	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,pfscan_Armadillo	p.A1753fs	ENST00000423738.3	37	c.5252	CCDS59170.1	X																																																																																			ARMCX4	-	NULL	ENSG00000196440		0.512	ARMCX4-010	PUTATIVE	upstream_ATG|upstream_uORF|basic|appris_principal|CCDS	protein_coding	ARMCX4	HGNC	protein_coding	OTTHUMT00000370455.2		0.00	51	0	A	NM_001256155		100748828	+1	tier1		no_errors	ENST00000423738	ensembl	human	putative	74_37	frame_shift_del	8.57	32	3	DEL	0.000	-
ATAD2B	54454	genome.wustl.edu	37	2	24090793	24090793	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:24090793G>T	ENST00000238789.5	-	10	1443	c.1100C>A	c.(1099-1101)gCa>gAa	p.A367E		NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	367						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAAGTCCTCTGCTCTGAAGTT	0.343																																																	0													177.0	171.0	173.0					2																	24090793		1857	4101	5958	SO:0001583	missense	0			AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.1100C>A	2.37:g.24090793G>T	ENSP00000238789:p.Ala367Glu		B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,pfam_IstB_ATP-bd,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.A367E	ENST00000238789.5	37	c.1100	CCDS46227.1	2	.	.	.	.	.	.	.	.	.	.	G	11.55	1.672908	0.29693	.	.	ENSG00000119778	ENST00000238789	D	0.91407	-2.84	4.62	3.73	0.42828	.	.	.	.	.	T	0.76227	0.3958	N	0.04063	-0.285	0.50039	D	0.999841	B	0.28998	0.23	B	0.24006	0.05	T	0.73430	-0.3985	9	0.05351	T	0.99	.	15.4348	0.75137	0.0:0.1401:0.8599:0.0	.	367	Q9ULI0	ATD2B_HUMAN	E	367	ENSP00000238789:A367E	ENSP00000238789:A367E	A	-	2	0	ATAD2B	23944297	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.140000	0.50585	1.231000	0.43661	0.655000	0.94253	GCA	ATAD2B	-	NULL	ENSG00000119778		0.343	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	ATAD2B	HGNC	protein_coding	OTTHUMT00000324333.1		0.00	57	0	G	NM_017552		24090793	-1			no_errors	ENST00000238789	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
ATM	472	genome.wustl.edu	37	11	108170474	108170474	+	Missense_Mutation	SNP	C	C	A	rs587782153		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:108170474C>A	ENST00000452508.2	+	35	5228	c.5039C>A	c.(5038-5040)cCt>cAt	p.P1680H	ATM_ENST00000278616.4_Missense_Mutation_p.P1680H			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1680					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GAAGTGGGTCCTATAGATTTC	0.353			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													126.0	133.0	130.0					11																	108170474		2201	4298	6499	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.5039C>A	11.37:g.108170474C>A	ENSP00000388058:p.Pro1680His		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.P1680H	ENST00000452508.2	37	c.5039	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	C	25.5	4.645295	0.87859	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	T;T	0.67865	-0.29;-0.29	5.2	5.2	0.72013	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81725	0.4883	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	D	0.83866	0.0271	10	0.87932	D	0	.	18.7539	0.91825	0.0:1.0:0.0:0.0	.	1680	Q13315	ATM_HUMAN	H	1680	ENSP00000278616:P1680H;ENSP00000388058:P1680H	ENSP00000278616:P1680H	P	+	2	0	ATM	107675684	1.000000	0.71417	0.996000	0.52242	0.967000	0.64934	7.114000	0.77103	2.421000	0.82119	0.650000	0.86243	CCT	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.353	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	-	0.00	29	0	C	NM_000051		108170474	+1	tier1	-	no_errors	ENST00000278616	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	A
ATP2A3	489	genome.wustl.edu	37	17	3848001	3848001	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr17:3848001G>T	ENST00000352011.3	-	10	1338	c.1284C>A	c.(1282-1284)aaC>aaA	p.N428K	ATP2A3_ENST00000309890.7_Missense_Mutation_p.N428K|ATP2A3_ENST00000397035.3_Missense_Mutation_p.N428K|ATP2A3_ENST00000397043.3_Missense_Mutation_p.N428K|ATP2A3_ENST00000397039.1_5'UTR|ATP2A3_ENST00000397041.3_Missense_Mutation_p.N428K|ATP2A3_ENST00000359983.3_Missense_Mutation_p.N428K			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous	428					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		GGCCCACCTCGTTGTAGTCCA	0.647																																					GBM(32;29 774 15719 37967)												0													49.0	41.0	44.0					17																	3848001		2203	4298	6501	SO:0001583	missense	0				CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084		ENST00000352011.3:c.1284C>A	17.37:g.3848001G>T	ENSP00000301387:p.Asn428Lys		A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_IIA,tigrfam_Cation_transp_P_typ_ATPase	p.N428K	ENST00000352011.3	37	c.1284	CCDS11041.1	17	.	.	.	.	.	.	.	.	.	.	G	13.83	2.353573	0.41700	.	.	ENSG00000074370	ENST00000397043;ENST00000352011;ENST00000359983;ENST00000397041;ENST00000397045;ENST00000309890;ENST00000397035	D;D;D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67;-1.67;-1.67	3.94	-1.76	0.08006	ATPase, cation-transporting, domain N (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.86142	0.5862	L	0.55990	1.75	0.80722	D	1	D;D;D;P;D;P	0.89917	1.0;0.996;0.999;0.933;0.998;0.933	D;P;D;B;P;B	0.83275	0.996;0.903;0.942;0.382;0.903;0.292	T	0.83127	-0.0115	10	0.59425	D	0.04	.	11.0942	0.48134	0.6427:0.0:0.3573:0.0	.	428;428;428;428;428;428	Q93084-4;Q93084-2;Q93084;Q93084-6;G3XAE1;Q93084-3	.;.;AT2A3_HUMAN;.;.;.	K	428	ENSP00000380236:N428K;ENSP00000301387:N428K;ENSP00000353072:N428K;ENSP00000380234:N428K;ENSP00000312577:N428K;ENSP00000380229:N428K	ENSP00000312577:N428K	N	-	3	2	ATP2A3	3794750	0.001000	0.12720	0.971000	0.41717	0.350000	0.29205	-1.276000	0.02815	-0.561000	0.06094	-2.069000	0.00389	AAC	ATP2A3	-	superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Ca-transp_IIA	ENSG00000074370		0.647	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	ATP2A3	HGNC	protein_coding	OTTHUMT00000438401.1	-	0.00	77	0	G	NM_174953		3848001	-1	tier1	-	no_errors	ENST00000359983	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.992	T
ATP8A1	10396	genome.wustl.edu	37	4	42627653	42627653	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:42627653A>G	ENST00000381668.5	-	3	473	c.242T>C	c.(241-243)tTt>tCt	p.F81S	ATP8A1_ENST00000510289.1_3'UTR|ATP8A1_ENST00000264449.10_Missense_Mutation_p.F81S	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	81					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	AATAAAGAGAAAAAATGAATT	0.363																																																	0													90.0	91.0	90.0					4																	42627653		2203	4300	6503	SO:0001583	missense	0			AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.242T>C	4.37:g.42627653A>G	ENSP00000371084:p.Phe81Ser		Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.F81S	ENST00000381668.5	37	c.242	CCDS3466.1	4	.	.	.	.	.	.	.	.	.	.	A	19.76	3.887103	0.72410	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	D;D	0.85258	-1.96;-1.96	5.8	5.8	0.92144	ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.94618	0.8265	H	0.94306	3.52	0.80722	D	1	D;D;D	0.89917	0.967;1.0;1.0	D;D;D	0.97110	0.91;0.999;1.0	D	0.95897	0.8912	10	0.87932	D	0	.	16.4401	0.83898	1.0:0.0:0.0:0.0	.	81;81;81	B4DII6;Q32M35;Q9Y2Q0	.;.;AT8A1_HUMAN	S	81	ENSP00000371084:F81S;ENSP00000264449:F81S	ENSP00000264449:F81S	F	-	2	0	ATP8A1	42322410	1.000000	0.71417	1.000000	0.80357	0.336000	0.28762	8.818000	0.91991	2.340000	0.79590	0.528000	0.53228	TTT	ATP8A1	-	tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000124406		0.363	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP8A1	HGNC	protein_coding	OTTHUMT00000216861.2	-	0.00	70	0	A	NM_006095		42627653	-1	tier1	-	no_errors	ENST00000381668	ensembl	human	known	74_37	missense	21.95	64	18	SNP	1.000	G
BAALC	79870	genome.wustl.edu	37	8	104153150	104153150	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr8:104153150G>A	ENST00000297574.6	+	1	164	c.25G>A	c.(25-27)Gat>Aat	p.D9N	BAALC_ENST00000309982.5_Missense_Mutation_p.D9N|C8orf56_ENST00000436771.1_Intron|BAALC_ENST00000330955.5_Missense_Mutation_p.D9N|BAALC_ENST00000306391.6_Missense_Mutation_p.D9N|BAALC_ENST00000438105.2_Missense_Mutation_p.D9N|C8orf56_ENST00000521246.1_Intron			Q8WXS3	BAALC_HUMAN	brain and acute leukemia, cytoplasmic	9	Interaction with CAMK2A. {ECO:0000250}.					cytoplasm (GO:0005737)|membrane (GO:0016020)				kidney(1)|large_intestine(3)|lung(3)	7			OV - Ovarian serous cystadenocarcinoma(57;3.49e-05)|STAD - Stomach adenocarcinoma(118;0.133)			GAGCCGGGCGGATGCCATCGA	0.761																																																	0													6.0	8.0	7.0					8																	104153150		1989	3960	5949	SO:0001583	missense	0			AF363578	CCDS6297.1, CCDS47906.1	8q22.3	2008-07-29			ENSG00000164929	ENSG00000164929			14333	protein-coding gene	gene with protein product		606602				11707601	Standard	NM_024812		Approved		uc003yld.3	Q8WXS3	OTTHUMG00000164782	ENST00000297574.6:c.25G>A	8.37:g.104153150G>A	ENSP00000297574:p.Asp9Asn		Q8WTP6|Q8WXS0|Q8WXS1|Q8WXS2|Q9HA93	Missense_Mutation	SNP	pfam_BAALC	p.D9N	ENST00000297574.6	37	c.25		8	.	.	.	.	.	.	.	.	.	.	G	29.6	5.017043	0.93404	.	.	ENSG00000164929	ENST00000309982;ENST00000438105;ENST00000297574;ENST00000306391;ENST00000330955	T;T	0.58652	0.34;0.32	4.35	2.51	0.30379	.	0.178247	0.47852	D	0.000209	T	0.47544	0.1451	.	.	.	0.39738	D	0.971716	B	0.19073	0.033	B	0.19946	0.027	T	0.46624	-0.9178	9	0.87932	D	0	-15.5508	9.4779	0.38882	0.08:0.1436:0.7764:0.0	.	9	Q8WXS3-2	.	N	9	ENSP00000312457:D9N;ENSP00000297574:D9N	ENSP00000297574:D9N	D	+	1	0	BAALC	104222326	1.000000	0.71417	0.681000	0.30009	0.987000	0.75469	6.444000	0.73452	0.443000	0.26582	0.561000	0.74099	GAT	BAALC	-	pfam_BAALC	ENSG00000164929		0.761	BAALC-003	KNOWN	basic	protein_coding	BAALC	HGNC	protein_coding	OTTHUMT00000380257.1		0.00	11	0	G			104153150	+1			no_errors	ENST00000297574	ensembl	human	known	74_37	missense	50.00	3	3	SNP	0.995	A
BAI3	577	genome.wustl.edu	37	6	70070788	70070788	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:70070788G>A	ENST00000370598.1	+	29	4444	c.3623G>A	c.(3622-3624)cGa>cAa	p.R1208Q	BAI3_ENST00000238918.8_Missense_Mutation_p.R414Q|BAI3_ENST00000546190.1_Missense_Mutation_p.R172Q	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1208					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R1208Q(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GGTCCTTGCCGAGCAGCCACA	0.358																																																	1	Substitution - Missense(1)	central_nervous_system(1)											83.0	86.0	85.0					6																	70070788		2203	4299	6502	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.3623G>A	6.37:g.70070788G>A	ENSP00000359630:p.Arg1208Gln		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.R1208Q	ENST00000370598.1	37	c.3623	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	G	24.5	4.534042	0.85812	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.47177	1.99;2.62;0.85	5.61	5.61	0.85477	.	0.059612	0.64402	D	0.000010	T	0.35711	0.0941	L	0.50333	1.59	0.54753	D	0.99998	D;D	0.58268	0.961;0.982	B;B	0.41571	0.215;0.36	T	0.25363	-1.0134	10	0.44086	T	0.13	.	19.6357	0.95731	0.0:0.0:1.0:0.0	.	414;1208	B7Z356;O60242	.;BAI3_HUMAN	Q	1208;414;172	ENSP00000359630:R1208Q;ENSP00000238918:R414Q;ENSP00000441821:R172Q	ENSP00000238918:R414Q	R	+	2	0	BAI3	70127509	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	9.476000	0.97823	2.632000	0.89209	0.591000	0.81541	CGA	BAI3	-	NULL	ENSG00000135298		0.358	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1		0.00	31	0	G			70070788	+1			no_errors	ENST00000370598	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	A
BCAR1	9564	genome.wustl.edu	37	16	75276907	75276907	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr16:75276907C>T	ENST00000162330.5	-	2	220	c.94G>A	c.(94-96)Gtg>Atg	p.V32M	BCAR1_ENST00000538440.2_Missense_Mutation_p.V32M|BCAR1_ENST00000393422.2_Missense_Mutation_p.V50M|BCAR1_ENST00000393420.6_Missense_Mutation_p.V32M|BCAR1_ENST00000535626.2_Missense_Mutation_p.V32M|BCAR1_ENST00000420641.3_Missense_Mutation_p.V50M|BCAR1_ENST00000546196.1_Missense_Mutation_p.V3M|BCAR1_ENST00000418647.3_Missense_Mutation_p.V78M|BCAR1_ENST00000542031.2_Missense_Mutation_p.V30M	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	32	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		TGCTCCAGCACCGTCATGATG	0.637																																																	0													42.0	42.0	42.0					16																	75276907		2197	4300	6497	SO:0001583	missense	0			AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.94G>A	16.37:g.75276907C>T	ENSP00000162330:p.Val32Met		B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Missense_Mutation	SNP	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_Spectrin_alpha_SH3	p.V78M	ENST00000162330.5	37	c.232	CCDS10915.1	16	.	.	.	.	.	.	.	.	.	.	C	28.3	4.910347	0.92107	.	.	ENSG00000050820	ENST00000162330;ENST00000393422;ENST00000420641;ENST00000538440;ENST00000418647;ENST00000535626;ENST00000393420;ENST00000542031;ENST00000546196	T;T;T;T;T;T;T;T;T	0.63744	-0.04;-0.04;-0.04;-0.04;-0.04;-0.04;-0.04;-0.04;-0.06	5.08	5.08	0.68730	Src homology-3 domain (5);Spectrin alpha chain, SH3 domain (1);	0.000000	0.64402	D	0.000003	D	0.83119	0.5185	M	0.90814	3.15	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.998;1.0;1.0;0.998;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;0.999;0.998;0.994;0.998;1.0;0.994;0.999	D	0.86809	0.1997	10	0.87932	D	0	-26.4579	17.4106	0.87484	0.0:1.0:0.0:0.0	.	50;32;78;30;32;50;32;32	B4DIW5;F5GXV6;E9PCL5;F5GXA2;F8WA69;E9PCV2;F5H7Z0;P56945	.;.;.;.;.;.;.;BCAR1_HUMAN	M	32;50;50;32;78;32;32;30;3	ENSP00000162330:V32M;ENSP00000377074:V50M;ENSP00000392708:V50M;ENSP00000443841:V32M;ENSP00000391669:V78M;ENSP00000440370:V32M;ENSP00000377072:V32M;ENSP00000440415:V30M;ENSP00000442161:V3M	ENSP00000162330:V32M	V	-	1	0	BCAR1	73834408	1.000000	0.71417	0.995000	0.50966	0.872000	0.50106	7.445000	0.80570	2.537000	0.85549	0.561000	0.74099	GTG	BCAR1	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_Spectrin_alpha_SH3	ENSG00000050820		0.637	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAR1	HGNC	protein_coding	OTTHUMT00000269017.1		0.00	37	0	C	NM_014567		75276907	-1			no_errors	ENST00000418647	ensembl	human	known	74_37	missense	11.76	15	2	SNP	1.000	T
BICC1	80114	genome.wustl.edu	37	10	60549211	60549211	+	Missense_Mutation	SNP	G	G	T	rs201679654		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:60549211G>T	ENST00000373886.3	+	7	794	c.790G>T	c.(790-792)Gtg>Ttg	p.V264L		NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	264					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						CACTAGTGCTGTGAAGGTAAA	0.318																																																	0													97.0	94.0	95.0					10																	60549211		2203	4300	6503	SO:0001583	missense	0			AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.790G>T	10.37:g.60549211G>T	ENSP00000362993:p.Val264Leu			Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_KH_dom,smart_SAM,pfscan_SAM,pfscan_KH_dom_type_1	p.V264L	ENST00000373886.3	37	c.790	CCDS31206.1	10	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787627	0.70337	.	.	ENSG00000122870	ENST00000373886	T	0.48201	0.82	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.50684	0.1630	L	0.37561	1.115	0.80722	D	1	P	0.51351	0.944	P	0.49085	0.6	T	0.39623	-0.9605	10	0.39692	T	0.17	-8.2276	20.2422	0.98381	0.0:0.0:1.0:0.0	.	264	Q9H694	BICC1_HUMAN	L	264	ENSP00000362993:V264L	ENSP00000362993:V264L	V	+	1	0	BICC1	60219217	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.586000	0.67503	2.782000	0.95742	0.655000	0.94253	GTG	BICC1	-	NULL	ENSG00000122870		0.318	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICC1	HGNC	protein_coding	OTTHUMT00000048150.2		0.00	28	0	G	NM_025044		60549211	+1			no_errors	ENST00000373886	ensembl	human	known	74_37	missense	11.76	15	2	SNP	1.000	T
BTN1A1	696	genome.wustl.edu	37	6	26506976	26506976	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:26506976C>A	ENST00000244513.6	+	4	841	c.775C>A	c.(775-777)Ctt>Att	p.L259I		NM_001732.2	NP_001723.2	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1	259						extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(1)	26						GGTTCTAGGACTTCTCACCAT	0.458																																																	0													198.0	196.0	196.0					6																	26506976		2203	4300	6503	SO:0001583	missense	0			U39576	CCDS4614.1	6p22.1	2014-01-14			ENSG00000124557	ENSG00000124557		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1135	protein-coding gene	gene with protein product		601610		BTN		8114113, 9382921	Standard	NM_001732		Approved	BT, BTN1	uc003nif.4	Q13410	OTTHUMG00000016358	ENST00000244513.6:c.775C>A	6.37:g.26506976C>A	ENSP00000244513:p.Leu259Ile		Q4VAN3|Q4VAN4|Q9H458	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like_dom,prints_Butyrophylin	p.L259I	ENST00000244513.6	37	c.775	CCDS4614.1	6	.	.	.	.	.	.	.	.	.	.	C	6.390	0.440027	0.12104	.	.	ENSG00000124557	ENST00000244513;ENST00000377586	T	0.41758	0.99	5.4	1.63	0.23807	.	0.597033	0.15093	N	0.280975	T	0.13457	0.0326	L	0.53249	1.67	0.25343	N	0.988937	P	0.41420	0.749	B	0.39562	0.303	T	0.13818	-1.0495	10	0.22706	T	0.39	.	2.2278	0.03989	0.1583:0.5177:0.1531:0.1708	.	259	Q13410	BT1A1_HUMAN	I	259	ENSP00000244513:L259I	ENSP00000244513:L259I	L	+	1	0	BTN1A1	26614955	0.052000	0.20516	0.971000	0.41717	0.016000	0.09150	-0.885000	0.04161	0.071000	0.16664	0.655000	0.94253	CTT	BTN1A1	-	NULL	ENSG00000124557		0.458	BTN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN1A1	HGNC	protein_coding	OTTHUMT00000043776.1	-	0.00	52	0	C	NM_001732		26506976	+1	tier1	-	no_errors	ENST00000244513	ensembl	human	known	74_37	missense	8.62	53	5	SNP	0.999	A
BUB1B	701	genome.wustl.edu	37	15	40504783	40504783	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr15:40504783C>T	ENST00000287598.6	+	19	2664	c.2469C>T	c.(2467-2469)tgC>tgT	p.C823C	BUB1B_ENST00000412359.3_Silent_p.C837C	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B	823	Protein kinase.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		ATCATTTTTGCAGCTGTTATC	0.338			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome																														yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)		M	0													118.0	113.0	115.0					15																	40504783		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.2469C>T	15.37:g.40504783C>T			B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Silent	SNP	pfam_Mad3_BUB1_I,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Mad3_BUB1_I	p.C837	ENST00000287598.6	37	c.2511	CCDS10053.1	15																																																																																			BUB1B	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom	ENSG00000156970		0.338	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BUB1B	HGNC	protein_coding	OTTHUMT00000252122.4		0.00	47	0	C			40504783	+1			no_errors	ENST00000412359	ensembl	human	known	74_37	silent	5.71	66	4	SNP	1.000	T
C17orf105	284067	genome.wustl.edu	37	17	41859202	41859202	+	Missense_Mutation	SNP	G	G	A	rs535898355		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr17:41859202G>A	ENST00000449302.3	+	3	284	c.256G>A	c.(256-258)Gca>Aca	p.A86T	RP5-905N1.2_ENST00000591540.1_RNA|DUSP3_ENST00000397937.2_5'Flank|DUSP3_ENST00000226004.3_5'Flank	NM_001136483.1	NP_001129955.1	B2RV13	CQ105_HUMAN	chromosome 17 open reading frame 105	86																	TCAGAAAATCGCAAATGCCCA	0.403													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19748	0.0		0.0	False		,,,				2504	0.0																0													108.0	105.0	106.0					17																	41859202		692	1591	2283	SO:0001583	missense	0				CCDS45695.1	17q21.31	2012-10-23			ENSG00000231256	ENSG00000231256			37241	protein-coding gene	gene with protein product							Standard	NM_001136483		Approved		uc002ieg.3	B2RV13	OTTHUMG00000180890	ENST00000449302.3:c.256G>A	17.37:g.41859202G>A	ENSP00000415662:p.Ala86Thr			Missense_Mutation	SNP	NULL	p.A86T	ENST00000449302.3	37	c.256	CCDS45695.1	17	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663131	0.67700	.	.	ENSG00000231256	ENST00000449302	T	0.39406	1.08	5.2	5.2	0.72013	.	.	.	.	.	T	0.53883	0.1824	L	0.45228	1.405	0.39290	D	0.964721	D	0.76494	0.999	D	0.83275	0.996	T	0.41734	-0.9492	9	0.20519	T	0.43	-26.1394	14.4281	0.67230	0.0:0.0:1.0:0.0	.	86	B2RV13	CQ105_HUMAN	T	86	ENSP00000415662:A86T	ENSP00000415662:A86T	A	+	1	0	C17orf105	39214728	0.990000	0.36364	0.973000	0.42090	0.818000	0.46254	5.197000	0.65141	2.861000	0.98227	0.655000	0.94253	GCA	C17orf105	-	NULL	ENSG00000231256		0.403	C17orf105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf105	HGNC	protein_coding	OTTHUMT00000453508.1	-	0.00	56	0	G	NM_001136483		41859202	+1	tier1	-	no_errors	ENST00000449302	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.970	A
C1orf140	400804	genome.wustl.edu	37	1	221507319	221507319	+	lincRNA	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:221507319C>G	ENST00000439004.1	-	0	442					NR_024236.1																						GTGGAGGATCCTTTGCCAGCT	0.453																																																	0													140.0	114.0	122.0					1																	221507319		692	1591	2283			0																															1.37:g.221507319C>G				RNA	SNP	-	NULL	ENST00000439004.1	37	NULL		1																																																																																			RP11-421L10.1	-	-	ENSG00000234754		0.453	RP11-421L10.1-001	KNOWN	basic	lincRNA	C1orf140	Clone_based_vega_gene	lincRNA	OTTHUMT00000091116.2	-	0.00	55	0	C			221507319	-1	tier1	-	no_errors	ENST00000434398	ensembl	human	known	74_37	rna	20.59	27	7	SNP	0.000	G
C2CD3	26005	genome.wustl.edu	37	11	73753117	73753117	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:73753117G>C	ENST00000334126.7	-	29	5868	c.5642C>G	c.(5641-5643)tCc>tGc	p.S1881C	C2CD3_ENST00000313663.7_Missense_Mutation_p.S1881C			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1881					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					AGTCAGAATGGAGGTTTGGGA	0.483																																																	0													201.0	172.0	182.0					11																	73753117		2200	4293	6493	SO:0001583	missense	0			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.5642C>G	11.37:g.73753117G>C	ENSP00000334379:p.Ser1881Cys		C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom	p.S1881C	ENST00000334126.7	37	c.5642		11	.	.	.	.	.	.	.	.	.	.	G	20.8	4.049734	0.75846	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000414160	T;T;T	0.16324	2.69;2.75;2.35	5.82	5.82	0.92795	.	0.109450	0.64402	D	0.000005	T	0.38268	0.1034	M	0.74881	2.28	0.42635	D	0.993395	D	0.59357	0.985	P	0.55161	0.77	T	0.03739	-1.1008	10	0.40728	T	0.16	-11.7656	19.6888	0.95989	0.0:0.0:1.0:0.0	.	1881	Q4AC94-1	.	C	1881;1881;689	ENSP00000334379:S1881C;ENSP00000323339:S1881C;ENSP00000388750:S689C	ENSP00000323339:S1881C	S	-	2	0	C2CD3	73430765	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	6.611000	0.74183	2.757000	0.94681	0.585000	0.79938	TCC	C2CD3	-	NULL	ENSG00000168014		0.483	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2CD3	HGNC	protein_coding		-	0.00	53	0	G	NM_015531		73753117	-1	tier1	-	no_errors	ENST00000334126	ensembl	human	known	74_37	missense	27.27	40	15	SNP	1.000	C
C4orf50	389197	genome.wustl.edu	37	4	5991404	5991404	+	5'Flank	SNP	T	T	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:5991404T>C	ENST00000324058.5	-	0	0				C4orf50_ENST00000531445.1_Missense_Mutation_p.Q32R			Q6ZRC1	CD050_HUMAN	chromosome 4 open reading frame 50											breast(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(2)|skin(3)|urinary_tract(1)	15						GCTCACAGCCTGTGGATGACC	0.532																																																	0																																										SO:0001631	upstream_gene_variant	0			BC140710		4p16.1	2009-04-14			ENSG00000181215	ENSG00000181215			33766	protein-coding gene	gene with protein product							Standard	XM_003119922		Approved	FLJ46481		Q6ZRC1	OTTHUMG00000149971		4.37:g.5991404T>C	Exception_encountered			Missense_Mutation	SNP	NULL	p.Q32R	ENST00000324058.5	37	c.95		4	.	.	.	.	.	.	.	.	.	.	T	4.719	0.133664	0.09032	.	.	ENSG00000181215	ENST00000531445	T	0.23552	1.9	3.79	-3.32	0.04973	.	.	.	.	.	T	0.20700	0.0498	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35500	-0.9786	6	0.51188	T	0.08	.	4.9804	0.14162	0.0:0.3902:0.2867:0.3231	.	.	.	.	R	32	ENSP00000437121:Q32R	ENSP00000437121:Q32R	Q	-	2	0	C4orf50	6042305	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.612000	0.05616	-0.537000	0.06290	-1.198000	0.01671	CAG	C4orf50	-	NULL	ENSG00000181215		0.532	C4orf50-201	KNOWN	basic|appris_candidate	protein_coding	C4orf50	HGNC	protein_coding		-	0.00	27	0	T	NM_207405		5991404	-1	tier1	-	no_errors	ENST00000531445	ensembl	human	known	74_37	missense	14.29	18	3	SNP	0.000	C
CALB1	793	genome.wustl.edu	37	8	91078168	91078168	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr8:91078168C>T	ENST00000265431.3	-	6	589	c.408G>A	c.(406-408)aaG>aaA	p.K136K	CALB1_ENST00000518457.1_Silent_p.K79K	NM_004929.2	NP_004920.1	P05937	CALB1_HUMAN	calbindin 1, 28kDa	136					cellular response to organic substance (GO:0071310)|cytosolic calcium ion homeostasis (GO:0051480)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|metanephric collecting duct development (GO:0072205)|metanephric connecting tubule development (GO:0072286)|metanephric distal convoluted tubule development (GO:0072221)|metanephric part of ureteric bud development (GO:0035502)|regulation of synaptic plasticity (GO:0048167)|retina layer formation (GO:0010842)|short-term memory (GO:0007614)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|vitamin D binding (GO:0005499)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(8)|pancreas(1)	11			BRCA - Breast invasive adenocarcinoma(11;0.00953)			CATCAACAGTCTTGTTTGCTT	0.323																																					Melanoma(46;573 1182 27367 39727 48386)												0													126.0	112.0	117.0					8																	91078168		2202	4299	6501	SO:0001819	synonymous_variant	0				CCDS6251.1	8q21.3	2013-01-10	2002-08-29		ENSG00000104327	ENSG00000104327		"""EF-hand domain containing"""	1434	protein-coding gene	gene with protein product		114050		CALB			Standard	NM_004929		Approved		uc003yel.1	P05937	OTTHUMG00000134314	ENST00000265431.3:c.408G>A	8.37:g.91078168C>T			B2R696|B7Z9J4	Silent	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.K136	ENST00000265431.3	37	c.408	CCDS6251.1	8																																																																																			CALB1	-	NULL	ENSG00000104327		0.323	CALB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALB1	HGNC	protein_coding	OTTHUMT00000259338.2	-	0.00	50	0	C	NM_004929		91078168	-1	tier1	-	no_errors	ENST00000265431	ensembl	human	known	74_37	silent	22.95	47	14	SNP	0.995	T
CASK	8573	genome.wustl.edu	37	X	41524635	41524635	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:41524635G>T	ENST00000378163.1	-	7	1077	c.603C>A	c.(601-603)gaC>gaA	p.D201E	CASK_ENST00000421587.2_Missense_Mutation_p.D201E|CASK_ENST00000378166.4_Missense_Mutation_p.D201E|CASK_ENST00000378154.1_Missense_Mutation_p.D201E|CASK_ENST00000378158.1_Missense_Mutation_p.D201E|CASK_ENST00000318588.9_Missense_Mutation_p.D201E|CASK_ENST00000361962.4_Missense_Mutation_p.D201E|CASK_ENST00000442742.2_Missense_Mutation_p.D201E			O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	201	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium ion import (GO:0070509)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of wound healing (GO:0061045)|nucleotide phosphorylation (GO:0046939)|positive regulation of calcium ion import (GO:0090280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	actin cytoskeleton (GO:0015629)|basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(5)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|ovary(3)|prostate(1)|stomach(1)	32						ACCCCCAGACGTCTACAGGCT	0.413																																					NSCLC(42;104 1086 3090 27189 35040)												0													102.0	83.0	89.0					X																	41524635		2203	4300	6503	SO:0001583	missense	0			AF035582	CCDS14257.1, CCDS48094.1, CCDS48095.1	Xp11.4	2010-02-09			ENSG00000147044	ENSG00000147044			1497	protein-coding gene	gene with protein product		300172	"""trinucleotide repeat containing 8"""	TNRC8		9722958	Standard	NM_003688		Approved	LIN2, CAGH39, FGS4	uc004dfl.4	O14936	OTTHUMG00000021378	ENST00000378163.1:c.603C>A	X.37:g.41524635G>T	ENSP00000367405:p.Asp201Glu		A6NES1|B7ZKY0|O43215|Q17RI4|Q59HA0|Q5VT16|Q5VT17|Q5VT18|Q5VT19|Q66T42|Q9BYH6|Q9NYB2|Q9NYB3	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_GK/Ca_channel_bsu,pfam_L27_C,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_L27,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Guanylate_kin-like	p.D201E	ENST00000378163.1	37	c.603		X	.	.	.	.	.	.	.	.	.	.	G	20.9	4.069139	0.76301	.	.	ENSG00000147044	ENST00000421587;ENST00000318588;ENST00000361962;ENST00000378163;ENST00000378158;ENST00000378166;ENST00000442742;ENST00000378154	D;D;D;D;D;D;D;D	0.84589	-1.87;-1.87;-1.87;-1.87;-1.87;-1.87;-1.87;-1.87	5.73	-4.01	0.04045	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	D	0.92945	0.7755	H	0.95437	3.67	0.80722	D	1	D;P;D;D	0.89917	1.0;0.937;1.0;1.0	D;D;D;D	0.97110	0.993;0.915;1.0;1.0	D	0.91964	0.5581	10	0.87932	D	0	.	12.7745	0.57439	0.6455:0.0:0.3545:0.0	.	201;201;201;201	O14936-3;O14936-4;O14936-2;O14936	.;.;.;CSKP_HUMAN	E	201	ENSP00000400526:D201E;ENSP00000322727:D201E;ENSP00000354641:D201E;ENSP00000367405:D201E;ENSP00000367400:D201E;ENSP00000367408:D201E;ENSP00000398007:D201E;ENSP00000367396:D201E	ENSP00000322727:D201E	D	-	3	2	CASK	41409579	1.000000	0.71417	0.948000	0.38648	0.968000	0.65278	0.943000	0.29030	-0.889000	0.03950	-1.261000	0.01458	GAC	CASK	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000147044		0.413	CASK-007	KNOWN	basic|appris_candidate_longest	protein_coding	CASK	HGNC	protein_coding	OTTHUMT00000056285.1	-	0.00	48	0	G	NM_003688		41524635	-1	tier1	-	no_errors	ENST00000378163	ensembl	human	known	74_37	missense	22.22	35	10	SNP	0.971	T
CBR3	874	genome.wustl.edu	37	21	37504232	37504232	+	5'Flank	SNP	T	T	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr21:37504232T>A	ENST00000290354.5	+	0	0				CBR3-AS1_ENST00000453159.1_RNA|CBR3-AS1_ENST00000608622.1_RNA|CBR3-AS1_ENST00000413862.1_RNA|CBR3-AS1_ENST00000608632.1_RNA|CBR3-AS1_ENST00000608690.1_RNA|CBR3-AS1_ENST00000608641.1_RNA	NM_001236.3	NP_001227.1	O75828	CBR3_HUMAN	carbonyl reductase 3						cognition (GO:0050890)|phylloquinone catabolic process (GO:0042376)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	3-keto sterol reductase activity (GO:0000253)|carbonyl reductase (NADPH) activity (GO:0004090)|NADPH binding (GO:0070402)			kidney(1)|large_intestine(1)|lung(1)	3					Doxorubicin(DB00997)	aaataaataatttaaaaaata	0.269																																																	0																																										SO:0001631	upstream_gene_variant	0			AB004854	CCDS13642.1	21q22.2	2011-09-14			ENSG00000159231	ENSG00000159231	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	1549	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 21C, member 2"""	603608				9740676, 19027726	Standard	NM_001236		Approved	SDR21C2	uc002yve.3	O75828	OTTHUMG00000086617		21.37:g.37504232T>A	Exception_encountered		Q6FHP2	RNA	SNP	-	NULL	ENST00000290354.5	37	NULL	CCDS13642.1	21																																																																																			CBR3-AS1	-	-	ENSG00000236830		0.269	CBR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBR3-AS1	HGNC	protein_coding	OTTHUMT00000194632.1		0.00	23	0	T			37504232	-1			no_errors	ENST00000413862	ensembl	human	known	74_37	rna	21.05	15	4	SNP	0.000	A
CCDC178	374864	genome.wustl.edu	37	18	30803178	30803178	+	Silent	SNP	A	A	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr18:30803178A>C	ENST00000383096.3	-	18	2006	c.1824T>G	c.(1822-1824)ctT>ctG	p.L608L	CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000300227.8_Intron|CCDC178_ENST00000579947.1_Silent_p.L608L|CCDC178_ENST00000583930.1_Silent_p.L608L|CCDC178_ENST00000402325.1_Silent_p.L608L|CCDC178_ENST00000403303.1_Silent_p.L608L|CCDC178_ENST00000406524.2_Silent_p.L608L			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	608																	TTATATTATTAAGCATCTAGA	0.313																																																	0													65.0	60.0	62.0					18																	30803178		1807	4057	5864	SO:0001819	synonymous_variant	0			AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.1824T>G	18.37:g.30803178A>C			A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Silent	SNP	NULL	p.L608	ENST00000383096.3	37	c.1824	CCDS42424.1	18																																																																																			CCDC178	-	NULL	ENSG00000166960		0.313	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC178	HGNC	protein_coding	OTTHUMT00000255373.2	-	0.00	36	0	A	NM_198995		30803178	-1	tier1	-	no_errors	ENST00000406524	ensembl	human	known	74_37	silent	20.69	23	6	SNP	0.001	C
CCDC81	60494	genome.wustl.edu	37	11	86097108	86097108	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:86097108G>T	ENST00000445632.2	+	2	367	c.95G>T	c.(94-96)tGg>tTg	p.W32L	CCDC81_ENST00000278487.3_5'UTR|CCDC81_ENST00000354755.1_Missense_Mutation_p.W32L	NM_001156474.1	NP_001149946.1	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81	32										kidney(3)|large_intestine(8)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	20		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				TCTATTATCTGGGGGAATGTA	0.269																																																	0													57.0	55.0	56.0					11																	86097108		2202	4297	6499	SO:0001583	missense	0			AK131331	CCDS8276.1, CCDS53691.1	11q14.2	2006-03-09			ENSG00000149201	ENSG00000149201			26281	protein-coding gene	gene with protein product							Standard	NM_001156474		Approved	FLJ16339, FLJ23514	uc001pbx.2	Q6ZN84	OTTHUMG00000167213	ENST00000445632.2:c.95G>T	11.37:g.86097108G>T	ENSP00000415528:p.Trp32Leu		A0AVL7|Q53FW3|Q9H5E5	Missense_Mutation	SNP	superfamily_IHF-like_DNA-bd_dom	p.W32L	ENST00000445632.2	37	c.95	CCDS53691.1	11	.	.	.	.	.	.	.	.	.	.	G	15.67	2.903474	0.52333	.	.	ENSG00000149201	ENST00000354755;ENST00000531271;ENST00000445632	T;T	0.79845	-1.31;-0.52	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.88706	0.6509	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.994	D	0.87931	0.2710	9	.	.	.	-11.1967	18.0136	0.89232	0.0:0.0:1.0:0.0	.	32;32	Q6ZN84;Q6ZN84-2	CCD81_HUMAN;.	L	32	ENSP00000346800:W32L;ENSP00000415528:W32L	.	W	+	2	0	CCDC81	85774756	1.000000	0.71417	0.949000	0.38748	0.085000	0.17905	5.293000	0.65680	2.609000	0.88269	0.655000	0.94253	TGG	CCDC81	-	superfamily_IHF-like_DNA-bd_dom	ENSG00000149201		0.269	CCDC81-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC81	HGNC	protein_coding	OTTHUMT00000393756.1	-	0.00	88	0	G	NM_021827		86097108	+1	tier1	-	no_errors	ENST00000445632	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
CCR3	1232	genome.wustl.edu	37	3	46306820	46306820	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:46306820G>T	ENST00000357422.2	+	4	714	c.171G>T	c.(169-171)atG>atT	p.M57I	CCR3_ENST00000395940.2_Missense_Mutation_p.M57I|CCR3_ENST00000395942.2_Missense_Mutation_p.M57I|CCR3_ENST00000541018.1_Missense_Mutation_p.M57I|CCR3_ENST00000545097.1_Missense_Mutation_p.M78I			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	57					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		TGGTGGTGATGATCCTCATAA	0.527																																																	0													157.0	127.0	137.0					3																	46306820		2203	4300	6503	SO:0001583	missense	0			AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.171G>T	3.37:g.46306820G>T	ENSP00000350003:p.Met57Ile		B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CCR3,prints_Chemokine_CCR1	p.M78I	ENST00000357422.2	37	c.234	CCDS2738.1	3	.	.	.	.	.	.	.	.	.	.	G	11.62	1.691682	0.30052	.	.	ENSG00000183625	ENST00000357422;ENST00000545097;ENST00000541018;ENST00000395940;ENST00000452454;ENST00000395942	T;T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37;1.37	6.07	6.07	0.98685	GPCR, rhodopsin-like superfamily (1);	0.709898	0.12482	N	0.465030	T	0.19765	0.0475	N	0.02129	-0.67	0.25280	N	0.989443	B;B;B;B	0.12630	0.006;0.004;0.004;0.002	B;B;B;B	0.15052	0.004;0.001;0.01;0.012	T	0.23547	-1.0185	10	0.52906	T	0.07	.	16.051	0.80763	0.0:0.1333:0.8667:0.0	.	57;57;78;57	Q8TDP5;Q8TDP6;F5GWL6;P51677	.;.;.;CCR3_HUMAN	I	57;78;57;57;57;57	ENSP00000350003:M57I;ENSP00000441600:M78I;ENSP00000440097:M57I;ENSP00000379271:M57I;ENSP00000389336:M57I;ENSP00000379273:M57I	ENSP00000350003:M57I	M	+	3	0	CCR3	46281824	1.000000	0.71417	0.959000	0.39883	0.393000	0.30537	1.452000	0.35156	2.884000	0.98904	0.655000	0.94253	ATG	CCR3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000183625		0.527	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR3	HGNC	protein_coding	OTTHUMT00000257380.2		0.00	40	0	G			46306820	+1			no_errors	ENST00000545097	ensembl	human	known	74_37	missense	5.71	32	2	SNP	0.998	T
CD1C	911	genome.wustl.edu	37	1	158262075	158262075	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:158262075T>A	ENST00000368170.3	+	3	809	c.530T>A	c.(529-531)gTg>gAg	p.V177E		NM_001765.2	NP_001756.2	P29017	CD1C_HUMAN	CD1c molecule	177					antigen processing and presentation (GO:0019882)|T cell activation involved in immune response (GO:0002286)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	endogenous lipid antigen binding (GO:0030883)|exogenous lipid antigen binding (GO:0030884)|glycolipid binding (GO:0051861)|lipopeptide binding (GO:0071723)			NS(1)|endometrium(3)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	39	all_hematologic(112;0.0378)					ACAGAAACAGTGTATAATCTC	0.473																																																	0													292.0	292.0	292.0					1																	158262075		2203	4300	6503	SO:0001583	missense	0			M28827	CCDS1175.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158481	ENSG00000158481		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1636	protein-coding gene	gene with protein product		188340	"""CD1C antigen, c polypeptide"", ""CD1c antigen"""	CD1		2447586	Standard	NM_001765		Approved		uc001fru.3	P29017	OTTHUMG00000017514	ENST00000368170.3:c.530T>A	1.37:g.158262075T>A	ENSP00000357152:p.Val177Glu		Q5TDJ7|Q6IAS4|Q9UMM0|Q9UN96	Missense_Mutation	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.V177E	ENST00000368170.3	37	c.530	CCDS1175.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	9.318|9.318	1.057360|1.057360	0.19907|0.19907	.|.	.|.	ENSG00000158481|ENSG00000158481	ENST00000443761|ENST00000368169;ENST00000368170	.|T	.|0.17691	.|2.26	3.36|3.36	-1.76|-1.76	0.08006|0.08006	.|MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.|0.521986	.|0.14328	.|N	.|0.326564	T|T	0.07638|0.07638	0.0192|0.0192	M|M	0.83223|0.83223	2.63|2.63	0.09310|0.09310	N|N	1|1	.|B	.|0.34329	.|0.449	.|B	.|0.27076	.|0.076	T|T	0.14783|0.14783	-1.0460|-1.0460	5|10	.|0.87932	.|D	.|0	.|.	7.3382|7.3382	0.26621|0.26621	0.0:0.4748:0.0:0.5252|0.0:0.4748:0.0:0.5252	.|.	.|177	.|P29017	.|CD1C_HUMAN	R|E	111|177	.|ENSP00000357152:V177E	.|ENSP00000357151:V177E	S|V	+|+	3|2	2|0	CD1C|CD1C	156528699|156528699	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	0.443000|0.443000	0.21644|0.21644	-0.362000|-0.362000	0.08113|0.08113	-0.923000|-0.923000	0.02734|0.02734	AGT|GTG	CD1C	-	superfamily_MHC_I/II-like_Ag-recog	ENSG00000158481		0.473	CD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD1C	HGNC	protein_coding	OTTHUMT00000046351.2	-	0.00	43	0	T	NM_001765		158262075	+1	tier1	-	no_errors	ENST00000368170	ensembl	human	known	74_37	missense	29.27	29	12	SNP	0.000	A
CD300A	11314	genome.wustl.edu	37	17	72462866	72462866	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr17:72462866G>T	ENST00000360141.3	+	1	312	c.24G>T	c.(22-24)ttG>ttT	p.L8F	CD300A_ENST00000310828.5_Missense_Mutation_p.L8F|CD300A_ENST00000577511.1_5'Flank|CD300A_ENST00000361933.3_Missense_Mutation_p.L8F|CD300A_ENST00000392625.3_Missense_Mutation_p.L8F	NM_001256841.1|NM_007261.3	NP_001243770.1|NP_009192.2	Q9UGN4	CLM8_HUMAN	CD300a molecule	8					cell adhesion (GO:0007155)|immune system process (GO:0002376)|negative regulation of activation of JAK2 kinase activity (GO:1902569)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of eosinophil activation (GO:1902567)|negative regulation of eosinophil migration (GO:2000417)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell activation involved in immune response (GO:0033007)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of neutrophil activation (GO:1902564)|negative regulation of NK T cell activation (GO:0051134)|negative regulation of phagocytosis, engulfment (GO:0060101)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|regulation of T cell receptor signaling pathway (GO:0050856)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)|signaling receptor activity (GO:0038023)			breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|skin(4)|urinary_tract(1)	16						GGGCTCTGTTGCTTCTCTGGG	0.657																																																	0													110.0	71.0	84.0					17																	72462866		2201	4298	6499	SO:0001583	missense	0			BC032352	CCDS32720.1, CCDS58590.1	17q25.2	2013-01-11	2006-03-28		ENSG00000167851	ENSG00000167851		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19319	protein-coding gene	gene with protein product		606790	"""CD300a antigen"""			9701027, 10746781	Standard	NM_007261		Approved	Irp60, CMRF35H, CMRF-35-H9, IRC1, IRC2, IGSF12	uc002jkv.4	Q9UGN4	OTTHUMG00000067612	ENST00000360141.3:c.24G>T	17.37:g.72462866G>T	ENSP00000353259:p.Leu8Phe		A8MW96|O95100|Q9HD97|Q9P0F3|Q9UBK4|Q9UMS9|Q9UMT0	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.L8F	ENST00000360141.3	37	c.24	CCDS32720.1	17	.	.	.	.	.	.	.	.	.	.	g	14.88	2.668563	0.47677	.	.	ENSG00000167851	ENST00000361933;ENST00000360141;ENST00000392625;ENST00000310828	T;T	0.59638	3.29;0.25	4.84	3.81	0.43845	.	0.722105	0.10721	U	0.641771	T	0.73410	0.3583	M	0.66378	2.025	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.996;0.998;0.984	T	0.71869	-0.4462	10	0.72032	D	0.01	.	11.626	0.51145	0.0:0.1803:0.8197:0.0	.	8;8;8;8	Q9UGN4-3;Q9UGN4-4;Q9UGN4-2;Q9UGN4	.;.;.;CLM8_HUMAN	F	8	ENSP00000353259:L8F;ENSP00000308188:L8F	ENSP00000308188:L8F	L	+	3	2	CD300A	69974461	0.990000	0.36364	1.000000	0.80357	0.845000	0.48019	0.796000	0.26986	2.391000	0.81399	0.651000	0.88453	TTG	CD300A	-	NULL	ENSG00000167851		0.657	CD300A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD300A	HGNC	protein_coding	OTTHUMT00000145091.1	-	0.00	76	0	G	NM_007261		72462866	+1	tier1	-	no_errors	ENST00000360141	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
CDH10	1008	genome.wustl.edu	37	5	24498600	24498600	+	Silent	SNP	A	A	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:24498600A>C	ENST00000264463.4	-	9	1929	c.1422T>G	c.(1420-1422)gcT>gcG	p.A474A	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	474	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TCACAAAAACAGCCACGCGTG	0.388										HNSCC(23;0.051)																																							0													83.0	83.0	83.0					5																	24498600		2203	4300	6503	SO:0001819	synonymous_variant	0			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1422T>G	5.37:g.24498600A>C			Q9ULB3	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.C429G	ENST00000264463.4	37	c.1285	CCDS3892.1	5																																																																																			CDH10	-	superfamily_Cadherin-like	ENSG00000040731		0.388	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH10	HGNC	protein_coding	OTTHUMT00000207345.2	-	0.00	74	0	A	NM_006727		24498600	-1	tier1	-	no_errors	ENST00000510477	ensembl	human	known	74_37	missense	8.55	106	10	SNP	1.000	C
CDH11	1009	genome.wustl.edu	37	16	65025827	65025827	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr16:65025827T>A	ENST00000268603.4	-	6	1270	c.655A>T	c.(655-657)Aca>Tca	p.T219S	CDH11_ENST00000566827.1_Missense_Mutation_p.T93S|CDH11_ENST00000394156.3_Missense_Mutation_p.T219S	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	219	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GGTAGGGCTGTTCTGATGATA	0.498			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																														Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0													201.0	135.0	157.0					16																	65025827		2203	4300	6503	SO:0001583	missense	0			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.655A>T	16.37:g.65025827T>A	ENSP00000268603:p.Thr219Ser		A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T219S	ENST00000268603.4	37	c.655	CCDS10803.1	16	.	.	.	.	.	.	.	.	.	.	T	22.3	4.271981	0.80469	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.56444	0.46;0.46	5.54	4.44	0.53790	Cadherin (4);Cadherin-like (1);	0.098277	0.64402	D	0.000001	T	0.69931	0.3166	M	0.79475	2.455	0.49130	D	0.999757	P;P	0.52842	0.879;0.956	P;D	0.66602	0.674;0.945	T	0.72401	-0.4305	10	0.87932	D	0	.	11.2271	0.48890	0.1372:0.0:0.0:0.8628	.	219;219	P55287-2;P55287	.;CAD11_HUMAN	S	219;219;202	ENSP00000268603:T219S;ENSP00000377711:T219S	ENSP00000268603:T219S	T	-	1	0	CDH11	63583328	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	5.111000	0.64628	0.907000	0.36646	0.528000	0.53228	ACA	CDH11	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000140937		0.498	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH11	HGNC	protein_coding	OTTHUMT00000268755.1	-	0.00	70	0	T	NM_033664		65025827	-1	tier1	-	no_errors	ENST00000268603	ensembl	human	known	74_37	missense	21.92	57	16	SNP	0.997	A
CDK2	1017	genome.wustl.edu	37	12	56365555	56365555	+	3'UTR	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:56365555G>T	ENST00000266970.4	+	0	1283				CDK2_ENST00000553376.1_3'UTR|RAB5B_ENST00000553116.1_5'Flank|RAB5B_ENST00000360299.5_5'Flank|RAB5B_ENST00000448789.2_5'Flank|CDK2_ENST00000354056.4_3'UTR	NM_001798.3	NP_001789.2	P24941	CDK2_HUMAN	cyclin-dependent kinase 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|blood coagulation (GO:0007596)|cellular response to nitric oxide (GO:0071732)|centrosome duplication (GO:0051298)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|histone phosphorylation (GO:0016572)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transport (GO:0006813)|Ras protein signal transduction (GO:0007265)|regulation of gene silencing (GO:0060968)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	Cajal body (GO:0015030)|centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|condensed chromosome (GO:0000793)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|X chromosome (GO:0000805)|Y chromosome (GO:0000806)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	18			UCEC - Uterine corpus endometrioid carcinoma (6;0.123)|OV - Ovarian serous cystadenocarcinoma(18;0.235)		Bosutinib(DB06616)	GCCAACTCTGGGAATACAGGG	0.507																																																	0																																										SO:0001624	3_prime_UTR_variant	0			M68520	CCDS8898.1, CCDS8899.1	12q13	2011-11-08				ENSG00000123374		"""Cyclin-dependent kinases"""	1771	protein-coding gene	gene with protein product		116953				1717994, 8275715	Standard	NM_001798		Approved		uc001sit.4	P24941		ENST00000266970.4:c.*146G>T	12.37:g.56365555G>T			A8K7C6|O75100	RNA	SNP	-	NULL	ENST00000266970.4	37	NULL	CCDS8898.1	12																																																																																			CDK2	-	-	ENSG00000123374		0.507	CDK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK2	HGNC	protein_coding	OTTHUMT00000409650.1	-	0.00	42	0	G			56365555	+1	tier1	-	no_errors	ENST00000554545	ensembl	human	known	74_37	rna	8.33	44	4	SNP	0.171	T
CDK5RAP2	55755	genome.wustl.edu	37	9	123182069	123182069	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr9:123182069G>C	ENST00000349780.4	-	27	4353	c.4174C>G	c.(4174-4176)Caa>Gaa	p.Q1392E	CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.Q1360E|CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.Q1351E|CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.Q1392E	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1392					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						AGCTTACCTTGAGAAAAACTG	0.373																																																	0													205.0	183.0	191.0					9																	123182069		2203	4300	6503	SO:0001583	missense	0			BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.4174C>G	9.37:g.123182069G>C	ENSP00000343818:p.Gln1392Glu		Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	pfam_Spindle_assoc	p.Q1392E	ENST00000349780.4	37	c.4174	CCDS6823.1	9	.	.	.	.	.	.	.	.	.	.	G	21.2	4.107914	0.77096	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000416449;ENST00000425647;ENST00000345313	T;T;T;T;T;T	0.22539	3.92;3.85;3.93;3.83;2.25;1.95	5.62	5.62	0.85841	.	0.119372	0.38217	N	0.001771	T	0.46658	0.1404	M	0.72118	2.19	0.34373	D	0.692212	D;D;D;D;D;D	0.71674	0.99;0.998;0.994;0.996;0.996;0.994	P;D;P;D;P;D	0.77557	0.848;0.946;0.876;0.99;0.883;0.954	T	0.57871	-0.7736	10	0.52906	T	0.07	.	16.3933	0.83546	0.0:0.0:1.0:0.0	.	402;1161;1360;1392;1392;786	Q5JTU8;Q6MZT4;Q96SN8-2;Q96SN8-4;Q96SN8;B1AMJ5	.;.;.;.;CK5P2_HUMAN;.	E	1360;1351;1392;1392;786;402;1164	ENSP00000354065:Q1360E;ENSP00000352258:Q1351E;ENSP00000343818:Q1392E;ENSP00000353317:Q1392E;ENSP00000400395:Q786E;ENSP00000409941:Q402E	ENSP00000341695:Q1164E	Q	-	1	0	CDK5RAP2	122221890	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.911000	0.69939	2.648000	0.89879	0.655000	0.94253	CAA	CDK5RAP2	-	NULL	ENSG00000136861		0.373	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK5RAP2	HGNC	protein_coding	OTTHUMT00000055535.1	-	0.00	56	0	G	NM_018249		123182069	-1	tier1	-	no_errors	ENST00000349780	ensembl	human	known	74_37	missense	24.56	43	14	SNP	1.000	C
CDKN1A	1026	genome.wustl.edu	37	6	36652260	36652260	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:36652260G>A	ENST00000405375.1	+	2	617	c.382G>A	c.(382-384)Gaa>Aaa	p.E128K	CDKN1A_ENST00000373711.2_Missense_Mutation_p.E128K|CDKN1A_ENST00000478800.1_3'UTR|CDKN1A_ENST00000244741.5_Missense_Mutation_p.E128K|CDKN1A_ENST00000448526.2_Missense_Mutation_p.E162K	NM_001220778.1	NP_001207707.1	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	128					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to ionizing radiation (GO:0071479)|cellular senescence (GO:0090398)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of gene expression (GO:0010629)|negative regulation of phosphorylation (GO:0042326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of DNA biosynthetic process (GO:2000278)|regulation of protein import into nucleus, translocation (GO:0033158)|response to arsenic-containing substance (GO:0046685)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to organonitrogen compound (GO:0010243)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|stress-induced premature senescence (GO:0090400)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA-p21 complex (GO:0070557)	cyclin-dependent protein kinase activating kinase activity (GO:0019912)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|urinary_tract(5)	15						GGAGCAGGCTGAAGGGTCCCC	0.612																																																	0													49.0	50.0	50.0					6																	36652260		2203	4300	6503	SO:0001583	missense	0			U03106	CCDS4824.1	6p21.1	2009-01-21			ENSG00000124762	ENSG00000124762			1784	protein-coding gene	gene with protein product		116899		CDKN1			Standard	NM_000389		Approved	P21, CIP1, WAF1, SDI1, CAP20, p21CIP1, p21Cip1/Waf1	uc021yzb.1	P38936	OTTHUMG00000014603	ENST00000405375.1:c.382G>A	6.37:g.36652260G>A	ENSP00000384849:p.Glu128Lys		Q14010|Q6FI05|Q9BUT4	Missense_Mutation	SNP	pfam_CDI	p.E162K	ENST00000405375.1	37	c.484	CCDS4824.1	6	.	.	.	.	.	.	.	.	.	.	G	15.42	2.828158	0.50845	.	.	ENSG00000124762	ENST00000448526;ENST00000244741;ENST00000405375;ENST00000373711	T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58	5.23	5.23	0.72850	.	0.108901	0.40818	N	0.001012	T	0.61236	0.2331	L	0.49126	1.545	0.26676	N	0.97163	P;P;P	0.52842	0.956;0.884;0.884	P;B;B	0.53146	0.719;0.358;0.358	T	0.55592	-0.8117	10	0.16420	T	0.52	-22.1044	14.1752	0.65537	0.0:0.0:1.0:0.0	.	162;128;128	B4DQP9;P38936;Q96LE1	.;CDN1A_HUMAN;.	K	162;128;128;128	ENSP00000409259:E162K;ENSP00000244741:E128K;ENSP00000384849:E128K;ENSP00000362815:E128K	ENSP00000244741:E128K	E	+	1	0	CDKN1A	36760238	0.531000	0.26338	0.216000	0.23742	0.048000	0.14542	1.124000	0.31320	2.724000	0.93272	0.561000	0.74099	GAA	CDKN1A	-	NULL	ENSG00000124762		0.612	CDKN1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN1A	HGNC	protein_coding	OTTHUMT00000040354.1		0.00	20	0	G	NM_078467		36652260	+1			no_errors	ENST00000448526	ensembl	human	known	74_37	missense	22.22	7	2	SNP	0.319	A
CDS1	1040	genome.wustl.edu	37	4	85525396	85525396	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:85525396G>T	ENST00000295887.5	+	2	541	c.118G>T	c.(118-120)Gaa>Taa	p.E40*		NM_001263.3	NP_001254.2	O96017	CHK2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1	0					cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|ovary(1)	20		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)		TTAATTTTAGGAAACAGATAT	0.363																																																	0													65.0	68.0	67.0					4																	85525396		2203	4300	6503	SO:0001630	splice_region_variant	0			U65887	CCDS3608.1	4q21	2008-02-05			ENSG00000163624	ENSG00000163624	2.7.7.41		1800	protein-coding gene	gene with protein product		603548				9806839, 9115637	Standard	NM_001263		Approved		uc011ccv.2	Q92903	OTTHUMG00000130428	ENST00000295887.5:c.118-1G>T	4.37:g.85525396G>T			A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Nonsense_Mutation	SNP	pfam_PC_trans,pirsf_PC_Trfase_euk	p.E40*	ENST00000295887.5	37	c.118	CCDS3608.1	4	.	.	.	.	.	.	.	.	.	.	G	39	7.754605	0.98471	.	.	ENSG00000163624	ENST00000295887	.	.	.	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-20.2526	18.266	0.90052	0.0:0.0:1.0:0.0	.	.	.	.	X	40	.	.	E	+	1	0	CDS1	85744420	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.715000	0.74697	2.693000	0.91896	0.655000	0.94253	GAA	CDS1	-	pirsf_PC_Trfase_euk	ENSG00000163624		0.363	CDS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDS1	HGNC	protein_coding	OTTHUMT00000252817.2	-	0.00	55	0	G		Nonsense_Mutation	85525396	+1	tier1	-	no_errors	ENST00000295887	ensembl	human	known	74_37	nonsense	6.15	61	4	SNP	1.000	T
CENPH	64946	genome.wustl.edu	37	5	68491608	68491608	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:68491608G>T	ENST00000283006.2	+	4	391	c.304G>T	c.(304-306)Gca>Tca	p.A102S	CENPH_ENST00000515001.1_Missense_Mutation_p.A102S	NM_022909.3	NP_075060.1			centromere protein H											kidney(15)|large_intestine(2)|lung(3)	20		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.41e-56)|Epithelial(20;1.29e-52)|all cancers(19;3.15e-48)|Lung(70;0.0178)		AAAAAAGCTTGCATTAGACAG	0.333																																																	0													32.0	33.0	33.0					5																	68491608		2197	4292	6489	SO:0001583	missense	0			AB035124	CCDS3998.1	5p15.2	2013-11-05			ENSG00000153044	ENSG00000153044			17268	protein-coding gene	gene with protein product		605607				11092768, 15502821	Standard	NM_022909		Approved		uc003jvp.3	Q9H3R5	OTTHUMG00000097816	ENST00000283006.2:c.304G>T	5.37:g.68491608G>T	ENSP00000283006:p.Ala102Ser			Missense_Mutation	SNP	pfam_CENP-H	p.A102S	ENST00000283006.2	37	c.304	CCDS3998.1	5	.	.	.	.	.	.	.	.	.	.	G	12.99	2.104200	0.37145	.	.	ENSG00000153044	ENST00000283006;ENST00000515001	.	.	.	4.72	2.01	0.26516	.	0.416073	0.23091	N	0.052028	T	0.41858	0.1177	L	0.32530	0.975	0.23156	N	0.998207	D;D	0.89917	0.996;1.0	D;D	0.71184	0.935;0.972	T	0.12142	-1.0559	9	0.66056	D	0.02	-15.0048	6.5877	0.22630	0.2904:0.0:0.7096:0.0	.	102;102	B3KVZ3;Q9H3R5	.;CENPH_HUMAN	S	102	.	ENSP00000283006:A102S	A	+	1	0	CENPH	68527364	1.000000	0.71417	0.907000	0.35723	0.241000	0.25554	2.761000	0.47589	0.476000	0.27440	-0.150000	0.13652	GCA	CENPH	-	NULL	ENSG00000153044		0.333	CENPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPH	HGNC	protein_coding	OTTHUMT00000215083.1		0.00	98	0	G			68491608	+1			no_errors	ENST00000283006	ensembl	human	known	74_37	missense	5.15	92	5	SNP	0.934	T
CHCHD2	51142	genome.wustl.edu	37	7	56170694	56170694	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr7:56170694C>T	ENST00000395422.3	-	3	473	c.311G>A	c.(310-312)gGa>gAa	p.G104E	snoU13_ENST00000458988.1_RNA	NM_016139.2	NP_057223.1	Q9Y6H1	CHCH2_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 2	104						mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(3)	5	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TGGCTGGGTTCCCTGAGGCTC	0.473																																																	0													54.0	50.0	51.0					7																	56170694		2203	4300	6503	SO:0001583	missense	0			AF078845	CCDS5526.1	7p11.2	2014-07-14	2004-01-19	2004-01-21	ENSG00000106153	ENSG00000106153		"""Coiled-coil-helix-coiled-coil-helix domain containing"""	21645	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 17"""	C7orf17		23303788	Standard	NM_016139		Approved		uc003tsa.3	Q9Y6H1	OTTHUMG00000129429	ENST00000395422.3:c.311G>A	7.37:g.56170694C>T	ENSP00000378812:p.Gly104Glu		Q498C3|Q6NZ50	Missense_Mutation	SNP	pfam_CHCH	p.G104E	ENST00000395422.3	37	c.311	CCDS5526.1	7	.	.	.	.	.	.	.	.	.	.	C	5.170	0.216874	0.09810	.	.	ENSG00000106153	ENST00000395422	T	0.42131	0.98	5.45	4.57	0.56435	.	0.337859	0.32161	N	0.006486	T	0.29817	0.0745	L	0.45698	1.435	0.36549	D	0.871712	P	0.35124	0.485	B	0.35859	0.212	T	0.23511	-1.0186	10	0.02654	T	1	.	8.1847	0.31333	0.0:0.7438:0.1699:0.0863	.	104	Q9Y6H1	CHCH2_HUMAN	E	104	ENSP00000378812:G104E	ENSP00000378812:G104E	G	-	2	0	CHCHD2	56138188	0.988000	0.35896	0.975000	0.42487	0.144000	0.21451	2.431000	0.44775	1.294000	0.44707	0.557000	0.71058	GGA	CHCHD2	-	NULL	ENSG00000106153		0.473	CHCHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHCHD2	HGNC	protein_coding	OTTHUMT00000251589.1	-	0.00	44	0	C	NM_016139		56170694	-1	tier1	-	no_errors	ENST00000395422	ensembl	human	known	74_37	missense	18.75	39	9	SNP	0.943	T
CHD5	26038	genome.wustl.edu	37	1	6188558	6188558	+	Splice_Site	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:6188558C>T	ENST00000262450.3	-	24	3830		c.e24+1		CHD5_ENST00000378021.1_Splice_Site	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5						tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TTGGCCCCTACCTGGCGGGGT	0.662																																																	0													45.0	50.0	49.0					1																	6188558		2203	4300	6503	SO:0001630	splice_region_variant	0			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.3730+1G>A	1.37:g.6188558C>T			A8KAP8|A8MQ44|D3DSH9|O60740	Splice_Site	SNP	-	e24+1	ENST00000262450.3	37	c.3730+1	CCDS57.1	1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.557837	0.45590	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000378021;ENST00000536802;ENST00000538279;ENST00000377999	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2441	0.73493	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CHD5	6111145	1.000000	0.71417	0.998000	0.56505	0.461000	0.32589	4.923000	0.63412	2.265000	0.75225	0.462000	0.41574	.	CHD5	-	-	ENSG00000116254		0.662	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	-	0.00	84	0	C	NM_015557	Intron	6188558	-1	tier1	-	no_errors	ENST00000262450	ensembl	human	known	74_37	splice_site	6.78	55	4	SNP	1.000	T
CHD9	80205	genome.wustl.edu	37	16	53243720	53243720	+	Missense_Mutation	SNP	A	A	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr16:53243720A>C	ENST00000398510.3	+	2	1866	c.1779A>C	c.(1777-1779)aaA>aaC	p.K593N	CHD9_ENST00000447540.1_Missense_Mutation_p.K593N|CHD9_ENST00000566029.1_Missense_Mutation_p.K593N|CHD9_ENST00000564845.1_Missense_Mutation_p.K593N			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	593	Lys-rich.				cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				AGAAGACAAAAATTGGGTAAG	0.308																																																	0													14.0	13.0	13.0					16																	53243720		1797	4064	5861	SO:0001583	missense	0			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.1779A>C	16.37:g.53243720A>C	ENSP00000381522:p.Lys593Asn		B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.K593N	ENST00000398510.3	37	c.1779		16	.	.	.	.	.	.	.	.	.	.	A	15.65	2.896874	0.52121	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000219084	T;T	0.74315	-0.83;-0.83	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000006	D	0.83622	0.5294	M	0.71581	2.175	0.52099	D	0.999948	P;D;D;D;D	0.89917	0.745;0.97;0.993;1.0;0.996	B;P;P;D;P	0.83275	0.209;0.894;0.738;0.996;0.866	D	0.83894	0.0286	10	0.46703	T	0.11	-24.4743	10.4282	0.44391	0.9276:0.0:0.0724:0.0	.	119;593;593;593;593	B4DR07;Q3L8U1-3;Q3L8U1;Q8NAR9;Q3L8U1-2	.;.;CHD9_HUMAN;.;.	N	593;593;119	ENSP00000396345:K593N;ENSP00000381522:K593N	ENSP00000219084:K119N	K	+	3	2	CHD9	51801221	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.734000	0.62043	2.202000	0.70862	0.533000	0.62120	AAA	CHD9	-	NULL	ENSG00000177200		0.308	CHD9-020	KNOWN	basic	protein_coding	CHD9	HGNC	protein_coding	OTTHUMT00000422345.1	-	0.00	12	0	A	NM_025134		53243720	+1	tier1	-	no_errors	ENST00000398510	ensembl	human	known	74_37	missense	45.45	6	5	SNP	1.000	C
CHIA	27159	genome.wustl.edu	37	1	111860635	111860635	+	Silent	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:111860635C>A	ENST00000369740.1	+	8	736	c.633C>A	c.(631-633)acC>acA	p.T211T	RP5-1125M8.2_ENST00000426321.1_RNA|CHIA_ENST00000343320.6_Silent_p.T211T|CHIA_ENST00000451398.2_Silent_p.T50T|CHIA_ENST00000353665.6_Silent_p.T50T|CHIA_ENST00000483391.1_Silent_p.T50T|CHIA_ENST00000430615.1_Silent_p.T103T	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	211	Chitooligosaccharide binding. {ECO:0000305}.				apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)	p.T103T(1)|p.T211T(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		ATGTCATGACCTACGACCTCC	0.537																																																	2	Substitution - coding silent(2)	endometrium(2)											98.0	91.0	93.0					1																	111860635		2203	4300	6503	SO:0001819	synonymous_variant	0			AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.633C>A	1.37:g.111860635C>A			Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Silent	SNP	pfam_Glyco_hydro18cat,pfam_Chitin-bd_dom,superfamily_Glycoside_hydrolase_SF,superfamily_Chitin-bd_dom,smart_Chitinase_II,smart_Chitin-bd_dom,pfscan_Chitin-bd_dom	p.T211	ENST00000369740.1	37	c.633	CCDS41368.1	1																																																																																			CHIA	-	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	ENSG00000134216		0.537	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHIA	HGNC	protein_coding	OTTHUMT00000030710.1		0.00	53	0	C			111860635	+1			no_errors	ENST00000343320	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.999	A
CNDP2	55748	genome.wustl.edu	37	18	72186240	72186240	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr18:72186240A>G	ENST00000324262.4	+	11	1583	c.1267A>G	c.(1267-1269)Acc>Gcc	p.T423A	CNDP2_ENST00000324301.8_Missense_Mutation_p.T339A|CNDP2_ENST00000579847.1_Missense_Mutation_p.T423A	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	423					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		CGTGACCTTGACCTTTCAGGA	0.547																																																	0													93.0	96.0	95.0					18																	72186240		2203	4300	6503	SO:0001583	missense	0			AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.1267A>G	18.37:g.72186240A>G	ENSP00000325548:p.Thr423Ala		B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	Missense_Mutation	SNP	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,superfamily_Peptidase_M20_dimer,pirsf_GSH_degradosome_DUG1	p.T423A	ENST00000324262.4	37	c.1267	CCDS12006.1	18	.	.	.	.	.	.	.	.	.	.	A	17.57	3.423606	0.62733	.	.	ENSG00000133313	ENST00000324262;ENST00000324301	T;T	0.07908	3.15;3.15	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.15955	0.0384	M	0.71920	2.185	0.80722	D	1	B;B	0.23058	0.079;0.035	B;B	0.33196	0.159;0.046	T	0.01776	-1.1276	10	0.41790	T	0.15	-11.4355	15.4304	0.75092	1.0:0.0:0.0:0.0	.	339;423	Q96KP4-2;Q96KP4	.;CNDP2_HUMAN	A	423;339	ENSP00000325548:T423A;ENSP00000325756:T339A	ENSP00000325548:T423A	T	+	1	0	CNDP2	70337220	1.000000	0.71417	0.744000	0.31058	0.981000	0.71138	7.474000	0.81024	2.054000	0.61138	0.528000	0.53228	ACC	CNDP2	-	pfam_Peptidase_M20,pirsf_GSH_degradosome_DUG1	ENSG00000133313		0.547	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNDP2	HGNC	protein_coding	OTTHUMT00000256327.1	-	0.00	61	0	A	NM_018235		72186240	+1	tier1	-	no_errors	ENST00000324262	ensembl	human	known	74_37	missense	20.00	28	7	SNP	0.998	G
CNKSR3	154043	genome.wustl.edu	37	6	154727685	154727685	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:154727685G>A	ENST00000607772.1	-	13	2015	c.1471C>T	c.(1471-1473)Cgg>Tgg	p.R491W	CNKSR3_ENST00000433165.2_Missense_Mutation_p.R316W|CNKSR3_ENST00000479339.1_Missense_Mutation_p.R411W	NM_173515.2	NP_775786.2	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	491	DUF1170.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	15		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		ACCAGATGCCGCTCGGTCGTG	0.582																																																	0													91.0	87.0	88.0					6																	154727685		2203	4300	6503	SO:0001583	missense	0			AK055911	CCDS5246.1	6q25.2	2013-01-10	2005-04-11	2005-04-11	ENSG00000153721	ENSG00000153721		"""Sterile alpha motif (SAM) domain containing"""	23034	protein-coding gene	gene with protein product			"""membrane associated guanylate kinase interacting protein-like 1"""	MAGI1			Standard	NM_173515		Approved	FLJ31349		Q6P9H4	OTTHUMG00000015873	ENST00000607772.1:c.1471C>T	6.37:g.154727685G>A	ENSP00000475915:p.Arg491Trp		Q5SGD5|Q96N65	Missense_Mutation	SNP	pfam_CNKSR2,pfam_CRIC_domain_Chordata,pfam_SAM_type1,pfam_SAM_2,pfam_PDZ,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_PDZ,pfscan_PDZ,pfscan_SAM	p.R491W	ENST00000607772.1	37	c.1471	CCDS5246.1	6	.	.	.	.	.	.	.	.	.	.	G	21.7	4.180705	0.78677	.	.	ENSG00000153721	ENST00000367213;ENST00000433165;ENST00000479339	T;T;T	0.55234	1.14;0.53;0.54	4.93	-1.21	0.09524	Connector enhancer of kinase suppressor of ras 2 (1);	0.211412	0.40222	N	0.001153	T	0.55768	0.1941	M	0.62723	1.935	0.29466	N	0.857397	D	0.76494	0.999	D	0.68353	0.957	T	0.65660	-0.6114	10	0.87932	D	0	.	17.9622	0.89089	0.0:0.0:0.205:0.795	.	491	Q6P9H4	CNKR3_HUMAN	W	491;316;411	ENSP00000356182:R491W;ENSP00000414185:R316W;ENSP00000418975:R411W	ENSP00000356182:R491W	R	-	1	2	CNKSR3	154769377	0.982000	0.34865	0.945000	0.38365	0.990000	0.78478	0.465000	0.22004	-0.509000	0.06532	0.655000	0.94253	CGG	CNKSR3	-	pfam_CNKSR2	ENSG00000153721		0.582	CNKSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNKSR3	HGNC	protein_coding	OTTHUMT00000042792.2	-	0.00	52	0	G	NM_173515		154727685	-1	tier1	-	no_errors	ENST00000607772	ensembl	human	known	74_37	missense	21.74	36	10	SNP	0.988	A
CNOT1	23019	genome.wustl.edu	37	16	58577315	58577316	+	Intron	INS	-	-	A	rs192650861|rs74558612|rs201890659|rs5817153	byFrequency	TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr16:58577315_58577316insA	ENST00000317147.5	-	31	4767				CNOT1_ENST00000569240.1_Intron|CNOT1_ENST00000441024.2_Frame_Shift_Ins_p.L1544fs|CNOT1_ENST00000245138.4_Intron	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		gaatataacagaaaaaaaaaaa	0.277																																																	0																																										SO:0001627	intron_variant	0			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.4434+194->T	16.37:g.58577326_58577326dupA			Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Frame_Shift_Ins	INS	superfamily_ARM-type_fold	p.L1543fs	ENST00000317147.5	37	c.4630_4629	CCDS10799.1	16																																																																																			CNOT1	-	NULL	ENSG00000125107		0.277	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3		0.00	39	0	-	NM_016284		58577316	-1	tier1		no_errors	ENST00000441024	ensembl	human	known	74_37	frame_shift_ins	6.52	43	3	INS	0.004:0.000	A
CNTN6	27255	genome.wustl.edu	37	3	1367589	1367589	+	Missense_Mutation	SNP	A	A	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:1367589A>T	ENST00000446702.2	+	9	1664	c.1037A>T	c.(1036-1038)aAc>aTc	p.N346I	CNTN6_ENST00000350110.2_Missense_Mutation_p.N346I|CNTN6_ENST00000539053.1_Missense_Mutation_p.N274I			Q9UQ52	CNTN6_HUMAN	contactin 6	346	Ig-like C2-type 4.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GGAAAGCCAAACCCTTGGTAT	0.378																																																	0													122.0	115.0	117.0					3																	1367589		2203	4300	6503	SO:0001583	missense	0			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.1037A>T	3.37:g.1367589A>T	ENSP00000407822:p.Asn346Ile		Q2KHM2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.N346I	ENST00000446702.2	37	c.1037	CCDS2557.1	3	.	.	.	.	.	.	.	.	.	.	A	5.998	0.368012	0.11352	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.67698	-0.28;-0.28;-0.28	5.26	-8.6	0.00889	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.867540	0.02514	N	0.091874	T	0.37839	0.1018	N	0.04063	-0.285	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.23368	-1.0190	10	0.38643	T	0.18	.	6.1381	0.20245	0.0963:0.2605:0.4792:0.1641	.	346	Q9UQ52	CNTN6_HUMAN	I	346;274;346	ENSP00000407822:N346I;ENSP00000442791:N274I;ENSP00000341882:N346I	ENSP00000341882:N346I	N	+	2	0	CNTN6	1342589	0.000000	0.05858	0.000000	0.03702	0.366000	0.29705	-0.832000	0.04400	-1.041000	0.03266	-0.321000	0.08615	AAC	CNTN6	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000134115		0.378	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2	-	0.00	35	0	A	NM_014461		1367589	+1	tier1	-	no_errors	ENST00000350110	ensembl	human	known	74_37	missense	20.00	32	8	SNP	0.000	T
CNTRL	11064	genome.wustl.edu	37	9	123903795	123903795	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr9:123903795C>T	ENST00000373855.1	+	18	2880	c.2620C>T	c.(2620-2622)Ctg>Ttg	p.L874L	CNTRL_ENST00000373847.1_Silent_p.L322L|CNTRL_ENST00000373850.1_Silent_p.L322L|CNTRL_ENST00000238341.5_Silent_p.L874L			Q7Z7A1	CNTRL_HUMAN	centriolin	874					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						AGAAATGGCTCTGCAGCAAGA	0.478																																																	0													64.0	64.0	64.0					9																	123903795		2203	4300	6503	SO:0001819	synonymous_variant	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.2620C>T	9.37:g.123903795C>T			A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Silent	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.L874	ENST00000373855.1	37	c.2620	CCDS35118.1	9																																																																																			CNTRL	-	superfamily_Prefoldin	ENSG00000119397		0.478	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	-	0.00	51	0	C	NM_007018		123903795	+1	tier1	-	no_errors	ENST00000238341	ensembl	human	known	74_37	silent	16.36	46	9	SNP	1.000	T
COL11A1	1301	genome.wustl.edu	37	1	103379194	103379194	+	Splice_Site	SNP	G	G	T	rs528959090		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:103379194G>T	ENST00000370096.3	-	53	4343	c.4031C>A	c.(4030-4032)cCg>cAg	p.P1344Q	COL11A1_ENST00000353414.4_Splice_Site_p.P1305Q|COL11A1_ENST00000512756.1_Splice_Site_p.P1228Q|COL11A1_ENST00000358392.2_Splice_Site_p.P1356Q	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1344	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTTACTCACCGGTTGACCAGG	0.343																																																	0													124.0	123.0	124.0					1																	103379194		2203	4300	6503	SO:0001630	splice_region_variant	0			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4032+1C>A	1.37:g.103379194G>T			B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.P1356Q	ENST00000370096.3	37	c.4067	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.855279	0.32791	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.93247	-3.19;-3.19;-3.19;-3.19	5.31	4.37	0.52481	.	0.062065	0.64402	N	0.000003	D	0.92371	0.7579	L	0.37897	1.145	0.80722	D	1	B;B;P;B;B	0.46912	0.028;0.047;0.886;0.028;0.027	B;B;P;B;B	0.61070	0.017;0.039;0.883;0.017;0.039	D	0.93574	0.6906	10	0.87932	D	0	.	14.0986	0.65039	0.0:0.0:0.8484:0.1516	.	1228;1305;1356;1344;564	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	Q	1344;1356;1305;564;1228	ENSP00000359114:P1344Q;ENSP00000351163:P1356Q;ENSP00000302551:P1305Q;ENSP00000426533:P1228Q	ENSP00000302551:P1305Q	P	-	2	0	COL11A1	103151782	1.000000	0.71417	0.987000	0.45799	0.103000	0.19146	6.029000	0.70895	1.188000	0.43014	0.585000	0.79938	CCG	COL11A1	-	NULL	ENSG00000060718		0.343	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1	-	0.00	74	0	G	NM_080630	Missense_Mutation	103379194	-1	tier1	-	no_errors	ENST00000358392	ensembl	human	known	74_37	missense	18.97	46	11	SNP	1.000	T
COL12A1	1303	genome.wustl.edu	37	6	75890711	75890711	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:75890711G>A	ENST00000322507.8	-	11	2417	c.2108C>T	c.(2107-2109)gCg>gTg	p.A703V	COL12A1_ENST00000416123.2_Missense_Mutation_p.A703V|COL12A1_ENST00000483888.2_Missense_Mutation_p.A703V|COL12A1_ENST00000345356.6_Intron	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	703	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CTCATACTCCGCAGTCACATT	0.502																																																	0													124.0	125.0	125.0					6																	75890711		2026	4173	6199	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.2108C>T	6.37:g.75890711G>A	ENSP00000325146:p.Ala703Val		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.A703V	ENST00000322507.8	37	c.2108	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	G	28.4	4.913587	0.92178	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.68624	-0.34;-0.34;-0.34	5.98	5.98	0.97165	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	T	0.82116	0.4967	M	0.88979	2.995	0.58432	D	0.999998	D;D	0.69078	0.997;0.997	P;P	0.60949	0.881;0.871	D	0.84394	0.0556	10	0.87932	D	0	.	20.4581	0.99154	0.0:0.0:1.0:0.0	.	703;703	D6RGG3;Q99715	.;COCA1_HUMAN	V	703	ENSP00000325146:A703V;ENSP00000412864:A703V;ENSP00000421216:A703V	ENSP00000325146:A703V	A	-	2	0	COL12A1	75947431	1.000000	0.71417	0.825000	0.32803	0.575000	0.36095	9.294000	0.96088	2.835000	0.97688	0.650000	0.86243	GCG	COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.502	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	-	0.00	50	0	G	NM_004370		75890711	-1	tier1	-	no_errors	ENST00000322507	ensembl	human	known	74_37	missense	15.69	43	8	SNP	0.999	A
COL17A1	1308	genome.wustl.edu	37	10	105830296	105830296	+	Silent	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:105830296G>C	ENST00000353479.5	-	9	785	c.495C>G	c.(493-495)ctC>ctG	p.L165L	COL17A1_ENST00000393211.3_Silent_p.L165L|COL17A1_ENST00000369733.3_Silent_p.L165L	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	165	Necessary for interaction with DST and for the recruitment of DST to hemidesmosome.|Nonhelical region (NC16).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GACTCCCCTTGAGCAAACGCT	0.517																																																	0													148.0	137.0	141.0					10																	105830296		2203	4300	6503	SO:0001819	synonymous_variant	0			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.495C>G	10.37:g.105830296G>C			Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Silent	SNP	pfam_Collagen	p.L165	ENST00000353479.5	37	c.495	CCDS7554.1	10																																																																																			COL17A1	-	NULL	ENSG00000065618		0.517	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	HGNC	protein_coding	OTTHUMT00000050181.1	-	0.00	70	0	G	NM_130778, NM_000494		105830296	-1	tier1	-	no_errors	ENST00000353479	ensembl	human	known	74_37	silent	17.50	66	14	SNP	1.000	C
COL19A1	1310	genome.wustl.edu	37	6	70916656	70916656	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:70916656G>T	ENST00000322773.4	+	50	3377	c.3275G>T	c.(3274-3276)gGg>gTg	p.G1092V	COL19A1_ENST00000393344.1_Missense_Mutation_p.G714V	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	1092	Triple-helical region 6 (COL6).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						GGGCTGCCAGGGAGTCCAGGT	0.458																																																	0													83.0	80.0	81.0					6																	70916656		2203	4300	6503	SO:0001583	missense	0				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.3275G>T	6.37:g.70916656G>T	ENSP00000316030:p.Gly1092Val		Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.G1092V	ENST00000322773.4	37	c.3275	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	G	15.48	2.845402	0.51164	.	.	ENSG00000082293	ENST00000322773;ENST00000393344	D;D	0.99637	-6.29;-6.29	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.99837	0.9926	H	0.97440	4.005	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96963	0.9703	10	0.87932	D	0	.	18.1731	0.89753	0.0:0.0:1.0:0.0	.	1092	Q14993	COJA1_HUMAN	V	1092;714	ENSP00000316030:G1092V;ENSP00000377013:G714V	ENSP00000316030:G1092V	G	+	2	0	COL19A1	70973377	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	6.382000	0.73167	2.729000	0.93468	0.467000	0.42956	GGG	COL19A1	-	NULL	ENSG00000082293		0.458	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	HGNC	protein_coding	OTTHUMT00000041127.1	-	0.00	68	0	G			70916656	+1	tier1	-	no_errors	ENST00000322773	ensembl	human	known	74_37	missense	16.00	63	12	SNP	1.000	T
COL3A1	1281	genome.wustl.edu	37	2	189861937	189861937	+	Missense_Mutation	SNP	G	G	T	rs587779477		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:189861937G>T	ENST00000304636.3	+	25	1978	c.1808G>T	c.(1807-1809)gGc>gTc	p.G603V	COL3A1_ENST00000317840.5_Missense_Mutation_p.G603V	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	603	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	GGAGGACCTGGCCCTCAGGTA	0.433																																																	0													144.0	146.0	146.0					2																	189861937		2203	4300	6503	SO:0001583	missense	0			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.1808G>T	2.37:g.189861937G>T	ENSP00000304408:p.Gly603Val		D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.G603V	ENST00000304636.3	37	c.1808	CCDS2297.1	2	.	.	.	.	.	.	.	.	.	.	G	19.23	3.786770	0.70337	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.94138	-3.36;-3.36	6.03	6.03	0.97812	.	0.000000	0.49916	D	0.000133	D	0.98207	0.9407	H	0.97440	4.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98638	1.0674	10	0.72032	D	0.01	.	20.1547	0.98103	0.0:0.0:1.0:0.0	.	603	P02461	CO3A1_HUMAN	V	603	ENSP00000304408:G603V;ENSP00000315243:G603V	ENSP00000304408:G603V	G	+	2	0	COL3A1	189570182	1.000000	0.71417	0.970000	0.41538	0.683000	0.39861	7.707000	0.84623	2.868000	0.98415	0.555000	0.69702	GGC	COL3A1	-	NULL	ENSG00000168542		0.433	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL3A1	HGNC	protein_coding	OTTHUMT00000255899.3	-	0.00	65	0	G	NM_000090		189861937	+1	tier1	-	no_errors	ENST00000304636	ensembl	human	known	74_37	missense	7.02	52	4	SNP	1.000	T
COL6A5	256076	genome.wustl.edu	37	3	130188024	130188024	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:130188024G>C	ENST00000432398.2	+	38	7670	c.7176G>C	c.(7174-7176)tgG>tgC	p.W2392C	COL6A5_ENST00000265379.6_Missense_Mutation_p.W2392C	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	2392	Nonhelical region.|VWFA 10. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.W431*(1)|p.W2392*(1)		endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						CCTTGCAGTGGACAATTGACA	0.383																																																	2	Substitution - Nonsense(2)	lung(2)											125.0	112.0	116.0					3																	130188024		1856	4106	5962	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.7176G>C	3.37:g.130188024G>C	ENSP00000390895:p.Trp2392Cys		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.W2392C	ENST00000432398.2	37	c.7176		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.93|11.93	1.784880|1.784880	0.31593|0.31593	.|.	.|.	ENSG00000172752|ENSG00000172752	ENST00000512836|ENST00000432398;ENST00000265379;ENST00000373157;ENST00000512482	.|D;D;D;D	.|0.83075	.|-1.68;-1.68;-1.68;-1.68	5.35|5.35	5.35|5.35	0.76521|0.76521	.|von Willebrand factor, type A (3);	.|0.000000	.|0.49916	.|D	.|0.000129	D|D	0.91243|0.91243	0.7240|0.7240	M|M	0.86178|0.86178	2.8|2.8	0.44036|0.44036	D|D	0.996763|0.996763	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	D|D	0.92145|0.92145	0.5723|0.5723	5|10	.|0.72032	.|D	.|0.01	.|.	12.88|12.88	0.58012|0.58012	0.0:0.0:0.837:0.163|0.0:0.0:0.837:0.163	.|.	.|2392;2392	.|A8TX70;A8TX70-2	.|CO6A5_HUMAN;.	H|C	644|2392;2392;335;227	.|ENSP00000390895:W2392C;ENSP00000265379:W2392C;ENSP00000362250:W335C;ENSP00000424968:W227C	.|ENSP00000265379:W2392C	D|W	+|+	1|3	0|0	COL6A5|COL6A5	131670714|131670714	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.925000|0.925000	0.55904|0.55904	5.175000|5.175000	0.65021|0.65021	2.506000|2.506000	0.84524|0.84524	0.655000|0.655000	0.94253|0.94253	GAC|TGG	COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000172752		0.383	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		-	0.00	60	0	G	NM_153264		130188024	+1	tier1	-	no_errors	ENST00000265379	ensembl	human	known	74_37	missense	15.09	43	8	SNP	1.000	C
COLQ	8292	genome.wustl.edu	37	3	15540090	15540090	+	Intron	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:15540090G>T	ENST00000383788.5	-	2	232				COLQ_ENST00000435459.2_Missense_Mutation_p.T2K|COLQ_ENST00000383786.5_Intron|COLQ_ENST00000383781.4_Missense_Mutation_p.T2K|COLQ_ENST00000383787.2_Intron|COLQ_ENST00000383785.2_Intron|COLQ_ENST00000603808.1_Intron|MIR4270_ENST00000581799.1_RNA	NM_005677.3	NP_005668.2	Q9Y215	COLQ_HUMAN	collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase						acetylcholine catabolic process in synaptic cleft (GO:0001507)|asymmetric protein localization (GO:0008105)	basal lamina (GO:0005605)|cell junction (GO:0030054)|collagen trimer (GO:0005581)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(4)|lung(10)|skin(3)	19						TGATGAGCCCGTCATTGTGAG	0.587																																																	0													56.0	61.0	59.0					3																	15540090		2042	3923	5965	SO:0001627	intron_variant	0			AF057036	CCDS33709.1, CCDS43057.1, CCDS46768.1	3p	2008-07-18			ENSG00000206561	ENSG00000206561			2226	protein-coding gene	gene with protein product	"""single strand of homotrimeric collagen-like tail subunit of asymmetric acetylcholinesterase"", ""collagenic tail of endplate acetylcholinesterase"", ""AChE Q subunit"", ""acetylcholinesterase-associated collagen"""	603033				9689136	Standard	NM_005677		Approved	EAD	uc003bzx.3	Q9Y215	OTTHUMG00000156233	ENST00000383788.5:c.107-8946C>A	3.37:g.15540090G>T			B3KY09|Q6DK18|Q6YH18|Q6YH19|Q6YH20|Q6YH21|Q9NP18|Q9NP19|Q9NP20|Q9NP21|Q9NP22|Q9NP23|Q9NP24|Q9UP88	Missense_Mutation	SNP	pfam_Collagen,tigrfam_Myxo_disulph_rpt	p.T2K	ENST00000383788.5	37	c.5	CCDS33709.1	3	.	.	.	.	.	.	.	.	.	.	g	2.349	-0.349368	0.05173	.	.	ENSG00000206561	ENST00000383781;ENST00000435459;ENST00000420589	D;D	0.90788	-2.73;-2.68	4.87	-1.59	0.08453	.	.	.	.	.	T	0.77136	0.4086	N	0.08118	0	0.09310	N	1	B	0.19200	0.034	B	0.17433	0.018	T	0.62296	-0.6884	9	0.46703	T	0.11	.	5.285	0.15696	0.4257:0.141:0.4333:0.0	.	2	Q9Y215-2	.	K	2	ENSP00000373291:T2K;ENSP00000402511:T2K	ENSP00000373291:T2K	T	-	2	0	COLQ	15515094	0.000000	0.05858	0.001000	0.08648	0.081000	0.17604	-0.107000	0.10873	-0.783000	0.04534	-0.215000	0.12644	ACG	COLQ	-	NULL	ENSG00000206561		0.587	COLQ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COLQ	HGNC	protein_coding	OTTHUMT00000343575.1	-	0.00	45	0	G	NM_005677		15540090	-1	tier1	-	no_errors	ENST00000383781	ensembl	human	known	74_37	missense	13.64	19	3	SNP	0.000	T
COL6A5	256076	genome.wustl.edu	37	3	130188259	130188259	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:130188259C>T	ENST00000432398.2	+	38	7905	c.7411C>T	c.(7411-7413)Cga>Tga	p.R2471*	COL6A5_ENST00000265379.6_Nonsense_Mutation_p.R2471*	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	2471	Nonhelical region.|VWFA 10. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						CCAACTTGGCCGAACCCACAA	0.398																																																	0																																										SO:0001587	stop_gained	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.7411C>T	3.37:g.130188259C>T	ENSP00000390895:p.Arg2471*		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Nonsense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.R2471*	ENST00000432398.2	37	c.7411		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	51|51	17.806177|17.806177	0.99893|0.99893	.|.	.|.	ENSG00000172752|ENSG00000172752	ENST00000512836|ENST00000432398;ENST00000265379;ENST00000373157;ENST00000512482	.|.	.|.	.|.	5.0|5.0	4.03|4.03	0.46877|0.46877	.|.	.|0.000000	.|0.42821	.|D	.|0.000642	T|.	0.23649|.	0.0572|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.28038|.	-1.0056|.	3|.	.|0.02654	.|T	.|1	.|.	9.8126|9.8126	0.40833|0.40833	0.4106:0.5894:0.0:0.0|0.4106:0.5894:0.0:0.0	.|.	.|.	.|.	.|.	L|X	722|2471;2471;414;306	.|.	.|ENSP00000265379:R2471X	P|R	+|+	2|1	0|2	COL6A5|COL6A5	131670949|131670949	0.893000|0.893000	0.30496|0.30496	1.000000|1.000000	0.80357|0.80357	0.953000|0.953000	0.61014|0.61014	1.343000|1.343000	0.33930|0.33930	2.318000|2.318000	0.78349|0.78349	0.563000|0.563000	0.77884|0.77884	CCG|CGA	COL6A5	-	smart_VWF_A,pfscan_VWF_A	ENSG00000172752		0.398	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		-	0.00	63	0	C	NM_153264		130188259	+1	tier1	-	no_errors	ENST00000265379	ensembl	human	known	74_37	nonsense	24.62	49	16	SNP	1.000	T
CPA3	1359	genome.wustl.edu	37	3	148603919	148603919	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:148603919C>G	ENST00000296046.3	+	10	1073	c.1021C>G	c.(1021-1023)Cga>Gga	p.R341G	RP11-680B3.2_ENST00000488190.1_RNA	NM_001870.2	NP_001861.2	P15088	CBPA3_HUMAN	carboxypeptidase A3 (mast cell)	341					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TCTATCAACTCGATATGAAAC	0.353																																																	0													103.0	97.0	99.0					3																	148603919		2203	4300	6503	SO:0001583	missense	0				CCDS3138.1	3q24	2012-02-10			ENSG00000163751	ENSG00000163751	3.4.17.1		2298	protein-coding gene	gene with protein product	"""mast cell carboxypeptidase A"", ""tissue carboxypeptidase A"""	114851					Standard	NM_001870		Approved		uc003ewm.3	P15088	OTTHUMG00000159526	ENST00000296046.3:c.1021C>G	3.37:g.148603919C>G	ENSP00000296046:p.Arg341Gly		Q96E94	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.R341G	ENST00000296046.3	37	c.1021	CCDS3138.1	3	.	.	.	.	.	.	.	.	.	.	C	7.869	0.727755	0.15507	.	.	ENSG00000163751	ENST00000296046	T	0.11495	2.77	4.52	1.54	0.23209	Peptidase M14, carboxypeptidase A (2);	0.367213	0.24991	N	0.033988	T	0.12008	0.0292	L	0.60012	1.86	0.09310	N	1	P	0.39696	0.683	B	0.40702	0.338	T	0.10019	-1.0648	10	0.52906	T	0.07	.	7.3313	0.26584	0.3062:0.6106:0.0:0.0832	.	341	P15088	CBPA3_HUMAN	G	341	ENSP00000296046:R341G	ENSP00000296046:R341G	R	+	1	2	CPA3	150086609	0.001000	0.12720	0.016000	0.15963	0.536000	0.34869	0.164000	0.16542	0.194000	0.20326	0.591000	0.81541	CGA	CPA3	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000163751		0.353	CPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA3	HGNC	protein_coding	OTTHUMT00000355974.1	-	0.00	56	0	C	NM_001870		148603919	+1	tier1	-	no_errors	ENST00000296046	ensembl	human	known	74_37	missense	14.81	69	12	SNP	0.097	G
CREBRF	153222	genome.wustl.edu	37	5	172550134	172550134	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:172550134T>C	ENST00000296953.2	+	8	2052	c.1733T>C	c.(1732-1734)gTa>gCa	p.V578A	CREBRF_ENST00000540014.1_Missense_Mutation_p.V580A	NM_153607.2	NP_705835.2	Q8IUR6	CRERF_HUMAN	CREB3 regulatory factor	578	bZIP.				negative regulation of endoplasmic reticulum unfolded protein response (GO:1900102)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular transport (GO:0032388)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein transport (GO:0051222)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GTAAACCGGGTACAGAATCCA	0.378																																																	0													96.0	109.0	104.0					5																	172550134		2203	4300	6503	SO:0001583	missense	0			AY139008	CCDS34293.1, CCDS54948.1	5q35.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164463	ENSG00000164463			24050	protein-coding gene	gene with protein product	"""luman/CREB3 recruitment factor"""		"""chromosome 5 open reading frame 41"""	C5orf41		18391022	Standard	NM_153607		Approved	LRF	uc003mch.3	Q8IUR6	OTTHUMG00000163322	ENST00000296953.2:c.1733T>C	5.37:g.172550134T>C	ENSP00000296953:p.Val578Ala		B3DFH2|B3KW49|D3DQM2|F5GXN3|Q5HYG4|Q5HYK0|Q86YR3|Q8IZG1	Missense_Mutation	SNP	NULL	p.V580A	ENST00000296953.2	37	c.1739	CCDS34293.1	5	.	.	.	.	.	.	.	.	.	.	T	17.70	3.455244	0.63401	.	.	ENSG00000164463	ENST00000296953;ENST00000540014;ENST00000538538;ENST00000393776	T;T	0.21191	2.02;2.02	5.3	5.3	0.74995	.	0.183530	0.48286	D	0.000199	T	0.16557	0.0398	N	0.24115	0.695	0.58432	D	0.999996	P	0.39181	0.663	B	0.37731	0.257	T	0.03761	-1.1006	10	0.40728	T	0.16	.	15.1983	0.73112	0.0:0.0:0.0:1.0	.	578	Q8IUR6	CE041_HUMAN	A	578;580;578;578	ENSP00000296953:V578A;ENSP00000440075:V580A	ENSP00000296953:V578A	V	+	2	0	C5orf41	172482740	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.739000	0.68622	2.141000	0.66446	0.533000	0.62120	GTA	CREBRF	-	NULL	ENSG00000164463		0.378	CREBRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBRF	HGNC	protein_coding	OTTHUMT00000372667.1	-	0.00	24	0	T	NM_153607		172550134	+1	tier1	-	no_errors	ENST00000540014	ensembl	human	known	74_37	missense	25.00	24	8	SNP	1.000	C
CSMD1	64478	genome.wustl.edu	37	8	2954438	2954438	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr8:2954438G>T	ENST00000520002.1	-	48	7629	c.7074C>A	c.(7072-7074)taC>taA	p.Y2358*	CSMD1_ENST00000602723.1_Nonsense_Mutation_p.Y2358*|CSMD1_ENST00000400186.3_Nonsense_Mutation_p.Y2358*|CSMD1_ENST00000542608.1_Nonsense_Mutation_p.Y2357*|CSMD1_ENST00000602557.1_Nonsense_Mutation_p.Y2358*|CSMD1_ENST00000537824.1_Nonsense_Mutation_p.Y2357*			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2358	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGGTAATGTTGTAGTTTGGTT	0.413																																																	0													86.0	79.0	81.0					8																	2954438		1864	4089	5953	SO:0001587	stop_gained	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7074C>A	8.37:g.2954438G>T	ENSP00000430733:p.Tyr2358*		Q0H0J5|Q96QU9|Q96RM4	Nonsense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.Y2358*	ENST00000520002.1	37	c.7074		8	.	.	.	.	.	.	.	.	.	.	G	45	11.899153	0.99615	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	.	.	.	5.25	-10.5	0.00291	.	0.091999	0.45606	U	0.000352	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	21.8927	0.99963	0.2264:0.0:0.7736:0.0	.	.	.	.	X	2358;2358;2219;2357;2357	.	ENSP00000320445:Y2219X	Y	-	3	2	CSMD1	2941845	1.000000	0.71417	0.014000	0.15608	0.237000	0.25408	0.604000	0.24164	-2.003000	0.00962	-1.223000	0.01593	TAC	CSMD1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000183117		0.413	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2		0.00	53	0	G	NM_033225		2954438	-1			no_errors	ENST00000520002	ensembl	human	known	74_37	nonsense	5.71	66	4	SNP	0.950	T
CTCFL	140690	genome.wustl.edu	37	20	56083740	56083740	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr20:56083740G>T	ENST00000608263.1	-	8	2257	c.1596C>A	c.(1594-1596)caC>caA	p.H532Q	CTCFL_ENST00000609232.1_Missense_Mutation_p.H532Q|CTCFL_ENST00000429804.3_Missense_Mutation_p.H482Q|CTCFL_ENST00000539382.1_Missense_Mutation_p.H327Q|CTCFL_ENST00000243914.3_Missense_Mutation_p.H532Q|CTCFL_ENST00000608903.1_Missense_Mutation_p.H270Q|CTCFL_ENST00000423479.3_Missense_Mutation_p.H532Q|CTCFL_ENST00000608440.1_Missense_Mutation_p.H532Q|CTCFL_ENST00000433949.3_Missense_Mutation_p.H327Q|CTCFL_ENST00000422869.2_Missense_Mutation_p.H532Q|CTCFL_ENST00000608425.1_Missense_Mutation_p.H532Q|CTCFL_ENST00000432255.2_Missense_Mutation_p.H388Q|CTCFL_ENST00000502686.2_Missense_Mutation_p.H270Q|CTCFL_ENST00000371196.2_Missense_Mutation_p.H532Q	NM_001269041.1	NP_001255970.1	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor (zinc finger protein)-like	532					cell cycle (GO:0007049)|DNA methylation involved in gamete generation (GO:0043046)|histone methylation (GO:0016571)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of histone H3-K4 methylation (GO:0051569)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(28)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			ATTTCCTGAAGTGAGCGTTTA	0.448																																																	0													207.0	200.0	202.0					20																	56083740		2203	4300	6503	SO:0001583	missense	0				CCDS13459.1, CCDS58776.1, CCDS58777.1, CCDS58778.1, CCDS58779.1, CCDS58780.1, CCDS58781.1, CCDS58782.1, CCDS68161.1, CCDS68162.1, CCDS68163.1, CCDS68164.1	20q13.31	2013-01-08			ENSG00000124092	ENSG00000124092		"""Zinc fingers, C2H2-type"""	16234	protein-coding gene	gene with protein product	"""cancer/testis antigen 27"""	607022					Standard	NM_001269040		Approved	dJ579F20.2, BORIS, CT27	uc010giw.1	Q8NI51	OTTHUMG00000032829	ENST00000608263.1:c.1596C>A	20.37:g.56083740G>T	ENSP00000476783:p.His532Gln		A0S6W1|A1L4C6|A6XGL8|A6XGM2|A6XGM3|A6XGM8|A6XGN0|A6XGN1|A6XGN2|A6XGN3|A6XGN4|E7EQ27|E7EUE3|E9PBA9|Q5JUG4|Q9BZ30|Q9NQJ3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H532Q	ENST00000608263.1	37	c.1596	CCDS13459.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.77|16.77	3.215940|3.215940	0.58452|0.58452	.|.	.|.	ENSG00000124092|ENSG00000124092	ENST00000423479;ENST00000243914;ENST00000371196;ENST00000429804;ENST00000433949;ENST00000502686;ENST00000432255;ENST00000539382;ENST00000422869|ENST00000422109	D;D;D;D;D;D;D;D;D|T	0.96168|0.06608	-3.93;-3.93;-3.93;-3.93;-3.93;-3.93;-3.93;-3.93;-3.93|3.28	5.39|5.39	3.45|3.45	0.39498|0.39498	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	0.000000|.	0.47093|.	D|.	0.000250|.	T|T	0.17152|0.17152	0.0412|0.0412	M|M	0.92738|0.92738	3.34|3.34	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;0.999;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D|.	0.97110|.	1.0;0.999;0.997;0.999;0.999;0.997;0.997|.	T|T	0.38394|0.38394	-0.9663|-0.9663	10|7	0.87932|0.02654	D|T	0|1	-38.1049|-38.1049	9.0114|9.0114	0.36144|0.36144	0.2412:0.0:0.7588:0.0|0.2412:0.0:0.7588:0.0	.|.	532;388;532;482;532;532;532|.	A6XGM9;A6XGM8;A6XGM2;E7EUE3;A1L4C6;A6XGL8;Q8NI51|.	.;.;.;.;.;.;CTCFL_HUMAN|.	Q|I	532;532;532;482;532;270;388;327;532|401	ENSP00000415579:H532Q;ENSP00000243914:H532Q;ENSP00000360239:H532Q;ENSP00000415329:H482Q;ENSP00000392034:H532Q;ENSP00000437999:H270Q;ENSP00000409344:H388Q;ENSP00000439998:H327Q;ENSP00000399061:H532Q|ENSP00000413713:L401I	ENSP00000243914:H532Q|ENSP00000413713:L401I	H|L	-|-	3|1	2|0	CTCFL|CTCFL	55517146|55517146	1.000000|1.000000	0.71417|0.71417	0.266000|0.266000	0.24541|0.24541	0.432000|0.432000	0.31715|0.31715	1.955000|1.955000	0.40372|0.40372	0.759000|0.759000	0.33084|0.33084	0.655000|0.655000	0.94253|0.94253	CAC|CTT	CTCFL	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000124092		0.448	CTCFL-019	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	CTCFL	HGNC	protein_coding	OTTHUMT00000472040.1	-	0.00	73	0	G	NM_080618		56083740	-1	tier1	-	no_errors	ENST00000423479	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
CTNNA3	29119	genome.wustl.edu	37	10	68040237	68040237	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:68040237C>A	ENST00000433211.2	-	13	2049	c.1875G>T	c.(1873-1875)atG>atT	p.M625I	CTNNA3_ENST00000373744.4_Missense_Mutation_p.M625I	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						CCCGAATCATCATGACTGAAC	0.358																																																	0													171.0	165.0	167.0					10																	68040237		2203	4299	6502	SO:0001583	missense	0			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.1875G>T	10.37:g.68040237C>A	ENSP00000389714:p.Met625Ile			Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.M625I	ENST00000433211.2	37	c.1875	CCDS7269.1	10	.	.	.	.	.	.	.	.	.	.	C	21.6	4.179869	0.78564	.	.	ENSG00000183230	ENST00000433211;ENST00000373744	T;T	0.36340	1.26;1.26	5.78	5.78	0.91487	.	0.079798	0.52532	D	0.000064	T	0.44052	0.1275	L	0.29908	0.895	0.80722	D	1	P	0.40180	0.705	P	0.52758	0.708	T	0.35822	-0.9773	10	0.87932	D	0	-19.9025	15.4992	0.75684	0.0:1.0:0.0:0.0	.	625	Q9UI47	CTNA3_HUMAN	I	625	ENSP00000389714:M625I;ENSP00000362849:M625I	ENSP00000362849:M625I	M	-	3	0	CTNNA3	67710243	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	3.737000	0.55060	2.724000	0.93272	0.655000	0.94253	ATG	CTNNA3	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin	ENSG00000183230		0.358	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA3	HGNC	protein_coding	OTTHUMT00000048282.2		0.00	44	0	C	NM_013266		68040237	-1			no_errors	ENST00000373744	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	A
CUL7	9820	genome.wustl.edu	37	6	43016152	43016152	+	Silent	SNP	G	G	T	rs199607543		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:43016152G>T	ENST00000265348.3	-	8	2066	c.1981C>A	c.(1981-1983)Cgg>Agg	p.R661R	CUL7_ENST00000535468.1_Silent_p.R745R|CUL7_ENST00000478630.1_5'Flank			Q14999	CUL7_HUMAN	cullin 7	661					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TGCGGCTGCCGCTGCAGCTGC	0.597																																																	0																																										SO:0001819	synonymous_variant	0			BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.1981C>A	6.37:g.43016152G>T			B4DYZ0|F5H0L1|Q5T654	Silent	SNP	pfam_Cullin_N,pfam_CPH_domain,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_Cullin_homology,superfamily_ARM-type_fold,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.R745	ENST00000265348.3	37	c.2233	CCDS4881.1	6																																																																																			CUL7	-	NULL	ENSG00000044090		0.597	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL7	HGNC	protein_coding	OTTHUMT00000040575.1		0.00	37	0	G	NM_014780		43016152	-1			no_errors	ENST00000535468	ensembl	human	known	74_37	silent	9.52	19	2	SNP	0.076	T
CXCL6	6372	genome.wustl.edu	37	4	74702958	74702958	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:74702958C>A	ENST00000226317.5	+	3	535	c.281C>A	c.(280-282)cCg>cAg	p.P94Q	CXCL6_ENST00000503446.1_3'UTR|CXCL6_ENST00000515050.1_Missense_Mutation_p.P94Q	NM_002993.3	NP_002984.1	P80162	CXCL6_HUMAN	chemokine (C-X-C motif) ligand 6	94					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|heparin binding (GO:0008201)			large_intestine(1)|lung(7)	8	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			TGTCTGGACCCGGAAGCCCCT	0.443																																																	0													89.0	97.0	95.0					4																	74702958		2203	4300	6503	SO:0001583	missense	0			U83303	CCDS3560.1	4q13.3	2013-02-25	2012-10-17	2002-08-23	ENSG00000124875	ENSG00000124875		"""Endogenous ligands"""	10643	protein-coding gene	gene with protein product	"""granulocyte chemotactic protein 2"""	138965	"""small inducible cytokine subfamily B (Cys-X-Cys), member 6 (granulocyte chemotactic protein 2)"", ""chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2)"""	SCYB6		9465307	Standard	NM_002993		Approved	GCP-2, CKA-3	uc003hhf.3	P80162	OTTHUMG00000130010	ENST00000226317.5:c.281C>A	4.37:g.74702958C>A	ENSP00000226317:p.Pro94Gln		B2R4X3|Q4W5D4	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_CXC	p.P94Q	ENST00000226317.5	37	c.281	CCDS3560.1	4	.	.	.	.	.	.	.	.	.	.	C	13.81	2.349057	0.41599	.	.	ENSG00000124875	ENST00000226317;ENST00000515050	T;T	0.12984	2.63;2.63	3.87	3.87	0.44632	Chemokine interleukin-8-like domain (3);	0.000000	0.85682	D	0.000000	T	0.45316	0.1336	M	0.93328	3.405	0.41943	D	0.990625	D	0.89917	1.0	D	0.97110	1.0	T	0.58177	-0.7682	10	0.87932	D	0	.	11.5238	0.50567	0.0:1.0:0.0:0.0	.	94	P80162	CXCL6_HUMAN	Q	94	ENSP00000226317:P94Q;ENSP00000424819:P94Q	ENSP00000226317:P94Q	P	+	2	0	CXCL6	74921822	1.000000	0.71417	0.997000	0.53966	0.035000	0.12851	4.003000	0.57061	2.150000	0.67090	0.650000	0.86243	CCG	CXCL6	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_CXC	ENSG00000124875		0.443	CXCL6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CXCL6	HGNC	protein_coding	OTTHUMT00000252283.2		0.00	27	0	C	NM_002993		74702958	+1			no_errors	ENST00000226317	ensembl	human	known	74_37	missense	11.11	16	2	SNP	1.000	A
CYP24A1	1591	genome.wustl.edu	37	20	52775550	52775550	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr20:52775550G>T	ENST00000216862.3	-	8	1496	c.1103C>A	c.(1102-1104)gCa>gAa	p.A368E	CYP24A1_ENST00000460643.1_5'Flank|CYP24A1_ENST00000395954.3_Missense_Mutation_p.A226E|CYP24A1_ENST00000395955.3_Missense_Mutation_p.A368E	NM_000782.4	NP_000773.2	Q07973	CP24A_HUMAN	cytochrome P450, family 24, subfamily A, polypeptide 1	368				A -> E (in Ref. 1; AAA62379). {ECO:0000305}.	osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin D receptor signaling pathway (GO:0070561)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity (GO:0030342)|25-hydroxycholecalciferol-24-hydroxylase activity (GO:0008403)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Corticotropin(DB01285)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	CAAATCTTCTGCCCGTGGCAC	0.388																																																	0													125.0	130.0	128.0					20																	52775550		2203	4300	6503	SO:0001583	missense	0			U60669	CCDS33491.1, CCDS46616.1	20q13.2-q13.3	2003-02-28	2003-02-14	2003-02-28	ENSG00000019186	ENSG00000019186		"""Cytochrome P450s"""	2602	protein-coding gene	gene with protein product		126065	"""cytochrome P450, subfamily XXIV (vitamin D 24-hydroxylase)"""	CYP24			Standard	NM_000782		Approved	CP24, P450-CC24	uc002xwv.2	Q07973	OTTHUMG00000032773	ENST00000216862.3:c.1103C>A	20.37:g.52775550G>T	ENSP00000216862:p.Ala368Glu		Q15807|Q32ML3|Q5I2W7	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_CYP24A_mit,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	p.A368E	ENST00000216862.3	37	c.1103	CCDS33491.1	20	.	.	.	.	.	.	.	.	.	.	G	17.78	3.473822	0.63737	.	.	ENSG00000019186	ENST00000216862;ENST00000395955;ENST00000395954	T;T;T	0.67698	-0.28;-0.28;-0.28	5.58	5.58	0.84498	.	0.051582	0.85682	D	0.000000	T	0.75451	0.3851	L	0.35644	1.08	0.58432	D	0.999996	D;D;D	0.89917	0.964;1.0;0.999	P;D;D	0.75484	0.523;0.986;0.975	T	0.73509	-0.3960	10	0.38643	T	0.18	-6.189	18.553	0.91072	0.0:0.0:1.0:0.0	.	368;368;226	Q32ML3;Q07973;Q5I2W7	.;CP24A_HUMAN;.	E	368;368;226	ENSP00000216862:A368E;ENSP00000379285:A368E;ENSP00000379284:A226E	ENSP00000216862:A368E	A	-	2	0	CYP24A1	52208957	1.000000	0.71417	0.855000	0.33649	0.537000	0.34900	7.011000	0.76359	2.615000	0.88500	0.650000	0.86243	GCA	CYP24A1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000019186		0.388	CYP24A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP24A1	HGNC	protein_coding	OTTHUMT00000079769.2	-	0.00	51	0	G			52775550	-1	tier1	-	no_errors	ENST00000216862	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
CYP7B1	9420	genome.wustl.edu	37	8	65536985	65536985	+	Silent	SNP	A	A	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr8:65536985A>T	ENST00000310193.3	-	2	407	c.234T>A	c.(232-234)ggT>ggA	p.G78G		NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	78					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TGAAAGTGTCACCATGTTGCT	0.363																																																	0													143.0	138.0	140.0					8																	65536985		2203	4300	6503	SO:0001819	synonymous_variant	0			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.234T>A	8.37:g.65536985A>T			B2RN07|Q9UNF5	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450	p.G78	ENST00000310193.3	37	c.234	CCDS6180.1	8																																																																																			CYP7B1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I	ENSG00000172817		0.363	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP7B1	HGNC	protein_coding	OTTHUMT00000378550.1	-	0.00	64	0	A			65536985	-1	tier1	-	no_errors	ENST00000310193	ensembl	human	known	74_37	silent	13.85	56	9	SNP	0.998	T
DACT1	51339	genome.wustl.edu	37	14	59112640	59112640	+	Frame_Shift_Del	DEL	G	G	-			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr14:59112640delG	ENST00000335867.4	+	4	1323	c.1299delG	c.(1297-1299)gtgfs	p.V433fs	DACT1_ENST00000395153.3_Frame_Shift_Del_p.V396fs|DACT1_ENST00000556859.1_Frame_Shift_Del_p.V152fs|DACT1_ENST00000541264.2_Frame_Shift_Del_p.V152fs			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	433					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						GCAAGAGGGTGCCCCTGCCAG	0.587																																																	0													44.0	51.0	49.0					14																	59112640		2203	4299	6502	SO:0001589	frameshift_variant	0			AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.1299delG	14.37:g.59112640delG	ENSP00000337439:p.Val433fs		A8MYJ2|Q86TY0	Frame_Shift_Del	DEL	NULL	p.L435fs	ENST00000335867.4	37	c.1299	CCDS9736.1	14																																																																																			DACT1	-	NULL	ENSG00000165617		0.587	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACT1	HGNC	protein_coding	OTTHUMT00000325515.1		0.00	65	0	G	NM_016651		59112640	+1	tier1		no_errors	ENST00000335867	ensembl	human	known	74_37	frame_shift_del	44.44	25	20	DEL	0.325	-
DACT1	51339	genome.wustl.edu	37	14	59112641	59112641	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr14:59112641C>A	ENST00000335867.4	+	4	1324	c.1300C>A	c.(1300-1302)Ccc>Acc	p.P434T	DACT1_ENST00000395153.3_Missense_Mutation_p.P397T|DACT1_ENST00000556859.1_Missense_Mutation_p.P153T|DACT1_ENST00000541264.2_Missense_Mutation_p.P153T			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	434					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						CAAGAGGGTGCCCCTGCCAGA	0.592																																																	0													44.0	51.0	49.0					14																	59112641		2203	4299	6502	SO:0001583	missense	0			AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.1300C>A	14.37:g.59112641C>A	ENSP00000337439:p.Pro434Thr		A8MYJ2|Q86TY0	Missense_Mutation	SNP	NULL	p.P434T	ENST00000335867.4	37	c.1300	CCDS9736.1	14	.	.	.	.	.	.	.	.	.	.	C	3.393	-0.123838	0.06795	.	.	ENSG00000165617	ENST00000556859;ENST00000395151;ENST00000395153;ENST00000335867;ENST00000541264	T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95	5.35	2.5	0.30297	.	0.364043	0.28140	N	0.016449	T	0.27765	0.0683	L	0.34521	1.04	0.09310	N	0.999997	P;P	0.35872	0.465;0.525	B;B	0.33521	0.124;0.165	T	0.09122	-1.0689	10	0.35671	T	0.21	-1.4995	8.1779	0.31294	0.0:0.7206:0.1347:0.1447	.	397;434	A8MYJ2;Q9NYF0	.;DACT1_HUMAN	T	153;153;397;434;153	ENSP00000451598:P153T;ENSP00000378581:P153T;ENSP00000378582:P397T;ENSP00000337439:P434T;ENSP00000442850:P153T	ENSP00000337439:P434T	P	+	1	0	DACT1	58182394	0.027000	0.19231	0.012000	0.15200	0.034000	0.12701	0.708000	0.25719	0.242000	0.21303	-0.251000	0.11542	CCC	DACT1	-	NULL	ENSG00000165617		0.592	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACT1	HGNC	protein_coding	OTTHUMT00000325515.1	-	0.00	64	0	C	NM_016651		59112641	+1	tier1	-	no_errors	ENST00000335867	ensembl	human	known	74_37	missense	46.67	24	21	SNP	0.319	A
DCHS2	54798	genome.wustl.edu	37	4	155412323	155412323	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:155412323G>T	ENST00000339452.1	-	1	545	c.185C>A	c.(184-186)tCc>tAc	p.S62Y	DCHS2_ENST00000443500.1_Missense_Mutation_p.S62Y|DCHS2_ENST00000456341.2_Missense_Mutation_p.S55Y	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	375	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CTGGGCAGAGGAGCCCGAGGC	0.687																																																	0													18.0	31.0	27.0					4																	155412323		692	1591	2283	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.185C>A	4.37:g.155412323G>T	ENSP00000345062:p.Ser62Tyr		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S62Y	ENST00000339452.1	37	c.185	CCDS47150.1	4	.	.	.	.	.	.	.	.	.	.	G	13.18	2.160969	0.38119	.	.	ENSG00000197410	ENST00000339452;ENST00000544161;ENST00000456341;ENST00000443500	T;T;T	0.59083	0.29;0.29;0.29	5.24	5.24	0.73138	.	.	.	.	.	T	0.70046	0.3179	L	0.57536	1.79	0.09310	N	1	D;P	0.76494	0.999;0.94	D;P	0.70487	0.969;0.459	T	0.61466	-0.7057	9	0.62326	D	0.03	.	10.12	0.42614	0.0:0.1476:0.6999:0.1525	.	62;62	E9PG03;E9PC11	.;.	Y	62;62;55;62	ENSP00000345062:S62Y;ENSP00000408543:S55Y;ENSP00000395539:S62Y	ENSP00000345062:S62Y	S	-	2	0	DCHS2	155631773	0.227000	0.23707	0.736000	0.30914	0.518000	0.34316	1.867000	0.39499	2.444000	0.82710	0.462000	0.41574	TCC	DCHS2	-	NULL	ENSG00000197410		0.687	DCHS2-002	KNOWN	basic|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365282.1	-	0.00	57	0	G	NM_001142552		155412323	-1	tier1	-	no_errors	ENST00000339452	ensembl	human	known	74_37	missense	16.67	20	4	SNP	0.283	T
DFNB31	25861	genome.wustl.edu	37	9	117240860	117240860	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr9:117240860G>T	ENST00000362057.3	-	2	978	c.810C>A	c.(808-810)caC>caA	p.H270Q	DFNB31_ENST00000374057.3_Missense_Mutation_p.H270Q|DFNB31_ENST00000265134.6_5'UTR	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	270					inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CTTGCAGGAGGTGCAGGGTGC	0.662																																																	0													49.0	48.0	48.0					9																	117240860		2203	4300	6503	SO:0001583	missense	0			AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.810C>A	9.37:g.117240860G>T	ENSP00000354623:p.His270Gln		A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.H270Q	ENST00000362057.3	37	c.810	CCDS6806.1	9	.	.	.	.	.	.	.	.	.	.	G	9.530	1.110591	0.20714	.	.	ENSG00000095397	ENST00000362057;ENST00000374057	T;T	0.16597	2.33;2.37	5.42	2.43	0.29744	PDZ/DHR/GLGF (1);	0.680111	0.16082	N	0.230464	T	0.05960	0.0155	N	0.03281	-0.365	0.25668	N	0.985927	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.0	T	0.37126	-0.9719	10	0.21014	T	0.42	-8.7431	4.1227	0.10112	0.0972:0.3869:0.4008:0.1151	.	270;270;270	Q9P202-2;B9EGE6;Q9P202	.;.;WHRN_HUMAN	Q	270	ENSP00000354623:H270Q;ENSP00000363170:H270Q	ENSP00000354623:H270Q	H	-	3	2	DFNB31	116280681	1.000000	0.71417	0.912000	0.35992	0.937000	0.57800	2.784000	0.47774	0.633000	0.30452	0.462000	0.41574	CAC	DFNB31	-	superfamily_PDZ	ENSG00000095397		0.662	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNB31	HGNC	protein_coding	OTTHUMT00000053776.2		0.00	46	0	G	NM_015404		117240860	-1			no_errors	ENST00000362057	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
DHODH	1723	genome.wustl.edu	37	16	72055078	72055078	+	Frame_Shift_Del	DEL	G	G	-	rs148523165	byFrequency	TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr16:72055078delG	ENST00000219240.4	+	5	594	c.573delG	c.(571-573)gcgfs	p.A191fs	DHODH_ENST00000572887.1_Frame_Shift_Del_p.A191fs|DHODH_ENST00000573922.1_Intron	NM_001361.4	NP_001352.2	Q02127	PYRD_HUMAN	dihydroorotate dehydrogenase (quinone)	191					'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of apoptotic process (GO:0043065)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of mitochondrial fission (GO:0090140)|response to caffeine (GO:0031000)|response to drug (GO:0042493)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|neuronal cell body (GO:0043025)	dihydroorotate dehydrogenase activity (GO:0004152)|dihydroorotate oxidase activity (GO:0004158)|drug binding (GO:0008144)|FMN binding (GO:0010181)|ubiquinone binding (GO:0048039)			breast(1)|endometrium(2)|large_intestine(4)|ovary(1)|skin(1)|stomach(1)	10		Ovarian(137;0.125)			Atovaquone(DB01117)|Leflunomide(DB01097)|Teriflunomide(DB08880)	TGGACGCCGCGGAGGACTACG	0.642																																																	0													33.0	44.0	40.0					16																	72055078		2069	4177	6246	SO:0001589	frameshift_variant	0				CCDS42192.1	16q22.2	2012-10-02	2011-09-05		ENSG00000102967	ENSG00000102967	1.3.5.2		2867	protein-coding gene	gene with protein product		126064	"""dihydroorotate dehydrogenase"""			8211381	Standard	NM_001361		Approved		uc002fbp.3	Q02127	OTTHUMG00000178093	ENST00000219240.4:c.573delG	16.37:g.72055078delG	ENSP00000219240:p.Ala191fs		A8K8C8|Q6P176	Frame_Shift_Del	DEL	pfam_Dihydroorotate_DH_1_2,pirsf_Dihydroorotate_DH_1_2,tigrfam_Dihydroorotate_DH_2	p.E192fs	ENST00000219240.4	37	c.573	CCDS42192.1	16																																																																																			DHODH	-	pfam_Dihydroorotate_DH_1_2,pirsf_Dihydroorotate_DH_1_2,tigrfam_Dihydroorotate_DH_2	ENSG00000102967		0.642	DHODH-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DHODH	HGNC	protein_coding			0.00	64	0	G	NM_001361		72055078	+1	tier1		no_errors	ENST00000219240	ensembl	human	known	74_37	frame_shift_del	24.07	41	13	DEL	0.284	-
DHX57	90957	genome.wustl.edu	37	2	39088678	39088678	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:39088678C>T	ENST00000295373.6	-	5	1000	c.874G>A	c.(874-876)Gaa>Aaa	p.E292K	AC018693.6_ENST00000442829.1_RNA|DHX57_ENST00000479345.2_5'UTR	NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	292							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				TTGGTACTTTCTTTTGGCTTG	0.338																																					Melanoma(191;1090 2095 4375 23729 47341)												0													85.0	86.0	86.0					2																	39088678		2203	4300	6503	SO:0001583	missense	0			AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.874G>A	2.37:g.39088678C>T	ENSP00000295373:p.Glu292Lys		A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Missense_Mutation	SNP	pfam_RWD-domain,pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Znf_CCCH,superfamily_P-loop_NTPase,superfamily_UBA-like,superfamily_UBQ-conjugating_enzyme/RWD,smart_Znf_CCCH,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E292K	ENST00000295373.6	37	c.874	CCDS1800.1	2	.	.	.	.	.	.	.	.	.	.	C	4.299	0.054741	0.08291	.	.	ENSG00000163214	ENST00000295373;ENST00000355320	T	0.02709	4.19	5.78	4.89	0.63831	RWD domain (1);	0.366682	0.23762	N	0.044812	T	0.02455	0.0075	N	0.22421	0.69	0.09310	N	1	B;B	0.16802	0.019;0.001	B;B	0.12156	0.007;0.002	T	0.47535	-0.9110	10	0.11485	T	0.65	.	13.3763	0.60741	0.0:0.8726:0.0:0.1274	.	292;292	Q6P158-2;Q6P158	.;DHX57_HUMAN	K	292;190	ENSP00000295373:E292K	ENSP00000295373:E292K	E	-	1	0	DHX57	38942182	0.000000	0.05858	0.991000	0.47740	0.387000	0.30353	0.609000	0.24238	2.724000	0.93272	0.563000	0.77884	GAA	DHX57	-	pfam_RWD-domain,superfamily_UBQ-conjugating_enzyme/RWD	ENSG00000163214		0.338	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX57	HGNC	protein_coding	OTTHUMT00000219940.2	-	0.00	32	0	C	NM_145646		39088678	-1	tier1	-	no_errors	ENST00000295373	ensembl	human	known	74_37	missense	18.92	30	7	SNP	0.006	T
DMBT1	1755	genome.wustl.edu	37	10	124396806	124396806	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:124396806C>T	ENST00000338354.3	+	51	6639	c.6533C>T	c.(6532-6534)tCa>tTa	p.S2178L	DMBT1_ENST00000368956.2_Missense_Mutation_p.S1550L|DMBT1_ENST00000330163.4_Missense_Mutation_p.S1550L|DMBT1_ENST00000368909.3_Missense_Mutation_p.S2178L|DMBT1_ENST00000344338.3_Missense_Mutation_p.S2168L|DMBT1_ENST00000359586.6_Missense_Mutation_p.S898L|DMBT1_ENST00000368955.3_Missense_Mutation_p.S2168L			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	2178	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				ATTCCCTACTCAGGCTGCGGC	0.512																																					Ovarian(182;93 2026 18125 22222 38972)												0													56.0	54.0	55.0					10																	124396806		1916	4117	6033	SO:0001583	missense	0				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.6533C>T	10.37:g.124396806C>T	ENSP00000342210:p.Ser2178Leu		A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	pfam_SRCR,pfam_CUB_dom,pfam_ZP_dom,superfamily_Srcr_rcpt-rel,superfamily_CUB_dom,smart_Srcr_rcpt-rel,smart_CUB_dom,smart_ZP_dom,pfscan_CUB_dom,pfscan_SRCR,pfscan_ZP_dom,prints_SRCR	p.S2178L	ENST00000338354.3	37	c.6533		10	.	.	.	.	.	.	.	.	.	.	C	14.23	2.473675	0.43942	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000344467;ENST00000359586	D;D;D;D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7;-1.7;-1.7;-1.7	4.99	0.00281	0.14052	Zona pellucida sperm-binding protein (3);	.	.	.	.	T	0.75824	0.3902	L	0.58101	1.795	0.09310	N	1	B;B;B;B;B;B;B	0.33841	0.138;0.428;0.138;0.053;0.053;0.053;0.065	B;B;B;B;B;B;B	0.35899	0.022;0.213;0.037;0.022;0.022;0.022;0.037	T	0.67749	-0.5590	9	0.87932	D	0	.	1.4448	0.02362	0.2939:0.4178:0.1143:0.174	.	898;2158;1427;2307;1550;2168;2178	F8WEF7;Q9UGM3-5;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;.;DMBT1_HUMAN	L	2178;2307;2178;2178;2178;2177;1550;2168;1550;1550;2178;2168;1550;324;898	ENSP00000342210:S2178L;ENSP00000343175:S2168L;ENSP00000327747:S1550L;ENSP00000357905:S2178L;ENSP00000357951:S2168L;ENSP00000357952:S1550L;ENSP00000352593:S898L	ENSP00000331522:S1550L	S	+	2	0	DMBT1	124386796	0.000000	0.05858	0.002000	0.10522	0.428000	0.31595	-0.105000	0.10907	0.205000	0.20568	0.655000	0.94253	TCA	DMBT1	-	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom	ENSG00000187908		0.512	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	DMBT1	HGNC	protein_coding	OTTHUMT00000050792.2	-	0.00	38	0	C	NM_004406		124396806	+1	tier1	-	no_errors	ENST00000338354	ensembl	human	known	74_37	missense	17.86	23	5	SNP	0.006	T
DNAI2	64446	genome.wustl.edu	37	17	72301522	72301522	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr17:72301522C>T	ENST00000311014.6	+	9	1219	c.1152C>T	c.(1150-1152)ggC>ggT	p.G384G	DNAI2_ENST00000582036.1_Silent_p.G384G|AC103809.1_ENST00000516976.1_RNA|RP11-647F2.2_ENST00000585167.1_RNA|DNAI2_ENST00000446837.2_Silent_p.G384G|DNAI2_ENST00000307504.5_Silent_p.G241G|DNAI2_ENST00000579490.1_Silent_p.G441G			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	384					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						TGACGGTTGGCGACTGGACAG	0.577									Kartagener syndrome																																								0													66.0	64.0	64.0					17																	72301522		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.1152C>T	17.37:g.72301522C>T			C9J0S6|Q8IUW4|Q9H179|Q9NT53	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.G384	ENST00000311014.6	37	c.1152	CCDS11697.1	17																																																																																			DNAI2	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000171595		0.577	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	DNAI2	HGNC	protein_coding	OTTHUMT00000442537.1	-	0.00	106	0	C	NM_023036		72301522	+1	tier1	-	no_errors	ENST00000311014	ensembl	human	known	74_37	silent	28.57	40	16	SNP	0.007	T
DNMBP	23268	genome.wustl.edu	37	10	101658499	101658499	+	Splice_Site	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:101658499C>G	ENST00000324109.4	-	8	2812		c.e8+1		DNMBP_ENST00000543621.1_Splice_Site|DNMBP_ENST00000540316.1_5'Flank|DNMBP_ENST00000342239.3_Splice_Site	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein						intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		ATGGAACTTACCATTCGTTGT	0.368																																																	0													174.0	170.0	171.0					10																	101658499		2203	4300	6503	SO:0001630	splice_region_variant	0			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.2720+1G>C	10.37:g.101658499C>G			Q8IVY3|Q9Y2L3	Splice_Site	SNP	-	e7+1	ENST00000324109.4	37	c.2720+1	CCDS7485.1	10	.	.	.	.	.	.	.	.	.	.	C	13.09	2.132644	0.37630	.	.	ENSG00000107554	ENST00000342239;ENST00000324109;ENST00000543621;ENST00000422692	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0569	0.86536	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNMBP	101648489	1.000000	0.71417	1.000000	0.80357	0.331000	0.28603	4.697000	0.61782	2.534000	0.85438	0.561000	0.74099	.	DNMBP	-	-	ENSG00000107554		0.368	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNMBP	HGNC	protein_coding	OTTHUMT00000049832.2	-	0.00	42	0	C	NM_015221	Intron	101658499	-1	tier1	-	no_errors	ENST00000342239	ensembl	human	known	74_37	splice_site	14.29	30	5	SNP	1.000	G
DST	667	genome.wustl.edu	37	6	56473870	56473870	+	Silent	SNP	T	T	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:56473870T>A	ENST00000361203.3	-	36	4930	c.4923A>T	c.(4921-4923)acA>acT	p.T1641T	DST_ENST00000370769.4_Silent_p.T1641T|DST_ENST00000446842.2_Silent_p.T1315T|DST_ENST00000312431.6_Silent_p.T1641T|DST_ENST00000370788.2_Intron|DST_ENST00000370754.5_Silent_p.T1819T|DST_ENST00000421834.2_Intron|DST_ENST00000244364.6_Intron			Q03001	DYST_HUMAN	dystonin	1641					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GTACTGGAATTGTGGTAGGTG	0.413																																																	0													265.0	256.0	259.0					6																	56473870		1893	4128	6021	SO:0001819	synonymous_variant	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.4923A>T	6.37:g.56473870T>A			B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.T1819	ENST00000361203.3	37	c.5457		6																																																																																			DST	-	superfamily_ABC1_TM_dom	ENSG00000151914		0.413	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	36	0	T	NM_001723		56473870	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	silent	52.63	18	20	SNP	0.000	A
DUSP27	92235	genome.wustl.edu	37	1	167096823	167096823	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:167096823A>G	ENST00000361200.2	+	6	2621	c.2455A>G	c.(2455-2457)Acc>Gcc	p.T819A	DUSP27_ENST00000443333.1_Missense_Mutation_p.T819A|DUSP27_ENST00000271385.5_Missense_Mutation_p.T819A|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	819					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						AGTGAGGGGGACCAGCAAGCC	0.547																																																	0													88.0	82.0	84.0					1																	167096823		2203	4300	6503	SO:0001583	missense	0			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2455A>G	1.37:g.167096823A>G	ENSP00000354483:p.Thr819Ala		A0AUM4|Q9C074	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.T819A	ENST00000361200.2	37	c.2455	CCDS30932.1	1	.	.	.	.	.	.	.	.	.	.	A	17.47	3.396795	0.62177	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.05580	3.42;3.42;3.42	5.36	4.24	0.50183	.	0.074674	0.51477	N	0.000100	T	0.13030	0.0316	M	0.71581	2.175	0.43662	D	0.996082	D	0.76494	0.999	D	0.78314	0.991	T	0.00603	-1.1649	10	0.87932	D	0	-23.1122	10.8573	0.46806	0.9261:0.0:0.0739:0.0	.	819	Q5VZP5	DUS27_HUMAN	A	819	ENSP00000354483:T819A;ENSP00000271385:T819A;ENSP00000404874:T819A	ENSP00000271385:T819A	T	+	1	0	DUSP27	165363447	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	5.952000	0.70282	0.865000	0.35603	0.450000	0.29827	ACC	DUSP27	-	NULL	ENSG00000198842		0.547	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	HGNC	protein_coding	OTTHUMT00000083244.1	-	0.00	43	0	A	NM_001080426		167096823	+1	tier1	-	no_errors	ENST00000271385	ensembl	human	known	74_37	missense	32.50	27	13	SNP	1.000	G
DYNC1I2	1781	genome.wustl.edu	37	2	172584463	172584463	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:172584463G>A	ENST00000397119.3	+	12	1296	c.1129G>A	c.(1129-1131)Gca>Aca	p.A377T	DYNC1I2_ENST00000409773.1_Missense_Mutation_p.A377T|DYNC1I2_ENST00000410079.3_Missense_Mutation_p.A369T|DYNC1I2_ENST00000340296.4_Missense_Mutation_p.A351T|DYNC1I2_ENST00000358002.6_Missense_Mutation_p.A369T|DYNC1I2_ENST00000409317.1_Missense_Mutation_p.A371T|DYNC1I2_ENST00000409197.1_Missense_Mutation_p.A351T|DYNC1I2_ENST00000263811.4_Missense_Mutation_p.A371T|DYNC1I2_ENST00000508530.1_Missense_Mutation_p.A351T|DYNC1I2_ENST00000534253.2_Missense_Mutation_p.A377T|DYNC1I2_ENST00000409453.1_Missense_Mutation_p.A377T	NM_001378.1	NP_001369.1	Q13409	DC1I2_HUMAN	dynein, cytoplasmic 1, intermediate chain 2	377					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|microtubule (GO:0005874)|vesicle (GO:0031982)	microtubule motor activity (GO:0003777)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.198)			TCCACTGTCAGCAGCTGCACA	0.413																																																	0													60.0	57.0	58.0					2																	172584463		1933	4153	6086	SO:0001583	missense	0			AK055491	CCDS46450.1, CCDS63054.1, CCDS63056.1, CCDS63057.1	2q31.1	2013-01-10	2005-11-24	2005-11-24	ENSG00000077380	ENSG00000077380		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2964	protein-coding gene	gene with protein product		603331	"""dynein, cytoplasmic, intermediate polypeptide 2"""	DNCI2		10049579, 16260502	Standard	NM_001378		Approved		uc002uha.2	Q13409	OTTHUMG00000154061	ENST00000397119.3:c.1129G>A	2.37:g.172584463G>A	ENSP00000380308:p.Ala377Thr		B7ZA04|D3DPD4|D3DPD5|D3DPD6|Q32LY9|Q53S84|Q5BJF8|Q7Z4X1|Q96NG7|Q96S87|Q9BXZ5|Q9NT58	Missense_Mutation	SNP	pfam_Dynein_IC_1/2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.A377T	ENST00000397119.3	37	c.1129	CCDS46450.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.188106	0.94923	.	.	ENSG00000077380	ENST00000340296;ENST00000534253;ENST00000263811;ENST00000397119;ENST00000410079;ENST00000508530;ENST00000409197;ENST00000409317;ENST00000409773;ENST00000409453;ENST00000358002	T;T;T;T;T;T;T;T;T;T;T	0.75821	-0.82;-0.97;-0.83;-0.75;-0.59;-0.59;-0.82;-0.83;-0.75;-0.61;-0.59	6.01	6.01	0.97437	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.82176	0.4980	L	0.39898	1.24	0.80722	D	1	B;D;P;P;P;D	0.89917	0.048;1.0;0.542;0.542;0.678;1.0	B;D;B;B;B;D	0.91635	0.023;0.999;0.327;0.327;0.421;0.999	T	0.77219	-0.2668	10	0.27785	T	0.31	-19.2259	20.5211	0.99222	0.0:0.0:1.0:0.0	.	100;369;371;351;351;377	B4DX93;B7ZA04;Q13409-2;Q13409-6;Q13409-3;Q13409	.;.;.;.;.;DC1I2_HUMAN	T	351;377;371;377;369;351;351;371;377;377;369	ENSP00000339430:A351T;ENSP00000433791:A377T;ENSP00000263811:A371T;ENSP00000380308:A377T;ENSP00000386522:A369T;ENSP00000423339:A351T;ENSP00000386397:A351T;ENSP00000386591:A371T;ENSP00000386415:A377T;ENSP00000386886:A377T;ENSP00000350692:A369T	ENSP00000263811:A371T	A	+	1	0	DYNC1I2	172292709	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.774000	0.98992	2.861000	0.98227	0.650000	0.86243	GCA	DYNC1I2	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000077380		0.413	DYNC1I2-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	DYNC1I2	HGNC	protein_coding	OTTHUMT00000333683.2	-	0.00	49	0	G	NM_001378		172584463	+1	tier1	-	no_errors	ENST00000397119	ensembl	human	known	74_37	missense	24.59	46	15	SNP	1.000	A
DYNC2H1	79659	genome.wustl.edu	37	11	103055753	103055753	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:103055753G>A	ENST00000375735.2	+	41	6750	c.6606G>A	c.(6604-6606)atG>atA	p.M2202I	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.M2202I	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	2202					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		ATCTGAATATGAAGTCACGTT	0.338																																																	0													137.0	128.0	131.0					11																	103055753		1831	4080	5911	SO:0001583	missense	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.6606G>A	11.37:g.103055753G>A	ENSP00000364887:p.Met2202Ile		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.M2202I	ENST00000375735.2	37	c.6606	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	G	5.323	0.244959	0.10077	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.26660	1.72;1.72	4.86	3.94	0.45596	.	.	.	.	.	T	0.26011	0.0634	L	0.47716	1.5	0.32313	N	0.563491	B;B	0.06786	0.001;0.001	B;B	0.11329	0.0;0.006	T	0.19128	-1.0315	9	0.38643	T	0.18	.	15.4322	0.75108	0.0:0.1397:0.8603:0.0	.	2202;2202	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	I	2202	ENSP00000364887:M2202I;ENSP00000381167:M2202I	ENSP00000364887:M2202I	M	+	3	0	DYNC2H1	102560963	1.000000	0.71417	0.998000	0.56505	0.716000	0.41182	1.823000	0.39062	1.164000	0.42652	0.460000	0.39030	ATG	DYNC2H1	-	superfamily_P-loop_NTPase	ENSG00000187240		0.338	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	-	0.00	65	0	G	XM_370652		103055753	+1	tier1	-	no_errors	ENST00000398093	ensembl	human	known	74_37	missense	27.16	59	22	SNP	1.000	A
EFNA5	1946	genome.wustl.edu	37	5	106763018	106763018	+	Silent	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:106763018G>A	ENST00000333274.6	-	2	599	c.318C>T	c.(316-318)caC>caT	p.H106H	EFNA5_ENST00000509503.1_Silent_p.H106H	NM_001962.2	NP_001953.1	P52803	EFNA5_HUMAN	ephrin-A5	106	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				axon guidance (GO:0007411)|ephrin receptor signaling pathway (GO:0048013)|nervous system development (GO:0007399)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell-cell adhesion (GO:0022407)|regulation of focal adhesion assembly (GO:0051893)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rho GTPase activity (GO:0032319)|retinal ganglion cell axon guidance (GO:0031290)	anchored component of external side of plasma membrane (GO:0031362)|plasma membrane (GO:0005886)	chemorepellent activity (GO:0045499)|ephrin receptor binding (GO:0046875)			large_intestine(6)	6		all_cancers(142;5.15e-06)|all_epithelial(76;4.39e-07)|Prostate(80;0.00726)|Lung NSC(167;0.0736)|Ovarian(225;0.0797)|all_lung(232;0.0854)|Colorectal(57;0.241)		Epithelial(69;1.25e-12)|OV - Ovarian serous cystadenocarcinoma(64;1.32e-11)|BRCA - Breast invasive adenocarcinoma(61;0.0376)|COAD - Colon adenocarcinoma(37;0.109)		CATTTGGAGAGTGAGGCCGGT	0.473																																																	0													98.0	96.0	97.0					5																	106763018		2202	4300	6502	SO:0001819	synonymous_variant	0			U26403	CCDS4097.1	5q21	2011-03-09			ENSG00000184349	ENSG00000184349		"""Ephrins"""	3225	protein-coding gene	gene with protein product		601535		EPLG7		8661153, 9245480	Standard	NM_001962		Approved	AF1, LERK7	uc003kol.3	P52803	OTTHUMG00000128741	ENST00000333274.6:c.318C>T	5.37:g.106763018G>A				Silent	SNP	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	p.H106	ENST00000333274.6	37	c.318	CCDS4097.1	5																																																																																			EFNA5	-	pfam_Ephrin,superfamily_Cupredoxin	ENSG00000184349		0.473	EFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFNA5	HGNC	protein_coding	OTTHUMT00000250652.1	-	0.00	68	0	G	NM_001962		106763018	-1	tier1	-	no_errors	ENST00000333274	ensembl	human	known	74_37	silent	20.31	51	13	SNP	1.000	A
EGF	1950	genome.wustl.edu	37	4	110897167	110897167	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:110897167G>T	ENST00000265171.5	+	13	2274		c.e13-1		EGF_ENST00000503392.1_Splice_Site|EGF_ENST00000509793.1_Splice_Site	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor						activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	CTTGATTAAAGGAGATTATTC	0.353																																																	0													143.0	161.0	155.0					4																	110897167		2203	4300	6503	SO:0001630	splice_region_variant	0			X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1830-1G>T	4.37:g.110897167G>T			B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Splice_Site	SNP	-	e13-1	ENST00000265171.5	37	c.1830-1	CCDS3689.1	4	.	.	.	.	.	.	.	.	.	.	G	17.88	3.496602	0.64186	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3699	0.74554	0.0:0.0:0.86:0.14	.	.	.	.	.	-1	.	.	.	+	.	.	EGF	111116616	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.302000	0.89953	2.665000	0.90641	0.655000	0.94253	.	EGF	-	-	ENSG00000138798		0.353	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGF	HGNC	protein_coding	OTTHUMT00000255065.1	-	0.00	31	0	G		Intron	110897167	+1	tier1	-	no_errors	ENST00000265171	ensembl	human	known	74_37	splice_site	9.76	37	4	SNP	1.000	T
ENGASE	64772	genome.wustl.edu	37	17	77082217	77082217	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr17:77082217C>G	ENST00000579016.1	+	14	2018	c.2018C>G	c.(2017-2019)tCt>tGt	p.S673C		NM_001042573.2	NP_001036038.1	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	673						cytoplasm (GO:0005737)	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925)			breast(2)|endometrium(4)|large_intestine(1)|lung(15)|prostate(2)|skin(1)	25						AGTGATGACTCTCCGGGCAGG	0.627																																																	0													51.0	61.0	57.0					17																	77082217		2102	4220	6322	SO:0001583	missense	0			AF512564	CCDS42394.1	17q25.3	2009-03-03			ENSG00000167280	ENSG00000167280	3.2.1.96		24622	protein-coding gene	gene with protein product	"""Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase"", ""Di-N-acetylchitobiosyl beta-N-acetylglucosaminidase"""	611898				12114544, 18586680	Standard	NM_001042573		Approved	FLJ21865	uc002jwv.4	Q8NFI3	OTTHUMG00000167714	ENST00000579016.1:c.2018C>G	17.37:g.77082217C>G	ENSP00000462333:p.Ser673Cys		Q659F0|Q8TB86|Q9H6U4	Missense_Mutation	SNP	pfam_Glyco_hydro_85,pfscan_BRCT_dom	p.S673C	ENST00000579016.1	37	c.2018	CCDS42394.1	17	.	.	.	.	.	.	.	.	.	.	C	14.00	2.404648	0.42613	.	.	ENSG00000167280	ENST00000545583	.	.	.	3.85	2.88	0.33553	.	0.758616	0.12039	N	0.505232	T	0.49098	0.1537	L	0.60455	1.87	0.40030	D	0.975527	P	0.47545	0.897	B	0.43916	0.436	T	0.44967	-0.9293	9	0.40728	T	0.16	-11.2151	7.1576	0.25647	0.0:0.8754:0.0:0.1246	.	673	Q8NFI3	ENASE_HUMAN	C	673	.	ENSP00000438577:S673C	S	+	2	0	ENGASE	74593812	0.018000	0.18449	0.002000	0.10522	0.017000	0.09413	3.626000	0.54245	0.822000	0.34565	-0.373000	0.07131	TCT	ENGASE	-	NULL	ENSG00000167280		0.627	ENGASE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENGASE	HGNC	protein_coding	OTTHUMT00000395807.1	-	0.00	50	0	C	NM_022759		77082217	+1	tier1	-	no_errors	ENST00000579016	ensembl	human	known	74_37	missense	18.18	36	8	SNP	0.042	G
POPDC3	64208	genome.wustl.edu	37	6	105629061	105629068	+	5'Flank	DEL	TATATATA	TATATATA	-	rs140503760|rs375016144|rs367674232|rs377060256|rs371884011|rs376600509		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	TATATATA	TATATATA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:105629061_105629068delTATATATA	ENST00000254765.3	-	0	0				POPDC3_ENST00000474760.1_5'Flank|AL359709.1_ENST00000408617.1_RNA	NM_022361.4	NP_071756.2	Q9HBV1	POPD3_HUMAN	popeye domain containing 3						regulation of membrane potential (GO:0042391)	integral component of membrane (GO:0016021)				NS(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(3)|urinary_tract(1)	26		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				tgtgtgtgtgtatatatatgtATATATA	0.385																																																	0																																										SO:0001631	upstream_gene_variant	0			BC022323	CCDS5052.1	6q21	2003-06-12			ENSG00000132429	ENSG00000132429			17649	protein-coding gene	gene with protein product		605824				10882522	Standard	NM_022361		Approved	POP3, MGC22671, bA355M14.1	uc003prb.3	Q9HBV1	OTTHUMG00000015293		6.37:g.105629061_105629068delTATATATA	Exception_encountered		B2RA98|Q5T3Y8|Q8TBW6	RNA	DEL	-	NULL	ENST00000254765.3	37	NULL	CCDS5052.1	6																																																																																			AL359709.1	-	-	ENSG00000221544		0.385	POPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221544	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000041651.1		0.00	9	0	TATATATA	NM_022361		105629068	-1			no_errors	ENST00000408617	ensembl	human	novel	74_37	rna	15.79	16	3	DEL	0.004:0.005:0.007:0.007:0.007:0.007:0.007:0.002	0
LOC101929268	101929268	genome.wustl.edu	37	8	49503246	49503246	+	lincRNA	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr8:49503246G>T	ENST00000430626.1	+	0	286				RP11-770E5.1_ENST00000522575.1_RNA																							TCTATTGTTTGTCTCAGCTGC	0.542																																																	0													135.0	120.0	124.0					8																	49503246		692	1591	2283			0																															8.37:g.49503246G>T				RNA	SNP	-	NULL	ENST00000430626.1	37	NULL		8																																																																																			AC026904.1	-	-	ENSG00000233858		0.542	AC026904.1-001	KNOWN	basic	lincRNA	ENSG00000233858	Clone_based_vega_gene	lincRNA	OTTHUMT00000280498.1	-	0.00	36	0	G			49503246	+1	tier1	-	no_errors	ENST00000430626	ensembl	human	known	74_37	rna	11.43	31	4	SNP	0.000	T
CACNB2	783	genome.wustl.edu	37	10	18830178	18830178	+	IGR	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:18830178C>T	ENST00000324631.7	+	0	3446				CACNB2_ENST00000396576.2_3'UTR|RP11-499P20.2_ENST00000436485.1_RNA|RP11-499P20.2_ENST00000425669.1_RNA	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit						axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGTTTCTGTTCTTCAGAAGAA	0.423																																																	0																																										SO:0001628	intergenic_variant	0			U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764		10.37:g.18830178C>T			A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Splice_Site	SNP	-	NULL	ENST00000324631.7	37	c.NULL	CCDS7125.1	10																																																																																			RP11-499P20.2	-	-	ENSG00000240291		0.423	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000240291	Clone_based_vega_gene	protein_coding	OTTHUMT00000047072.2	-	0.00	38	0	C	NM_000724		18830178	-1	tier1	-	no_errors	ENST00000425669	ensembl	human	known	74_37	splice_site	17.31	43	9	SNP	0.002	T
PCDHB17	54661	genome.wustl.edu	37	5	140537151	140537151	+	Silent	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:140537151G>A	ENST00000539533.1	+	1	1575	c.1575G>A	c.(1573-1575)ctG>ctA	p.L525L						protocadherin beta 17 pseudogene																		ACGAGGCCCTGCAGGAGTTCG	0.667																																																	0																																										SO:0001819	synonymous_variant	0			AF152527		5q31	2010-01-26				ENSG00000255622		"""Cadherins / Protocadherins : Clustered"""	14547	pseudogene	pseudogene						10380929	Standard	NR_001280		Approved	PCDH-psi1	uc003lis.3			ENST00000539533.1:c.1575G>A	5.37:g.140537151G>A				Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L525	ENST00000539533.1	37	c.1575		5																																																																																			PCDHB17	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000255622		0.667	PCDHB17-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000255622	Uniprot_gn	protein_coding		-	0.00	198	0	G			140537151	+1	tier1	-	no_errors	ENST00000539533	ensembl	human	known	74_37	silent	16.44	122	24	SNP	0.937	A
EP300	2033	genome.wustl.edu	37	22	41564862	41564862	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr22:41564862C>A	ENST00000263253.7	+	25	5382	c.4163C>A	c.(4162-4164)cCc>cAc	p.P1388H	RP1-85F18.6_ENST00000415054.1_RNA|RNU6-375P_ENST00000517050.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1388	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TGCCCTCCACCCAACCAGAGG	0.458			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0													164.0	146.0	152.0					22																	41564862		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4163C>A	22.37:g.41564862C>A	ENSP00000263253:p.Pro1388His		B1AKC2	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.P1388H	ENST00000263253.7	37	c.4163	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	C	24.4	4.524272	0.85600	.	.	ENSG00000100393	ENST00000263253	D	0.93659	-3.26	5.95	5.95	0.96441	.	0.000000	0.48286	D	0.000184	D	0.97726	0.9254	M	0.93062	3.375	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.97953	1.0333	10	0.87932	D	0	-8.4055	20.3748	0.98911	0.0:1.0:0.0:0.0	.	1388	Q09472	EP300_HUMAN	H	1388	ENSP00000263253:P1388H	ENSP00000263253:P1388H	P	+	2	0	EP300	39894808	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.734000	0.84928	2.817000	0.96982	0.563000	0.77884	CCC	EP300	-	pfam_Histone_H3-K56_AcTrfase_RTT109	ENSG00000100393		0.458	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	-	0.00	61	0	C	NM_001429		41564862	+1	tier1	-	no_errors	ENST00000263253	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	A
EPHA3	2042	genome.wustl.edu	37	3	89462301	89462301	+	Silent	SNP	A	A	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:89462301A>G	ENST00000336596.2	+	10	1998	c.1773A>G	c.(1771-1773)ccA>ccG	p.P591P	EPHA3_ENST00000494014.1_Silent_p.P591P	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	591					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TAAAACTTCCAGGTCTCAGGA	0.363										TSP Lung(6;0.00050)																																							0													110.0	107.0	108.0					3																	89462301		2203	4299	6502	SO:0001819	synonymous_variant	0			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1773A>G	3.37:g.89462301A>G			Q9H2V3|Q9H2V4	Silent	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.P591	ENST00000336596.2	37	c.1773	CCDS2922.1	3																																																																																			EPHA3	-	pirsf_Tyr_kinase_ephrin_rcpt	ENSG00000044524		0.363	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA3	HGNC	protein_coding	OTTHUMT00000352995.1		0.00	68	0	A	NM_005233		89462301	+1			no_errors	ENST00000336596	ensembl	human	known	74_37	silent	5.36	53	3	SNP	1.000	G
EPHA4	2043	genome.wustl.edu	37	2	222365784	222365784	+	Missense_Mutation	SNP	C	C	T	rs375924623		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:222365784C>T	ENST00000281821.2	-	4	973	c.932G>A	c.(931-933)cGa>cAa	p.R311Q	EPHA4_ENST00000409854.1_Missense_Mutation_p.R311Q|EPHA4_ENST00000409938.1_Missense_Mutation_p.R311Q|EPHA4_ENST00000392071.4_Missense_Mutation_p.R260Q	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	311	Cys-rich.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GAAAAAGCCTCGGTCACAGGT	0.532																																																	0								C	GLN/ARG	0,4406		0,0,2203	147.0	124.0	131.0		932	6.1	1.0	2		131	1,8599	1.2+/-3.3	0,1,4299	no	missense	EPHA4	NM_004438.3	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	311/987	222365784	1,13005	2203	4300	6503	SO:0001583	missense	0			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.932G>A	2.37:g.222365784C>T	ENSP00000281821:p.Arg311Gln		A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R311Q	ENST00000281821.2	37	c.932	CCDS2447.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.75|15.75	2.926449|2.926449	0.52759|0.52759	0.0|0.0	1.16E-4|1.16E-4	ENSG00000116106|ENSG00000116106	ENST00000441679|ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071	.|T;T;T;T	.|0.62232	.|0.04;0.04;0.04;0.04	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	.|0.060275	.|0.64402	.|D	.|0.000004	T|T	0.44456|0.44456	0.1294|0.1294	N|N	0.12746|0.12746	0.255|0.255	0.45962|0.45962	D|D	0.998785|0.998785	.|B	.|0.27910	.|0.193	.|B	.|0.21151	.|0.033	T|T	0.34403|0.34403	-0.9830|-0.9830	5|10	.|0.24483	.|T	.|0.36	.|.	16.8423|16.8423	0.85972|0.85972	0.0:0.8718:0.1281:0.0|0.0:0.8718:0.1281:0.0	.|.	.|311	.|P54764	.|EPHA4_HUMAN	K|Q	48|311;311;311;260	.|ENSP00000281821:R311Q;ENSP00000386276:R311Q;ENSP00000386829:R311Q;ENSP00000375923:R260Q	.|ENSP00000281821:R311Q	E|R	-|-	1|2	0|0	EPHA4|EPHA4	222074028|222074028	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.743000|3.743000	0.55104|0.55104	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	GAG|CGA	EPHA4	-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_Growth_fac_rcpt_N_dom	ENSG00000116106		0.532	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	HGNC	protein_coding	OTTHUMT00000256836.3		0.00	60	0	C			222365784	-1			no_errors	ENST00000281821	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
ERMP1	79956	genome.wustl.edu	37	9	5787517	5787517	+	Silent	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr9:5787517G>T	ENST00000339450.5	-	14	2552	c.2463C>A	c.(2461-2463)acC>acA	p.T821T	ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000543230.1_Missense_Mutation_p.P416T|ERMP1_ENST00000381506.3_3'UTR	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	821						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		TTGTGACTGGGGTGCCATTGC	0.483																																																	0													177.0	167.0	171.0					9																	5787517		2203	4300	6503	SO:0001819	synonymous_variant	0			AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.2463C>A	9.37:g.5787517G>T			B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Missense_Mutation	SNP	pfam_Peptidase_M28,pfam_Peptidase_M20	p.P838T	ENST00000339450.5	37	c.2512	CCDS34983.1	9	.	.	.	.	.	.	.	.	.	.	G	2.923	-0.222675	0.06061	.	.	ENSG00000099219	ENST00000543230	.	.	.	5.9	0.183	0.15082	.	.	.	.	.	T	0.45816	0.1361	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27088	-1.0084	4	.	.	.	-12.134	4.3857	0.11316	0.3803:0.0:0.2962:0.3235	.	.	.	.	T	416	.	.	P	-	1	0	ERMP1	5777517	0.840000	0.29493	0.992000	0.48379	0.008000	0.06430	-0.171000	0.09883	0.092000	0.17331	-0.157000	0.13467	CCC	ERMP1	-	NULL	ENSG00000099219		0.483	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ERMP1	HGNC	protein_coding	OTTHUMT00000354877.1		0.00	60	0	G	NM_024896		5787517	-1			no_errors	ENST00000489219	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.964	T
FAM180A	389558	genome.wustl.edu	37	7	135421860	135421860	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr7:135421860T>A	ENST00000338588.3	-	2	429	c.164A>T	c.(163-165)gAg>gTg	p.E55V	FAM180A_ENST00000415751.1_Missense_Mutation_p.E55V|FAM180A_ENST00000435869.1_5'UTR	NM_205855.3	NP_995327.1	Q6UWF9	F180A_HUMAN	family with sequence similarity 180, member A	55						extracellular region (GO:0005576)				endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)	14						GTAGAGCAGCTCCACCTCCTC	0.532																																																	0													76.0	63.0	67.0					7																	135421860		2203	4300	6503	SO:0001583	missense	0			AC091736, AK290250, AK310180, AY358803	CCDS5841.1	7q33	2008-07-25			ENSG00000189320	ENSG00000189320			33773	protein-coding gene	gene with protein product						12975309, 12690205	Standard	NM_205855		Approved	HWKM1940, UNQ1940	uc003vtd.3	Q6UWF9	OTTHUMG00000155537	ENST00000338588.3:c.164A>T	7.37:g.135421860T>A	ENSP00000342336:p.Glu55Val		B2RP85	Missense_Mutation	SNP	NULL	p.E55V	ENST00000338588.3	37	c.164	CCDS5841.1	7	.	.	.	.	.	.	.	.	.	.	T	17.71	3.457655	0.63401	.	.	ENSG00000189320	ENST00000338588;ENST00000415751	T;T	0.33216	1.42;1.42	5.15	5.15	0.70609	.	0.281816	0.39985	N	0.001214	T	0.37919	0.1021	L	0.35723	1.085	0.45554	D	0.998505	D	0.55385	0.971	P	0.55455	0.776	T	0.08806	-1.0704	10	0.42905	T	0.14	-19.5371	13.2242	0.59905	0.0:0.0:0.0:1.0	.	55	Q6UWF9	F180A_HUMAN	V	55	ENSP00000342336:E55V;ENSP00000395467:E55V	ENSP00000342336:E55V	E	-	2	0	FAM180A	135072400	0.796000	0.28864	0.997000	0.53966	0.968000	0.65278	4.467000	0.60155	2.082000	0.62665	0.454000	0.30748	GAG	FAM180A	-	NULL	ENSG00000189320		0.532	FAM180A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM180A	HGNC	protein_coding	OTTHUMT00000340554.2		0.00	43	0	T	NM_205855		135421860	-1			no_errors	ENST00000338588	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.998	A
ESYT2	57488	genome.wustl.edu	37	7	158527118	158527118	+	Silent	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr7:158527118G>T	ENST00000251527.5	-	21	2696	c.2631C>A	c.(2629-2631)acC>acA	p.T877T	ESYT2_ENST00000435514.2_Silent_p.T312T	NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	905	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						CTCACCACTGGGTCCAGCCTT	0.557																																																	0													78.0	73.0	75.0					7																	158527118		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.2631C>A	7.37:g.158527118G>T			A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.T877	ENST00000251527.5	37	c.2631	CCDS34791.1	7																																																																																			ESYT2	-	superfamily_C2_dom,smart_C2_dom	ENSG00000117868		0.557	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESYT2	HGNC	protein_coding	OTTHUMT00000322647.1	-	0.00	73	0	G	NM_020728		158527118	-1	tier1	-	no_errors	ENST00000251527	ensembl	human	known	74_37	silent	8.16	45	4	SNP	1.000	T
FAM230A	653203	genome.wustl.edu	37	22	20709402	20709402	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr22:20709402C>T	ENST00000434783.3	+	8	1318	c.1134C>T	c.(1132-1134)gcC>gcT	p.A378A	USP41_ENST00000486536.2_Intron|USP41_ENST00000454608.2_Intron					family with sequence similarity 230, member A																		ACGAGGACGCCGTCCAGGGCA	0.677																																																	0																																										SO:0001819	synonymous_variant	0			JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.1134C>T	22.37:g.20709402C>T				Silent	SNP	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.A378	ENST00000434783.3	37	c.1134		22																																																																																			FAM230A	-	superfamily_Kinase-like_dom	ENSG00000188280		0.677	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	HGNC	protein_coding	OTTHUMT00000319609.4	-	0.00	139	0	C			20709402	+1	tier1	-	no_errors	ENST00000434783	ensembl	human	known	74_37	silent	27.14	51	19	SNP	0.000	T
FBXO15	201456	genome.wustl.edu	37	18	71803093	71803093	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr18:71803093G>A	ENST00000419743.2	-	3	315	c.236C>T	c.(235-237)tCa>tTa	p.S79L	FBXO15_ENST00000269500.5_Missense_Mutation_p.S3L	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	79	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.					SCF ubiquitin ligase complex (GO:0019005)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		CAAGATTTCTGAAGGCATTCT	0.413																																																	0													55.0	55.0	55.0					18																	71803093		2203	4300	6503	SO:0001583	missense	0			AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.236C>T	18.37:g.71803093G>A	ENSP00000393154:p.Ser79Leu		B3KST3	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.S79L	ENST00000419743.2	37	c.236	CCDS45884.1	18	.	.	.	.	.	.	.	.	.	.	G	14.52	2.558963	0.45590	.	.	ENSG00000141665	ENST00000269500;ENST00000419743	T;T	0.42513	0.97;0.97	5.7	5.7	0.88788	F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	0.267254	0.37623	N	0.002010	T	0.59865	0.2225	L	0.56340	1.77	0.53005	D	0.999966	D;D	0.63880	0.993;0.982	D;P	0.63113	0.911;0.864	T	0.59910	-0.7365	10	0.66056	D	0.02	-5.3364	18.6066	0.91268	0.0:0.0:1.0:0.0	.	79;3	B3KST3;Q8NCQ5	.;FBX15_HUMAN	L	3;79	ENSP00000269500:S3L;ENSP00000393154:S79L	ENSP00000269500:S3L	S	-	2	0	FBXO15	69954073	1.000000	0.71417	0.998000	0.56505	0.936000	0.57629	6.967000	0.76079	2.687000	0.91594	0.655000	0.94253	TCA	FBXO15	-	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	ENSG00000141665		0.413	FBXO15-002	KNOWN	basic|CCDS	protein_coding	FBXO15	HGNC	protein_coding	OTTHUMT00000444223.1	-	0.00	29	0	G	NM_152676		71803093	-1	tier1	-	no_errors	ENST00000419743	ensembl	human	known	74_37	missense	23.53	13	4	SNP	1.000	A
FCHO2	115548	genome.wustl.edu	37	5	72285328	72285328	+	Splice_Site	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:72285328G>C	ENST00000430046.2	+	3	316	c.200G>C	c.(199-201)gGa>gCa	p.G67A	FCHO2_ENST00000287761.6_Splice_Site_p.G67A|FCHO2_ENST00000341845.6_Splice_Site_p.G67A|FCHO2_ENST00000512348.1_Splice_Site_p.G67A	NM_001146032.1|NM_138782.2	NP_001139504.1|NP_620137.2	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2	67	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.|Mediates dimerization and binding to membranes enriched in Pi(4,5)-P2 and induces their tubulation.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|membrane invagination (GO:0010324)|protein localization to plasma membrane (GO:0072659)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	17		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		TCACAACTTGGGTGAGTTAAT	0.348																																																	0													110.0	104.0	106.0					5																	72285328		1842	4068	5910	SO:0001630	splice_region_variant	0			AL831971	CCDS47230.1, CCDS54868.1	5q13.2	2005-08-15			ENSG00000157107	ENSG00000157107			25180	protein-coding gene	gene with protein product		613438				15254787	Standard	NM_138782		Approved		uc003kcl.3	Q0JRZ9	OTTHUMG00000162413	ENST00000430046.2:c.200+1G>C	5.37:g.72285328G>C			A8K6W7|B2RNQ9|B4DHK0|E9PG79|Q0JTJ3|Q96CF5	Missense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_FCH_dom,smart_FCH_dom,pfscan_FCH_dom	p.G67A	ENST00000430046.2	37	c.200	CCDS47230.1	5	.	.	.	.	.	.	.	.	.	.	G	25.8	4.675825	0.88445	.	.	ENSG00000157107	ENST00000430046;ENST00000341845;ENST00000512348;ENST00000287761	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.13	5.13	0.70059	Fps/Fes/Fer/CIP4 homology (3);	0.049048	0.85682	D	0.000000	T	0.73737	0.3625	M	0.89353	3.025	0.80722	D	1	D;D;D	0.89917	0.999;0.998;1.0	D;D;D	0.73708	0.981;0.939;0.965	T	0.79610	-0.1732	10	0.87932	D	0	-20.6916	17.1181	0.86694	0.0:0.0:1.0:0.0	.	67;67;67	E9PG79;Q0JRZ9-2;Q0JRZ9	.;.;FCHO2_HUMAN	A	67	ENSP00000393776:G67A;ENSP00000344034:G67A;ENSP00000427296:G67A;ENSP00000287761:G67A	ENSP00000287761:G67A	G	+	2	0	FCHO2	72321084	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.109000	0.94291	2.545000	0.85829	0.585000	0.79938	GGA	FCHO2	-	pfam_FCH_dom,smart_FCH_dom,pfscan_FCH_dom	ENSG00000157107		0.348	FCHO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCHO2	HGNC	protein_coding	OTTHUMT00000368795.3	-	0.00	42	0	G	XM_291142	Missense_Mutation	72285328	+1	tier1	-	no_errors	ENST00000341845	ensembl	human	known	74_37	missense	13.46	45	7	SNP	1.000	C
FGL2	10875	genome.wustl.edu	37	7	76825667	76825667	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr7:76825667G>T	ENST00000248598.5	-	2	1281	c.1249C>A	c.(1249-1251)Cac>Aac	p.H417N	CCDC146_ENST00000431197.1_Intron|CCDC146_ENST00000285871.4_Intron|RP11-467H10.2_ENST00000459742.1_RNA	NM_006682.2	NP_006673.1	Q14314	FGL2_HUMAN	fibrinogen-like 2	417	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)				breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	13						CCACCAGGGTGTGCCTCACTT	0.443																																																	0													75.0	66.0	69.0					7																	76825667		2203	4300	6503	SO:0001583	missense	0			Z36531	CCDS5591.1	7q11.23	2013-02-06			ENSG00000127951	ENSG00000127951		"""Fibrinogen C domain containing"""	3696	protein-coding gene	gene with protein product		605351				7642106	Standard	NM_006682		Approved	pT49, T49	uc003ugb.3	Q14314	OTTHUMG00000130681	ENST00000248598.5:c.1249C>A	7.37:g.76825667G>T	ENSP00000248598:p.His417Asn			Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.H417N	ENST00000248598.5	37	c.1249	CCDS5591.1	7	.	.	.	.	.	.	.	.	.	.	G	11.29	1.595853	0.28445	.	.	ENSG00000127951	ENST00000248598	T	0.57107	0.42	5.87	5.87	0.94306	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);	0.469797	0.27176	N	0.020572	T	0.48466	0.1501	L	0.50333	1.59	0.35555	D	0.804223	B	0.02656	0.0	B	0.09377	0.004	T	0.51228	-0.8732	10	0.37606	T	0.19	.	14.9639	0.71176	0.0:0.0:0.8232:0.1768	.	417	Q14314	FGL2_HUMAN	N	417	ENSP00000248598:H417N	ENSP00000248598:H417N	H	-	1	0	FGL2	76663603	1.000000	0.71417	0.862000	0.33874	0.996000	0.88848	3.764000	0.55264	2.941000	0.99782	0.655000	0.94253	CAC	FGL2	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000127951		0.443	FGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGL2	HGNC	protein_coding	OTTHUMT00000253176.1	-	0.00	53	0	G	NM_006682		76825667	-1	tier1	-	no_errors	ENST00000248598	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.975	T
DMBT1P1	375940	genome.wustl.edu	37	10	124516322	124516322	+	RNA	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:124516322C>T	ENST00000439464.2	+	0	113					NR_003570.1																						GTGATGATCTCTGGGACCTGG	0.657																																																	0																																												0																															10.37:g.124516322C>T				RNA	SNP	-	NULL	ENST00000439464.2	37	NULL		10																																																																																			RP11-318C4.2	-	-	ENSG00000176584		0.657	RP11-318C4.2-001	KNOWN	basic	processed_transcript	FLJ46361	Clone_based_vega_gene	pseudogene	OTTHUMT00000471298.1	-	0.00	56	0	C			124516322	+1	tier1	-	no_errors	ENST00000439464	ensembl	human	known	74_37	rna	21.43	33	9	SNP	0.852	T
FLNB	2317	genome.wustl.edu	37	3	58145286	58145286	+	Silent	SNP	G	G	T	rs141740204		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:58145286G>T	ENST00000295956.4	+	42	7059	c.6894G>T	c.(6892-6894)tcG>tcT	p.S2298S	FLNB_ENST00000358537.3_Silent_p.S2274S|FLNB_ENST00000348383.5_Silent_p.S2257S|FLNB_ENST00000357272.4_3'UTR|FLNB-AS1_ENST00000488720.1_RNA|FLNB_ENST00000429972.2_Silent_p.S2287S|FLNB_ENST00000490882.1_Silent_p.S2329S|FLNB_ENST00000493452.1_Silent_p.S2105S|FLNB_ENST00000419752.2_Silent_p.S2118S	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	2298	Interaction with INPPL1.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.S2298S(2)|p.S2329S(1)		NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		CTCAGGAATCGGGATTAAAAG	0.502																																																	3	Substitution - coding silent(3)	lung(2)|large_intestine(1)											55.0	55.0	55.0					3																	58145286		2203	4300	6503	SO:0001819	synonymous_variant	0			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.6894G>T	3.37:g.58145286G>T			B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.S2298	ENST00000295956.4	37	c.6894	CCDS2885.1	3																																																																																			FLNB	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000136068		0.502	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLNB	HGNC	protein_coding	OTTHUMT00000353569.1		0.00	54	0	G	NM_001457		58145286	+1			no_errors	ENST00000295956	ensembl	human	known	74_37	silent	5.26	36	2	SNP	0.957	T
FMN1	342184	genome.wustl.edu	37	15	33359062	33359062	+	Intron	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr15:33359062G>T	ENST00000559047.1	-	3	2043				FMN1_ENST00000558197.1_Missense_Mutation_p.L342M|FMN1_ENST00000561249.1_Intron|FMN1_ENST00000559150.1_Intron|FMN1_ENST00000334528.9_Missense_Mutation_p.L342M			Q68DA7	FMN1_HUMAN	formin 1						actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		AGCTGCTCCAGGAGAGTGGGA	0.552																																																	0													65.0	68.0	67.0					15																	33359062		2011	4168	6179	SO:0001627	intron_variant	0			AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2044-1787C>A	15.37:g.33359062G>T			Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	pfam_FH2_Formin,smart_FH2_Formin,prints_Formin_Cappuccino_subfam	p.L342M	ENST00000559047.1	37	c.1024		15	.	.	.	.	.	.	.	.	.	.	G	13.61	2.288034	0.40494	.	.	ENSG00000248905	ENST00000334528	T	0.58060	0.36	5.68	3.59	0.41128	.	.	.	.	.	T	0.61800	0.2376	.	.	.	.	.	.	D;P	0.61697	0.99;0.936	P;P	0.59424	0.857;0.64	T	0.70117	-0.4960	7	0.54805	T	0.06	.	6.2921	0.21065	0.1919:0.0:0.6581:0.1499	.	342;342	Q68DA7-3;Q68DA7-5	.;.	M	342	ENSP00000333950:L342M	ENSP00000333950:L342M	L	-	1	2	FMN1	31146354	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.299000	0.33424	1.418000	0.47098	0.643000	0.83706	CTG	FMN1	-	NULL	ENSG00000248905		0.552	FMN1-005	NOVEL	basic|exp_conf	protein_coding	FMN1	HGNC	protein_coding	OTTHUMT00000417414.1		0.00	36	0	G	NM_001103184		33359062	-1			no_errors	ENST00000334528	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	T
FOXJ2	55810	genome.wustl.edu	37	12	8201390	8201390	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:8201390C>T	ENST00000162391.3	+	8	2468	c.1323C>T	c.(1321-1323)ttC>ttT	p.F441F	FOXJ2_ENST00000428177.2_Silent_p.F441F	NM_018416.2	NP_060886.1	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	441					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	16				Kidney(36;0.0944)		AGTCACAATTCTCAGGTTAGT	0.453																																																	0													125.0	123.0	124.0					12																	8201390		2203	4300	6503	SO:0001819	synonymous_variant	0			AF155132	CCDS8587.1	12p13.31	2006-12-15				ENSG00000065970		"""Forkhead boxes"""	24818	protein-coding gene	gene with protein product						10777590, 10966786	Standard	NM_018416		Approved	FHX	uc001qtu.3	Q9P0K8		ENST00000162391.3:c.1323C>T	12.37:g.8201390C>T			A0AVK4|B2RMP3|Q96PS9|Q9NSN5	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.F441	ENST00000162391.3	37	c.1323	CCDS8587.1	12																																																																																			FOXJ2	-	NULL	ENSG00000065970		0.453	FOXJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXJ2	HGNC	protein_coding	OTTHUMT00000400088.1	-	0.00	29	0	C	NM_018416		8201390	+1	tier1	-	no_errors	ENST00000162391	ensembl	human	known	74_37	silent	21.62	29	8	SNP	1.000	T
FMNL3	91010	genome.wustl.edu	37	12	50044990	50044990	+	Silent	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:50044990G>T	ENST00000293590.5	-	16	1991	c.1758C>A	c.(1756-1758)ggC>ggA	p.G586G	FMNL3_ENST00000352151.5_Silent_p.G535G|FMNL3_ENST00000550488.1_Silent_p.G586G|FMNL3_ENST00000335154.5_Silent_p.G586G			Q8IVF7	FMNL3_HUMAN	formin-like 3	586	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)	GTPase activating protein binding (GO:0032794)			breast(4)|endometrium(7)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|stomach(1)	39						TGAAGACAGTGCCACTGATCT	0.502																																																	0													111.0	107.0	108.0					12																	50044990		1973	4197	6170	SO:0001819	synonymous_variant	0			AK128195	CCDS41780.1, CCDS44874.1	12q13.12	2006-04-10							23698	protein-coding gene	gene with protein product						12684686	Standard	NM_198900		Approved	DKFZp762B245, MGC45819, WBP3	uc001ruv.1	Q8IVF7	OTTHUMG00000169651	ENST00000293590.5:c.1758C>A	12.37:g.50044990G>T			B0JZA7|Q6ZRJ1	Silent	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin	p.G586	ENST00000293590.5	37	c.1758		12																																																																																			FMNL3	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000161791		0.502	FMNL3-201	KNOWN	basic	protein_coding	FMNL3	HGNC	protein_coding			0.00	80	0	G	NM_175736		50044990	-1			no_errors	ENST00000293590	ensembl	human	known	74_37	silent	5.00	75	4	SNP	1.000	T
FOXN4	121643	genome.wustl.edu	37	12	109724463	109724463	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:109724463G>T	ENST00000299162.5	-	7	787	c.683C>A	c.(682-684)cCc>cAc	p.P228H	FOXN4_ENST00000355216.1_Missense_Mutation_p.P48H	NM_213596.2	NP_998761.2	Q96NZ1	FOXN4_HUMAN	forkhead box N4	228					amacrine cell differentiation (GO:0035881)|atrioventricular canal development (GO:0036302)|heart looping (GO:0001947)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of heart contraction (GO:0008016)|regulation of transcription, DNA-templated (GO:0006355)|retina layer formation (GO:0010842)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|lung(9)|ovary(2)	16						CTTGAAGTAGGGGAAGTGCTC	0.612																																																	0													98.0	70.0	80.0					12																	109724463		2203	4300	6503	SO:0001583	missense	0			AF425596	CCDS9126.2	12q24.12	2008-02-05			ENSG00000139445	ENSG00000139445		"""Forkhead boxes"""	21399	protein-coding gene	gene with protein product		609429					Standard	NM_213596		Approved		uc001toe.4	Q96NZ1	OTTHUMG00000152868	ENST00000299162.5:c.683C>A	12.37:g.109724463G>T	ENSP00000299162:p.Pro228His		Q6ZMR4|Q96NZ0	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.P228H	ENST00000299162.5	37	c.683	CCDS9126.2	12	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366745	0.82463	.	.	ENSG00000139445	ENST00000355216;ENST00000299162	D;D	0.96992	-4.2;-4.2	4.4	4.4	0.53042	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.000000	0.85682	D	0.000000	D	0.98972	0.9650	H	0.98786	4.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99184	1.0868	10	0.87932	D	0	-1.5799	16.3552	0.83233	0.0:0.0:1.0:0.0	.	228;228	A6H901;Q96NZ1	.;FOXN4_HUMAN	H	48;228	ENSP00000347354:P48H;ENSP00000299162:P228H	ENSP00000299162:P228H	P	-	2	0	FOXN4	108208846	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.815000	0.99349	2.171000	0.68590	0.491000	0.48974	CCC	FOXN4	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	ENSG00000139445		0.612	FOXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXN4	HGNC	protein_coding	OTTHUMT00000328306.1	-	0.00	32	0	G	XM_062735		109724463	-1	tier1	-	no_errors	ENST00000299162	ensembl	human	known	74_37	missense	14.29	18	3	SNP	1.000	T
FOXP1	27086	genome.wustl.edu	37	3	71015091	71015091	+	Silent	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:71015091G>T	ENST00000318789.4	-	20	2364	c.1839C>A	c.(1837-1839)acC>acA	p.T613T	FOXP1_ENST00000475937.1_Silent_p.T613T|FOXP1_ENST00000493089.1_Silent_p.T612T|FOXP1_ENST00000484350.1_Silent_p.T537T|FOXP1_ENST00000468577.1_Silent_p.T549T|FOXP1_ENST00000498215.1_Silent_p.T613T|FOXP1_ENST00000491238.1_Silent_p.T615T	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1	613			T -> N. {ECO:0000269|PubMed:20950788}.		negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		CGTTGCTGTTGGTATGCTCCA	0.517			T	PAX5	ALL																																			Dom	yes		3	3p14.1	27086	forkhead box P1		L	0													315.0	259.0	278.0					3																	71015091		2203	4300	6503	SO:0001819	synonymous_variant	0			AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.1839C>A	3.37:g.71015091G>T			A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,prints_TF_fork_head,pfscan_TF_fork_head	p.T613	ENST00000318789.4	37	c.1839	CCDS2914.1	3																																																																																			FOXP1	-	NULL	ENSG00000114861		0.517	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FOXP1	HGNC	protein_coding	OTTHUMT00000352250.1		0.00	62	0	G	NM_032682		71015091	-1			no_errors	ENST00000318789	ensembl	human	known	74_37	silent	11.11	32	4	SNP	1.000	T
FRG1B	284802	genome.wustl.edu	37	20	29612021	29612021	+	5'UTR	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr20:29612021C>G	ENST00000278882.3	+	0	165				FRG1B_ENST00000468180.2_3'UTR|FRG1B_ENST00000439954.2_5'UTR|FRG1B_ENST00000358464.4_5'UTR			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						CGGCTTCAGCCTGTCCGCGCA	0.582																																																	0																																										SO:0001623	5_prime_UTR_variant	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-216C>G	20.37:g.29612021C>G			C4AME5	RNA	SNP	-	NULL	ENST00000278882.3	37	NULL		20																																																																																			FRG1B	-	-	ENSG00000149531		0.582	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	HGNC	protein_coding	OTTHUMT00000078494.2	-	0.00	123	0	C	NR_003579		29612021	+1	tier1	-	no_errors	ENST00000468180	ensembl	human	known	74_37	rna	16.67	73	15	SNP	0.000	G
FSD1L	83856	genome.wustl.edu	37	9	108296830	108296830	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr9:108296830G>T	ENST00000481272.1	+	11	1201	c.1082G>T	c.(1081-1083)aGa>aTa	p.R361I	FSD1L_ENST00000484973.1_Missense_Mutation_p.R328I|FSD1L_ENST00000394926.3_Missense_Mutation_p.R340I|FSD1L_ENST00000374710.3_Missense_Mutation_p.R329I|FSD1L_ENST00000539376.1_Missense_Mutation_p.R214I|FSD1L_ENST00000374707.1_Missense_Mutation_p.R142I	NM_001145313.1	NP_001138785.1	Q9BXM9	FSD1L_HUMAN	fibronectin type III and SPRY domain containing 1-like	361	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.									NS(1)|endometrium(1)	2						CCAGCAGTAAGAGGCAGTAGA	0.368																																																	0													113.0	105.0	108.0					9																	108296830		692	1591	2283	SO:0001583	missense	0			AF316830	CCDS6765.2, CCDS47999.1, CCDS6765.3, CCDS75870.1	9q31	2013-02-11	2006-03-10	2006-03-10	ENSG00000106701	ENSG00000106701		"""Fibronectin type III domain containing"""	13753	protein-coding gene	gene with protein product		609829	"""cystatin and DUF19 domain containing 1"", ""coiled-coil domain containing 10"""	CSDUFD1, CCDC10, FSD1NL, FSD1CL		11267680	Standard	XM_005252254		Approved		uc004bcq.2	Q9BXM9	OTTHUMG00000020426	ENST00000481272.1:c.1082G>T	9.37:g.108296830G>T	ENSP00000417492:p.Arg361Ile		A2A338|A6NKH7|B7Z5S6|B7Z5W3|Q5T879|Q5T880	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,prints_Butyrophylin	p.R214I	ENST00000481272.1	37	c.641	CCDS47999.1	9	.	.	.	.	.	.	.	.	.	.	G	32	5.161294	0.94727	.	.	ENSG00000106701	ENST00000374710;ENST00000481272;ENST00000484973;ENST00000394926;ENST00000539376;ENST00000374707	T;T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58;1.58	5.22	5.22	0.72569	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.062160	0.64402	D	0.000007	T	0.49355	0.1552	L	0.50333	1.59	0.80722	D	1	D;D;D	0.63880	0.993;0.978;0.993	D;P;D	0.66351	0.943;0.828;0.943	T	0.47548	-0.9109	10	0.72032	D	0.01	.	16.6441	0.85172	0.0:0.0:1.0:0.0	.	340;361;329	F8W946;Q9BXM9;Q9BXM9-2	.;FSD1L_HUMAN;.	I	329;361;328;340;214;142	ENSP00000363842:R329I;ENSP00000417492:R361I;ENSP00000419691:R328I;ENSP00000378384:R340I;ENSP00000438140:R214I;ENSP00000363839:R142I	ENSP00000363839:R142I	R	+	2	0	FSD1L	107336651	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.213000	0.77950	2.609000	0.88269	0.563000	0.77884	AGA	FSD1L	-	superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY	ENSG00000106701		0.368	FSD1L-007	NOVEL	basic|CCDS	protein_coding	FSD1L	HGNC	protein_coding	OTTHUMT00000349935.1	-	0.00	32	0	G	NM_207647		108296830	+1	tier1	-	no_errors	ENST00000539376	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
FSHR	2492	genome.wustl.edu	37	2	49381432	49381432	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:49381432G>A	ENST00000406846.2	-	1	244	c.125C>T	c.(124-126)tCt>tTt	p.S42F	FSHR_ENST00000304421.4_Missense_Mutation_p.S42F|FSHR_ENST00000346173.3_Missense_Mutation_p.S42F	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	42	LRRNT.				female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	CGGGAGGTCAGAAGGAATCTC	0.478									Gonadal Dysgenesis, 46 XX																																								0													71.0	71.0	71.0					2																	49381432		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.125C>T	2.37:g.49381432G>A	ENSP00000384708:p.Ser42Phe		A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_GnHR_TM,pfam_LRR-contain_N,pfam_Leu-rich_rpt,smart_LRR-contain_N,pfscan_GPCR_Rhodpsn_7TM,prints_FSH_rcpt,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,prints_TSH_rcpt	p.S42F	ENST00000406846.2	37	c.125	CCDS1843.1	2	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980977	0.53827	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000454032	D;D;D;D	0.96685	-4.09;-4.09;-4.09;-4.09	5.46	5.46	0.80206	Leucine-rich repeat-containing N-terminal (2);	0.797796	0.11225	N	0.586312	D	0.96278	0.8786	M	0.65975	2.015	0.80722	D	1	P;P;P	0.50528	0.658;0.936;0.593	P;B;P	0.47864	0.559;0.382;0.473	D	0.94311	0.7545	9	.	.	.	.	14.6913	0.69087	0.0:0.0:1.0:0.0	.	42;42;42	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	F	42	ENSP00000384708:S42F;ENSP00000333908:S42F;ENSP00000306780:S42F;ENSP00000415504:S42F	.	S	-	2	0	FSHR	49234936	0.001000	0.12720	0.682000	0.30024	0.648000	0.38561	0.806000	0.27126	2.840000	0.97914	0.655000	0.94253	TCT	FSHR	-	pfam_LRR-contain_N,smart_LRR-contain_N	ENSG00000170820		0.478	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSHR	HGNC	protein_coding	OTTHUMT00000251367.2	-	0.00	54	0	G			49381432	-1	tier1	-	no_errors	ENST00000406846	ensembl	human	known	74_37	missense	15.38	21	4	SNP	0.379	A
FYCO1	79443	genome.wustl.edu	37	3	46021323	46021323	+	Splice_Site	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:46021323C>T	ENST00000296137.2	-	4	368		c.e4-1		FYCO1_ENST00000535325.1_Splice_Site	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1						plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		TCTGATCAAACTGGGTAGGGA	0.488																																																	0													156.0	160.0	159.0					3																	46021323		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.163-1G>A	3.37:g.46021323C>T			B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Splice_Site	SNP	-	e3-1	ENST00000296137.2	37	c.163-1	CCDS2734.1	3	.	.	.	.	.	.	.	.	.	.	C	20.5	4.008059	0.75046	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7942	0.88565	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FYCO1	45996327	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	7.477000	0.81069	2.641000	0.89580	0.585000	0.79938	.	FYCO1	-	-	ENSG00000163820		0.488	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FYCO1	HGNC	protein_coding	OTTHUMT00000257320.2	-	0.00	39	0	C	NM_024513	Intron	46021323	-1	tier1	-	no_errors	ENST00000535325	ensembl	human	known	74_37	splice_site	8.70	42	4	SNP	1.000	T
GABRA1	2554	genome.wustl.edu	37	5	161317974	161317974	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:161317974C>A	ENST00000428797.2	+	9	1129	c.774C>A	c.(772-774)taC>taA	p.Y258*	GABRA1_ENST00000444819.1_Nonsense_Mutation_p.Y258*|GABRA1_ENST00000437025.2_Nonsense_Mutation_p.Y258*|GABRA1_ENST00000420560.1_Nonsense_Mutation_p.Y258*|GABRA1_ENST00000023897.6_Nonsense_Mutation_p.Y258*|GABRA1_ENST00000393943.4_Nonsense_Mutation_p.Y258*	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	258					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	TTCAAACATACCTGCCATGCA	0.398																																																	0													140.0	132.0	135.0					5																	161317974		2203	4300	6503	SO:0001587	stop_gained	0				CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.774C>A	5.37:g.161317974C>A	ENSP00000393097:p.Tyr258*		D3DQK6|Q8N629	Nonsense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa1_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.Y258*	ENST00000428797.2	37	c.774	CCDS4357.1	5	.	.	.	.	.	.	.	.	.	.	C	25.1	4.604747	0.87157	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000420560;ENST00000444819	.	.	.	5.52	0.696	0.18075	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0249	0.42066	0.0:0.5539:0.0:0.4461	.	.	.	.	X	258	.	ENSP00000023897:Y258X	Y	+	3	2	GABRA1	161250552	0.147000	0.22687	0.998000	0.56505	0.566000	0.35808	-0.402000	0.07223	0.041000	0.15688	-0.145000	0.13849	TAC	GABRA1	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel	ENSG00000022355		0.398	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA1	HGNC	protein_coding	OTTHUMT00000252702.2	-	0.00	46	0	C	NM_000806.5		161317974	+1	tier1	-	no_errors	ENST00000023897	ensembl	human	known	74_37	nonsense	28.21	28	11	SNP	0.992	A
GBP1	2633	genome.wustl.edu	37	1	89520389	89520389	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:89520389C>G	ENST00000370473.4	-	10	1860	c.1641G>C	c.(1639-1641)gaG>gaC	p.E547D	GBP1_ENST00000484970.1_5'UTR	NM_002053.2	NP_002044.2	P32455	GBP1_HUMAN	guanylate binding protein 1, interferon-inducible	547					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)	cytosol (GO:0005829)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			endometrium(7)|kidney(4)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	30		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		CGAGGGTCCTCTCTTGCTCTT	0.448																																																	0													223.0	217.0	219.0					1																	89520389		2203	4300	6503	SO:0001583	missense	0			BC002666	CCDS718.1	1p22.2	2011-03-09	2011-03-09		ENSG00000117228	ENSG00000117228			4182	protein-coding gene	gene with protein product		600411	"""guanylate binding protein 1, interferon-inducible, 67kDa"""			7518790	Standard	NM_002053		Approved		uc001dmx.2	P32455	OTTHUMG00000010614	ENST00000370473.4:c.1641G>C	1.37:g.89520389C>G	ENSP00000359504:p.Glu547Asp		D3DT26|Q5T8M1	Missense_Mutation	SNP	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.E547D	ENST00000370473.4	37	c.1641	CCDS718.1	1	.	.	.	.	.	.	.	.	.	.	C	9.328	1.059680	0.19987	.	.	ENSG00000117228	ENST00000370473;ENST00000542693	T	0.57595	0.39	4.67	-0.822	0.10819	Guanylate-binding protein, C-terminal (3);	0.376773	0.26156	N	0.026020	T	0.21841	0.0526	L	0.60957	1.885	0.09310	N	1	B	0.13145	0.007	B	0.19148	0.024	T	0.28106	-1.0054	10	0.46703	T	0.11	.	5.3744	0.16156	0.0:0.4455:0.1372:0.4173	.	547	P32455	GBP1_HUMAN	D	547;510	ENSP00000359504:E547D	ENSP00000359504:E547D	E	-	3	2	GBP1	89292977	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-1.491000	0.02302	-0.488000	0.06726	-0.326000	0.08463	GAG	GBP1	-	pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	ENSG00000117228		0.448	GBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP1	HGNC	protein_coding	OTTHUMT00000029289.3	-	0.00	31	0	C	NM_002053		89520389	-1	tier1	-	no_errors	ENST00000370473	ensembl	human	known	74_37	missense	30.00	21	9	SNP	0.000	G
GBP1	2633	genome.wustl.edu	37	1	89520993	89520993	+	Intron	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:89520993C>G	ENST00000370473.4	-	9	1588				GBP1_ENST00000484970.1_5'UTR	NM_002053.2	NP_002044.2	P32455	GBP1_HUMAN	guanylate binding protein 1, interferon-inducible						cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)	cytosol (GO:0005829)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			endometrium(7)|kidney(4)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	30		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		TCTGGGAATTCTTTCTCTTGG	0.493																																																	0																																										SO:0001627	intron_variant	0			BC002666	CCDS718.1	1p22.2	2011-03-09	2011-03-09		ENSG00000117228	ENSG00000117228			4182	protein-coding gene	gene with protein product		600411	"""guanylate binding protein 1, interferon-inducible, 67kDa"""			7518790	Standard	NM_002053		Approved		uc001dmx.2	P32455	OTTHUMG00000010614	ENST00000370473.4:c.1369-95G>C	1.37:g.89520993C>G			D3DT26|Q5T8M1	RNA	SNP	-	NULL	ENST00000370473.4	37	NULL	CCDS718.1	1																																																																																			GBP1	-	-	ENSG00000117228		0.493	GBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP1	HGNC	protein_coding	OTTHUMT00000029289.3	-	0.00	67	0	C	NM_002053		89520993	-1	tier1	-	no_errors	ENST00000479889	ensembl	human	known	74_37	rna	21.52	62	17	SNP	0.000	G
GIPC1	10755	genome.wustl.edu	37	19	14589343	14589343	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:14589343T>A	ENST00000393033.4	-	9	1156	c.887A>T	c.(886-888)aAc>aTc	p.N296I	GIPC1_ENST00000393029.3_Missense_Mutation_p.N199I|GIPC1_ENST00000586027.1_Missense_Mutation_p.N296I|GIPC1_ENST00000591349.1_Missense_Mutation_p.N199I|GIPC1_ENST00000345425.2_Missense_Mutation_p.N296I|GIPC1_ENST00000393028.1_Missense_Mutation_p.N199I	NM_005716.3	NP_005707.1	O14908	GIPC1_HUMAN	GIPC PDZ domain containing family, member 1	296					endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|glutamate secretion (GO:0014047)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of cytokinesis (GO:0032467)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein targeting (GO:0006605)|regulation of protein stability (GO:0031647)|regulation of synaptic plasticity (GO:0048167)|synaptic transmission (GO:0007268)	brush border (GO:0005903)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|myosin binding (GO:0017022)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(1)|lung(4)|upper_aerodigestive_tract(1)	6						CTCATCCGGGTTCCTTTTGTC	0.622																																					Pancreas(33;78 923 2910 41023 52850)												0													40.0	42.0	41.0					19																	14589343		2203	4300	6503	SO:0001583	missense	0			AF089816	CCDS12310.1, CCDS12311.1	19p13.1	2009-09-22	2005-06-28	2005-06-28					1226	protein-coding gene	gene with protein product		605072	"""chromosome 19 open reading frame 3"", ""regulator of G-protein signalling 19 interacting protein 1"""	C19orf3, RGS19IP1		9770488, 9482110	Standard	NM_005716		Approved	TIP-2, Hs.6454, GIPC, SEMCAP, GLUT1CBP, SYNECTIN, NIP	uc002myx.4	O14908		ENST00000393033.4:c.887A>T	19.37:g.14589343T>A	ENSP00000376753:p.Asn296Ile		A8K4I3|A8MZG3|Q9BTC9	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_UCP038083_PDZ,pfscan_PDZ	p.N296I	ENST00000393033.4	37	c.887	CCDS12310.1	19	.	.	.	.	.	.	.	.	.	.	t	24.9	4.577823	0.86645	.	.	ENSG00000123159	ENST00000393033;ENST00000345425;ENST00000393029;ENST00000393028;ENST00000351277	D;D;D;D	0.87887	-1.77;-1.77;-2.31;-2.31	4.28	4.28	0.50868	.	0.104380	0.64402	D	0.000007	D	0.93190	0.7831	M	0.89478	3.035	0.58432	D	0.999999	D	0.63880	0.993	D	0.64506	0.926	D	0.93940	0.7222	10	0.87932	D	0	-12.8588	11.3771	0.49735	0.0:0.0:0.0:1.0	.	296	O14908	GIPC1_HUMAN	I	296;296;199;199;296	ENSP00000376753:N296I;ENSP00000340698:N296I;ENSP00000376749:N199I;ENSP00000376748:N199I	ENSP00000340698:N296I	N	-	2	0	GIPC1	14450343	1.000000	0.71417	0.995000	0.50966	0.980000	0.70556	1.902000	0.39848	1.586000	0.49944	0.454000	0.30748	AAC	GIPC1	-	pirsf_UCP038083_PDZ	ENSG00000123159		0.622	GIPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIPC1	HGNC	protein_coding	OTTHUMT00000460239.2	-	0.00	31	0	T			14589343	-1	tier1	-	no_errors	ENST00000345425	ensembl	human	known	74_37	missense	23.08	30	9	SNP	1.000	A
GNAO1	2775	genome.wustl.edu	37	16	56370660	56370660	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr16:56370660G>T	ENST00000262493.6	+	6	1457	c.611G>T	c.(610-612)gGc>gTc	p.G204V	GNAO1_ENST00000262494.7_Missense_Mutation_p.G204V	NM_020988.2	NP_066268.1	P09471	GNAO_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O	204					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|dopamine receptor signaling pathway (GO:0007212)|forebrain development (GO:0030900)|locomotory behavior (GO:0007626)|muscle contraction (GO:0006936)|negative regulation of calcium ion transport (GO:0051926)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|regulation of heart contraction (GO:0008016)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to morphine (GO:0043278)	heterotrimeric G-protein complex (GO:0005834)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	corticotropin-releasing hormone receptor 1 binding (GO:0051430)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|mu-type opioid receptor binding (GO:0031852)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)	17		all_neural(199;0.159)				GACGTCGGAGGCCAGCGATCT	0.602																																																	0													80.0	59.0	66.0					16																	56370660		2198	4300	6498	SO:0001583	missense	0				CCDS10756.1, CCDS10757.1	16q13	2008-08-01			ENSG00000087258	ENSG00000087258			4389	protein-coding gene	gene with protein product		139311				1899283, 11395521	Standard	NM_020988		Approved	G-ALPHA-o	uc002eit.4	P09471	OTTHUMG00000133241	ENST00000262493.6:c.611G>T	16.37:g.56370660G>T	ENSP00000262493:p.Gly204Val		P29777|Q8TD72|Q9UMV4	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I	p.G204V	ENST00000262493.6	37	c.611	CCDS10756.1	16	.	.	.	.	.	.	.	.	.	.	G	24.0	4.477108	0.84640	.	.	ENSG00000087258	ENST00000262493;ENST00000262494	D;D	0.99201	-5.55;-5.55	5.28	4.31	0.51392	.	0.054309	0.64402	D	0.000001	D	0.99670	0.9877	H	0.99682	4.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97075	0.9780	10	0.87932	D	0	.	15.8025	0.78463	0.0:0.1366:0.8634:0.0	.	204;204	P09471;P09471-2	GNAO_HUMAN;.	V	204	ENSP00000262493:G204V;ENSP00000262494:G204V	ENSP00000262493:G204V	G	+	2	0	GNAO1	54928161	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.856000	0.99531	1.183000	0.42943	0.557000	0.71058	GGC	GNAO1	-	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su	ENSG00000087258		0.602	GNAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAO1	HGNC	protein_coding	OTTHUMT00000256981.2		0.00	53	0	G	NM_020988		56370660	+1			no_errors	ENST00000262493	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
GPAT2	150763	genome.wustl.edu	37	2	96688929	96688929	+	Missense_Mutation	SNP	G	G	A	rs201647131	byFrequency	TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:96688929G>A	ENST00000434632.1	-	20	2533	c.2074C>T	c.(2074-2076)Cgc>Tgc	p.R692C	GPAT2_ENST00000359548.4_Missense_Mutation_p.R692C|FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000377137.3_Intron|GPAT2_ENST00000453542.1_Missense_Mutation_p.R621C			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	692					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.R692C(3)		NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						CTGAGCAGGCGGCAGAGGAAA	0.652																																																	3	Substitution - Missense(3)	large_intestine(1)|NS(1)|skin(1)											14.0	17.0	16.0					2																	96688929		1816	4045	5861	SO:0001583	missense	0			BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.2074C>T	2.37:g.96688929G>A	ENSP00000389395:p.Arg692Cys		Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Missense_Mutation	SNP	smart_Plipid/glycerol_acylTrfase	p.R692C	ENST00000434632.1	37	c.2074	CCDS42714.1	2	152	0.0695970695970696	8	0.016260162601626018	16	0.04419889502762431	27	0.0472027972027972	101	0.13324538258575197	g	16.45	3.127649	0.56721	.	.	ENSG00000186281	ENST00000359548;ENST00000434632;ENST00000453542	T;T;T	0.80480	-1.38;-1.38;-0.41	5.44	5.44	0.79542	.	0.381151	0.27411	N	0.019488	T	0.02727	0.0082	L	0.50333	1.59	0.80722	D	1	P;D;P;B	0.54207	0.584;0.965;0.953;0.354	B;B;B;B	0.42062	0.093;0.374;0.267;0.065	T	0.41840	-0.9486	10	0.66056	D	0.02	-11.9956	16.7485	0.85479	0.0:0.0:1.0:0.0	.	621;698;692;621	E9PE95;Q6NUI2-4;Q6NUI2;B4DNZ9	.;.;GPAT2_HUMAN;.	C	692;692;621	ENSP00000352547:R692C;ENSP00000389395:R692C;ENSP00000393770:R621C	ENSP00000352547:R692C	R	-	1	0	GPAT2	96052656	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.041000	0.49807	2.569000	0.86673	0.637000	0.83480	CGC	GPAT2	-	NULL	ENSG00000186281		0.652	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAT2	HGNC	protein_coding	OTTHUMT00000338786.1	-	0.00	37	0	G	NM_207328		96688929	-1	tier1	rs201647131	no_errors	ENST00000359548	ensembl	human	known	74_37	missense	20.69	23	6	SNP	1.000	A
GPR112	139378	genome.wustl.edu	37	X	135429986	135429987	+	Frame_Shift_Ins	INS	-	-	T	rs367750296		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:135429986_135429987insT	ENST00000394143.1	+	6	4412_4413	c.4121_4122insT	c.(4120-4125)acttttfs	p.TF1374fs	GPR112_ENST00000412101.1_Frame_Shift_Ins_p.TF1169fs|GPR112_ENST00000370652.1_Frame_Shift_Ins_p.TF1374fs|GPR112_ENST00000287534.4_Frame_Shift_Ins_p.TF1311fs|GPR112_ENST00000394141.1_Frame_Shift_Ins_p.TF1169fs	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1374					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACAATCACCACTTTTTTGTGTC	0.46																																																	0																																										SO:0001589	frameshift_variant	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.4127dupT	X.37:g.135429992_135429992dupT	ENSP00000377699:p.Thr1374fs		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Frame_Shift_Ins	INS	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.L1376fs	ENST00000394143.1	37	c.4121_4122	CCDS35409.1	X																																																																																			GPR112	-	NULL	ENSG00000156920		0.460	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1		0.00	39	0	-			135429987	+1	tier1		no_errors	ENST00000370652	ensembl	human	known	74_37	frame_shift_ins	22.92	37	11	INS	0.029:0.014	T
GPR112	139378	genome.wustl.edu	37	X	135430355	135430355	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:135430355T>C	ENST00000394143.1	+	6	4781	c.4490T>C	c.(4489-4491)aTg>aCg	p.M1497T	GPR112_ENST00000412101.1_Missense_Mutation_p.M1292T|GPR112_ENST00000370652.1_Missense_Mutation_p.M1497T|GPR112_ENST00000287534.4_Missense_Mutation_p.M1434T|GPR112_ENST00000394141.1_Missense_Mutation_p.M1292T	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1497					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					GTACCTACAATGCTTCCTAGA	0.433																																																	0													90.0	85.0	86.0					X																	135430355		2203	4297	6500	SO:0001583	missense	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.4490T>C	X.37:g.135430355T>C	ENSP00000377699:p.Met1497Thr		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.M1497T	ENST00000394143.1	37	c.4490	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	t	0	-2.597736	0.00125	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.27256	1.71;1.71;1.68;1.82;1.68	2.81	-0.959	0.10343	.	.	.	.	.	T	0.08268	0.0206	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.34775	-0.9815	9	0.02654	T	1	.	2.8275	0.05489	0.2221:0.4743:0.0:0.3036	.	1434;1292;1497	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	T	1497;1497;1292;1434;1292	ENSP00000377699:M1497T;ENSP00000359686:M1497T;ENSP00000416526:M1292T;ENSP00000287534:M1434T;ENSP00000377697:M1292T	ENSP00000287534:M1434T	M	+	2	0	GPR112	135258021	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.041000	0.12084	-0.457000	0.07033	-0.668000	0.03835	ATG	GPR112	-	NULL	ENSG00000156920		0.433	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	-	0.00	53	0	T			135430355	+1	tier1	-	no_errors	ENST00000370652	ensembl	human	known	74_37	missense	15.91	37	7	SNP	0.000	C
GPR179	440435	genome.wustl.edu	37	17	36484015	36484015	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr17:36484015C>T	ENST00000342292.4	-	11	5457	c.5437G>A	c.(5437-5439)Gaa>Aaa	p.E1813K	GPR179_ENST00000584976.1_Intron	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1813					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TTGGCTTTTTCACTGGTAGCA	0.532																																																	0													158.0	149.0	152.0					17																	36484015		1963	4152	6115	SO:0001583	missense	0				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.5437G>A	17.37:g.36484015C>T	ENSP00000345060:p.Glu1813Lys			Missense_Mutation	SNP	pfam_GPCR_3_C,superfamily_Growth_fac_rcpt_N_dom,pfscan_GPCR_3_C	p.E1813K	ENST00000342292.4	37	c.5437	CCDS42308.1	17	.	.	.	.	.	.	.	.	.	.	C	15.39	2.820554	0.50633	.	.	ENSG00000188888	ENST00000342292	T	0.52295	0.67	4.7	2.72	0.32119	.	0.616301	0.14415	N	0.321015	T	0.38427	0.1040	M	0.61703	1.905	0.09310	N	1	P	0.42203	0.773	B	0.31290	0.127	T	0.24119	-1.0169	10	0.54805	T	0.06	-1.7419	8.6863	0.34240	0.0:0.8148:0.0:0.1852	.	1813	Q6PRD1	GP179_HUMAN	K	1813	ENSP00000345060:E1813K	ENSP00000345060:E1813K	E	-	1	0	GPR179	33737541	0.000000	0.05858	0.960000	0.40013	0.935000	0.57460	0.067000	0.14510	0.599000	0.29845	0.655000	0.94253	GAA	GPR179	-	NULL	ENSG00000188888		0.532	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	HGNC	protein_coding	OTTHUMT00000255329.2		0.00	11	0	C			36484015	-1			no_errors	ENST00000342292	ensembl	human	known	74_37	missense	15.38	11	2	SNP	0.073	T
GPR180	160897	genome.wustl.edu	37	13	95257761	95257761	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr13:95257761G>T	ENST00000376958.4	+	2	287	c.262G>T	c.(262-264)Ggt>Tgt	p.G88C		NM_180989.5	NP_851320.1	Q86V85	GP180_HUMAN	G protein-coupled receptor 180	88					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	10	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					AAGCAGTCATGGTTATAGCTG	0.373																																																	0													110.0	101.0	104.0					13																	95257761		2203	4300	6503	SO:0001583	missense	0			AF339823	CCDS9472.1	13q32.1	2006-04-05			ENSG00000152749	ENSG00000152749			28899	protein-coding gene	gene with protein product	"""intimal thickness related receptor"""	607787				12538434	Standard	NM_180989		Approved	ITR	uc001vly.3	Q86V85	OTTHUMG00000017207	ENST00000376958.4:c.262G>T	13.37:g.95257761G>T	ENSP00000366157:p.Gly88Cys		A8K1D5	Missense_Mutation	SNP	pfam_Intimal_thickness-rel_rcpt,pfam_TM_rcpt_euk	p.G88C	ENST00000376958.4	37	c.262	CCDS9472.1	13	.	.	.	.	.	.	.	.	.	.	G	12.66	2.003225	0.35320	.	.	ENSG00000152749	ENST00000376958	T	0.46063	0.88	5.9	3.27	0.37495	.	1.030760	0.07629	N	0.928257	T	0.33089	0.0851	L	0.36672	1.1	0.09310	N	1	P	0.40660	0.726	B	0.32980	0.156	T	0.15150	-1.0447	10	0.49607	T	0.09	-5.8031	11.2563	0.49056	0.1962:0.0:0.8038:0.0	.	88	Q86V85	GP180_HUMAN	C	88	ENSP00000366157:G88C	ENSP00000366157:G88C	G	+	1	0	GPR180	94055762	0.100000	0.21855	0.000000	0.03702	0.913000	0.54294	2.795000	0.47861	0.414000	0.25790	0.650000	0.86243	GGT	GPR180	-	NULL	ENSG00000152749		0.373	GPR180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR180	HGNC	protein_coding	OTTHUMT00000045465.3	-	0.00	43	0	G	NM_180989		95257761	+1	tier1	-	no_errors	ENST00000376958	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.005	T
GSTCD	79807	genome.wustl.edu	37	4	106640346	106640346	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:106640346C>T	ENST00000515279.1	+	3	776	c.556C>T	c.(556-558)Cct>Tct	p.P186S	GSTCD_ENST00000360505.5_Missense_Mutation_p.P186S|GSTCD_ENST00000507281.1_Missense_Mutation_p.P99S|GSTCD_ENST00000394728.3_Missense_Mutation_p.P186S|GSTCD_ENST00000394730.3_Missense_Mutation_p.P99S|GSTCD_ENST00000515255.1_Intron			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	186	GST C-terminal.					extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		GCTTAGTGAGCCTGTTAGAGT	0.458																																																	0													109.0	119.0	115.0					4																	106640346		2203	4300	6503	SO:0001583	missense	0			BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.556C>T	4.37:g.106640346C>T	ENSP00000422354:p.Pro186Ser		A8K8J0|A8MVD3|H9KV97|Q9H8S3	Missense_Mutation	SNP	pfam_rRNA_ssu_MeTfrase_G,pfam_Small_mtfrase_dom,superfamily_Glutathione-S-Trfase_C-like	p.P186S	ENST00000515279.1	37	c.556	CCDS43257.1	4	.	.	.	.	.	.	.	.	.	.	C	28.7	4.941491	0.92526	.	.	ENSG00000138780	ENST00000394730;ENST00000507281;ENST00000515279;ENST00000360505;ENST00000394728	.	.	.	5.17	5.17	0.71159	Glutathione S-transferase, C-terminal-like (1);Glutathione S-transferase/chloride channel, C-terminal (1);	0.108809	0.64402	D	0.000004	D	0.84745	0.5540	M	0.86953	2.85	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87171	0.2221	9	0.87932	D	0	-12.8027	18.8657	0.92292	0.0:1.0:0.0:0.0	.	99;186	D6R9W2;Q8NEC7	.;GSTCD_HUMAN	S	99;99;186;186;186	.	ENSP00000353695:P186S	P	+	1	0	GSTCD	106859795	1.000000	0.71417	0.978000	0.43139	0.990000	0.78478	7.023000	0.76437	2.684000	0.91462	0.650000	0.86243	CCT	GSTCD	-	superfamily_Glutathione-S-Trfase_C-like	ENSG00000138780		0.458	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GSTCD	HGNC	protein_coding	OTTHUMT00000363981.1	-	0.00	41	0	C	NM_024751		106640346	+1	tier1	-	no_errors	ENST00000360505	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
GTF2H5	404672	genome.wustl.edu	37	6	158613034	158613034	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:158613034C>T	ENST00000607778.1	+	3	139	c.61C>T	c.(61-63)Ctg>Ttg	p.L21L		NM_207118.2	NP_997001.1	Q6ZYL4	TF2H5_HUMAN	general transcription factor IIH, polypeptide 5	21			L -> P (in TTDP). {ECO:0000269|PubMed:15220921}.		cellular response to gamma radiation (GO:0071480)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, preincision complex assembly (GO:0006294)|regulation of transcription, DNA-templated (GO:0006355)|rRNA processing (GO:0006364)|transcription elongation from RNA polymerase I promoter (GO:0006362)	core TFIIH complex (GO:0000439)|nucleolus (GO:0005730)	rDNA binding (GO:0000182)						Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;5.98e-18)|BRCA - Breast invasive adenocarcinoma(81;2.83e-05)		GCAGTTTCTGCTGTACTTGGA	0.408								Nucleotide excision repair (NER)																																									0													141.0	114.0	123.0					6																	158613034		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055106	CCDS5256.1	6q25.3	2014-09-17	2004-07-15	2004-07-16		ENSG00000272047		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	21157	protein-coding gene	gene with protein product	"""DNA repair syndrome trichothiodystrophy group A"""	608780	"""chromosome 6 open reading frame 175"", ""trichothiodystrophy"""	C6orf175, TTD		15220921	Standard	NM_207118		Approved	FLJ30544, bA120J8.2, TTD-A, TFB5, TFIIH, TTDA	uc003qrd.3	Q6ZYL4		ENST00000607778.1:c.61C>T	6.37:g.158613034C>T			Q0P5V8	Silent	SNP	pfam_TFIIH_TTDA/Tfb5,superfamily_TFIIH_TTDA/Tfb5	p.L21	ENST00000607778.1	37	c.61	CCDS5256.1	6																																																																																			GTF2H5	-	pfam_TFIIH_TTDA/Tfb5,superfamily_TFIIH_TTDA/Tfb5	ENSG00000272047		0.408	GTF2H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2H5	HGNC	protein_coding	OTTHUMT00000042865.2	-	0.00	57	0	C	NM_207118		158613034	+1	tier1	-	no_errors	ENST00000607778	ensembl	human	known	74_37	silent	6.78	55	4	SNP	1.000	T
GTF2IRD1	9569	genome.wustl.edu	37	7	74016708	74016708	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr7:74016708T>C	ENST00000265755.3	+	27	3221	c.2828T>C	c.(2827-2829)aTg>aCg	p.M943T	GTF2IRD1_ENST00000455841.2_Missense_Mutation_p.M960T|GTF2IRD1_ENST00000424337.2_Missense_Mutation_p.M928T|GTF2IRD1_ENST00000476977.1_3'UTR	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	943					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CCAATGTACATGGTGGACTAT	0.483																																																	0													142.0	130.0	134.0					7																	74016708		2203	4300	6503	SO:0001583	missense	0			AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.2828T>C	7.37:g.74016708T>C	ENSP00000265755:p.Met943Thr		O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Missense_Mutation	SNP	pfam_GTF2I,superfamily_GTF2I,pirsf_TF_II-I,pfscan_GTF2I	p.M943T	ENST00000265755.3	37	c.2828	CCDS5571.1	7	.	.	.	.	.	.	.	.	.	.	T	14.63	2.593244	0.46214	.	.	ENSG00000006704	ENST00000265755;ENST00000455841;ENST00000424337	T;T;T	0.38560	1.13;1.13;1.14	5.66	5.66	0.87406	.	0.292083	0.36628	N	0.002486	T	0.56217	0.1970	L	0.48642	1.525	0.80722	D	1	D;D;D	0.60160	0.973;0.987;0.984	P;D;D	0.66716	0.885;0.942;0.946	T	0.53760	-0.8393	10	0.40728	T	0.16	-27.5613	15.0547	0.71904	0.0:0.0:0.0:1.0	.	960;943;928	Q6DSU6;Q9UHL9;Q9UHL9-2	.;GT2D1_HUMAN;.	T	943;960;928	ENSP00000265755:M943T;ENSP00000397566:M960T;ENSP00000408477:M928T	ENSP00000265755:M943T	M	+	2	0	GTF2IRD1	73654644	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.255000	0.65462	2.149000	0.67028	0.459000	0.35465	ATG	GTF2IRD1	-	NULL	ENSG00000006704		0.483	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTF2IRD1	HGNC	protein_coding	OTTHUMT00000252654.2	-	0.00	76	0	T	NM_016328		74016708	+1	tier1	-	no_errors	ENST00000265755	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	C
GTF3C2	2976	genome.wustl.edu	37	2	27566340	27566340	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:27566340G>A	ENST00000359541.2	-	2	511	c.82C>T	c.(82-84)Caa>Taa	p.Q28*	AC109828.1_ENST00000589853.1_RNA|AC109828.1_ENST00000588707.1_RNA|GTF3C2_ENST00000264720.3_Nonsense_Mutation_p.Q28*|AC109828.1_ENST00000590383.1_RNA			Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide 2, beta 110kDa	28					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)				central_nervous_system(4)|endometrium(6)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	38	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCACCTCTTGTCCAGGAGAG	0.552																																																	0													127.0	127.0	127.0					2																	27566340		2203	4300	6503	SO:0001587	stop_gained	0			D13636	CCDS1749.1	2p23.3	2013-01-10	2002-08-29		ENSG00000115207	ENSG00000115207		"""General transcription factors"", ""WD repeat domain containing"""	4665	protein-coding gene	gene with protein product		604883	"""general transcription factor IIIC, polypeptide 2 (beta subunit, 110kD)"""			7729686	Standard	NM_001521		Approved	KIAA0011, TFIIIC110	uc002rjw.2	Q8WUA4	OTTHUMG00000097785	ENST00000359541.2:c.82C>T	2.37:g.27566340G>A	ENSP00000352536:p.Gln28*		D6W557|Q16632|Q9BWI7	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q28*	ENST00000359541.2	37	c.82	CCDS1749.1	2	.	.	.	.	.	.	.	.	.	.	G	19.92	3.916877	0.73098	.	.	ENSG00000115207	ENST00000359541;ENST00000264720;ENST00000457748;ENST00000423998	.	.	.	4.8	2.81	0.32909	.	0.711358	0.12586	N	0.455981	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-0.3234	6.9692	0.24639	0.0:0.1808:0.6049:0.2143	.	.	.	.	X	28	.	ENSP00000264720:Q28X	Q	-	1	0	GTF3C2	27419844	1.000000	0.71417	0.999000	0.59377	0.842000	0.47809	1.765000	0.38481	1.234000	0.43709	0.563000	0.77884	CAA	GTF3C2	-	NULL	ENSG00000115207		0.552	GTF3C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C2	HGNC	protein_coding	OTTHUMT00000215028.2	-	0.00	48	0	G			27566340	-1	tier1	-	no_errors	ENST00000264720	ensembl	human	known	74_37	nonsense	15.62	26	5	SNP	0.998	A
GZF1	64412	genome.wustl.edu	37	20	23349433	23349433	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr20:23349433G>T	ENST00000338121.5	+	4	1571	c.1494G>T	c.(1492-1494)aaG>aaT	p.K498N	GZF1_ENST00000544236.1_Missense_Mutation_p.K22N|GZF1_ENST00000461789.1_3'UTR|GZF1_ENST00000377051.2_Missense_Mutation_p.K498N|GZF1_ENST00000542987.1_Missense_Mutation_p.K7N			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	498					branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					CATGTGGCAAGAGTTTTGCTT	0.368																																																	0													118.0	113.0	114.0					20																	23349433		2203	4300	6503	SO:0001583	missense	0			AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.1494G>T	20.37:g.23349433G>T	ENSP00000338290:p.Lys498Asn		A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.K498N	ENST00000338121.5	37	c.1494	CCDS13151.1	20	.	.	.	.	.	.	.	.	.	.	G	19.06	3.754758	0.69648	.	.	ENSG00000125812	ENST00000544236;ENST00000338121;ENST00000542987;ENST00000377051	T;T;T;T	0.27890	3.15;1.64;3.15;1.64	5.87	1.25	0.21368	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000005	T	0.55577	0.1929	M	0.85710	2.77	0.49051	D	0.999749	D	0.89917	1.0	D	0.91635	0.999	T	0.61033	-0.7144	10	0.87932	D	0	.	11.338	0.49516	0.2911:0.0:0.7089:0.0	.	498	Q9H116	GZF1_HUMAN	N	22;498;7;498	ENSP00000445458:K22N;ENSP00000338290:K498N;ENSP00000445118:K7N;ENSP00000366250:K498N	ENSP00000338290:K498N	K	+	3	2	GZF1	23297433	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.194000	0.51005	0.399000	0.25367	-0.145000	0.13849	AAG	GZF1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000125812		0.368	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GZF1	HGNC	protein_coding	OTTHUMT00000078333.1		0.00	65	0	G	NM_022482		23349433	+1			no_errors	ENST00000338121	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
HCFC1	3054	genome.wustl.edu	37	X	153219809	153219809	+	Silent	SNP	A	A	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:153219809A>G	ENST00000310441.7	-	17	5007	c.4041T>C	c.(4039-4041)ggT>ggC	p.G1347G	HCFC1_ENST00000354233.3_Silent_p.G1278G|HCFC1_ENST00000369984.4_Silent_p.G1347G	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	1347					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCTGCTGCCCACCCTCGGGCT	0.687																																																	0													60.0	70.0	66.0					X																	153219809		2145	4210	6355	SO:0001819	synonymous_variant	0				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.4041T>C	X.37:g.153219809A>G			Q6P4G5	Silent	SNP	pfam_Kelch_2,pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.G1347	ENST00000310441.7	37	c.4041	CCDS44020.1	X																																																																																			HCFC1	-	NULL	ENSG00000172534		0.687	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC1	HGNC	protein_coding	OTTHUMT00000061099.4	-	0.00	45	0	A	NM_005334		153219809	-1	tier1	-	no_errors	ENST00000310441	ensembl	human	known	74_37	silent	21.74	18	5	SNP	0.018	G
HCN3	57657	genome.wustl.edu	37	1	155258694	155258694	+	3'UTR	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:155258694G>A	ENST00000368358.3	+	0	2773				HCN3_ENST00000496230.1_Intron	NM_020897.2	NP_065948.1	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 3						potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CAATGATCCTGCAGGTTCTGC	0.547																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB040968	CCDS1108.1	1q21.2	2011-07-05			ENSG00000143630	ENSG00000143630		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	19183	protein-coding gene	gene with protein product		609973				16382102	Standard	NM_020897		Approved	KIAA1535	uc001fjz.2	Q9P1Z3	OTTHUMG00000035872	ENST00000368358.3:c.*440G>A	1.37:g.155258694G>A			D3DV90|Q4VX12|Q8N6W6|Q9BWQ2	RNA	SNP	-	NULL	ENST00000368358.3	37	NULL	CCDS1108.1	1																																																																																			HCN3	-	-	ENSG00000143630		0.547	HCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN3	HGNC	protein_coding	OTTHUMT00000087388.1	-	0.00	60	0	G	NM_020897		155258694	+1	tier1	-	no_errors	ENST00000492035	ensembl	human	known	74_37	rna	21.74	36	10	SNP	0.000	A
HEMGN	55363	genome.wustl.edu	37	9	100692387	100692387	+	Silent	SNP	T	T	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr9:100692387T>C	ENST00000259456.3	-	4	1433	c.1290A>G	c.(1288-1290)acA>acG	p.T430T		NM_018437.3|NM_197978.2	NP_060907.2|NP_932095.1	Q9BXL5	HEMGN_HUMAN	hemogen	430					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)	nucleus (GO:0005634)				NS(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|skin(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(62;0.0559)				GGGGCCCACCTGTTTCTTGGT	0.448																																																	0													255.0	237.0	243.0					9																	100692387		2203	4300	6503	SO:0001819	synonymous_variant	0			AF228713	CCDS6731.1	9q22.33	2014-01-21			ENSG00000136929	ENSG00000136929			17509	protein-coding gene	gene with protein product		610715					Standard	NM_018437		Approved	EDAG, CT155, NDR	uc004axy.4	Q9BXL5	OTTHUMG00000020336	ENST00000259456.3:c.1290A>G	9.37:g.100692387T>C			Q6XAR3|Q86XY5|Q9NPC0	Silent	SNP	NULL	p.T430	ENST00000259456.3	37	c.1290	CCDS6731.1	9																																																																																			HEMGN	-	NULL	ENSG00000136929		0.448	HEMGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEMGN	HGNC	protein_coding	OTTHUMT00000053344.2	-	0.00	48	0	T	NM_197978		100692387	-1	tier1	-	no_errors	ENST00000259456	ensembl	human	known	74_37	silent	8.00	46	4	SNP	0.869	C
HERC3	8916	genome.wustl.edu	37	4	89608381	89608381	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:89608381G>T	ENST00000402738.1	+	23	2827	c.2588G>T	c.(2587-2589)aGc>aTc	p.S863I	RNU6-33P_ENST00000384793.1_RNA|HERC3_ENST00000543130.1_Missense_Mutation_p.S307I|HERC3_ENST00000264345.3_Missense_Mutation_p.S863I	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	863					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		TGCCGAGAAAGCTATGGAGTG	0.388																																																	0													89.0	90.0	90.0					4																	89608381		2203	4300	6503	SO:0001583	missense	0			D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.2588G>T	4.37:g.89608381G>T	ENSP00000385684:p.Ser863Ile		A8K1S5|Q8IXX3	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,superfamily_HECT,superfamily_RCC1/BLIP-II,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.S863I	ENST00000402738.1	37	c.2588	CCDS34028.1	4	.	.	.	.	.	.	.	.	.	.	G	11.33	1.607090	0.28623	.	.	ENSG00000138641	ENST00000402738;ENST00000264345;ENST00000543130;ENST00000512194	T;T;T;T	0.58358	0.34;0.34;0.34;0.34	4.88	4.04	0.47022	HECT (4);	0.237095	0.49305	D	0.000157	T	0.42177	0.1191	N	0.16567	0.415	0.47905	D	0.999543	B	0.29671	0.254	B	0.40101	0.319	T	0.27706	-1.0066	10	0.22109	T	0.4	.	13.3288	0.60475	0.0759:0.0:0.9241:0.0	.	863	Q15034	HERC3_HUMAN	I	863;863;307;256	ENSP00000385684:S863I;ENSP00000264345:S863I;ENSP00000441703:S307I;ENSP00000421021:S256I	ENSP00000264345:S863I	S	+	2	0	HERC3	89827404	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.278000	0.78587	1.413000	0.46997	0.655000	0.94253	AGC	HERC3	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000138641		0.388	HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC3	HGNC	protein_coding	OTTHUMT00000318081.2	-	0.00	69	0	G	NM_014606		89608381	+1	tier1	-	no_errors	ENST00000264345	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
HES1	3280	genome.wustl.edu	37	3	193854799	193854799	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:193854799T>C	ENST00000232424.3	+	3	490	c.254T>C	c.(253-255)gTg>gCg	p.V85A		NM_005524.3	NP_005515.1	P30042	ES1_HUMAN	hes family bHLH transcription factor 1	0						mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	6	all_cancers(143;7.3e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;3.65e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.48e-05)		GAAATGACAGTGAAGCACCTC	0.627																																																	0													61.0	63.0	62.0					3																	193854799		2203	4300	6503	SO:0001583	missense	0			L19314	CCDS3305.1	3q28-q29	2013-10-17	2013-10-17	2003-01-10	ENSG00000114315	ENSG00000114315		"""Basic helix-loop-helix proteins"""	5192	protein-coding gene	gene with protein product		139605	"""hairy homolog (Drosophila)"", ""hairy and enhancer of split 1, (Drosophila)"""	HRY		8020957	Standard	NM_005524		Approved	FLJ20408, HES-1, Hes1, bHLHb39	uc003ftq.2	Q14469	OTTHUMG00000155984	ENST00000232424.3:c.254T>C	3.37:g.193854799T>C	ENSP00000232424:p.Val85Ala		A6NFJ6|A6NJY7|O00650|O00660|O15011|O15012|P55346|P78474|Q92505|Q92507	Missense_Mutation	SNP	pfam_Orange,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,smart_Orange_subgr,pfscan_Orange,pfscan_bHLH_dom	p.V85A	ENST00000232424.3	37	c.254	CCDS3305.1	3	.	.	.	.	.	.	.	.	.	.	T	33	5.213493	0.95069	.	.	ENSG00000114315	ENST00000232424	D	0.98493	-4.96	4.75	4.75	0.60458	Helix-loop-helix DNA-binding (5);	0.133458	0.49916	U	0.000128	D	0.99312	0.9759	H	0.98295	4.195	0.80722	D	1	D	0.63880	0.993	D	0.65573	0.936	D	0.98534	1.0629	10	0.87932	D	0	-7.502	13.1164	0.59301	0.0:0.0:0.0:1.0	.	85	Q14469	HES1_HUMAN	A	85	ENSP00000232424:V85A	ENSP00000232424:V85A	V	+	2	0	HES1	195337493	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.974000	0.88039	1.760000	0.52011	0.529000	0.55759	GTG	HES1	-	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	ENSG00000114315		0.627	HES1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HES1	HGNC	protein_coding	OTTHUMT00000342632.1	-	0.00	56	0	T			193854799	+1	tier1	-	no_errors	ENST00000232424	ensembl	human	known	74_37	missense	34.29	23	12	SNP	1.000	C
HMGXB4	10042	genome.wustl.edu	37	22	35659857	35659857	+	Nonsense_Mutation	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr22:35659857C>G	ENST00000216106.5	+	4	377	c.249C>G	c.(247-249)taC>taG	p.Y83*	HMGXB4_ENST00000444518.2_5'UTR	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	83					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CTGATGATTACTACTATGGAG	0.453																																																	0													128.0	109.0	115.0					22																	35659857		2203	4300	6503	SO:0001587	stop_gained	0			AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.249C>G	22.37:g.35659857C>G	ENSP00000216106:p.Tyr83*		O75672|O75673|Q9UMT5	Nonsense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.Y83*	ENST00000216106.5	37	c.249	CCDS33641.1	22	.	.	.	.	.	.	.	.	.	.	C	27.1	4.796573	0.90453	.	.	ENSG00000100281	ENST00000216106	.	.	.	6.02	3.88	0.44766	.	0.409704	0.27811	N	0.017754	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.2516	9.7458	0.40446	0.0:0.8343:0.0:0.1657	.	.	.	.	X	83	.	ENSP00000216106:Y83X	Y	+	3	2	HMGXB4	33989857	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.499000	0.53310	0.807000	0.34208	-0.355000	0.07637	TAC	HMGXB4	-	NULL	ENSG00000100281		0.453	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HMGXB4	HGNC	protein_coding	OTTHUMT00000318104.2	-	0.00	53	0	C	NM_005487		35659857	+1	tier1	-	no_errors	ENST00000216106	ensembl	human	known	74_37	nonsense	21.54	51	14	SNP	1.000	G
HRCT1	646962	genome.wustl.edu	37	9	35906348	35906350	+	In_Frame_Del	DEL	CTG	CTG	-	rs370606246		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr9:35906348_35906350delCTG	ENST00000354323.2	+	1	160_162	c.64_66delCTG	c.(64-66)ctgdel	p.L28del		NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	28						integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						TGTGGCGGTCctgctgctgctgc	0.67																																																	0										367,3839		38,291,1774						-8.3	0.0			23	737,7385		88,561,3412	no	coding	HRCT1	NM_001039792.1		126,852,5186	A1A1,A1R,RR		9.0741,8.7256,8.9552				1104,11224				SO:0001651	inframe_deletion	0				CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.64_66delCTG	9.37:g.35906357_35906359delCTG	ENSP00000346283:p.Leu28del		B7ZBJ1	In_Frame_Del	DEL	NULL	p.L25in_frame_del	ENST00000354323.2	37	c.64_66	CCDS35012.1	9																																																																																			HRCT1	-	NULL	ENSG00000196196		0.670	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRCT1	HGNC	protein_coding	OTTHUMT00000334099.1		0.00	38	0	CTG	NM_001039792		35906350	+1	tier1		no_errors	ENST00000354323	ensembl	human	known	74_37	in_frame_del	10.26	35	4	DEL	0.168:0.493:0.516	-
HSD17B13	345275	genome.wustl.edu	37	4	88231439	88231439	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:88231439C>T	ENST00000328546.4	-	6	832	c.768G>A	c.(766-768)atG>atA	p.M256I	HSD17B13_ENST00000302219.6_Missense_Mutation_p.M220I	NM_178135.3	NP_835236.2	Q7Z5P4	DHB13_HUMAN	hydroxysteroid (17-beta) dehydrogenase 13	256						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|urinary_tract(1)	8		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.000308)		GAACAAAAATCATTTTCTTAT	0.318																																																	0													98.0	100.0	100.0					4																	88231439		2202	4299	6501	SO:0001583	missense	0				CCDS3618.1, CCDS47097.1	4q22.1	2011-09-20			ENSG00000170509	ENSG00000170509	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	18685	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 3"""	612127				19027726	Standard	NM_178135		Approved	SCDR9, SDR16C3	uc003hqo.2	Q7Z5P4	OTTHUMG00000130602	ENST00000328546.4:c.768G>A	4.37:g.88231439C>T	ENSP00000333300:p.Met256Ile		A8K9R9|Q2M1L5|Q86W22|Q86W23	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.M256I	ENST00000328546.4	37	c.768	CCDS3618.1	4	.	.	.	.	.	.	.	.	.	.	C	13.24	2.179469	0.38511	.	.	ENSG00000170509	ENST00000302219;ENST00000328546	D;D	0.88896	-2.44;-2.44	5.08	4.24	0.50183	.	0.160100	0.42682	D	0.000667	D	0.86108	0.5854	M	0.72894	2.215	0.32733	N	0.508704	B;B	0.11235	0.004;0.001	B;B	0.20577	0.03;0.005	T	0.82444	-0.0454	10	0.24483	T	0.36	.	8.507	0.33193	0.1513:0.7665:0.0:0.0822	.	220;256	Q7Z5P4-2;Q7Z5P4	.;DHB13_HUMAN	I	220;256	ENSP00000305438:M220I;ENSP00000333300:M256I	ENSP00000305438:M220I	M	-	3	0	HSD17B13	88450463	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.460000	0.35244	1.133000	0.42147	0.650000	0.86243	ATG	HSD17B13	-	NULL	ENSG00000170509		0.318	HSD17B13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B13	HGNC	protein_coding	OTTHUMT00000253052.1	-	0.00	122	0	C	NM_178135		88231439	-1	tier1	-	no_errors	ENST00000328546	ensembl	human	known	74_37	missense	22.02	85	24	SNP	1.000	T
IBSP	3381	genome.wustl.edu	37	4	88732897	88732897	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:88732897C>T	ENST00000226284.5	+	7	856	c.789C>T	c.(787-789)taC>taT	p.Y263Y		NM_004967.3	NP_004958.2	P21815	SIAL_HUMAN	integrin-binding sialoprotein	263					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)	21		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		AGGGGGAGTACGAATACACGG	0.483																																																	0													71.0	64.0	66.0					4																	88732897		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3624.1	4q21.1	2008-07-28	2008-07-28		ENSG00000029559	ENSG00000029559			5341	protein-coding gene	gene with protein product	"""bone sialoprotein"", ""bone sialoprotein II"""	147563				8406493	Standard	NM_004967		Approved	BSP, SP-II, BSP-II	uc003hqx.4	P21815	OTTHUMG00000130600	ENST00000226284.5:c.789C>T	4.37:g.88732897C>T				Silent	SNP	pfam_BSP_II	p.Y263	ENST00000226284.5	37	c.789	CCDS3624.1	4																																																																																			IBSP	-	pfam_BSP_II	ENSG00000029559		0.483	IBSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IBSP	HGNC	protein_coding	OTTHUMT00000253050.2		0.00	64	0	C			88732897	+1			no_errors	ENST00000226284	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.672	T
INPP5E	56623	genome.wustl.edu	37	9	139327463	139327463	+	Silent	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr9:139327463G>T	ENST00000371712.3	-	5	1626	c.1224C>A	c.(1222-1224)ggC>ggA	p.G408G		NM_019892.4	NP_063945.2	Q10713	MPPA_HUMAN	inositol polyphosphate-5-phosphatase, 72 kDa	0					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|endometrium(1)|lung(4)|skin(3)	9		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.36e-06)|Epithelial(140;1.4e-05)		TGAAGCTGATGCCCAAGGCCC	0.587																																																	0													201.0	180.0	187.0					9																	139327463		2200	4299	6499	SO:0001819	synonymous_variant	0			AF187891	CCDS7000.1	9q34.3	2011-02-11			ENSG00000148384	ENSG00000148384			21474	protein-coding gene	gene with protein product		613037	"""Joubert syndrome 1"""	JBTS1		10764818, 10577920, 19668216	Standard	NM_019892		Approved	PPI5PIV, CORS1	uc004cho.3	Q9NRR6	OTTHUMG00000020927	ENST00000371712.3:c.1224C>A	9.37:g.139327463G>T			B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Silent	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	p.G408	ENST00000371712.3	37	c.1224	CCDS7000.1	9																																																																																			INPP5E	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	ENSG00000148384		0.587	INPP5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5E	HGNC	protein_coding	OTTHUMT00000055058.1		0.00	48	0	G	NM_019892		139327463	-1			no_errors	ENST00000371712	ensembl	human	known	74_37	silent	11.76	30	4	SNP	0.769	T
INSR	3643	genome.wustl.edu	37	19	7172394	7172394	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:7172394G>T	ENST00000302850.5	-	5	1317	c.1175C>A	c.(1174-1176)tCa>tAa	p.S392*	INSR_ENST00000341500.5_Nonsense_Mutation_p.S392*	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	392					activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	TAGATACCCTGAAATTTCTTC	0.453																																																	0													141.0	129.0	133.0					19																	7172394		2203	4300	6503	SO:0001587	stop_gained	0			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.1175C>A	19.37:g.7172394G>T	ENSP00000303830:p.Ser392*		Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Nonsense_Mutation	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom	p.S392*	ENST00000302850.5	37	c.1175	CCDS12176.1	19	.	.	.	.	.	.	.	.	.	.	G	39	7.886802	0.98542	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	.	.	.	5.12	5.12	0.69794	.	0.198808	0.24745	N	0.035952	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	16.0778	0.80979	0.0:0.0:1.0:0.0	.	.	.	.	X	392	.	ENSP00000303830:S392X	S	-	2	0	INSR	7123394	1.000000	0.71417	0.982000	0.44146	0.958000	0.62258	9.402000	0.97298	2.397000	0.81536	0.561000	0.74099	TCA	INSR	-	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_EGF_rcpt_L	ENSG00000171105		0.453	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSR	HGNC	protein_coding	OTTHUMT00000458544.1		0.00	52	0	G			7172394	-1			no_errors	ENST00000302850	ensembl	human	known	74_37	nonsense	6.12	46	3	SNP	1.000	T
INTS7	25896	genome.wustl.edu	37	1	212149950	212149950	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:212149950G>T	ENST00000366994.3	-	12	1686	c.1582C>A	c.(1582-1584)Cgt>Agt	p.R528S	INTS7_ENST00000469606.1_5'UTR|INTS7_ENST00000366993.3_Missense_Mutation_p.R528S|INTS7_ENST00000440600.2_Missense_Mutation_p.R479S|INTS7_ENST00000366992.3_Missense_Mutation_p.R528S	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	528					cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)				NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		CTGGCAATACGGTATACAGTC	0.408																																																	0													163.0	148.0	153.0					1																	212149950		2203	4300	6503	SO:0001583	missense	0			AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.1582C>A	1.37:g.212149950G>T	ENSP00000355961:p.Arg528Ser		B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R479S	ENST00000366994.3	37	c.1435	CCDS1501.1	1	.	.	.	.	.	.	.	.	.	.	G	17.56	3.420154	0.62622	.	.	ENSG00000143493	ENST00000366994;ENST00000366993;ENST00000366992;ENST00000440600	T;T;T;T	0.27557	1.66;1.66;1.66;1.66	5.87	5.87	0.94306	Armadillo-like helical (1);Armadillo-type fold (1);	0.051603	0.85682	D	0.000000	T	0.29355	0.0731	L	0.42744	1.35	0.58432	D	0.999997	P;P;P;P	0.46064	0.872;0.872;0.872;0.872	B;B;B;B	0.41440	0.357;0.357;0.357;0.357	T	0.03296	-1.1051	10	0.62326	D	0.03	-18.2821	13.1566	0.59520	0.0:0.0:0.7367:0.2633	.	479;528;528;528	B4DLZ6;Q9NVH2-3;Q9NVH2-2;Q9NVH2	.;.;.;INT7_HUMAN	S	528;528;528;479	ENSP00000355961:R528S;ENSP00000355960:R528S;ENSP00000355959:R528S;ENSP00000388908:R479S	ENSP00000355959:R528S	R	-	1	0	INTS7	210216573	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	3.919000	0.56439	2.785000	0.95823	0.655000	0.94253	CGT	INTS7	-	NULL	ENSG00000143493		0.408	INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	INTS7	HGNC	protein_coding	OTTHUMT00000090142.1	-	0.00	45	0	G	NM_015434		212149950	-1	tier1	-	no_errors	ENST00000440600	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	T
IQSEC2	23096	genome.wustl.edu	37	X	53268414	53268414	+	Silent	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:53268414G>C	ENST00000375368.5	-	10	3248	c.3048C>G	c.(3046-3048)ccC>ccG	p.P1016P	IQSEC2_ENST00000375365.2_Silent_p.P821P|IQSEC2_ENST00000396435.3_Silent_p.P1026P			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	1016	PH.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						TTTCCACGAGGGGGAAAGACT	0.512											OREG0019800	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													114.0	103.0	107.0					X																	53268414		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.3048C>G	X.37:g.53268414G>C		991	B3KT97|C7SDG1|O60275|Q5JUX1	Silent	SNP	pfam_Sec7_dom,superfamily_Sec7_dom,superfamily_P-loop_NTPase,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7_dom	p.P1026	ENST00000375368.5	37	c.3078		X																																																																																			IQSEC2	-	smart_Pleckstrin_homology	ENSG00000124313		0.512	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		-	0.00	104	0	G	XM_291345		53268414	-1	tier1	-	no_errors	ENST00000396435	ensembl	human	known	74_37	silent	23.66	71	22	SNP	0.970	C
IWS1	55677	genome.wustl.edu	37	2	128262391	128262391	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:128262391G>T	ENST00000295321.4	-	3	1347	c.1088C>A	c.(1087-1089)tCt>tAt	p.S363Y	IWS1_ENST00000486662.1_5'Flank|IWS1_ENST00000455721.2_Missense_Mutation_p.S370Y|AC010976.2_ENST00000599001.1_RNA	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	363	Glu-rich.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		CTCACTATCAGAACTGTGAAA	0.428																																																	0													290.0	278.0	282.0					2																	128262391		2203	4300	6503	SO:0001583	missense	0			AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.1088C>A	2.37:g.128262391G>T	ENSP00000295321:p.Ser363Tyr		Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Missense_Mutation	SNP	pfam_TFIIS_N,superfamily_TFIIS_N	p.S363Y	ENST00000295321.4	37	c.1088	CCDS2146.1	2	.	.	.	.	.	.	.	.	.	.	G	16.99	3.273477	0.59649	.	.	ENSG00000163166	ENST00000295321;ENST00000433551;ENST00000455721	T;T	0.41758	1.23;0.99	5.93	5.93	0.95920	.	0.310366	0.32901	N	0.005503	T	0.62684	0.2448	L	0.59436	1.845	0.52099	D	0.999943	D	0.71674	0.998	D	0.65773	0.938	T	0.61173	-0.7116	10	0.62326	D	0.03	-15.6871	20.3363	0.98740	0.0:0.0:1.0:0.0	.	363	Q96ST2	IWS1_HUMAN	Y	363;316;370	ENSP00000295321:S363Y;ENSP00000399245:S370Y	ENSP00000295321:S363Y	S	-	2	0	IWS1	127978861	1.000000	0.71417	1.000000	0.80357	0.618000	0.37518	4.564000	0.60830	2.814000	0.96858	0.563000	0.77884	TCT	IWS1	-	NULL	ENSG00000163166		0.428	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IWS1	HGNC	protein_coding	OTTHUMT00000254384.2		0.00	48	0	G	NM_017969		128262391	-1			no_errors	ENST00000295321	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
ITGAV	3685	genome.wustl.edu	37	2	187495554	187495554	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:187495554G>A	ENST00000261023.3	+	5	828	c.554G>A	c.(553-555)tGt>tAt	p.C185Y	ITGAV_ENST00000374907.3_Intron|ITGAV_ENST00000433736.2_Missense_Mutation_p.C139Y	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	185					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	CAGGGATTTTGTCAAGGAGGA	0.299																																					Melanoma(58;108 1995 6081)												0													226.0	238.0	234.0					2																	187495554		2203	4300	6503	SO:0001583	missense	0				CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.554G>A	2.37:g.187495554G>A	ENSP00000261023:p.Cys185Tyr		A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.C185Y	ENST00000261023.3	37	c.554	CCDS2292.1	2	.	.	.	.	.	.	.	.	.	.	G	18.98	3.738778	0.69304	.	.	ENSG00000138448	ENST00000544640;ENST00000261023;ENST00000433736	T;D	0.92595	0.25;-3.07	5.97	5.09	0.68999	.	.	.	.	.	D	0.96769	0.8945	M	0.92026	3.265	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.97541	1.0086	9	0.87932	D	0	.	14.9005	0.70675	0.0:0.0:0.8565:0.1435	.	139;185	E7EWZ6;P06756	.;ITAV_HUMAN	Y	185;185;139	ENSP00000261023:C185Y;ENSP00000404291:C139Y	ENSP00000261023:C185Y	C	+	2	0	ITGAV	187203799	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.966000	0.76073	1.511000	0.48818	0.655000	0.94253	TGT	ITGAV	-	NULL	ENSG00000138448		0.299	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAV	HGNC	protein_coding	OTTHUMT00000255882.2	-	0.00	35	0	G	NM_002210		187495554	+1	tier1	-	no_errors	ENST00000261023	ensembl	human	known	74_37	missense	29.41	24	10	SNP	1.000	A
KCNH2	3757	genome.wustl.edu	37	7	150642567	150642567	+	Silent	SNP	C	C	T	rs371473271	byFrequency	TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr7:150642567C>T	ENST00000262186.5	-	15	3767	c.3366G>A	c.(3364-3366)ccG>ccA	p.P1122P	KCNH2_ENST00000392968.2_Silent_p.P1026P|KCNH2_ENST00000330883.4_Silent_p.P782P	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	1122					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	CTGGGGCCCCCGGGGGCAGCT	0.672													c|||	2	0.000399361	0.0015	0.0	5008	,	,		16834	0.0		0.0	False		,,,				2504	0.0				GBM(137;110 1844 13671 20123 45161)												0			GRCh37	CI043726	KCNH2	I		T	,	2,4314		0,2,2156	9.0	10.0	10.0		3366,2346	-9.2	0.1	7		10	0,8478		0,0,4239	no	coding-synonymous,coding-synonymous	KCNH2	NM_000238.3,NM_172057.2	,	0,2,6395	TT,TC,CC		0.0,0.0463,0.0156	,	1122/1160,782/820	150642567	2,12792	2158	4239	6397	SO:0001819	synonymous_variant	0			U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.3366G>A	7.37:g.150642567C>T			A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Silent	SNP	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_cNMP-bd_dom,pfam_PAS_fold,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.P1122	ENST00000262186.5	37	c.3366	CCDS5910.1	7																																																																																			KCNH2	-	NULL	ENSG00000055118		0.672	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH2	HGNC	protein_coding	OTTHUMT00000350741.2	-	0.00	55	0	C	NM_000238		150642567	-1	tier1	-	no_errors	ENST00000262186	ensembl	human	known	74_37	silent	19.44	29	7	SNP	0.020	T
KCNMA1	3778	genome.wustl.edu	37	10	78778787	78778787	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:78778787C>A	ENST00000286628.8	-	17	1998	c.1999G>T	c.(1999-2001)Gcc>Tcc	p.A667S	KCNMA1_ENST00000286627.5_Missense_Mutation_p.A667S|KCNMA1_ENST00000404857.1_Missense_Mutation_p.A667S|KCNMA1_ENST00000372443.1_Missense_Mutation_p.A667S|KCNMA1_ENST00000354353.5_Missense_Mutation_p.A667S|KCNMA1_ENST00000372440.1_Missense_Mutation_p.A667S|KCNMA1_ENST00000406533.3_Missense_Mutation_p.A671S|KCNMA1_ENST00000404771.3_Missense_Mutation_p.A667S	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	667					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	ACTTCTTTGGCATCACTTGCG	0.408																																																	0													121.0	123.0	122.0					10																	78778787		2203	4300	6503	SO:0001583	missense	0			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.1999G>T	10.37:g.78778787C>A	ENSP00000286628:p.Ala667Ser		F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_RCK_N,prints_K_chnl_Ca-activ_BK_asu,prints_K_chnl	p.A671S	ENST00000286628.8	37	c.2011		10	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	23.4|23.4|23.4	4.416372|4.416372|4.416372	0.83449|0.83449|0.83449	.|.|.	.|.|.	ENSG00000156113|ENSG00000156113|ENSG00000156113	ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708|ENST00000372421;ENST00000434208;ENST00000450795|ENST00000372403;ENST00000428546	D;D;D;D;D;D;D;D;D|.|.	0.84944|.|.	-1.87;-1.84;-1.88;-1.9;-1.87;-1.87;-1.89;-1.92;-1.92|.|.	5.49|5.49|5.49	5.49|5.49|5.49	0.81192|0.81192|0.81192	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.69584|0.69584|0.69584	0.3127|0.3127|0.3127	L|L|L	0.45698|0.45698|0.45698	1.435|1.435|1.435	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;B;B;P;B;B;B;B|.|.	0.63880|.|.	0.993;0.014;0.049;0.697;0.024;0.093;0.452;0.014|.|.	D;B;B;P;B;B;B;B|.|.	0.83275|.|.	0.996;0.082;0.22;0.899;0.074;0.419;0.367;0.05|.|.	T|T|T	0.64424|0.64424|0.64424	-0.6411|-0.6411|-0.6411	10|5|5	0.30854|.|.	T|.|.	0.27|.|.	-14.7165|-14.7165|-14.7165	19.7445|19.7445|19.7445	0.96247|0.96247|0.96247	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	667;667;667;667;667;449;667;667|.|.	Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;C9JFZ9;F8WA96;Q5SVJ7|.|.	.;.;.;KCMA1_HUMAN;.;.;.;.|.|.	S|F|I	667;604;602;641;604;667;667;641;671;667;667;449|655;345;159|617;150	ENSP00000361517:A667S;ENSP00000361485:A604S;ENSP00000361514:A602S;ENSP00000396608:A641S;ENSP00000361520:A667S;ENSP00000286627:A667S;ENSP00000385552:A671S;ENSP00000346321:A667S;ENSP00000385806:A667S|.|.	ENSP00000286627:A667S|.|.	A|C|M	-|-|-	1|2|3	0|0|0	KCNMA1|KCNMA1|KCNMA1	78448793|78448793|78448793	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.999000|0.999000|0.999000	0.98932|0.98932|0.98932	7.776000|7.776000|7.776000	0.85560|0.85560|0.85560	2.739000|2.739000|2.739000	0.93911|0.93911|0.93911	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GCC|TGC|ATG	KCNMA1	-	NULL	ENSG00000156113		0.408	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	KCNMA1	HGNC	protein_coding	OTTHUMT00000048885.3	-	0.00	52	0	C	NM_002247		78778787	-1	tier1	-	no_errors	ENST00000406533	ensembl	human	known	74_37	missense	18.33	49	11	SNP	1.000	A
KCNU1	157855	genome.wustl.edu	37	8	36671820	36671820	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr8:36671820C>T	ENST00000399881.3	+	8	865	c.828C>T	c.(826-828)acC>acT	p.T276T		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	276					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		CAACGTCAACCGTTGGATTTG	0.398																																																	0													66.0	65.0	65.0					8																	36671820		1881	4101	5982	SO:0001819	synonymous_variant	0			BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.828C>T	8.37:g.36671820C>T				Silent	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_Ca-activ_BK_asu	p.T276	ENST00000399881.3	37	c.828	CCDS55220.1	8																																																																																			KCNU1	-	pfam_2pore_dom_K_chnl_dom	ENSG00000215262		0.398	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	KCNU1	HGNC	protein_coding	OTTHUMT00000376631.1	-	0.00	74	0	C	NM_001031836		36671820	+1	tier1	-	no_errors	ENST00000399881	ensembl	human	known	74_37	silent	6.41	73	5	SNP	0.972	T
KCTD3	51133	genome.wustl.edu	37	1	215793669	215793669	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:215793669G>C	ENST00000259154.4	+	18	2451	c.2157G>C	c.(2155-2157)ttG>ttC	p.L719F	KCTD3_ENST00000495537.1_3'UTR	NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	719					protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		TAAAAAGTTTGAGAGAATTGG	0.353																																																	0													67.0	75.0	72.0					1																	215793669		2201	4299	6500	SO:0001583	missense	0			AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.2157G>C	1.37:g.215793669G>C	ENSP00000259154:p.Leu719Phe		A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,superfamily_WD40_repeat_dom,smart_BTB/POZ-like,smart_WD40_repeat,pfscan_BTB/POZ-like	p.L719F	ENST00000259154.4	37	c.2157	CCDS1515.1	1	.	.	.	.	.	.	.	.	.	.	G	9.988	1.230063	0.22542	.	.	ENSG00000136636	ENST00000259154	T	0.38401	1.14	5.81	2.49	0.30216	.	1.976990	0.01828	N	0.034509	T	0.22399	0.0540	N	0.14661	0.345	0.09310	N	1	B;B;B;B	0.17667	0.009;0.009;0.023;0.013	B;B;B;B	0.20384	0.019;0.019;0.029;0.013	T	0.21280	-1.0250	10	0.15066	T	0.55	1.091	4.8632	0.13594	0.077:0.3195:0.4239:0.1797	.	469;471;717;719	B7ZAF7;B4DJX2;Q9Y597-2;Q9Y597	.;.;.;KCTD3_HUMAN	F	719	ENSP00000259154:L719F	ENSP00000259154:L719F	L	+	3	2	KCTD3	213860292	0.000000	0.05858	0.015000	0.15790	0.986000	0.74619	0.222000	0.17699	1.423000	0.47198	0.655000	0.94253	TTG	KCTD3	-	NULL	ENSG00000136636		0.353	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD3	HGNC	protein_coding	OTTHUMT00000089871.2	-	0.00	42	0	G	NM_016121		215793669	+1	tier1	-	no_errors	ENST00000259154	ensembl	human	known	74_37	missense	13.64	38	6	SNP	0.000	C
KDM3B	51780	genome.wustl.edu	37	5	137727938	137727939	+	Frame_Shift_Ins	INS	-	-	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:137727938_137727939insC	ENST00000314358.5	+	8	2817_2818	c.2617_2618insC	c.(2617-2619)gccfs	p.A873fs	KDM3B_ENST00000394866.1_Frame_Shift_Ins_p.A529fs|KDM3B_ENST00000542866.1_Intron	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	873					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						GCCTCGGACTGCCCCCCTGAAA	0.609																																																	0																																										SO:0001589	frameshift_variant	0			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.2623dupC	5.37:g.137727944_137727944dupC	ENSP00000326563:p.Ala873fs		A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Frame_Shift_Ins	INS	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.L875fs	ENST00000314358.5	37	c.2617_2618	CCDS34242.1	5																																																																																			KDM3B	-	NULL	ENSG00000120733		0.609	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3B	HGNC	protein_coding	OTTHUMT00000373597.1		0.00	25	0	-	NM_016604		137727939	+1	tier1		no_errors	ENST00000314358	ensembl	human	known	74_37	frame_shift_ins	9.52	19	2	INS	0.986:0.996	C
KIAA1257	57501	genome.wustl.edu	37	3	128711907	128711907	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:128711907G>T	ENST00000265068.5	-	2	408	c.241C>A	c.(241-243)Ctg>Atg	p.L81M	KIAA1257_ENST00000510149.1_Intron|KIAA1257_ENST00000511438.1_Missense_Mutation_p.L81M|KIAA1257_ENST00000515659.1_5'Flank	NM_020741.2	NP_065792.1	Q9ULG3	K1257_HUMAN	KIAA1257	81										breast(1)|endometrium(2)|large_intestine(3)|lung(6)|skin(2)	14						GGGAAGGCCAGTGAGATGGTG	0.547																																																	0													150.0	159.0	156.0					3																	128711907		2092	4216	6308	SO:0001583	missense	0			AB033083	CCDS46905.1	3q21.3	2011-11-07			ENSG00000114656	ENSG00000114656			29231	protein-coding gene	gene with protein product						10574462	Standard	NM_020741		Approved		uc003elj.4	Q9ULG3	OTTHUMG00000159946	ENST00000265068.5:c.241C>A	3.37:g.128711907G>T	ENSP00000265068:p.Leu81Met		Q8IXY7|Q8N5T4	Missense_Mutation	SNP	NULL	p.L81M	ENST00000265068.5	37	c.241	CCDS46905.1	3	.	.	.	.	.	.	.	.	.	.	G	13.40	2.226285	0.39300	.	.	ENSG00000114656	ENST00000511438;ENST00000265068	.	.	.	4.37	1.59	0.23543	.	.	.	.	.	T	0.53465	0.1798	L	0.27053	0.805	0.49051	D	0.999748	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.52162	-0.8612	8	0.59425	D	0.04	-11.4143	5.8984	0.18951	0.3299:0.0:0.6701:0.0	.	81;81	Q9ULG3;D6RH05	K1257_HUMAN;.	M	81	.	ENSP00000265068:L81M	L	-	1	2	KIAA1257	130194597	0.309000	0.24518	0.643000	0.29450	0.380000	0.30137	0.326000	0.19646	0.607000	0.29982	0.484000	0.47621	CTG	KIAA1257	-	NULL	ENSG00000114656		0.547	KIAA1257-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	KIAA1257	HGNC	protein_coding	OTTHUMT00000358430.1	-	0.00	30	0	G	NM_020741		128711907	-1	tier1	-	no_errors	ENST00000265068	ensembl	human	known	74_37	missense	15.38	22	4	SNP	0.392	T
KIAA1462	57608	genome.wustl.edu	37	10	30315887	30315887	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:30315887G>T	ENST00000375377.1	-	3	3291	c.3190C>A	c.(3190-3192)Cta>Ata	p.L1064I		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	1064					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						GACCCCTCTAGCTCACTGGCA	0.592																																																	0													158.0	155.0	156.0					10																	30315887		1920	4126	6046	SO:0001583	missense	0			AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.3190C>A	10.37:g.30315887G>T	ENSP00000364526:p.Leu1064Ile		Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	NULL	p.L1064I	ENST00000375377.1	37	c.3190	CCDS41500.1	10	.	.	.	.	.	.	.	.	.	.	G	13.92	2.382002	0.42207	.	.	ENSG00000165757	ENST00000375377	T	0.14640	2.49	4.89	-3.17	0.05202	.	2.145100	0.01898	N	0.038981	T	0.22205	0.0535	L	0.56769	1.78	0.09310	N	1	D	0.60160	0.987	P	0.52793	0.709	T	0.39702	-0.9601	10	0.26408	T	0.33	0.4746	7.9295	0.29893	0.4395:0.1227:0.4378:0.0	.	1064	Q9P266	K1462_HUMAN	I	1064	ENSP00000364526:L1064I	ENSP00000364526:L1064I	L	-	1	2	KIAA1462	30355893	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.639000	0.05446	-0.538000	0.06281	-0.502000	0.04539	CTA	KIAA1462	-	NULL	ENSG00000165757		0.592	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1462	HGNC	protein_coding	OTTHUMT00000047409.1	-	0.00	32	0	G	NM_020848		30315887	-1	tier1	-	no_errors	ENST00000375377	ensembl	human	known	74_37	missense	15.38	22	4	SNP	0.000	T
KIF22	3835	genome.wustl.edu	37	16	29811283	29811283	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr16:29811283G>T	ENST00000160827.4	+	8	1234	c.1194G>T	c.(1192-1194)gaG>gaT	p.E398D	KIF22_ENST00000561482.1_Missense_Mutation_p.E330D|KIF22_ENST00000400750.2_5'UTR|KIF22_ENST00000563263.1_3'UTR|KIF22_ENST00000569382.2_Missense_Mutation_p.E330D|KIF22_ENST00000400751.5_Missense_Mutation_p.E330D	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	398					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						GTCCACCAGAGGCAAAGAGAG	0.597																																																	0													89.0	82.0	84.0					16																	29811283		2197	4300	6497	SO:0001583	missense	0			D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.1194G>T	16.37:g.29811283G>T	ENSP00000160827:p.Glu398Asp		B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_RuvA_2-like,smart_Kinesin_motor_dom,smart_Hlx-hairpin-Hlx_DNA-bd_motif,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E398D	ENST00000160827.4	37	c.1194	CCDS10653.1	16	.	.	.	.	.	.	.	.	.	.	G	11.57	1.677666	0.29783	.	.	ENSG00000079616	ENST00000160827;ENST00000400751	T;T	0.74421	-0.77;-0.84	5.41	2.24	0.28232	.	.	.	.	.	T	0.59252	0.2180	N	0.24115	0.695	0.80722	D	1	D;P	0.53151	0.958;0.925	B;B	0.44224	0.444;0.422	T	0.58864	-0.7561	9	0.62326	D	0.03	.	6.4778	0.22045	0.3017:0.0:0.6983:0.0	.	330;398	B7Z265;Q14807	.;KIF22_HUMAN	D	398;330	ENSP00000160827:E398D;ENSP00000383562:E330D	ENSP00000160827:E398D	E	+	3	2	KIF22	29718784	1.000000	0.71417	0.998000	0.56505	0.662000	0.39071	1.147000	0.31602	0.862000	0.35528	0.650000	0.86243	GAG	KIF22	-	NULL	ENSG00000079616		0.597	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF22	HGNC	protein_coding	OTTHUMT00000215012.2	-	0.00	40	0	G			29811283	+1	tier1	-	no_errors	ENST00000160827	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.996	T
KIF23	9493	genome.wustl.edu	37	15	69733338	69733338	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr15:69733338G>T	ENST00000260363.4	+	18	2416	c.2299G>T	c.(2299-2301)Ggg>Tgg	p.G767W	KIF23_ENST00000395392.2_Missense_Mutation_p.G767W|KIF23_ENST00000537891.1_Intron|KIF23_ENST00000558585.1_Intron|KIF23_ENST00000352331.4_Intron|KIF23_ENST00000559279.1_Intron	NM_138555.2	NP_612565.1	Q02241	KIF23_HUMAN	kinesin family member 23	767					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle elongation (GO:0000022)|positive regulation of cytokinesis (GO:0032467)|spindle midzone assembly involved in mitosis (GO:0051256)	centralspindlin complex (GO:0097149)|centrosome (GO:0005813)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercellular bridge (GO:0045171)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(6)|prostate(2)|skin(1)	21						CAGAAGGCGAGGGATGTACTG	0.468																																																	0													121.0	91.0	101.0					15																	69733338		2199	4298	6497	SO:0001583	missense	0			X67155	CCDS32278.1, CCDS32279.1	15q23	2008-03-03	2003-01-13	2003-01-17		ENSG00000137807		"""Kinesins"""	6392	protein-coding gene	gene with protein product		605064	"""kinesin-like 5 (mitotic kinesin-like protein 1)"""	KNSL5		1406973	Standard	NM_138555		Approved	MKLP1, MKLP-1	uc002asb.3	Q02241		ENST00000260363.4:c.2299G>T	15.37:g.69733338G>T	ENSP00000260363:p.Gly767Trp		Q8WVP0	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G767W	ENST00000260363.4	37	c.2299	CCDS32278.1	15	.	.	.	.	.	.	.	.	.	.	G	21.7	4.190115	0.78789	.	.	ENSG00000137807	ENST00000260363;ENST00000395392	T;D	0.82526	-1.39;-1.62	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.81583	0.4853	N	0.08118	0	0.80722	D	1	D	0.71674	0.998	D	0.65573	0.936	D	0.84722	0.0740	10	0.51188	T	0.08	.	16.2703	0.82612	0.0:0.0:1.0:0.0	.	767	Q02241	KIF23_HUMAN	W	767	ENSP00000260363:G767W;ENSP00000378790:G767W	ENSP00000260363:G767W	G	+	1	0	KIF23	67520392	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.635000	0.91006	2.595000	0.87683	0.555000	0.69702	GGG	KIF23	-	NULL	ENSG00000137807		0.468	KIF23-201	KNOWN	basic|CCDS	protein_coding	KIF23	HGNC	protein_coding		-	0.00	30	0	G			69733338	+1	tier1	-	no_errors	ENST00000260363	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	T
KMT2D	8085	genome.wustl.edu	37	12	49422901	49422902	+	Nonsense_Mutation	DNP	GC	GC	AA	rs368920289		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:49422901_49422902GC>AA	ENST00000301067.7	-	44	14192_14193	c.14193_14194GC>TT	c.(14191-14196)gaGCaa>gaTTaa	p.4731_4732EQ>D*		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4731					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CGGTCCTCTTGCTCCCACCGGC	0.624																																																	0																																										SO:0001587	stop_gained	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.14193_14194delinsAA	12.37:g.49422901_49422902delinsAA	ENSP00000301067:p.E4731_Q4732delinsD*		O14687	Nonsense_Mutation|Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q4732*|p.E4731D	ENST00000301067.7	37	c.14194|c.14193	CCDS44873.1	12																																																																																			KMT2D	-	NULL	ENSG00000167548		0.624	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	-	0.00	61	0	G|C			49422901|49422902	-1	tier1	-	no_errors	ENST00000301067	ensembl	human	known	74_37	nonsense|missense	19.23	21	5	SNP	1.000	A
KRT222	125113	genome.wustl.edu	37	17	38821286	38821286	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr17:38821286C>G	ENST00000476049.1	-	1	107	c.66G>C	c.(64-66)caG>caC	p.Q22H	KRT222_ENST00000394052.3_Missense_Mutation_p.Q22H|AC073508.1_ENST00000607244.1_RNA			Q8N1A0	KT222_HUMAN	keratin 222	22						intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(2)|skin(1)	15						CCGTCTCTATCTGATTTCTGG	0.463																																																	0													316.0	282.0	294.0					17																	38821286		2203	4300	6503	SO:0001583	missense	0			AK092967	CCDS11371.1	17q21.2	2013-06-25	2009-08-25	2009-08-25	ENSG00000213424	ENSG00000213424		"""-"""	28695	protein-coding gene	gene with protein product			"""keratin 222 pseudogene"""	KRT222P		16831889	Standard	NM_152349		Approved	KA21, MGC45562	uc002hvc.2	Q8N1A0	OTTHUMG00000133374	ENST00000476049.1:c.66G>C	17.37:g.38821286C>G	ENSP00000463483:p.Gln22His		Q7Z368	Missense_Mutation	SNP	pfam_IF,prints_Keratin_I	p.Q22H	ENST00000476049.1	37	c.66	CCDS11371.1	17	.	.	.	.	.	.	.	.	.	.	C	16.06	3.015303	0.54468	.	.	ENSG00000213424	ENST00000394052	D	0.89270	-2.49	5.74	5.74	0.90152	Filament (1);	0.479877	0.18409	U	0.142111	D	0.85483	0.5707	L	0.41906	1.305	0.33212	D	0.553514	B	0.32543	0.375	B	0.32864	0.154	D	0.88814	0.3294	10	0.59425	D	0.04	-12.3743	15.4031	0.74858	0.0:0.8614:0.1386:0.0	.	22	Q8N1A0	KT222_HUMAN	H	22	ENSP00000377616:Q22H	ENSP00000377616:Q22H	Q	-	3	2	KRT222	36074812	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.064000	0.57506	2.709000	0.92574	0.655000	0.94253	CAG	KRT222	-	pfam_IF	ENSG00000213424		0.463	KRT222-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	KRT222	HGNC	protein_coding	OTTHUMT00000447539.1		0.00	41	0	C	NM_152349		38821286	-1			no_errors	ENST00000394052	ensembl	human	known	74_37	missense	8.11	34	3	SNP	1.000	G
LAMC3	10319	genome.wustl.edu	37	9	133948140	133948140	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr9:133948140G>T	ENST00000361069.4	+	19	3468	c.3335G>T	c.(3334-3336)tGc>tTc	p.C1112F	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1112	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CAGAAGACCTGCACCCAGCTG	0.647																																																	0													30.0	31.0	31.0					9																	133948140		2203	4299	6502	SO:0001583	missense	0			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.3335G>T	9.37:g.133948140G>T	ENSP00000354360:p.Cys1112Phe		B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_B_type_IV,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.C1112F	ENST00000361069.4	37	c.3335	CCDS6938.1	9	.	.	.	.	.	.	.	.	.	.	G	19.01	3.744343	0.69418	.	.	ENSG00000050555	ENST00000361069;ENST00000355048	T	0.27402	1.67	4.97	4.97	0.65823	.	0.107106	0.64402	D	0.000005	T	0.45617	0.1351	M	0.70595	2.14	0.42012	D	0.990946	D	0.55172	0.97	P	0.51866	0.682	T	0.49103	-0.8974	10	0.56958	D	0.05	.	15.3606	0.74472	0.0:0.0:1.0:0.0	.	1112	Q9Y6N6	LAMC3_HUMAN	F	1112	ENSP00000354360:C1112F	ENSP00000347156:C1112F	C	+	2	0	LAMC3	132937961	0.999000	0.42202	0.983000	0.44433	0.747000	0.42532	3.382000	0.52463	2.476000	0.83614	0.555000	0.69702	TGC	LAMC3	-	NULL	ENSG00000050555		0.647	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	HGNC	protein_coding	OTTHUMT00000054717.3	-	0.00	46	0	G	NM_006059		133948140	+1	tier1	-	no_errors	ENST00000361069	ensembl	human	known	74_37	missense	22.50	31	9	SNP	0.995	T
LCN8	138307	genome.wustl.edu	37	9	139650774	139650774	+	5'UTR	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr9:139650774G>A	ENST00000482893.1	-	0	771				LCN8_ENST00000371688.3_Intron			Q6JVE9	LCN8_HUMAN	lipocalin 8						response to hormone (GO:0009725)|transport (GO:0006810)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)	10	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;5.56e-06)|Epithelial(140;8.32e-05)		gaacagtgcagggagcagtgc	0.552																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK124003	CCDS35183.1	9q34.3	2011-10-24	2005-01-11		ENSG00000204001	ENSG00000204001		"""Lipocalins"""	27038	protein-coding gene	gene with protein product		612902	"""chromosome 9 open reading frame 137"", ""lipocalin 5"""	LCN5			Standard	XM_005266058		Approved		uc004cjb.1	Q6JVE9	OTTHUMG00000020942	ENST00000482893.1:c.-1854C>T	9.37:g.139650774G>A			A1L4A8|A6NMN9|Q5T5R4	RNA	SNP	-	NULL	ENST00000482893.1	37	NULL		9																																																																																			LCN8	-	-	ENSG00000204001		0.552	LCN8-003	KNOWN	basic	processed_transcript	LCN8	HGNC	protein_coding	OTTHUMT00000055111.1	-	0.00	182	0	G	NM_178469		139650774	-1	tier1	-	no_errors	ENST00000482893	ensembl	human	known	74_37	rna	5.13	148	8	SNP	0.163	A
LETMD1	25875	genome.wustl.edu	37	12	51450147	51450147	+	Silent	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:51450147G>T	ENST00000262055.4	+	7	816	c.777G>T	c.(775-777)cgG>cgT	p.R259R	LETMD1_ENST00000418425.2_Silent_p.R272R|LETMD1_ENST00000380123.2_3'UTR|LETMD1_ENST00000547008.1_Silent_p.R135R|LETMD1_ENST00000552739.1_Silent_p.R142R|LETMD1_ENST00000550929.1_Silent_p.R203R|LETMD1_ENST00000548516.1_3'UTR	NM_015416.4	NP_056231.3	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1	259	LETM1.					integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)				central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(3)	16						CCTTGAGCCGGGCCATGCTTC	0.468																																																	0													194.0	161.0	172.0					12																	51450147		2203	4300	6503	SO:0001819	synonymous_variant	0			AF195651	CCDS8806.1, CCDS58231.1, CCDS73469.1	12q13.13	2006-04-12				ENSG00000050426			24241	protein-coding gene	gene with protein product	"""cervical cancer 1 protooncogene"""					12879013, 12061725	Standard	NM_015416		Approved	HCCR1	uc009zlw.3	Q6P1Q0	OTTHUMG00000169538	ENST00000262055.4:c.777G>T	12.37:g.51450147G>T			A6NER7|B3KXK7|Q6X2E4|Q6X2E5|Q7L2G9|Q7L690|Q8WXW6|Q96PK7|Q9BY59|Q9Y3X3	Missense_Mutation	SNP	NULL	p.G97C	ENST00000262055.4	37	c.289	CCDS8806.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.77|16.77	3.215026|3.215026	0.58452|0.58452	.|.	.|.	ENSG00000050426|ENSG00000050426	ENST00000553043|ENST00000551931	.|.	.|.	.|.	5.49|5.49	0.312|0.312	0.15837|0.15837	.|.	.|.	.|.	.|.	.|.	T|T	0.42359|0.42359	0.1199|0.1199	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D;B|.	0.56287|.	0.975;0.044|.	P;B|.	0.54100|.	0.742;0.066|.	T|T	0.21280|0.21280	-1.0250|-1.0250	7|4	0.87932|.	D|.	0|.	-8.0586|-8.0586	1.928|1.928	0.03321|0.03321	0.3972:0.1254:0.3507:0.1267|0.3972:0.1254:0.3507:0.1267	.|.	97;97|.	B7Z9A7;F8W6J0|.	.;.|.	C|V	28|43	.|.	ENSP00000369478:G97C|.	G|G	+|+	1|2	0|0	LETMD1|LETMD1	49736414|49736414	0.943000|0.943000	0.32029|0.32029	0.994000|0.994000	0.49952|0.49952	0.985000|0.985000	0.73830|0.73830	-0.228000|-0.228000	0.09114|0.09114	-0.146000|-0.146000	0.11274|0.11274	-0.137000|-0.137000	0.14449|0.14449	GGC|GGG	LETMD1	-	NULL	ENSG00000050426		0.468	LETMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LETMD1	HGNC	protein_coding	OTTHUMT00000404710.1	-	0.00	28	0	G	NM_015416		51450147	+1	tier1	-	no_errors	ENST00000550100	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.987	T
LILRA2	11027	genome.wustl.edu	37	19	55086220	55086220	+	Silent	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:55086220C>A	ENST00000251377.3	+	5	508	c.375C>A	c.(373-375)ctC>ctA	p.L125L	LILRB1_ENST00000396321.2_Intron|LILRA2_ENST00000391738.3_Silent_p.L125L|LILRB1_ENST00000418536.2_Intron|LILRA2_ENST00000391737.1_Silent_p.L113L|LILRB1_ENST00000448689.1_Intron|LILRA2_ENST00000495786.1_3'UTR|LILRA2_ENST00000251376.3_Silent_p.L125L			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	125	Ig-like C2-type 2.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		AACCCACCCTCTCAGCTCTGC	0.572																																																	0													125.0	120.0	121.0					19																	55086220		2203	4300	6503	SO:0001819	synonymous_variant	0			U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.375C>A	19.37:g.55086220C>A			O75020	Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like_dom	p.L125	ENST00000251377.3	37	c.375	CCDS46179.1	19																																																																																			LILRA2	-	pirsf_A1B_glyco/leuk_Ig-like_rcpt	ENSG00000239998		0.572	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LILRA2	HGNC	protein_coding	OTTHUMT00000140813.2	-	0.00	265	0	C			55086220	+1	tier1	-	no_errors	ENST00000251377	ensembl	human	known	74_37	silent	28.57	120	48	SNP	0.305	A
LINC00710	254312	genome.wustl.edu	37	10	10986282	10986282	+	RNA	SNP	T	T	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:10986282T>G	ENST00000428520.2	-	0	433					NR_015413.1				long intergenic non-protein coding RNA 710																		GGCAAAACATTTTGACCTGCA	0.433																																																	0																																												0					10p14	2012-12-05			ENSG00000229240	ENSG00000229240		"""Long non-coding RNAs"""	27386	non-coding RNA	RNA, long non-coding							Standard	NR_015413		Approved		uc009xiu.3		OTTHUMG00000017661		10.37:g.10986282T>G				RNA	SNP	-	NULL	ENST00000428520.2	37	NULL		10																																																																																			LINC00710	-	-	ENSG00000229240		0.433	LINC00710-001	KNOWN	basic	lincRNA	LINC00710	HGNC	processed_transcript	OTTHUMT00000046746.3	-	0.00	24	0	T	NR_015413		10986282	-1	tier1	-	no_errors	ENST00000428520	ensembl	human	known	74_37	rna	26.47	25	9	SNP	0.019	G
LOC285556	285556	genome.wustl.edu	37	4	100575648	100575648	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:100575648C>A	ENST00000511828.1	-	1	157	c.158G>T	c.(157-159)gGa>gTa	p.G53V																								GGCTGCTGCTCCGGCCGAGAC	0.657																																																	0																																										SO:0001583	missense	0																														ENST00000511828.1:c.158G>T	4.37:g.100575648C>A	ENSP00000427555:p.Gly53Val			Missense_Mutation	SNP	NULL	p.G53V	ENST00000511828.1	37	c.158		4	.	.	.	.	.	.	.	.	.	.	C	9.101	1.004230	0.19199	.	.	ENSG00000248713	ENST00000511828	T	0.31510	1.49	4.9	3.13	0.36017	.	.	.	.	.	T	0.22666	0.0547	N	0.08118	0	.	.	.	.	.	.	.	.	.	T	0.40270	-0.9572	6	0.66056	D	0.02	.	13.3451	0.60569	0.0:0.4924:0.5076:0.0	.	.	.	.	V	53	ENSP00000427555:G53V	ENSP00000427555:G53V	G	-	2	0	RP11-766F14.2	100794671	0.345000	0.24835	0.651000	0.29564	0.967000	0.64934	0.790000	0.26900	0.613000	0.30089	0.655000	0.94253	GGA	RP11-766F14.2	-	NULL	ENSG00000248713		0.657	RP11-766F14.2-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	LOC285556	Clone_based_vega_gene	protein_coding	OTTHUMT00000365456.1	-	0.00	125	0	C			100575648	-1	tier1	-	no_errors	ENST00000511828	ensembl	human	putative	74_37	missense	19.27	88	21	SNP	0.486	A
PLPPR3	79948	genome.wustl.edu	37	19	821508	821508	+	Silent	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:821508G>A	ENST00000520876.3	-	2	130	c.52C>T	c.(52-54)Ctg>Ttg	p.L18L	LPPR3_ENST00000359894.2_Silent_p.L18L	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		18						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										AAGCAGGGCAGAAGCGTCATG	0.701																																																	0													45.0	40.0	42.0					19																	821508		1966	3779	5745	SO:0001819	synonymous_variant	0																														ENST00000520876.3:c.52C>T	19.37:g.821508G>A			Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Silent	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.L18	ENST00000520876.3	37	c.52	CCDS58636.1	19																																																																																			LPPR3	-	superfamily_P_Acid_Pase_2/haloperoxidase	ENSG00000129951		0.701	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR3	Uniprot_gn	protein_coding	OTTHUMT00000379096.3	-	0.00	91	0	G			821508	-1	tier1	-	no_errors	ENST00000359894	ensembl	human	known	74_37	silent	15.91	37	7	SNP	0.998	A
LRRC37BP1	147172	genome.wustl.edu	37	17	28964385	28964385	+	RNA	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr17:28964385G>T	ENST00000417404.1	+	0	4643									leucine rich repeat containing 37B pseudogene 1																		TTAAATATTGGTTTTTTACTT	0.284																																																	0																																												0			BC118647		17q11.2	2012-10-05	2010-08-16	2010-08-16	ENSG00000250462	ENSG00000250462			25390	pseudogene	pseudogene			"""leucine rich repeat containing 37, member B2"""	LRRC37B2			Standard	NR_015341		Approved	DKFZp667M2411	uc010csj.3		OTTHUMG00000132795		17.37:g.28964385G>T				RNA	SNP	-	NULL	ENST00000417404.1	37	NULL		17																																																																																			LRRC37BP1	-	-	ENSG00000250462		0.284	LRRC37BP1-003	KNOWN	basic	processed_transcript	LRRC37BP1	HGNC	pseudogene	OTTHUMT00000256203.1	-	0.00	42	0	G	NR_015341		28964385	+1	tier1	-	no_errors	ENST00000417404	ensembl	human	known	74_37	rna	18.75	26	6	SNP	0.018	T
LRRC3B	116135	genome.wustl.edu	37	3	26751271	26751271	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:26751271G>T	ENST00000396641.2	+	2	700	c.108G>T	c.(106-108)aaG>aaT	p.K36N	LRRC3B_ENST00000456208.2_Missense_Mutation_p.K36N|AC114877.3_ENST00000446601.1_lincRNA|LRRC3B_ENST00000417744.1_Missense_Mutation_p.K36N	NM_052953.2	NP_443185.1	Q96PB8	LRC3B_HUMAN	leucine rich repeat containing 3B	36	LRRNT.					integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	21						TGTGTCCCAAGGGCTGTCTTT	0.443																																																	0													176.0	164.0	168.0					3																	26751271		2203	4300	6503	SO:0001583	missense	0			AF396933	CCDS2644.1	3p24	2004-07-12			ENSG00000179796	ENSG00000179796			28105	protein-coding gene	gene with protein product							Standard	NM_052953		Approved	LRP15	uc003cdp.3	Q96PB8	OTTHUMG00000130572	ENST00000396641.2:c.108G>T	3.37:g.26751271G>T	ENSP00000379880:p.Lys36Asn		Q5M8T0	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.K36N	ENST00000396641.2	37	c.108	CCDS2644.1	3	.	.	.	.	.	.	.	.	.	.	G	15.11	2.735271	0.48939	.	.	ENSG00000179796	ENST00000396641;ENST00000414619;ENST00000432040;ENST00000417744;ENST00000456208	D;D;D;D	0.96232	-3.95;-3.95;-3.95;-3.95	6.17	4.19	0.49359	Leucine-rich repeat-containing N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.95956	0.8683	M	0.76170	2.325	0.54753	D	0.999982	P	0.51147	0.942	P	0.52646	0.705	D	0.94768	0.7942	10	0.52906	T	0.07	-19.4498	4.8361	0.13466	0.364:0.0:0.636:0.0	.	36	Q96PB8	LRC3B_HUMAN	N	36	ENSP00000379880:K36N;ENSP00000398184:K36N;ENSP00000406370:K36N;ENSP00000394940:K36N	ENSP00000379880:K36N	K	+	3	2	LRRC3B	26726275	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.422000	0.44696	1.633000	0.50488	-0.137000	0.14449	AAG	LRRC3B	-	pfam_LRR-contain_N,smart_LRR-contain_N	ENSG00000179796		0.443	LRRC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC3B	HGNC	protein_coding	OTTHUMT00000252997.2	-	0.00	35	0	G	NM_052953		26751271	+1	tier1	-	no_errors	ENST00000396641	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
LYPD3	27076	genome.wustl.edu	37	19	43965593	43965593	+	Frame_Shift_Del	DEL	C	C	-			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:43965593delC	ENST00000244333.3	-	5	1039	c.951delG	c.(949-951)gggfs	p.G317fs		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	317					cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				GCTGCTGGGGCCCCCCTTTTG	0.622																																																	0													42.0	45.0	44.0					19																	43965593		2203	4300	6503	SO:0001589	frameshift_variant	0			AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.951delG	19.37:g.43965593delC	ENSP00000244333:p.Gly317fs		Q9UJ74	Frame_Shift_Del	DEL	pfam_LY6_UPAR,smart_LY6_UPA_recep-like	p.Q319fs	ENST00000244333.3	37	c.951	CCDS12620.1	19																																																																																			LYPD3	-	NULL	ENSG00000124466		0.622	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYPD3	HGNC	protein_coding	OTTHUMT00000463177.1		0.00	63	0	C	NM_014400		43965593	-1	tier1		no_errors	ENST00000244333	ensembl	human	known	74_37	frame_shift_del	9.68	28	3	DEL	0.000	-
MACROD2	140733	genome.wustl.edu	37	20	14830575	14830575	+	Intron	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr20:14830575G>T	ENST00000310348.4	+	5	418				MACROD2_ENST00000217246.4_Intron|MACROD2_ENST00000464883.1_Intron			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2						brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				GAAAGCTATTGAAACTGAATC	0.373																																																	0													36.0	35.0	35.0					20																	14830575		876	1990	2866	SO:0001627	intron_variant	0			BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.418+164970G>T	20.37:g.14830575G>T			A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	RNA	SNP	-	NULL	ENST00000310348.4	37	NULL	CCDS13120.2	20																																																																																			MACROD2	-	-	ENSG00000172264		0.373	MACROD2-201	KNOWN	basic|CCDS	protein_coding	MACROD2	HGNC	protein_coding		-	0.00	57	0	G	NM_080676		14830575	+1	tier1	-	no_errors	ENST00000463861	ensembl	human	known	74_37	rna	6.45	58	4	SNP	0.001	T
MAP2K2	5605	genome.wustl.edu	37	19	4090621	4090621	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:4090621C>T	ENST00000262948.5	-	11	1431	c.1178G>A	c.(1177-1179)gGc>gAc	p.G393D	MAP2K2_ENST00000394867.4_Missense_Mutation_p.G296D	NM_030662.3	NP_109587.1	P36507	MP2K2_HUMAN	mitogen-activated protein kinase kinase 2	393					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of cell motility (GO:2000147)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|scaffold protein binding (GO:0097110)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)	Bosutinib(DB06616)|Trametinib(DB08911)	CGTGGGTGTGCCGGGCTGGTT	0.652																																																	0													22.0	17.0	19.0					19																	4090621		2144	4204	6348	SO:0001583	missense	0			L11285	CCDS12120.1	19p13.3	2014-09-17			ENSG00000126934	ENSG00000126934	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6842	protein-coding gene	gene with protein product		601263		PRKMK2		8388392	Standard	NM_030662		Approved	MEK2	uc002lzk.3	P36507	OTTHUMG00000134286	ENST00000262948.5:c.1178G>A	19.37:g.4090621C>T	ENSP00000262948:p.Gly393Asp			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G393D	ENST00000262948.5	37	c.1178	CCDS12120.1	19	.	.	.	.	.	.	.	.	.	.	c	12.68	2.010704	0.35511	.	.	ENSG00000126934	ENST00000262948;ENST00000394867	T;T	0.77358	-0.89;-1.09	3.47	2.43	0.29744	.	0.180678	0.52532	D	0.000078	T	0.56455	0.1986	N	0.08118	0	0.27654	N	0.947297	B	0.25772	0.134	B	0.20767	0.031	T	0.55522	-0.8128	10	0.72032	D	0.01	-19.4552	9.7407	0.40416	0.0:0.8941:0.0:0.1059	.	393	P36507	MP2K2_HUMAN	D	393;296	ENSP00000262948:G393D;ENSP00000378336:G296D	ENSP00000262948:G393D	G	-	2	0	MAP2K2	4041621	1.000000	0.71417	1.000000	0.80357	0.290000	0.27261	4.350000	0.59392	0.806000	0.34183	-0.229000	0.12294	GGC	MAP2K2	-	NULL	ENSG00000126934		0.652	MAP2K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K2	HGNC	protein_coding	OTTHUMT00000258957.2		0.00	88	0	C			4090621	-1			no_errors	ENST00000262948	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
MAP3K4	4216	genome.wustl.edu	37	6	161510458	161510458	+	Missense_Mutation	SNP	G	G	T	rs145004605		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:161510458G>T	ENST00000392142.4	+	11	3076	c.2928G>T	c.(2926-2928)caG>caT	p.Q976H	MAP3K4_ENST00000348824.7_Missense_Mutation_p.Q976H|MAP3K4_ENST00000366920.2_Missense_Mutation_p.Q976H|MAP3K4_ENST00000366919.2_Missense_Mutation_p.Q976H	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	976					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		GCCAGGAGCAGACATCCAGTC	0.443																																																	0													140.0	139.0	139.0					6																	161510458		2203	4300	6503	SO:0001583	missense	0			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.2928G>T	6.37:g.161510458G>T	ENSP00000375986:p.Gln976His		A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q976H	ENST00000392142.4	37	c.2928	CCDS34565.1	6	.	.	.	.	.	.	.	.	.	.	G	18.82	3.705294	0.68615	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.74526	-0.85;-0.85;-0.84;-0.85	5.42	3.61	0.41365	.	0.000000	0.85682	D	0.000000	T	0.77370	0.4120	L	0.60455	1.87	0.48135	D	0.999599	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.87578	0.998;0.996;0.997	T	0.79550	-0.1757	10	0.59425	D	0.04	-32.5254	11.1837	0.48644	0.2057:0.0:0.7943:0.0	.	976;976;976	F5H538;Q9Y6R4-2;Q9Y6R4	.;.;M3K4_HUMAN	H	976	ENSP00000355886:Q976H;ENSP00000375986:Q976H;ENSP00000355887:Q976H;ENSP00000297332:Q976H	ENSP00000297332:Q976H	Q	+	3	2	MAP3K4	161430448	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	3.043000	0.49823	1.427000	0.47276	0.591000	0.81541	CAG	MAP3K4	-	NULL	ENSG00000085511		0.443	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K4	HGNC	protein_coding	OTTHUMT00000042988.3	-	0.00	28	0	G			161510458	+1	tier1	-	no_errors	ENST00000392142	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
MAPK10	5602	genome.wustl.edu	37	4	86952542	86952542	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:86952542G>T	ENST00000359221.3	-	12	1679	c.1153C>A	c.(1153-1155)Cac>Aac	p.H385N	MAPK10_ENST00000395161.2_Missense_Mutation_p.H385N|MAPK10_ENST00000395157.3_Missense_Mutation_p.H240N|MAPK10_ENST00000395160.3_Missense_Mutation_p.H240N|MAPK10_ENST00000449047.2_Missense_Mutation_p.H240N|MAPK10_ENST00000395166.1_Missense_Mutation_p.H347N|MAPK10_ENST00000395169.3_Missense_Mutation_p.H347N|MAPK10_ENST00000361569.2_Missense_Mutation_p.H385N			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	385					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)			breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		TCAATTGTGTGTTCTCTTTCA	0.308																																																	0													125.0	118.0	120.0					4																	86952542		2203	4300	6503	SO:0001583	missense	0			U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.1153C>A	4.37:g.86952542G>T	ENSP00000352157:p.His385Asn		A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_MAPK_JNK,pfscan_Prot_kinase_dom	p.H385N	ENST00000359221.3	37	c.1153	CCDS34026.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.89|17.89	3.500835|3.500835	0.64298|0.64298	.|.	.|.	ENSG00000109339|ENSG00000109339	ENST00000395169;ENST00000359221;ENST00000395157;ENST00000361569;ENST00000395166;ENST00000395160;ENST00000449047;ENST00000395161|ENST00000515400	T;T;T;T;T;T;T;T|.	0.41400|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	5.49|5.49	5.49|5.49	0.81192|0.81192	Protein kinase-like domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.82641|0.82641	0.5081|0.5081	M|M	0.85630|0.85630	2.765|2.765	0.80722|0.80722	D|D	1|1	B;P;P;P;B|.	0.43287|.	0.339;0.802;0.554;0.698;0.145|.	P;P;B;P;B|.	0.51415|.	0.473;0.669;0.365;0.459;0.183|.	D|D	0.84310|0.84310	0.0510|0.0510	10|5	0.30854|.	T|.	0.27|.	-20.5741|-20.5741	18.1636|18.1636	0.89718|0.89718	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	271;240;347;385;385|.	B7Z1Z1;Q499Y8;P53779-3;P53779-2;P53779|.	.;.;.;.;MK10_HUMAN|.	N|K	347;385;240;385;347;240;240;385|297	ENSP00000378598:H347N;ENSP00000352157:H385N;ENSP00000378586:H240N;ENSP00000355297:H385N;ENSP00000378595:H347N;ENSP00000378589:H240N;ENSP00000414469:H240N;ENSP00000378590:H385N|.	ENSP00000352157:H385N|.	H|T	-|-	1|2	0|0	MAPK10|MAPK10	87171566|87171566	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.649000|0.649000	0.38597|0.38597	8.450000|8.450000	0.90340|0.90340	2.566000|2.566000	0.86566|0.86566	0.563000|0.563000	0.77884|0.77884	CAC|ACA	MAPK10	-	superfamily_Kinase-like_dom	ENSG00000109339		0.308	MAPK10-012	KNOWN	basic|CCDS	protein_coding	MAPK10	HGNC	protein_coding	OTTHUMT00000361363.2	-	0.00	62	0	G			86952542	-1	tier1	-	no_errors	ENST00000359221	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
MARCH6	10299	genome.wustl.edu	37	5	10382027	10382027	+	Silent	SNP	A	A	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:10382027A>G	ENST00000274140.5	+	4	438	c.306A>G	c.(304-306)gcA>gcG	p.A102A	MARCH6_ENST00000449913.2_Intron|MARCH6_ENST00000503788.1_Intron	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	102					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						TGGCCTTTGCATGGTTGGGAG	0.378																																																	0													329.0	311.0	317.0					5																	10382027		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.306A>G	5.37:g.10382027A>G			A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.A102	ENST00000274140.5	37	c.306	CCDS34135.1	5																																																																																			MARCH6	-	NULL	ENSG00000145495		0.378	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH6	HGNC	protein_coding	OTTHUMT00000366919.2	-	0.00	28	0	A	NM_005885		10382027	+1	tier1	-	no_errors	ENST00000274140	ensembl	human	known	74_37	silent	18.42	31	7	SNP	0.966	G
MCTP2	55784	genome.wustl.edu	37	15	95013620	95013620	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr15:95013620G>A	ENST00000357742.4	+	20	2419	c.2419G>A	c.(2419-2421)Gcc>Acc	p.A807T	MCTP2_ENST00000451018.3_Missense_Mutation_p.A752T	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	807					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			TCTGGCAGCAGCCACCATCAT	0.413																																																	0													194.0	185.0	188.0					15																	95013620		2197	4298	6495	SO:0001583	missense	0			AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.2419G>A	15.37:g.95013620G>A	ENSP00000350377:p.Ala807Thr		A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	pfam_C2_dom,pfam_PRibTrfase_C,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.A807T	ENST00000357742.4	37	c.2419	CCDS32338.1	15	.	.	.	.	.	.	.	.	.	.	G	14.90	2.673218	0.47781	.	.	ENSG00000140563	ENST00000451018;ENST00000357742	T;T	0.71698	-0.59;-0.45	5.32	2.37	0.29283	Phosphoribosyltransferase C-terminal (1);	0.098007	0.64402	N	0.000001	D	0.83207	0.5204	M	0.86953	2.85	0.80722	D	1	D;B	0.76494	0.999;0.189	D;B	0.71414	0.973;0.253	T	0.82309	-0.0521	10	0.46703	T	0.11	.	11.0907	0.48115	0.2043:0.0:0.7957:0.0	.	752;807	Q6DN12-2;Q6DN12	.;MCTP2_HUMAN	T	752;807	ENSP00000395109:A752T;ENSP00000350377:A807T	ENSP00000350377:A807T	A	+	1	0	MCTP2	92814624	1.000000	0.71417	0.122000	0.21767	0.701000	0.40568	3.436000	0.52856	0.307000	0.22880	0.650000	0.86243	GCC	MCTP2	-	pfam_PRibTrfase_C	ENSG00000140563		0.413	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCTP2	HGNC	protein_coding	OTTHUMT00000415060.3	-	0.00	40	0	G	NM_018349		95013620	+1	tier1	-	no_errors	ENST00000357742	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.997	A
MDH1B	130752	genome.wustl.edu	37	2	207619836	207619836	+	Missense_Mutation	SNP	C	C	T	rs374037340		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:207619836C>T	ENST00000374412.3	-	5	1082	c.807G>A	c.(805-807)atG>atA	p.M269I	MDH1B_ENST00000449792.1_Missense_Mutation_p.M171I|MDH1B_ENST00000454776.2_Missense_Mutation_p.M269I|MDH1B_ENST00000392214.2_Intron	NM_001039845.1|NM_001282940.1	NP_001034934.1|NP_001269869.1	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	269					carbohydrate metabolic process (GO:0005975)|malate metabolic process (GO:0006108)|tricarboxylic acid cycle (GO:0006099)		malate dehydrogenase activity (GO:0016615)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)	p.M269I(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(14)|ovary(4)|stomach(1)	34				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		GGGCATATCTCATGAGTAAAA	0.488																																					Pancreas(76;29 1355 28675 37177 51207)												1	Substitution - Missense(1)	lung(1)											131.0	116.0	121.0					2																	207619836		2203	4300	6503	SO:0001583	missense	0				CCDS33365.1, CCDS63102.1	2q33.3	2008-05-27			ENSG00000138400	ENSG00000138400			17836	protein-coding gene	gene with protein product							Standard	NM_001039845		Approved	FLJ25341, RP11-95H11	uc002vbs.3	Q5I0G3	OTTHUMG00000132918	ENST00000374412.3:c.807G>A	2.37:g.207619836C>T	ENSP00000363533:p.Met269Ile		A8K8M1|Q53TK9|Q8IV51	Missense_Mutation	SNP	pfam_Lactate/malate_DH_C,superfamily_Lactate_DH/Glyco_Ohase_4_C	p.M269I	ENST00000374412.3	37	c.807	CCDS33365.1	2	.	.	.	.	.	.	.	.	.	.	C	0.395	-0.921216	0.02396	.	.	ENSG00000138400	ENST00000374412;ENST00000449792;ENST00000454776	T;T;T	0.08370	3.1;3.1;3.1	5.59	0.615	0.17608	NAD(P)-binding domain (1);	0.604868	0.19796	N	0.105878	T	0.04724	0.0128	N	0.21194	0.64	0.09310	N	0.999998	B;B	0.06786	0.001;0.001	B;B	0.11329	0.006;0.002	T	0.45702	-0.9243	10	0.13108	T	0.6	-11.3068	7.9048	0.29755	0.0:0.5875:0.1015:0.311	.	269;269	Q5I0G3-2;Q5I0G3	.;MDH1B_HUMAN	I	269;171;269	ENSP00000363533:M269I;ENSP00000416577:M171I;ENSP00000389916:M269I	ENSP00000363533:M269I	M	-	3	0	MDH1B	207328081	0.038000	0.19896	0.000000	0.03702	0.001000	0.01503	0.317000	0.19487	0.107000	0.17824	-0.136000	0.14681	ATG	MDH1B	-	NULL	ENSG00000138400		0.488	MDH1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDH1B	HGNC	protein_coding	OTTHUMT00000256429.2		0.00	32	0	C	NM_001039845		207619836	-1			no_errors	ENST00000374412	ensembl	human	known	74_37	missense	7.69	24	2	SNP	0.004	T
MED12	9968	genome.wustl.edu	37	X	70339933	70339933	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:70339933G>T	ENST00000374080.3	+	4	498	c.466G>T	c.(466-468)Gct>Tct	p.A156S	MED12_ENST00000333646.6_Missense_Mutation_p.A156S|MED12_ENST00000374102.1_Missense_Mutation_p.A156S			Q93074	MED12_HUMAN	mediator complex subunit 12	156					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					TGTGATGCGGGCTGCCTGGCT	0.473			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																	Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													117.0	113.0	114.0					X																	70339933		2030	4167	6197	SO:0001583	missense	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.466G>T	X.37:g.70339933G>T	ENSP00000363193:p.Ala156Ser		O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.A156S	ENST00000374080.3	37	c.466	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	.	16.47	3.133077	0.56828	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.78003	-1.14;-1.11;-1.12;-0.96	5.09	5.09	0.68999	Mediator complex, subunit Med12 (1);	0.066777	0.64402	D	0.000008	T	0.75481	0.3855	L	0.52573	1.65	0.42620	D	0.993348	B;B;B;B	0.30889	0.254;0.036;0.073;0.299	B;B;B;B	0.34824	0.12;0.012;0.046;0.19	T	0.76921	-0.2780	10	0.59425	D	0.04	-12.8808	15.7853	0.78297	0.0:0.0:1.0:0.0	.	156;3;156;156	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	S	156;156;156;156;124	ENSP00000333125:A156S;ENSP00000363215:A156S;ENSP00000363193:A156S;ENSP00000414203:A124S	ENSP00000333125:A156S	A	+	1	0	MED12	70256658	1.000000	0.71417	0.994000	0.49952	0.967000	0.64934	6.973000	0.76116	2.348000	0.79779	0.600000	0.82982	GCT	MED12	-	pfam_Mediator_Med12	ENSG00000184634		0.473	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	-	0.00	37	0	G	NM_005120		70339933	+1	tier1	-	no_errors	ENST00000333646	ensembl	human	known	74_37	missense	18.00	41	9	SNP	1.000	T
MEGF6	1953	genome.wustl.edu	37	1	3431144	3431144	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:3431144G>A	ENST00000356575.4	-	7	1049	c.823C>T	c.(823-825)Cag>Tag	p.Q275*	MEGF6_ENST00000294599.4_Nonsense_Mutation_p.Q170*	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	275	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		GCTGCTAGCTGATAGCCCACG	0.687																																					Ovarian(73;978 3658)												0													18.0	28.0	25.0					1																	3431144		2068	4184	6252	SO:0001587	stop_gained	0			AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.823C>T	1.37:g.3431144G>A	ENSP00000348982:p.Gln275*		Q4AC86|Q5VV39	Nonsense_Mutation	SNP	pfam_EGF_laminin,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.Q275*	ENST00000356575.4	37	c.823	CCDS41237.1	1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.726495	0.89298	.	.	ENSG00000162591	ENST00000294599;ENST00000356575	.	.	.	4.31	2.43	0.29744	.	0.735551	0.12721	N	0.444668	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-2.1998	4.2559	0.10717	0.1807:0.0:0.5211:0.2982	.	.	.	.	X	170;275	.	ENSP00000294599:Q170X	Q	-	1	0	MEGF6	3421004	0.141000	0.22595	0.745000	0.31077	0.123000	0.20343	0.468000	0.22051	0.453000	0.26858	0.484000	0.47621	CAG	MEGF6	-	smart_EG-like_dom,smart_EGF-like_Ca-bd_dom	ENSG00000162591		0.687	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF6	HGNC	protein_coding	OTTHUMT00000354866.1	-	0.00	29	0	G	NM_001409		3431144	-1	tier1	-	no_errors	ENST00000356575	ensembl	human	known	74_37	nonsense	41.67	7	5	SNP	0.246	A
MFNG	4242	genome.wustl.edu	37	22	37875509	37875509	+	Silent	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr22:37875509G>A	ENST00000356998.3	-	4	658	c.435C>T	c.(433-435)aaC>aaT	p.N145N	MFNG_ENST00000416983.3_Silent_p.N131N	NM_002405.3	NP_002396.2	O00587	MFNG_HUMAN	MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	145					pattern specification process (GO:0007389)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein binding (GO:0032092)	extracellular space (GO:0005615)|integral component of Golgi membrane (GO:0030173)	metal ion binding (GO:0046872)|O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity (GO:0033829)			large_intestine(2)|lung(2)|skin(1)	5	Melanoma(58;0.0574)					GGTTCACATAGTTGTCATCGT	0.612																																																	0													82.0	70.0	74.0					22																	37875509		2203	4300	6503	SO:0001819	synonymous_variant	0			BC094814	CCDS13947.1, CCDS54525.1	22q13.1	2013-02-19	2006-11-13		ENSG00000100060	ENSG00000100060	2.4.1.222	"""Beta 3-glycosyltransferases"""	7038	protein-coding gene	gene with protein product		602577	"""manic fringe (Drosophila) homolog"", ""manic fringe homolog (Drosophila)"""			9878264, 9187150	Standard	NM_002405		Approved		uc003ass.2	O00587	OTTHUMG00000150560	ENST00000356998.3:c.435C>T	22.37:g.37875509G>A			B4DLT6|O43730|Q504S9	Missense_Mutation	SNP	pfam_Fringe-like	p.T129I	ENST00000356998.3	37	c.386	CCDS13947.1	22																																																																																			MFNG	-	NULL	ENSG00000100060		0.612	MFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFNG	HGNC	protein_coding	OTTHUMT00000318902.1	-	0.00	103	0	G	NM_002405		37875509	-1	tier1	-	no_errors	ENST00000438891	ensembl	human	known	74_37	missense	20.83	57	15	SNP	1.000	A
MID2	11043	genome.wustl.edu	37	X	107084038	107084038	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:107084038G>A	ENST00000262843.6	+	2	691	c.143G>A	c.(142-144)aGc>aAc	p.S48N	MID2_ENST00000443968.2_Missense_Mutation_p.S48N	NM_012216.3|NM_052817.2	NP_036348.2|NP_438112.2	Q9UJV3	TRIM1_HUMAN	midline 2	48					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein localization to microtubule (GO:0035372)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)	19						TGTGCTCACAGCCTCTGCTTC	0.483																																																	0													175.0	160.0	165.0					X																	107084038		2203	4300	6503	SO:0001583	missense	0				CCDS14532.2, CCDS14533.2	Xq22.1-q22.2	2013-02-11			ENSG00000080561	ENSG00000080561		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7096	protein-coding gene	gene with protein product		300204				10400986	Standard	NM_012216		Approved	FXY2, TRIM1, RNF60	uc004enl.3	Q9UJV3	OTTHUMG00000022171	ENST00000262843.6:c.143G>A	X.37:g.107084038G>A	ENSP00000262843:p.Ser48Asn		A6NEL8|A6PVI5|Q5JYF5|Q8WWK1|Q9UJR9	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.S48N	ENST00000262843.6	37	c.143	CCDS14532.2	X	.	.	.	.	.	.	.	.	.	.	G	14.23	2.473049	0.43942	.	.	ENSG00000080561	ENST00000451923;ENST00000262843;ENST00000443968	T;T;T	0.17854	2.25;2.25;2.25	5.65	5.65	0.86999	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	T	0.16557	0.0398	N	0.11023	0.085	0.51233	D	0.999912	P;P	0.44946	0.846;0.65	P;B	0.51777	0.679;0.421	T	0.18085	-1.0348	10	0.19147	T	0.46	.	16.1582	0.81680	0.0:0.0:1.0:0.0	.	48;48	Q9UJV3;Q9UJV3-2	TRIM1_HUMAN;.	N	28;48;48	ENSP00000410730:S28N;ENSP00000262843:S48N;ENSP00000413976:S48N	ENSP00000262843:S48N	S	+	2	0	MID2	106970694	1.000000	0.71417	0.995000	0.50966	0.974000	0.67602	9.813000	0.99286	2.506000	0.84524	0.600000	0.82982	AGC	MID2	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000080561		0.483	MID2-001	KNOWN	basic|CCDS	protein_coding	MID2	HGNC	protein_coding	OTTHUMT00000057852.2	-	0.00	42	0	G	NM_012216		107084038	+1	tier1	-	no_errors	ENST00000262843	ensembl	human	known	74_37	missense	34.29	23	12	SNP	1.000	A
MIOX	55586	genome.wustl.edu	37	22	50926323	50926323	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr22:50926323G>T	ENST00000216075.6	+	4	260	c.186G>T	c.(184-186)caG>caT	p.Q62H	MIOX_ENST00000395733.3_Missense_Mutation_p.Q62H|MIOX_ENST00000395732.3_Missense_Mutation_p.Q62H	NM_017584.5	NP_060054.4	Q9UGB7	MIOX_HUMAN	myo-inositol oxygenase	62					inositol catabolic process (GO:0019310)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)	aldo-keto reductase (NADP) activity (GO:0004033)|ferric iron binding (GO:0008199)|inositol oxygenase activity (GO:0050113)|NADP binding (GO:0050661)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen (GO:0016701)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	13		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		AGCATGCCCAGTTTGGGGGCT	0.632																																																	0													41.0	46.0	45.0					22																	50926323		2203	4300	6503	SO:0001583	missense	0			AF197129	CCDS14092.1	22q13.3	2008-06-11	2005-06-15	2005-06-15	ENSG00000100253	ENSG00000100253			14522	protein-coding gene	gene with protein product	"""kidney-specific protein 32"""	606774	"""aldehyde reductase (aldose reductase) like 6"""	ALDRL6		10944187, 11716759	Standard	NM_017584		Approved		uc003bll.1	Q9UGB7	OTTHUMG00000150207	ENST00000216075.6:c.186G>T	22.37:g.50926323G>T	ENSP00000216075:p.Gln62His		Q05DJ6|Q5S8C9|Q9BZZ1|Q9UHB8	Missense_Mutation	SNP	pfam_Inositol_oxygenase	p.Q62H	ENST00000216075.6	37	c.186	CCDS14092.1	22	.	.	.	.	.	.	.	.	.	.	G	11.11	1.543237	0.27563	.	.	ENSG00000100253	ENST00000395733;ENST00000216075;ENST00000395732;ENST00000451761	.	.	.	4.38	3.33	0.38152	.	0.186064	0.45867	D	0.000332	T	0.52901	0.1763	L	0.33339	1.005	0.43448	D	0.995635	D;B;B	0.71674	0.998;0.083;0.006	D;B;B	0.64877	0.93;0.028;0.019	T	0.46830	-0.9163	9	0.32370	T	0.25	-26.2818	6.925	0.24410	0.2066:0.0:0.7934:0.0	.	62;62;62	Q9UGB7-2;A6PVH2;Q9UGB7	.;.;MIOX_HUMAN	H	62;62;62;57	.	ENSP00000216075:Q62H	Q	+	3	2	MIOX	49273189	1.000000	0.71417	0.982000	0.44146	0.967000	0.64934	1.712000	0.37940	2.243000	0.73865	0.491000	0.48974	CAG	MIOX	-	pfam_Inositol_oxygenase	ENSG00000100253		0.632	MIOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIOX	HGNC	protein_coding	OTTHUMT00000316835.1	-	0.00	54	0	G	NM_017584		50926323	+1	tier1	-	no_errors	ENST00000216075	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
MIPEP	4285	genome.wustl.edu	37	13	24443488	24443488	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr13:24443488C>A	ENST00000382172.3	-	7	984	c.886G>T	c.(886-888)Gtg>Ttg	p.V296L		NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase	296					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		GAATACCCCACCAACTTTGCC	0.403																																																	0													102.0	104.0	103.0					13																	24443488		2203	4300	6503	SO:0001583	missense	0				CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.886G>T	13.37:g.24443488C>A	ENSP00000371607:p.Val296Leu		Q5JV15|Q5T9Q9|Q96G65	Missense_Mutation	SNP	pfam_Pept_M3A_M3B	p.V296L	ENST00000382172.3	37	c.886	CCDS9303.1	13	.	.	.	.	.	.	.	.	.	.	C	15.55	2.866546	0.51588	.	.	ENSG00000027001	ENST00000382172	T	0.04551	3.6	5.9	5.9	0.94986	Neurolysin/Thimet oligopeptidase, domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.06462	0.0166	L	0.35487	1.065	0.54753	D	0.999986	P	0.36086	0.536	B	0.41135	0.348	T	0.14364	-1.0475	10	0.02654	T	1	.	20.2664	0.98460	0.0:1.0:0.0:0.0	.	296	Q99797	MIPEP_HUMAN	L	296	ENSP00000371607:V296L	ENSP00000371607:V296L	V	-	1	0	MIPEP	23341488	1.000000	0.71417	0.390000	0.26220	0.303000	0.27691	7.222000	0.78025	2.786000	0.95864	0.561000	0.74099	GTG	MIPEP	-	pfam_Pept_M3A_M3B	ENSG00000027001		0.403	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIPEP	HGNC	protein_coding	OTTHUMT00000044169.1	-	0.00	80	0	C			24443488	-1	tier1	-	no_errors	ENST00000382172	ensembl	human	known	74_37	missense	20.41	39	10	SNP	1.000	A
MIR3687-2	103504728	genome.wustl.edu	37	21	9825977	9825977	+	RNA	SNP	T	T	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr21:9825977T>C	ENST00000577708.1	+	0	0				MIR3648_ENST00000581792.1_RNA	NR_037458.1																						GGGGTCCCCGTGGCGTCCCCT	0.811																																																	0																																												0																															21.37:g.9825977T>C				RNA	SNP	-	NULL	ENST00000577708.1	37	NULL		21																																																																																			MIR3648	-	-	ENSG00000264462		0.811	MIR3687-201	KNOWN	basic	miRNA	MIR3648	HGNC	miRNA		-	0.00	42	0	T			9825977	+1	tier1	-	no_errors	ENST00000581792	ensembl	human	known	74_37	rna	25.00	18	6	SNP	0.075	C
C17orf49	124944	genome.wustl.edu	37	17	6920512	6920512	+	Intron	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr17:6920512G>T	ENST00000439424.2	+	6	590				C17orf49_ENST00000547709.1_Intron|MIR497HG_ENST00000385056.1_RNA|RP11-589P10.7_ENST00000572547.1_RNA|RNASEK-C17orf49_ENST00000547302.2_Intron|MIR497HG_ENST00000572453.1_RNA|MIR497HG_ENST00000385194.1_RNA|C17orf49_ENST00000546760.1_Intron|C17orf49_ENST00000552402.1_Intron|C17orf49_ENST00000552775.1_Intron|C17orf49_ENST00000546495.1_Intron|AC040977.1_ENST00000593646.1_5'Flank|MIR497HG_ENST00000443997.1_RNA	NM_001142798.2|NM_174893.3	NP_001136270.1|NP_777553.1	Q8IXM2	BAP18_HUMAN	chromosome 17 open reading frame 49						chromatin modification (GO:0016568)	MLL1 complex (GO:0071339)|NURF complex (GO:0016589)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|ovary(1)	4						CAGGGAGGTGGGAGTGGCCTT	0.572																																																	0													160.0	148.0	152.0					17																	6920512		692	1591	2283	SO:0001627	intron_variant	0			AK055800	CCDS32542.1, CCDS45595.1, CCDS45596.1	17p13.1	2013-02-11			ENSG00000258315	ENSG00000258315			28737	protein-coding gene	gene with protein product	"""BPTF associated protein of 18 kDa"", ""human embryo lung cellular protein interacting with SARS-CoV nsp-10"""						Standard	NM_174893		Approved	MGC49942, BAP18, HEPIS		Q8IXM2	OTTHUMG00000170147	ENST00000439424.2:c.515-68G>T	17.37:g.6920512G>T			B4DIV3|C9J4G0|E9PB29	RNA	SNP	-	NULL	ENST00000439424.2	37	NULL	CCDS32542.1	17																																																																																			MIR497HG	-	-	ENSG00000267532		0.572	C17orf49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR497HG	HGNC	protein_coding	OTTHUMT00000407666.1	-	0.00	57	0	G	NM_174893		6920512	-1	tier1	-	no_errors	ENST00000443997	ensembl	human	known	74_37	rna	10.00	36	4	SNP	0.001	T
MST1L	11223	genome.wustl.edu	37	1	17087349	17087349	+	RNA	SNP	T	T	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:17087349T>C	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										CCATGGCTGCTCACATTGTAG	0.607																																																	0																																												0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17087349T>C			B7WPB1|Q13209	RNA	SNP	-	NULL	ENST00000455405.2	37	NULL		1	.	.	.	.	.	.	.	.	.	.	.	11.80	1.747823	0.30955	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552;ENST00000545160	.	.	.	.	.	.	.	0.129899	0.35262	N	0.003327	T	0.49474	0.1559	.	.	.	.	.	.	P	0.48834	0.916	P	0.53224	0.721	T	0.56944	-0.7895	6	0.62326	D	0.03	.	4.4758	0.11739	0.0:8.0E-4:0.0:0.9992	.	79	Q2TV78-2	.	G	49;79;79;11	.	ENSP00000439273:S79G	S	-	1	0	MST1P9	16959936	0.655000	0.27376	0.000000	0.03702	0.000000	0.00434	1.663000	0.37429	0.000000	0.14550	0.000000	0.15137	AGC	MST1L	-	-	ENSG00000186715		0.607	MST1L-002	KNOWN	basic	processed_transcript	MST1L	HGNC	pseudogene	OTTHUMT00000400328.1	-	0.00	404	0	T	NM_001271733		17087349	-1	tier1	-	no_errors	ENST00000545160	ensembl	human	known	74_37	rna	5.64	318	19	SNP	0.998	C
MUC12	10071	genome.wustl.edu	37	7	100634150	100634150	+	Silent	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr7:100634150C>A	ENST00000379442.3	+	5	735	c.735C>A	c.(733-735)acC>acA	p.T245T	MUC12_ENST00000536621.1_Silent_p.T102T			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	245	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						ACTCTGCAACCTCAGTTTTTG	0.512																																																	0													141.0	127.0	131.0					7																	100634150		692	1591	2283	SO:0001819	synonymous_variant	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.735C>A	7.37:g.100634150C>A			A6ND38|F5GWV9|Q9UKN0	Silent	SNP	pfam_SEA_dom	p.T102	ENST00000379442.3	37	c.306		7																																																																																			MUC12	-	NULL	ENSG00000205277		0.512	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	142	0	C	XM_379904		100634150	+1	tier1	-	no_errors	ENST00000536621	ensembl	human	known	74_37	silent	24.17	91	29	SNP	0.000	A
MYB	4602	genome.wustl.edu	37	6	135521339	135521339	+	Splice_Site	SNP	T	T	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:135521339T>C	ENST00000367814.4	+	11	1647		c.e11+2		MYB_ENST00000528774.1_Splice_Site|MYB_ENST00000531845.1_Splice_Site|MYB_ENST00000534044.1_Splice_Site|MYB_ENST00000527615.1_Splice_Site|MYB_ENST00000442647.2_Splice_Site|MYB_ENST00000341911.5_Splice_Site|MYB_ENST00000316528.8_Splice_Site|MYB_ENST00000534121.1_Splice_Site|MYB_ENST00000525369.1_Splice_Site|MYB_ENST00000533624.1_Splice_Site	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog						B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		AAGATGCTAGTAAGTTCTAGA	0.398			T	NFIB	adenoid cystic carcinoma																																			Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	0													80.0	84.0	83.0					6																	135521339		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.1461+2T>C	6.37:g.135521339T>C			E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Splice_Site	SNP	-	e12+2	ENST00000367814.4	37	c.1824+2	CCDS5174.1	6	.	.	.	.	.	.	.	.	.	.	T	24.0	4.478732	0.84747	.	.	ENSG00000118513	ENST00000341911;ENST00000442647;ENST00000316528;ENST00000237302;ENST00000367814;ENST00000527615;ENST00000525369;ENST00000528774;ENST00000534121;ENST00000534044;ENST00000533624	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7153	0.77663	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYB	135563032	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.978000	0.88095	2.127000	0.65507	0.533000	0.62120	.	MYB	-	-	ENSG00000118513		0.398	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYB	HGNC	protein_coding	OTTHUMT00000042347.4	-	0.00	65	0	T		Intron	135521339	+1	tier1	-	no_errors	ENST00000341911	ensembl	human	known	74_37	splice_site	9.18	89	9	SNP	1.000	C
MYO5A	4644	genome.wustl.edu	37	15	52676452	52676452	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr15:52676452G>A	ENST00000399231.3	-	15	2063	c.1820C>T	c.(1819-1821)tCa>tTa	p.S607L	MYO5A_ENST00000356338.6_Missense_Mutation_p.S607L|MYO5A_ENST00000399233.2_Missense_Mutation_p.S607L|MYO5A_ENST00000553916.1_Missense_Mutation_p.S607L|MYO5A_ENST00000358212.6_Missense_Mutation_p.S607L	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	607	Myosin motor.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		TGTGCGCCCTGAGGAGGTGGC	0.473																																																	0													127.0	140.0	135.0					15																	52676452		2050	4195	6245	SO:0001583	missense	0				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.1820C>T	15.37:g.52676452G>A	ENSP00000382177:p.Ser607Leu		A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Skp1_comp_dimer,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.S607L	ENST00000399231.3	37	c.1820	CCDS42037.1	15	.	.	.	.	.	.	.	.	.	.	G	18.13	3.555919	0.65425	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	D;D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2;-2.2	5.27	4.33	0.51752	Myosin head, motor domain (2);	0.216308	0.41396	D	0.000899	D	0.82486	0.5047	L	0.34521	1.04	0.19300	N	0.999973	B;P	0.42518	0.099;0.782	B;B	0.41174	0.065;0.349	T	0.75001	-0.3471	10	0.48119	T	0.1	.	15.6337	0.76933	0.0:0.1378:0.8622:0.0	.	607;607	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	L	607;141;607;607;607;237;607	ENSP00000382177:S607L;ENSP00000382179:S607L;ENSP00000348693:S607L;ENSP00000350945:S607L;ENSP00000451109:S607L	ENSP00000348693:S607L	S	-	2	0	MYO5A	50463744	0.995000	0.38212	0.799000	0.32177	0.677000	0.39632	3.108000	0.50337	1.163000	0.42636	0.650000	0.86243	TCA	MYO5A	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000197535		0.473	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYO5A	HGNC	protein_coding	OTTHUMT00000268102.1	-	0.00	85	0	G	NM_000259		52676452	-1	tier1	-	no_errors	ENST00000358212	ensembl	human	known	74_37	missense	20.00	60	15	SNP	0.135	A
MZB1	51237	genome.wustl.edu	37	5	138725510	138725512	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:138725510_138725512delCAG	ENST00000302125.8	-	1	91_93	c.34_36delCTG	c.(34-36)ctgdel	p.L12del	MZB1_ENST00000457570.2_In_Frame_Del_p.L12del|MZB1_ENST00000412103.2_5'UTR	NM_016459.3	NP_057543.2	Q8WU39	MZB1_HUMAN	marginal zone B and B1 cell-specific protein	12					apoptotic process (GO:0006915)|integrin activation (GO:0033622)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immunoglobulin biosynthetic process (GO:0002642)|regulation of B cell proliferation (GO:0030888)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)											CCCAGGCTCCcagcagcagcagc	0.626																																																	0										3,22,3657		0,0,3,3,16,1819						1.3	0.7			37	1,48,7121		0,0,1,6,36,3542	no	codingComplex	MZB1	NM_016459.3		0,0,4,9,52,5361	A1A1,A1A2,A1R,A2A2,A2R,RR		0.6834,0.679,0.6819				4,70,10778				SO:0001651	inframe_deletion	0			AF151024	CCDS47273.1	5q31.2	2012-09-27	2012-09-19		ENSG00000170476	ENSG00000170476			30125	protein-coding gene	gene with protein product	"""plasma cell-induced ER protein 1"", ""proapoptotic caspase adaptor protein"", ""mesenteric oestrogen-dependent adipose gene- 7"""	609447				22573353, 12573802, 11350957, 21093319, 21688198	Standard	NM_016459		Approved	PACAP, MGC29506, HSPC190, pERp1, MEDA-7	uc003lei.3	Q8WU39	OTTHUMG00000163390	ENST00000302125.8:c.34_36delCTG	5.37:g.138725519_138725521delCAG	ENSP00000303920:p.Leu12del		D2IYS0|Q7Z6N2|Q96RL5|Q9P0T3	In_Frame_Del	DEL	NULL	p.L12in_frame_del	ENST00000302125.8	37	c.36_34	CCDS47273.1	5																																																																																			MZB1	-	NULL	ENSG00000170476		0.626	MZB1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MZB1	HGNC	protein_coding	OTTHUMT00000373055.1		0.00	24	0	CAG	NM_016459		138725512	-1	tier1		no_errors	ENST00000503481	ensembl	human	known	74_37	in_frame_del	15.00	17	3	DEL	0.366:0.352:0.265	-
NACAD	23148	genome.wustl.edu	37	7	45125071	45125071	+	Silent	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr7:45125071G>A	ENST00000490531.2	-	2	727	c.708C>T	c.(706-708)ctC>ctT	p.L236L		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	236					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						CCAGCAGGCTGAGGGAACAGG	0.677																																																	0													22.0	29.0	27.0					7																	45125071		691	1590	2281	SO:0001819	synonymous_variant	0			AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.708C>T	7.37:g.45125071G>A				Silent	SNP	pfam_Nas_poly-pep-assoc_cplx_dom,pfscan_Nas_poly-pep-assoc_cplx_dom	p.L236	ENST00000490531.2	37	c.708	CCDS47582.1	7																																																																																			NACAD	-	NULL	ENSG00000136274		0.677	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACAD	HGNC	protein_coding	OTTHUMT00000353652.2	-	0.00	82	0	G	NM_001146334		45125071	-1	tier1	-	no_errors	ENST00000490531	ensembl	human	known	74_37	silent	11.11	48	6	SNP	1.000	A
NAE1	8883	genome.wustl.edu	37	16	66850909	66850909	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr16:66850909G>T	ENST00000290810.3	-	10	804	c.707C>A	c.(706-708)aCg>aAg	p.T236K	NAE1_ENST00000379463.2_Missense_Mutation_p.T230K|NAE1_ENST00000394074.2_Missense_Mutation_p.T147K|NAE1_ENST00000564040.2_5'Flank|NAE1_ENST00000359087.4_Missense_Mutation_p.T239K			Q13564	ULA1_HUMAN	NEDD8 activating enzyme E1 subunit 1	236					mitotic DNA replication checkpoint (GO:0033314)|neuron apoptotic process (GO:0051402)|protein neddylation (GO:0045116)|regulation of apoptotic process (GO:0042981)|regulation of neuron apoptotic process (GO:0043523)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|protein heterodimerization activity (GO:0046982)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0914)|Epithelial(162;0.214)	Adenosine triphosphate(DB00171)	TTCTTTATACGTTTTAGGTAT	0.289																																																	0													70.0	72.0	71.0					16																	66850909		2198	4298	6496	SO:0001583	missense	0			U50939	CCDS10820.1, CCDS42171.1, CCDS42172.1, CCDS67050.1	16q22	2013-09-26	2007-12-11	2007-12-11	ENSG00000159593	ENSG00000159593		"""Ubiquitin-like modifier activating enzymes"""	621	protein-coding gene	gene with protein product		603385	"""amyloid beta precursor protein binding protein 1, 59kDa"""	APPBP1		8626687, 12740388	Standard	XM_005256215		Approved	ula-1	uc002eqf.3	Q13564	OTTHUMG00000137513	ENST00000290810.3:c.707C>A	16.37:g.66850909G>T	ENSP00000290810:p.Thr236Lys		A6NCK0|A6NFN4|A8MU28|B2R700|B3KUP9	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,superfamily_Molybdenum_cofac_synth_MoeB	p.T236K	ENST00000290810.3	37	c.707	CCDS10820.1	16	.	.	.	.	.	.	.	.	.	.	G	12.38	1.920710	0.33908	.	.	ENSG00000159593	ENST00000359087;ENST00000290810;ENST00000379463;ENST00000394074	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.47	3.48	0.39840	Molybdenum cofactor biosynthesis, MoeB (1);	0.217643	0.46442	D	0.000286	T	0.42359	0.1199	M	0.79614	2.46	0.25963	N	0.982596	B;B;B	0.24963	0.115;0.027;0.107	B;B;B	0.24269	0.052;0.009;0.035	T	0.46456	-0.9190	10	0.44086	T	0.13	-12.0515	1.9775	0.03419	0.1523:0.2498:0.4007:0.1971	.	239;236;230	A6NCK0;Q13564;A6NFN4	.;ULA1_HUMAN;.	K	239;236;230;147	ENSP00000351990:T239K;ENSP00000290810:T236K;ENSP00000368776:T230K;ENSP00000377637:T147K	ENSP00000290810:T236K	T	-	2	0	NAE1	65408410	0.918000	0.31147	0.637000	0.29366	0.849000	0.48306	1.318000	0.33643	0.654000	0.30846	0.650000	0.86243	ACG	NAE1	-	superfamily_Molybdenum_cofac_synth_MoeB	ENSG00000159593		0.289	NAE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NAE1	HGNC	protein_coding	OTTHUMT00000268832.1	-	0.00	79	0	G	NM_003905		66850909	-1	tier1	-	no_errors	ENST00000290810	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.224	T
NAGS	162417	genome.wustl.edu	37	17	42084980	42084980	+	Silent	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr17:42084980G>C	ENST00000293404.3	+	6	1408	c.1290G>C	c.(1288-1290)ctG>ctC	p.L430L		NM_153006.2	NP_694551.1	Q8N159	NAGS_HUMAN	N-acetylglutamate synthase	430	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.		L -> P (in NAGSD; markedly decreases activity). {ECO:0000269|PubMed:12754705, ECO:0000269|PubMed:15878741}.		arginine biosynthetic process (GO:0006526)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	mitochondrial matrix (GO:0005759)	acetyl-CoA:L-glutamate N-acetyltransferase activity (GO:0004042)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8		Breast(137;0.00536)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CCGCCATTCTGACCATGGAGC	0.692											OREG0024449	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													13.0	16.0	15.0					17																	42084980		2194	4283	6477	SO:0001819	synonymous_variant	0			AY116537	CCDS11473.1	17q21.31	2008-02-05				ENSG00000161653			17996	protein-coding gene	gene with protein product		608300				15050968, 12459178	Standard	NM_153006		Approved	AGAS, ARGA, NAT7	uc002ies.3	Q8N159		ENST00000293404.3:c.1290G>C	17.37:g.42084980G>C		906	B2RAZ9|Q8IWR4	Silent	SNP	pfam_DUF619,superfamily_Asp/Glu/Uridylate_kinase,superfamily_Acyl_CoA_acyltransferase,pirsf_GlcNAc_Synth_met,pfscan_GNAT_dom	p.L430	ENST00000293404.3	37	c.1290	CCDS11473.1	17																																																																																			NAGS	-	pfam_DUF619,superfamily_Acyl_CoA_acyltransferase,pirsf_GlcNAc_Synth_met,pfscan_GNAT_dom	ENSG00000161653		0.692	NAGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAGS	HGNC	protein_coding	OTTHUMT00000457660.1	-	0.00	24	0	G	NM_153006		42084980	+1	tier1	-	no_errors	ENST00000293404	ensembl	human	known	74_37	silent	33.33	14	7	SNP	1.000	C
NAT14	57106	genome.wustl.edu	37	19	55998266	55998266	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:55998266G>T	ENST00000205194.4	+	3	867	c.564G>T	c.(562-564)gaG>gaT	p.E188D	NAT14_ENST00000592719.1_Intron|SSC5D_ENST00000587166.1_5'Flank|SSC5D_ENST00000389623.6_5'Flank|NAT14_ENST00000587400.1_Intron	NM_020378.3	NP_065111.1	Q8WUY8	NAT14_HUMAN	N-acetyltransferase 14 (GCN5-related, putative)	188	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				DNA-templated transcription, initiation (GO:0006352)|positive regulation of transcription, DNA-templated (GO:0045893)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|N-acetyltransferase activity (GO:0008080)			central_nervous_system(1)|large_intestine(1)|ovary(1)|pancreas(1)	4	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0527)		ACCAGGCCGAGGGGGGCTGGG	0.716																																																	0													5.0	5.0	5.0					19																	55998266		1928	3892	5820	SO:0001583	missense	0			AB055059	CCDS12926.1	19q13.42	2011-11-25	2008-09-24		ENSG00000090971	ENSG00000090971			28918	protein-coding gene	gene with protein product	"""K562 cells-derived leucine zipper-like protein 1"""		"""N-acetyltransferase 14"""			10873651	Standard	NM_020378		Approved	KLP1	uc002qle.2	Q8WUY8		ENST00000205194.4:c.564G>T	19.37:g.55998266G>T	ENSP00000205194:p.Glu188Asp		Q8TDY7|Q9NS72	Missense_Mutation	SNP	pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.E188D	ENST00000205194.4	37	c.564	CCDS12926.1	19	.	.	.	.	.	.	.	.	.	.	.	14.34	2.505866	0.44558	.	.	ENSG00000090971	ENST00000205194	.	.	.	4.45	2.18	0.27775	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (1);	0.687236	0.12939	N	0.426797	T	0.23054	0.0557	N	0.16656	0.425	0.31966	N	0.607836	B	0.26081	0.141	B	0.17722	0.019	T	0.23833	-1.0177	9	0.27082	T	0.32	-44.6472	7.0352	0.24989	0.0952:0.0:0.7338:0.171	.	188	Q8WUY8	NAT14_HUMAN	D	188	.	ENSP00000205194:E188D	E	+	3	2	NAT14	60690078	0.123000	0.22298	0.406000	0.26421	0.872000	0.50106	0.048000	0.14078	0.388000	0.25054	0.462000	0.41574	GAG	NAT14	-	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000090971		0.716	NAT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAT14	HGNC	protein_coding	OTTHUMT00000453339.1	-	0.00	29	0	G	NM_020378		55998266	+1	tier1	-	no_errors	ENST00000205194	ensembl	human	known	74_37	missense	30.00	7	3	SNP	0.991	T
NAV3	89795	genome.wustl.edu	37	12	78511809	78511809	+	Silent	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:78511809G>T	ENST00000397909.2	+	14	2945	c.2772G>T	c.(2770-2772)ctG>ctT	p.L924L	NAV3_ENST00000228327.6_Silent_p.L924L|NAV3_ENST00000266692.7_Silent_p.L924L|NAV3_ENST00000536525.2_Silent_p.L924L			Q8IVL0	NAV3_HUMAN	neuron navigator 3	924				L -> V (in Ref. 3; AAM73757). {ECO:0000305}.		membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.L924L(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CTTTATAGCTGAGGACAGATT	0.368										HNSCC(70;0.22)																																							1	Substitution - coding silent(1)	lung(1)											97.0	100.0	99.0					12																	78511809		1834	4093	5927	SO:0001819	synonymous_variant	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2772G>T	12.37:g.78511809G>T			Q8NFW7|Q9Y2E7	Silent	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.L924	ENST00000397909.2	37	c.2772		12																																																																																			NAV3	-	NULL	ENSG00000067798		0.368	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	-	0.00	42	0	G	NM_001024383		78511809	+1	tier1	-	no_errors	ENST00000397909	ensembl	human	known	74_37	silent	11.76	30	4	SNP	0.998	T
NCOA2	10499	genome.wustl.edu	37	8	71126198	71126198	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr8:71126198G>T	ENST00000452400.2	-	4	380	c.199C>A	c.(199-201)Cct>Act	p.P67T		NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	67	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			CATTTGTCAGGTTTGAAGTTA	0.308			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																			Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	0													99.0	86.0	90.0					8																	71126198		1788	4071	5859	SO:0001583	missense	0			X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.199C>A	8.37:g.71126198G>T	ENSP00000399968:p.Pro67Thr		Q14CD2	Missense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.P67T	ENST00000452400.2	37	c.199	CCDS47872.1	8	.	.	.	.	.	.	.	.	.	.	G	23.9	4.476179	0.84640	.	.	ENSG00000140396	ENST00000452400	T	0.01981	4.52	5.53	5.53	0.82687	Helix-loop-helix DNA-binding (4);	0.000000	0.85682	D	0.000000	T	0.12220	0.0297	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00187	-1.1941	10	0.66056	D	0.02	.	19.466	0.94939	0.0:0.0:1.0:0.0	.	67	Q15596	NCOA2_HUMAN	T	67	ENSP00000399968:P67T	ENSP00000399968:P67T	P	-	1	0	NCOA2	71288752	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.607000	0.88179	0.655000	0.94253	CCT	NCOA2	-	superfamily_bHLH_dom,smart_bHLH_dom,pirsf_Nuclear_rcpt_coactivator,pfscan_bHLH_dom	ENSG00000140396		0.308	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA2	HGNC	protein_coding	OTTHUMT00000379696.1	-	0.00	67	0	G			71126198	-1	tier1	-	no_errors	ENST00000452400	ensembl	human	known	74_37	missense	12.50	49	7	SNP	1.000	T
NCOR2	9612	genome.wustl.edu	37	12	124824597	124824597	+	Frame_Shift_Del	DEL	T	T	-			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:124824597delT	ENST00000405201.1	-	37	5642	c.5642delA	c.(5641-5643)aagfs	p.K1881fs	NCOR2_ENST00000356219.3_Frame_Shift_Del_p.K1888fs|NCOR2_ENST00000404121.2_Frame_Shift_Del_p.K1442fs|NCOR2_ENST00000429285.2_Frame_Shift_Del_p.K1871fs|NCOR2_ENST00000404621.1_Frame_Shift_Del_p.K1871fs|NCOR2_ENST00000397355.1_Frame_Shift_Del_p.K1872fs			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1892					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GATGATACCCTTCATGCCTGT	0.667																																																	0													87.0	99.0	95.0					12																	124824597		2124	4227	6351	SO:0001589	frameshift_variant	0			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5642delA	12.37:g.124824597delT	ENSP00000384018:p.Lys1881fs		O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Frame_Shift_Del	DEL	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.K1888fs	ENST00000405201.1	37	c.5663	CCDS41858.2	12																																																																																			NCOR2	-	NULL	ENSG00000196498		0.667	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	HGNC	protein_coding	OTTHUMT00000318173.2		0.00	54	0	T	NM_006312		124824597	-1	tier1		no_errors	ENST00000356219	ensembl	human	known	74_37	frame_shift_del	9.52	19	2	DEL	1.000	-
NDNF	79625	genome.wustl.edu	37	4	121958158	121958158	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:121958158A>G	ENST00000379692.4	-	4	1494	c.968T>C	c.(967-969)aTg>aCg	p.M323T	NDNF_ENST00000506900.1_5'Flank	NM_024574.3	NP_078850.3	Q8TB73	NDNF_HUMAN	neuron-derived neurotrophic factor	323	Fibronectin type-III 1.				cell growth (GO:0016049)|extracellular matrix organization (GO:0030198)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron projection development (GO:0010976)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)	p.M323R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(3)|skin(1)|urinary_tract(1)	29						AGCGGTGCTCATGTTGCTGTT	0.418																																																	1	Substitution - Missense(1)	urinary_tract(1)											164.0	137.0	146.0					4																	121958158		2203	4300	6503	SO:0001583	missense	0			BC019351	CCDS3717.2	4q27	2011-07-05	2011-07-05	2011-07-05	ENSG00000173376	ENSG00000173376			26256	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 31"""	C4orf31		12975309, 20969804	Standard	NM_024574		Approved	FLJ23191	uc003idq.1	Q8TB73	OTTHUMG00000132973	ENST00000379692.4:c.968T>C	4.37:g.121958158A>G	ENSP00000369014:p.Met323Thr		A8K0Q0|Q6UWE5|Q9H5P7	Missense_Mutation	SNP	pfam_DUF2369,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.M323T	ENST00000379692.4	37	c.968	CCDS3717.2	4	.	.	.	.	.	.	.	.	.	.	A	1.169	-0.641641	0.03531	.	.	ENSG00000173376	ENST00000379692	T	0.52057	0.68	5.88	-6.47	0.01902	.	0.381500	0.34002	N	0.004347	T	0.23094	0.0558	N	0.12746	0.255	0.40986	D	0.984813	B	0.02656	0.0	B	0.01281	0.0	T	0.07751	-1.0756	10	0.17832	T	0.49	-7.416	15.585	0.76475	0.5346:0.0:0.4654:0.0	.	323	Q8TB73	NDNF_HUMAN	T	323	ENSP00000369014:M323T	ENSP00000369014:M323T	M	-	2	0	NDNF	122177608	0.977000	0.34250	0.601000	0.28877	0.977000	0.68977	0.572000	0.23684	-1.050000	0.03230	-0.290000	0.09829	ATG	NDNF	-	pfam_DUF2369,superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000173376		0.418	NDNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDNF	HGNC	protein_coding	OTTHUMT00000256532.2		0.00	18	0	A	NM_024574		121958158	-1			no_errors	ENST00000379692	ensembl	human	known	74_37	missense	13.33	13	2	SNP	0.668	G
NDST2	8509	genome.wustl.edu	37	10	75563503	75563503	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:75563503G>T	ENST00000309979.6	-	11	2527	c.1971C>A	c.(1969-1971)taC>taA	p.Y657*	NDST2_ENST00000299641.4_Nonsense_Mutation_p.Y534*|ZSWIM8-AS1_ENST00000456638.2_RNA|RP11-574K11.31_ENST00000603027.1_Nonsense_Mutation_p.Y657*			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	657	Heparan sulfate N-sulfotransferase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					AGAAATCCATGTACCTAGGAA	0.483																																																	0													114.0	124.0	121.0					10																	75563503		2203	4300	6503	SO:0001587	stop_gained	0			U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.1971C>A	10.37:g.75563503G>T	ENSP00000310657:p.Tyr657*		Q2TB32|Q59H89	Nonsense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.Y657*	ENST00000309979.6	37	c.1971	CCDS7335.1	10	.	.	.	.	.	.	.	.	.	.	G	45	12.054000	0.99631	.	.	ENSG00000166507	ENST00000309979;ENST00000299641	.	.	.	5.95	4.09	0.47781	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.2834	0.43554	0.2014:0.0:0.7986:0.0	.	.	.	.	X	657;534	.	ENSP00000299641:Y534X	Y	-	3	2	NDST2	75233509	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.249000	0.43169	0.842000	0.35045	0.655000	0.94253	TAC	NDST2	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	ENSG00000166507		0.483	NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST2	HGNC	protein_coding	OTTHUMT00000048710.1		0.00	74	0	G	NM_003635		75563503	-1			no_errors	ENST00000309979	ensembl	human	known	74_37	nonsense	5.19	73	4	SNP	1.000	T
NEURL1	9148	genome.wustl.edu	37	10	105349417	105349418	+	Splice_Site	INS	-	-	GTAA			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:105349417_105349418insGTAA	ENST00000369780.4	+	5	1895	c.1486_1486insGTAA	c.(1486-1488)ggg>GTAAggg	p.G496fs	SH3PXD2A_ENST00000427662.2_Intron|NEURL_ENST00000369777.2_Splice_Site_p.G479fs	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		496					brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CTCTGCTGGTGGTAAGTAGGCT	0.644																																																	0																																										SO:0001630	splice_region_variant	0																														ENST00000369780.4:c.1486+1->GTAA	10.37:g.105349418_105349421dupGTAA			Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Frame_Shift_Ins	INS	pfam_Neu_Z,smart_Neu_Z,pfscan_Neu_Z,pfscan_Znf_RING	p.T497fs	ENST00000369780.4	37	c.1486_1487	CCDS7551.1	10																																																																																			NEURL	-	NULL	ENSG00000107954		0.644	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEURL	HGNC	protein_coding	OTTHUMT00000050170.1		0.00	51	0	-		Frame_Shift_Ins	105349418	+1	tier1		no_errors	ENST00000369780	ensembl	human	known	74_37	frame_shift_ins	10.00	27	3	INS	0.998:1.000	GTAA
NLGN3	54413	genome.wustl.edu	37	X	70367646	70367646	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:70367646C>A	ENST00000358741.3	+	2	350	c.47C>A	c.(46-48)cCc>cAc	p.P16H	NLGN3_ENST00000536169.1_Missense_Mutation_p.P16H|NLGN3_ENST00000374051.3_Missense_Mutation_p.P16H	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	16					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					AGCCCCAAGCCCACGGTTGGC	0.662																																					Esophageal Squamous(103;760 1488 16849 22250 40351)												0													23.0	21.0	21.0					X																	70367646		2203	4300	6503	SO:0001583	missense	0			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.47C>A	X.37:g.70367646C>A	ENSP00000351591:p.Pro16His		B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.P16H	ENST00000358741.3	37	c.47	CCDS55441.1	X	.	.	.	.	.	.	.	.	.	.	C	9.869	1.198367	0.22037	.	.	ENSG00000196338	ENST00000536169;ENST00000374051;ENST00000395855;ENST00000358741	T;T;T;T	0.68903	-0.12;-0.14;-0.36;-0.13	4.56	2.79	0.32731	.	0.540066	0.19802	N	0.105728	T	0.38904	0.1058	N	0.08118	0	0.21933	N	0.999467	B;P;B	0.40144	0.291;0.704;0.415	B;B;B	0.33392	0.078;0.047;0.163	T	0.20940	-1.0260	10	0.45353	T	0.12	.	7.0292	0.24956	0.0:0.6778:0.0:0.3222	.	16;16;16	D3DVV1;B7Z5Y1;Q9NZ94-2	.;.;.	H	16	ENSP00000445298:P16H;ENSP00000363163:P16H;ENSP00000379196:P16H;ENSP00000351591:P16H	ENSP00000351591:P16H	P	+	2	0	NLGN3	70284371	1.000000	0.71417	0.994000	0.49952	0.880000	0.50808	2.221000	0.42917	0.390000	0.25115	0.529000	0.55759	CCC	NLGN3	-	NULL	ENSG00000196338		0.662	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN3	HGNC	protein_coding	OTTHUMT00000057121.1	-	0.00	81	0	C	NM_018977		70367646	+1	tier1	-	no_errors	ENST00000358741	ensembl	human	known	74_37	missense	25.53	35	12	SNP	0.935	A
NOP14	8602	genome.wustl.edu	37	4	2955331	2955331	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:2955331C>T	ENST00000314262.6	-	5	702	c.654G>A	c.(652-654)acG>acA	p.T218T	NOP14-AS1_ENST00000503709.1_RNA|NOP14_ENST00000398071.4_Silent_p.T218T|NOP14-AS1_ENST00000515194.1_RNA|NOP14_ENST00000502735.1_Silent_p.T218T|NOP14_ENST00000416614.2_Silent_p.T218T	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein	218					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						CTAGCTTCTCCGTGAGCTCGA	0.483																																																	0													276.0	256.0	263.0					4																	2955331		2203	4300	6503	SO:0001819	synonymous_variant	0			AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.654G>A	4.37:g.2955331C>T			D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Silent	SNP	pfam_Nop14	p.T218	ENST00000314262.6	37	c.654	CCDS33945.1	4																																																																																			NOP14	-	pfam_Nop14	ENSG00000087269		0.483	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	NOP14	HGNC	protein_coding	OTTHUMT00000358135.2	-	0.00	35	0	C	NM_003703		2955331	-1	tier1	-	no_errors	ENST00000416614	ensembl	human	known	74_37	silent	12.90	27	4	SNP	0.013	T
NPC1L1	29881	genome.wustl.edu	37	7	44561742	44561742	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr7:44561742C>T	ENST00000289547.4	-	11	2792	c.2737G>A	c.(2737-2739)Gag>Aag	p.E913K	NPC1L1_ENST00000381160.3_Missense_Mutation_p.E913K|NPC1L1_ENST00000546276.1_Missense_Mutation_p.E867K	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	913					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	ATCCCAGCCTCGCTGGAGAAG	0.542																																																	0													86.0	81.0	83.0					7																	44561742		2203	4300	6503	SO:0001583	missense	0				CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.2737G>A	7.37:g.44561742C>T	ENSP00000289547:p.Glu913Lys		A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.E913K	ENST00000289547.4	37	c.2737	CCDS5491.1	7	.	.	.	.	.	.	.	.	.	.	.	0.240	-1.014237	0.02095	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276	D;D;D	0.94046	-3.34;-3.34;-3.2	5.2	-2.28	0.06826	.	0.781728	0.12088	N	0.500653	D	0.84092	0.5396	L	0.42744	1.35	0.09310	N	1	B;B;B	0.27765	0.146;0.005;0.188	B;B;B	0.15870	0.011;0.005;0.014	T	0.70450	-0.4868	10	0.07175	T	0.84	-6.3521	4.6129	0.12411	0.2173:0.287:0.0:0.4957	.	867;913;913	B7ZLE6;Q17RV5;D3DVK9	.;.;.	K	913;913;867	ENSP00000289547:E913K;ENSP00000370552:E913K;ENSP00000438033:E867K	ENSP00000289547:E913K	E	-	1	0	NPC1L1	44528267	0.000000	0.05858	0.001000	0.08648	0.308000	0.27856	-0.568000	0.05909	-0.078000	0.12730	-0.215000	0.12644	GAG	NPC1L1	-	NULL	ENSG00000015520		0.542	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	NPC1L1	HGNC	protein_coding	OTTHUMT00000251256.1	-	0.00	52	0	C	NM_013389		44561742	-1	tier1	-	no_errors	ENST00000289547	ensembl	human	known	74_37	missense	15.00	68	12	SNP	0.001	T
NPLOC4	55666	genome.wustl.edu	37	17	79564312	79564312	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr17:79564312C>T	ENST00000331134.6	-	10	1167	c.952G>A	c.(952-954)Gaa>Aaa	p.E318K	NPLOC4_ENST00000374747.5_Missense_Mutation_p.E318K|NPLOC4_ENST00000539314.1_Missense_Mutation_p.E157K	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)	318					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			CGGGTATCTTCTGAGACGAGG	0.488																																																	0													118.0	117.0	117.0					17																	79564312		1981	4154	6135	SO:0001583	missense	0			AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.952G>A	17.37:g.79564312C>T	ENSP00000331487:p.Glu318Lys		Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Missense_Mutation	SNP	pfam_NPL4,pfam_NPL4_Zn-bd_put,pfam_Npl4_Ub-like_dom,pirsf_PolyUb_recognition_cplx_Npl4	p.E318K	ENST00000331134.6	37	c.952	CCDS45812.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.592163	0.96590	.	.	ENSG00000182446	ENST00000331134;ENST00000374747;ENST00000539314	.	.	.	5.54	5.54	0.83059	Nuclear pore localisation protein NPL4 (1);	0.000000	0.85682	D	0.000000	T	0.74839	0.3769	L	0.54323	1.7	0.80722	D	1	B;D;D	0.67145	0.143;0.996;0.996	B;D;D	0.69654	0.201;0.94;0.965	T	0.68108	-0.5496	9	0.23302	T	0.38	-22.1502	19.9063	0.97008	0.0:1.0:0.0:0.0	.	157;318;318	B4DG89;Q8TAT6-2;Q8TAT6	.;.;NPL4_HUMAN	K	318;317;157	.	ENSP00000331487:E318K	E	-	1	0	NPLOC4	77174750	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	7.314000	0.78988	2.774000	0.95407	0.644000	0.83932	GAA	NPLOC4	-	pfam_NPL4,pirsf_PolyUb_recognition_cplx_Npl4	ENSG00000182446		0.488	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPLOC4	HGNC	protein_coding	OTTHUMT00000440140.1	-	0.00	51	0	C			79564312	-1	tier1	-	no_errors	ENST00000374747	ensembl	human	known	74_37	missense	18.87	43	10	SNP	1.000	T
NPR1	4881	genome.wustl.edu	37	1	153653735	153653735	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:153653735A>G	ENST00000368680.3	+	3	1473	c.1001A>G	c.(1000-1002)tAt>tGt	p.Y334C	NPR1_ENST00000413826.1_Intron	NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	334					body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	CACCTGGCCTATGAGCAGTTC	0.537																																					Pancreas(141;1349 1870 15144 15830 40702)												0													75.0	80.0	78.0					1																	153653735		2203	4300	6503	SO:0001583	missense	0			BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.1001A>G	1.37:g.153653735A>G	ENSP00000357669:p.Tyr334Cys		B0ZBF0|Q5SR08|Q6P4Q3	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Peripla_BP_I,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ntpep_rcpt,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.Y334C	ENST00000368680.3	37	c.1001	CCDS1051.1	1	.	.	.	.	.	.	.	.	.	.	A	9.097	1.003133	0.19121	.	.	ENSG00000169418	ENST00000368680	D	0.82711	-1.64	5.06	-10.1	0.00402	Extracellular ligand-binding receptor (1);	1.178950	0.06105	N	0.666023	T	0.36303	0.0962	N	0.08118	0	0.09310	N	1	B	0.23937	0.094	B	0.17098	0.017	T	0.46133	-0.9213	10	0.62326	D	0.03	.	4.7623	0.13113	0.326:0.0:0.2804:0.3936	.	334	P16066	ANPRA_HUMAN	C	334	ENSP00000357669:Y334C	ENSP00000357669:Y334C	Y	+	2	0	NPR1	151920359	0.000000	0.05858	0.000000	0.03702	0.341000	0.28922	-1.757000	0.01811	-2.706000	0.00396	-1.122000	0.02009	TAT	NPR1	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000169418		0.537	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR1	HGNC	protein_coding	OTTHUMT00000090034.1		0.00	34	0	A	NM_000906		153653735	+1			no_errors	ENST00000368680	ensembl	human	known	74_37	missense	12.50	21	3	SNP	0.000	G
NUP155	9631	genome.wustl.edu	37	5	37304888	37304888	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:37304888G>T	ENST00000231498.3	-	27	3318	c.3115C>A	c.(3115-3117)Ctt>Att	p.L1039I	NUP155_ENST00000502533.1_5'UTR|NUP155_ENST00000513532.1_Missense_Mutation_p.L975I|NUP155_ENST00000381843.2_Missense_Mutation_p.L980I	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	1039					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CAATTATAAAGGGCAATACTA	0.328																																																	0													137.0	140.0	139.0					5																	37304888		2202	4300	6502	SO:0001583	missense	0			AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.3115C>A	5.37:g.37304888G>T	ENSP00000231498:p.Leu1039Ile		Q9UBE9|Q9UFL5	Missense_Mutation	SNP	pfam_Nucleoporin_Nup133/Nup155_C,pfam_Nucleoporin_Nup133/Nup155_N,superfamily_WD40_repeat_dom	p.L1039I	ENST00000231498.3	37	c.3115	CCDS3921.1	5	.	.	.	.	.	.	.	.	.	.	G	20.6	4.025854	0.75390	.	.	ENSG00000113569	ENST00000231498;ENST00000381843;ENST00000434056;ENST00000513532	D;D;D	0.84223	-1.82;-1.8;-1.76	5.54	5.54	0.83059	Nucleoporin, Nup133/Nup155-like, C-terminal (1);	0.054540	0.85682	D	0.000000	D	0.83991	0.5374	L	0.34521	1.04	0.58432	D	0.999993	P;B	0.41366	0.747;0.338	P;B	0.45610	0.487;0.277	D	0.84488	0.0609	10	0.51188	T	0.08	-2.8718	19.4812	0.95011	0.0:0.0:1.0:0.0	.	975;1039	E9PF10;O75694	.;NU155_HUMAN	I	1039;980;1001;975	ENSP00000231498:L1039I;ENSP00000371265:L980I;ENSP00000422019:L975I	ENSP00000231498:L1039I	L	-	1	0	NUP155	37340645	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.189000	0.77747	2.600000	0.87896	0.655000	0.94253	CTT	NUP155	-	pfam_Nucleoporin_Nup133/Nup155_C	ENSG00000113569		0.328	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP155	HGNC	protein_coding	OTTHUMT00000207593.2	-	0.00	41	0	G	NM_153485, NM_004298		37304888	-1	tier1	-	no_errors	ENST00000231498	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
NXPH2	11249	genome.wustl.edu	37	2	139428697	139428697	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:139428697G>A	ENST00000272641.3	-	2	696	c.590C>T	c.(589-591)gCg>gTg	p.A197V		NM_007226.2	NP_009157.1	O95156	NXPH2_HUMAN	neurexophilin 2	197	V (Cys-rich).				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)|urinary_tract(3)	22				BRCA - Breast invasive adenocarcinoma(221;0.101)		GGTCTTTTTCGCCCGATCTGT	0.488																																																	0													69.0	67.0	68.0					2																	139428697		1878	4103	5981	SO:0001583	missense	0			AF043467	CCDS46421.1	2q22.1	2008-05-15			ENSG00000144227	ENSG00000144227			8076	protein-coding gene	gene with protein product		604635				9570794	Standard	NM_007226		Approved	NPH2	uc002tvi.3	O95156	OTTHUMG00000153636	ENST00000272641.3:c.590C>T	2.37:g.139428697G>A	ENSP00000272641:p.Ala197Val		B7WP24|Q494R1|Q75QC3	Missense_Mutation	SNP	pfam_NXPH/NXPE,pirsf_Neurexophilin	p.A197V	ENST00000272641.3	37	c.590	CCDS46421.1	2	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035977	0.75617	.	.	ENSG00000144227	ENST00000272641	.	.	.	5.51	5.51	0.81932	.	0.153169	0.64402	D	0.000016	T	0.71685	0.3369	L	0.54323	1.7	0.41580	D	0.988739	P	0.52170	0.951	P	0.55345	0.774	T	0.68907	-0.5285	8	.	.	.	-17.4868	19.7866	0.96442	0.0:0.0:1.0:0.0	.	197	O95156	NXPH2_HUMAN	V	197	.	.	A	-	2	0	NXPH2	139145167	1.000000	0.71417	0.990000	0.47175	0.983000	0.72400	5.064000	0.64338	2.756000	0.94617	0.655000	0.94253	GCG	NXPH2	-	pfam_NXPH/NXPE,pirsf_Neurexophilin	ENSG00000144227		0.488	NXPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXPH2	HGNC	protein_coding	OTTHUMT00000331901.1		0.00	24	0	G			139428697	-1			no_errors	ENST00000272641	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.996	A
OBSCN	84033	genome.wustl.edu	37	1	228467709	228467709	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:228467709C>T	ENST00000422127.1	+	28	7628	c.7584C>T	c.(7582-7584)ctC>ctT	p.L2528L	OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000359599.6_Silent_p.L1375L|OBSCN_ENST00000570156.2_Silent_p.L2957L|OBSCN_ENST00000284548.11_Silent_p.L2528L|OBSCN_ENST00000366709.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2528	Ig-like 24.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGCGCATCCTCCGGCTCATGC	0.622																																																	0													21.0	24.0	23.0					1																	228467709		2114	4218	6332	SO:0001819	synonymous_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.7584C>T	1.37:g.228467709C>T			Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.L2528	ENST00000422127.1	37	c.7584	CCDS58065.1	1																																																																																			OBSCN	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000154358		0.622	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	30	0	C	NM_052843		228467709	+1	tier1	-	no_errors	ENST00000422127	ensembl	human	known	74_37	silent	20.83	19	5	SNP	0.015	T
OIT3	170392	genome.wustl.edu	37	10	74684045	74684045	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:74684045C>T	ENST00000334011.5	+	7	1228	c.1010C>T	c.(1009-1011)cCg>cTg	p.P337L		NM_152635.1	NP_689848.1	Q8WWZ8	OIT3_HUMAN	oncoprotein induced transcript 3	337	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)	35	Prostate(51;0.0198)					AAGCAGACCCCGGGGAGCAGC	0.567																																					Colon(7;19 345 13446 17537)												0													81.0	80.0	80.0					10																	74684045		2203	4300	6503	SO:0001583	missense	0				CCDS7318.1	10q22.2-q22.3	2004-04-21			ENSG00000138315	ENSG00000138315			29953	protein-coding gene	gene with protein product		609330				12975309, 12939600	Standard	NM_152635		Approved	LZP, FLJ39116	uc001jte.1	Q8WWZ8	OTTHUMG00000018444	ENST00000334011.5:c.1010C>T	10.37:g.74684045C>T	ENSP00000333900:p.Pro337Leu		A0AVP3|Q8N1M8	Missense_Mutation	SNP	pfam_ZP_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_ZP_dom,pfscan_ZP_dom,prints_ZP_dom	p.P337L	ENST00000334011.5	37	c.1010	CCDS7318.1	10	.	.	.	.	.	.	.	.	.	.	C	21.1	4.093474	0.76756	.	.	ENSG00000138315	ENST00000334011	T	0.80033	-1.33	5.72	5.72	0.89469	Zona pellucida sperm-binding protein (3);	0.000000	0.56097	D	0.000021	D	0.88474	0.6446	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85106	0.0960	10	0.27082	T	0.32	-14.4264	19.879	0.96888	0.0:1.0:0.0:0.0	.	337	Q8WWZ8	OIT3_HUMAN	L	337	ENSP00000333900:P337L	ENSP00000333900:P337L	P	+	2	0	OIT3	74354051	1.000000	0.71417	0.968000	0.41197	0.944000	0.59088	7.525000	0.81892	2.695000	0.91970	0.655000	0.94253	CCG	OIT3	-	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom	ENSG00000138315		0.567	OIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OIT3	HGNC	protein_coding	OTTHUMT00000048596.1	-	0.00	70	0	C	NM_152635		74684045	+1	tier1	-	no_errors	ENST00000334011	ensembl	human	known	74_37	missense	32.65	33	16	SNP	1.000	T
OR1E1	8387	genome.wustl.edu	37	17	3301281	3301281	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr17:3301281G>T	ENST00000322608.2	-	1	423	c.424C>A	c.(424-426)Ctc>Atc	p.L142I		NM_003553.2	NP_003544.2	P30953	OR1E1_HUMAN	olfactory receptor, family 1, subfamily E, member 1	142					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(2)|lung(5)	10						ACCAGGGCGAGACAGAGCATG	0.567											OREG0007321	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=OR1E1|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																																					0													96.0	75.0	82.0					17																	3301281		2203	4300	6503	SO:0001583	missense	0			U04642	CCDS11024.1	17p13.3	2012-08-09			ENSG00000180016	ENSG00000180016		"""GPCR / Class A : Olfactory receptors"""	8189	protein-coding gene	gene with protein product				OR1E9P, OR1E5, OR1E6		8004088, 1370859	Standard	NM_003553		Approved	OR17-2, HGM071, OR17-32, OR13-66	uc002fvj.1	P30953	OTTHUMG00000090643	ENST00000322608.2:c.424C>A	17.37:g.3301281G>T	ENSP00000313384:p.Leu142Ile	610	O43884|P47882|P47885|Q6IFA9|Q6IFM5|Q9UBJ1|Q9UM60	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L142I	ENST00000322608.2	37	c.424	CCDS11024.1	17	.	.	.	.	.	.	.	.	.	.	G	6.494	0.459355	0.12342	.	.	ENSG00000180016	ENST00000322608	T	0.37584	1.19	4.69	-5.25	0.02781	GPCR, rhodopsin-like superfamily (1);	1.121610	0.06689	N	0.769410	T	0.14270	0.0345	N	0.10685	0.025	0.09310	N	1	B	0.06786	0.001	B	0.15870	0.014	T	0.19451	-1.0305	10	0.38643	T	0.18	.	1.7005	0.02871	0.3446:0.3312:0.2016:0.1226	.	142	P30953	OR1E1_HUMAN	I	142	ENSP00000313384:L142I	ENSP00000313384:L142I	L	-	1	0	OR1E1	3248031	0.000000	0.05858	0.032000	0.17829	0.495000	0.33615	-2.276000	0.01161	-0.567000	0.06046	0.591000	0.81541	CTC	OR1E1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000180016		0.567	OR1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1E1	HGNC	protein_coding	OTTHUMT00000207303.1		0.00	87	0	G	NM_003553		3301281	-1			no_errors	ENST00000322608	ensembl	human	known	74_37	missense	8.20	56	5	SNP	0.000	T
OR4K2	390431	genome.wustl.edu	37	14	20345037	20345037	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr14:20345037G>A	ENST00000298642.2	+	1	647	c.611G>A	c.(610-612)gGc>gAc	p.G204D		NM_001005501.1	NP_001005501.1	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K, member 2	204						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(16)|ovary(2)|skin(9)|upper_aerodigestive_tract(2)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TCAACAAGTGGCATAATTGCG	0.408																																																	0													328.0	327.0	327.0					14																	20345037		2203	4300	6503	SO:0001583	missense	0				CCDS32023.1	14q11.2	2013-09-23			ENSG00000165762	ENSG00000165762		"""GPCR / Class A : Olfactory receptors"""	14728	protein-coding gene	gene with protein product							Standard	NM_001005501		Approved		uc001vwh.1	Q8NGD2	OTTHUMG00000170624	ENST00000298642.2:c.611G>A	14.37:g.20345037G>A	ENSP00000298642:p.Gly204Asp		B2RNK8|Q6IFA5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G204D	ENST00000298642.2	37	c.611	CCDS32023.1	14	.	.	.	.	.	.	.	.	.	.	.	16.83	3.230089	0.58777	.	.	ENSG00000165762	ENST00000298642	T	0.38560	1.13	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.127072	0.35555	N	0.003130	T	0.73984	0.3657	H	0.95950	3.745	0.33745	D	0.61996	P	0.51933	0.949	D	0.64237	0.923	D	0.86605	0.1869	10	0.87932	D	0	.	15.826	0.78706	0.0:0.0:1.0:0.0	.	204	Q8NGD2	OR4K2_HUMAN	D	204	ENSP00000298642:G204D	ENSP00000298642:G204D	G	+	2	0	OR4K2	19414877	0.000000	0.05858	1.000000	0.80357	0.868000	0.49771	0.361000	0.20267	2.596000	0.87737	0.467000	0.42956	GGC	OR4K2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000165762		0.408	OR4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K2	HGNC	protein_coding	OTTHUMT00000409864.1	-	0.00	41	0	G			20345037	+1	tier1	-	no_errors	ENST00000298642	ensembl	human	known	74_37	missense	16.67	15	3	SNP	0.999	A
OR52I2	143502	genome.wustl.edu	37	11	4608080	4608080	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:4608080T>C	ENST00000312614.4	+	1	60	c.38T>C	c.(37-39)aTa>aCa	p.I13T		NM_001005170.2	NP_001005170.1	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I, member 2	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|pancreas(1)|skin(1)	19		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATTCTTCTCATACATCATTTG	0.438																																																	0													92.0	80.0	84.0					11																	4608080		2201	4298	6499	SO:0001583	missense	0			BK004264	CCDS31355.1	11p15.4	2012-08-09			ENSG00000226288	ENSG00000226288		"""GPCR / Class A : Olfactory receptors"""	15221	protein-coding gene	gene with protein product							Standard	NM_001005170		Approved		uc010qyh.2	Q8NH67	OTTHUMG00000165721	ENST00000312614.4:c.38T>C	11.37:g.4608080T>C	ENSP00000308764:p.Ile13Thr		B2RNJ5|B9EKV8|Q6IFJ8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I13T	ENST00000312614.4	37	c.38	CCDS31355.1	11	.	.	.	.	.	.	.	.	.	.	T	7.011	0.556847	0.13436	.	.	ENSG00000226288	ENST00000312614	T	0.00626	6.13	2.9	-5.8	0.02347	.	4.129600	0.01144	U	0.006271	T	0.00440	0.0014	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.48758	-0.9007	10	0.48119	T	0.1	.	1.4437	0.02360	0.3004:0.1078:0.1164:0.4753	.	13	Q8NH67	O52I2_HUMAN	T	13	ENSP00000308764:I13T	ENSP00000308764:I13T	I	+	2	0	OR52I2	4564656	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.080000	0.11339	-1.590000	0.01623	-0.385000	0.06624	ATA	OR52I2	-	NULL	ENSG00000226288		0.438	OR52I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52I2	HGNC	protein_coding	OTTHUMT00000385946.1	-	0.00	35	0	T	NM_001005170		4608080	+1	tier1	-	no_errors	ENST00000312614	ensembl	human	known	74_37	missense	14.29	36	6	SNP	0.000	C
OVGP1	5016	genome.wustl.edu	37	1	111964264	111964264	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:111964264C>A	ENST00000369732.3	-	7	695	c.640G>T	c.(640-642)Gac>Tac	p.D214Y	OVGP1_ENST00000481495.1_5'UTR|OVGP1_ENST00000540696.1_Intron	NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	214					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		CCATGTAAGTCATAAGACAAG	0.458																																																	0													88.0	91.0	90.0					1																	111964264		2203	4300	6503	SO:0001583	missense	0			U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.640G>T	1.37:g.111964264C>A	ENSP00000358747:p.Asp214Tyr		A0AV19|B9EGE1|Q15841	Missense_Mutation	SNP	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	p.D214Y	ENST00000369732.3	37	c.640	CCDS834.1	1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.623408	0.66901	.	.	ENSG00000085465	ENST00000369732;ENST00000369728;ENST00000434331	T	0.25912	1.77	5.08	5.08	0.68730	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.61640	0.2363	H	0.97465	4.01	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75932	-0.3143	10	0.87932	D	0	-34.5035	15.9896	0.80193	0.0:1.0:0.0:0.0	.	214;278	Q12889;Q59HH5	OVGP1_HUMAN;.	Y	214;278;22	ENSP00000358747:D214Y	ENSP00000358743:D278Y	D	-	1	0	OVGP1	111765787	1.000000	0.71417	1.000000	0.80357	0.578000	0.36192	6.691000	0.74573	2.635000	0.89317	0.491000	0.48974	GAC	OVGP1	-	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	ENSG00000085465		0.458	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OVGP1	HGNC	protein_coding	OTTHUMT00000032461.1	-	0.00	49	0	C	NM_002557		111964264	-1	tier1	-	no_errors	ENST00000369732	ensembl	human	known	74_37	missense	16.67	50	10	SNP	1.000	A
P4HA2	8974	genome.wustl.edu	37	5	131528849	131528850	+	Intron	INS	-	-	C	rs77183859	byFrequency	TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:131528849_131528850insC	ENST00000401867.1	-	16	2106				P4HA2_ENST00000379086.1_Intron|P4HA2_ENST00000379100.2_Intron|P4HA2-AS1_ENST00000417667.1_RNA|P4HA2_ENST00000360568.3_Intron|P4HA2_ENST00000379104.2_Intron|P4HA2_ENST00000166534.4_Intron			O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha polypeptide II						peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|procollagen-proline 4-dioxygenase complex (GO:0016222)	electron carrier activity (GO:0009055)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	CTTCATGATGACCccctgcact	0.421																																					Esophageal Squamous(68;117 1135 17362 19256 34242)												0																																										SO:0001627	intron_variant	0			U90441	CCDS4151.1, CCDS34230.1	5q31	2008-12-09	2008-12-09		ENSG00000072682	ENSG00000072682	1.14.11.2		8547	protein-coding gene	gene with protein product	"""4-PH alpha 2"", ""collagen prolyl 4-hydroxylase alpha(II)"""	600608	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II"""			9211872, 9149945	Standard	NM_001142598		Approved	C-P4Halpha(II)	uc003kwl.3	O15460	OTTHUMG00000059647	ENST00000401867.1:c.1538-76->G	5.37:g.131528854_131528854dupC			D3DQ85|D3DQ86|Q8WWN0	RNA	INS	-	NULL	ENST00000401867.1	37	NULL	CCDS4151.1	5																																																																																			P4HA2	-	-	ENSG00000072682		0.421	P4HA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	P4HA2	HGNC	protein_coding	OTTHUMT00000132653.4		0.00	29	0	-	NM_004199		131528850	-1	tier1		no_errors	ENST00000506807	ensembl	human	known	74_37	rna	8.33	22	2	INS	0.003:0.002	C
PACRG	135138	genome.wustl.edu	37	6	163510422	163510422	+	Missense_Mutation	SNP	A	A	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:163510422A>T	ENST00000337019.3	+	5	819	c.595A>T	c.(595-597)Atc>Ttc	p.I199F	PACRG_ENST00000366888.2_Missense_Mutation_p.I199F|PACRG_ENST00000366889.2_Missense_Mutation_p.I199F	NM_152410.2	NP_689623.2	Q96M98	PACRG_HUMAN	PARK2 co-regulated	199					spermatid development (GO:0007286)	cell body (GO:0044297)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm midpiece (GO:0097225)				endometrium(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)		TGTCCTGAACATCTTTAAGAA	0.453																																																	0													118.0	101.0	107.0					6																	163510422		2203	4300	6503	SO:0001583	missense	0			AK057286	CCDS5284.1, CCDS43524.1	6q26	2004-07-01			ENSG00000112530	ENSG00000112530			19152	protein-coding gene	gene with protein product		608427				12547187	Standard	NM_001080378		Approved	PARK2CRG, FLJ32724, Glup, HAK005771	uc003qua.3	Q96M98	OTTHUMG00000016116	ENST00000337019.3:c.595A>T	6.37:g.163510422A>T	ENSP00000337946:p.Ile199Phe		E1P5B5|Q6IMB8|Q8IZM1|Q8NHP5|Q9H1V9	Missense_Mutation	SNP	pfam_Parkin_co-regulated_protein,superfamily_ARM-type_fold	p.I199F	ENST00000337019.3	37	c.595	CCDS5284.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.02|19.02	3.746254|3.746254	0.69418|0.69418	.|.	.|.	ENSG00000112530|ENSG00000112530	ENST00000534958|ENST00000337019;ENST00000366889;ENST00000366888	.|T;T;T	.|0.67698	.|-0.2;-0.28;-0.28	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	.|0.114225	.|0.64402	.|D	.|0.000006	T|T	0.76772|0.76772	0.4034|0.4034	M|M	0.77313|0.77313	2.365|2.365	0.58432|0.58432	D|D	0.999999|0.999999	.|P;D	.|0.59357	.|0.794;0.985	.|P;D	.|0.64321	.|0.66;0.924	T|T	0.80795|0.80795	-0.1223|-0.1223	5|10	.|0.72032	.|D	.|0.01	-20.6637|-20.6637	15.6511|15.6511	0.77095|0.77095	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|199;199	.|Q96M98-2;Q96M98	.|.;PACRG_HUMAN	L|F	114|199	.|ENSP00000337946:I199F;ENSP00000355855:I199F;ENSP00000355854:I199F	.|ENSP00000337946:I199F	H|I	+|+	2|1	0|0	PACRG|PACRG	163430412|163430412	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	6.301000|6.301000	0.72782|0.72782	2.101000|2.101000	0.63845|0.63845	0.482000|0.482000	0.46254|0.46254	CAT|ATC	PACRG	-	pfam_Parkin_co-regulated_protein,superfamily_ARM-type_fold	ENSG00000112530		0.453	PACRG-003	KNOWN	basic|CCDS	protein_coding	PACRG	HGNC	protein_coding	OTTHUMT00000400424.1	-	0.00	54	0	A	NM_152410		163510422	+1	tier1	-	no_errors	ENST00000337019	ensembl	human	known	74_37	missense	36.21	37	21	SNP	1.000	T
PADI6	353238	genome.wustl.edu	37	1	17698739	17698739	+	RNA	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:17698739G>T	ENST00000434762.2	+	0	49							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	GCAGGCCTGAGGATGGTCAGC	0.622																																																	0													111.0	124.0	120.0					1																	17698739		2193	4289	6482			0			AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17698739G>T			Q330K5|Q70SX3	RNA	SNP	-	NULL	ENST00000434762.2	37	NULL		1																																																																																			PADI6	-	-	ENSG00000256049		0.622	PADI6-001	KNOWN	basic	processed_transcript	PADI6	HGNC	processed_transcript	OTTHUMT00000006804.4	-	0.00	41	0	G	NM_207421		17698739	+1	tier1	-	no_errors	ENST00000358481	ensembl	human	known	74_37	rna	8.16	45	4	SNP	0.027	T
PARD3B	117583	genome.wustl.edu	37	2	206041301	206041301	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:206041301G>T	ENST00000406610.2	+	13	2131	c.1924G>T	c.(1924-1926)Ggt>Tgt	p.G642C	PARD3B_ENST00000462231.1_Splice_Site_p.G642C|PARD3B_ENST00000351153.1_Splice_Site_p.G642C|PARD3B_ENST00000349953.3_Splice_Site_p.G642C|PARD3B_ENST00000358768.2_Splice_Site_p.G580C	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	642					cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)		p.G642R(1)|p.G580R(1)|p.G581R(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CAAACAGAAAGGTAAGAGTCT	0.353																																																	3	Substitution - Missense(3)	lung(3)											83.0	75.0	78.0					2																	206041301		1863	4100	5963	SO:0001630	splice_region_variant	0			AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.1924+1G>T	2.37:g.206041301G>T			E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Missense_Mutation	SNP	pfam_DUF3534,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.G642C	ENST00000406610.2	37	c.1924		2	.	.	.	.	.	.	.	.	.	.	G	18.75	3.691197	0.68271	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000351153;ENST00000349953	T;T;T;T	0.12361	2.89;2.69;2.88;2.89	5.9	5.9	0.94986	.	0.735823	0.13314	N	0.397276	T	0.21267	0.0512	N	0.22421	0.69	0.26768	N	0.96986	D;P;P;P;P	0.61080	0.989;0.861;0.873;0.771;0.956	P;B;B;P;P	0.54629	0.757;0.233;0.371;0.455;0.455	T	0.11299	-1.0593	10	0.62326	D	0.03	.	17.4224	0.87518	0.0:0.0:1.0:0.0	.	642;642;642;580;642	Q8TEW8-3;Q8TEW8;E9PE87;Q8TEW8-2;Q8TEW8-5	.;PAR3L_HUMAN;.;.;.	C	642;580;642;642	ENSP00000385848:G642C;ENSP00000351618:G580C;ENSP00000317261:G642C;ENSP00000340280:G642C	ENSP00000340280:G642C	G	+	1	0	PARD3B	205749546	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.153000	0.71819	2.786000	0.95864	0.561000	0.74099	GGT	PARD3B	-	NULL	ENSG00000116117		0.353	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	PARD3B	HGNC	protein_coding	OTTHUMT00000335992.1		0.00	44	0	G	NM_057177	Missense_Mutation	206041301	+1			no_errors	ENST00000406610	ensembl	human	known	74_37	missense	8.70	21	2	SNP	1.000	T
PARP1	142	genome.wustl.edu	37	1	226551783	226551783	+	Intron	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:226551783G>T	ENST00000366794.5	-	20	2802				PARP1_ENST00000490921.1_Intron	NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1						base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		TGGAAGGTCGGAAAAGGGAGA	0.498								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																																									0													82.0	79.0	80.0					1																	226551783		2203	4300	6503	SO:0001627	intron_variant	0			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.2659-12C>A	1.37:g.226551783G>T			B1ANJ4|Q8IUZ9	RNA	SNP	-	NULL	ENST00000366794.5	37	NULL	CCDS1554.1	1																																																																																			PARP1	-	-	ENSG00000143799		0.498	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP1	HGNC	protein_coding	OTTHUMT00000091519.1	-	0.00	55	0	G	NM_001618		226551783	-1	tier1	-	no_errors	ENST00000463968	ensembl	human	known	74_37	rna	7.84	47	4	SNP	0.835	T
PARP16	54956	genome.wustl.edu	37	15	65553309	65553309	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr15:65553309G>C	ENST00000444347.2	-	3	818	c.402C>G	c.(400-402)gaC>gaG	p.D134E	PARP16_ENST00000261888.6_Missense_Mutation_p.D249E			Q8N5Y8	PAR16_HUMAN	poly (ADP-ribose) polymerase family, member 16	249	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell death (GO:0060548)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum tubular network (GO:0071782)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)	kinase binding (GO:0019900)|NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|protein serine/threonine kinase activator activity (GO:0043539)			kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	9						TGGGAGGGATGTCTCCCCCTT	0.488																																					NSCLC(50;885 1163 13509 21242 41978)												0													209.0	177.0	188.0					15																	65553309		2201	4299	6500	SO:0001583	missense	0			AK000516	CCDS10204.1	15q22.2	2010-02-16	2004-08-25	2004-08-25	ENSG00000138617	ENSG00000138617		"""Poly (ADP-ribose) polymerases"""	26040	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 30"""	C15orf30		15273990	Standard	NM_017851		Approved	FLJ20509, FLJ25281, pART15	uc002aoq.3	Q8N5Y8	OTTHUMG00000133138	ENST00000444347.2:c.402C>G	15.37:g.65553309G>C	ENSP00000396118:p.Asp134Glu		Q6PK64|Q9NX03	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.D249E	ENST00000444347.2	37	c.747		15	.	.	.	.	.	.	.	.	.	.	G	12.17	1.856317	0.32791	.	.	ENSG00000138617	ENST00000261888;ENST00000444347	T;T	0.12774	2.65;2.65	5.21	-3.6	0.04570	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.295956	0.41001	N	0.000978	T	0.04679	0.0127	N	0.12961	0.28	0.33327	D	0.56806	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.13407	0.005;0.003;0.009	T	0.27468	-1.0073	10	0.20519	T	0.43	-13.1655	1.8317	0.03132	0.3948:0.2196:0.2746:0.111	.	249;134;249	Q8N5Y8-3;Q8N5Y8-2;Q8N5Y8	.;.;PAR16_HUMAN	E	249;134	ENSP00000261888:D249E;ENSP00000396118:D134E	ENSP00000261888:D249E	D	-	3	2	PARP16	63340362	0.005000	0.15991	0.839000	0.33178	0.981000	0.71138	-0.783000	0.04638	-0.277000	0.09193	0.655000	0.94253	GAC	PARP16	-	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000138617		0.488	PARP16-002	NOVEL	basic|exp_conf	protein_coding	PARP16	HGNC	protein_coding	OTTHUMT00000418174.1	-	0.00	56	0	G	NM_017851		65553309	-1	tier1	-	no_errors	ENST00000261888	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.533	C
PAXIP1	22976	genome.wustl.edu	37	7	154760285	154760285	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr7:154760285C>G	ENST00000404141.1	-	7	1780	c.1626G>C	c.(1624-1626)caG>caC	p.Q542H	PAXIP1_ENST00000473219.1_5'UTR|PAXIP1_ENST00000397192.1_Missense_Mutation_p.Q542H			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	542	Gln-rich.			Missing (in Ref. 4; AAB91434). {ECO:0000305}.	adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)		p.Q508H(1)		NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		gctgctgctgctggtgcatgc	0.627																																																	1	Substitution - Missense(1)	large_intestine(1)											13.0	13.0	13.0					7																	154760285		1934	3626	5560	SO:0001583	missense	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1626G>C	7.37:g.154760285C>G	ENSP00000384048:p.Gln542His		O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.Q542H	ENST00000404141.1	37	c.1626	CCDS47753.1	7	.	.	.	.	.	.	.	.	.	.	C	11.13	1.548436	0.27652	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000323199	T;T	0.48201	0.82;0.82	4.96	-3.3	0.05003	.	0.298320	0.23000	N	0.053095	T	0.26593	0.0650	N	0.19112	0.55	0.25352	N	0.988853	B;B;B;B	0.14012	0.001;0.009;0.002;0.001	B;B;B;B	0.12156	0.003;0.007;0.007;0.003	T	0.11991	-1.0565	10	0.45353	T	0.12	-3.9012	9.2332	0.37450	0.0:0.4209:0.4486:0.1305	.	495;451;508;542	B4DEQ6;Q6ZW49-3;Q6ZW49-1;Q6ZW49	.;.;.;PAXI1_HUMAN	H	542;542;495	ENSP00000384048:Q542H;ENSP00000380376:Q542H	ENSP00000319149:Q495H	Q	-	3	2	PAXIP1	154391218	0.712000	0.27916	0.413000	0.26509	0.911000	0.54048	0.051000	0.14141	-0.530000	0.06349	-0.357000	0.07601	CAG	PAXIP1	-	NULL	ENSG00000157212		0.627	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1		0.00	22	0	C	NM_007349		154760285	-1			no_errors	ENST00000397192	ensembl	human	known	74_37	missense	13.33	13	2	SNP	0.930	G
PCDH11X	27328	genome.wustl.edu	37	X	91642828	91642828	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:91642828G>T	ENST00000373094.1	+	5	4084	c.3239G>T	c.(3238-3240)aGc>aTc	p.S1080I	PCDH11X_ENST00000504220.2_Intron|PCDH11X_ENST00000361655.2_Missense_Mutation_p.S1070I|PCDH11X_ENST00000373097.1_Missense_Mutation_p.S1070I|PCDH11X_ENST00000298274.8_Missense_Mutation_p.S1043I|PCDH11X_ENST00000406881.1_Missense_Mutation_p.S1080I|PCDH11X_ENST00000373088.1_Missense_Mutation_p.S1043I	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1080					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						AGCCTTACCAGCACATCTCAT	0.557																																					NSCLC(38;925 1092 2571 38200 45895)												0													192.0	147.0	162.0					X																	91642828		2201	4298	6499	SO:0001583	missense	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3239G>T	X.37:g.91642828G>T	ENSP00000362186:p.Ser1080Ile		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S1080I	ENST00000373094.1	37	c.3239	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	G	12.79	2.042498	0.35989	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000373088;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T	0.58797	0.31;0.52;0.34;0.47;0.42;0.34	3.56	3.56	0.40772	.	0.000000	0.56097	U	0.000024	T	0.62073	0.2398	L	0.57536	1.79	0.31657	N	0.646004	D;P;P;P;P	0.54964	0.969;0.936;0.936;0.936;0.894	P;P;P;P;P	0.54629	0.757;0.692;0.692;0.692;0.495	T	0.68580	-0.5371	10	0.72032	D	0.01	.	7.9813	0.30185	0.1202:0.0:0.8798:0.0	.	1043;1070;1080;1070;1080	Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7	.;.;.;.;PC11X_HUMAN	I	1080;1070;1043;1070;1080;1080;1043	ENSP00000362186:S1080I;ENSP00000362189:S1070I;ENSP00000362180:S1043I;ENSP00000355105:S1070I;ENSP00000384758:S1080I;ENSP00000298274:S1043I	ENSP00000298274:S1043I	S	+	2	0	PCDH11X	91529484	1.000000	0.71417	0.990000	0.47175	0.198000	0.23893	6.912000	0.75753	1.376000	0.46267	0.502000	0.49764	AGC	PCDH11X	-	NULL	ENSG00000102290		0.557	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	-	0.00	83	0	G	NM_032969		91642828	+1	tier1	-	no_errors	ENST00000373094	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
PCDH17	27253	genome.wustl.edu	37	13	58299063	58299063	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr13:58299063C>A	ENST00000377918.3	+	4	3141	c.3115C>A	c.(3115-3117)Cca>Aca	p.P1039T		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	1039					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		ATCAAGCAGCCCAACCAAGGC	0.532																																					Melanoma(72;952 1291 1619 12849 33676)												0													86.0	86.0	86.0					13																	58299063		2203	4300	6503	SO:0001583	missense	0			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.3115C>A	13.37:g.58299063C>A	ENSP00000367151:p.Pro1039Thr		A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P1039T	ENST00000377918.3	37	c.3115	CCDS31986.1	13	.	.	.	.	.	.	.	.	.	.	C	17.38	3.374291	0.61735	.	.	ENSG00000118946	ENST00000377918	T	0.50548	0.74	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.58963	0.2159	L	0.43152	1.355	0.80722	D	1	D	0.62365	0.991	P	0.57244	0.816	T	0.49707	-0.8911	9	.	.	.	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	1039	O14917	PCD17_HUMAN	T	1039	ENSP00000367151:P1039T	.	P	+	1	0	PCDH17	57197064	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.885000	0.99019	0.655000	0.94253	CCA	PCDH17	-	NULL	ENSG00000118946		0.532	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH17	HGNC	protein_coding	OTTHUMT00000045139.1	-	0.00	30	0	C	NM_001040429		58299063	+1	tier1	-	no_errors	ENST00000377918	ensembl	human	known	74_37	missense	22.22	13	4	SNP	1.000	A
PCDH19	57526	genome.wustl.edu	37	X	99661722	99661722	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:99661722C>T	ENST00000373034.4	-	1	3549	c.1874G>A	c.(1873-1875)aGa>aAa	p.R625K	PCDH19_ENST00000420881.2_Missense_Mutation_p.R625K|PCDH19_ENST00000255531.7_Missense_Mutation_p.R625K	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	625	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						GCGGGTGGTTCTGACTTCGCC	0.572																																																	0													60.0	60.0	60.0					X																	99661722		2045	4174	6219	SO:0001583	missense	0			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.1874G>A	X.37:g.99661722C>T	ENSP00000362125:p.Arg625Lys		B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R625K	ENST00000373034.4	37	c.1874	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	C	17.88	3.497106	0.64186	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.50001	0.76;0.76;0.76	5.84	5.84	0.93424	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.67221	0.2870	L	0.57536	1.79	0.58432	D	0.999998	D;P;P	0.69078	0.997;0.815;0.846	D;P;P	0.80764	0.994;0.55;0.679	T	0.67352	-0.5692	10	0.56958	D	0.05	.	19.0738	0.93151	0.0:1.0:0.0:0.0	.	625;625;625	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	K	625	ENSP00000400327:R625K;ENSP00000362125:R625K;ENSP00000255531:R625K	ENSP00000255531:R625K	R	-	2	0	PCDH19	99548378	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.920000	0.70017	2.454000	0.82982	0.513000	0.50165	AGA	PCDH19	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165194		0.572	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	HGNC	protein_coding	OTTHUMT00000057479.2	-	0.00	37	0	C	NM_020766		99661722	-1	tier1	-	no_errors	ENST00000373034	ensembl	human	known	74_37	missense	20.00	24	6	SNP	1.000	T
PCDHB6	56130	genome.wustl.edu	37	5	140530577	140530577	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:140530577G>T	ENST00000231136.1	+	1	739	c.739G>T	c.(739-741)Gaa>Taa	p.E247*	PCDHB6_ENST00000543635.1_Nonsense_Mutation_p.E111*	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	247	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGAGCTCTATGAAGCACAAGT	0.547																																																	0													50.0	52.0	52.0					5																	140530577		2203	4300	6503	SO:0001587	stop_gained	0			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.739G>T	5.37:g.140530577G>T	ENSP00000231136:p.Glu247*		B2R8R9	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E247*	ENST00000231136.1	37	c.739	CCDS4248.1	5	.	.	.	.	.	.	.	.	.	.	G	21.9	4.217366	0.79352	.	.	ENSG00000113211	ENST00000543635;ENST00000231136;ENST00000542861	.	.	.	4.85	2.98	0.34508	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	5.0071	0.14293	0.2535:0.1737:0.5728:0.0	.	.	.	.	X	111;247;32	.	ENSP00000231136:E247X	E	+	1	0	PCDHB6	140510761	0.000000	0.05858	0.910000	0.35882	0.232000	0.25224	0.458000	0.21892	1.114000	0.41781	0.561000	0.74099	GAA	PCDHB6	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000113211		0.547	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB6	HGNC	protein_coding	OTTHUMT00000251818.2		0.00	31	0	G	NM_018939		140530577	+1			no_errors	ENST00000231136	ensembl	human	known	74_37	nonsense	8.89	41	4	SNP	0.966	T
PCDHB7	56129	genome.wustl.edu	37	5	140554584	140554584	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:140554584G>T	ENST00000231137.3	+	1	2342	c.2168G>T	c.(2167-2169)tGc>tTc	p.C723F	PCDHB8_ENST00000239444.2_5'Flank	NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	723					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTGGGTCGCTGCTCGGTGCCT	0.667																																																	0													77.0	125.0	108.0					5																	140554584		2203	4300	6503	SO:0001583	missense	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.2168G>T	5.37:g.140554584G>T	ENSP00000231137:p.Cys723Phe		A1L3Y8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.C723F	ENST00000231137.3	37	c.2168	CCDS4249.1	5	.	.	.	.	.	.	.	.	.	.	G	14.78	2.637246	0.47049	.	.	ENSG00000113212	ENST00000231137	T	0.53640	0.61	3.55	3.55	0.40652	.	.	.	.	.	T	0.70824	0.3268	H	0.97491	4.015	0.09310	N	1	P	0.48694	0.914	P	0.48738	0.588	T	0.69694	-0.5076	9	0.62326	D	0.03	.	13.867	0.63594	0.0:0.0:1.0:0.0	.	723	Q9Y5E2	PCDB7_HUMAN	F	723	ENSP00000231137:C723F	ENSP00000231137:C723F	C	+	2	0	PCDHB7	140534768	0.045000	0.20229	0.009000	0.14445	0.683000	0.39861	1.499000	0.35671	1.922000	0.55676	0.449000	0.29647	TGC	PCDHB7	-	NULL	ENSG00000113212		0.667	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	-	0.00	85	0	G	NM_018940		140554584	+1	tier1	-	no_errors	ENST00000231137	ensembl	human	known	74_37	missense	21.54	51	14	SNP	0.032	T
PCDHGB2	56103	genome.wustl.edu	37	5	140741730	140741730	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:140741730C>T	ENST00000522605.1	+	1	2028	c.2028C>T	c.(2026-2028)agC>agT	p.S676S	PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	676					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGACCTCAGCGACCGCCGGG	0.602																																																	0													54.0	59.0	57.0					5																	140741730		2031	4194	6225	SO:0001819	synonymous_variant	0			AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.2028C>T	5.37:g.140741730C>T			Q3MIJ3|Q9UN65	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S676	ENST00000522605.1	37	c.2028	CCDS54924.1	5																																																																																			PCDHGB2	-	NULL	ENSG00000253910		0.602	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB2	HGNC	protein_coding	OTTHUMT00000374741.1		0.00	49	0	C	NM_018923		140741730	+1			no_errors	ENST00000522605	ensembl	human	known	74_37	silent	5.71	33	2	SNP	0.048	T
PCSK7	9159	genome.wustl.edu	37	11	117098032	117098032	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:117098032C>T	ENST00000320934.3	-	5	1240	c.610G>A	c.(610-612)Gag>Aag	p.E204K		NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	204	Peptidase S8.				peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		TAGCTACCCTCAGGGCTCTGA	0.537			T	IGH@	MLCLS																																			Dom	yes		11	11q23.3	9159	proprotein convertase subtilisin/kexin type 7		L	0													86.0	90.0	89.0					11																	117098032		2201	4296	6497	SO:0001583	missense	0			U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.610G>A	11.37:g.117098032C>T	ENSP00000325917:p.Glu204Lys		B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.E204K	ENST00000320934.3	37	c.610	CCDS8382.1	11	.	.	.	.	.	.	.	.	.	.	C	15.58	2.874869	0.51695	.	.	ENSG00000160613	ENST00000320934;ENST00000543900;ENST00000525027	D;D	0.87491	-2.26;-2.26	5.61	5.61	0.85477	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	T	0.79730	0.4496	N	0.22421	0.69	0.80722	D	1	P	0.35923	0.528	B	0.35931	0.214	T	0.76785	-0.2831	10	0.11794	T	0.64	-29.9691	18.6171	0.91306	0.0:1.0:0.0:0.0	.	204	Q16549	PCSK7_HUMAN	K	204	ENSP00000325917:E204K;ENSP00000431181:E204K	ENSP00000325917:E204K	E	-	1	0	PCSK7	116603242	1.000000	0.71417	0.998000	0.56505	0.215000	0.24574	6.022000	0.70839	2.633000	0.89246	0.655000	0.94253	GAG	PCSK7	-	pfam_Peptidase_S8/S53_dom,superfamily_Peptidase_S8/S53_dom	ENSG00000160613		0.537	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK7	HGNC	protein_coding	OTTHUMT00000385529.2	-	0.00	31	0	C	NM_004716		117098032	-1	tier1	-	no_errors	ENST00000320934	ensembl	human	known	74_37	missense	30.30	23	10	SNP	1.000	T
PDXK	8566	genome.wustl.edu	37	21	45152521	45152521	+	Intron	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr21:45152521C>T	ENST00000291565.4	+	2	270				PDXK_ENST00000327574.4_Missense_Mutation_p.S88L|PDXK_ENST00000398081.1_Intron|PDXK_ENST00000468090.1_Intron|PDXK_ENST00000476313.1_Intron	NM_003681.4	NP_003672.1	O00764	PDXK_HUMAN	pyridoxal (pyridoxine, vitamin B6) kinase						cell proliferation (GO:0008283)|pyridoxal 5'-phosphate salvage (GO:0009443)|pyridoxal phosphate biosynthetic process (GO:0042823)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|lithium ion binding (GO:0031403)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|protein homodimerization activity (GO:0042803)|pyridoxal kinase activity (GO:0008478)|pyridoxal phosphate binding (GO:0030170)|sodium ion binding (GO:0031402)|zinc ion binding (GO:0008270)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5				Colorectal(79;0.109)|READ - Rectum adenocarcinoma(84;0.161)|STAD - Stomach adenocarcinoma(101;0.18)	Pyridoxal(DB00147)|Pyridoxine(DB00165)	TCTGTTTCTTCACAGTCGGTT	0.393																																																	0													109.0	115.0	113.0					21																	45152521		876	1991	2867	SO:0001627	intron_variant	0			U89606	CCDS13699.1	21q22.3	2007-05-10			ENSG00000160209	ENSG00000160209	2.7.1.35		8819	protein-coding gene	gene with protein product		179020	"""chromosome 21 open reading frame 97"", ""chromosome 21 open reading frame 124"""	C21orf97, C21orf124		9099727	Standard	NM_003681		Approved	PNK, PKH, FLJ21324, PRED79, FLJ31940, MGC15873	uc002zdm.4	O00764	OTTHUMG00000086870	ENST00000291565.4:c.88-1429C>T	21.37:g.45152521C>T			Q7Z2Y0|Q9BS02	Missense_Mutation	SNP	NULL	p.S88L	ENST00000291565.4	37	c.263	CCDS13699.1	21	.	.	.	.	.	.	.	.	.	.	C	7.016	0.557783	0.13436	.	.	ENSG00000160209	ENST00000327574	.	.	.	2.96	-0.157	0.13387	.	.	.	.	.	T	0.17789	0.0427	.	.	.	0.09310	N	1	B	0.19817	0.039	B	0.22880	0.042	T	0.26052	-1.0114	6	.	.	.	.	1.3012	0.02079	0.2215:0.4217:0.2164:0.1404	.	88	A8MT14	.	L	88	.	.	S	+	2	0	PDXK	43976949	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.053000	0.11846	-0.047000	0.13423	0.655000	0.94253	TCA	PDXK	-	NULL	ENSG00000160209		0.393	PDXK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDXK	HGNC	protein_coding	OTTHUMT00000195636.1	-	0.00	62	0	C	NM_003681		45152521	+1	tier1	-	no_errors	ENST00000327574	ensembl	human	putative	74_37	missense	10.91	49	6	SNP	0.000	T
JADE3	9767	genome.wustl.edu	37	X	46917885	46917885	+	Silent	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:46917885G>A	ENST00000218343.4	+	11	2176	c.1878G>A	c.(1876-1878)ccG>ccA	p.P626P	PHF16_ENST00000397189.1_Silent_p.P626P	NM_014735.3	NP_055550.1														NS(2)|endometrium(8)|kidney(4)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(2)	33						GGAGAACCCCGTCCTCGGAGT	0.537																																																	0													60.0	56.0	57.0					X																	46917885		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000218343.4:c.1878G>A	X.37:g.46917885G>A				Silent	SNP	pfam_Enhancer_polycomb-like_N,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.P626	ENST00000218343.4	37	c.1878	CCDS14271.1	X																																																																																			PHF16	-	NULL	ENSG00000102221		0.537	PHF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF16	HGNC	protein_coding	OTTHUMT00000056376.1	-	0.00	38	0	G			46917885	+1	tier1	-	no_errors	ENST00000218343	ensembl	human	known	74_37	silent	28.57	25	10	SNP	0.024	A
PLBD2	196463	genome.wustl.edu	37	12	113824744	113824744	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:113824744C>T	ENST00000280800.3	+	10	1320	c.1289C>T	c.(1288-1290)tCc>tTc	p.S430F	PLBD2_ENST00000545182.2_Missense_Mutation_p.S398F	NM_173542.3	NP_775813.2	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2	430					lipid catabolic process (GO:0016042)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						CCCGGCAGGTCCTTCGAGACT	0.622																																																	0													51.0	44.0	46.0					12																	113824744		2203	4300	6503	SO:0001583	missense	0			BC030618	CCDS9168.1, CCDS53834.1	12q24.13	2013-10-11				ENSG00000151176			27283	protein-coding gene	gene with protein product	"""PLB homolog 2 (Dictyostelium)"", ""mannose-6-phosphate protein associated protein p76"""					17105447, 15193148, 19019078	Standard	NM_001159727		Approved	p76	uc001tve.2	Q8NHP8	OTTHUMG00000169567	ENST00000280800.3:c.1289C>T	12.37:g.113824744C>T	ENSP00000280800:p.Ser430Phe		F5H5E2	Missense_Mutation	SNP	pfam_PLipase_B-like	p.S430F	ENST00000280800.3	37	c.1289	CCDS9168.1	12	.	.	.	.	.	.	.	.	.	.	C	9.838	1.190293	0.21954	.	.	ENSG00000151176	ENST00000545182;ENST00000280800	T;T	0.10860	2.83;2.83	5.33	0.429	0.16506	.	0.252483	0.41194	D	0.000924	T	0.04318	0.0119	N	0.02181	-0.65	0.23975	N	0.996292	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.002	T	0.36939	-0.9727	10	0.30854	T	0.27	-22.8453	15.2073	0.73190	0.6683:0.3317:0.0:0.0	.	398;430	F5H5E2;Q8NHP8	.;PLBL2_HUMAN	F	398;430	ENSP00000443463:S398F;ENSP00000280800:S430F	ENSP00000280800:S430F	S	+	2	0	PLBD2	112309127	1.000000	0.71417	0.992000	0.48379	0.980000	0.70556	2.265000	0.43311	0.149000	0.19098	0.561000	0.74099	TCC	PLBD2	-	pfam_PLipase_B-like	ENSG00000151176		0.622	PLBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLBD2	HGNC	protein_coding	OTTHUMT00000404835.1	-	0.00	32	0	C	NM_173542		113824744	+1	tier1	-	no_errors	ENST00000280800	ensembl	human	known	74_37	missense	35.71	18	10	SNP	1.000	T
PLCH1	23007	genome.wustl.edu	37	3	155282725	155282725	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:155282725C>G	ENST00000340059.7	-	7	1011	c.1012G>C	c.(1012-1014)Gag>Cag	p.E338Q	PLCH1_ENST00000447496.2_Missense_Mutation_p.E338Q|PLCH1_ENST00000334686.6_Missense_Mutation_p.E320Q|PLCH1_ENST00000414191.1_Missense_Mutation_p.E320Q|PLCH1_ENST00000460012.1_Missense_Mutation_p.E320Q|PLCH1_ENST00000494598.1_Missense_Mutation_p.E338Q	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	338	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CGACAGCCCTCTTGCAGCACC	0.488																																																	0													148.0	134.0	139.0					3																	155282725		2203	4300	6503	SO:0001583	missense	0			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.1012G>C	3.37:g.155282725C>G	ENSP00000345988:p.Glu338Gln		Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_EF_hand_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.E338Q	ENST00000340059.7	37	c.1012	CCDS46939.1	3	.	.	.	.	.	.	.	.	.	.	C	17.58	3.424450	0.62733	.	.	ENSG00000114805	ENST00000494598;ENST00000460012;ENST00000447496;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02;-0.02;-0.02	5.11	5.11	0.69529	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.409870	0.26796	N	0.022453	T	0.45677	0.1354	N	0.01284	-0.91	0.37290	D	0.908234	P;P;B	0.45212	0.823;0.853;0.143	P;P;B	0.50617	0.513;0.646;0.113	T	0.58289	-0.7662	10	0.19590	T	0.45	.	18.5371	0.91014	0.0:1.0:0.0:0.0	.	320;338;338	Q4KWH8-2;Q4KWH8;Q4KWH8-3	.;PLCH1_HUMAN;.	Q	338;320;338;338;320;320	ENSP00000419100:E338Q;ENSP00000417502:E320Q;ENSP00000402759:E338Q;ENSP00000345988:E338Q;ENSP00000335469:E320Q;ENSP00000412977:E320Q	ENSP00000335469:E320Q	E	-	1	0	PLCH1	156765419	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.050000	0.57404	2.371000	0.80710	0.655000	0.94253	GAG	PLCH1	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom,prints_Pinositol_PLipase_C	ENSG00000114805		0.488	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	HGNC	protein_coding	OTTHUMT00000351125.1	-	0.00	42	0	C	NM_014996		155282725	-1	tier1	-	no_errors	ENST00000340059	ensembl	human	known	74_37	missense	34.55	36	19	SNP	1.000	G
PLK3	1263	genome.wustl.edu	37	1	45270777	45270778	+	Intron	INS	-	-	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:45270777_45270778insA	ENST00000372201.4	+	14	1874				PLK3_ENST00000465443.1_Intron	NM_004073.2	NP_004064.2	Q9H4B4	PLK3_HUMAN	polo-like kinase 3						apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic microtubule organization (GO:0031122)|endomitotic cell cycle (GO:0007113)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi disassembly (GO:0090166)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G1/S transition checkpoint (GO:0044819)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell division (GO:0051302)|regulation of cytokinesis (GO:0032465)|response to osmotic stress (GO:0006970)|response to radiation (GO:0009314)|response to reactive oxygen species (GO:0000302)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi stack (GO:0005795)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					gactccatctcaaaaaaaaaaa	0.51																																																	0																																										SO:0001627	intron_variant	0			AJ293866	CCDS515.1	1p34.1	2013-01-18	2010-06-24	2004-01-28	ENSG00000173846	ENSG00000173846			2154	protein-coding gene	gene with protein product		602913	"""cytokine-inducible kinase"", ""polo-like kinase 3 (Drosophila)"""	CNK		8702627	Standard	NM_004073		Approved	FNK, PRK	uc001cmn.3	Q9H4B4	OTTHUMG00000008491	ENST00000372201.4:c.1636-160->A	1.37:g.45270788_45270788dupA			Q15767|Q5JR99|Q96CV1	RNA	INS	-	NULL	ENST00000372201.4	37	NULL	CCDS515.1	1																																																																																			PLK3	-	-	ENSG00000173846		0.510	PLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK3	HGNC	protein_coding	OTTHUMT00000023429.1		0.00	20	0	-	NM_004073		45270778	+1	tier1		no_errors	ENST00000461769	ensembl	human	known	74_37	rna	18.75	13	3	INS	0.017:0.019	A
PNLIPRP1	5407	genome.wustl.edu	37	10	118354274	118354274	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:118354274C>G	ENST00000528052.1	+	5	434	c.363C>G	c.(361-363)atC>atG	p.I121M	PNLIPRP1_ENST00000534537.1_Missense_Mutation_p.I121M|PNLIPRP1_ENST00000358834.4_Missense_Mutation_p.I121M			P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1	121					lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|triglyceride lipase activity (GO:0004806)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	38				all cancers(201;0.0161)		TGAACTGCATCTGCGTGGACT	0.592																																																	0													123.0	104.0	111.0					10																	118354274		2203	4300	6503	SO:0001583	missense	0			BC025784	CCDS7595.1	10q26.12	2006-07-04			ENSG00000187021	ENSG00000187021			9156	protein-coding gene	gene with protein product		604422				1379598	Standard	NM_006229		Approved	PLRP1	uc001lco.1	P54315	OTTHUMG00000019109	ENST00000528052.1:c.363C>G	10.37:g.118354274C>G	ENSP00000433933:p.Ile121Met		Q68D83|Q68DR6|Q8TAU2|Q9BS82	Missense_Mutation	SNP	pfam_Lipase_N,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pirsf_Lipoprotein_lipase_LIPH,pfscan_PLAT/LH2_dom,prints_Lipase_panc,prints_Lipase	p.I121M	ENST00000528052.1	37	c.363	CCDS7595.1	10	.	.	.	.	.	.	.	.	.	.	C	13.35	2.211868	0.39102	.	.	ENSG00000187021	ENST00000531984;ENST00000358834;ENST00000528052;ENST00000471549;ENST00000534537	D;D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09;-3.09	5.3	3.43	0.39272	Lipase, N-terminal (1);	0.104471	0.50627	D	0.000112	D	0.95865	0.8654	M	0.93550	3.43	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.94480	0.7692	10	0.62326	D	0.03	-21.3591	4.3769	0.11275	0.0:0.5783:0.1747:0.247	.	121	P54315	LIPR1_HUMAN	M	121	ENSP00000436123:I121M;ENSP00000351695:I121M;ENSP00000433933:I121M;ENSP00000431207:I121M;ENSP00000434159:I121M	ENSP00000351695:I121M	I	+	3	3	PNLIPRP1	118344264	0.817000	0.29147	0.989000	0.46669	0.959000	0.62525	0.223000	0.17719	1.374000	0.46228	0.650000	0.86243	ATC	PNLIPRP1	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase_panc,prints_Lipase	ENSG00000187021		0.592	PNLIPRP1-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PNLIPRP1	HGNC	protein_coding	OTTHUMT00000384633.1	-	0.00	55	0	C	NM_006229		118354274	+1	tier1	-	no_errors	ENST00000358834	ensembl	human	known	74_37	missense	20.37	43	11	SNP	0.929	G
POU6F1	5463	genome.wustl.edu	37	12	51586185	51586185	+	Missense_Mutation	SNP	C	C	T	rs139629485	byFrequency	TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:51586185C>T	ENST00000389243.4	-	9	1258	c.319G>A	c.(319-321)Gcc>Acc	p.A107T	POU6F1_ENST00000333640.10_Missense_Mutation_p.A107T|POU6F1_ENST00000550824.1_Missense_Mutation_p.A107T			Q14863	PO6F1_HUMAN	POU class 6 homeobox 1	107	Gln/Pro-rich.				brain development (GO:0007420)|heart development (GO:0007507)|muscle organ development (GO:0007517)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A107T(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	11						GATGGCTTGGCGGCTGGAGCT	0.597													C|||	2	0.000399361	0.0015	0.0	5008	,	,		16879	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	large_intestine(1)						C	THR/ALA	6,4400	11.4+/-27.6	0,6,2197	94.0	92.0	93.0		319	1.4	0.1	12	dbSNP_134	93	0,8600		0,0,4300	yes	missense	POU6F1	NM_002702.3	58	0,6,6497	TT,TC,CC		0.0,0.1362,0.0461	benign	107/302	51586185	6,13000	2203	4300	6503	SO:0001583	missense	0			AL832881	CCDS31803.1	12q13.13	2011-06-20	2007-07-13			ENSG00000184271		"""Homeoboxes / POU class"""	9224	protein-coding gene	gene with protein product			"""POU domain, class 6, transcription factor 1"""			7908264	Standard	NM_002702		Approved	BRN5, MPOU, TCFB1	uc001rxz.3	Q14863		ENST00000389243.4:c.319G>A	12.37:g.51586185C>T	ENSP00000373895:p.Ala107Thr		Q15944|Q6DK47|Q7Z7P6	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.A107T	ENST00000389243.4	37	c.319	CCDS31803.1	12	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	10.47	1.358510	0.24598	0.001362	0.0	ENSG00000184271	ENST00000389243;ENST00000333640;ENST00000550824	D;D;D	0.84730	-1.89;-1.89;-1.89	5.69	1.42	0.22433	.	0.417442	0.21082	U	0.080474	T	0.73094	0.3543	L	0.39898	1.24	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.52503	-0.8567	10	0.08837	T	0.75	.	7.4781	0.27390	0.0:0.4386:0.4107:0.1507	.	107	Q14863	PO6F1_HUMAN	T	107	ENSP00000373895:A107T;ENSP00000330190:A107T;ENSP00000448389:A107T	ENSP00000330190:A107T	A	-	1	0	POU6F1	49872452	0.353000	0.24904	0.056000	0.19401	0.978000	0.69477	0.706000	0.25690	0.289000	0.22422	0.655000	0.94253	GCC	POU6F1	-	NULL	ENSG00000184271		0.597	POU6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU6F1	HGNC	protein_coding	OTTHUMT00000405126.1		0.00	31	0	C	NM_002702		51586185	-1			no_errors	ENST00000333640	ensembl	human	known	74_37	missense	9.68	28	3	SNP	0.044	T
PPM1D	8493	genome.wustl.edu	37	17	58700916	58700916	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr17:58700916C>T	ENST00000305921.3	+	2	739	c.507C>T	c.(505-507)agC>agT	p.S169S		NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	169	PP2C-like.				G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			GTCTTCCTAGCACATCAGGGA	0.433																																																	0													197.0	189.0	192.0					17																	58700916		2203	4300	6503	SO:0001819	synonymous_variant	0			U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.507C>T	17.37:g.58700916C>T			Q53XP4|Q6P991|Q8IVR6	Silent	SNP	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.S169	ENST00000305921.3	37	c.507	CCDS11625.1	17																																																																																			PPM1D	-	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	ENSG00000170836		0.433	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1D	HGNC	protein_coding	OTTHUMT00000449474.1	-	0.00	53	0	C	NM_003620		58700916	+1	tier1	-	no_errors	ENST00000305921	ensembl	human	known	74_37	silent	25.71	51	18	SNP	1.000	T
PPOX	5498	genome.wustl.edu	37	1	161140274	161140274	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:161140274G>T	ENST00000367999.4	+	10	1329	c.1063G>T	c.(1063-1065)Gag>Tag	p.E355*	PPOX_ENST00000352210.5_Nonsense_Mutation_p.E355*|PPOX_ENST00000432542.2_Nonsense_Mutation_p.E100*|PPOX_ENST00000544598.1_Intron|PPOX_ENST00000495483.1_3'UTR|PPOX_ENST00000535223.1_Intron|B4GALT3_ENST00000470882.1_5'Flank	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	355					heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TGCTTTCCCTGAGCAGGACGG	0.542																																																	0													95.0	92.0	93.0					1																	161140274		2203	4300	6503	SO:0001587	stop_gained	0			BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.1063G>T	1.37:g.161140274G>T	ENSP00000356978:p.Glu355*		D3DVG0|Q5VTW8	Nonsense_Mutation	SNP	pfam_Amino_oxidase,tigrfam_Protoporphyrinogen_oxidase	p.E355*	ENST00000367999.4	37	c.1063	CCDS1221.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.660002	0.97743	.	.	ENSG00000143224	ENST00000352210;ENST00000367999;ENST00000435935;ENST00000432542	.	.	.	5.42	5.42	0.78866	.	0.169819	0.51477	D	0.000085	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-10.1371	14.5794	0.68274	0.0:0.0:1.0:0.0	.	.	.	.	X	355;355;322;100	.	ENSP00000343943:E355X	E	+	1	0	PPOX	159406898	0.995000	0.38212	1.000000	0.80357	0.997000	0.91878	1.833000	0.39161	2.820000	0.97059	0.650000	0.86243	GAG	PPOX	-	pfam_Amino_oxidase,tigrfam_Protoporphyrinogen_oxidase	ENSG00000143224		0.542	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PPOX	HGNC	protein_coding	OTTHUMT00000082993.1		0.00	32	0	G	NM_000309		161140274	+1			no_errors	ENST00000352210	ensembl	human	known	74_37	nonsense	19.23	21	5	SNP	1.000	T
PRB1	5542	genome.wustl.edu	37	12	11506274	11506274	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:11506274G>C	ENST00000500254.2	-	4	401	c.364C>G	c.(364-366)Cca>Gca	p.P122A	PRB1_ENST00000546254.1_Missense_Mutation_p.P122A|PRB1_ENST00000545626.1_Intron	NM_005039.3|NM_199353.2	NP_005030.2|NP_955385.1	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1	0	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-[PAQ]-Q-[GE]-[GD]- [NKS]-[KSQRN]-[PRQS]-[QS] [GPS]-[PQAR]- [PSR].		Missing (in allele M).|Missing (in clone CP-4).|Missing (in clone CP-5).			extracellular region (GO:0005576)				NS(1)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20			OV - Ovarian serous cystadenocarcinoma(49;0.185)			CCTGGAGGTGGGGGACCTTGA	0.612																																																	0													114.0	140.0	131.0					12																	11506274		2123	4274	6397	SO:0001583	missense	0				CCDS8642.1, CCDS55805.1	12p13.2	2012-10-02							9337	protein-coding gene	gene with protein product		180989				8317492	Standard	NM_199353		Approved	PM, PMF, PMS, PRB1M, PRB1L	uc001qzu.1	P04280		ENST00000500254.2:c.364C>G	12.37:g.11506274G>C	ENSP00000420826:p.Pro122Ala		Q08805|Q15186|Q15187|Q15214|Q15215|Q16038	Missense_Mutation	SNP	NULL	p.P122A	ENST00000500254.2	37	c.364	CCDS8642.1	12	.	.	.	.	.	.	.	.	.	.	.	0.004	-2.310138	0.00237	.	.	ENSG00000251655	ENST00000500254;ENST00000546254	T;T	0.04454	3.62;3.62	1.29	-0.935	0.10423	.	.	.	.	.	T	0.05914	0.0154	M	0.79343	2.45	0.09310	N	1	B;B	0.16603	0.018;0.018	B;B	0.11329	0.004;0.006	T	0.43261	-0.9402	8	.	.	.	.	0.5372	0.00638	0.1834:0.2427:0.3292:0.2447	.	262;122	Q86YA1;G3V1M9	.;.	A	122	ENSP00000420826:P122A;ENSP00000442127:P122A	.	P	-	1	0	PRB1	11397541	0.000000	0.05858	0.000000	0.03702	0.131000	0.20780	-0.504000	0.06375	-0.270000	0.09285	0.134000	0.15878	CCA	PRB1	-	NULL	ENSG00000251655		0.612	PRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRB1	HGNC	protein_coding	OTTHUMT00000402312.1	-	0.00	103	0	G	NM_005039		11506274	-1	tier1	-	no_errors	ENST00000500254	ensembl	human	known	74_37	missense	5.15	92	5	SNP	0.000	C
PRDM6	93166	genome.wustl.edu	37	5	122495267	122495267	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:122495267G>T	ENST00000407847.4	+	5	1502	c.1088G>T	c.(1087-1089)tGg>tTg	p.W363L	PRDM6_ENST00000464424.1_Intron	NM_001136239.1	NP_001129711.1	Q9NQX0	PRDM6_HUMAN	PR domain containing 6	363	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				negative regulation of smooth muscle cell differentiation (GO:0051151)|negative regulation of transcription, DNA-templated (GO:0045892)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	7						CTTCTGGTGTGGTACAATGAC	0.398																																																	0													181.0	149.0	159.0					5																	122495267		692	1591	2283	SO:0001583	missense	0			AF272898	CCDS47259.1	5q21-q23	2013-01-08			ENSG00000061455	ENSG00000061455		"""Zinc fingers, C2H2-type"""	9350	protein-coding gene	gene with protein product							Standard	NM_001136239		Approved		uc003kti.3	Q9NQX0	OTTHUMG00000150469	ENST00000407847.4:c.1088G>T	5.37:g.122495267G>T	ENSP00000384725:p.Trp363Leu		B5MCJ4|Q9NQW9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.W363L	ENST00000407847.4	37	c.1088	CCDS47259.1	5	.	.	.	.	.	.	.	.	.	.	G	15.05	2.718623	0.48622	.	.	ENSG00000061455	ENST00000407847	T	0.73575	-0.76	5.91	5.91	0.95273	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.88844	0.6547	M	0.88640	2.97	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.89690	0.3897	10	0.62326	D	0.03	-22.94	18.4751	0.90790	0.0:0.0:1.0:0.0	.	363	Q9NQX0	PRDM6_HUMAN	L	363	ENSP00000384725:W363L	ENSP00000384725:W363L	W	+	2	0	PRDM6	122523166	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.796000	0.99103	2.804000	0.96469	0.462000	0.41574	TGG	PRDM6	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000061455		0.398	PRDM6-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRDM6	HGNC	protein_coding	OTTHUMT00000318226.2	-	0.00	77	0	G	XM_049619		122495267	+1	tier1	-	no_errors	ENST00000407847	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
PRKCSH	5589	genome.wustl.edu	37	19	11558541	11558541	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:11558541G>T	ENST00000589838.1	+	11	1042	c.1042G>T	c.(1042-1044)Gcc>Tcc	p.A348S	PRKCSH_ENST00000591462.1_Missense_Mutation_p.A345S|PRKCSH_ENST00000412601.1_Missense_Mutation_p.A345S|PRKCSH_ENST00000587327.1_Missense_Mutation_p.A345S|PRKCSH_ENST00000592741.1_Missense_Mutation_p.A355S|PRKCSH_ENST00000252455.2_Missense_Mutation_p.A348S			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	348					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						CCCGCAGCCGGCCAGCCCTGC	0.687																																																	0													16.0	17.0	17.0					19																	11558541		2191	4283	6474	SO:0001583	missense	0				CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.1042G>T	19.37:g.11558541G>T	ENSP00000465461:p.Ala348Ser		A8K318|Q96BU9|Q96D06|Q9P0W9	Missense_Mutation	SNP	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_LDrepeatLR_classA_rpt,pfscan_EF_hand_dom	p.A348S	ENST00000589838.1	37	c.1042	CCDS32911.1	19	.	.	.	.	.	.	.	.	.	.	G	12.46	1.945025	0.34283	.	.	ENSG00000130175	ENST00000252455;ENST00000412601	T;T	0.71817	-0.59;-0.6	4.81	3.68	0.42216	.	0.627945	0.15833	N	0.242435	T	0.60287	0.2257	L	0.47716	1.5	0.30342	N	0.785597	B;B;B;B	0.15141	0.012;0.012;0.002;0.002	B;B;B;B	0.10450	0.005;0.005;0.005;0.002	T	0.51826	-0.8656	10	0.08837	T	0.75	-13.6473	12.2549	0.54619	0.0:0.2408:0.7592:0.0	.	355;355;345;348	E7EQZ9;B4DJQ5;A8K318;P14314	.;.;.;GLU2B_HUMAN	S	348;345	ENSP00000252455:A348S;ENSP00000395616:A345S	ENSP00000252455:A348S	A	+	1	0	PRKCSH	11419541	0.044000	0.20184	0.719000	0.30619	0.020000	0.10135	0.436000	0.21526	0.869000	0.35703	0.491000	0.48974	GCC	PRKCSH	-	NULL	ENSG00000130175		0.687	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKCSH	HGNC	protein_coding	OTTHUMT00000458817.1	-	0.00	41	0	G			11558541	+1	tier1	-	no_errors	ENST00000252455	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.921	T
PRMT5	10419	genome.wustl.edu	37	14	23392262	23392262	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr14:23392262C>T	ENST00000324366.8	-	13	1706	c.1483G>A	c.(1483-1485)Gag>Aag	p.E495K	PRMT5-AS1_ENST00000590290.1_RNA|PRMT5_ENST00000553897.1_Missense_Mutation_p.E451K|PRMT5_ENST00000397441.2_Missense_Mutation_p.E478K|PRMT5-AS1_ENST00000424245.2_RNA|PRMT5-AS1_ENST00000599580.2_RNA|PRMT5-AS1_ENST00000595662.1_RNA|PRMT5-AS1_ENST00000609885.1_RNA|PRMT5-AS1_ENST00000457443.2_RNA|PRMT5_ENST00000216350.8_Missense_Mutation_p.E434K|PRMT5_ENST00000397440.4_Missense_Mutation_p.E324K|PRMT5-AS1_ENST00000587245.2_RNA|PRMT5_ENST00000538452.1_Missense_Mutation_p.E389K	NM_006109.3	NP_006100.2	O14744	ANM5_HUMAN	protein arginine methyltransferase 5	495	Beta barrel. {ECO:0000269|PubMed:23071334}.|SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|endothelial cell activation (GO:0042118)|gene expression (GO:0010467)|histone H4-R3 methylation (GO:0043985)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|peptidyl-arginine N-methylation (GO:0035246)|regulation of mitosis (GO:0007088)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|methylosome (GO:0034709)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|histone-arginine N-methyltransferase activity (GO:0008469)|methyltransferase activity (GO:0008168)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|transcription corepressor activity (GO:0003714)			endometrium(4)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	25	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)		TTCTTTACCTCAGGGTCACGG	0.493																																																	0													57.0	48.0	51.0					14																	23392262		2203	4300	6503	SO:0001583	missense	0			AF015913	CCDS9579.1, CCDS41922.1, CCDS61394.1, CCDS61395.1, CCDS61396.1	14q11.2	2014-06-12	2006-02-16	2006-02-16	ENSG00000100462	ENSG00000100462	2.1.1.125	"""Protein arginine methyltransferases"""	10894	protein-coding gene	gene with protein product		604045	"""skb1 (S. pombe) homolog"", ""SKB1 homolog (S. pombe)"""	HRMT1L5, SKB1		9843966	Standard	NM_001282955		Approved	SKB1Hs	uc001whm.1	O14744	OTTHUMG00000028709	ENST00000324366.8:c.1483G>A	14.37:g.23392262C>T	ENSP00000319169:p.Glu495Lys		A8MTP3|A8MZ91|B4DX49|B4DY30|B5BU10|D3DS33|E2QRE7|Q6IBR1|Q9UKH1	Missense_Mutation	SNP	pfam_Arg_MeTrfase,pirsf_Arg_MeTrfase_PRMT5	p.E495K	ENST00000324366.8	37	c.1483	CCDS9579.1	14	.	.	.	.	.	.	.	.	.	.	C	7.400	0.632484	0.14322	.	.	ENSG00000100462	ENST00000324366;ENST00000397441;ENST00000397440;ENST00000216350;ENST00000555454;ENST00000538452;ENST00000553897	T;T;T;T;T;T;T	0.20332	2.08;2.08;2.08;2.08;2.08;2.08;2.08	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.29524	0.0736	M	0.74258	2.255	0.80722	D	1	P;P;P;P;P	0.42357	0.616;0.517;0.667;0.777;0.483	B;P;P;B;P	0.45232	0.343;0.474;0.474;0.406;0.474	T	0.10337	-1.0634	10	0.07990	T	0.79	-19.3234	16.1347	0.81475	0.0:1.0:0.0:0.0	.	451;434;324;495;478	G3V5W5;B4DX49;A8MTP3;O14744;A8MZ91	.;.;.;ANM5_HUMAN;.	K	495;478;324;434;94;389;451	ENSP00000319169:E495K;ENSP00000380583:E478K;ENSP00000380582:E324K;ENSP00000216350:E434K;ENSP00000451245:E94K;ENSP00000444915:E389K;ENSP00000452555:E451K	ENSP00000216350:E434K	E	-	1	0	PRMT5	22462102	1.000000	0.71417	1.000000	0.80357	0.134000	0.20937	6.999000	0.76283	2.465000	0.83290	0.561000	0.74099	GAG	PRMT5	-	pfam_Arg_MeTrfase,pirsf_Arg_MeTrfase_PRMT5	ENSG00000100462		0.493	PRMT5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT5	HGNC	protein_coding	OTTHUMT00000071674.3	-	0.00	37	0	C			23392262	-1	tier1	-	no_errors	ENST00000324366	ensembl	human	known	74_37	missense	41.18	20	14	SNP	1.000	T
PRR4	11272	genome.wustl.edu	37	12	11002053	11002053	+	5'UTR	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:11002053G>T	ENST00000228811.4	-	0	21				PRR4_ENST00000540107.1_5'UTR|PRR4_ENST00000536668.1_Intron|PRR4_ENST00000544994.1_5'UTR	NM_007244.2	NP_009175.2	Q16378	PROL4_HUMAN	proline rich 4 (lacrimal)						retina homeostasis (GO:0001895)|visual perception (GO:0007601)	extracellular space (GO:0005615)				endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	9						GGAGGCTCTGGAGTTGCTCCC	0.478																																																	0													32.0	34.0	34.0					12																	11002053		2044	4245	6289	SO:0001623	5_prime_UTR_variant	0				CCDS41756.1, CCDS55804.1	12p13	2008-02-05		2004-05-28		ENSG00000111215			18020	protein-coding gene	gene with protein product		605359		PROL4		7544782	Standard	NM_007244		Approved	LPRP	uc001qyz.4	Q16378		ENST00000228811.4:c.-17C>A	12.37:g.11002053G>T			A8KA69|F5H0D7|Q8NFB3	RNA	SNP	-	NULL	ENST00000228811.4	37	NULL	CCDS41756.1	12																																																																																			PRR4	-	-	ENSG00000111215		0.478	PRR4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRR4	HGNC	protein_coding	OTTHUMT00000400049.1	-	0.00	66	0	G	NM_007244		11002053	-1	tier1	-	no_errors	ENST00000542658	ensembl	human	known	74_37	rna	6.15	61	4	SNP	0.002	T
PRSS38	339501	genome.wustl.edu	37	1	228033281	228033281	+	Frame_Shift_Del	DEL	G	G	-			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:228033281delG	ENST00000366757.3	+	4	718	c.694delG	c.(694-696)gggfs	p.G232fs		NM_183062.2	NP_898885.1	A1L453	PRS38_HUMAN	protease, serine, 38	232	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						GCTGTGTGCTGGGGACATCCT	0.612																																																	0													234.0	159.0	184.0					1																	228033281		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS1563.1	1q42.13	2010-05-07			ENSG00000185888	ENSG00000185888		"""Serine peptidases / Serine peptidases"""	29625	protein-coding gene	gene with protein product	"""marapsin 2"""					12838346	Standard	NM_183062		Approved	MPN2	uc001hrh.3	A1L453	OTTHUMG00000037701	ENST00000366757.3:c.694delG	1.37:g.228033281delG	ENSP00000355719:p.Gly232fs		Q7RTY6	Frame_Shift_Del	DEL	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.D233fs	ENST00000366757.3	37	c.694	CCDS1563.1	1																																																																																			PRSS38	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000185888		0.612	PRSS38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS38	HGNC	protein_coding	OTTHUMT00000091981.1		0.00	48	0	G	NM_183062		228033281	+1	tier1		no_errors	ENST00000366757	ensembl	human	known	74_37	frame_shift_del	6.67	28	2	DEL	0.942	-
PTPRS	5802	genome.wustl.edu	37	19	5244258	5244258	+	Silent	SNP	G	G	A	rs2230609		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:5244258G>A	ENST00000587303.1	-	10	1323	c.1224C>T	c.(1222-1224)atC>atT	p.I408I	PTPRS_ENST00000357368.4_Silent_p.I408I|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000353284.2_Silent_p.I395I|PTPRS_ENST00000592099.1_Silent_p.I395I|PTPRS_ENST00000588012.1_Silent_p.I395I|PTPRS_ENST00000348075.2_Silent_p.I395I|PTPRS_ENST00000372412.4_Silent_p.I409I|PTPRS_ENST00000262963.6_Silent_p.I404I			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	408	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	GCCCCTGGCCGATGGAGTTGA	0.667																																																	0													45.0	42.0	43.0					19																	5244258		2203	4300	6503	SO:0001819	synonymous_variant	0			U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.1224C>T	19.37:g.5244258G>A			O75255|O75870|Q15718|Q16341|Q2M3R7	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom	p.I409	ENST00000587303.1	37	c.1227	CCDS45930.1	19																																																																																			PTPRS	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000105426		0.667	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRS	HGNC	protein_coding	OTTHUMT00000450762.2	-	0.00	89	0	G			5244258	-1	tier1	rs2230609	no_errors	ENST00000372412	ensembl	human	known	74_37	silent	21.82	43	12	SNP	0.925	A
PVRL1	5818	genome.wustl.edu	37	11	119545303	119545303	+	Intron	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:119545303C>T	ENST00000264025.3	-	5	1534				PVRL1_ENST00000341398.2_Intron|PVRL1_ENST00000340882.2_Silent_p.*353*|PVRL1_ENST00000524510.1_5'Flank	NM_002855.4	NP_002846.3	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 (herpesvirus entry mediator C)						adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|desmosome organization (GO:0002934)|enamel mineralization (GO:0070166)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|immune response (GO:0006955)|iron ion transport (GO:0006826)|lens morphogenesis in camera-type eye (GO:0002089)|regulation of synapse assembly (GO:0051963)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|viral entry into host cell (GO:0046718)	adherens junction (GO:0005912)|axon (GO:0030424)|cell-cell adherens junction (GO:0005913)|extracellular region (GO:0005576)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|protein homodimerization activity (GO:0042803)|virion binding (GO:0046790)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		AGTCTCTCCTCAGAACATCCT	0.542																																																	0													334.0	305.0	315.0					11																	119545303		2199	4295	6494	SO:0001627	intron_variant	0			X76400	CCDS8425.1, CCDS8426.1, CCDS8427.1	11q23-q24	2013-01-29	2007-06-07		ENSG00000110400	ENSG00000110400		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9706	protein-coding gene	gene with protein product	"""nectin"""	600644		HVEC, ED4		7721102, 9616127	Standard	NM_203285		Approved	PRR, PRR1, PVRR1, SK-12, HIgR, CLPED1, CD111, OFC7	uc001pwv.3	Q15223	OTTHUMG00000166177	ENST00000264025.3:c.1003+565G>A	11.37:g.119545303C>T			O75465|Q2M3D3|Q9HBE6|Q9HBW2	Silent	SNP	pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.*353	ENST00000264025.3	37	c.1058	CCDS8426.1	11																																																																																			PVRL1	-	NULL	ENSG00000110400		0.542	PVRL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRL1	HGNC	protein_coding	OTTHUMT00000388231.1	-	0.00	68	0	C			119545303	-1	tier1	-	no_errors	ENST00000340882	ensembl	human	known	74_37	silent	22.86	54	16	SNP	0.000	T
PVRL1	5818	genome.wustl.edu	37	11	119545984	119545984	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:119545984C>G	ENST00000264025.3	-	5	1418	c.888G>C	c.(886-888)caG>caC	p.Q296H	PVRL1_ENST00000341398.2_Missense_Mutation_p.Q296H|PVRL1_ENST00000340882.2_Missense_Mutation_p.Q296H|PVRL1_ENST00000524510.1_5'Flank	NM_002855.4	NP_002846.3	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 (herpesvirus entry mediator C)	296	Ig-like C2-type 2.|Interaction with FGFR. {ECO:0000250}.				adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|desmosome organization (GO:0002934)|enamel mineralization (GO:0070166)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|immune response (GO:0006955)|iron ion transport (GO:0006826)|lens morphogenesis in camera-type eye (GO:0002089)|regulation of synapse assembly (GO:0051963)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|viral entry into host cell (GO:0046718)	adherens junction (GO:0005912)|axon (GO:0030424)|cell-cell adherens junction (GO:0005913)|extracellular region (GO:0005576)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|protein homodimerization activity (GO:0042803)|virion binding (GO:0046790)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		GGGTTCTGTTCTGGGCCTCCA	0.582																																																	0													135.0	118.0	123.0					11																	119545984		2199	4295	6494	SO:0001583	missense	0			X76400	CCDS8425.1, CCDS8426.1, CCDS8427.1	11q23-q24	2013-01-29	2007-06-07		ENSG00000110400	ENSG00000110400		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9706	protein-coding gene	gene with protein product	"""nectin"""	600644		HVEC, ED4		7721102, 9616127	Standard	NM_203285		Approved	PRR, PRR1, PVRR1, SK-12, HIgR, CLPED1, CD111, OFC7	uc001pwv.3	Q15223	OTTHUMG00000166177	ENST00000264025.3:c.888G>C	11.37:g.119545984C>G	ENSP00000264025:p.Gln296His		O75465|Q2M3D3|Q9HBE6|Q9HBW2	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.Q296H	ENST00000264025.3	37	c.888	CCDS8426.1	11	.	.	.	.	.	.	.	.	.	.	C	11.58	1.680450	0.29872	.	.	ENSG00000110400	ENST00000341398;ENST00000264025;ENST00000340882	T;T;T	0.14893	2.47;2.47;2.47	5.46	3.23	0.37069	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.155438	0.56097	N	0.000024	T	0.11367	0.0277	L	0.41079	1.255	0.32301	N	0.565028	P;P;B	0.46578	0.855;0.88;0.001	B;B;B	0.37239	0.244;0.186;0.001	T	0.15752	-1.0426	10	0.56958	D	0.05	.	6.2147	0.20648	0.1374:0.6469:0.1339:0.0818	.	296;296;296	Q15223-3;Q15223;Q15223-2	.;PVRL1_HUMAN;.	H	296	ENSP00000344974:Q296H;ENSP00000264025:Q296H;ENSP00000345289:Q296H	ENSP00000264025:Q296H	Q	-	3	2	PVRL1	119051194	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	0.589000	0.23939	1.291000	0.44653	0.655000	0.94253	CAG	PVRL1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000110400		0.582	PVRL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRL1	HGNC	protein_coding	OTTHUMT00000388231.1	-	0.00	79	0	C			119545984	-1	tier1	-	no_errors	ENST00000264025	ensembl	human	known	74_37	missense	30.49	57	25	SNP	0.998	G
RB1	5925	genome.wustl.edu	37	13	49030486	49030486	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr13:49030486G>T	ENST00000267163.4	+	19	2098		c.e19+1			NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(11)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TATAAAAAAGGTTAGTAGATG	0.398		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	26	Whole gene deletion(15)|Unknown(11)	bone(10)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|eye(2)|adrenal_gland(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|liver(1)	GRCh37	CD941779|CI984663|CS071258	RB1	D|I|S							53.0	51.0	52.0					13																	49030486		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1960+1G>T	13.37:g.49030486G>T			A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	SNP	-	e19+1	ENST00000267163.4	37	c.1960+1	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	G	24.7	4.560824	0.86335	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4214	0.99039	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RB1	47928487	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.835000	0.86780	2.820000	0.97059	0.655000	0.94253	.	RB1	-	-	ENSG00000139687		0.398	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1		0.00	30	0	G		Intron	49030486	+1			no_errors	ENST00000267163	ensembl	human	known	74_37	splice_site	6.90	27	2	SNP	1.000	T
RBM10	8241	genome.wustl.edu	37	X	47030561	47030563	+	In_Frame_Del	DEL	GGA	GGA	-			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	GGA	GGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:47030561_47030563delGGA	ENST00000377604.3	+	4	1078_1080	c.336_338delGGA	c.(334-339)ggggag>ggg	p.E119del	RBM10_ENST00000329236.7_Intron|RBM10_ENST00000345781.6_Intron	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	119	Poly-Glu.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						CCGAGCAAGGggaggaggaggag	0.66																																					Melanoma(171;120 2705 19495 39241)												0									,,,,	630,3068		53,380,144,1150,388					,,,,	4.2	1.0			18	1271,5155		67,669,468,1609,1268	no	intron,coding,coding,coding,intron	RBM10	NM_152856.2,NM_005676.4,NM_001204468.1,NM_001204467.1,NM_001204466.1	,,,,	120,1049,612,2759,1656	A1A1,A1R,A1,RR,R		19.779,17.0362,18.7772	,,,,	,,,,		1901,8223				SO:0001651	inframe_deletion	0			U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.336_338delGGA	X.37:g.47030570_47030572delGGA	ENSP00000366829:p.Glu119del		C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	In_Frame_Del	DEL	pfam_G_patch_dom,pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,smart_G_patch_dom,pfscan_Znf_RanBP2,pfscan_Znf_C2H2,pfscan_G_patch_dom,pfscan_RRM_dom	p.E116in_frame_del	ENST00000377604.3	37	c.336_338	CCDS14274.1	X																																																																																			RBM10	-	NULL	ENSG00000182872		0.660	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM10	HGNC	protein_coding	OTTHUMT00000056381.1		0.00	49	0	GGA	NM_005676		47030563	+1	tier1		no_errors	ENST00000377604	ensembl	human	known	74_37	in_frame_del	11.54	23	3	DEL	1.000:1.000:1.000	-
REG3G	130120	genome.wustl.edu	37	2	79254209	79254209	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:79254209G>T	ENST00000272324.5	+	4	429	c.245G>T	c.(244-246)gGg>gTg	p.G82V	REG3G_ENST00000409471.1_Intron|REG3G_ENST00000393897.2_Missense_Mutation_p.G82V	NM_001008387.2	NP_001008388.1	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma	82	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|defense response to Gram-positive bacterium (GO:0050830)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(27)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GTGCTCAGTGGGGCTGAGGGA	0.547																																																	0													161.0	150.0	154.0					2																	79254209		2203	4300	6503	SO:0001583	missense	0			AY359047	CCDS1962.1, CCDS58714.1	2p12	2005-02-11			ENSG00000143954	ENSG00000143954			29595	protein-coding gene	gene with protein product		609933				12975309	Standard	NM_001008387		Approved	UNQ429, LPPM429, PAP1B	uc002snx.4	Q6UW15	OTTHUMG00000130018	ENST00000272324.5:c.245G>T	2.37:g.79254209G>T	ENSP00000272324:p.Gly82Val		A8K980|D6W5J6|Q3SYE4|Q3SYE6|Q6FH18	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.G82V	ENST00000272324.5	37	c.245	CCDS1962.1	2	.	.	.	.	.	.	.	.	.	.	G	5.204	0.223189	0.09863	.	.	ENSG00000143954	ENST00000393897;ENST00000272324	T;T	0.18810	2.19;2.19	4.83	-1.81	0.07882	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	1.071090	0.07250	N	0.865798	T	0.16599	0.0399	L	0.39397	1.21	0.09310	N	0.999997	B	0.23591	0.088	B	0.35859	0.212	T	0.45323	-0.9269	10	0.13853	T	0.58	.	3.4509	0.07498	0.1652:0.4587:0.2472:0.1289	.	82	Q6UW15	REG3G_HUMAN	V	82	ENSP00000377475:G82V;ENSP00000272324:G82V	ENSP00000272324:G82V	G	+	2	0	REG3G	79107717	0.000000	0.05858	0.001000	0.08648	0.538000	0.34931	-1.271000	0.02828	-0.491000	0.06697	-0.176000	0.13171	GGG	REG3G	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000143954		0.547	REG3G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	REG3G	HGNC	protein_coding	OTTHUMT00000328247.1	-	0.00	72	0	G	NM_198448		79254209	+1	tier1	-	no_errors	ENST00000272324	ensembl	human	known	74_37	missense	25.00	33	11	SNP	0.002	T
RELT	84957	genome.wustl.edu	37	11	73104900	73104900	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:73104900G>A	ENST00000064780.2	+	7	905	c.644G>A	c.(643-645)cGg>cAg	p.R215Q	RELT_ENST00000393580.2_Missense_Mutation_p.R215Q|RP11-809N8.2_ENST00000544674.1_RNA	NM_152222.1	NP_689408.1	Q969Z4	TR19L_HUMAN	RELT tumor necrosis factor receptor	215						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	12						CCTGCCTACCGGACTGAGGAT	0.592											OREG0021216	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													135.0	139.0	138.0					11																	73104900		2200	4293	6493	SO:0001583	missense	0			AF319553	CCDS8222.1	11q13.2	2013-05-22	2007-06-14	2007-06-14		ENSG00000054967		"""Tumor necrosis factor receptor superfamily"""	13764	protein-coding gene	gene with protein product		611211	"""tumor necrosis factor receptor superfamily, member 19-like"""	TNFRSF19L		11313261, 16547002, 16950202, 16389068	Standard	NM_032871		Approved	FLJ14993	uc001otv.3	Q969Z4		ENST00000064780.2:c.644G>A	11.37:g.73104900G>A	ENSP00000064780:p.Arg215Gln	1142	Q86V34|Q96JU1|Q9BUX7	Missense_Mutation	SNP	pfam_TNF_rcpt_RELT,prints_TNFR_19-like	p.R215Q	ENST00000064780.2	37	c.644	CCDS8222.1	11	.	.	.	.	.	.	.	.	.	.	G	10.79	1.448923	0.26074	.	.	ENSG00000054967	ENST00000064780;ENST00000393580;ENST00000438119	T;T	0.74842	-0.88;-0.88	5.2	0.838	0.18902	.	0.442672	0.22313	N	0.061715	T	0.61098	0.2320	L	0.60455	1.87	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.40961	-0.9535	10	0.15499	T	0.54	-4.0267	3.9923	0.09543	0.3361:0.0:0.4794:0.1845	.	215	Q969Z4	TR19L_HUMAN	Q	215;215;83	ENSP00000064780:R215Q;ENSP00000377207:R215Q	ENSP00000064780:R215Q	R	+	2	0	RELT	72782548	0.205000	0.23458	0.026000	0.17262	0.976000	0.68499	2.146000	0.42216	-0.053000	0.13289	0.561000	0.74099	CGG	RELT	-	NULL	ENSG00000054967		0.592	RELT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RELT	HGNC	protein_coding	OTTHUMT00000397380.2	-	0.00	52	0	G	NM_032871		73104900	+1	tier1	-	no_errors	ENST00000064780	ensembl	human	known	74_37	missense	14.58	41	7	SNP	0.008	A
REN	5972	genome.wustl.edu	37	1	204131165	204131165	+	Silent	SNP	G	G	A	rs374481579		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:204131165G>A	ENST00000272190.8	-	2	253	c.225C>T	c.(223-225)tcC>tcT	p.S75S	REN_ENST00000367195.2_Silent_p.S75S	NM_000537.3	NP_000528.1	P00797	RENI_HUMAN	renin	75					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cell maturation (GO:0048469)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|drinking behavior (GO:0042756)|hormone-mediated signaling pathway (GO:0009755)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mesonephros development (GO:0001823)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of MAPK cascade (GO:0043408)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cAMP (GO:0051591)|response to cGMP (GO:0070305)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|peptidase activity (GO:0008233)|receptor binding (GO:0005102)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|skin(4)|urinary_tract(1)	19	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	TGAGGATCACGGAGGAGGTGG	0.582																																																	0								G		0,4406		0,0,2203	212.0	164.0	180.0		225	-6.7	0.1	1		180	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	REN	NM_000537.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		75/407	204131165	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			BC047752	CCDS30981.1	1q32	2008-02-05			ENSG00000143839	ENSG00000143839	3.4.23.15		9958	protein-coding gene	gene with protein product		179820					Standard	NM_000537		Approved		uc001haq.2	P00797	OTTHUMG00000036059	ENST00000272190.8:c.225C>T	1.37:g.204131165G>A			Q6FI38|Q6T5C2	Silent	SNP	pfam_Aspartic_peptidase,pfam_Aspartic_peptidase_N,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase	p.S75	ENST00000272190.8	37	c.225	CCDS30981.1	1																																																																																			REN	-	superfamily_Peptidase_aspartic_dom	ENSG00000143839		0.582	REN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REN	HGNC	protein_coding	OTTHUMT00000087891.1	-	0.00	69	0	G	NM_000537		204131165	-1	tier1	-	no_errors	ENST00000272190	ensembl	human	known	74_37	silent	25.93	40	14	SNP	0.344	A
RGMA	56963	genome.wustl.edu	37	15	93595305	93595305	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr15:93595305G>A	ENST00000329082.7	-	3	834	c.563C>T	c.(562-564)cCg>cTg	p.P188L	RGMA_ENST00000555584.1_5'Flank|RGMA_ENST00000425933.2_Missense_Mutation_p.P172L|RGMA_ENST00000556658.1_Missense_Mutation_p.P79L|RGMA_ENST00000556087.1_Missense_Mutation_p.P172L|RGMA_ENST00000557301.1_Missense_Mutation_p.P196L|RGMA_ENST00000557420.1_Intron|RGMA_ENST00000543599.1_Missense_Mutation_p.P172L|RGMA_ENST00000538818.1_Missense_Mutation_p.P79L|RGMA_ENST00000542321.2_Missense_Mutation_p.P172L	NM_020211.2	NP_064596	Q96B86	RGMA_HUMAN	repulsive guidance molecule family member a	188					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|neural tube closure (GO:0001843)|regulation of BMP signaling pathway (GO:0030510)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	9	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			GTCGATGAGCGGCCAGGCGCC	0.647																																																	0													46.0	54.0	51.0					15																	93595305		2065	4187	6252	SO:0001583	missense	0			AL390083	CCDS45357.1, CCDS53973.1, CCDS53974.1	15q26.1	2013-11-06	2013-11-06			ENSG00000182175			30308	protein-coding gene	gene with protein product		607362	"""RGM domain family, member A"""			15975920	Standard	NM_020211		Approved	RGM, RGMa	uc010urc.2	Q96B86		ENST00000329082.7:c.563C>T	15.37:g.93595305G>A	ENSP00000330005:p.Pro188Leu		B2RTW1|B7Z5S8|F5GXQ7|F5GZU6|G3V518|Q0JV97|Q8NC80|Q9H0E6|Q9NPM3	Missense_Mutation	SNP	pfam_RGM_N,pfam_RGM_C	p.P188L	ENST00000329082.7	37	c.563	CCDS45357.1	15	.	.	.	.	.	.	.	.	.	.	G	31	5.094097	0.94149	.	.	ENSG00000182175	ENST00000543599;ENST00000425933;ENST00000329082;ENST00000542321;ENST00000538818;ENST00000557301	D;D;D;D;D;D	0.99405	-5.84;-5.84;-5.84;-5.84;-5.84;-5.84	5.28	5.28	0.74379	Repulsive guidance molecule, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99536	0.9834	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98457	1.0594	10	0.87932	D	0	-6.3682	18.491	0.90848	0.0:0.0:1.0:0.0	.	196;188	G3V518;Q96B86	.;RGMA_HUMAN	L	172;172;188;172;79;196	ENSP00000442498:P172L;ENSP00000404442:P172L;ENSP00000330005:P188L;ENSP00000440025:P172L;ENSP00000442546:P79L;ENSP00000452126:P196L	ENSP00000330005:P188L	P	-	2	0	RGMA	91396309	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.815000	0.99349	2.479000	0.83701	0.561000	0.74099	CCG	RGMA	-	pfam_RGM_N	ENSG00000182175		0.647	RGMA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RGMA	HGNC	protein_coding	OTTHUMT00000415091.1	-	0.00	52	0	G	NM_020211		93595305	-1	tier1	-	no_errors	ENST00000329082	ensembl	human	known	74_37	missense	28.57	25	10	SNP	1.000	A
RIN2	54453	genome.wustl.edu	37	20	19982600	19982600	+	3'UTR	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr20:19982600G>T	ENST00000255006.6	+	0	4004				RIN2_ENST00000484638.1_3'UTR	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2						endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						AAACAATTTTGAAAGCCCCTT	0.333																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.*1020G>T	20.37:g.19982600G>T			Q00425|Q5TFT8|Q9BQL3|Q9H071	RNA	SNP	-	NULL	ENST00000255006.6	37	NULL	CCDS56182.1	20																																																																																			RIN2	-	-	ENSG00000132669		0.333	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	HGNC	protein_coding	OTTHUMT00000078212.1	-	0.00	53	0	G			19982600	+1	tier1	-	no_errors	ENST00000484638	ensembl	human	known	74_37	rna	12.50	21	3	SNP	0.043	T
RLTPR	146206	genome.wustl.edu	37	16	67682606	67682606	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr16:67682606C>T	ENST00000334583.6	+	16	1786	c.1458C>T	c.(1456-1458)ctC>ctT	p.L486L	RLTPR_ENST00000545661.1_Silent_p.L450L	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	486					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		TGGATGGCCTCGCGCTCAACA	0.672																																																	0													20.0	22.0	22.0					16																	67682606		2055	4229	6284	SO:0001819	synonymous_variant	0			AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.1458C>T	16.37:g.67682606C>T			B8X2Z3	Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.L486	ENST00000334583.6	37	c.1458	CCDS45513.1	16																																																																																			RLTPR	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000159753		0.672	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RLTPR	HGNC	protein_coding	OTTHUMT00000467858.1	-	0.00	32	0	C	NM_001013838		67682606	+1	tier1	-	no_errors	ENST00000334583	ensembl	human	known	74_37	silent	20.00	16	4	SNP	0.653	T
RNASE2	6036	genome.wustl.edu	37	14	21424157	21424157	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr14:21424157C>A	ENST00000304625.2	+	2	317	c.227C>A	c.(226-228)gCt>gAt	p.A76D		NM_002934.2	NP_002925.1	P10153	RNAS2_HUMAN	ribonuclease, RNase A family, 2 (liver, eosinophil-derived neurotoxin)	76					chemotaxis (GO:0006935)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)|ribonuclease activity (GO:0004540)			breast(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	17	all_cancers(95;0.00381)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)		ACAACTTTTGCTAACGTAGTT	0.398																																																	0													90.0	82.0	85.0					14																	21424157		2203	4300	6503	SO:0001583	missense	0			X55988	CCDS9561.1	14q11.2	2014-03-13			ENSG00000169385	ENSG00000169385		"""Ribonucleases, RNase A"""	10045	protein-coding gene	gene with protein product		131410		RNS2		1577491, 2734298	Standard	NM_002934		Approved	EDN	uc001vyl.1	P10153	OTTHUMG00000029607	ENST00000304625.2:c.227C>A	14.37:g.21424157C>A	ENSP00000303276:p.Ala76Asp		Q52M39|Q9H2B7|Q9UCG7	Missense_Mutation	SNP	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	p.A76D	ENST00000304625.2	37	c.227	CCDS9561.1	14	.	.	.	.	.	.	.	.	.	.	c	12.56	1.976148	0.34848	.	.	ENSG00000169385	ENST00000304625	T	0.73152	-0.72	2.78	-1.91	0.07641	Ribonuclease A, domain (4);	0.340197	0.20800	U	0.085444	T	0.75547	0.3864	M	0.82716	2.605	0.09310	N	1	D	0.71674	0.998	D	0.63033	0.91	T	0.64820	-0.6317	10	0.52906	T	0.07	.	0.6166	0.00771	0.192:0.372:0.1888:0.2472	.	76	P10153	RNAS2_HUMAN	D	76	ENSP00000303276:A76D	ENSP00000303276:A76D	A	+	2	0	RNASE2	20493997	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.498000	0.06420	-0.432000	0.07297	0.455000	0.32223	GCT	RNASE2	-	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	ENSG00000169385		0.398	RNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASE2	HGNC	protein_coding	OTTHUMT00000073799.2	-	0.00	75	0	C			21424157	+1	tier1	-	no_errors	ENST00000304625	ensembl	human	known	74_37	missense	42.11	22	16	SNP	0.000	A
RNF208	727800	genome.wustl.edu	37	9	140115495	140115495	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr9:140115495G>T	ENST00000392827.1	-	2	338	c.170C>A	c.(169-171)aCc>aAc	p.T57N	RNF208_ENST00000391553.1_Missense_Mutation_p.T57N			Q9H0X6	RN208_HUMAN	ring finger protein 208	57					protein autoubiquitination (GO:0051865)		ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			lung(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		CAGAGTTGGGGTGGGCCGGGG	0.627																																																	0													11.0	14.0	13.0					9																	140115495		1900	4112	6012	SO:0001583	missense	0			AF416715	CCDS7037.2	9q34.3	2007-01-19				ENSG00000212864		"""RING-type (C3HC4) zinc fingers"""	25420	protein-coding gene	gene with protein product						11230166	Standard	NM_031297		Approved	DKFZP761H1710	uc004clz.2	Q9H0X6		ENST00000392827.1:c.170C>A	9.37:g.140115495G>T	ENSP00000376572:p.Thr57Asn		A2BFA0	Missense_Mutation	SNP	pfscan_Znf_RING	p.T57N	ENST00000392827.1	37	c.170	CCDS7037.2	9	.	.	.	.	.	.	.	.	.	.	G	9.455	1.091523	0.20471	.	.	ENSG00000212864	ENST00000392827;ENST00000391553	T;T	0.31769	1.48;1.48	4.26	3.29	0.37713	.	0.595434	0.13584	U	0.377134	T	0.21186	0.0510	N	0.08118	0	0.27240	N	0.959172	P	0.45176	0.852	P	0.46253	0.509	T	0.06338	-1.0832	10	0.66056	D	0.02	-30.6633	10.4714	0.44640	0.0:0.0:0.8049:0.1951	.	57	Q9H0X6	RN208_HUMAN	N	57	ENSP00000376572:T57N;ENSP00000375397:T57N	ENSP00000375397:T57N	T	-	2	0	RNF208	139235316	0.975000	0.34042	1.000000	0.80357	0.519000	0.34347	1.297000	0.33400	1.919000	0.55581	0.561000	0.74099	ACC	RNF208	-	NULL	ENSG00000212864		0.627	RNF208-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RNF208	HGNC	protein_coding	OTTHUMT00000254714.1		0.00	53	0	G	NM_031297		140115495	-1			no_errors	ENST00000391553	ensembl	human	known	74_37	missense	6.98	40	3	SNP	1.000	T
RPL32	6161	genome.wustl.edu	37	3	12877607	12877607	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:12877607C>T	ENST00000429711.2	-	4	493	c.394G>A	c.(394-396)Gaa>Aaa	p.E132K	RPL32_ENST00000396957.1_Missense_Mutation_p.E132K|RPL32_ENST00000273223.6_Missense_Mutation_p.E150K|RPL32_ENST00000396953.2_Missense_Mutation_p.E132K|RPL32_ENST00000435983.1_Missense_Mutation_p.E132K	NM_000994.3	NP_000985.1	P62910	RL32_HUMAN	ribosomal protein L32	132					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)	6						TCATTTTCTTCACTGCGCAGC	0.468																																																	0													72.0	72.0	72.0					3																	12877607		2203	4300	6503	SO:0001583	missense	0			CA436299, CF124158, CR608027	CCDS2614.1	3q13.3-q21	2011-04-06			ENSG00000144713	ENSG00000144713		"""L ribosomal proteins"""	10336	protein-coding gene	gene with protein product						9284913	Standard	NM_001007073		Approved	L32	uc003bxl.3	P62910	OTTHUMG00000129804	ENST00000429711.2:c.394G>A	3.37:g.12877607C>T	ENSP00000416429:p.Glu132Lys		B2R4Q3|P02433	Missense_Mutation	SNP	pfam_Ribosomal_L32e,superfamily_Ribosomal_L32e	p.E132K	ENST00000429711.2	37	c.394	CCDS2614.1	3	.	.	.	.	.	.	.	.	.	.	C	21.1	4.097855	0.76870	.	.	ENSG00000144713	ENST00000429711;ENST00000396957;ENST00000273223;ENST00000435983;ENST00000396953;ENST00000457131	.	.	.	5.41	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.73040	0.3536	M	0.93062	3.375	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.73319	-0.4020	9	0.51188	T	0.08	0.3669	12.1672	0.54138	0.0:0.916:0.0:0.084	.	132	P62910	RL32_HUMAN	K	132;132;150;132;132;132	.	ENSP00000339064:E150K	E	-	1	0	RPL32	12852607	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.844000	0.69430	1.400000	0.46741	0.655000	0.94253	GAA	RPL32	-	superfamily_Ribosomal_L32e	ENSG00000144713		0.468	RPL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL32	HGNC	protein_coding	OTTHUMT00000252032.2	-	0.00	74	0	C	NM_000994		12877607	-1	tier1	-	no_errors	ENST00000396953	ensembl	human	known	74_37	missense	30.88	47	21	SNP	1.000	T
RPUSD2	27079	genome.wustl.edu	37	15	40861732	40861732	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr15:40861732G>C	ENST00000315616.7	+	1	234	c.196G>C	c.(196-198)Gag>Cag	p.E66Q	RPUSD2_ENST00000559271.1_Missense_Mutation_p.E66Q	NM_152260.1	NP_689473.1	Q8IZ73	RUSD2_HUMAN	RNA pseudouridylate synthase domain containing 2	66					pseudouridine synthesis (GO:0001522)		poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			kidney(4)|lung(4)|skin(3)	11		all_cancers(109;2.74e-14)|all_epithelial(112;1.64e-11)|Lung NSC(122;6.69e-09)|all_lung(180;1.22e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;3.1e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0786)		CGCGAAGGTTGAGCTGTCCCC	0.697																																																	0													20.0	20.0	20.0					15																	40861732		2203	4299	6502	SO:0001583	missense	0			AK055971	CCDS10061.1, CCDS66737.1	15q13.3	2013-02-11	2005-01-31	2005-02-07	ENSG00000166133	ENSG00000166133		"""RNA pseudouridylate synthase domain containing"""	24180	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 19"""	C15orf19		12477932	Standard	NM_001286407		Approved	C18B11, FLJ31409	uc001zmd.1	Q8IZ73	OTTHUMG00000130031	ENST00000315616.7:c.196G>C	15.37:g.40861732G>C	ENSP00000323288:p.Glu66Gln		B4DDD1|Q7L989|Q92939|Q96IA7|Q96N50	Missense_Mutation	SNP	pfam_PsdUridine_synth_RsuA/RluD,superfamily_PsdUridine_synth_cat_dom,tigrfam_PsdUridine_synth_RluC/D	p.E66Q	ENST00000315616.7	37	c.196	CCDS10061.1	15	.	.	.	.	.	.	.	.	.	.	G	13.52	2.261309	0.39995	.	.	ENSG00000166133	ENST00000315616;ENST00000417769	T	0.35236	1.32	3.77	1.9	0.25705	.	0.263222	0.29853	N	0.011036	T	0.25606	0.0623	L	0.38531	1.155	0.09310	N	1	B	0.29085	0.232	B	0.27715	0.082	T	0.17077	-1.0381	10	0.51188	T	0.08	-7.1773	8.5647	0.33531	0.1854:0.0:0.8146:0.0	.	66	Q8IZ73	RUSD2_HUMAN	Q	66	ENSP00000323288:E66Q	ENSP00000323288:E66Q	E	+	1	0	RPUSD2	38649024	0.546000	0.26457	0.004000	0.12327	0.002000	0.02628	1.965000	0.40471	0.599000	0.29845	0.650000	0.86243	GAG	RPUSD2	-	NULL	ENSG00000166133		0.697	RPUSD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPUSD2	HGNC	protein_coding	OTTHUMT00000252308.2	-	0.00	61	0	G	NM_152260		40861732	+1	tier1	-	no_errors	ENST00000315616	ensembl	human	known	74_37	missense	19.44	29	7	SNP	0.015	C
RPP25	54913	genome.wustl.edu	37	15	75248376	75248376	+	Silent	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr15:75248376C>G	ENST00000322177.5	-	1	1429	c.549G>C	c.(547-549)gcG>gcC	p.A183A	RPP25_ENST00000499788.2_Silent_p.A183A	NM_017793.2	NP_060263.2	Q9BUL9	RPP25_HUMAN	ribonuclease P/MRP 25kDa subunit	183					tRNA processing (GO:0008033)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ribonuclease P activity (GO:0004526)			breast(1)|lung(1)	2						GCGATCGCTTCGCGGAGCCTT	0.687																																																	0													18.0	20.0	19.0					15																	75248376		2196	4291	6487	SO:0001819	synonymous_variant	0			AY034074	CCDS10274.1	15q24.2	2012-05-21	2007-06-26		ENSG00000178718	ENSG00000178718			30361	protein-coding gene	gene with protein product	"""RNase P protein subunit p25"""		"""ribonuclease P 25kDa subunit"""			12003489	Standard	NM_017793		Approved	FLJ20374	uc002azj.1	Q9BUL9	OTTHUMG00000142822	ENST00000322177.5:c.549G>C	15.37:g.75248376C>G			D3DW70|Q9NX88	Silent	SNP	pfam_DNA/RNA-bd_Alba-like	p.A183	ENST00000322177.5	37	c.549	CCDS10274.1	15																																																																																			RPP25	-	NULL	ENSG00000178718		0.687	RPP25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPP25	HGNC	protein_coding	OTTHUMT00000286413.1	-	0.00	48	0	C	NM_017793		75248376	-1	tier1	-	no_errors	ENST00000322177	ensembl	human	known	74_37	silent	20.59	26	7	SNP	0.098	G
SAMD9L	219285	genome.wustl.edu	37	7	92762448	92762448	+	Frame_Shift_Del	DEL	A	A	-			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr7:92762448delA	ENST00000318238.4	-	5	4053	c.2837delT	c.(2836-2838)ttgfs	p.L946fs	SAMD9L_ENST00000437805.1_Frame_Shift_Del_p.L946fs|SAMD9L_ENST00000411955.1_Frame_Shift_Del_p.L946fs	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	946					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TATGATTCCCAAAAATATTTC	0.373																																																	0													83.0	80.0	81.0					7																	92762448		2203	4299	6502	SO:0001589	frameshift_variant	0			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.2837delT	7.37:g.92762448delA	ENSP00000326247:p.Leu946fs		A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Frame_Shift_Del	DEL	superfamily_SAM/pointed,superfamily_P-loop_NTPase,pfscan_SAM	p.L946fs	ENST00000318238.4	37	c.2837	CCDS34681.1	7																																																																																			SAMD9L	-	NULL	ENSG00000177409		0.373	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9L	HGNC	protein_coding	OTTHUMT00000341730.1		0.00	15	0	A	NM_152703		92762448	-1	tier1		no_errors	ENST00000318238	ensembl	human	known	74_37	frame_shift_del	14.29	12	2	DEL	0.997	-
SBNO1	55206	genome.wustl.edu	37	12	123798200	123798200	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:123798200G>T	ENST00000602398.1	-	24	3314	c.3187C>A	c.(3187-3189)Cca>Aca	p.P1063T	SBNO1_ENST00000267176.4_Missense_Mutation_p.P1062T|SBNO1_ENST00000420886.2_Missense_Mutation_p.P1063T|SBNO1_ENST00000602750.1_Missense_Mutation_p.P1062T			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	1063					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TCTGGAGGTGGTGATACCATA	0.318																																																	0													68.0	69.0	69.0					12																	123798200		2203	4300	6503	SO:0001583	missense	0			AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.3187C>A	12.37:g.123798200G>T	ENSP00000473665:p.Pro1063Thr		Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Prismane-like	p.P1063T	ENST00000602398.1	37	c.3187	CCDS53844.1	12	.	.	.	.	.	.	.	.	.	.	G	24.3	4.511360	0.85389	.	.	ENSG00000139697	ENST00000420886;ENST00000267176	T;T	0.34667	1.35;1.35	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.61248	0.2332	M	0.76574	2.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.962	D;D;P	0.91635	0.999;0.998;0.828	T	0.54977	-0.8212	10	0.23302	T	0.38	-10.9363	19.4863	0.95030	0.0:0.0:1.0:0.0	.	1063;1062;174	A3KN83;A3KN83-2;B3KUC1	SBNO1_HUMAN;.;.	T	1063;1062	ENSP00000387361:P1063T;ENSP00000267176:P1062T	ENSP00000267176:P1062T	P	-	1	0	SBNO1	122364153	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.668000	0.83897	2.618000	0.88619	0.591000	0.81541	CCA	SBNO1	-	NULL	ENSG00000139697		0.318	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SBNO1	HGNC	protein_coding	OTTHUMT00000467684.1	-	0.00	37	0	G	NM_018183		123798200	-1	tier1	-	no_errors	ENST00000420886	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
SCN9A	6335	genome.wustl.edu	37	2	167133514	167133514	+	Silent	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:167133514G>A	ENST00000409435.1	-	15	2852	c.2853C>T	c.(2851-2853)gtC>gtT	p.V951V	SCN9A_ENST00000375387.4_Silent_p.V952V|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Silent_p.V952V|SCN9A_ENST00000409672.1_Silent_p.V940V			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	951					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAATGACCATGACCATCATGT	0.398																																																	0													189.0	182.0	184.0					2																	167133514		2203	4300	6503	SO:0001819	synonymous_variant	0			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.2853C>T	2.37:g.167133514G>A			A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Silent	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.V952	ENST00000409435.1	37	c.2856	CCDS46441.1	2																																																																																			SCN9A	-	pfam_Ion_trans_dom	ENSG00000169432		0.398	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1	-	0.00	89	0	G	NM_002977		167133514	-1	tier1	-	no_errors	ENST00000303354	ensembl	human	known	74_37	silent	18.31	58	13	SNP	1.000	A
SERPINA6	866	genome.wustl.edu	37	14	94770818	94770818	+	Silent	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr14:94770818G>T	ENST00000341584.3	-	5	1301	c.1155C>A	c.(1153-1155)atC>atA	p.I385I		NM_001756.3	NP_001747	P08185	CBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6	385					glucocorticoid metabolic process (GO:0008211)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)|steroid binding (GO:0005496)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	26		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	CGAAGATCATGATGATGAAGG	0.537																																																	0													203.0	162.0	176.0					14																	94770818		2203	4300	6503	SO:0001819	synonymous_variant	0			J02943	CCDS9924.1	14q32.13	2014-02-18	2005-08-18		ENSG00000170099	ENSG00000170099		"""Serine (or cysteine) peptidase inhibitors"""	1540	protein-coding gene	gene with protein product	"""corticosteroid binding globulin"", ""transcortin"""	122500	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6"""	CBG		3299377, 7912884, 24172014	Standard	NM_001756		Approved		uc001ycv.3	P08185	OTTHUMG00000171346	ENST00000341584.3:c.1155C>A	14.37:g.94770818G>T			A8K456|Q7Z2Q9	Silent	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.I385	ENST00000341584.3	37	c.1155	CCDS9924.1	14																																																																																			SERPINA6	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000170099		0.537	SERPINA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA6	HGNC	protein_coding	OTTHUMT00000413065.1	-	0.00	78	0	G	NM_001756		94770818	-1	tier1	-	no_errors	ENST00000341584	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.001	T
SERTAD2	9792	genome.wustl.edu	37	2	64863890	64863890	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:64863890G>T	ENST00000313349.3	-	2	413	c.116C>A	c.(115-117)aCt>aAt	p.T39N	SERTAD2_ENST00000476805.2_5'UTR	NM_014755.2	NP_055570.1	Q14140	SRTD2_HUMAN	SERTA domain containing 2	39	SERTA. {ECO:0000255|PROSITE- ProRule:PRU00396}.				negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|skin(1)	12						GTTGAAGATAGTCTGGCGCTG	0.473																																																	0													149.0	144.0	145.0					2																	64863890		2203	4300	6503	SO:0001583	missense	0			D50917	CCDS33210.1	2p15	2007-05-01			ENSG00000179833	ENSG00000179833			30784	protein-coding gene	gene with protein product	"""transcriptional regulator interacting with the PHS-bromodomain 2"""					8590280, 11331592	Standard	NM_014755		Approved	TRIP-Br2, KIAA0127, Sei-2	uc002sde.2	Q14140	OTTHUMG00000152678	ENST00000313349.3:c.116C>A	2.37:g.64863890G>T	ENSP00000326933:p.Thr39Asn		Q53TS2	Missense_Mutation	SNP	pfam_SERTA,pfscan_SERTA	p.T39N	ENST00000313349.3	37	c.116	CCDS33210.1	2	.	.	.	.	.	.	.	.	.	.	G	19.31	3.802987	0.70682	.	.	ENSG00000179833	ENST00000313349	.	.	.	5.83	5.83	0.93111	.	0.046985	0.85682	D	0.000000	T	0.75170	0.3813	L	0.44542	1.39	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.74097	-0.3775	9	0.52906	T	0.07	-12.4574	20.1338	0.98010	0.0:0.0:1.0:0.0	.	39	Q14140	SRTD2_HUMAN	N	39	.	ENSP00000326933:T39N	T	-	2	0	SERTAD2	64717394	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.567000	0.82357	2.770000	0.95276	0.655000	0.94253	ACT	SERTAD2	-	pfscan_SERTA	ENSG00000179833		0.473	SERTAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERTAD2	HGNC	protein_coding	OTTHUMT00000327322.2	-	0.00	46	0	G	NM_014755		64863890	-1	tier1	-	no_errors	ENST00000313349	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
SFTPA2	729238	genome.wustl.edu	37	10	81319210	81319210	+	Silent	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:81319210G>A	ENST00000372325.2	-	3	114	c.30C>T	c.(28-30)ctC>ctT	p.L10L	SFTPA2_ENST00000372327.5_Silent_p.L10L	NM_001098668.2	NP_001092138.1	Q8IWL1	SFPA2_HUMAN	surfactant protein A2	10					respiratory gaseous exchange (GO:0007585)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)			endometrium(1)|kidney(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			CCATCAAGATGAGGGTGAGGG	0.637									Pulmonary Fibrosis, Idiopathic																																								0													122.0	83.0	96.0					10																	81319210		2202	4294	6496	SO:0001819	synonymous_variant	0	Familial Cancer Database	Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia		CCDS41540.1	10q22.3	2012-11-02	2008-08-26			ENSG00000185303		"""Collectins"""	10799	protein-coding gene	gene with protein product	"""surfactant, pulmonary-associated protein A2A"""	178642	"""surfactant, pulmonary-associated protein A2"""				Standard	NM_001098668		Approved	SP-A2, COLEC5	uc001kal.4	Q8IWL1		ENST00000372325.2:c.30C>T	10.37:g.81319210G>A			A4QPA7|B2RXI6|B2RXK9|C9J9I7|E3VLC6|E3VLC7|E3VLC8|E3VLC9|P07714|Q14DV3|Q5RIR8|Q5RIR9	Silent	SNP	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.L10	ENST00000372325.2	37	c.30	CCDS41540.1	10																																																																																			SFTPA2	-	NULL	ENSG00000185303		0.637	SFTPA2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SFTPA2	HGNC	protein_coding	OTTHUMT00000048961.1	-	0.00	54	0	G	NM_001098668		81319210	-1	tier1	-	no_errors	ENST00000372325	ensembl	human	known	74_37	silent	29.73	26	11	SNP	0.114	A
SH2D3A	10045	genome.wustl.edu	37	19	6752623	6752623	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:6752623C>T	ENST00000245908.6	-	10	1981	c.1712G>A	c.(1711-1713)cGc>cAc	p.R571H	CTD-3128G10.6_ENST00000594056.1_RNA|SH2D3A_ENST00000437152.3_Missense_Mutation_p.R478H|SH2D3A_ENST00000599563.1_5'Flank	NM_005490.2	NP_005481.2	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	571					JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|urinary_tract(1)	24						AGGCTCCAGGCGCTGCGACAG	0.667																																																	0													16.0	22.0	20.0					19																	6752623		2198	4292	6490	SO:0001583	missense	0			AF124249	CCDS12173.1	19p13.3	2013-02-14	2002-01-14			ENSG00000125731		"""SH2 domain containing"""	16885	protein-coding gene	gene with protein product		604721	"""SH2 domain-containing 3A"""			10187783	Standard	NM_005490		Approved	NSP1	uc002mft.3	Q9BRG2		ENST00000245908.6:c.1712G>A	19.37:g.6752623C>T	ENSP00000245908:p.Arg571His		A8K9R6|B4DRS7|Q9Y2X4	Missense_Mutation	SNP	pfam_SH2,pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_SH2,smart_RasGRF_CDC25,pfscan_SH2,prints_SH2	p.R571H	ENST00000245908.6	37	c.1712	CCDS12173.1	19	.	.	.	.	.	.	.	.	.	.	C	15.60	2.882493	0.51908	.	.	ENSG00000125731	ENST00000245908;ENST00000437152	T;T	0.35236	2.33;1.32	4.85	3.82	0.43975	.	0.000000	0.41500	D	0.000873	T	0.49098	0.1537	L	0.60455	1.87	0.27613	N	0.948592	D;D	0.89917	1.0;0.999	D;P	0.67725	0.953;0.899	T	0.39187	-0.9626	10	0.66056	D	0.02	-24.5399	6.6659	0.23041	0.0:0.7885:0.0:0.2115	.	478;571	B4DRS7;Q9BRG2	.;SH23A_HUMAN	H	571;478	ENSP00000245908:R571H;ENSP00000393303:R478H	ENSP00000245908:R571H	R	-	2	0	SH2D3A	6703623	0.996000	0.38824	0.932000	0.37286	0.739000	0.42172	2.764000	0.47613	1.253000	0.44018	0.563000	0.77884	CGC	SH2D3A	-	smart_RasGRF_CDC25	ENSG00000125731		0.667	SH2D3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH2D3A	HGNC	protein_coding	OTTHUMT00000458016.1	-	0.00	90	0	C	NM_005490		6752623	-1	tier1	-	no_errors	ENST00000245908	ensembl	human	known	74_37	missense	34.55	36	19	SNP	0.741	T
SIGLEC10	89790	genome.wustl.edu	37	19	51914441	51914441	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:51914441G>T	ENST00000339313.5	-	11	2122	c.2006C>A	c.(2005-2007)aCg>aAg	p.T669K	SIGLEC10_ENST00000439889.2_Missense_Mutation_p.T611K|SIGLEC10_ENST00000356298.5_Missense_Mutation_p.T669K|SIGLEC10_ENST00000432469.2_Missense_Mutation_p.T491K|SIGLEC10_ENST00000353836.5_Missense_Mutation_p.T574K|SIGLEC10_ENST00000441969.3_Missense_Mutation_p.T516K|SIGLEC10_ENST00000525998.1_Missense_Mutation_p.T484K|SIGLEC10_ENST00000442846.3_Missense_Mutation_p.T426K|SIGLEC10_ENST00000436984.2_Missense_Mutation_p.T526K			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	669					cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.T611M(1)|p.T669M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		GAAGTTGAGCGTGGCATAATG	0.552																																																	2	Substitution - Missense(2)	large_intestine(2)											168.0	161.0	164.0					19																	51914441		2203	4300	6503	SO:0001583	missense	0			AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.2006C>A	19.37:g.51914441G>T	ENSP00000345243:p.Thr669Lys		A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T669K	ENST00000339313.5	37	c.2006	CCDS12832.1	19	.	.	.	.	.	.	.	.	.	.	.	11.73	1.724883	0.30593	.	.	ENSG00000142512	ENST00000353836;ENST00000432469;ENST00000442846;ENST00000356298;ENST00000441969;ENST00000525998;ENST00000439889;ENST00000436984;ENST00000339313	T;T;T;T;T;T;T;T;T	0.51574	1.03;2.24;1.7;0.86;2.08;1.89;0.7;2.02;0.86	4.55	-2.7	0.06004	.	1.841900	0.02815	N	0.124894	T	0.52419	0.1733	L	0.44542	1.39	0.09310	N	1	P;D;P;P;P;P;B	0.76494	0.904;0.999;0.904;0.942;0.942;0.786;0.16	P;D;P;P;P;B;B	0.65233	0.476;0.933;0.476;0.675;0.675;0.39;0.071	T	0.47560	-0.9108	10	0.51188	T	0.08	.	1.3318	0.02136	0.2085:0.3074:0.3279:0.1562	.	526;484;574;574;516;611;669	C9JM10;E9PL79;B7ZL04;Q96LC7-2;Q96LC7-6;Q96LC7-3;Q96LC7	.;.;.;.;.;.;SIG10_HUMAN	K	574;491;426;669;516;484;611;526;669	ENSP00000342389:T574K;ENSP00000396742:T491K;ENSP00000395475:T426K;ENSP00000348646:T669K;ENSP00000408387:T516K;ENSP00000431444:T484K;ENSP00000389132:T611K;ENSP00000414324:T526K;ENSP00000345243:T669K	ENSP00000345243:T669K	T	-	2	0	SIGLEC10	56606253	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-0.283000	0.08433	-0.153000	0.11137	-0.219000	0.12488	ACG	SIGLEC10	-	NULL	ENSG00000142512		0.552	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC10	HGNC	protein_coding	OTTHUMT00000384620.2		0.00	63	0	G	NM_033130		51914441	-1			no_errors	ENST00000339313	ensembl	human	known	74_37	missense	5.45	52	3	SNP	0.000	T
SIX1	6495	genome.wustl.edu	37	14	61115638	61115638	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr14:61115638C>T	ENST00000247182.6	-	1	542	c.270G>A	c.(268-270)gcG>gcA	p.A90A	SIX1_ENST00000554986.1_Intron	NM_005982.3	NP_005973.1	Q15475	SIX1_HUMAN	SIX homeobox 1	90					aorta morphogenesis (GO:0035909)|apoptotic process (GO:0006915)|branching involved in ureteric bud morphogenesis (GO:0001658)|cochlea morphogenesis (GO:0090103)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic skeletal system morphogenesis (GO:0048704)|epithelial cell differentiation (GO:0030855)|facial nerve morphogenesis (GO:0021610)|generation of neurons (GO:0048699)|inner ear development (GO:0048839)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesonephric tubule formation (GO:0072172)|metanephric mesenchyme development (GO:0072075)|middle ear morphogenesis (GO:0042474)|myoblast migration (GO:0051451)|negative regulation of branching involved in ureteric bud morphogenesis (GO:0090191)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|organ induction (GO:0001759)|otic vesicle development (GO:0071599)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|protein localization to nucleus (GO:0034504)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of neuron differentiation (GO:0045664)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.A90A(1)		breast(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.0201)		CCACGTAATGCGCCTTCAGCC	0.627																																																	1	Substitution - coding silent(1)	lung(1)											105.0	107.0	107.0					14																	61115638		2203	4300	6503	SO:0001819	synonymous_variant	0			X91868	CCDS9748.1	14q23.1	2011-06-20	2007-07-13		ENSG00000126778	ENSG00000126778		"""Homeoboxes / SINE class"""	10887	protein-coding gene	gene with protein product		601205	"""sine oculis homeobox (Drosophila) homolog 1"", ""sine oculis homeobox homolog 1 (Drosophila)"", ""deafness, autosomal dominant 23"""	DFNA23		8617500, 15141091	Standard	NM_005982		Approved		uc001xfb.4	Q15475	OTTHUMG00000140334	ENST00000247182.6:c.270G>A	14.37:g.61115638C>T			Q53Y16|Q96H64	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.A90	ENST00000247182.6	37	c.270	CCDS9748.1	14																																																																																			SIX1	-	NULL	ENSG00000126778		0.627	SIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX1	HGNC	protein_coding	OTTHUMT00000276951.3		0.00	44	0	C			61115638	-1			no_errors	ENST00000247182	ensembl	human	known	74_37	silent	5.56	34	2	SNP	1.000	T
SLC19A1	6573	genome.wustl.edu	37	21	46950838	46950838	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr21:46950838G>A	ENST00000311124.4	-	4	1149	c.997C>T	c.(997-999)Cgc>Tgc	p.R333C	SLC19A1_ENST00000380010.4_Missense_Mutation_p.R333C|SLC19A1_ENST00000485649.2_Missense_Mutation_p.R293C|SLC19A1_ENST00000567670.1_Missense_Mutation_p.R333C	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	333					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	TTGGACCAGCGCGCCCAGCGG	0.716																																																	0													18.0	19.0	19.0					21																	46950838		2191	4289	6480	SO:0001583	missense	0			U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.997C>T	21.37:g.46950838G>A	ENSP00000308895:p.Arg333Cys		B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Missense_Mutation	SNP	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier	p.R333C	ENST00000311124.4	37	c.997	CCDS13725.1	21	.	.	.	.	.	.	.	.	.	.	g	10.79	1.449231	0.26074	.	.	ENSG00000173638	ENST00000380014;ENST00000311124;ENST00000380010;ENST00000485649	D;D;D	0.84298	-1.83;-1.83;-1.83	4.16	1.05	0.20165	Major facilitator superfamily domain, general substrate transporter (1);	0.610874	0.15514	N	0.258373	T	0.81645	0.4866	L	0.61036	1.89	0.27796	N	0.942648	D;D;B;P	0.57571	0.98;0.98;0.041;0.866	P;P;B;P	0.44897	0.463;0.463;0.017;0.463	T	0.74109	-0.3771	10	0.62326	D	0.03	-8.8755	6.8145	0.23822	0.18:0.1442:0.6758:0.0	.	293;355;333;333	B7Z8C3;D3DSM6;E9PFY4;P41440	.;.;.;S19A1_HUMAN	C	80;333;333;293	ENSP00000308895:R333C;ENSP00000369347:R333C;ENSP00000441772:R293C	ENSP00000308895:R333C	R	-	1	0	SLC19A1	45775266	0.004000	0.15560	0.308000	0.25141	0.042000	0.13812	-0.051000	0.11885	0.338000	0.23692	0.289000	0.19496	CGC	SLC19A1	-	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier	ENSG00000173638		0.716	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC19A1	HGNC	protein_coding	OTTHUMT00000206796.1	-	0.00	33	0	G			46950838	-1	tier1	-	no_errors	ENST00000311124	ensembl	human	known	74_37	missense	30.30	23	10	SNP	0.298	A
SLC25A21	89874	genome.wustl.edu	37	14	37154021	37154021	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr14:37154021G>T	ENST00000331299.5	-	8	1228	c.713C>A	c.(712-714)cCt>cAt	p.P238H	SLC25A21_ENST00000555449.1_Missense_Mutation_p.P238H	NM_030631.3	NP_085134.1	Q9BQT8	ODC_HUMAN	solute carrier family 25 (mitochondrial oxoadipate carrier), member 21	238					cellular nitrogen compound metabolic process (GO:0034641)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.P238H(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|pancreas(1)|prostate(1)|skin(1)	9	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)		AACTGGTTGAGGCCCTTGAAT	0.393																																																	1	Substitution - Missense(1)	lung(1)											165.0	162.0	163.0					14																	37154021		2203	4300	6503	SO:0001583	missense	0			AJ278148	CCDS9663.1, CCDS55913.1	14q13.3	2014-01-28	2012-03-29		ENSG00000183032	ENSG00000183032		"""Solute carriers"""	14411	protein-coding gene	gene with protein product		607571	"""solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21"""			11083877	Standard	NM_030631		Approved	ODC1, ODC	uc001wtz.2	Q9BQT8	OTTHUMG00000140250	ENST00000331299.5:c.713C>A	14.37:g.37154021G>T	ENSP00000329452:p.Pro238His		A8K0L0|G3V4L5|Q3MJ99	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.P238H	ENST00000331299.5	37	c.713	CCDS9663.1	14	.	.	.	.	.	.	.	.	.	.	G	18.73	3.686453	0.68157	.	.	ENSG00000183032	ENST00000555449;ENST00000331299	T;T	0.78707	-1.2;-1.2	5.67	5.67	0.87782	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.86108	0.5854	L	0.55213	1.73	0.80722	D	1	D	0.71674	0.998	D	0.71656	0.974	D	0.84994	0.0896	10	0.49607	T	0.09	-6.1526	20.1095	0.97908	0.0:0.0:1.0:0.0	.	238	Q9BQT8	ODC_HUMAN	H	238	ENSP00000451873:P238H;ENSP00000329452:P238H	ENSP00000329452:P238H	P	-	2	0	SLC25A21	36223772	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.286000	0.95898	2.831000	0.97527	0.655000	0.94253	CCT	SLC25A21	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000183032		0.393	SLC25A21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A21	HGNC	protein_coding	OTTHUMT00000276732.2	-	0.00	71	0	G	NM_030631		37154021	-1	tier1	-	no_errors	ENST00000331299	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
SLC37A1	54020	genome.wustl.edu	37	21	43955658	43955658	+	Silent	SNP	C	C	A	rs199619177		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr21:43955658C>A	ENST00000352133.2	+	5	1330	c.348C>A	c.(346-348)ctC>ctA	p.L116L	SLC37A1_ENST00000398341.3_Silent_p.L116L			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1	116					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						GGATGTACCTCAGGTAGGTCT	0.542																																																	0													156.0	150.0	152.0					21																	43955658		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.348C>A	21.37:g.43955658C>A			D3DSJ7|Q9HAQ1	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L116	ENST00000352133.2	37	c.348	CCDS13689.1	21																																																																																			SLC37A1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000160190		0.542	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC37A1	HGNC	protein_coding	OTTHUMT00000195377.1	-	0.00	96	0	C			43955658	+1	tier1	rs199619177	no_errors	ENST00000352133	ensembl	human	known	74_37	silent	12.90	54	8	SNP	0.997	A
SLC38A1	81539	genome.wustl.edu	37	12	46582819	46582819	+	Silent	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:46582819G>T	ENST00000398637.5	-	17	2092	c.1398C>A	c.(1396-1398)tcC>tcA	p.S466S	SLC38A1_ENST00000549049.1_Silent_p.S466S|SLC38A1_ENST00000546893.1_Silent_p.S466S|SLC38A1_ENST00000439706.1_Silent_p.S466S	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1	466					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)			NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			TGCTGACCAAGGAGAACAACA	0.507																																																	0													86.0	93.0	90.0					12																	46582819		1949	4154	6103	SO:0001819	synonymous_variant	0			AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.1398C>A	12.37:g.46582819G>T			Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	Silent	SNP	pfam_AA_transpt_TM	p.S466	ENST00000398637.5	37	c.1398	CCDS41774.1	12																																																																																			SLC38A1	-	pfam_AA_transpt_TM	ENSG00000111371		0.507	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A1	HGNC	protein_coding	OTTHUMT00000404218.2	-	0.00	38	0	G			46582819	-1	tier1	-	no_errors	ENST00000398637	ensembl	human	known	74_37	silent	7.14	52	4	SNP	0.998	T
SLC38A4	55089	genome.wustl.edu	37	12	47172402	47172402	+	Missense_Mutation	SNP	C	C	T	rs189669525	byFrequency	TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:47172402C>T	ENST00000447411.1	-	10	1081	c.875G>A	c.(874-876)cGc>cAc	p.R292H	SLC38A4_ENST00000266579.4_Missense_Mutation_p.R292H	NM_001143824.1	NP_001137296.1	Q969I6	S38A4_HUMAN	solute carrier family 38, member 4	292					amino acid transport (GO:0006865)|ion transport (GO:0006811)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)	p.R292H(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	21	Lung SC(27;0.192)|Renal(347;0.236)					TGCAGGATTGCGGTGGGTGTA	0.458																																																	1	Substitution - Missense(1)	endometrium(1)											116.0	104.0	108.0					12																	47172402		2203	4299	6502	SO:0001583	missense	0			AF193836	CCDS8750.1	12q13	2013-05-22				ENSG00000139209		"""Solute carriers"""	14679	protein-coding gene	gene with protein product		608065				11414754	Standard	NM_018018		Approved	PAAT, NAT3, ATA3	uc001rpj.2	Q969I6		ENST00000447411.1:c.875G>A	12.37:g.47172402C>T	ENSP00000389843:p.Arg292His		A8K553	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.R292H	ENST00000447411.1	37	c.875	CCDS8750.1	12	.	.	.	.	.	.	.	.	.	.	C	11.47	1.649611	0.29336	.	.	ENSG00000139209	ENST00000447411;ENST00000266579	T;T	0.04119	3.7;3.7	4.91	-1.52	0.08637	.	0.991659	0.08198	N	0.982792	T	0.02848	0.0085	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46925	-0.9156	10	0.32370	T	0.25	0.0169	10.3171	0.43743	0.0:0.4305:0.0:0.5695	.	292	Q969I6	S38A4_HUMAN	H	292	ENSP00000389843:R292H;ENSP00000266579:R292H	ENSP00000266579:R292H	R	-	2	0	SLC38A4	45458669	0.000000	0.05858	0.002000	0.10522	0.942000	0.58702	-0.503000	0.06383	-0.352000	0.08237	0.484000	0.47621	CGC	SLC38A4	-	NULL	ENSG00000139209		0.458	SLC38A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A4	HGNC	protein_coding	OTTHUMT00000404574.1		0.00	27	0	C			47172402	-1			no_errors	ENST00000266579	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.000	T
SLC41A1	254428	genome.wustl.edu	37	1	205779531	205779531	+	Silent	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:205779531C>T	ENST00000367137.3	-	2	1053	c.39G>A	c.(37-39)ctG>ctA	p.L13L		NM_173854.4	NP_776253.3	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 (magnesium transporter), member 1	13					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	17	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			CAGTCCCGTTCAGTTGGTGGA	0.592											OREG0014163	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													78.0	84.0	82.0					1																	205779531		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ514402	CCDS30988.1	1q32.1	2013-07-17	2013-07-17		ENSG00000133065	ENSG00000133065		"""Solute carriers"""	19429	protein-coding gene	gene with protein product		610801				12810078, 18367447	Standard	NM_173854		Approved	MgtE	uc001hdh.1	Q8IVJ1	OTTHUMG00000036000	ENST00000367137.3:c.39G>A	1.37:g.205779531C>T		2154	Q63HJ4|Q658Z5|Q659A4|Q6MZK2	Silent	SNP	pfam_SLC41_membr_dom	p.L13	ENST00000367137.3	37	c.39	CCDS30988.1	1																																																																																			SLC41A1	-	NULL	ENSG00000133065		0.592	SLC41A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC41A1	HGNC	protein_coding	OTTHUMT00000087731.1	-	0.00	43	0	C			205779531	-1	tier1	-	no_errors	ENST00000367137	ensembl	human	known	74_37	silent	25.00	21	7	SNP	1.000	T
SLC6A13	6540	genome.wustl.edu	37	12	369020	369020	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:369020C>T	ENST00000343164.4	-	2	251	c.199G>A	c.(199-201)Gga>Aga	p.G67R	SLC6A13_ENST00000436453.1_Missense_Mutation_p.G67R|RP11-283I3.4_ENST00000540868.1_RNA|SLC6A13_ENST00000445055.2_Missense_Mutation_p.G67R	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	67					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			ATCTCACCTCCCCCATTTTTG	0.542																																																	0													140.0	127.0	131.0					12																	369020		2203	4300	6503	SO:0001583	missense	0			U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.199G>A	12.37:g.369020C>T	ENSP00000339260:p.Gly67Arg		B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_GABA_GAT2	p.G67R	ENST00000343164.4	37	c.199	CCDS8502.1	12	.	.	.	.	.	.	.	.	.	.	C	19.95	3.921275	0.73213	.	.	ENSG00000010379	ENST00000445055;ENST00000313154;ENST00000343164;ENST00000546319;ENST00000436453	D;D;D;D	0.97161	-4.27;-4.27;-4.27;-4.27	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	D	0.99306	0.9757	H	0.99182	4.46	0.39972	D	0.974809	B;D;D;D	0.89917	0.018;1.0;1.0;1.0	B;D;D;D	0.97110	0.011;0.999;1.0;0.999	D	0.98900	1.0776	10	0.87932	D	0	.	20.3594	0.98849	0.0:1.0:0.0:0.0	.	67;46;67;67	B4DJL1;B4DJS3;Q8WW56;Q9NSD5	.;.;.;S6A13_HUMAN	R	67;46;67;67;67	ENSP00000407104:G67R;ENSP00000339260:G67R;ENSP00000444606:G67R;ENSP00000389316:G67R	ENSP00000318097:G46R	G	-	1	0	SLC6A13	239281	1.000000	0.71417	1.000000	0.80357	0.024000	0.10985	7.818000	0.86416	2.816000	0.96949	0.563000	0.77884	GGA	SLC6A13	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000010379		0.542	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A13	HGNC	protein_coding	OTTHUMT00000397801.1		0.00	39	0	C	NM_016615		369020	-1			no_errors	ENST00000343164	ensembl	human	known	74_37	missense	8.57	32	3	SNP	1.000	T
SLC6A9	6536	genome.wustl.edu	37	1	44466463	44466463	+	Silent	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:44466463G>T	ENST00000360584.2	-	12	1922	c.1731C>A	c.(1729-1731)cgC>cgA	p.R577R	SLC6A9_ENST00000372306.3_Missense_Mutation_p.L534I|SLC6A9_ENST00000372307.3_Silent_p.R439R|SLC6A9_ENST00000372310.3_Silent_p.R504R|SLC6A9_ENST00000475075.2_Silent_p.R393R|SLC6A9_ENST00000357730.2_Silent_p.R523R	NM_201649.3	NP_964012.2	P48067	SC6A9_HUMAN	solute carrier family 6 (neurotransmitter transporter, glycine), member 9	577					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(2)	22	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	GAGAGACGAAGCGCCAGCAGA	0.622																																																	0													61.0	64.0	63.0					1																	44466463		2203	4300	6503	SO:0001819	synonymous_variant	0			S70609	CCDS30695.1, CCDS41316.1, CCDS41317.1	1p33	2013-05-22			ENSG00000196517	ENSG00000196517		"""Solute carriers"""	11056	protein-coding gene	gene with protein product		601019				8183239, 7587377	Standard	NM_006934		Approved	GLYT1	uc001cll.4	P48067	OTTHUMG00000008294	ENST00000360584.2:c.1731C>A	1.37:g.44466463G>T			A6NDH1|A6NII2|A6NNZ8|Q5TAB8|Q5TAB9|Q5TAC0	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_glycine_GLY1	p.L534I	ENST00000360584.2	37	c.1600	CCDS41317.1	1	.	.	.	.	.	.	.	.	.	.	G	13.14	2.147477	0.37923	.	.	ENSG00000196517	ENST00000372306	T	0.76060	-0.99	5.7	-1.13	0.09775	.	.	.	.	.	T	0.56062	0.1960	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.52290	-0.8595	8	0.54805	T	0.06	.	1.2593	0.01998	0.2697:0.1775:0.3847:0.168	.	534	B7Z8W5	.	I	534	ENSP00000361380:L534I	ENSP00000361380:L534I	L	-	1	0	SLC6A9	44239050	0.833000	0.29383	1.000000	0.80357	0.951000	0.60555	-0.122000	0.10627	0.330000	0.23485	0.591000	0.81541	CTT	SLC6A9	-	NULL	ENSG00000196517		0.622	SLC6A9-001	KNOWN	basic|CCDS	protein_coding	SLC6A9	HGNC	protein_coding	OTTHUMT00000022825.2		0.00	74	0	G	NM_201649		44466463	-1			no_errors	ENST00000372306	ensembl	human	putative	74_37	missense	5.41	70	4	SNP	0.933	T
SLC7A5	8140	genome.wustl.edu	37	16	87885450	87885450	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr16:87885450G>T	ENST00000261622.4	-	2	609	c.544C>A	c.(544-546)Ctc>Atc	p.L182I	SLC7A5_ENST00000565644.1_5'UTR	NM_003486.5	NP_003477.4	Q01650	LAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 5	182					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(80;0.049)	Dextrothyroxine(DB00509)|L-DOPA(DB01235)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Melphalan(DB01042)	ACGGCCGTGAGCAGCACTGTG	0.687																																																	0													33.0	34.0	34.0					16																	87885450		2197	4300	6497	SO:0001583	missense	0			AF077866	CCDS10964.1	16q24.3	2013-05-22	2011-07-12		ENSG00000103257	ENSG00000103257		"""CD molecules"", ""Solute carriers"""	11063	protein-coding gene	gene with protein product		600182				9751058, 7829099	Standard	XM_006721286		Approved	LAT1, E16, D16S469E, MPE16, CD98	uc002fkm.3	Q01650	OTTHUMG00000137658	ENST00000261622.4:c.544C>A	16.37:g.87885450G>T	ENSP00000261622:p.Leu182Ile		Q8IV97|Q9UBN8|Q9UP15|Q9UQC0	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1,tigrfam_L_AA_transporter	p.L182I	ENST00000261622.4	37	c.544	CCDS10964.1	16	.	.	.	.	.	.	.	.	.	.	G	24.7	4.559985	0.86335	.	.	ENSG00000103257	ENST00000261622	D	0.89617	-2.54	5.31	5.31	0.75309	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.92805	0.7712	L	0.52759	1.655	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	D	0.92508	0.6014	10	0.46703	T	0.11	.	17.9637	0.89093	0.0:0.0:1.0:0.0	.	182	Q01650	LAT1_HUMAN	I	182	ENSP00000261622:L182I	ENSP00000261622:L182I	L	-	1	0	SLC7A5	86442951	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.592000	0.61027	2.467000	0.83353	0.655000	0.94253	CTC	SLC7A5	-	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1,tigrfam_L_AA_transporter	ENSG00000103257		0.687	SLC7A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A5	HGNC	protein_coding	OTTHUMT00000269110.2		0.00	85	0	G	NM_003486		87885450	-1			no_errors	ENST00000261622	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
SLC9A4	389015	genome.wustl.edu	37	2	103141605	103141605	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:103141605G>T	ENST00000295269.4	+	10	2398	c.1941G>T	c.(1939-1941)tgG>tgT	p.W647C		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	647					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)	p.W647C(1)		NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						GCCTGCCCTGGGGAAAGCCGG	0.532																																																	1	Substitution - Missense(1)	lung(1)											115.0	118.0	117.0					2																	103141605		2203	4300	6503	SO:0001583	missense	0				CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.1941G>T	2.37:g.103141605G>T	ENSP00000295269:p.Trp647Cys		Q69YK0	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_NaH_exchanger,prints_Na/H_exchanger_2,tigrfam_NaH_exchanger	p.W647C	ENST00000295269.4	37	c.1941	CCDS33264.1	2	.	.	.	.	.	.	.	.	.	.	G	11.97	1.796142	0.31777	.	.	ENSG00000180251	ENST00000295269	T	0.45668	0.89	5.75	5.75	0.90469	.	1.037700	0.07434	N	0.896245	T	0.61553	0.2356	M	0.70595	2.14	0.58432	D	0.999995	D	0.61697	0.99	P	0.59889	0.865	T	0.45804	-0.9236	10	0.38643	T	0.18	.	12.0985	0.53769	0.0795:0.0:0.9205:0.0	.	647	Q6AI14	SL9A4_HUMAN	C	647	ENSP00000295269:W647C	ENSP00000295269:W647C	W	+	3	0	SLC9A4	102508037	1.000000	0.71417	0.942000	0.38095	0.066000	0.16364	3.421000	0.52742	2.718000	0.92993	0.579000	0.79373	TGG	SLC9A4	-	NULL	ENSG00000180251		0.532	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A4	HGNC	protein_coding	OTTHUMT00000329498.1	-	0.00	41	0	G	NM_001011552.3		103141605	+1	tier1	-	no_errors	ENST00000295269	ensembl	human	known	74_37	missense	12.50	21	3	SNP	0.998	T
SLIT2	9353	genome.wustl.edu	37	4	20552484	20552484	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:20552484G>A	ENST00000504154.1	+	25	2776	c.2524G>A	c.(2524-2526)Gaa>Aaa	p.E842K	SLIT2_ENST00000503837.1_Missense_Mutation_p.E838K|SLIT2_ENST00000509394.2_3'UTR|SLIT2_ENST00000503823.1_Missense_Mutation_p.E834K|SLIT2_ENST00000273739.5_Missense_Mutation_p.E846K	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	842					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						TGTTGTGCCTGAAGGTGCTTT	0.343																																																	0													201.0	184.0	190.0					4																	20552484		2203	4300	6503	SO:0001583	missense	0			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.2524G>A	4.37:g.20552484G>A	ENSP00000422591:p.Glu842Lys		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.E842K	ENST00000504154.1	37	c.2524	CCDS3426.1	4	.	.	.	.	.	.	.	.	.	.	G	21.5	4.157993	0.78114	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837;ENST00000511508	T;T;T;T;T	0.57595	0.39;0.39;0.39;0.39;0.39	5.86	5.86	0.93980	.	0.045582	0.85682	D	0.000000	T	0.50531	0.1621	L	0.31926	0.97	0.80722	D	1	P;P	0.37525	0.598;0.509	B;B	0.40477	0.33;0.245	T	0.48210	-0.9055	10	0.51188	T	0.08	.	20.5632	0.99335	0.0:0.0:1.0:0.0	.	834;842	O94813-3;O94813	.;SLIT2_HUMAN	K	834;842;846;838;838;43	ENSP00000427548:E834K;ENSP00000422591:E842K;ENSP00000273739:E846K;ENSP00000422261:E838K;ENSP00000421975:E43K	ENSP00000273739:E846K	E	+	1	0	SLIT2	20161582	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.764000	0.85297	2.937000	0.99478	0.650000	0.86243	GAA	SLIT2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000145147		0.343	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2	-	0.00	30	0	G			20552484	+1	tier1	-	no_errors	ENST00000504154	ensembl	human	known	74_37	missense	17.65	28	6	SNP	1.000	A
SLIT2	9353	genome.wustl.edu	37	4	20620418	20620418	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr4:20620418G>C	ENST00000504154.1	+	37	4628	c.4376G>C	c.(4375-4377)aGa>aCa	p.R1459T	SLIT2_ENST00000503837.1_Missense_Mutation_p.R1455T|SLIT2_ENST00000503823.1_Missense_Mutation_p.R1451T|SLIT2_ENST00000273739.5_Missense_Mutation_p.R1472T	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1459	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039, ECO:0000305}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GAAAGGATAAGAGATTATTAC	0.458																																																	0													97.0	98.0	98.0					4																	20620418		2203	4300	6503	SO:0001583	missense	0			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.4376G>C	4.37:g.20620418G>C	ENSP00000422591:p.Arg1459Thr		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.R1459T	ENST00000504154.1	37	c.4376	CCDS3426.1	4	.	.	.	.	.	.	.	.	.	.	G	22.9	4.350078	0.82132	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	D;D;D;D	0.82344	-1.6;-1.6;-1.5;-1.57	6.07	6.07	0.98685	Cystine knot, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.92299	0.7557	M	0.84683	2.71	0.80722	D	1	D;D	0.71674	0.998;0.996	D;P	0.68192	0.956;0.894	D	0.92021	0.5626	10	0.62326	D	0.03	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	1451;1459	O94813-3;O94813	.;SLIT2_HUMAN	T	1451;1459;1472;1455;1455	ENSP00000427548:R1451T;ENSP00000422591:R1459T;ENSP00000273739:R1472T;ENSP00000422261:R1455T	ENSP00000273739:R1472T	R	+	2	0	SLIT2	20229516	1.000000	0.71417	0.556000	0.28293	0.997000	0.91878	9.869000	0.99810	2.884000	0.98904	0.655000	0.94253	AGA	SLIT2	-	smart_Cys_knot_C,pfscan_Cys_knot_C	ENSG00000145147		0.458	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2		0.00	31	0	G			20620418	+1			no_errors	ENST00000504154	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	C
SMOC2	64094	genome.wustl.edu	37	6	169053824	169053824	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:169053824G>A	ENST00000356284.2	+	11	1421	c.1201G>A	c.(1201-1203)Gac>Aac	p.D401N	SMOC2_ENST00000354536.5_Missense_Mutation_p.D412N	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	401	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		CGTGAATAATGACAAATCCAT	0.463																																																	0													125.0	117.0	119.0					6																	169053824		2203	4300	6503	SO:0001583	missense	0			AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.1201G>A	6.37:g.169053824G>A	ENSP00000348630:p.Asp401Asn		B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_SPARC/Testican_Ca-bd-dom,pfam_Kazal_dom,superfamily_Thyroglobulin_1,smart_Kazal_dom,smart_Thyroglobulin_1,pfscan_EF_hand_dom,pfscan_Thyroglobulin_1	p.D412N	ENST00000356284.2	37	c.1234	CCDS55076.1	6	.	.	.	.	.	.	.	.	.	.	G	16.87	3.240925	0.58995	.	.	ENSG00000112562	ENST00000356284;ENST00000354536;ENST00000366793;ENST00000392101;ENST00000538593;ENST00000417208	T;T	0.60672	0.25;0.17	4.92	4.05	0.47172	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.061993	0.64402	N	0.000007	T	0.62122	0.2402	M	0.64170	1.965	0.80722	D	1	P;D	0.89917	0.95;1.0	P;D	0.91635	0.889;0.999	T	0.63001	-0.6734	10	0.38643	T	0.18	0.4753	12.0415	0.53456	0.0833:0.0:0.9167:0.0	.	401;412	Q9H3U7;Q9H3U7-2	SMOC2_HUMAN;.	N	401;412;401;78;78;21	ENSP00000348630:D401N;ENSP00000346537:D412N	ENSP00000346537:D412N	D	+	1	0	SMOC2	168795749	1.000000	0.71417	0.399000	0.26333	0.095000	0.18619	7.233000	0.78125	1.053000	0.40415	0.655000	0.94253	GAC	SMOC2	-	pfam_SPARC/Testican_Ca-bd-dom,pfscan_EF_hand_dom	ENSG00000112562		0.463	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMOC2	HGNC	protein_coding	OTTHUMT00000043201.1	-	0.00	95	0	G			169053824	+1	tier1	-	no_errors	ENST00000354536	ensembl	human	known	74_37	missense	13.43	58	9	SNP	1.000	A
SOX11	6664	genome.wustl.edu	37	2	5832933	5832933	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:5832933T>G	ENST00000322002.3	+	1	135	c.80T>G	c.(79-81)aTg>aGg	p.M27R	AC108025.2_ENST00000420221.1_RNA|AC107057.2_ENST00000458264.1_RNA|AC108025.2_ENST00000453678.1_RNA	NM_003108.3	NP_003099.1	P35716	SOX11_HUMAN	SRY (sex determining region Y)-box 11	27					cardiac ventricle formation (GO:0003211)|closure of optic fissure (GO:0061386)|cornea development in camera-type eye (GO:0061303)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|hard palate development (GO:0060022)|kidney development (GO:0001822)|lens morphogenesis in camera-type eye (GO:0002089)|limb bud formation (GO:0060174)|lung morphogenesis (GO:0060425)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural crest cell development (GO:0014032)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|neuron differentiation (GO:0030182)|noradrenergic neuron differentiation (GO:0003357)|oligodendrocyte development (GO:0014003)|outflow tract morphogenesis (GO:0003151)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of hippo signaling (GO:0035332)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lens epithelial cell proliferation (GO:2001111)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|signal transduction involved in cell cycle checkpoint (GO:0072395)|skeletal muscle cell differentiation (GO:0035914)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)|somite development (GO:0061053)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|translation (GO:0006412)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|translation factor activity, nucleic acid binding (GO:0008135)			central_nervous_system(5)|cervix(1)|endometrium(1)|liver(1)|lung(4)|stomach(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		GGCGAATTCATGGCTTGCAGC	0.662																																																	0													33.0	34.0	34.0					2																	5832933		2203	4300	6503	SO:0001583	missense	0				CCDS1654.1	2p25	2008-05-21			ENSG00000176887	ENSG00000176887		"""SRY (sex determining region Y)-boxes"""	11191	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 11"""	600898				8666406, 12637543	Standard	NM_003108		Approved		uc002qyj.3	P35716	OTTHUMG00000090333	ENST00000322002.3:c.80T>G	2.37:g.5832933T>G	ENSP00000322568:p.Met27Arg		Q4ZFV8	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pirsf_SOX-12/11/4a,pfscan_HMG_box_dom	p.M27R	ENST00000322002.3	37	c.80	CCDS1654.1	2	.	.	.	.	.	.	.	.	.	.	t	19.01	3.744380	0.69418	.	.	ENSG00000176887	ENST00000322002	D	0.97811	-4.55	3.14	3.14	0.36123	.	0.000000	0.64402	U	0.000002	D	0.96710	0.8926	M	0.67397	2.05	0.50813	D	0.999891	D	0.57257	0.979	P	0.49332	0.607	D	0.94753	0.7929	10	0.25106	T	0.35	.	11.3878	0.49796	0.0:0.0:0.0:1.0	.	27	P35716	SOX11_HUMAN	R	27	ENSP00000322568:M27R	ENSP00000322568:M27R	M	+	2	0	SOX11	5750384	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.551000	0.45820	1.190000	0.43042	0.382000	0.24955	ATG	SOX11	-	pirsf_SOX-12/11/4a	ENSG00000176887		0.662	SOX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX11	HGNC	protein_coding	OTTHUMT00000206698.1	-	0.00	74	0	T	NM_003108		5832933	+1	tier1	-	no_errors	ENST00000322002	ensembl	human	known	74_37	missense	7.04	66	5	SNP	1.000	G
SPAG17	200162	genome.wustl.edu	37	1	118558800	118558801	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:118558800_118558801delTT	ENST00000336338.5	-	29	4139_4140	c.4074_4075delAA	c.(4072-4077)aaaagtfs	p.S1359fs		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1359						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CTTTTGTGACTTTTTCCTGTGA	0.381																																																	0										1,4265		0,1,2132						2.7	1.0			113	0,8254		0,0,4127	no	frameshift	SPAG17	NM_206996.2		0,1,6259	A1A1,A1R,RR		0.0,0.0234,0.0080				1,12519				SO:0001589	frameshift_variant	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.4074_4075delAA	1.37:g.118558802_118558803delTT	ENSP00000337804:p.Ser1359fs		Q8NAZ1|Q9NT21	Frame_Shift_Del	DEL	NULL	p.H1360fs	ENST00000336338.5	37	c.4075_4074	CCDS899.1	1																																																																																			SPAG17	-	NULL	ENSG00000155761		0.381	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1		0.00	37	0	TT	NM_206996		118558801	-1	tier1		no_errors	ENST00000336338	ensembl	human	known	74_37	frame_shift_del	22.86	27	8	DEL	0.965:0.981	-
SPATC1	375686	genome.wustl.edu	37	8	145095594	145095594	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr8:145095594G>A	ENST00000377470.3	+	3	994	c.892G>A	c.(892-894)Gcc>Acc	p.A298T	SPATC1_ENST00000447830.2_Missense_Mutation_p.A298T	NM_198572.2	NP_940974.2	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	298						centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCCCAAGACGGCCTTCTCCTT	0.652																																																	0													220.0	104.0	143.0					8																	145095594		2203	4300	6503	SO:0001583	missense	0			BC053547	CCDS6413.2, CCDS47937.1	8q24.3	2005-01-11			ENSG00000186583	ENSG00000186583			30510	protein-coding gene	gene with protein product		610874				15280373	Standard	NM_198572		Approved	MGC61633, SPATA15, SPERIOLIN	uc011lkw.2	Q76KD6	OTTHUMG00000156976	ENST00000377470.3:c.892G>A	8.37:g.145095594G>A	ENSP00000366690:p.Ala298Thr		B4DWW9|Q5U5I8|Q7Z6L7	Missense_Mutation	SNP	NULL	p.A298T	ENST00000377470.3	37	c.892	CCDS6413.2	8	.	.	.	.	.	.	.	.	.	.	G	11.72	1.723276	0.30503	.	.	ENSG00000186583	ENST00000377470;ENST00000447830	T	0.48836	0.8	4.33	3.43	0.39272	.	0.204155	0.24580	N	0.037312	T	0.39759	0.1090	L	0.33485	1.01	0.09310	N	1	P;P	0.50156	0.932;0.884	P;B	0.50352	0.638;0.219	T	0.15037	-1.0451	10	0.14252	T	0.57	.	7.6507	0.28346	0.1251:0.0:0.8749:0.0	.	298;298	B4DWW9;Q76KD6	.;SPERI_HUMAN	T	298	ENSP00000366690:A298T	ENSP00000366690:A298T	A	+	1	0	SPATC1	145167582	0.038000	0.19896	0.040000	0.18447	0.031000	0.12232	0.722000	0.25925	0.908000	0.36671	0.558000	0.71614	GCC	SPATC1	-	NULL	ENSG00000186583		0.652	SPATC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATC1	HGNC	protein_coding	OTTHUMT00000346926.1		0.00	68	0	G	NM_198572		145095594	+1			no_errors	ENST00000377470	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.037	A
SPIN4	139886	genome.wustl.edu	37	X	62570563	62570563	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:62570563G>T	ENST00000335144.3	-	1	655	c.136C>A	c.(136-138)Caa>Aaa	p.Q46K	SPIN4_ENST00000374884.2_Missense_Mutation_p.Q28K|SPIN4-AS1_ENST00000451979.1_RNA	NM_001012968.2	NP_001012986.2	Q56A73	SPIN4_HUMAN	spindlin family, member 4	46					gamete generation (GO:0007276)					endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	11						CAGCCGTGTTGAATGCGGCAG	0.542																																																	0													42.0	42.0	42.0					X																	62570563		2065	4174	6239	SO:0001583	missense	0			AK126931	CCDS43964.1	Xq11.1	2008-02-05			ENSG00000186767	ENSG00000186767			27040	protein-coding gene	gene with protein product						12477932	Standard	NM_001012968		Approved	FLJ44984	uc004dvf.3	Q56A73	OTTHUMG00000021696	ENST00000335144.3:c.136C>A	X.37:g.62570563G>T	ENSP00000334163:p.Gln46Lys		B3KX90|Q5JUL2	Missense_Mutation	SNP	pfam_Spin_Ssty	p.Q46K	ENST00000335144.3	37	c.136	CCDS43964.1	X	.	.	.	.	.	.	.	.	.	.	.	24.9	4.587025	0.86851	.	.	ENSG00000186767	ENST00000374884;ENST00000335144	T;T	0.47869	0.83;0.83	3.9	3.9	0.45041	.	0.000000	0.64402	D	0.000001	T	0.55909	0.1950	M	0.72894	2.215	0.54753	D	0.999986	P	0.51653	0.947	P	0.50570	0.644	T	0.63484	-0.6627	10	0.72032	D	0.01	-33.3085	12.9049	0.58145	0.0:0.0:1.0:0.0	.	46	Q56A73	SPIN4_HUMAN	K	28;46	ENSP00000364018:Q28K;ENSP00000334163:Q46K	ENSP00000334163:Q46K	Q	-	1	0	SPIN4	62487288	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.908000	0.87438	2.203000	0.70933	0.422000	0.28245	CAA	SPIN4	-	pfam_Spin_Ssty	ENSG00000186767		0.542	SPIN4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIN4	HGNC	protein_coding		-	0.00	55	0	G	NM_001012968		62570563	-1	tier1	-	no_errors	ENST00000335144	ensembl	human	known	74_37	missense	18.75	38	9	SNP	1.000	T
SPTBN5	51332	genome.wustl.edu	37	15	42144894	42144894	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr15:42144894G>T	ENST00000320955.6	-	61	10614	c.10387C>A	c.(10387-10389)Cag>Aag	p.Q3463K	RNA5SP393_ENST00000363423.1_RNA	NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	3463					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		TCTAAGTCCTGGTGTCTGTGC	0.602																																																	0													161.0	175.0	170.0					15																	42144894		2040	4195	6235	SO:0001583	missense	0			AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.10387C>A	15.37:g.42144894G>T	ENSP00000317790:p.Gln3463Lys			Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.Q3463K	ENST00000320955.6	37	c.10387		15	.	.	.	.	.	.	.	.	.	.	.	12.29	1.893786	0.33442	.	.	ENSG00000137877	ENST00000320955	T	0.44482	0.92	4.73	-2.47	0.06442	.	1.149070	0.06488	N	0.734113	T	0.28433	0.0703	L	0.27053	0.805	0.09310	N	0.999999	B	0.15141	0.012	B	0.17433	0.018	T	0.29941	-0.9995	10	0.17832	T	0.49	.	10.7168	0.46017	0.0:0.5134:0.2177:0.2688	.	3463	Q9NRC6	SPTN5_HUMAN	K	3463	ENSP00000317790:Q3463K	ENSP00000317790:Q3463K	Q	-	1	0	SPTBN5	39932186	0.816000	0.29132	0.039000	0.18376	0.989000	0.77384	0.536000	0.23129	-0.960000	0.03613	0.655000	0.94253	CAG	SPTBN5	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000137877		0.602	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	SPTBN5	HGNC	protein_coding	OTTHUMT00000420237.1	-	0.00	50	0	G	NM_016642		42144894	-1	tier1	-	no_errors	ENST00000320955	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.346	T
SSTR5	6755	genome.wustl.edu	37	16	1129139	1129140	+	In_Frame_Ins	INS	-	-	TGT			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr16:1129139_1129140insTGT	ENST00000293897.4	+	1	359_360	c.271_272insTGT	c.(271-273)ctg>cTGTtg	p.91_91L>LL	SSTR5_ENST00000562758.1_In_Frame_Ins_p.91_91L>LL|SSTR5_ENST00000397547.2_In_Frame_Ins_p.91_91L>LL|SSTR5-AS1_ENST00000569832.1_RNA	NM_001053.3	NP_001044.1	P35346	SSR5_HUMAN	somatostatin receptor 5	91					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytokinesis (GO:0032467)|regulation of insulin secretion (GO:0050796)|somatostatin signaling pathway (GO:0038170)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			endometrium(2)|lung(5)|prostate(1)|skin(1)	9		Hepatocellular(780;0.00369)			Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	CCTGTACATGCTGGGGCTGCCT	0.619																																																	0																																										SO:0001652	inframe_insertion	0			D16827	CCDS10429.1	16p13.3	2012-08-08			ENSG00000162009	ENSG00000162009		"""GPCR / Class A : Somatostatin receptors"""	11334	protein-coding gene	gene with protein product		182455				7607700	Standard	NM_001053		Approved		uc021taf.1	P35346	OTTHUMG00000047842	Exception_encountered	16.37:g.1129139_1129140insTGT	ENSP00000293897:p.Leu91dup		P34988|Q541E0|Q9UJI5	In_Frame_Ins	INS	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Somatstn_rcpt_5,prints_Somatstn_rcpt,prints_Opioid_rcpt,prints_NPY_rcpt	p.92in_frame_insL	ENST00000293897.4	37	c.271_272	CCDS10429.1	16																																																																																			SSTR5	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000162009		0.619	SSTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSTR5	HGNC	protein_coding	OTTHUMT00000420836.1		0.00	49	0	-			1129140	+1	tier1		no_errors	ENST00000293897	ensembl	human	known	74_37	in_frame_ins	20.45	35	9	INS	0.998:1.000	TGT
ST14	6768	genome.wustl.edu	37	11	130058798	130058798	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:130058798G>T	ENST00000278742.5	+	4	822	c.404G>T	c.(403-405)gGc>gTc	p.G135V		NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)	135	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	CCATTCCTGGGCCCCTACCAC	0.642																																																	0													43.0	40.0	41.0					11																	130058798		2201	4297	6498	SO:0001583	missense	0			AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	ENST00000278742.5:c.404G>T	11.37:g.130058798G>T	ENSP00000278742:p.Gly135Val		Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Missense_Mutation	SNP	pirsf_Peptidase_S1A_matripase,pfam_Peptidase_S1,pfam_LDrepeatLR_classA_rpt,pfam_CUB_dom,pfam_SEA_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1,prints_LDrepeatLR_classA_rpt,prints_Peptidase_S1A,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1	p.G135V	ENST00000278742.5	37	c.404	CCDS8487.1	11	.	.	.	.	.	.	.	.	.	.	G	19.06	3.754125	0.69648	.	.	ENSG00000149418	ENST00000278742	T	0.37411	1.2	5.5	5.5	0.81552	SEA (1);	0.000000	0.38837	N	0.001556	T	0.56455	0.1986	M	0.72894	2.215	0.80722	D	1	D	0.57257	0.979	P	0.58660	0.843	T	0.59616	-0.7421	10	0.72032	D	0.01	.	17.1709	0.86830	0.0:0.0:1.0:0.0	.	135	Q9Y5Y6	ST14_HUMAN	V	135	ENSP00000278742:G135V	ENSP00000278742:G135V	G	+	2	0	ST14	129564008	0.995000	0.38212	1.000000	0.80357	0.667000	0.39255	2.409000	0.44583	2.583000	0.87209	0.561000	0.74099	GGC	ST14	-	pirsf_Peptidase_S1A_matripase,pfam_SEA_dom	ENSG00000149418		0.642	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST14	HGNC	protein_coding	OTTHUMT00000386119.1	-	0.00	67	0	G			130058798	+1	tier1	-	no_errors	ENST00000278742	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
STAM2	10254	genome.wustl.edu	37	2	153004816	153004817	+	Splice_Site	INS	-	-	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:153004816_153004817insA	ENST00000263904.4	-	3	475		c.e3-2		STAM2_ENST00000465460.1_Splice_Site	NM_005843.4	NP_005834.4	O75886	STAM2_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 2						endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(3)|large_intestine(4)|lung(8)|ovary(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.22)		TCTTTCGCTCTAAAAAAAAAAA	0.297																																																	0																																										SO:0001630	splice_region_variant	0			AF042274	CCDS2196.1	2q23.3	2009-04-29			ENSG00000115145	ENSG00000115145			11358	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	606244				10899310, 10993906	Standard	NM_005843		Approved	Hbp	uc002tyc.4	O75886	OTTHUMG00000131885	ENST00000263904.4:c.126-2->T	2.37:g.153004827_153004827dupA			A8K8A0|D3DPA1|Q7LDQ0|Q9UF58	Splice_Site	INS	-	e3-2	ENST00000263904.4	37	c.126-3_126-2	CCDS2196.1	2																																																																																			STAM2	-	-	ENSG00000115145		0.297	STAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAM2	HGNC	protein_coding	OTTHUMT00000254835.2		0.00	28	0	-	NM_005843	Intron	153004817	-1	tier1		no_errors	ENST00000263904	ensembl	human	known	74_37	splice_site_ins	7.14	26	2	INS	1.000:0.002	A
STAU2	27067	genome.wustl.edu	37	8	74332341	74332341	+	IGR	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr8:74332341G>C	ENST00000524300.1	-	0	3065				STAU2-AS1_ENST00000517604.1_lincRNA	NM_001164380.1|NM_001164381.1	NP_001157852.1|NP_001157853.1	Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2						transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			ATGTTGGGTCGAGCAGTTAGA	0.433																																																	0																																										SO:0001628	intergenic_variant	0			Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499		8.37:g.74332341G>C			B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	RNA	SNP	-	NULL	ENST00000524300.1	37	NULL	CCDS55247.1	8																																																																																			STAU2-AS1	-	-	ENSG00000253302		0.433	STAU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAU2-AS1	HGNC	protein_coding	OTTHUMT00000379000.2	-	0.00	48	0	G	NM_001164380		74332341	+1	tier1	-	no_errors	ENST00000517604	ensembl	human	known	74_37	rna	26.83	30	11	SNP	0.991	C
STK11	6794	genome.wustl.edu	37	19	1206968	1206968	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:1206968C>T	ENST00000326873.7	+	1	1229	c.56C>T	c.(55-57)tCg>tTg	p.S19L	STK11_ENST00000585748.1_Intron	NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	19					activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(3)|p.S19*(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGCTGATGTCGGTGGGTATG	0.662		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	serine/threonine kinase 11 gene (LKB1)		"""E, M, O"""	24	Whole gene deletion(20)|Unknown(2)|Substitution - Nonsense(1)|Deletion - Frameshift(1)	cervix(16)|lung(3)|skin(1)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)											21.0	24.0	23.0					19																	1206968		2065	4199	6264	SO:0001583	missense	0	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.56C>T	19.37:g.1206968C>T	ENSP00000324856:p.Ser19Leu		B2RBX7|E7EW76	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S19L	ENST00000326873.7	37	c.56	CCDS45896.1	19	.	.	.	.	.	.	.	.	.	.	C	20.2	3.942120	0.73672	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	D	0.87729	-2.29	3.9	3.9	0.45041	.	0.000000	0.51477	D	0.000089	T	0.81143	0.4761	L	0.44542	1.39	0.44555	D	0.997514	B	0.32781	0.384	B	0.22152	0.038	T	0.81506	-0.0902	10	0.48119	T	0.1	-9.5019	14.9009	0.70678	0.0:1.0:0.0:0.0	.	19	Q15831	STK11_HUMAN	L	19	ENSP00000324856:S19L	ENSP00000324856:S19L	S	+	2	0	STK11	1157968	0.999000	0.42202	0.986000	0.45419	0.991000	0.79684	5.094000	0.64523	1.733000	0.51620	0.462000	0.41574	TCG	STK11	-	NULL	ENSG00000118046		0.662	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	STK11	HGNC	protein_coding	OTTHUMT00000449839.3		0.00	40	0	C	NM_000455		1206968	+1			no_errors	ENST00000326873	ensembl	human	known	74_37	missense	9.09	20	2	SNP	0.997	T
SUPT6H	6830	genome.wustl.edu	37	17	27002162	27002162	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr17:27002162G>T	ENST00000314616.6	+	5	803	c.520G>T	c.(520-522)Gaa>Taa	p.E174*	SUPT6H_ENST00000347486.4_Nonsense_Mutation_p.E174*|AC010761.13_ENST00000578819.1_RNA	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	174	Asp/Glu-rich.|Interaction with IWS1. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GGAGGAGGAAGAAGATGATGA	0.522																																																	0													66.0	70.0	69.0					17																	27002162		2203	4300	6503	SO:0001587	stop_gained	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.520G>T	17.37:g.27002162G>T	ENSP00000319104:p.Glu174*		A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Nonsense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_SH2,superfamily_NA-bd_OB-fold,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,smart_SH2,pirsf_TF_Spt6,pfscan_SH2,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.E174*	ENST00000314616.6	37	c.520	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	G	38	6.854401	0.97889	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-12.4494	20.0706	0.97721	0.0:0.0:1.0:0.0	.	.	.	.	X	174	.	ENSP00000319104:E174X	E	+	1	0	SUPT6H	24026289	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.010000	0.93611	2.744000	0.94065	0.655000	0.94253	GAA	SUPT6H	-	pirsf_TF_Spt6	ENSG00000109111		0.522	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SUPT6H	HGNC	protein_coding	OTTHUMT00000446422.2		0.00	11	0	G	NM_003170		27002162	+1			no_errors	ENST00000314616	ensembl	human	known	74_37	nonsense	7.14	26	2	SNP	1.000	T
SUPT7L	9913	genome.wustl.edu	37	2	27883883	27883883	+	Silent	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:27883883G>T	ENST00000337768.5	-	3	956	c.387C>A	c.(385-387)atC>atA	p.I129I	SLC4A1AP_ENST00000326019.6_5'Flank|SUPT7L_ENST00000405491.1_Silent_p.I127I|SUPT7L_ENST00000406540.1_Silent_p.I127I|SUPT7L_ENST00000404798.2_Intron|SUPT7L_ENST00000464789.2_Silent_p.I127I	NM_001282729.1|NM_014860.1	NP_001269658.1|NP_055675.1	O94864	ST65G_HUMAN	suppressor of Ty 7 (S. cerevisiae)-like	129					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|maintenance of protein location in nucleus (GO:0051457)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)					CACTGTGCCGGATCTGGAATG	0.488																																																	0													93.0	94.0	94.0					2																	27883883		2009	4175	6184	SO:0001819	synonymous_variant	0			AF197954	CCDS42667.1, CCDS62885.1, CCDS62886.1	2p23.3	2008-02-05			ENSG00000119760	ENSG00000119760			30632	protein-coding gene	gene with protein product		612762				9872452, 11564863	Standard	NM_001282732		Approved	STAF65, gamma, KIAA0764, SPT7L	uc002rli.1	O94864	OTTHUMG00000151947	ENST00000337768.5:c.387C>A	2.37:g.27883883G>T			B4E3W3|Q6IB21|Q9H2T6	Silent	SNP	pfam_BTP,smart_BTP	p.I129	ENST00000337768.5	37	c.387	CCDS42667.1	2																																																																																			SUPT7L	-	NULL	ENSG00000119760		0.488	SUPT7L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT7L	HGNC	protein_coding	OTTHUMT00000324568.1	-	0.00	46	0	G	NM_014860		27883883	-1	tier1	-	no_errors	ENST00000337768	ensembl	human	known	74_37	silent	6.90	54	4	SNP	0.879	T
SUV420H1	51111	genome.wustl.edu	37	11	67934523	67934523	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:67934523C>T	ENST00000304363.4	-	10	1453	c.1100G>A	c.(1099-1101)aGc>aAc	p.S367N	SUV420H1_ENST00000402789.1_Missense_Mutation_p.S367N|SUV420H1_ENST00000401547.2_Missense_Mutation_p.S367N|SUV420H1_ENST00000405515.1_Missense_Mutation_p.S367N|SUV420H1_ENST00000402185.2_Missense_Mutation_p.S344N	NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	367					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						ATTTTTGCTGCTGTCACCTAA	0.403																																																	0													155.0	143.0	147.0					11																	67934523		2200	4294	6494	SO:0001583	missense	0			AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.1100G>A	11.37:g.67934523C>T	ENSP00000305899:p.Ser367Asn		B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.S367N	ENST00000304363.4	37	c.1100	CCDS31623.1	11	.	.	.	.	.	.	.	.	.	.	C	13.07	2.128262	0.37533	.	.	ENSG00000110066	ENST00000304363;ENST00000401547;ENST00000405515;ENST00000402789;ENST00000402185	T;T;T;T;T	0.48836	0.8;0.89;0.89;0.88;0.9	5.9	4.96	0.65561	.	0.095176	0.64402	D	0.000001	T	0.38692	0.1050	L	0.32530	0.975	0.58432	D	0.999994	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.06405	0.0;0.0;0.001;0.002	T	0.14811	-1.0459	10	0.45353	T	0.12	-12.7418	14.2086	0.65750	0.0:0.9261:0.0:0.0739	.	344;367;367;367	B7WNX0;B5MCB3;Q4FZB7-2;Q4FZB7	.;.;.;SV421_HUMAN	N	367;367;367;367;344	ENSP00000305899:S367N;ENSP00000385965:S367N;ENSP00000385640:S367N;ENSP00000385005:S367N;ENSP00000384724:S344N	ENSP00000305899:S367N	S	-	2	0	SUV420H1	67691099	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.783000	0.68982	1.430000	0.47334	0.650000	0.86243	AGC	SUV420H1	-	NULL	ENSG00000110066		0.403	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUV420H1	HGNC	protein_coding	OTTHUMT00000318319.1	-	0.00	63	0	C	NM_017635		67934523	-1	tier1	-	no_errors	ENST00000304363	ensembl	human	known	74_37	missense	20.37	43	11	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152730801	152730801	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:152730801G>T	ENST00000367255.5	-	43	6875	c.6274C>A	c.(6274-6276)Cag>Aag	p.Q2092K	RNA5SP223_ENST00000365174.1_RNA|SYNE1_ENST00000423061.1_Missense_Mutation_p.Q2099K|SYNE1_ENST00000448038.1_Missense_Mutation_p.Q2099K|SYNE1_ENST00000265368.4_Missense_Mutation_p.Q2092K|SYNE1_ENST00000341594.5_Missense_Mutation_p.Q2129K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2092					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTCAGGTTCTGATATTCTCTC	0.363										HNSCC(10;0.0054)																																							0													95.0	93.0	94.0					6																	152730801		2202	4300	6502	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.6274C>A	6.37:g.152730801G>T	ENSP00000356224:p.Gln2092Lys		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Q2092K	ENST00000367255.5	37	c.6274	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	23.8	4.464499	0.84425	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29	5.92	5.92	0.95590	.	0.000000	0.56097	D	0.000031	T	0.44685	0.1305	M	0.63843	1.955	0.80722	D	1	D;P;P;D	0.69078	0.997;0.835;0.917;0.99	D;B;B;P	0.77004	0.989;0.363;0.445;0.843	T	0.29366	-1.0014	10	0.06236	T	0.91	.	20.3343	0.98733	0.0:0.0:1.0:0.0	.	2075;2092;2092;2099	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	K	2092;2099;2092;2099;2129	ENSP00000356224:Q2092K;ENSP00000396024:Q2099K;ENSP00000265368:Q2092K;ENSP00000390975:Q2099K;ENSP00000341887:Q2129K	ENSP00000265368:Q2092K	Q	-	1	0	SYNE1	152772494	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.824000	0.99380	2.822000	0.97130	0.650000	0.86243	CAG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.363	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	23	0	G	NM_182961		152730801	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
SYNE2	23224	genome.wustl.edu	37	14	64532290	64532290	+	Silent	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr14:64532290G>T	ENST00000344113.4	+	51	10565	c.10353G>T	c.(10351-10353)ctG>ctT	p.L3451L	SYNE2_ENST00000554584.1_Silent_p.L3484L|SYNE2_ENST00000555002.1_Silent_p.L85L|SYNE2_ENST00000358025.3_Silent_p.L3451L|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3451					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGAAATGGCTGAGTTTGCTGG	0.443																																																	0													171.0	169.0	169.0					14																	64532290		1982	4172	6154	SO:0001819	synonymous_variant	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.10353G>T	14.37:g.64532290G>T			Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L3451	ENST00000344113.4	37	c.10353	CCDS41963.1	14																																																																																			SYNE2	-	NULL	ENSG00000054654		0.443	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	-	0.00	58	0	G	NM_182914		64532290	+1	tier1	-	no_errors	ENST00000358025	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.802	T
SYT7	9066	genome.wustl.edu	37	11	61286123	61286123	+	Silent	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:61286123G>T	ENST00000263846.4	-	9	1515	c.1188C>A	c.(1186-1188)gcC>gcA	p.A396A	SYT7_ENST00000542836.1_Silent_p.A440A|SYT7_ENST00000539008.1_Silent_p.A679A|SYT7_ENST00000535826.1_Silent_p.A515A|SYT7_ENST00000542670.1_Silent_p.A604A|SYT7_ENST00000540677.1_Silent_p.A471A	NM_004200.3	NP_004191.2	O43581	SYT7_HUMAN	synaptotagmin VII	396					exocytosis (GO:0006887)|plasma membrane repair (GO:0001778)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(4)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GGTGCCACTGGGCCACGGGCT	0.667																																																	0													29.0	26.0	27.0					11																	61286123		1792	3322	5114	SO:0001819	synonymous_variant	0			AF038535	CCDS31577.1, CCDS58139.1, CCDS73298.1	11q12-q13.1	2013-01-21			ENSG00000011347	ENSG00000011347		"""Synaptotagmins"""	11514	protein-coding gene	gene with protein product		604146	"""prostate cancer associated protein 7"""	PCANAP7		9615227	Standard	NM_001252065		Approved	IPCA-7, SYT-VII, MGC150517	uc009ynr.3	O43581	OTTHUMG00000168199	ENST00000263846.4:c.1188C>A	11.37:g.61286123G>T			F5GZU9|Q08AH6	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin,prints_C2_dom	p.A396	ENST00000263846.4	37	c.1188	CCDS31577.1	11																																																																																			SYT7	-	superfamily_C2_dom,smart_C2_dom	ENSG00000011347		0.667	SYT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT7	HGNC	protein_coding	OTTHUMT00000398733.1	-	0.00	82	0	G	NM_004200		61286123	-1	tier1	-	no_errors	ENST00000263846	ensembl	human	known	74_37	silent	14.94	74	13	SNP	1.000	T
TAF6L	10629	genome.wustl.edu	37	11	62549740	62549740	+	Silent	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:62549740C>A	ENST00000294168.3	+	8	963	c.762C>A	c.(760-762)atC>atA	p.I254I	TMEM223_ENST00000527073.1_Intron	NM_006473.3	NP_006464.1	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	254					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|histone H3 acetylation (GO:0043966)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	histone deacetylase complex (GO:0000118)|STAGA complex (GO:0030914)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			endometrium(2)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)	16						CTGCCTCCATCAACCCCCTGA	0.612																																																	0													81.0	82.0	82.0					11																	62549740		2201	4299	6500	SO:0001819	synonymous_variant	0			BC008785	CCDS8035.1	11q12.3	2008-02-01	2002-08-29		ENSG00000162227	ENSG00000162227			17305	protein-coding gene	gene with protein product		602946	"""TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425	Standard	NM_006473		Approved	PAF65A	uc001nvc.3	Q9Y6J9	OTTHUMG00000167610	ENST00000294168.3:c.762C>A	11.37:g.62549740C>A			B2RAT0|Q96HA6	Silent	SNP	pfam_TAF_TATA-bd,pfam_DUF1546,superfamily_Histone-fold,smart_TAF_TATA-bd	p.I254	ENST00000294168.3	37	c.762	CCDS8035.1	11																																																																																			TAF6L	-	pfam_DUF1546	ENSG00000162227		0.612	TAF6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF6L	HGNC	protein_coding	OTTHUMT00000395352.1		0.00	56	0	C	NM_006473		62549740	+1			no_errors	ENST00000294168	ensembl	human	known	74_37	silent	6.06	31	2	SNP	1.000	A
TAS2R30	259293	genome.wustl.edu	37	12	11286713	11286714	+	Missense_Mutation	DNP	AC	AC	TG	rs113799622		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A|C	A|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:11286713_11286714AC>TG	ENST00000539585.1	-	1	529_530	c.130_131GT>CA	c.(130-132)GTt>CAt	p.V44H	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	44					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						AATTTGGTCAACAAAGGAGATC	0.381																																																	0																																										SO:0001583	missense	0			AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.130_131delinsTG	12.37:g.11286713_11286714delinsTG	ENSP00000444736:p.Val44His		Q645X7	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.V44D|p.V44L	ENST00000539585.1	37	c.131|c.130	CCDS53750.1	12																																																																																			TAS2R30	-	pfam_TAS2_rcpt	ENSG00000256188		0.381	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R30	HGNC	protein_coding	OTTHUMT00000400238.1	-	0.00	74	0	A|C	NM_001097643		11286713|11286714	-1	tier1	-	no_errors	ENST00000539585	ensembl	human	known	74_37	missense	28.38|29.33	53	21|22	SNP	0.000	T|G
TBC1D32	221322	genome.wustl.edu	37	6	121655552	121655552	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:121655552G>T	ENST00000398212.2	-	1	74	c.25C>A	c.(25-27)Cag>Aag	p.Q9K	TBC1D32_ENST00000275159.6_Missense_Mutation_p.Q9K	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	9					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										agcatcgcctgGTCCTCGCTG	0.582																																																	0													43.0	45.0	44.0					6																	121655552		2015	4180	6195	SO:0001583	missense	0			AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.25C>A	6.37:g.121655552G>T	ENSP00000381270:p.Gln9Lys		Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Missense_Mutation	SNP	NULL	p.Q9K	ENST00000398212.2	37	c.25	CCDS43501.1	6	.	.	.	.	.	.	.	.	.	.	G	10.32	1.316524	0.23908	.	.	ENSG00000146350	ENST00000275159;ENST00000398212;ENST00000422369	T;T;T	0.41400	2.32;2.32;1.0	5.25	3.46	0.39613	.	.	.	.	.	T	0.16171	0.0389	N	0.22421	0.69	0.23731	N	0.996997	B	0.11235	0.004	B	0.13407	0.009	T	0.33189	-0.9878	9	0.62326	D	0.03	.	15.5419	0.76057	0.0:0.6996:0.3004:0.0	.	9	Q96NH3	BROMI_HUMAN	K	9	ENSP00000275159:Q9K;ENSP00000381270:Q9K;ENSP00000397993:Q9K	ENSP00000275159:Q9K	Q	-	1	0	C6orf170	121697251	1.000000	0.71417	0.111000	0.21465	0.034000	0.12701	3.197000	0.51028	0.761000	0.33130	0.313000	0.20887	CAG	TBC1D32	-	NULL	ENSG00000146350		0.582	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	TBC1D32	HGNC	protein_coding	OTTHUMT00000380937.2	-	0.00	59	0	G	NM_152730		121655552	-1	tier1	-	no_errors	ENST00000464622	ensembl	human	known	74_37	missense	41.03	23	16	SNP	0.999	T
TCERG1	10915	genome.wustl.edu	37	5	145834808	145834808	+	Silent	SNP	A	A	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:145834808A>G	ENST00000296702.5	+	2	287	c.249A>G	c.(247-249)ggA>ggG	p.G83G	TCERG1_ENST00000394421.2_Silent_p.G83G	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	83	Pro-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTCCTCCAGGAGGGATACCTC	0.507																																																	0													83.0	85.0	84.0					5																	145834808		2203	4300	6503	SO:0001819	synonymous_variant	0			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.249A>G	5.37:g.145834808A>G			Q2NKN2|Q59EA1	Silent	SNP	pfam_FF_domain,pfam_WW_dom,superfamily_FF_domain,superfamily_WW_dom,smart_WW_dom,smart_FF_domain,pfscan_WW_dom	p.G83	ENST00000296702.5	37	c.249	CCDS4282.1	5																																																																																			TCERG1	-	NULL	ENSG00000113649		0.507	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCERG1	HGNC	protein_coding	OTTHUMT00000251886.1	-	0.00	70	0	A	NM_001040006		145834808	+1	tier1	-	no_errors	ENST00000296702	ensembl	human	known	74_37	silent	31.58	39	18	SNP	0.999	G
TENC1	23371	genome.wustl.edu	37	12	53457660	53457660	+	Frame_Shift_Del	DEL	A	A	-			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:53457660delA	ENST00000314250.6	+	29	4514	c.4224delA	c.(4222-4224)agafs	p.R1408fs	TENC1_ENST00000451358.1_Frame_Shift_Del_p.R1398fs|TENC1_ENST00000314276.3_Frame_Shift_Del_p.R1418fs|TENC1_ENST00000549700.1_Frame_Shift_Del_p.R1343fs|TENC1_ENST00000546602.1_Frame_Shift_Del_p.R1311fs|TENC1_ENST00000552570.1_Frame_Shift_Del_p.R1406fs|TENC1_ENST00000379902.3_Frame_Shift_Del_p.R1284fs	NM_170754.2	NP_736610.2	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase (tensin 2)	1408					cellular homeostasis (GO:0019725)|collagen metabolic process (GO:0032963)|intracellular signal transduction (GO:0035556)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|response to muscle activity (GO:0014850)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(19)|ovary(1)|pancreas(1)|stomach(3)	34						TGGGCCAGAGAAAATGAAGGA	0.592																																																	0													86.0	88.0	87.0					12																	53457660		2203	4300	6503	SO:0001589	frameshift_variant	0			AF518729	CCDS8842.1, CCDS8843.1, CCDS8844.1	12q13.13	2013-02-14	2004-03-05			ENSG00000111077		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	19737	protein-coding gene	gene with protein product	"""tensin 2"""	607717	"""tensin like C1 domain-containing phosphatase"""				Standard	NM_015319		Approved	KIAA1075, C1-TEN, TNS2	uc001sbp.3	Q63HR2	OTTHUMG00000169730	ENST00000314250.6:c.4224delA	12.37:g.53457660delA	ENSP00000319684:p.Arg1408fs		A2VDF2|A2VDF3|A2VDI8|A5PKY4|Q2NL80|Q76MW6|Q7Z5T9|Q8NFF9|Q8NFG0|Q96P25|Q9NT29|Q9UPS7	Frame_Shift_Del	DEL	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH2,smart_PTB/PI_dom,pfscan_SH2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.K1419fs	ENST00000314250.6	37	c.4254	CCDS8843.1	12																																																																																			TENC1	-	smart_PTB/PI_dom	ENSG00000111077		0.592	TENC1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	TENC1	HGNC	protein_coding	OTTHUMT00000405779.1		0.00	29	0	A	NM_170754		53457660	+1	tier1		no_errors	ENST00000314276	ensembl	human	known	74_37	frame_shift_del	8.33	22	2	DEL	0.996	-
TINAG	27283	genome.wustl.edu	37	6	54212285	54212285	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr6:54212285A>G	ENST00000259782.4	+	6	965	c.869A>G	c.(868-870)gAt>gGt	p.D290G		NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	290					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			GGAAGCATCGATAGGGCTTGG	0.428																																																	0													100.0	88.0	92.0					6																	54212285		2203	4300	6503	SO:0001583	missense	0			AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.869A>G	6.37:g.54212285A>G	ENSP00000259782:p.Asp290Gly		Q5T467|Q9UJW1|Q9ULZ4	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,pfam_Somatomedin_B_dom,smart_Somatomedin_B_dom,smart_Peptidase_C1A_C,pfscan_Somatomedin_B_dom	p.D290G	ENST00000259782.4	37	c.869	CCDS4955.1	6	.	.	.	.	.	.	.	.	.	.	A	26.3	4.728047	0.89390	.	.	ENSG00000137251	ENST00000259782	D	0.84516	-1.86	5.77	5.77	0.91146	Peptidase C1A, papain C-terminal (2);	0.000000	0.64402	D	0.000001	D	0.86372	0.5917	L	0.47190	1.495	0.80722	D	1	D	0.76494	0.999	D	0.66847	0.947	D	0.86224	0.1633	10	0.39692	T	0.17	.	14.9308	0.70914	1.0:0.0:0.0:0.0	.	290	Q9UJW2	TINAG_HUMAN	G	290	ENSP00000259782:D290G	ENSP00000259782:D290G	D	+	2	0	TINAG	54320244	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	5.601000	0.67606	2.203000	0.70933	0.482000	0.46254	GAT	TINAG	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C	ENSG00000137251		0.428	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TINAG	HGNC	protein_coding	OTTHUMT00000040984.1	-	0.00	67	0	A	NM_014464		54212285	+1	tier1	-	no_errors	ENST00000259782	ensembl	human	known	74_37	missense	53.85	24	28	SNP	1.000	G
TLE2	7089	genome.wustl.edu	37	19	3006510	3006510	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:3006510G>C	ENST00000262953.6	-	15	1670	c.1408C>G	c.(1408-1410)Cag>Gag	p.Q470E	TLE2_ENST00000443826.3_Missense_Mutation_p.Q348E|TLE2_ENST00000591529.1_Missense_Mutation_p.Q484E|TLE2_ENST00000590536.1_Missense_Mutation_p.Q471E|TLE2_ENST00000447365.2_Missense_Mutation_p.Q137E|TLE2_ENST00000586422.1_Intron|TLE2_ENST00000455444.2_Missense_Mutation_p.Q348E|TLE2_ENST00000426948.2_Missense_Mutation_p.Q484E	NM_003260.4	NP_003251.2	Q04725	TLE2_HUMAN	transducin-like enhancer of split 2	470					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TACACATGCTGTGTGGAGCCG	0.706																																																	0													14.0	17.0	16.0					19																	3006510		2102	4229	6331	SO:0001583	missense	0			M99436	CCDS45911.1, CCDS45912.1, CCDS45913.1, CCDS74255.1	19p13.3	2014-03-07	2014-03-07					"""WD repeat domain containing"""	11838	protein-coding gene	gene with protein product	"""enhancer of split groucho 2"""	601041	"""transducin-like enhancer of split 2, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)"""			8808280	Standard	NM_003260		Approved	ESG2, GRG2, ESG, FLJ41188	uc002lww.3	Q04725		ENST00000262953.6:c.1408C>G	19.37:g.3006510G>C	ENSP00000262953:p.Gln470Glu		B4DE03|E9PEV7|F8WCH2|Q8WVY0|Q9Y6S0	Missense_Mutation	SNP	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Groucho_enhance,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q470E	ENST00000262953.6	37	c.1408	CCDS45911.1	19	.	.	.	.	.	.	.	.	.	.	G	17.83	3.485253	0.63962	.	.	ENSG00000065717	ENST00000262953;ENST00000455444;ENST00000360654;ENST00000450017;ENST00000447365;ENST00000443826;ENST00000426948	T;T;T;T;T	0.11277	2.79;2.79;2.79;2.79;2.79	3.7	3.7	0.42460	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.060200	0.64402	D	0.000002	T	0.06371	0.0164	N	0.14661	0.345	0.33892	D	0.637488	B;B;P;B;B	0.38992	0.22;0.151;0.653;0.22;0.22	B;B;B;B;B	0.35114	0.085;0.063;0.196;0.122;0.122	T	0.18935	-1.0321	10	0.87932	D	0	-15.3824	10.0821	0.42395	0.0:0.0:0.7988:0.2012	.	348;137;484;348;470	E9PEV7;B4DE62;F8WCH2;B4DE03;Q04725	.;.;.;.;TLE2_HUMAN	E	470;348;17;464;137;348;484	ENSP00000262953:Q470E;ENSP00000413107:Q348E;ENSP00000406523:Q137E;ENSP00000392427:Q348E;ENSP00000392869:Q484E	ENSP00000262953:Q470E	Q	-	1	0	TLE2	2957510	1.000000	0.71417	0.994000	0.49952	0.901000	0.52897	4.538000	0.60650	2.074000	0.62210	0.456000	0.33151	CAG	TLE2	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000065717		0.706	TLE2-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	TLE2	HGNC	protein_coding	OTTHUMT00000452194.2	-	0.00	114	0	G	NM_003260		3006510	-1	tier1	-	no_errors	ENST00000262953	ensembl	human	known	74_37	missense	34.48	38	20	SNP	0.999	C
TLN2	83660	genome.wustl.edu	37	15	62945485	62945485	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr15:62945485G>T	ENST00000561311.1	+	6	719	c.489G>T	c.(487-489)ttG>ttT	p.L163F	TLN2_ENST00000306829.6_Missense_Mutation_p.L163F			Q9Y4G6	TLN2_HUMAN	talin 2	163	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						TGGAGAAGTTGAAGGCCAAGC	0.458																																																	0													108.0	87.0	94.0					15																	62945485		2203	4300	6503	SO:0001583	missense	0			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.489G>T	15.37:g.62945485G>T	ENSP00000453508:p.Leu163Phe		A6NLB8	Missense_Mutation	SNP	pfam_Talin_cent,pfam_ILWEQ_dom,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.L163F	ENST00000561311.1	37	c.489	CCDS32261.1	15	.	.	.	.	.	.	.	.	.	.	G	19.48	3.834962	0.71373	.	.	ENSG00000171914	ENST00000306829	T	0.73575	-0.76	5.95	2.56	0.30785	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.000000	0.64402	D	0.000001	D	0.84197	0.5419	M	0.87682	2.9	0.53688	D	0.99997	D	0.89917	1.0	D	0.97110	1.0	T	0.82564	-0.0394	10	0.87932	D	0	-11.7437	4.7708	0.13155	0.1477:0.1216:0.606:0.1247	.	163	Q9Y4G6	TLN2_HUMAN	F	163	ENSP00000303476:L163F	ENSP00000303476:L163F	L	+	3	2	TLN2	60732777	0.978000	0.34361	0.998000	0.56505	0.998000	0.95712	0.146000	0.16180	0.826000	0.34661	0.655000	0.94253	TTG	TLN2	-	pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000171914		0.458	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2	-	0.00	42	0	G			62945485	+1	tier1	-	no_errors	ENST00000306829	ensembl	human	known	74_37	missense	18.97	47	11	SNP	1.000	T
TMEM145	284339	genome.wustl.edu	37	19	42821103	42821103	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:42821103C>G	ENST00000301204.3	+	11	929	c.888C>G	c.(886-888)atC>atG	p.I296M	TMEM145_ENST00000598766.1_Missense_Mutation_p.I320M	NM_173633.2	NP_775904.2	Q8NBT3	TM145_HUMAN	transmembrane protein 145	296					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	27		Prostate(69;0.00682)				TGCTGCTCATCTACGAGGCGG	0.662																																																	0													47.0	36.0	40.0					19																	42821103		2203	4300	6503	SO:0001583	missense	0			AK075286	CCDS12603.1	19q13.2	2008-02-05				ENSG00000167619			26912	protein-coding gene	gene with protein product							Standard	NM_173633		Approved	FLJ90805	uc002otk.1	Q8NBT3		ENST00000301204.3:c.888C>G	19.37:g.42821103C>G	ENSP00000301204:p.Ile296Met			Missense_Mutation	SNP	pfam_Intimal_thickness-rel_rcpt	p.I296M	ENST00000301204.3	37	c.888	CCDS12603.1	19	.	.	.	.	.	.	.	.	.	.	C	11.97	1.796640	0.31777	.	.	ENSG00000167619	ENST00000301204	T	0.52057	0.68	3.98	1.83	0.25207	Rhodopsin-like GPCR transmembrane domain (1);	0.386473	0.21090	N	0.080333	T	0.45337	0.1337	M	0.73962	2.25	0.45515	D	0.998476	B	0.33044	0.395	B	0.37943	0.261	T	0.36866	-0.9730	10	0.54805	T	0.06	-22.3788	3.8146	0.08811	0.1897:0.5967:0.0:0.2136	.	296	Q8NBT3	TM145_HUMAN	M	296	ENSP00000301204:I296M	ENSP00000301204:I296M	I	+	3	3	TMEM145	47512943	1.000000	0.71417	1.000000	0.80357	0.355000	0.29361	1.783000	0.38664	0.288000	0.22398	-0.362000	0.07510	ATC	TMEM145	-	pfam_Intimal_thickness-rel_rcpt	ENSG00000167619		0.662	TMEM145-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM145	HGNC	protein_coding	OTTHUMT00000463737.1		0.00	61	0	C	NM_173633		42821103	+1			no_errors	ENST00000301204	ensembl	human	known	74_37	missense	10.71	25	3	SNP	1.000	G
TMEM45A	55076	genome.wustl.edu	37	3	100295818	100295818	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:100295818C>G	ENST00000323523.4	+	6	1097	c.784C>G	c.(784-786)Ctg>Gtg	p.L262V	TMEM45A_ENST00000403410.1_Missense_Mutation_p.L278V	NM_018004.1	NP_060474.1	Q9NWC5	TM45A_HUMAN	transmembrane protein 45A	262						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)	11						AGTTGGACTTCTGAAAAATGC	0.358																																																	0													103.0	111.0	108.0					3																	100295818		2203	4300	6503	SO:0001583	missense	0			AK000996	CCDS2937.1	3q12.2	2005-02-04			ENSG00000181458	ENSG00000181458			25480	protein-coding gene	gene with protein product						12477932	Standard	XM_005247568		Approved	FLJ10134, DERP7	uc003dtz.1	Q9NWC5	OTTHUMG00000150327	ENST00000323523.4:c.784C>G	3.37:g.100295818C>G	ENSP00000319009:p.Leu262Val		Q53YW5	Missense_Mutation	SNP	pfam_DUF716_TMEM45	p.L262V	ENST00000323523.4	37	c.784	CCDS2937.1	3	.	.	.	.	.	.	.	.	.	.	C	15.85	2.954821	0.53293	.	.	ENSG00000181458	ENST00000323523;ENST00000403410	T;T	0.34667	1.39;1.35	5.91	5.03	0.67393	.	0.000000	0.64402	D	0.000002	T	0.53818	0.1820	M	0.68952	2.095	0.48452	D	0.99965	D	0.76494	0.999	D	0.80764	0.994	T	0.43032	-0.9416	10	0.25751	T	0.34	-9.7734	11.6326	0.51185	0.0:0.918:0.0:0.082	.	262	Q9NWC5	TM45A_HUMAN	V	262;278	ENSP00000319009:L262V;ENSP00000385089:L278V	ENSP00000319009:L262V	L	+	1	2	TMEM45A	101778508	1.000000	0.71417	1.000000	0.80357	0.361000	0.29550	2.289000	0.43523	2.793000	0.96121	0.655000	0.94253	CTG	TMEM45A	-	NULL	ENSG00000181458		0.358	TMEM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM45A	HGNC	protein_coding	OTTHUMT00000317571.1	-	0.00	26	0	C	NM_018004		100295818	+1	tier1	-	no_errors	ENST00000323523	ensembl	human	known	74_37	missense	36.73	31	18	SNP	1.000	G
TMEM57	55219	genome.wustl.edu	37	1	25785138	25785138	+	Silent	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:25785138G>T	ENST00000374343.4	+	6	1088	c.909G>T	c.(907-909)gtG>gtT	p.V303V	TMEM57_ENST00000470035.1_3'UTR|TMEM57_ENST00000399766.3_Intron|TMEM57_ENST00000399763.3_Intron	NM_018202.4	NP_060672.2	Q8N5G2	MACOI_HUMAN	transmembrane protein 57	303					brain development (GO:0007420)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|synapse (GO:0045202)				breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		ATGATCTTGTGGGAAGTACAG	0.328																																																	0													85.0	91.0	89.0					1																	25785138		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001609	CCDS30638.1, CCDS60034.1	1p36.11	2008-02-05			ENSG00000204178	ENSG00000204178			25572	protein-coding gene	gene with protein product		610301				12459264, 15255972	Standard	XM_005245931		Approved	FLJ10747	uc001bkk.3	Q8N5G2	OTTHUMG00000003473	ENST00000374343.4:c.909G>T	1.37:g.25785138G>T			B1AK00|Q2TLX5|Q2TLX6|Q9NVG6	Silent	SNP	pfam_Macoilin,superfamily_Prefoldin	p.V303	ENST00000374343.4	37	c.909	CCDS30638.1	1																																																																																			TMEM57	-	pfam_Macoilin	ENSG00000204178		0.328	TMEM57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM57	HGNC	protein_coding	OTTHUMT00000009659.2		0.00	14	0	G	NM_018202		25785138	+1			no_errors	ENST00000374343	ensembl	human	known	74_37	silent	5.56	34	2	SNP	1.000	T
TOLLIP	54472	genome.wustl.edu	37	11	1307298	1307298	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:1307298G>A	ENST00000317204.6	-	5	667	c.544C>T	c.(544-546)Cca>Tca	p.P182S	TOLLIP_ENST00000527886.1_Missense_Mutation_p.P113S|TOLLIP_ENST00000525159.1_Missense_Mutation_p.P121S|TOLLIP_ENST00000542915.1_Missense_Mutation_p.P132S|TOLLIP_ENST00000528719.1_5'Flank|TOLLIP_ENST00000263646.7_Missense_Mutation_p.P154S|TOLLIP_ENST00000527938.1_Intron	NM_019009.3	NP_061882.2	Q9H0E2	TOLIP_HUMAN	toll interacting protein	182					autophagy (GO:0006914)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|leukocyte activation (GO:0045321)|phosphorylation (GO:0016310)|positive regulation of protein sumoylation (GO:0033235)|protein localization to endosome (GO:0036010)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|interleukin-1 receptor complex (GO:0045323)|interleukin-18 receptor complex (GO:0045092)|nuclear body (GO:0016604)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|signal transducer activity (GO:0004871)|Toll-like receptor binding (GO:0035325)			large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	6		all_cancers(49;7.62e-05)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00152)|Lung(200;0.09)|LUSC - Lung squamous cell carcinoma(625;0.107)		GGCTGGGGTGGCATCACCATG	0.627																																																	0													116.0	85.0	96.0					11																	1307298		2196	4297	6493	SO:0001583	missense	0			AJ242972	CCDS7723.1	11p	2008-02-05			ENSG00000078902	ENSG00000078902			16476	protein-coding gene	gene with protein product		606277				9426216, 10854325	Standard	NM_019009		Approved	IL-1RAcPIP	uc001lte.3	Q9H0E2	OTTHUMG00000133333	ENST00000317204.6:c.544C>T	11.37:g.1307298G>A	ENSP00000314733:p.Pro182Ser		B3KXC6|Q9H9E6|Q9UJ69	Missense_Mutation	SNP	pfam_CUE,pfam_C2_dom,superfamily_C2_dom,superfamily_UBA-like,smart_C2_dom,smart_CUE,pfscan_CUE	p.P182S	ENST00000317204.6	37	c.544	CCDS7723.1	11	.	.	.	.	.	.	.	.	.	.	G	7.040	0.562346	0.13498	.	.	ENSG00000078902	ENST00000317204;ENST00000527886;ENST00000525159;ENST00000263646;ENST00000542915;ENST00000382211;ENST00000530541	T;T;T;T;T;T	0.49720	0.83;0.83;0.95;0.77;0.84;0.8	5.08	3.2	0.36748	C2 calcium/lipid-binding domain, CaLB (1);	0.312928	0.31450	N	0.007625	T	0.37544	0.1007	L	0.47716	1.5	0.37865	D	0.929845	B;B;B	0.19445	0.036;0.01;0.0	B;B;B	0.15052	0.012;0.007;0.001	T	0.23797	-1.0178	10	0.22706	T	0.39	-17.4572	10.6031	0.45379	0.072:0.1331:0.7949:0.0	.	121;132;182	F2Z2Y8;B3KR28;Q9H0E2	.;.;TOLIP_HUMAN	S	182;113;121;154;132;213;132	ENSP00000314733:P182S;ENSP00000434035:P113S;ENSP00000432668:P121S;ENSP00000263646:P154S;ENSP00000437404:P132S;ENSP00000434494:P132S	ENSP00000263646:P154S	P	-	1	0	TOLLIP	1263874	1.000000	0.71417	0.857000	0.33713	0.022000	0.10575	4.272000	0.58908	0.715000	0.32103	-0.305000	0.09177	CCA	TOLLIP	-	superfamily_C2_dom	ENSG00000078902		0.627	TOLLIP-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TOLLIP	HGNC	protein_coding	OTTHUMT00000257162.2	-	0.00	35	0	G	NM_019009		1307298	-1	tier1	-	no_errors	ENST00000317204	ensembl	human	known	74_37	missense	16.67	15	3	SNP	0.998	A
TP53	7157	genome.wustl.edu	37	17	7577022	7577022	+	Nonsense_Mutation	SNP	G	G	A	rs121913344		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr17:7577022G>A	ENST00000269305.4	-	8	1105	c.916C>T	c.(916-918)Cga>Tga	p.R306*	TP53_ENST00000455263.2_Nonsense_Mutation_p.R306*|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Nonsense_Mutation_p.R306*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R306*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R306*|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	306	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		R -> P (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R306*(133)|p.0?(8)|p.?(3)|p.R306fs*39(2)|p.K305fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGCTTACCTCGCTTAGTGCTC	0.562	R306*(HCC1937_BREAST)|R306*(JURLMK1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(MFE296_ENDOMETRIUM)|R306*(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(RCM1_LARGE_INTESTINE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	147	Substitution - Nonsense(133)|Whole gene deletion(8)|Unknown(3)|Deletion - Frameshift(2)|Insertion - Frameshift(1)	large_intestine(39)|breast(21)|upper_aerodigestive_tract(15)|ovary(11)|central_nervous_system(10)|oesophagus(10)|stomach(8)|lung(8)|endometrium(6)|bone(4)|pancreas(3)|haematopoietic_and_lymphoid_tissue(3)|biliary_tract(3)|kidney(2)|NS(2)|urinary_tract(1)|liver(1)	GRCh37	CM971506	TP53	M	rs121913344						120.0	106.0	110.0					17																	7577022		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.916C>T	17.37:g.7577022G>A	ENSP00000269305:p.Arg306*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R306*	ENST00000269305.4	37	c.916	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782988	0.90282	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	3.21	0.36854	.	1.348720	0.05032	N	0.474808	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4785	0.44678	0.0:0.0:0.6334:0.3666	.	.	.	.	X	306;306;306;306;306;295;174	.	ENSP00000269305:R306X	R	-	1	2	TP53	7517747	1.000000	0.71417	0.970000	0.41538	0.345000	0.29048	2.280000	0.43443	0.735000	0.32537	0.561000	0.74099	CGA	TP53	-	NULL	ENSG00000141510		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	82	0	G	NM_000546		7577022	-1	tier1	rs121913344	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	24.00	38	12	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578439	7578439	+	Frame_Shift_Del	DEL	T	T	-			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr17:7578439delT	ENST00000269305.4	-	5	680	c.491delA	c.(490-492)aagfs	p.K164fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.K164fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.K164fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.K164fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.K164fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.K164fs|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	164	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		K -> E (in sporadic cancers; somatic mutation).|K -> M (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation).|K -> Q (in sporadic cancers; somatic mutation).|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.K164M(4)|p.K164fs*5(2)|p.K164fs*3(2)|p.K164T(2)|p.V157_C176del20(1)|p.Y163fs*1(1)|p.Y163_Q165delYKQ(1)|p.P151_V173del23(1)|p.K164fs*17(1)|p.Y163fs*14(1)|p.K164R(1)|p.S149fs*72(1)|p.A159_Q167delAMAIYKQSQ(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGTGACTGCTTGTAGATGGC	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	27	Whole gene deletion(8)|Substitution - Missense(7)|Deletion - Frameshift(7)|Deletion - In frame(4)|Insertion - Frameshift(1)	oesophagus(5)|breast(4)|bone(4)|stomach(3)|central_nervous_system(3)|lung(3)|large_intestine(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)											53.0	54.0	54.0					17																	7578439		2203	4300	6503	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.491delA	17.37:g.7578439delT	ENSP00000269305:p.Lys164fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.K164fs	ENST00000269305.4	37	c.491	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1		0.00	37	0	T	NM_000546		7578439	-1	tier1		no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	37.93	18	11	DEL	1.000	-
TPO	7173	genome.wustl.edu	37	2	1459852	1459852	+	Missense_Mutation	SNP	G	G	T	rs144088710		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:1459852G>T	ENST00000345913.4	+	7	708	c.617G>T	c.(616-618)cGg>cTg	p.R206L	TPO_ENST00000346956.3_Missense_Mutation_p.R206L|TPO_ENST00000382198.1_Missense_Mutation_p.R206L|TPO_ENST00000382201.3_Missense_Mutation_p.R206L|TPO_ENST00000349624.3_Missense_Mutation_p.R206L|TPO_ENST00000329066.4_Missense_Mutation_p.R206L|TPO_ENST00000497517.2_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.R206L	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	206					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	ACCCAGGTCCGGGAGGTGACA	0.502																																																	0													88.0	65.0	73.0					2																	1459852		2203	4300	6503	SO:0001583	missense	0				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.617G>T	2.37:g.1459852G>T	ENSP00000318820:p.Arg206Leu		P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_EGF-like_Ca-bd_dom,superfamily_Haem_peroxidase,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.R206L	ENST00000345913.4	37	c.617	CCDS1643.1	2	.	.	.	.	.	.	.	.	.	.	G	16.67	3.188130	0.57909	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464	T;T;T;T;T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74;-0.74	5.04	5.04	0.67666	.	0.125727	0.53938	D	0.000059	D	0.89339	0.6687	M	0.91663	3.23	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.76575	0.98;0.986;0.98;0.988	D	0.91737	0.5401	10	0.87932	D	0	-42.5583	18.7337	0.91746	0.0:0.0:1.0:0.0	.	206;206;206;206	P07202-4;P07202-5;P07202-2;P07202	.;.;.;PERT_HUMAN	L	206;206;206;206;206;206;206;135	ENSP00000337263:R206L;ENSP00000318820:R206L;ENSP00000263886:R206L;ENSP00000332044:R206L;ENSP00000329869:R206L;ENSP00000371636:R206L;ENSP00000371633:R206L;ENSP00000405788:R135L	ENSP00000329869:R206L	R	+	2	0	TPO	1438859	1.000000	0.71417	0.996000	0.52242	0.299000	0.27559	8.134000	0.89606	2.485000	0.83878	0.563000	0.77884	CGG	TPO	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000115705		0.502	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPO	HGNC	protein_coding	OTTHUMT00000206594.2	-	0.00	37	0	G	NM_000547		1459852	+1	tier1	-	no_errors	ENST00000329066	ensembl	human	known	74_37	missense	45.16	17	14	SNP	1.000	T
TPRXL	348825	genome.wustl.edu	37	3	14106011	14106012	+	In_Frame_Ins	INS	-	-	CAG			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr3:14106011_14106012insCAG	ENST00000424053.1	+	3	882_883	c.335_336insCAG	c.(334-339)tccagc>tcCAGcagc	p.112_113SS>SSS	TPRXL_ENST00000429201.1_In_Frame_Ins_p.112_113SS>SSS|TPRXL_ENST00000532753.1_Intron|TPRXL_ENST00000326972.8_In_Frame_Ins_p.112_113SS>SSS			Q17RH7	TPRXL_HUMAN	tetra-peptide repeat homeobox-like	0	Ser-rich.									endometrium(1)	1						agtagcagctccagcagcagca	0.663																																																	0																																										SO:0001652	inframe_insertion	0			AK092426		3p25.1	2011-06-20			ENSG00000180438	ENSG00000180438		"""Homeoboxes / PRD class"""	32178	pseudogene	pseudogene		611167					Standard	NR_002223		Approved	FLJ35107	uc003byg.3	Q17RH7	OTTHUMG00000155509	ENST00000424053.1:c.345_347dupCAG	3.37:g.14106018_14106020dupCAG	ENSP00000400448:p.Ser115_Ser116dup		Q8NAM5	In_Frame_Ins	INS	NULL	p.116in_frame_insS	ENST00000424053.1	37	c.335_336		3																																																																																			TPRXL	-	NULL	ENSG00000180438		0.663	TPRXL-003	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	TPRXL	HGNC	protein_coding	OTTHUMT00000340436.1		0.00	28	0	-	NR_002223		14106012	+1	tier1		no_errors	ENST00000326972	ensembl	human	known	74_37	in_frame_ins	55.56	4	5	INS	0.001:0.001	CAG
TTLL7	79739	genome.wustl.edu	37	1	84376889	84376889	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:84376889T>A	ENST00000260505.8	-	15	2122	c.1745A>T	c.(1744-1746)aAt>aTt	p.N582I	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	582					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		GGGTTTAAGATTATATGTAAC	0.303																																																	0													234.0	235.0	235.0					1																	84376889		2203	4300	6503	SO:0001583	missense	0			AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.1745A>T	1.37:g.84376889T>A	ENSP00000260505:p.Asn582Ile		Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Missense_Mutation	SNP	pfam_TTL/TTLL_fam	p.N582I	ENST00000260505.8	37	c.1745	CCDS690.2	1	.	.	.	.	.	.	.	.	.	.	T	6.811	0.518727	0.13005	.	.	ENSG00000137941	ENST00000260505;ENST00000370704;ENST00000370703	T	0.03772	3.81	5.53	-0.341	0.12639	.	0.819934	0.11233	N	0.585416	T	0.00875	0.0029	N	0.14661	0.345	0.09310	N	1	B	0.29805	0.257	B	0.29267	0.1	T	0.46803	-0.9165	10	0.48119	T	0.1	.	4.7759	0.13178	0.0:0.1921:0.2933:0.5146	.	582	Q6ZT98	TTLL7_HUMAN	I	582;359;582	ENSP00000260505:N582I	ENSP00000260505:N582I	N	-	2	0	TTLL7	84149477	0.979000	0.34478	0.000000	0.03702	0.006000	0.05464	2.043000	0.41231	-0.303000	0.08856	-0.619000	0.04042	AAT	TTLL7	-	NULL	ENSG00000137941		0.303	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL7	HGNC	protein_coding	OTTHUMT00000027498.1	-	0.00	32	0	T	NM_024686		84376889	-1	tier1	-	no_errors	ENST00000260505	ensembl	human	known	74_37	missense	26.92	19	7	SNP	0.002	A
TSHB	7252	genome.wustl.edu	37	1	115576687	115576687	+	Nonsense_Mutation	SNP	G	G	T	rs190110651	byFrequency	TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:115576687G>T	ENST00000369517.1	+	2	256	c.256G>T	c.(256-258)Gga>Tga	p.G86*	TSHB_ENST00000256592.1_Nonsense_Mutation_p.G86*			P01222	TSHB_HUMAN	thyroid stimulating hormone, beta	86					anatomical structure morphogenesis (GO:0009653)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|G-protein coupled receptor signaling pathway (GO:0007186)|peptide hormone processing (GO:0016486)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to vitamin A (GO:0033189)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)	7	Lung SC(450;0.211)	all_cancers(81;3.22e-07)|all_epithelial(167;1.4e-06)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)		AGAAATACCAGGATGCCCACT	0.433																																																	0													232.0	219.0	224.0					1																	115576687		2203	4300	6503	SO:0001587	stop_gained	0			BC069298	CCDS880.1	1p13	2013-02-28			ENSG00000134200	ENSG00000134200		"""Endogenous ligands"""	12372	protein-coding gene	gene with protein product		188540				2457586, 3243440	Standard	NM_000549		Approved		uc001efs.2	P01222	OTTHUMG00000011881	ENST00000369517.1:c.256G>T	1.37:g.115576687G>T	ENSP00000358530:p.Gly86*		B1AKP0|Q16163	Nonsense_Mutation	SNP	pfam_Cys_knot,smart_Gonadotropin_bsu	p.G86*	ENST00000369517.1	37	c.256	CCDS880.1	1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.719581	0.89205	.	.	ENSG00000134200	ENST00000256592;ENST00000369517	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-9.0016	19.9359	0.97142	0.0:0.0:1.0:0.0	.	.	.	.	X	86	.	ENSP00000256592:G86X	G	+	1	0	TSHB	115378210	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.920000	0.87521	2.814000	0.96858	0.655000	0.94253	GGA	TSHB	-	pfam_Cys_knot,smart_Gonadotropin_bsu	ENSG00000134200		0.433	TSHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHB	HGNC	protein_coding	OTTHUMT00000032833.2	-	0.00	58	0	G	NM_000549		115576687	+1	tier1	-	no_errors	ENST00000256592	ensembl	human	known	74_37	nonsense	8.33	44	4	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179443596	179443596	+	Missense_Mutation	SNP	C	C	T	rs374492812		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:179443596C>T	ENST00000591111.1	-	270	63462	c.63238G>A	c.(63238-63240)Gaa>Aaa	p.E21080K	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E13781K|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E20153K|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592600.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E22721K|TTN_ENST00000460472.2_Missense_Mutation_p.E13656K|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E13848K|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21080	Fibronectin type-III 52. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATTTATTTTCGGCACTGACC	0.453													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21021	0.0		0.0	False		,,,				2504	0.0																0								C	LYS/GLU,LYS/GLU,LYS/GLU,LYS/GLU	1,3823		0,1,1911	102.0	99.0	100.0		40966,60457,41341,41542	5.9	1.0	2		100	0,8222		0,0,4111	no	missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	56,56,56,56	0,1,6022	TT,TC,CC		0.0,0.0262,0.0083	probably-damaging,probably-damaging,probably-damaging,probably-damaging	13656/26927,20153/33424,13781/27052,13848/27119	179443596	1,12045	1912	4111	6023	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.63238G>A	2.37:g.179443596C>T	ENSP00000465570:p.Glu21080Lys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E20153K	ENST00000591111.1	37	c.60457		2	.	.	.	.	.	.	.	.	.	.	C	17.47	3.397672	0.62177	2.62E-4	0.0	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	5.87	5.87	0.94306	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70202	0.3197	L	0.50919	1.6	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.70494	-0.4856	9	0.87932	D	0	.	20.2227	0.98327	0.0:1.0:0.0:0.0	.	13656;13781;13848;21080	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	20153;13656;13848;13781;13654	ENSP00000343764:E20153K;ENSP00000434586:E13656K;ENSP00000340554:E13848K;ENSP00000352154:E13781K	ENSP00000340554:E13848K	E	-	1	0	TTN	179151842	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.770000	0.85390	2.778000	0.95560	0.650000	0.86243	GAA	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.453	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	33	0	C	NM_133378		179443596	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	25.00	27	9	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179647024	179647024	+	Missense_Mutation	SNP	C	C	T	rs368282893		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:179647024C>T	ENST00000591111.1	-	20	3519	c.3295G>A	c.(3295-3297)Gtg>Atg	p.V1099M	TTN_ENST00000359218.5_Missense_Mutation_p.V1053M|TTN_ENST00000360870.5_Missense_Mutation_p.V1099M|TTN_ENST00000342992.6_Missense_Mutation_p.V1099M|TTN_ENST00000589042.1_Missense_Mutation_p.V1099M|TTN_ENST00000460472.2_Missense_Mutation_p.V1053M|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V1053M			Q8WZ42	TITIN_HUMAN	titin	33318	Ig-like 4.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCAAACACCACGCTCCCACCT	0.502																																																	0								C	MET/VAL,MET/VAL,MET/VAL,MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	78.0	76.0	77.0		3157,3295,3295,3157,3157	-2.6	0.0	2		77	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133379.3,NM_133432.3,NM_133437.3	21,21,21,21,21	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	1053/26927,1099/33424,1099/5605,1053/27052,1053/27119	179647024	2,13004	2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.3295G>A	2.37:g.179647024C>T	ENSP00000465570:p.Val1099Met		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.V1099M	ENST00000591111.1	37	c.3295		2	.	.	.	.	.	.	.	.	.	.	C	11.54	1.669367	0.29693	2.27E-4	1.16E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69	5.6	-2.62	0.06152	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.60064	0.2240	M	0.76170	2.325	0.09310	N	0.999996	P;P;P;P;D	0.60575	0.908;0.908;0.908;0.908;0.988	P;P;P;P;P	0.56278	0.487;0.487;0.647;0.647;0.795	T	0.60850	-0.7181	9	0.87932	D	0	.	13.614	0.62097	0.0:0.4899:0.0:0.5101	.	1053;1053;1053;1099;1099	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	M	1099;1053;1053;1053;1053;1099	ENSP00000343764:V1099M;ENSP00000434586:V1053M;ENSP00000340554:V1053M;ENSP00000352154:V1053M;ENSP00000354117:V1099M	ENSP00000340554:V1053M	V	-	1	0	TTN	179355269	0.013000	0.17824	0.021000	0.16686	0.992000	0.81027	0.263000	0.18478	-0.797000	0.04450	0.650000	0.86243	GTG	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.502	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	34	0	C	NM_133378		179647024	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	38.24	21	13	SNP	0.139	T
TXNDC2	84203	genome.wustl.edu	37	18	9886734	9886734	+	Silent	SNP	C	C	T	rs144698163		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr18:9886734C>T	ENST00000306084.6	+	2	457	c.258C>T	c.(256-258)ggC>ggT	p.G86G	TXNDC2_ENST00000357775.5_Silent_p.G19G|TXNDC2_ENST00000426718.3_3'UTR|TXNDC2_ENST00000536353.2_Silent_p.G19G	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	86					cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)	p.G19G(1)|p.G86G(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						CACAGGAGGGCGATGACCTAC	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		17261	0.0		0.001	False		,,,				2504	0.0																2	Substitution - coding silent(2)	lung(2)						C	,	1,4405	2.1+/-5.4	0,1,2202	155.0	101.0	119.0		258,57	-6.6	0.0	18	dbSNP_134	119	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	TXNDC2	NM_001098529.1,NM_032243.5	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	86/554,19/487	9886734	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.258C>T	18.37:g.9886734C>T			A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Silent	SNP	pfam_Thioredoxin_domain,pfam_Glutenin,superfamily_Thioredoxin-like_fold	p.G86	ENST00000306084.6	37	c.258	CCDS42414.1	18																																																																																			TXNDC2	-	NULL	ENSG00000168454		0.562	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TXNDC2	HGNC	protein_coding	OTTHUMT00000254487.1		0.00	73	0	C			9886734	+1			no_errors	ENST00000306084	ensembl	human	known	74_37	silent	5.45	52	3	SNP	0.000	T
UMOD	7369	genome.wustl.edu	37	16	20355414	20355414	+	Silent	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr16:20355414G>T	ENST00000570689.1	-	6	1409	c.1263C>A	c.(1261-1263)atC>atA	p.I421I	UMOD_ENST00000424589.1_Silent_p.I454I|UMOD_ENST00000396134.2_Silent_p.I454I|UMOD_ENST00000302509.4_Silent_p.I421I|UMOD_ENST00000570331.1_5'Flank|UMOD_ENST00000396142.2_Silent_p.I421I|UMOD_ENST00000396138.4_Silent_p.I470I			P07911	UROM_HUMAN	uromodulin	421	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)			endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						ATGCAAAGTTGATTTTGATGT	0.542																																																	0													167.0	138.0	148.0					16																	20355414		2203	4300	6503	SO:0001819	synonymous_variant	0			M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.1263C>A	16.37:g.20355414G>T			B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Silent	SNP	pfam_ZP_dom,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_ZP_dom,pfscan_EG-like_dom,pfscan_ZP_dom,prints_ZP_dom	p.I454	ENST00000570689.1	37	c.1362	CCDS10583.1	16																																																																																			UMOD	-	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom	ENSG00000169344		0.542	UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	UMOD	HGNC	protein_coding	OTTHUMT00000436862.1	-	0.00	33	0	G			20355414	-1	tier1	-	no_errors	ENST00000424589	ensembl	human	known	74_37	silent	11.76	30	4	SNP	0.932	T
USP2	9099	genome.wustl.edu	37	11	119234618	119234618	+	Intron	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:119234618G>T	ENST00000260187.2	-	3	1069				USP2_ENST00000455332.2_Intron|USP2_ENST00000525735.1_Missense_Mutation_p.P30T	NM_004205.4	NP_004196.4	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2						cell cycle (GO:0007049)|muscle organ development (GO:0007517)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue development (GO:0048643)|protein deubiquitination (GO:0016579)|protein stabilization (GO:0050821)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell cortex (GO:0005938)|centrosome (GO:0005813)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cyclin binding (GO:0030332)|cysteine-type endopeptidase activity (GO:0004197)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	24		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		GGGGAGAGAGGGGAGCGCGGC	0.736																																																	0													6.0	8.0	7.0					11																	119234618		1771	3497	5268	SO:0001627	intron_variant	0			AF079564	CCDS8422.1, CCDS8423.1, CCDS58189.1	11q23.3	2008-02-05	2005-08-08			ENSG00000036672		"""Ubiquitin-specific peptidases"""	12618	protein-coding gene	gene with protein product		604725	"""ubiquitin specific protease 2"""			12838346	Standard	NM_004205		Approved	UBP41	uc001pwm.4	O75604		ENST00000260187.2:c.775-3674C>A	11.37:g.119234618G>T			B0YJB8|E9PPM2|Q8IUM2|Q8IW04|Q96MB9|Q9BQ21	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.P30T	ENST00000260187.2	37	c.88	CCDS8422.1	11	.	.	.	.	.	.	.	.	.	.	G	14.68	2.608493	0.46527	.	.	ENSG00000036672	ENST00000525735	T	0.18960	2.18	5.0	5.0	0.66597	.	.	.	.	.	T	0.13415	0.0325	.	.	.	0.23266	N	0.998013	B	0.12013	0.005	B	0.17098	0.017	T	0.17561	-1.0365	8	0.22706	T	0.39	.	8.8685	0.35300	0.1079:0.0:0.8921:0.0	.	30	O75604-4	.	T	30	ENSP00000436952:P30T	ENSP00000436952:P30T	P	-	1	0	USP2	118739828	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.404000	0.34623	2.330000	0.79161	0.561000	0.74099	CCT	USP2	-	NULL	ENSG00000036672		0.736	USP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP2	HGNC	protein_coding	OTTHUMT00000388361.2		0.00	91	0	G	NM_171997		119234618	-1			no_errors	ENST00000525735	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
USP34	9736	genome.wustl.edu	37	2	61433937	61433937	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:61433937G>T	ENST00000398571.2	-	71	9080	c.9004C>A	c.(9004-9006)Ctt>Att	p.L3002I	USP34_ENST00000472689.1_5'Flank	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	3002					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			AAAACCGAAAGAAATATTGAC	0.378																																																	0													69.0	65.0	66.0					2																	61433937		1848	4102	5950	SO:0001583	missense	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.9004C>A	2.37:g.61433937G>T	ENSP00000381577:p.Leu3002Ile		A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_ARM-type_fold,pfscan_Peptidase_C19/C67	p.L3002I	ENST00000398571.2	37	c.9004	CCDS42686.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.23|17.23	3.337068|3.337068	0.60963|0.60963	.|.	.|.	ENSG00000115464|ENSG00000115464	ENST00000263989;ENST00000398571|ENST00000411912	T|.	0.68479|.	-0.33|.	5.82|5.82	4.95|4.95	0.65309|0.65309	Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.52964|0.52964	0.1767|0.1767	N|N	0.25647|0.25647	0.755|0.755	0.80722|0.80722	D|D	1|1	B|.	0.29378|.	0.243|.	B|.	0.28991|.	0.097|.	T|T	0.49224|0.49224	-0.8962|-0.8962	10|5	0.18710|.	T|.	0.47|.	.|.	14.895|14.895	0.70636|0.70636	0.0686:0.0:0.9314:0.0|0.0686:0.0:0.9314:0.0	.|.	3002|.	Q70CQ2|.	UBP34_HUMAN|.	I|Y	2850;3002|761	ENSP00000381577:L3002I|.	ENSP00000263989:L2850I|.	L|S	-|-	1|2	0|0	USP34|USP34	61287441|61287441	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.932000|0.932000	0.56968|0.56968	9.869000|9.869000	0.99810|0.99810	1.473000|1.473000	0.48159|0.48159	0.563000|0.563000	0.77884|0.77884	CTT|TCT	USP34	-	superfamily_ARM-type_fold	ENSG00000115464		0.378	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4		0.00	61	0	G			61433937	-1			no_errors	ENST00000398571	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
VAX2	25806	genome.wustl.edu	37	2	71160086	71160086	+	Frame_Shift_Del	DEL	G	G	-			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:71160086delG	ENST00000234392.2	+	3	657	c.625delG	c.(625-627)ggcfs	p.G209fs	ATP6V1B1_ENST00000412314.1_5'Flank|snoU13_ENST00000459218.1_RNA|ATP6V1B1_ENST00000234396.4_5'Flank	NM_012476.2	NP_036608.1	Q9UIW0	VAX2_HUMAN	ventral anterior homeobox 2	209					axonogenesis (GO:0007409)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic eye morphogenesis (GO:0048048)|forebrain development (GO:0030900)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	7						TAGCCTGCCAGGCCTACCTGC	0.697																																																	0													26.0	30.0	29.0					2																	71160086		2202	4300	6502	SO:0001589	frameshift_variant	0			Y17791	CCDS1911.1	2p13.3	2011-06-20			ENSG00000116035	ENSG00000116035		"""Homeoboxes / ANTP class : NKL subclass"""	12661	protein-coding gene	gene with protein product		604295				10485894	Standard	NM_012476		Approved	DRES93	uc002shh.3	Q9UIW0	OTTHUMG00000129714	ENST00000234392.2:c.625delG	2.37:g.71160086delG	ENSP00000234392:p.Gly209fs		Q53Y33	Frame_Shift_Del	DEL	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.G209fs	ENST00000234392.2	37	c.625	CCDS1911.1	2																																																																																			VAX2	-	NULL	ENSG00000116035		0.697	VAX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAX2	HGNC	protein_coding	OTTHUMT00000251923.1		0.00	88	0	G			71160086	+1	tier1		no_errors	ENST00000234392	ensembl	human	known	74_37	frame_shift_del	30.23	30	13	DEL	0.029	-
VDAC1	7416	genome.wustl.edu	37	5	133309491	133309491	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr5:133309491G>T	ENST00000265333.3	-	8	995	c.751C>A	c.(751-753)Cta>Ata	p.L251I	VDAC1_ENST00000395044.3_Missense_Mutation_p.L251I|VDAC1_ENST00000395047.2_Missense_Mutation_p.L251I	NM_003374.2	NP_003365.1	P21796	VDAC1_HUMAN	voltage-dependent anion channel 1	251					anion transport (GO:0006820)|apoptotic process (GO:0006915)|behavioral fear response (GO:0001662)|epithelial cell differentiation (GO:0030855)|learning (GO:0007612)|neuron-neuron synaptic transmission (GO:0007270)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pore complex (GO:0046930)	porin activity (GO:0015288)|protein kinase binding (GO:0019901)|voltage-gated anion channel activity (GO:0008308)			endometrium(1)|large_intestine(1)|lung(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)	CCTGGCTTTAGAGTCTGAGTG	0.348																																					NSCLC(127;1776 1806 35523 41489 48154)												0													125.0	127.0	126.0					5																	133309491		2203	4300	6503	SO:0001583	missense	0				CCDS4168.1	5q31	2011-11-15			ENSG00000213585	ENSG00000213585		"""Voltage-dependent anion channels"""	12669	protein-coding gene	gene with protein product		604492				7517385	Standard	NM_003374		Approved	MGC111064, PORIN	uc003kyr.2	P21796	OTTHUMG00000129118	ENST00000265333.3:c.751C>A	5.37:g.133309491G>T	ENSP00000265333:p.Leu251Ile		B3KVK4|D3DQ93|Q5FVE7|Q9UIQ5|Q9UPL0	Missense_Mutation	SNP	pfam_Porin_Euk/Tom40,prints_Porin_Euk	p.L251I	ENST00000265333.3	37	c.751	CCDS4168.1	5	.	.	.	.	.	.	.	.	.	.	G	24.2	4.510610	0.85389	.	.	ENSG00000213585	ENST00000265333;ENST00000395044;ENST00000395047	T;T;T	0.61274	0.12;0.12;0.12	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.78007	0.4216	M	0.86805	2.84	0.80722	D	1	D	0.56968	0.978	D	0.83275	0.996	T	0.80094	-0.1526	10	0.52906	T	0.07	.	13.0627	0.59015	0.0847:0.0:0.9153:0.0	.	251	P21796	VDAC1_HUMAN	I	251	ENSP00000265333:L251I;ENSP00000378484:L251I;ENSP00000378487:L251I	ENSP00000265333:L251I	L	-	1	2	VDAC1	133337390	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.441000	0.73439	2.630000	0.89119	0.467000	0.42956	CTA	VDAC1	-	pfam_Porin_Euk/Tom40,prints_Porin_Euk	ENSG00000213585		0.348	VDAC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VDAC1	HGNC	protein_coding	OTTHUMT00000259208.1		0.00	56	0	G			133309491	-1			no_errors	ENST00000265333	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
WDR45	11152	genome.wustl.edu	37	X	48935401	48935401	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:48935401C>A	ENST00000376372.3	-	4	317	c.136G>T	c.(136-138)Gag>Tag	p.E46*	WDR45_ENST00000473974.1_Nonsense_Mutation_p.E46*|WDR45_ENST00000553851.1_Intron|WDR45_ENST00000485908.1_Intron|WDR45_ENST00000322995.8_Nonsense_Mutation_p.E46*|AF196779.12_ENST00000376358.3_Intron|WDR45_ENST00000465431.1_Intron|WDR45_ENST00000396681.4_Nonsense_Mutation_p.E46*|WDR45_ENST00000376368.2_Nonsense_Mutation_p.E46*|WDR45_ENST00000356463.3_Nonsense_Mutation_p.E46*	NM_001029896.1	NP_001025067.1	Q9Y484	WIPI4_HUMAN	WD repeat domain 45	46					autophagy (GO:0006914)|cell death (GO:0008219)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	19						CCCACCTGCTCGTGGTCTGGA	0.622																																																	0													52.0	32.0	39.0					X																	48935401		2202	4298	6500	SO:0001587	stop_gained	0			BC003037	CCDS14318.1, CCDS35250.1	Xp11.23	2013-06-06	2004-09-02	2004-09-03	ENSG00000196998	ENSG00000196998		"""WD repeat domain containing"""	28912	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 5"""	300526	"""WD repeat domain, X-linked 1"""	WDRX1		12477932	Standard	NM_007075		Approved	JM5, WIPI4, NBIA5	uc004dmk.1	Q9Y484	OTTHUMG00000034500	ENST00000376372.3:c.136G>T	X.37:g.48935401C>A	ENSP00000365551:p.Glu46*		A6NGH5|B7WPI2|Q5MNZ5|Q6IBS7|Q6NT94|Q96H03	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.E46*	ENST00000376372.3	37	c.136	CCDS35250.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.6|27.6	4.845769|4.845769	0.91197|0.91197	.|.	.|.	ENSG00000196998|ENSG00000196998	ENST00000376372;ENST00000322995;ENST00000356463;ENST00000473974;ENST00000376368;ENST00000396681;ENST00000471338;ENST00000474053;ENST00000419567;ENST00000465382;ENST00000423215|ENST00000367375	.|.	.|.	.|.	3.71|3.71	3.71|3.71	0.42584|0.42584	.|.	0.129453|.	0.50627|.	D|.	0.000112|.	.|T	.|0.68833	.|0.3044	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.68716	.|-0.5335	.|4	0.08381|.	T|.	0.77|.	-24.1195|-24.1195	14.3421|14.3421	0.66633|0.66633	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	46|2	.|.	ENSP00000365543:E46X|.	E|R	-|-	1|2	0|0	WDR45|WDR45	48822345|48822345	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.976000|0.976000	0.68499|0.68499	6.908000|6.908000	0.75730|0.75730	2.111000|2.111000	0.64477|0.64477	0.529000|0.529000	0.55759|0.55759	GAG|CGA	WDR45	-	superfamily_WD40_repeat_dom	ENSG00000196998		0.622	WDR45-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR45	HGNC	protein_coding	OTTHUMT00000083418.2	-	0.00	50	0	C	NM_007075		48935401	-1	tier1	-	no_errors	ENST00000322995	ensembl	human	known	74_37	nonsense	27.59	21	8	SNP	1.000	A
WNT8B	7479	genome.wustl.edu	37	10	102241743	102241743	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:102241743G>C	ENST00000343737.5	+	5	570	c.442G>C	c.(442-444)Gat>Cat	p.D148H		NM_003393.3	NP_003384.2	Q93098	WNT8B_HUMAN	wingless-type MMTV integration site family, member 8B	148					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|determination of dorsal identity (GO:0048263)|gastrulation (GO:0007369)|negative regulation of gene expression (GO:0010629)|nervous system development (GO:0007399)|neuron differentiation (GO:0030182)|positive regulation of gene expression (GO:0010628)|response to estradiol (GO:0032355)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|large_intestine(1)|ovary(1)|skin(1)	4		Colorectal(252;0.117)		Epithelial(162;1.87e-10)|all cancers(201;1.64e-08)		GCAGTTTGTCGATGCCCTGGA	0.597											OREG0020440	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													117.0	102.0	107.0					10																	102241743		2203	4300	6503	SO:0001583	missense	0			X91940	CCDS7494.1	10q24	2003-11-12			ENSG00000075290	ENSG00000075290		"""Wingless-type MMTV integration sites"""	12789	protein-coding gene	gene with protein product		601396				8661156	Standard	NM_003393		Approved		uc001krb.3	Q93098	OTTHUMG00000018912	ENST00000343737.5:c.442G>C	10.37:g.102241743G>C	ENSP00000340677:p.Asp148His	1365	O00771|Q5VX55|Q8WYK9	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt8	p.D148H	ENST00000343737.5	37	c.442	CCDS7494.1	10	.	.	.	.	.	.	.	.	.	.	G	32	5.186423	0.94885	.	.	ENSG00000075290	ENST00000343737	T	0.80393	-1.37	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.93439	0.7907	H	0.96365	3.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95081	0.8213	10	0.87932	D	0	.	19.4761	0.94989	0.0:0.0:1.0:0.0	.	148	Q93098	WNT8B_HUMAN	H	148	ENSP00000340677:D148H	ENSP00000340677:D148H	D	+	1	0	WNT8B	102231733	1.000000	0.71417	0.987000	0.45799	0.986000	0.74619	9.813000	0.99286	2.682000	0.91365	0.561000	0.74099	GAT	WNT8B	-	pfam_Wnt,smart_Wnt	ENSG00000075290		0.597	WNT8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT8B	HGNC	protein_coding	OTTHUMT00000049867.1	-	0.00	51	0	G	NM_003393		102241743	+1	tier1	-	no_errors	ENST00000343737	ensembl	human	known	74_37	missense	14.71	29	5	SNP	1.000	C
XPO1	7514	genome.wustl.edu	37	2	61719279	61719279	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:61719279T>A	ENST00000401558.2	-	16	2505	c.1778A>T	c.(1777-1779)cAa>cTa	p.Q593L	XPO1_ENST00000406957.1_Missense_Mutation_p.Q593L|XPO1_ENST00000404992.2_Missense_Mutation_p.Q593L	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	593	Necessary for HTLV-1 Rex-mediated mRNA export.				gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			GCGGCATTTTTGGGCTATTTT	0.363			Mis		CLL																																		-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	0													71.0	73.0	73.0					2																	61719279		2203	4300	6503	SO:0001583	missense	0			Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.1778A>T	2.37:g.61719279T>A	ENSP00000384863:p.Gln593Leu		A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	pfam_CRM1_C_dom,pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.Q593L	ENST00000401558.2	37	c.1778	CCDS33205.1	2	.	.	.	.	.	.	.	.	.	.	T	18.07	3.541664	0.65085	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	T;T;T	0.66815	-0.23;-0.23;-0.23	5.49	5.49	0.81192	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.56108	0.1963	L	0.33485	1.01	0.80722	D	1	B;B	0.12013	0.005;0.005	B;B	0.08055	0.002;0.003	T	0.50980	-0.8763	10	0.23891	T	0.37	-12.6315	15.8844	0.79232	0.0:0.0:0.0:1.0	.	240;593	B3KWD0;O14980	.;XPO1_HUMAN	L	593	ENSP00000384863:Q593L;ENSP00000385942:Q593L;ENSP00000385559:Q593L	ENSP00000384863:Q593L	Q	-	2	0	XPO1	61572783	1.000000	0.71417	0.996000	0.52242	0.971000	0.66376	7.987000	0.88182	2.218000	0.71995	0.533000	0.62120	CAA	XPO1	-	superfamily_ARM-type_fold	ENSG00000082898		0.363	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO1	HGNC	protein_coding	OTTHUMT00000325872.3	-	0.00	37	0	T	NM_003400		61719279	-1	tier1	-	no_errors	ENST00000401558	ensembl	human	known	74_37	missense	28.26	33	13	SNP	1.000	A
ZC3H12C	85463	genome.wustl.edu	37	11	110030138	110030138	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:110030138G>T	ENST00000278590.3	+	4	1122	c.1071G>T	c.(1069-1071)agG>agT	p.R357S	ZC3H12C_ENST00000453089.2_Missense_Mutation_p.R326S|ZC3H12C_ENST00000528673.1_Missense_Mutation_p.R358S	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	357							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		ATAACTACAGGGACTTGGCTA	0.433																																																	0													61.0	64.0	63.0					11																	110030138		2115	4262	6377	SO:0001583	missense	0				CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.1071G>T	11.37:g.110030138G>T	ENSP00000278590:p.Arg357Ser		B4DI65|B4DR47	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.R357S	ENST00000278590.3	37	c.1071	CCDS44727.1	11	.	.	.	.	.	.	.	.	.	.	G	20.3	3.973946	0.74246	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.55930	0.49;0.49;0.49	5.55	2.62	0.31277	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.76212	0.3956	M	0.93594	3.435	0.54753	D	0.999987	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.87578	0.998;0.994;0.998	T	0.79472	-0.1789	10	0.87932	D	0	-26.6203	9.9478	0.41621	0.2219:0.0:0.7781:0.0	.	358;357;357	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	S	357;358;326	ENSP00000278590:R357S;ENSP00000431821:R358S;ENSP00000413094:R326S	ENSP00000278590:R357S	R	+	3	2	ZC3H12C	109535348	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.936000	0.40183	0.791000	0.33826	0.655000	0.94253	AGG	ZC3H12C	-	pfam_RNase_Zc3h12	ENSG00000149289		0.433	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	ZC3H12C	HGNC	protein_coding	OTTHUMT00000390491.1	-	0.00	54	0	G	NM_033390		110030138	+1	tier1	-	no_errors	ENST00000278590	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
ZC3H15	55854	genome.wustl.edu	37	2	187370557	187370557	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:187370557G>T	ENST00000337859.6	+	8	1182	c.955G>T	c.(955-957)Ggt>Tgt	p.G319C	ZC3H15_ENST00000544130.1_Missense_Mutation_p.G114C	NM_018471.2	NP_060941.2	Q8WU90	ZC3HF_HUMAN	zinc finger CCCH-type containing 15	319					cytokine-mediated signaling pathway (GO:0019221)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			CCAGGGAACAGGTGGTGATGA	0.428																																																	0													104.0	98.0	100.0					2																	187370557		2021	4172	6193	SO:0001583	missense	0				CCDS42791.1	2q32.1	2012-07-05			ENSG00000065548	ENSG00000065548		"""Zinc fingers, CCCH-type domain containing"""	29528	protein-coding gene	gene with protein product	"""likely ortholog of mouse immediate early response, erythropoietin 4"""					10880228	Standard	NM_018471		Approved	LEREPO4	uc002upo.3	Q8WU90	OTTHUMG00000154251	ENST00000337859.6:c.955G>T	2.37:g.187370557G>T	ENSP00000338788:p.Gly319Cys		B4DMW2|D3DPG7|Q5QTQ4|Q8WZ06|Q9NUZ3|Q9NZ37|Q9P079	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.G319C	ENST00000337859.6	37	c.955	CCDS42791.1	2	.	.	.	.	.	.	.	.	.	.	G	18.08	3.543967	0.65198	.	.	ENSG00000065548	ENST00000337859;ENST00000544130;ENST00000536434	T	0.31247	1.5	5.87	4.98	0.66077	.	0.478557	0.25823	N	0.028075	T	0.29524	0.0736	N	0.22421	0.69	0.31755	N	0.634067	D	0.58620	0.983	P	0.49502	0.613	T	0.14035	-1.0487	10	0.48119	T	0.1	-16.981	14.7909	0.69841	0.0689:0.0:0.9311:0.0	.	319	Q8WU90	ZC3HF_HUMAN	C	319;114;319	ENSP00000338788:G319C	ENSP00000338788:G319C	G	+	1	0	ZC3H15	187078802	0.995000	0.38212	1.000000	0.80357	0.989000	0.77384	2.244000	0.43124	2.941000	0.99782	0.655000	0.94253	GGT	ZC3H15	-	NULL	ENSG00000065548		0.428	ZC3H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H15	HGNC	protein_coding	OTTHUMT00000334547.2	-	0.00	54	0	G	NM_018471		187370557	+1	tier1	-	no_errors	ENST00000337859	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.821	T
ZCCHC11	23318	genome.wustl.edu	37	1	52897011	52897011	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr1:52897011T>A	ENST00000371544.3	-	28	4644	c.4382A>T	c.(4381-4383)cAg>cTg	p.Q1461L	ZCCHC11_ENST00000257177.4_Missense_Mutation_p.Q1462L	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	1461	Gln-rich.|Pro-rich.				cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						TTGGGCTCCCTGCTGAGGTGG	0.537																																																	0													103.0	90.0	94.0					1																	52897011		2203	4300	6503	SO:0001583	missense	0			D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.4382A>T	1.37:g.52897011T>A	ENSP00000360599:p.Gln1461Leu		A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_Znf_CCHC,pfam_Nucleotidyltransferase,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.Q1462L	ENST00000371544.3	37	c.4385	CCDS30716.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.50|10.50	1.366301|1.366301	0.24771|0.24771	.|.	.|.	ENSG00000134744|ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000531722|ENST00000494469	T;T|.	0.49432|.	0.78;0.78|.	5.37|5.37	4.18|4.18	0.49190|0.49190	.|.	0.381365|.	0.25517|.	N|.	0.030138|.	T|T	0.42720|0.42720	0.1215|0.1215	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	D|.	0.53151|.	0.958|.	P|.	0.45343|.	0.477|.	T|T	0.26643|0.26643	-1.0097|-1.0097	10|5	0.27082|.	T|.	0.32|.	.|.	11.6693|11.6693	0.51391|0.51391	0.0:0.0:0.3486:0.6514|0.0:0.0:0.3486:0.6514	.|.	1461|.	Q5TAX3|.	TUT4_HUMAN|.	L|W	1462;1461;299|34	ENSP00000257177:Q1462L;ENSP00000360599:Q1461L|.	ENSP00000257177:Q1462L|.	Q|R	-|-	2|1	0|2	ZCCHC11|ZCCHC11	52669599|52669599	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.641000|0.641000	0.38312|0.38312	3.423000|3.423000	0.52756|0.52756	2.036000|2.036000	0.60181|0.60181	0.455000|0.455000	0.32223|0.32223	CAG|AGG	ZCCHC11	-	NULL	ENSG00000134744		0.537	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZCCHC11	HGNC	protein_coding	OTTHUMT00000022462.1	-	0.00	62	0	T	XM_038288		52897011	-1	tier1	-	no_errors	ENST00000257177	ensembl	human	known	74_37	missense	29.17	51	21	SNP	1.000	A
ZDHHC15	158866	genome.wustl.edu	37	X	74644566	74644566	+	Silent	SNP	C	C	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chrX:74644566C>A	ENST00000373367.3	-	8	887	c.657G>T	c.(655-657)gtG>gtT	p.V219V	ZDHHC15_ENST00000541184.1_Silent_p.V210V|ZDHHC15_ENST00000373361.3_Missense_Mutation_p.W179L	NM_144969.2	NP_659406.1	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15	219					establishment of protein localization (GO:0045184)|protein palmitoylation (GO:0018345)|synaptic vesicle maturation (GO:0016188)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(1)|lung(11)|ovary(2)|skin(2)	26						ACATGCAGGCCACAAAGAGAA	0.378																																																	0													85.0	64.0	71.0					X																	74644566		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056374	CCDS14430.1, CCDS55454.1	Xq13.3	2008-05-02			ENSG00000102383	ENSG00000102383		"""Zinc fingers, DHHC-type"""	20342	protein-coding gene	gene with protein product		300576					Standard	NM_144969		Approved	FLJ31812, MRX91	uc004ecg.3	Q96MV8	OTTHUMG00000021866	ENST00000373367.3:c.657G>T	X.37:g.74644566C>A			B3KVG7|Q3SY30|Q6UWH3	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.W179L	ENST00000373367.3	37	c.536	CCDS14430.1	X	.	.	.	.	.	.	.	.	.	.	C	6.932	0.541767	0.13250	.	.	ENSG00000102383	ENST00000373361	T	0.17054	2.3	5.58	4.69	0.59074	.	.	.	.	.	T	0.13927	0.0337	.	.	.	0.35756	D	0.819762	.	.	.	.	.	.	T	0.07481	-1.0770	6	0.07644	T	0.81	-16.4706	14.555	0.68094	0.0:0.8569:0.1431:0.0	.	.	.	.	L	179	ENSP00000362459:W179L	ENSP00000362459:W179L	W	-	2	0	ZDHHC15	74561291	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.712000	0.37940	1.194000	0.43101	0.600000	0.82982	TGG	ZDHHC15	-	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	ENSG00000102383		0.378	ZDHHC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC15	HGNC	protein_coding	OTTHUMT00000057283.1	-	0.00	63	0	C	NM_144969		74644566	-1	tier1	-	no_errors	ENST00000373361	ensembl	human	known	74_37	missense	40.91	26	18	SNP	1.000	A
ZNF212	7988	genome.wustl.edu	37	7	148947553	148947553	+	Missense_Mutation	SNP	C	C	T	rs545726599		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr7:148947553C>T	ENST00000335870.2	+	2	456	c.328C>T	c.(328-330)Cgg>Tgg	p.R110W		NM_012256.3	NP_036388.2	Q9UDV6	ZN212_HUMAN	zinc finger protein 212	110					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|ovary(1)|prostate(1)	9	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)			ACTGCAGAGGCGGCTGGAGAA	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		16441	0.0		0.0	False		,,,				2504	0.001																0													77.0	91.0	86.0					7																	148947553		2203	4300	6503	SO:0001583	missense	0			U38864	CCDS5896.1	7q36.1	2013-01-08			ENSG00000170260	ENSG00000170260		"""Zinc fingers, C2H2-type"", ""-"""	13004	protein-coding gene	gene with protein product		602386				9169157	Standard	NM_012256		Approved	C2H2-150	uc003wfp.3	Q9UDV6	OTTHUMG00000158968	ENST00000335870.2:c.328C>T	7.37:g.148947553C>T	ENSP00000338572:p.Arg110Trp		B2RCF4|Q13396|Q8N664	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_DUF3669_Znf,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R110W	ENST00000335870.2	37	c.328	CCDS5896.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.92|16.92	3.256550|3.256550	0.59321|0.59321	.|.	.|.	ENSG00000170260|ENSG00000170260	ENST00000481584|ENST00000335870	.|T	.|0.80909	.|-1.43	5.95|5.95	5.0|5.0	0.66597|0.66597	.|.	.|0.000000	.|0.49305	.|D	.|0.000143	T|T	0.77691|0.77691	0.4168|0.4168	M|M	0.76328|0.76328	2.33|2.33	0.37636|0.37636	D|D	0.921846|0.921846	.|P	.|0.35959	.|0.53	.|B	.|0.32465	.|0.146	T|T	0.81493|0.81493	-0.0908|-0.0908	5|10	.|0.56958	.|D	.|0.05	-32.6889|-32.6889	10.6601|10.6601	0.45698|0.45698	0.2344:0.7656:0.0:0.0|0.2344:0.7656:0.0:0.0	.|.	.|110	.|Q9UDV6	.|ZN212_HUMAN	V|W	7|110	.|ENSP00000338572:R110W	.|ENSP00000338572:R110W	A|R	+|+	2|1	0|2	ZNF212|ZNF212	148578486|148578486	0.993000|0.993000	0.37304|0.37304	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	0.177000|0.177000	0.16801|0.16801	2.826000|2.826000	0.97356|0.97356	0.563000|0.563000	0.77884|0.77884	GCG|CGG	ZNF212	-	pfam_DUF3669_Znf	ENSG00000170260		0.647	ZNF212-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF212	HGNC	protein_coding	OTTHUMT00000352710.1	-	0.00	88	0	C	NM_012256		148947553	+1	tier1	-	no_errors	ENST00000335870	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
ZPR1	8882	genome.wustl.edu	37	11	116653716	116653716	+	Missense_Mutation	SNP	C	C	A	rs201683739		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr11:116653716C>A	ENST00000227322.3	-	11	1070	c.1011G>T	c.(1009-1011)gaG>gaT	p.E337D		NM_003904.3	NP_003895.1	O75312	ZPR1_HUMAN		337					apoptotic process involved in development (GO:1902742)|axon development (GO:0061564)|Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA endoreduplication (GO:0042023)|inner cell mass cell proliferation (GO:0001833)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of motor neuron apoptotic process (GO:2000672)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of RNA splicing (GO:0033120)|positive regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071931)|pre-mRNA catabolic process (GO:1990261)|regulation of myelination (GO:0031641)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|trophectodermal cell proliferation (GO:0001834)	axon (GO:0030424)|Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|SMN complex (GO:0032797)	translation initiation factor binding (GO:0031369)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.61e-06)|all cancers(92;0.000139)|OV - Ovarian serous cystadenocarcinoma(223;0.153)		CAAATTCTAGCTCTGGGATTT	0.502																																																	0													87.0	76.0	80.0					11																	116653716		2201	4296	6497	SO:0001583	missense	0																														ENST00000227322.3:c.1011G>T	11.37:g.116653716C>A	ENSP00000227322:p.Glu337Asp		Q2TAA0	Missense_Mutation	SNP	pfam_Znf_ZPR1,smart_Znf_ZPR1,tigrfam_Znf_ZPR1	p.E337D	ENST00000227322.3	37	c.1011	CCDS8375.1	11	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	25.0|25.0|25.0	4.597040|4.597040|4.597040	0.87055|0.87055|0.87055	.|.|.	.|.|.	ENSG00000109917|ENSG00000109917|ENSG00000109917	ENST00000429220|ENST00000227322|ENST00000444935	.|T|.	.|0.65549|.	.|-0.16|.	6.17|6.17|6.17	2.7|2.7|2.7	0.31948|0.31948|0.31948	.|Zinc finger, ZPR1-type (3);|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	T|T|T	0.76528|0.76528|0.76528	0.4000|0.4000|0.4000	M|M|M	0.87180|0.87180|0.87180	2.865|2.865|2.865	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;D|.	.|0.71674|.	.|0.998;0.995|.	.|D;D|.	.|0.71414|.	.|0.964;0.973|.	T|T|T	0.78650|0.78650|0.78650	-0.2121|-0.2121|-0.2121	5|10|5	.|0.72032|.	.|D|.	.|0.01|.	-28.0208|-28.0208|-28.0208	12.1201|12.1201|12.1201	0.53887|0.53887|0.53887	0.0:0.7704:0.0:0.2296|0.0:0.7704:0.0:0.2296|0.0:0.7704:0.0:0.2296	.|.|.	.|286;337|.	.|B4DVT8;O75312|.	.|.;ZPR1_HUMAN|.	S|D|I	264|337|337	.|ENSP00000227322:E337D|.	.|ENSP00000227322:E337D|.	A|E|S	-|-|-	1|3|2	0|2|0	ZNF259|ZNF259|ZNF259	116158926|116158926|116158926	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.990000|0.990000|0.990000	0.78478|0.78478|0.78478	3.706000|3.706000|3.706000	0.54830|0.54830|0.54830	0.829000|0.829000|0.829000	0.34733|0.34733|0.34733	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GCT|GAG|AGC	ZNF259	-	pfam_Znf_ZPR1,smart_Znf_ZPR1,tigrfam_Znf_ZPR1	ENSG00000109917		0.502	ZNF259-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF259	HGNC	protein_coding	OTTHUMT00000106283.2		0.00	57	0	C			116653716	-1			no_errors	ENST00000227322	ensembl	human	known	74_37	missense	6.67	42	3	SNP	1.000	A
ZNF33A	7581	genome.wustl.edu	37	10	38344263	38344263	+	Missense_Mutation	SNP	A	A	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr10:38344263A>T	ENST00000458705.2	+	5	1366	c.1208A>T	c.(1207-1209)cAg>cTg	p.Q403L	ZNF33A_ENST00000307441.9_Missense_Mutation_p.Q403L|ZNF33A_ENST00000374618.3_Missense_Mutation_p.Q404L|ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000432900.2_Missense_Mutation_p.Q410L			Q06730	ZN33A_HUMAN	zinc finger protein 33A	403					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						ACATTACACCAGAGAACACAT	0.433																																																	0													89.0	92.0	91.0					10																	38344263		2203	4300	6503	SO:0001583	missense	0			D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.1208A>T	10.37:g.38344263A>T	ENSP00000387713:p.Gln403Leu		A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q410L	ENST00000458705.2	37	c.1229	CCDS31182.1	10	.	.	.	.	.	.	.	.	.	.	A	14.66	2.602210	0.46423	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000307441	T;T;T;T	0.14391	2.51;2.51;2.51;2.51	2.34	2.34	0.29019	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.239546	0.21722	N	0.070101	T	0.13457	0.0326	N	0.03294	-0.36	0.23287	N	0.997973	D;D;D	0.89917	0.998;0.998;1.0	D;D;D	0.79108	0.981;0.992;0.968	T	0.07462	-1.0771	10	0.62326	D	0.03	.	8.1899	0.31361	1.0:0.0:0.0:0.0	.	410;403;404	F6TH33;Q06730;F8WAJ5	.;ZN33A_HUMAN;.	L	404;410;403;403	ENSP00000363747:Q404L;ENSP00000402467:Q410L;ENSP00000387713:Q403L;ENSP00000304268:Q403L	ENSP00000304268:Q403L	Q	+	2	0	ZNF33A	38384269	0.037000	0.19845	1.000000	0.80357	0.993000	0.82548	1.266000	0.33039	1.053000	0.40415	0.377000	0.23210	CAG	ZNF33A	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000189180		0.433	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF33A	HGNC	protein_coding	OTTHUMT00000047614.1	-	0.00	63	0	A	NM_006974		38344263	+1	tier1	-	no_errors	ENST00000432900	ensembl	human	known	74_37	missense	20.27	59	15	SNP	1.000	T
ZNF385A	25946	genome.wustl.edu	37	12	54767829	54767829	+	Missense_Mutation	SNP	C	C	T	rs201286538		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr12:54767829C>T	ENST00000338010.5	-	4	402	c.349G>A	c.(349-351)Gtc>Atc	p.V117I	ZNF385A_ENST00000394313.2_Missense_Mutation_p.V97I|ZNF385A_ENST00000552382.1_5'UTR|ZNF385A_ENST00000546970.1_Missense_Mutation_p.V97I|ZNF385A_ENST00000551109.1_Missense_Mutation_p.V97I|ZNF385A_ENST00000352268.6_Missense_Mutation_p.V117I|RP11-753H16.3_ENST00000550474.1_RNA|ZNF385A_ENST00000551771.1_Missense_Mutation_p.V97I|RP11-753H16.5_ENST00000552785.1_RNA	NM_001130967.1	NP_001124439.1	Q96PM9	Z385A_HUMAN	zinc finger protein 385A	117					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|hemostasis (GO:0007599)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)|positive regulation of DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:1902164)|positive regulation of fat cell differentiation (GO:0045600)|regulation of cytoplasmic translation (GO:2000765)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA 3'-UTR binding (GO:0003730)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(1)	15						GGTTCTCGGACGCCAGGCTCC	0.597																																																	0								C	ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	81.0	69.0	73.0		289,349,349	-1.4	0.0	12		73	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense,missense	ZNF385A	NM_015481.1,NM_001130968.1,NM_001130967.1	29,29,29	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	benign,benign,benign	97/367,117/306,117/387	54767829	3,13003	2203	4300	6503	SO:0001583	missense	0			AF304052	CCDS8879.1, CCDS44910.1, CCDS44911.1	12q13.13	2012-10-05	2007-12-06	2007-12-06		ENSG00000161642			17521	protein-coding gene	gene with protein product		609124	"""zinc finger protein 385"""	ZNF385			Standard	XM_005268785		Approved	DKFZp586G1122, Hzf, ZFP385	uc001sfy.3	Q96PM9	OTTHUMG00000169840	ENST00000338010.5:c.349G>A	12.37:g.54767829C>T	ENSP00000338927:p.Val117Ile		B2RDN5|B4DKH2|F1T0F1|J3KNS3|Q5VH53|Q9H7R6|Q9UFU3	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.V117I	ENST00000338010.5	37	c.349	CCDS44911.1	12	.	.	.	.	.	.	.	.	.	.	C	6.888	0.533269	0.13188	0.0	3.49E-4	ENSG00000161642	ENST00000551109;ENST00000352268;ENST00000394313;ENST00000338010;ENST00000546970;ENST00000551771;ENST00000546919;ENST00000549937;ENST00000549962;ENST00000547210;ENST00000550774;ENST00000550120	T;T;T;T;T;T;T;T;T;T;T	0.44083	1.56;0.98;1.56;1.56;1.56;0.98;1.55;1.57;0.95;0.93;0.94	4.02	-1.42	0.08913	.	1.246770	0.05892	N	0.628450	T	0.21186	0.0510	N	0.03608	-0.345	0.09310	N	1	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.001;0.001	B;B;B;B;B	0.06405	0.001;0.0;0.002;0.001;0.001	T	0.23084	-1.0198	10	0.32370	T	0.25	-0.4248	10.2868	0.43573	0.0:0.5539:0.0:0.4461	.	97;97;97;97;97	Q96PM9-2;F8VSJ1;F8VRY0;Q96PM9;F1T0F1	.;.;.;Z385A_HUMAN;.	I	97;117;97;117;97;97;97;79;80;97;97;60	ENSP00000449161:V97I;ENSP00000293385:V117I;ENSP00000377849:V97I;ENSP00000338927:V117I;ENSP00000446913:V97I;ENSP00000447162:V97I;ENSP00000448466:V97I;ENSP00000448567:V79I;ENSP00000450149:V80I;ENSP00000448264:V97I;ENSP00000449462:V97I	ENSP00000338927:V117I	V	-	1	0	ZNF385A	53054096	0.000000	0.05858	0.000000	0.03702	0.397000	0.30659	-0.985000	0.03751	-0.726000	0.04895	-1.134000	0.01955	GTC	ZNF385A	-	NULL	ENSG00000161642		0.597	ZNF385A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385A	HGNC	protein_coding	OTTHUMT00000406162.1	-	0.00	80	0	C	NM_015481		54767829	-1	tier1	rs201286538	no_errors	ENST00000338010	ensembl	human	known	74_37	missense	26.98	46	17	SNP	0.016	T
ZNF395	55893	genome.wustl.edu	37	8	28206730	28206730	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr8:28206730G>T	ENST00000344423.5	-	9	1473	c.1342C>A	c.(1342-1344)Cta>Ata	p.L448I	ZNF395_ENST00000523095.1_Missense_Mutation_p.L448I|ZNF395_ENST00000523202.1_Missense_Mutation_p.L448I	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	448					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		CTGAAGCTTAGCGACCGGCTC	0.622																																																	0													69.0	73.0	72.0					8																	28206730		2203	4300	6503	SO:0001583	missense	0			AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.1342C>A	8.37:g.28206730G>T	ENSP00000340494:p.Leu448Ile		B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.L448I	ENST00000344423.5	37	c.1342	CCDS6067.1	8	.	.	.	.	.	.	.	.	.	.	G	21.7	4.182357	0.78677	.	.	ENSG00000186918	ENST00000344423;ENST00000523202;ENST00000523095	T;T;T	0.46451	0.87;0.87;0.87	5.5	5.5	0.81552	.	0.418082	0.24169	N	0.040914	T	0.38401	0.1039	L	0.39898	1.24	0.80722	D	1	P	0.46656	0.882	B	0.43445	0.42	T	0.08432	-1.0722	10	0.30078	T	0.28	-17.5884	14.8936	0.70627	0.0:0.0:1.0:0.0	.	448	Q9H8N7	ZN395_HUMAN	I	448	ENSP00000340494:L448I;ENSP00000429640:L448I;ENSP00000428452:L448I	ENSP00000340494:L448I	L	-	1	2	ZNF395	28262649	0.979000	0.34478	0.831000	0.32960	0.882000	0.50991	2.645000	0.46621	2.596000	0.87737	0.561000	0.74099	CTA	ZNF395	-	NULL	ENSG00000186918		0.622	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF395	HGNC	protein_coding	OTTHUMT00000219976.1	-	0.00	49	0	G			28206730	-1	tier1	-	no_errors	ENST00000344423	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.959	T
ZNF587B	100293516	genome.wustl.edu	37	19	58352946	58352946	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:58352946G>C	ENST00000442832.4	+	3	1138	c.904G>C	c.(904-906)Gaa>Caa	p.E302Q	ZNF587B_ENST00000316462.4_Intron|ZNF587B_ENST00000594901.1_Missense_Mutation_p.E302Q|CTD-2583A14.10_ENST00000598031.1_Intron	NM_001204818.1	NP_001191747.1	E7ETH6	Z587B_HUMAN	zinc finger protein 587B	302					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										TGGGTGTGAAGAATGTGGGAA	0.398																																																	0																																										SO:0001583	missense	0			AK299091	CCDS56109.1	19q13.43	2013-01-08				ENSG00000269343		"""Zinc fingers, C2H2-type"", ""-"""	37142	protein-coding gene	gene with protein product							Standard	NM_001204818		Approved		uc021vcp.1	E7ETH6		ENST00000442832.4:c.904G>C	19.37:g.58352946G>C	ENSP00000392410:p.Glu302Gln		B4DR41	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E302Q	ENST00000442832.4	37	c.904	CCDS56109.1	19	.	.	.	.	.	.	.	.	.	.	.	11.46	1.643983	0.29246	.	.	ENSG00000198466	ENST00000442832	T	0.18502	2.21	1.95	-0.431	0.12295	.	.	.	.	.	T	0.19167	0.0460	N	0.25332	0.735	.	.	.	D;D	0.69078	0.997;0.975	D;P	0.68765	0.96;0.553	T	0.26360	-1.0105	7	.	.	.	.	1.954	0.03373	0.1379:0.1938:0.4716:0.1966	.	302;251	E7ETH6;Q92967	.;.	Q	302	ENSP00000392410:E302Q	.	E	+	1	0	ZNF587	63044758	0.000000	0.05858	0.126000	0.21872	0.121000	0.20230	-1.807000	0.01734	0.147000	0.19030	-1.254000	0.01491	GAA	ZNF587B	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000269343		0.398	ZNF587B-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	ZNF587B	HGNC	protein_coding	OTTHUMT00000466834.2	-	0.00	101	0	G	NM_001204818		58352946	+1	tier1	-	no_errors	ENST00000442832	ensembl	human	known	74_37	missense	29.76	58	25	SNP	0.014	C
ZNF638	27332	genome.wustl.edu	37	2	71626765	71626765	+	Silent	SNP	G	G	T	rs145725176		TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr2:71626765G>T	ENST00000409544.1	+	13	3207	c.2577G>T	c.(2575-2577)gtG>gtT	p.V859V	ZNF638_ENST00000355812.3_Silent_p.V859V|ZNF638_ENST00000264447.4_Silent_p.V859V	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	859					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						ACAAACCTGTGACTATACCAG	0.363																																																	0													122.0	129.0	127.0					2																	71626765		2203	4300	6503	SO:0001819	synonymous_variant	0			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.2577G>T	2.37:g.71626765G>T			B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Silent	SNP	pfam_RRM_dom,smart_Znf_U1,smart_Znf_C2H2-like,smart_RRM_dom,pfscan_Znf_C2H2_matrin,pfscan_RRM_dom	p.V859	ENST00000409544.1	37	c.2577	CCDS1917.1	2																																																																																			ZNF638	-	NULL	ENSG00000075292		0.363	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF638	HGNC	protein_coding	OTTHUMT00000327431.1	-	0.00	86	0	G	NM_014497		71626765	+1	tier1	-	no_errors	ENST00000264447	ensembl	human	known	74_37	silent	8.62	53	5	SNP	0.101	T
ZNF646	9726	genome.wustl.edu	37	16	31088424	31088424	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr16:31088424G>T	ENST00000394979.2	+	1	1202	c.779G>T	c.(778-780)aGc>aTc	p.S260I	ZNF668_ENST00000564456.1_5'Flank|ZNF646_ENST00000300850.5_Missense_Mutation_p.S260I|ZNF668_ENST00000300849.4_5'Flank			O15015	ZN646_HUMAN	zinc finger protein 646	260					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						CACCGCCAGAGCCACACGCTG	0.592																																																	0													92.0	83.0	86.0					16																	31088424		2197	4300	6497	SO:0001583	missense	0			AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.779G>T	16.37:g.31088424G>T	ENSP00000378429:p.Ser260Ile		Q8IVD8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S260I	ENST00000394979.2	37	c.779		16	.	.	.	.	.	.	.	.	.	.	G	18.30	3.593887	0.66219	.	.	ENSG00000167395	ENST00000300850;ENST00000394979;ENST00000439353	T;T	0.52295	0.67;0.67	5.51	5.51	0.81932	.	.	.	.	.	T	0.53206	0.1782	N	0.16368	0.405	0.39859	D	0.973341	D	0.76494	0.999	D	0.91635	0.999	T	0.51148	-0.8742	9	0.22109	T	0.4	-24.2249	18.1705	0.89744	0.0:0.0:1.0:0.0	.	260	O15015-2	.	I	260;260;25	ENSP00000300850:S260I;ENSP00000378429:S260I	ENSP00000300850:S260I	S	+	2	0	ZNF646	30995925	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.561000	0.53770	2.583000	0.87209	0.655000	0.94253	AGC	ZNF646	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167395		0.592	ZNF646-003	KNOWN	basic	protein_coding	ZNF646	HGNC	protein_coding	OTTHUMT00000108510.2		0.00	60	0	G	NM_014699		31088424	+1			no_errors	ENST00000300850	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
ZNF700	90592	genome.wustl.edu	37	19	12060674	12060674	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:12060674G>T	ENST00000254321.5	+	4	1978	c.1835G>T	c.(1834-1836)aGg>aTg	p.R612M	ZNF763_ENST00000590798.1_Intron|ZNF700_ENST00000482090.1_Missense_Mutation_p.R594M|ZNF763_ENST00000591944.1_Intron|ZNF763_ENST00000538752.1_Intron|CTD-2006C1.12_ENST00000586394.1_RNA	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	612					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						AAGCATGGTAGGACTCACACT	0.473																																																	0													102.0	100.0	101.0					19																	12060674		2203	4300	6503	SO:0001583	missense	0			AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.1835G>T	19.37:g.12060674G>T	ENSP00000254321:p.Arg612Met		B9EGU4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R612M	ENST00000254321.5	37	c.1835	CCDS32915.1	19	.	.	.	.	.	.	.	.	.	.	g	9.578	1.122912	0.20959	.	.	ENSG00000196757	ENST00000254321	T	0.25579	1.79	0.563	-1.13	0.09775	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.44540	0.1298	M	0.76328	2.33	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.27971	-1.0058	9	0.72032	D	0.01	.	6.4069	0.21670	0.0:0.0:0.7111:0.2889	.	612	Q9H0M5	ZN700_HUMAN	M	612	ENSP00000254321:R612M	ENSP00000254321:R612M	R	+	2	0	ZNF700	11921674	0.000000	0.05858	0.002000	0.10522	0.109000	0.19521	-0.433000	0.06948	-0.448000	0.07128	0.313000	0.20887	AGG	ZNF700	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196757		0.473	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF700	HGNC	protein_coding	OTTHUMT00000344126.2	-	0.00	56	0	G	NM_144566		12060674	+1	tier1	-	no_errors	ENST00000254321	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.000	T
ZNF676	163223	genome.wustl.edu	37	19	22363643	22363643	+	Silent	SNP	C	C	T	rs578027971	byFrequency	TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:22363643C>T	ENST00000397121.2	-	3	1193	c.876G>A	c.(874-876)tcG>tcA	p.S292S		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	292			S -> W (in dbSNP:rs11671538).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S292S(1)		NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				GCTTTGAGGACGAGTTGGAAG	0.438													C|||	2	0.000399361	0.0	0.0	5008	,	,		26954	0.0		0.0	False		,,,				2504	0.002																1	Substitution - coding silent(1)	prostate(1)											102.0	106.0	105.0					19																	22363643		2158	4279	6437	SO:0001819	synonymous_variant	0			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.876G>A	19.37:g.22363643C>T			A8MVX5	Silent	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S292	ENST00000397121.2	37	c.876	CCDS42539.1	19																																																																																			ZNF676	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196109		0.438	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF676	HGNC	protein_coding	OTTHUMT00000464392.1		0.00	37	0	C	NM_001001411		22363643	-1			no_errors	ENST00000397121	ensembl	human	known	74_37	silent	6.06	31	2	SNP	0.000	T
ZNF733P	643955	genome.wustl.edu	37	7	62752571	62752571	+	RNA	SNP	T	T	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr7:62752571T>G	ENST00000331425.6	-	0	864					NR_003952.1				zinc finger protein 733, pseudogene																		ATTCTTCACATTTGTAGGGTC	0.478																																																	0																																												0					7q11.21	2012-04-20	2012-04-20	2012-04-20	ENSG00000185037	ENSG00000185037			32473	pseudogene	pseudogene			"""zinc finger protein 733"""	ZNF733			Standard	NR_003952		Approved		uc011kdj.2		OTTHUMG00000156270		7.37:g.62752571T>G				RNA	SNP	-	NULL	ENST00000331425.6	37	NULL		7																																																																																			ZNF733P	-	-	ENSG00000185037		0.478	ZNF733P-002	KNOWN	basic	processed_transcript	ZNF733P	HGNC	pseudogene	OTTHUMT00000343679.1		0.00	54	0	T			62752571	-1			no_errors	ENST00000331425	ensembl	human	known	74_37	rna	16.67	40	8	SNP	0.823	G
ZNF808	388558	genome.wustl.edu	37	19	53058173	53058173	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:53058173G>A	ENST00000359798.4	+	5	2184	c.2004G>A	c.(2002-2004)tgG>tgA	p.W668*		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	668					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		CACTTGTATGGCATCGTAGAC	0.403																																																	0													127.0	131.0	129.0					19																	53058173		2203	4300	6503	SO:0001587	stop_gained	0			CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.2004G>A	19.37:g.53058173G>A	ENSP00000352846:p.Trp668*		Q68CN7	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.W668*	ENST00000359798.4	37	c.2004	CCDS46167.1	19	.	.	.	.	.	.	.	.	.	.	.	24.7	4.563083	0.86335	.	.	ENSG00000198482	ENST00000359798	.	.	.	1.38	-2.75	0.05914	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	1.1951	0.01873	0.216:0.3413:0.2815:0.1611	.	.	.	.	X	668	.	ENSP00000352846:W668X	W	+	3	0	ZNF808	57749985	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-6.495000	0.00064	-2.335000	0.00629	-0.754000	0.03487	TGG	ZNF808	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198482		0.403	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF808	HGNC	protein_coding	OTTHUMT00000350447.3	-	0.00	79	0	G	NM_001039886		53058173	+1	tier1	-	no_errors	ENST00000359798	ensembl	human	known	74_37	nonsense	5.63	67	4	SNP	0.022	A
ZNF831	128611	genome.wustl.edu	37	20	57767928	57767928	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr20:57767928G>C	ENST00000371030.2	+	1	1854	c.1854G>C	c.(1852-1854)gaG>gaC	p.E618D		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	618							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					TCTCCCAGGAGAAGTGGCAGG	0.592																																																	0													60.0	69.0	66.0					20																	57767928		2057	4202	6259	SO:0001583	missense	0			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.1854G>C	20.37:g.57767928G>C	ENSP00000360069:p.Glu618Asp		Q5TDR4|Q8TCP0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E618D	ENST00000371030.2	37	c.1854	CCDS42894.1	20	.	.	.	.	.	.	.	.	.	.	G	12.82	2.053618	0.36277	.	.	ENSG00000124203	ENST00000371030	T	0.06068	3.35	5.21	3.26	0.37387	.	0.117279	0.38326	N	0.001723	T	0.02929	0.0087	N	0.12746	0.255	0.26098	N	0.98086	B	0.30664	0.289	B	0.25987	0.065	T	0.38908	-0.9639	10	0.40728	T	0.16	-25.3256	2.2315	0.03997	0.1538:0.1688:0.5035:0.1739	.	618	Q5JPB2	ZN831_HUMAN	D	618	ENSP00000360069:E618D	ENSP00000360069:E618D	E	+	3	2	ZNF831	57201323	0.991000	0.36638	1.000000	0.80357	0.941000	0.58515	0.311000	0.19380	0.582000	0.29556	0.655000	0.94253	GAG	ZNF831	-	NULL	ENSG00000124203		0.592	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	HGNC	protein_coding	OTTHUMT00000079916.2	-	0.00	36	0	G	NM_178457		57767928	+1	tier1	-	no_errors	ENST00000371030	ensembl	human	novel	74_37	missense	38.46	8	5	SNP	1.000	C
ZNF846	162993	genome.wustl.edu	37	19	9869432	9869432	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:9869432G>T	ENST00000397902.2	-	6	734	c.321C>A	c.(319-321)agC>agA	p.S107R	ZNF846_ENST00000588267.1_5'UTR|ZNF846_ENST00000592859.1_5'UTR|ZNF846_ENST00000586293.1_Missense_Mutation_p.Q80K	NM_001077624.1	NP_001071092.1	Q147U1	ZN846_HUMAN	zinc finger protein 846	107					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22						CTGCAGTATTGCTTCTCTCCT	0.343																																																	0													103.0	94.0	97.0					19																	9869432		1829	4093	5922	SO:0001583	missense	0			AK097652	CCDS42496.1	19p13.2	2013-01-08			ENSG00000196605	ENSG00000196605		"""Zinc fingers, C2H2-type"", ""-"""	27260	protein-coding gene	gene with protein product							Standard	NM_001077624		Approved		uc002mmb.1	Q147U1		ENST00000397902.2:c.321C>A	19.37:g.9869432G>T	ENSP00000380999:p.Ser107Arg		A8K0H1|B3KUP1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S107R	ENST00000397902.2	37	c.321	CCDS42496.1	19	.	.	.	.	.	.	.	.	.	.	.	14.26	2.480890	0.44044	.	.	ENSG00000196605	ENST00000397902	T	0.15256	2.44	2.15	-0.0562	0.13806	.	.	.	.	.	T	0.14700	0.0355	L	0.35487	1.065	0.09310	N	1	P	0.52061	0.95	P	0.47864	0.559	T	0.18903	-1.0322	8	.	.	.	.	6.2064	0.20606	0.2885:0.0:0.7115:0.0	.	107	Q147U1	ZN846_HUMAN	R	107	ENSP00000380999:S107R	.	S	-	3	2	ZNF846	9730432	0.000000	0.05858	0.000000	0.03702	0.942000	0.58702	-0.431000	0.06965	0.063000	0.16370	-0.259000	0.10710	AGC	ZNF846	-	NULL	ENSG00000196605		0.343	ZNF846-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF846	HGNC	protein_coding	OTTHUMT00000450253.1		0.00	30	0	G	NM_001077624		9869432	-1			no_errors	ENST00000397902	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.094	T
ZSCAN5B	342933	genome.wustl.edu	37	19	56701846	56701846	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:56701846C>G	ENST00000586855.2	-	5	1151	c.838G>C	c.(838-840)Gct>Cct	p.A280P	ZSCAN5B_ENST00000358992.3_Missense_Mutation_p.A280P			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	280					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						TGAGTCAAAGCTTCTCTCTCC	0.517																																																	0													160.0	155.0	157.0					19																	56701846		2203	4300	6503	SO:0001583	missense	0				CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.838G>C	19.37:g.56701846C>G	ENSP00000466072:p.Ala280Pro			Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.A280P	ENST00000586855.2	37	c.838	CCDS46203.1	19	.	.	.	.	.	.	.	.	.	.	C	11.22	1.573851	0.28092	.	.	ENSG00000197213	ENST00000358992	T	0.06371	3.31	1.86	-2.3	0.06785	.	.	.	.	.	T	0.10078	0.0247	M	0.75447	2.3	0.09310	N	1	P	0.50710	0.938	P	0.49140	0.601	T	0.12142	-1.0559	9	0.39692	T	0.17	.	2.4583	0.04535	0.2267:0.4583:0.0:0.315	.	280	A6NJL1	ZSA5B_HUMAN	P	280	ENSP00000351883:A280P	ENSP00000351883:A280P	A	-	1	0	ZSCAN5B	61393658	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.168000	0.09925	-0.484000	0.06763	-1.206000	0.01644	GCT	ZSCAN5B	-	NULL	ENSG00000197213		0.517	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN5B	HGNC	protein_coding	OTTHUMT00000457834.2	-	0.00	112	0	C	NM_001080456		56701846	-1	tier1	-	no_errors	ENST00000358992	ensembl	human	known	74_37	missense	5.66	100	6	SNP	0.003	G
ZSCAN5C	649137	genome.wustl.edu	37	19	56720253	56720253	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr19:56720253G>A	ENST00000534327.1	+	5	1324	c.1175G>A	c.(1174-1176)cGc>cAc	p.R392H	ZSCAN5C_ENST00000376267.1_Missense_Mutation_p.R392H			A6NGD5	ZSA5C_HUMAN	zinc finger and SCAN domain containing 5C	392					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|lung(6)|stomach(1)	8						TGCGGGAAGCGCTTCATGCAG	0.557																																																	0																																										SO:0001583	missense	0					19q13.43	2013-01-08			ENSG00000204532	ENSG00000204532		"""-"", ""Zinc fingers, C2H2-type"""	34294	protein-coding gene	gene with protein product							Standard	NG_012782		Approved	ZNF495C		A6NGD5	OTTHUMG00000167475	ENST00000534327.1:c.1175G>A	19.37:g.56720253G>A	ENSP00000435234:p.Arg392His			Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R392H	ENST00000534327.1	37	c.1175		19	.	.	.	.	.	.	.	.	.	.	G	11.87	1.768403	0.31320	.	.	ENSG00000204532	ENST00000534327;ENST00000376267	T;T	0.19938	2.11;2.11	1.38	0.152	0.14893	.	.	.	.	.	T	0.19967	0.0480	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26744	-1.0094	6	0.56958	D	0.05	.	5.1586	0.15048	0.0:0.4089:0.5911:0.0	.	.	.	.	H	392	ENSP00000435234:R392H;ENSP00000365443:R392H	ENSP00000365443:R392H	R	+	2	0	ZSCAN5C	61412065	0.000000	0.05858	0.004000	0.12327	0.023000	0.10783	-0.131000	0.10482	0.116000	0.18110	0.195000	0.17529	CGC	ZSCAN5C	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204532		0.557	ZSCAN5C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ZSCAN5C	HGNC	protein_coding	OTTHUMT00000394739.1	-	0.00	74	0	G	XM_001131980		56720253	+1	tier1	-	no_errors	ENST00000376267	ensembl	human	known	74_37	missense	20.45	35	9	SNP	0.000	A
ZSWIM3	140831	genome.wustl.edu	37	20	44505581	44505581	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FD-01A-11D-A33E-09	TCGA-JY-A6FD-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	32802aaf-3f39-4e84-8523-63a8702ee946	79c13e3f-d511-4ccf-a158-558a49b00f43	g.chr20:44505581G>T	ENST00000255152.2	+	2	593	c.384G>T	c.(382-384)caG>caT	p.Q128H	ZSWIM3_ENST00000454862.2_Missense_Mutation_p.Q122H	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	128							zinc ion binding (GO:0008270)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				AGAGACTCCAGCCTGTGCAGC	0.493																																																	0													71.0	68.0	69.0					20																	44505581		2203	4300	6503	SO:0001583	missense	0			AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.384G>T	20.37:g.44505581G>T	ENSP00000255152:p.Gln128His		Q9BR13	Missense_Mutation	SNP	pfam_Znf_SWIM,pfam_MULE_transposase_dom,pfam_Transposase,smart_Znf_PMZ,pfscan_Znf_SWIM	p.Q128H	ENST00000255152.2	37	c.384	CCDS13381.1	20	.	.	.	.	.	.	.	.	.	.	G	10.65	1.409212	0.25378	.	.	ENSG00000132801	ENST00000255152;ENST00000454862	T;T	0.24538	1.88;1.85	5.12	3.1	0.35709	.	0.394581	0.24732	N	0.036043	T	0.17662	0.0424	L	0.29908	0.895	0.28052	N	0.933304	B;B	0.12630	0.006;0.006	B;B	0.10450	0.005;0.005	T	0.12785	-1.0534	10	0.40728	T	0.16	-8.6067	9.2078	0.37300	0.0782:0.0:0.7764:0.1454	.	122;128	E7ETT6;Q96MP5	.;ZSWM3_HUMAN	H	128;122	ENSP00000255152:Q128H;ENSP00000406313:Q122H	ENSP00000255152:Q128H	Q	+	3	2	ZSWIM3	43938988	0.028000	0.19301	0.974000	0.42286	0.774000	0.43823	1.513000	0.35823	0.698000	0.31739	0.561000	0.74099	CAG	ZSWIM3	-	NULL	ENSG00000132801		0.493	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM3	HGNC	protein_coding	OTTHUMT00000079540.1		0.00	36	0	G	NM_080752		44505581	+1			no_errors	ENST00000255152	ensembl	human	known	74_37	missense	8.82	31	3	SNP	0.972	T
