#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA10	10349	genome.wustl.edu	37	17	67218779	67218780	+	Frame_Shift_Ins	INS	-	-	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:67218779_67218780insT	ENST00000269081.4	-	5	1002_1003	c.93_94insA	c.(91-96)aaatacfs	p.Y32fs	ABCA10_ENST00000423818.2_Frame_Shift_Ins_p.Y32fs|ABCA10_ENST00000432313.2_Frame_Shift_Ins_p.Y32fs|ABCA10_ENST00000416101.2_Frame_Shift_Ins_p.Y32fs	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	32					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					ATTTCATGGTATTTTTTTGGAA	0.337																																																	0																																										SO:0001589	frameshift_variant	0			AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.94dupA	17.37:g.67218786_67218786dupT	ENSP00000269081:p.Tyr32fs		C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Frame_Shift_Ins	INS	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.Y31fs	ENST00000269081.4	37	c.94_93	CCDS11684.1	17																																																																																			ABCA10	-	NULL	ENSG00000154263		0.337	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA10	HGNC	protein_coding	OTTHUMT00000379881.4		0.00	77	0	-	NM_080282		67218780	-1	tier1		no_errors	ENST00000269081	ensembl	human	known	74_37	frame_shift_ins	32.74	76	37	INS	0.000:0.000	T
ABCC8	6833	genome.wustl.edu	37	11	17418754	17418754	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:17418754T>G	ENST00000389817.3	-	32	4042	c.3974A>C	c.(3973-3975)tAc>tCc	p.Y1325S	ABCC8_ENST00000302539.4_Missense_Mutation_p.Y1326S			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1325					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	GAGCCCCTCGTAGCTCTCTGC	0.622																																																	0													84.0	85.0	85.0					11																	17418754		2200	4293	6493	SO:0001583	missense	0			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.3974A>C	11.37:g.17418754T>G	ENSP00000374467:p.Tyr1325Ser		A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.Y1326S	ENST00000389817.3	37	c.3977	CCDS31437.1	11	.	.	.	.	.	.	.	.	.	.	T	15.62	2.887344	0.52014	.	.	ENSG00000006071	ENST00000389817;ENST00000302539	D;D	0.91295	-2.82;-2.82	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.80984	0.4729	N	0.05177	-0.1	0.80722	D	1	B	0.22414	0.069	B	0.21546	0.035	T	0.77133	-0.2700	10	0.36615	T	0.2	.	14.8179	0.70048	0.0:0.0:0.0:1.0	.	1325	Q09428	ABCC8_HUMAN	S	1325;1326	ENSP00000374467:Y1325S;ENSP00000303960:Y1326S	ENSP00000303960:Y1326S	Y	-	2	0	ABCC8	17375330	1.000000	0.71417	1.000000	0.80357	0.698000	0.40448	8.036000	0.88901	1.904000	0.55121	0.454000	0.30748	TAC	ABCC8	-	superfamily_P-loop_NTPase	ENSG00000006071		0.622	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	HGNC	protein_coding	OTTHUMT00000389093.1	-	0.00	53	0	T	NM_000352		17418754	-1	tier1	-	no_errors	ENST00000302539	ensembl	human	known	74_37	missense	48.28	15	14	SNP	1.000	G
ACACA	31	genome.wustl.edu	37	17	35518913	35518913	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:35518913C>T	ENST00000394406.2	-	42	5210	c.5020G>A	c.(5020-5022)Ggc>Agc	p.G1674S	ACACA_ENST00000360679.3_Missense_Mutation_p.G1616S|ACACA_ENST00000361253.5_5'Flank|ACACA_ENST00000353139.5_Missense_Mutation_p.G1711S|ACACA_ENST00000335166.5_Missense_Mutation_p.G1596S	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1674					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	ATATCTCGGCCTTCTGGATAT	0.408																																					Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)												0													79.0	73.0	75.0					17																	35518913		2203	4300	6503	SO:0001583	missense	0			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.5020G>A	17.37:g.35518913C>T	ENSP00000377928:p.Gly1674Ser		B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.G1711S	ENST00000394406.2	37	c.5131	CCDS11317.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.580486	0.96565	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166;ENST00000427330	D;D;D;D	0.99304	-5.72;-5.72;-5.72;-5.72	5.22	5.22	0.72569	Carboxyl transferase (1);	0.000000	0.85682	D	0.000000	D	0.99573	0.9846	M	0.92412	3.305	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98147	1.0439	10	0.87932	D	0	-12.5231	19.2127	0.93763	0.0:1.0:0.0:0.0	.	373;1711;1674;1616	F8W6G0;Q13085-4;Q13085;Q13085-2	.;.;ACACA_HUMAN;.	S	1711;1616;1674;1698;1596;373	ENSP00000344789:G1711S;ENSP00000353898:G1616S;ENSP00000377928:G1674S;ENSP00000335323:G1596S	ENSP00000335323:G1596S	G	-	1	0	ACACA	32593026	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.766000	0.85320	2.624000	0.88883	0.447000	0.29281	GGC	ACACA	-	pfam_Carboxyl_trans	ENSG00000132142		0.408	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACA	HGNC	protein_coding	OTTHUMT00000256696.1	-	0.00	33	0	C	NM_198836		35518913	-1	tier1	-	no_errors	ENST00000353139	ensembl	human	known	74_37	missense	37.50	35	21	SNP	0.801	T
ADAR	103	genome.wustl.edu	37	1	154562755	154562755	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:154562755G>A	ENST00000368474.4	-	7	2600	c.2401C>T	c.(2401-2403)Cgc>Tgc	p.R801C	ADAR_ENST00000292205.5_Missense_Mutation_p.R844C|ADAR_ENST00000368471.3_Missense_Mutation_p.R506C	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	801					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		AAACCCATGCGTTCTGCCTTC	0.557																																																	0													104.0	94.0	97.0					1																	154562755		2203	4300	6503	SO:0001583	missense	0			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.2401C>T	1.37:g.154562755G>A	ENSP00000357459:p.Arg801Cys		B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	pfam_A_deamin,pfam_dsRNA_A_deaminase,pfam_dsRNA-bd_dom,smart_dsRNA_A_deaminase,smart_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_dsRNA_A_deaminase,pfscan_A_deamin	p.R844C	ENST00000368474.4	37	c.2530	CCDS1071.1	1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.844044	0.91197	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	T;T;T;T	0.16597	2.54;2.54;2.33;2.53	5.94	5.94	0.96194	.	0.053834	0.85682	D	0.000000	T	0.19327	0.0464	L	0.29908	0.895	0.80722	D	1	P;P;D	0.89917	0.854;0.854;1.0	B;B;P	0.60609	0.239;0.239;0.877	T	0.00607	-1.1647	10	0.66056	D	0.02	-14.9326	15.91	0.79467	0.0:0.0:0.8642:0.1358	.	782;801;801	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	C	844;801;506;796	ENSP00000292205:R844C;ENSP00000357459:R801C;ENSP00000357456:R506C;ENSP00000431794:R796C	ENSP00000292205:R844C	R	-	1	0	ADAR	152829379	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.218000	0.77991	2.816000	0.96949	0.563000	0.77884	CGC	ADAR	-	NULL	ENSG00000160710		0.557	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAR	HGNC	protein_coding	OTTHUMT00000090691.2	-	0.00	86	0	G	NM_001111		154562755	-1	tier1	-	no_errors	ENST00000292205	ensembl	human	known	74_37	missense	40.48	50	34	SNP	1.000	A
ADAR	103	genome.wustl.edu	37	1	154569329	154569329	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:154569329G>T	ENST00000368474.4	-	6	2421	c.2222C>A	c.(2221-2223)gCt>gAt	p.A741D	ADAR_ENST00000292205.5_Missense_Mutation_p.A784D|ADAR_ENST00000368471.3_Missense_Mutation_p.A446D	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	741	DRBM 3. {ECO:0000255|PROSITE- ProRule:PRU00266}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		GAATTCAGCAGCAAAGCCATG	0.557																																																	0													113.0	96.0	102.0					1																	154569329		2203	4300	6503	SO:0001583	missense	0			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.2222C>A	1.37:g.154569329G>T	ENSP00000357459:p.Ala741Asp		B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	pfam_A_deamin,pfam_dsRNA_A_deaminase,pfam_dsRNA-bd_dom,smart_dsRNA_A_deaminase,smart_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_dsRNA_A_deaminase,pfscan_A_deamin	p.A784D	ENST00000368474.4	37	c.2351	CCDS1071.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.080923	0.94050	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96	5.27	5.27	0.74061	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.000000	0.85682	D	0.000000	T	0.79375	0.4435	L	0.40543	1.245	0.80722	D	1	D;D;D	0.89917	0.998;0.999;1.0	D;D;D	0.91635	0.95;0.973;0.999	T	0.80281	-0.1448	10	0.62326	D	0.03	-13.3562	19.0782	0.93171	0.0:0.0:1.0:0.0	.	722;741;741	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	D	784;741;446;736	ENSP00000292205:A784D;ENSP00000357459:A741D;ENSP00000357456:A446D;ENSP00000431794:A736D	ENSP00000292205:A784D	A	-	2	0	ADAR	152835953	1.000000	0.71417	0.674000	0.29902	0.967000	0.64934	8.918000	0.92759	2.733000	0.93635	0.462000	0.41574	GCT	ADAR	-	pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom	ENSG00000160710		0.557	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAR	HGNC	protein_coding	OTTHUMT00000090691.2		0.00	95	0	G	NM_001111		154569329	-1			no_errors	ENST00000292205	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
ADCY9	115	genome.wustl.edu	37	16	4016810	4016810	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:4016810C>T	ENST00000294016.3	-	11	3566	c.3028G>A	c.(3028-3030)Gga>Aga	p.G1010R		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	1010					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TCCACGTCTCCGTGGTAGTGG	0.572																																																	0													118.0	110.0	113.0					16																	4016810		2197	4300	6497	SO:0001583	missense	0			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.3028G>A	16.37:g.4016810C>T	ENSP00000294016:p.Gly1010Arg		A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.G1010R	ENST00000294016.3	37	c.3028	CCDS32382.1	16	.	.	.	.	.	.	.	.	.	.	C	23.6	4.430981	0.83776	.	.	ENSG00000162104	ENST00000294016	D	0.83250	-1.7	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.90466	0.7014	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88776	0.3267	10	0.39692	T	0.17	.	19.8013	0.96509	0.0:1.0:0.0:0.0	.	1010	O60503	ADCY9_HUMAN	R	1010	ENSP00000294016:G1010R	ENSP00000294016:G1010R	G	-	1	0	ADCY9	3956811	1.000000	0.71417	0.984000	0.44739	0.839000	0.47603	7.776000	0.85560	2.761000	0.94854	0.591000	0.81541	GGA	ADCY9	-	NULL	ENSG00000162104		0.572	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY9	HGNC	protein_coding	OTTHUMT00000438076.1	-	0.00	52	0	C			4016810	-1	tier1	-	no_errors	ENST00000294016	ensembl	human	known	74_37	missense	50.00	22	22	SNP	1.000	T
ADRA1A	148	genome.wustl.edu	37	8	26721736	26721736	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr8:26721736C>T	ENST00000519229.1	-	1	757	c.751G>A	c.(751-753)Gcc>Acc	p.A251T	ADRA1A_ENST00000380586.1_Missense_Mutation_p.A251T|ADRA1A_ENST00000380572.3_Missense_Mutation_p.A251T|ADRA1A_ENST00000358857.5_Missense_Mutation_p.A251T|ADRA1A_ENST00000380582.3_Missense_Mutation_p.A251T|ADRA1A_ENST00000354550.4_Missense_Mutation_p.A251T|ADRA1A_ENST00000380573.3_Missense_Mutation_p.A251T|ADRA1A_ENST00000380581.2_Missense_Mutation_p.A251T|ADRA1A_ENST00000276393.4_Missense_Mutation_p.A251T|ADRA1A_ENST00000380587.1_Missense_Mutation_p.A251T			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	324					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	TTGGTCTTGGCGCTGGCCATC	0.617																																																	0													53.0	49.0	50.0					8																	26721736		2203	4300	6503	SO:0001583	missense	0			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.751G>A	8.37:g.26721736C>T	ENSP00000430793:p.Ala251Thr		Q9NPY0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ADRA1A_rcpt,prints_GPCR_Rhodpsn,prints_ADR_fam	p.A251T	ENST00000519229.1	37	c.751		8	.	.	.	.	.	.	.	.	.	.	C	0.028	-1.351800	0.01256	.	.	ENSG00000120907	ENST00000380586;ENST00000380587;ENST00000380582;ENST00000380581;ENST00000519229;ENST00000354550;ENST00000276393;ENST00000380573;ENST00000380572;ENST00000358857	D;D;D;D;D;D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81	5.27	-5.74	0.02391	GPCR, rhodopsin-like superfamily (1);	1.052500	0.07340	N	0.880631	T	0.64670	0.2619	N	0.16656	0.425	0.09310	N	0.999996	B;B;B;B;B;B	0.23854	0.092;0.02;0.037;0.03;0.013;0.001	B;B;B;B;B;B	0.15484	0.013;0.013;0.009;0.005;0.001;0.005	T	0.53844	-0.8381	10	0.11182	T	0.66	.	4.01	0.09618	0.53:0.2078:0.0728:0.1894	.	251;251;251;251;251;251	P35348-9;P35348-8;P35348;P35348-4;P35348-3;B0ZBD3	.;.;ADA1A_HUMAN;.;.;.	T	251	ENSP00000369960:A251T;ENSP00000369961:A251T;ENSP00000369956:A251T;ENSP00000369955:A251T;ENSP00000430793:A251T;ENSP00000346557:A251T;ENSP00000276393:A251T;ENSP00000369947:A251T;ENSP00000369946:A251T;ENSP00000351725:A251T	ENSP00000276393:A251T	A	-	1	0	ADRA1A	26777653	0.026000	0.19158	0.197000	0.23402	0.232000	0.25224	-0.361000	0.07612	-1.097000	0.03042	-1.119000	0.02030	GCC	ADRA1A	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ADRA1A_rcpt	ENSG00000120907		0.617	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	ADRA1A	HGNC	protein_coding	OTTHUMT00000376207.1		0.00	69	0	C	NM_033303		26721736	-1			no_errors	ENST00000380586	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.048	T
AHCTF1	25909	genome.wustl.edu	37	1	247016531	247016531	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:247016531C>A	ENST00000391829.2	-	32	4548	c.4425G>T	c.(4423-4425)gaG>gaT	p.E1475D	AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_Missense_Mutation_p.E1484D|AHCTF1_ENST00000366508.1_Missense_Mutation_p.E1510D			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1475	Disordered. {ECO:0000250}.|Mediates transcriptional activity. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TAAGCCTGCGCTCAGAGACAA	0.408																																					Colon(145;197 1800 4745 15099 26333)												0													45.0	42.0	43.0					1																	247016531		2203	4300	6503	SO:0001583	missense	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.4425G>T	1.37:g.247016531C>A	ENSP00000375705:p.Glu1475Asp		A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like_supfam	p.E1484D	ENST00000391829.2	37	c.4452		1	.	.	.	.	.	.	.	.	.	.	C	8.567	0.879193	0.17395	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.35421	1.31;1.31;1.31	5.76	-0.668	0.11392	.	0.277134	0.32081	N	0.006607	T	0.28234	0.0697	M	0.68952	2.095	0.26797	N	0.969284	B;B;B	0.27997	0.197;0.028;0.016	B;B;B	0.30716	0.119;0.011;0.005	T	0.18618	-1.0331	10	0.40728	T	0.16	-11.7152	1.2405	0.01962	0.136:0.2333:0.1414:0.4893	.	336;1510;1475	B3KTD2;Q8WYP5-2;Q8WYP5	.;.;ELYS_HUMAN	D	1510;1484;1475	ENSP00000355464:E1510D;ENSP00000355465:E1484D;ENSP00000375705:E1475D	ENSP00000355465:E1484D	E	-	3	2	AHCTF1	245083154	0.879000	0.30193	0.902000	0.35471	0.003000	0.03518	0.153000	0.16323	-0.377000	0.07930	-1.078000	0.02229	GAG	AHCTF1	-	NULL	ENSG00000153207		0.408	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		-	0.00	27	0	C	NM_015446		247016531	-1	tier1	-	no_errors	ENST00000326225	ensembl	human	known	74_37	missense	48.28	15	14	SNP	0.845	A
AKAP6	9472	genome.wustl.edu	37	14	32902973	32902973	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr14:32902973C>A	ENST00000280979.4	+	2	444	c.274C>A	c.(274-276)Cag>Aag	p.Q92K	AKAP6_ENST00000557272.1_Missense_Mutation_p.Q92K|AKAP6_ENST00000557354.1_Missense_Mutation_p.Q92K|AKAP6_ENST00000554449.1_3'UTR	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	92					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CTATTCAGTCCAGCAGGATTC	0.488																																					Melanoma(49;821 1200 7288 13647 42351)												0													109.0	98.0	102.0					14																	32902973		2203	4300	6503	SO:0001583	missense	0			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.274C>A	14.37:g.32902973C>A	ENSP00000280979:p.Gln92Lys		A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.Q92K	ENST00000280979.4	37	c.274	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	C	18.32	3.598433	0.66332	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557102;ENST00000557272	T;T;T	0.22539	3.2;1.96;1.95	6.12	5.24	0.73138	.	0.137286	0.52532	D	0.000079	T	0.37019	0.0988	L	0.48642	1.525	0.41383	D	0.987567	D;D	0.67145	0.993;0.996	P;P	0.60415	0.787;0.874	T	0.18903	-1.0322	10	0.87932	D	0	-11.0216	15.7883	0.78326	0.0:0.9351:0.0:0.0649	.	92;92	A7E242;Q13023	.;AKAP6_HUMAN	K	92	ENSP00000280979:Q92K;ENSP00000450531:Q92K;ENSP00000451247:Q92K	ENSP00000280979:Q92K	Q	+	1	0	AKAP6	31972724	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	3.469000	0.53093	1.625000	0.50366	-0.149000	0.13747	CAG	AKAP6	-	NULL	ENSG00000151320		0.488	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2		0.00	36	0	C	NM_004274		32902973	+1			no_errors	ENST00000280979	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	A
ALMS1	7840	genome.wustl.edu	37	2	73677770	73677770	+	Silent	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:73677770C>A	ENST00000264448.6	+	8	4224	c.4113C>A	c.(4111-4113)ggC>ggA	p.G1371G	ALMS1_ENST00000377715.1_Silent_p.G1371G|ALMS1_ENST00000409009.1_Silent_p.G1329G	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1371	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						AGACAACTGGCACACCAACTG	0.453																																																	0													82.0	85.0	84.0					2																	73677770		1865	4101	5966	SO:0001819	synonymous_variant	0			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.4113C>A	2.37:g.73677770C>A			Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	NULL	p.G1371	ENST00000264448.6	37	c.4113	CCDS42697.1	2																																																																																			ALMS1	-	NULL	ENSG00000116127		0.453	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	-	0.00	47	0	C	NM_015120		73677770	+1	tier1	-	no_errors	ENST00000264448	ensembl	human	known	74_37	silent	36.11	46	26	SNP	0.000	A
ALOX5	240	genome.wustl.edu	37	10	45920427	45920427	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:45920427G>T	ENST00000374391.2	+	6	734	c.681G>T	c.(679-681)tgG>tgT	p.W227C	ALOX5_ENST00000542434.1_Missense_Mutation_p.W227C	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	227	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	TGAATCACTGGCAGGAAGACC	0.602																																																	0													135.0	133.0	134.0					10																	45920427		2203	4300	6503	SO:0001583	missense	0			J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.681G>T	10.37:g.45920427G>T	ENSP00000363512:p.Trp227Cys		B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,prints_LipOase_mml,prints_LipOase_C,pfscan_PLAT/LH2_dom	p.W227C	ENST00000374391.2	37	c.681	CCDS7212.1	10	.	.	.	.	.	.	.	.	.	.	G	13.45	2.240991	0.39598	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	D;D	0.89343	-2.5;-2.5	5.43	4.52	0.55395	Lipoxygenase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.95303	0.8476	M	0.92649	3.33	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95728	0.8772	10	0.87932	D	0	-12.0745	12.1291	0.53932	0.084:0.0:0.916:0.0	.	227;227;227	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	C	227	ENSP00000437634:W227C;ENSP00000363512:W227C	ENSP00000363512:W227C	W	+	3	0	ALOX5	45240433	1.000000	0.71417	1.000000	0.80357	0.114000	0.19823	9.869000	0.99810	1.293000	0.44690	-0.157000	0.13467	TGG	ALOX5	-	pfam_LipOase_C,superfamily_LipOase_C	ENSG00000012779		0.602	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX5	HGNC	protein_coding	OTTHUMT00000047780.1	-	0.00	60	0	G			45920427	+1	tier1	-	no_errors	ENST00000374391	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
AMT	275	genome.wustl.edu	37	3	49459414	49459414	+	Intron	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:49459414C>T	ENST00000273588.3	-	2	561				NICN1-AS1_ENST00000424915.1_RNA|AMT_ENST00000546031.1_Splice_Site|AMT_ENST00000395338.2_Intron|AMT_ENST00000476226.1_Intron|NICN1_ENST00000422593.1_5'Flank|AMT_ENST00000538581.1_Intron|AMT_ENST00000458307.2_Intron	NM_000481.3	NP_000472.2	P48728	GCST_HUMAN	aminomethyltransferase						glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|transaminase activity (GO:0008483)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	Tetrahydrofolic acid(DB00116)	ACCCCCATGACCTCTAGCTCT	0.512																																																	0																																										SO:0001627	intron_variant	0			D13811	CCDS2797.1, CCDS54583.1, CCDS54584.1, CCDS54585.1	3p21.2-p21.1	2014-09-17	2006-05-22		ENSG00000145020	ENSG00000145020	2.1.2.10		473	protein-coding gene	gene with protein product	"""glycine cleavage system protein T"""	238310	"""aminomethyltransferase (glycine cleavage system protein T)"""			1993704, 8188235	Standard	NM_000481		Approved	GCST, NKH	uc003cww.3	P48728	OTTHUMG00000156847	ENST00000273588.3:c.258+122G>A	3.37:g.49459414C>T			A8K3I5|B4DE61|B4DJQ0|E9PBG1|Q96IG6	Splice_Site	SNP	-	e0+1	ENST00000273588.3	37	c.1+1	CCDS2797.1	3																																																																																			AMT	-	-	ENSG00000145020		0.512	AMT-003	KNOWN	basic|appris_principal|CCDS	protein_coding	AMT	HGNC	protein_coding	OTTHUMT00000346216.2	-	0.00	34	0	C	NM_000481		49459414	-1	tier1	-	no_errors	ENST00000546031	ensembl	human	known	74_37	splice_site	46.43	15	13	SNP	0.001	T
ANKRD11	29123	genome.wustl.edu	37	16	89351637	89351637	+	Frame_Shift_Del	DEL	T	T	-			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:89351637delT	ENST00000301030.4	-	9	1773	c.1313delA	c.(1312-1314)aagfs	p.K438fs	ANKRD11_ENST00000378330.2_Frame_Shift_Del_p.K438fs	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	438					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CTCTCGTGTCTTACTACCAGG	0.493																																																	0													79.0	72.0	74.0					16																	89351637		2198	4300	6498	SO:0001589	frameshift_variant	0			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.1313delA	16.37:g.89351637delT	ENSP00000301030:p.Lys438fs		Q6NTG1|Q6QMF8	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.K438fs	ENST00000301030.4	37	c.1313	CCDS32513.1	16																																																																																			ANKRD11	-	NULL	ENSG00000167522		0.493	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	HGNC	protein_coding	OTTHUMT00000430462.3		0.00	16	0	T	NM_013275		89351637	-1	tier1		no_errors	ENST00000301030	ensembl	human	known	74_37	frame_shift_del	45.45	6	5	DEL	0.636	-
ANKRD20A5P	440482	genome.wustl.edu	37	18	14225656	14225657	+	IGR	INS	-	-	A	rs553983011|rs375288028	byFrequency	TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr18:14225656_14225657insA								RNU6-316P (34851 upstream) : RP11-757O6.1 (18966 downstream)																							aaaGATAAAAGAAAAAAAAAGA	0.371																																																	0																																										SO:0001628	intergenic_variant	0																															18.37:g.14225665_14225665dupA				RNA	INS	-	NULL		37	NULL		18																																																																																			ANKRD20A5P	-	-	ENSG00000186481	0	0.371					ANKRD20A5P	HGNC				0.00	61	0	-			14225657	+1	tier1		no_errors	ENST00000577614	ensembl	human	known	74_37	rna	25.49	76	26	INS	0.354:0.398	A
ANKRD27	84079	genome.wustl.edu	37	19	33095327	33095327	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:33095327C>A	ENST00000306065.4	-	25	2655	c.2497G>T	c.(2497-2499)Ggg>Tgg	p.G833W		NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	833					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.G833R(1)		breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					ATGGAGGCCCCGTGCTGGAAA	0.493																																																	1	Substitution - Missense(1)	large_intestine(1)											55.0	40.0	45.0					19																	33095327		2203	4300	6503	SO:0001583	missense	0			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.2497G>T	19.37:g.33095327C>A	ENSP00000304292:p.Gly833Trp		Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_VPS9,superfamily_Ankyrin_rpt-contain_dom,smart_VPS9_subgr,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_VPS9,prints_Ankyrin_rpt	p.G833W	ENST00000306065.4	37	c.2497	CCDS32986.1	19	.	.	.	.	.	.	.	.	.	.	C	18.37	3.609708	0.66558	.	.	ENSG00000105186	ENST00000306065	T	0.79554	-1.28	5.48	5.48	0.80851	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000017	D	0.94268	0.8159	H	0.98446	4.235	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96359	0.9264	10	0.87932	D	0	-31.7045	18.9221	0.92529	0.0:1.0:0.0:0.0	.	833	Q96NW4	ANR27_HUMAN	W	833	ENSP00000304292:G833W	ENSP00000304292:G833W	G	-	1	0	ANKRD27	37787167	0.994000	0.37717	0.962000	0.40283	0.565000	0.35776	4.535000	0.60629	2.556000	0.86216	0.563000	0.77884	GGG	ANKRD27	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	ENSG00000105186		0.493	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD27	HGNC	protein_coding	OTTHUMT00000450329.1		0.00	54	0	C	NM_032139		33095327	-1			no_errors	ENST00000306065	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.997	A
ANKRD49	54851	genome.wustl.edu	37	11	94231249	94231249	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:94231249C>T	ENST00000544612.1	+	3	768	c.271C>T	c.(271-273)Cgg>Tgg	p.R91W	ANKRD49_ENST00000302755.4_Missense_Mutation_p.R91W|ANKRD49_ENST00000538535.1_3'UTR|ANKRD49_ENST00000540349.1_3'UTR|ANKRD49_ENST00000544253.1_3'UTR	NM_017704.2	NP_060174.2	Q8WVL7	ANR49_HUMAN	ankyrin repeat domain 49	91					positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)		p.R91W(2)		autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|urinary_tract(1)	12		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TACCACAGTGCGGAGACTCCT	0.383																																					Melanoma(113;823 1621 4352 9582 22033)												2	Substitution - Missense(2)	large_intestine(1)|central_nervous_system(1)											47.0	48.0	48.0					11																	94231249		2201	4298	6499	SO:0001583	missense	0			AF025354	CCDS8300.1	11q21	2013-01-10				ENSG00000168876		"""Ankyrin repeat domain containing"""	25970	protein-coding gene	gene with protein product						11162141	Standard	NM_017704		Approved	FLJ20189, FGIF, GBIF	uc001pew.3	Q8WVL7		ENST00000544612.1:c.271C>T	11.37:g.94231249C>T	ENSP00000440396:p.Arg91Trp		Q8NDF2|Q96JE5|Q9NXK7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R91W	ENST00000544612.1	37	c.271	CCDS8300.1	11	.	.	.	.	.	.	.	.	.	.	C	18.43	3.621846	0.66787	.	.	ENSG00000168876	ENST00000544612;ENST00000535502;ENST00000545130;ENST00000302755	T;T;T	0.67523	-0.27;-0.27;-0.27	6.07	6.07	0.98685	Ankyrin repeat-containing domain (4);	0.912497	0.09637	N	0.775476	T	0.81442	0.4823	M	0.84156	2.68	0.09310	N	1	D	0.57571	0.98	P	0.55303	0.773	T	0.73861	-0.3849	10	0.87932	D	0	-2.4181	16.2596	0.82533	0.1404:0.8596:0.0:0.0	.	91	Q8WVL7	ANR49_HUMAN	W	91;50;126;91	ENSP00000440396:R91W;ENSP00000442449:R50W;ENSP00000303518:R91W	ENSP00000303518:R91W	R	+	1	2	ANKRD49	93870897	0.009000	0.17119	0.845000	0.33349	0.785000	0.44390	1.673000	0.37534	2.885000	0.99019	0.655000	0.94253	CGG	ANKRD49	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000168876		0.383	ANKRD49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD49	HGNC	protein_coding	OTTHUMT00000396314.2		0.00	35	0	C	NM_017704		94231249	+1			no_errors	ENST00000302755	ensembl	human	known	74_37	missense	9.09	20	2	SNP	0.019	T
ANO2	57101	genome.wustl.edu	37	12	5848531	5848531	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:5848531C>A	ENST00000356134.5	-	14	1448	c.1377G>T	c.(1375-1377)caG>caT	p.Q459H	ANO2_ENST00000546188.1_Missense_Mutation_p.Q459H|ANO2_ENST00000538154.1_5'UTR|ANO2_ENST00000327087.8_Missense_Mutation_p.Q458H	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	463					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						CCAGTCGCATCTGTAGCCTCT	0.418																																																	0													64.0	64.0	64.0					12																	5848531		1889	4122	6011	SO:0001583	missense	0			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.1377G>T	12.37:g.5848531C>A	ENSP00000348453:p.Gln459His		C4N787|Q9H847	Missense_Mutation	SNP	pfam_Anoctamin	p.Q459H	ENST00000356134.5	37	c.1377		12	.	.	.	.	.	.	.	.	.	.	C	19.03	3.748836	0.69533	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277;ENST00000545860	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	4.72	3.83	0.44106	.	0.000000	0.85682	D	0.000000	T	0.80798	0.4692	M	0.83603	2.65	0.54753	D	0.999985	D	0.89917	1.0	D	0.87578	0.998	T	0.81988	-0.0680	10	0.62326	D	0.03	.	10.165	0.42875	0.0:0.8329:0.0:0.1671	.	458	Q9NQ90-3	.	H	458;459;459;463;22	ENSP00000314048:Q458H;ENSP00000348453:Q459H;ENSP00000440981:Q459H;ENSP00000443813:Q22H	ENSP00000314048:Q458H	Q	-	3	2	ANO2	5718792	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.180000	0.50895	1.201000	0.43203	0.561000	0.74099	CAG	ANO2	-	pfam_Anoctamin	ENSG00000047617		0.418	ANO2-001	KNOWN	basic	protein_coding	ANO2	HGNC	protein_coding	OTTHUMT00000399019.4	-	0.00	57	0	C	NM_020373		5848531	-1	tier1	-	no_errors	ENST00000356134	ensembl	human	known	74_37	missense	6.67	55	4	SNP	1.000	A
ANXA4	307	genome.wustl.edu	37	2	70033579	70033579	+	Missense_Mutation	SNP	G	G	T	rs371182766		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:70033579G>T	ENST00000394295.4	+	5	503	c.255G>T	c.(253-255)atG>atT	p.M85I	ANXA4_ENST00000409920.1_Intron|ANXA4_ENST00000536030.1_Start_Codon_SNP_p.M1I	NM_001153.3	NP_001144.1	P09525	ANXA4_HUMAN	annexin A4	83			T -> M (in dbSNP:rs2228203).		epithelial cell differentiation (GO:0030855)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phospholipase inhibitor activity (GO:0004859)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	11						TTGTGGGGATGATGACGCCCA	0.527																																																	0													206.0	145.0	166.0					2																	70033579		2203	4300	6503	SO:0001583	missense	0			M82809	CCDS1894.1	2p13.3	2008-02-05			ENSG00000196975	ENSG00000196975		"""Annexins"""	542	protein-coding gene	gene with protein product		106491		ANX4		1346776	Standard	NM_001153		Approved		uc002sfr.4	P09525	OTTHUMG00000129649	ENST00000394295.4:c.255G>T	2.37:g.70033579G>T	ENSP00000377833:p.Met85Ile		B4DDF9|Q96F33|Q9BWK1	Missense_Mutation	SNP	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinIV,prints_AnnexinV	p.M85I	ENST00000394295.4	37	c.255	CCDS1894.1	2	.	.	.	.	.	.	.	.	.	.	G	10.66	1.412341	0.25465	.	.	ENSG00000196975	ENST00000394295;ENST00000536030	T;T	0.10860	2.83;2.83	4.97	4.08	0.47627	Annexin repeat, conserved site (1);	0.233066	0.44688	D	0.000421	T	0.07188	0.0182	N	0.21282	0.65	0.29286	N	0.869713	B;B	0.18968	0.032;0.009	B;B	0.22386	0.039;0.039	T	0.24012	-1.0172	9	.	.	.	.	8.6722	0.34156	0.0:0.1665:0.6612:0.1723	.	83;85	P09525;Q6LES2	ANXA4_HUMAN;.	I	85;1	ENSP00000377833:M85I;ENSP00000441931:M1I	.	M	+	3	0	ANXA4	69887083	1.000000	0.71417	0.983000	0.44433	0.011000	0.07611	5.833000	0.69349	1.208000	0.43306	-0.315000	0.08773	ATG	ANXA4	-	smart_Annexin_repeat,prints_Annexin,prints_AnnexinIV	ENSG00000196975		0.527	ANXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA4	HGNC	protein_coding	OTTHUMT00000251848.2	-	0.00	53	0	G	NM_001153		70033579	+1	tier1	-	no_errors	ENST00000394295	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
AOX2P	344454	genome.wustl.edu	37	2	201619758	201619759	+	IGR	DEL	TG	TG	-	rs563268698	byFrequency	TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:201619758_201619759delTG								AC007163.3 (19858 upstream) : AOX2P (7271 downstream)																							CCTTTCAAATtgtgtgtgtgtg	0.406														2052	0.409744	0.2262	0.3775	5008	,	,		16703	0.4236		0.4254	False		,,,				2504	0.6503																0																																										SO:0001628	intergenic_variant	0																															2.37:g.201619768_201619769delTG				RNA	DEL	-	NULL		37	NULL		2																																																																																			AOX2P	-	-	ENSG00000243478	0	0.406					AOX2P	HGNC				0.00	20	0	TG			201619759	+1	tier1		no_errors	ENST00000472376	ensembl	human	known	74_37	rna	11.54	23	3	DEL	0.000:0.000	-
AP2A1	160	genome.wustl.edu	37	19	50285877	50285877	+	Silent	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:50285877C>A	ENST00000359032.5	+	4	369	c.369C>A	c.(367-369)cgC>cgA	p.R123R	AP2A1_ENST00000354293.5_Silent_p.R123R|AP2A1_ENST00000600199.1_3'UTR	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	123					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		TGGCCAGCCGCAACCCCACCT	0.617																																																	0													32.0	36.0	34.0					19																	50285877		2160	4257	6417	SO:0001819	synonymous_variant	0			AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.369C>A	19.37:g.50285877C>A			Q96CI7|Q96PP6|Q96PP7|Q9H070	Silent	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.R123	ENST00000359032.5	37	c.369	CCDS46148.1	19																																																																																			AP2A1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP2_complex_asu	ENSG00000196961		0.617	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	AP2A1	HGNC	protein_coding	OTTHUMT00000465809.1	-	0.00	81	0	C			50285877	+1	tier1	-	no_errors	ENST00000354293	ensembl	human	known	74_37	silent	9.76	37	4	SNP	1.000	A
AP5M1	55745	genome.wustl.edu	37	14	57752991	57752991	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr14:57752991G>T	ENST00000261558.3	+	7	1750	c.1344G>T	c.(1342-1344)caG>caT	p.Q448H	AP5M1_ENST00000431972.2_Missense_Mutation_p.Q462H	NM_018229.3	NP_060699.3	Q9H0R1	AP5M1_HUMAN	adaptor-related protein complex 5, mu 1 subunit	448	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytosol (GO:0005829)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)											ATGCAGATCAGCATTCAGTTC	0.323																																																	0													175.0	171.0	173.0					14																	57752991		2203	4297	6500	SO:0001583	missense	0			AF094583	CCDS9729.1	14q22.2	2012-03-20	2012-03-20	2012-03-20	ENSG00000053770	ENSG00000053770			20192	protein-coding gene	gene with protein product	"""Mu-2 related death-inducing gene"""	614368	"""chromosome 14 open reading frame 108"", ""MU-2/AP1M2 domain containing, death-inducing"""	C14orf108, MUDENG		18395520	Standard	NM_018229		Approved	FLJ10813, MuD, mu5	uc001xcv.3	Q9H0R1	OTTHUMG00000140318	ENST00000261558.3:c.1344G>T	14.37:g.57752991G>T	ENSP00000261558:p.Gln448His		O95354|Q6ZMD7|Q96DX3|Q9NVC5	Missense_Mutation	SNP	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pfscan_Clathrin_mu_C	p.Q448H	ENST00000261558.3	37	c.1344	CCDS9729.1	14	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509625	0.64522	.	.	ENSG00000053770	ENST00000261558;ENST00000431972	T;T	0.19532	2.14;2.14	5.65	3.84	0.44239	Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.42063	0.1186	M	0.70595	2.14	0.58432	D	0.999999	D	0.89917	1.0	D	0.75484	0.986	T	0.24261	-1.0165	10	0.72032	D	0.01	.	9.4008	0.38431	0.216:0.0:0.784:0.0	.	448	Q9H0R1	MUDEN_HUMAN	H	448;462	ENSP00000261558:Q448H;ENSP00000390531:Q462H	ENSP00000261558:Q448H	Q	+	3	2	MUDENG	56822744	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.003000	0.40844	0.752000	0.32923	-0.225000	0.12378	CAG	AP5M1	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pfscan_Clathrin_mu_C	ENSG00000053770		0.323	AP5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP5M1	HGNC	protein_coding	OTTHUMT00000276922.1	-	0.00	28	0	G	NM_018229		57752991	+1	tier1	-	no_errors	ENST00000261558	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
LVRN	206338	genome.wustl.edu	37	5	115298449	115298449	+	Silent	SNP	G	G	A	rs376555664		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:115298449G>A	ENST00000357872.4	+	1	259	c.135G>A	c.(133-135)ccG>ccA	p.P45P	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		45						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P45P(1)									GCGTCCCACCGTCGGAGCTGC	0.701																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)						G		0,4338		0,0,2169	17.0	20.0	19.0		135	-1.8	0.0	5		19	1,8515		0,1,4257	no	coding-synonymous	AQPEP	NM_173800.4		0,1,6426	AA,AG,GG		0.0117,0.0,0.0078		45/991	115298449	1,12853	2169	4258	6427	SO:0001819	synonymous_variant	0																														ENST00000357872.4:c.135G>A	5.37:g.115298449G>A			A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Silent	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.P45	ENST00000357872.4	37	c.135	CCDS4124.1	5																																																																																			AQPEP	-	NULL	ENSG00000172901		0.701	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQPEP	Uniprot_gn	protein_coding	OTTHUMT00000250852.1		0.00	11	0	G			115298449	+1			no_errors	ENST00000357872	ensembl	human	known	74_37	silent	37.50	5	3	SNP	0.000	A
ARHGAP12	94134	genome.wustl.edu	37	10	32109333	32109333	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:32109333G>T	ENST00000344936.2	-	12	1848	c.1614C>A	c.(1612-1614)agC>agA	p.S538R	ARHGAP12_ENST00000311380.4_Missense_Mutation_p.S486R|ARHGAP12_ENST00000396144.4_Missense_Mutation_p.S533R|ARHGAP12_ENST00000375250.5_Missense_Mutation_p.S508R|ARHGAP12_ENST00000375245.4_Missense_Mutation_p.S486R|ARHGAP12_ENST00000492028.1_5'UTR	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	538	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				morphogenesis of an epithelial sheet (GO:0002011)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(11)|lung(10)|skin(1)|urinary_tract(2)	31		Prostate(175;0.0199)				CATTCTTTTTGCTGGATTTAT	0.343																																																	0													97.0	89.0	92.0					10																	32109333		2203	4300	6503	SO:0001583	missense	0			AY033594	CCDS7170.1, CCDS59214.1, CCDS59215.1, CCDS59216.1, CCDS73082.1	10p11.22	2013-01-10			ENSG00000165322	ENSG00000165322		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16348	protein-coding gene	gene with protein product		610577				11854031	Standard	NM_001270695		Approved	FLJ20737, FLJ10971, FLJ21785	uc001ivz.2	Q8IWW6	OTTHUMG00000017911	ENST00000344936.2:c.1614C>A	10.37:g.32109333G>T	ENSP00000345808:p.Ser538Arg		B1ANY0|B1ANY1|B1ANY2|Q504X1|Q86UB3|Q8IWW7|Q8N3L1|Q9NT76	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_WW_dom,smart_SH3_domain,smart_WW_dom,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_WW_dom,pfscan_RhoGAP_dom	p.S538R	ENST00000344936.2	37	c.1614	CCDS7170.1	10	.	.	.	.	.	.	.	.	.	.	G	18.36	3.606111	0.66445	.	.	ENSG00000165322	ENST00000311380;ENST00000375250;ENST00000344936;ENST00000396144;ENST00000375245	T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31	5.74	3.9	0.45041	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.89757	0.6807	M	0.88450	2.955	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.998;0.999;0.999;0.999;0.999;0.999	D	0.89586	0.3824	10	0.87932	D	0	.	9.5574	0.39348	0.2747:0.0:0.7253:0.0	.	491;508;508;533;538;486	Q1RLN5;B3KR88;Q8IWW6-2;Q504X1;Q8IWW6;Q8IWW6-3	.;.;.;.;RHG12_HUMAN;.	R	486;508;538;533;486	ENSP00000310984:S486R;ENSP00000364399:S508R;ENSP00000345808:S538R;ENSP00000379448:S533R;ENSP00000364394:S486R	ENSP00000310984:S486R	S	-	3	2	ARHGAP12	32149339	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.131000	0.50515	0.785000	0.33685	-0.229000	0.12294	AGC	ARHGAP12	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000165322		0.343	ARHGAP12-009	KNOWN	basic|CCDS	protein_coding	ARHGAP12	HGNC	protein_coding	OTTHUMT00000047465.1		0.00	32	0	G			32109333	-1			no_errors	ENST00000344936	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
ARHGAP26	23092	genome.wustl.edu	37	5	142603672	142603673	+	3'UTR	INS	-	-	T	rs35099513|rs11347785|rs34907127|rs397755690	byFrequency	TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:142603672_142603673insT	ENST00000274498.4	+	0	4484_4485				ARHGAP26_ENST00000378004.3_3'UTR|ARHGAP26_ENST00000486650.1_3'UTR	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26						actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTATCTTTTACTTTTTTTTTTT	0.282																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.*1662->T	5.37:g.142603683_142603683dupT			O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	RNA	INS	-	NULL	ENST00000274498.4	37	NULL	CCDS4277.1	5																																																																																			ARHGAP26	-	-	ENSG00000145819		0.282	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP26	HGNC	protein_coding	OTTHUMT00000132744.3		0.00	27	0	-	NM_015071		142603673	+1	tier1		no_errors	ENST00000486650	ensembl	human	known	74_37	rna	10.64	42	5	INS	0.938:0.929	T
ARHGEF18	23370	genome.wustl.edu	37	19	7505040	7505040	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:7505040C>T	ENST00000359920.6	+	1	467	c.214C>T	c.(214-216)Cgc>Tgc	p.R72C	ARHGEF18_ENST00000319670.9_Intron|CTD-2207O23.3_ENST00000593531.1_Intron	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	72					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R72C(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				GCTCCCCGGCCGCCCCGAGCT	0.662																																																	1	Substitution - Missense(1)	endometrium(1)											18.0	23.0	21.0					19																	7505040		692	1591	2283	SO:0001583	missense	0			AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.214C>T	19.37:g.7505040C>T	ENSP00000352995:p.Arg72Cys		A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R72C	ENST00000359920.6	37	c.214	CCDS45946.1	19	.	.	.	.	.	.	.	.	.	.	C	9.017	0.983984	0.18889	.	.	ENSG00000104880	ENST00000359920	T	0.31769	1.48	5.49	4.44	0.53790	.	0.551628	0.15055	N	0.283090	T	0.22589	0.0545	N	0.12182	0.205	0.35488	D	0.798702	D	0.65815	0.995	B	0.44315	0.446	T	0.34725	-0.9817	10	0.87932	D	0	-1.0871	13.9825	0.64313	0.0:0.8471:0.1529:0.0	.	72	Q6ZSZ5	ARHGI_HUMAN	C	72	ENSP00000352995:R72C	ENSP00000352995:R72C	R	+	1	0	ARHGEF18	7411040	0.914000	0.31030	0.068000	0.19968	0.180000	0.23129	1.808000	0.38912	1.289000	0.44618	0.561000	0.74099	CGC	ARHGEF18	-	NULL	ENSG00000104880		0.662	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF18	HGNC	protein_coding	OTTHUMT00000436340.1	-	0.00	104	0	C	NM_015318		7505040	+1	tier1	-	no_errors	ENST00000359920	ensembl	human	known	74_37	missense	41.43	41	29	SNP	0.074	T
ASPH	444	genome.wustl.edu	37	8	62577903	62577903	+	Intron	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr8:62577903C>T	ENST00000379454.4	-	4	510				ASPH_ENST00000517856.1_Intron|ASPH_ENST00000517903.1_Intron|ASPH_ENST00000518068.1_Intron|ASPH_ENST00000389204.4_Missense_Mutation_p.M195I|ASPH_ENST00000522835.1_Intron|ASPH_ENST00000522603.1_Missense_Mutation_p.M180I|ASPH_ENST00000356457.5_Intron|ASPH_ENST00000517847.2_Intron|ASPH_ENST00000541428.1_Intron|ASPH_ENST00000445642.3_Intron	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase						activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	ctcgggatgccattttactag	0.363																																																	0													245.0	219.0	228.0					8																	62577903		2203	4300	6503	SO:0001627	intron_variant	0			AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.323-11684G>A	8.37:g.62577903C>T			A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	pfam_Asp-B-hydro/Triadin_dom	p.M195I	ENST00000379454.4	37	c.585	CCDS34898.1	8	.	.	.	.	.	.	.	.	.	.	C	4.613	0.113912	0.08831	.	.	ENSG00000198363	ENST00000389204;ENST00000522603	T;T	0.55052	0.54;0.54	4.6	1.82	0.25136	.	.	.	.	.	T	0.36248	0.0960	.	.	.	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.20940	-1.0260	8	0.33141	T	0.24	.	7.9506	0.30012	0.0:0.73:0.0:0.27	.	180;195	Q12797-4;Q12797-3	.;.	I	195;180	ENSP00000373856:M195I;ENSP00000436188:M180I	ENSP00000373856:M195I	M	-	3	0	ASPH	62740457	0.001000	0.12720	0.000000	0.03702	0.695000	0.40330	0.972000	0.29409	0.261000	0.21753	-0.136000	0.14681	ATG	ASPH	-	pfam_Asp-B-hydro/Triadin_dom	ENSG00000198363		0.363	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPH	HGNC	protein_coding	OTTHUMT00000378510.3	-	0.00	32	0	C	NM_004318		62577903	-1	tier1	-	no_errors	ENST00000389204	ensembl	human	known	74_37	missense	29.17	51	21	SNP	0.000	T
ASPSCR1	79058	genome.wustl.edu	37	17	79954650	79954650	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:79954650G>A	ENST00000306739.4	+	7	958	c.861G>A	c.(859-861)tcG>tcA	p.S287S	ASPSCR1_ENST00000306729.7_Silent_p.S287S|ASPSCR1_ENST00000580534.1_Silent_p.S210S	NM_024083.3	NP_076988.1	Q9BZE9	ASPC1_HUMAN	alveolar soft part sarcoma chromosome region, candidate 1	287					glucose homeostasis (GO:0042593)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|regulation of glucose import (GO:0046324)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)			ASPSCR1/TFE3(167)	breast(2)|large_intestine(2)	4	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			AGTCCAAGTCGGGCCAGGATC	0.647			T	TFE3	alveolar soft part sarcoma																																			Dom	yes		17	17q25	79058	"""alveolar soft part sarcoma chromosome region, candidate 1"""		M	0													37.0	45.0	42.0					17																	79954650		2200	4298	6498	SO:0001819	synonymous_variant	0			AF324219	CCDS11796.1, CCDS58611.1	17q25	2011-06-28				ENSG00000169696		"""UBX domain containing"""	13825	protein-coding gene	gene with protein product	"""UBX domain protein 9"""	606236				11244503, 10506710	Standard	NM_024083		Approved	ASPS, ASPL, UBXD9, UBXN9	uc002kcy.3	Q9BZE9		ENST00000306739.4:c.861G>A	17.37:g.79954650G>A			A8K3K9|Q7Z6N7|Q8WV59|Q96LS5|Q96M40	Silent	SNP	pfam_TUG/UBX4,pfam_UBX,pfscan_UBX	p.S287	ENST00000306739.4	37	c.861	CCDS11796.1	17																																																																																			ASPSCR1	-	NULL	ENSG00000169696		0.647	ASPSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPSCR1	HGNC	protein_coding	OTTHUMT00000441972.1	-	0.00	212	0	G	NM_024083		79954650	+1	tier1	-	no_errors	ENST00000306729	ensembl	human	known	74_37	silent	35.92	66	37	SNP	0.314	A
ATAD2B	54454	genome.wustl.edu	37	2	24090761	24090761	+	Silent	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:24090761G>T	ENST00000238789.5	-	10	1475	c.1132C>A	c.(1132-1134)Cga>Aga	p.R378R		NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	378						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACTTTCACTCGTTCTCGGAGA	0.343																																																	0													198.0	194.0	195.0					2																	24090761		1867	4099	5966	SO:0001819	synonymous_variant	0			AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.1132C>A	2.37:g.24090761G>T			B9ZVQ5|Q6ZNA6|Q8N9E7	Silent	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,pfam_IstB_ATP-bd,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.R378	ENST00000238789.5	37	c.1132	CCDS46227.1	2																																																																																			ATAD2B	-	NULL	ENSG00000119778		0.343	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	ATAD2B	HGNC	protein_coding	OTTHUMT00000324333.1		0.00	46	0	G	NM_017552		24090761	-1			no_errors	ENST00000238789	ensembl	human	known	74_37	silent	5.00	76	4	SNP	1.000	T
ATCAY	85300	genome.wustl.edu	37	19	3907828	3907828	+	Missense_Mutation	SNP	G	G	A	rs372708763		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:3907828G>A	ENST00000450849.2	+	5	922	c.455G>A	c.(454-456)cGc>cAc	p.R152H	ATCAY_ENST00000398448.3_Missense_Mutation_p.R158H|ATCAY_ENST00000600960.1_Missense_Mutation_p.R152H|ATCAY_ENST00000301260.6_Missense_Mutation_p.R152H	NM_033064.4	NP_149053.1	Q86WG3	ATCAY_HUMAN	ataxia, cerebellar, Cayman type	152					apoptotic process (GO:0006915)|mitochondrion distribution (GO:0048311)|negative regulation of glutamate metabolic process (GO:2000212)|neuron projection development (GO:0031175)|regulation of protein localization (GO:0032880)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|synapse (GO:0045202)	kinesin binding (GO:0019894)			breast(1)|endometrium(2)|kidney(2)|lung(2)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		GCCAACGGGCGCCTGTGGCGG	0.647																																																	0								G	HIS/ARG	0,4054		0,0,2027	43.0	55.0	51.0		455	5.1	1.0	19		51	1,8371		0,1,4185	no	missense	ATCAY	NM_033064.4	29	0,1,6212	AA,AG,GG		0.0119,0.0,0.0080	probably-damaging	152/372	3907828	1,12425	2027	4186	6213	SO:0001583	missense	0				CCDS45923.1	19p13.3	2014-06-24	2008-07-18		ENSG00000167654	ENSG00000167654			779	protein-coding gene	gene with protein product	"""Cayman ataxia"", ""caytaxin"""	608179				8845847, 14556008	Standard	NM_033064		Approved		uc002lyy.4	Q86WG3	OTTHUMG00000181836	ENST00000450849.2:c.455G>A	19.37:g.3907828G>A	ENSP00000390941:p.Arg152His		Q8NAQ2|Q8TAQ3|Q96HC6|Q96JF5	Missense_Mutation	SNP	pfam_Bcl2-/adenovirus-E1B,pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.R152H	ENST00000450849.2	37	c.455	CCDS45923.1	19	.	.	.	.	.	.	.	.	.	.	G	27.7	4.855600	0.91355	0.0	1.19E-4	ENSG00000167654	ENST00000450849;ENST00000301260;ENST00000357694;ENST00000398448;ENST00000539301	T;T;T	0.44482	0.97;0.97;0.92	5.08	5.08	0.68730	.	0.107758	0.64402	N	0.000005	T	0.56455	0.1986	L	0.45137	1.4	0.54753	D	0.99998	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	T	0.50180	-0.8858	10	0.28530	T	0.3	.	17.5117	0.87762	0.0:0.0:1.0:0.0	.	158;152	B4DS11;Q86WG3	.;ATCAY_HUMAN	H	152;152;152;158;130	ENSP00000390941:R152H;ENSP00000301260:R152H;ENSP00000381466:R158H	ENSP00000301260:R152H	R	+	2	0	ATCAY	3858828	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.159000	0.94728	2.376000	0.81061	0.638000	0.83543	CGC	ATCAY	-	pfam_Bcl2-/adenovirus-E1B	ENSG00000167654		0.647	ATCAY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATCAY	HGNC	protein_coding	OTTHUMT00000457872.2	-	0.00	206	0	G			3907828	+1	tier1	-	no_errors	ENST00000301260	ensembl	human	known	74_37	missense	38.38	61	38	SNP	1.000	A
ATF7IP2	80063	genome.wustl.edu	37	16	10575953	10575953	+	Silent	SNP	T	T	A	rs558578447		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:10575953T>A	ENST00000396560.2	+	12	2123	c.1896T>A	c.(1894-1896)atT>atA	p.I632I	ATF7IP2_ENST00000324570.5_3'UTR|ATF7IP2_ENST00000356427.2_Silent_p.I632I|ATF7IP2_ENST00000543967.1_Silent_p.I176I|ATF7IP2_ENST00000396559.1_3'UTR	NM_024997.3	NP_079273.2	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting protein 2	632	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				large_intestine(3)	3						TTGGAGAAATTAAAGCTTTAC	0.373																																																	0													111.0	112.0	112.0					16																	10575953		2197	4300	6497	SO:0001819	synonymous_variant	0			AK022730	CCDS10540.1, CCDS58422.1	16p13.2	2008-02-05			ENSG00000166669	ENSG00000166669			20397	protein-coding gene	gene with protein product		613645					Standard	NM_001256160		Approved	FLJ12668	uc002czu.3	Q5U623	OTTHUMG00000129749	ENST00000396560.2:c.1896T>A	16.37:g.10575953T>A			B2RNR2|Q53EZ7|Q658U2|Q6IS97|Q8N9X8|Q9H9L6	Silent	SNP	superfamily_Fibronectin_type3	p.I632	ENST00000396560.2	37	c.1896	CCDS10540.1	16																																																																																			ATF7IP2	-	superfamily_Fibronectin_type3	ENSG00000166669		0.373	ATF7IP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATF7IP2	HGNC	protein_coding	OTTHUMT00000251961.1	-	0.00	30	0	T	NM_024997		10575953	+1	tier1	-	no_errors	ENST00000356427	ensembl	human	known	74_37	silent	29.41	48	20	SNP	0.996	A
ATP5D	513	genome.wustl.edu	37	19	1244157	1244157	+	Silent	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:1244157C>A	ENST00000215375.2	+	3	458	c.357C>A	c.(355-357)gcC>gcA	p.A119A	ATP5D_ENST00000395633.1_Silent_p.A119A|ATP5D_ENST00000591660.1_Silent_p.A119A	NM_001687.4	NP_001678.1	P30049	ATPD_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit	119					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|response to copper ion (GO:0046688)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, catalytic core F(1) (GO:0000275)|mitochondrion (GO:0005739)	proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			large_intestine(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CCGAAGAGGCCGTGACGCTGG	0.657											OREG0025113	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													39.0	35.0	36.0					19																	1244157		2203	4298	6501	SO:0001819	synonymous_variant	0			X63423	CCDS12058.1	19p13.3	2012-10-12			ENSG00000099624	ENSG00000099624		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	837	protein-coding gene	gene with protein product		603150				1531933	Standard	NM_001687		Approved		uc002lro.3	P30049		ENST00000215375.2:c.357C>A	19.37:g.1244157C>A		594	D6W5Y3|Q6FG90	Silent	SNP	pfam_ATPase_F1-cplx_dsu/esu_N,superfamily_ATPase_F1-cplx_dsu/esu_N,superfamily_ATPase_F1_dsu/esu_C,tigrfam_ATPase_F1-cplx_dsu/esu	p.A119	ENST00000215375.2	37	c.357	CCDS12058.1	19																																																																																			ATP5D	-	pfam_ATPase_F1-cplx_dsu/esu_N,superfamily_ATPase_F1-cplx_dsu/esu_N,tigrfam_ATPase_F1-cplx_dsu/esu	ENSG00000099624		0.657	ATP5D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5D	HGNC	protein_coding	OTTHUMT00000449958.1	-	0.00	180	0	C	NM_001687		1244157	+1	tier1	-	no_errors	ENST00000215375	ensembl	human	known	74_37	silent	26.67	65	24	SNP	0.002	A
ATP5F1	515	genome.wustl.edu	37	1	111996969	111996969	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:111996969G>T	ENST00000369722.3	+	3	820	c.214G>T	c.(214-216)Ggt>Tgt	p.G72C	ATP5F1_ENST00000369721.4_Intron|ATP5F1_ENST00000483994.1_Intron	NM_001688.4	NP_001679.2	P24539	AT5F1_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1	72					ATP catabolic process (GO:0006200)|ATP synthesis coupled proton transport (GO:0015986)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(1)|cervix(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	8		all_cancers(81;8.16e-06)|all_epithelial(167;5.63e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		TCCTAAAACTGGTGTAACAGG	0.418																																																	0													142.0	142.0	142.0					1																	111996969		2203	4300	6503	SO:0001583	missense	0			X60221	CCDS836.1	1p13.2	2012-10-12	2010-06-11		ENSG00000116459	ENSG00000116459		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	840	protein-coding gene	gene with protein product		603270	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit b, isoform 1"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1"""			1831354	Standard	XM_005270929		Approved		uc001ebc.3	P24539	OTTHUMG00000011745	ENST00000369722.3:c.214G>T	1.37:g.111996969G>T	ENSP00000358737:p.Gly72Cys		Q9BQ68|Q9BRU8	Missense_Mutation	SNP	pfam_ATPase_B_chain/sub_B/MI25	p.G72C	ENST00000369722.3	37	c.214	CCDS836.1	1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.671412	0.88348	.	.	ENSG00000116459	ENST00000369722	T	0.61627	0.09	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.75561	0.3866	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.80627	-0.1298	10	0.87932	D	0	.	17.7882	0.88545	0.0:0.0:1.0:0.0	.	72;72	Q08ET0;P24539	.;AT5F1_HUMAN	C	72	ENSP00000358737:G72C	ENSP00000358737:G72C	G	+	1	0	ATP5F1	111798492	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.827000	0.92041	2.373000	0.80994	0.467000	0.42956	GGT	ATP5F1	-	NULL	ENSG00000116459		0.418	ATP5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5F1	HGNC	protein_coding	OTTHUMT00000032455.1		0.00	32	0	G	NM_001688		111996969	+1			no_errors	ENST00000369722	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
ATP9A	10079	genome.wustl.edu	37	20	50287676	50287676	+	Silent	SNP	C	C	T	rs376405770		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr20:50287676C>T	ENST00000338821.5	-	12	1422	c.1158G>A	c.(1156-1158)tcG>tcA	p.S386S	ATP9A_ENST00000402822.1_Silent_p.S265S|ATP9A_ENST00000311637.5_Silent_p.S250S	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	386					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TGAGTAAGTACGAAATCCTGC	0.552																																																	0													82.0	71.0	75.0					20																	50287676		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.1158G>A	20.37:g.50287676C>T			E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.S386	ENST00000338821.5	37	c.1158	CCDS33489.1	20																																																																																			ATP9A	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000054793		0.552	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP9A	HGNC	protein_coding	OTTHUMT00000106494.1	-	0.00	33	0	C	NM_006045		50287676	-1	tier1	-	no_errors	ENST00000338821	ensembl	human	known	74_37	silent	40.54	22	15	SNP	0.016	T
ATXN1	6310	genome.wustl.edu	37	6	16328464	16328464	+	Silent	SNP	G	G	A	rs370874989		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:16328464G>A	ENST00000244769.4	-	8	1014	c.78C>T	c.(76-78)tcC>tcT	p.S26S	ATXN1_ENST00000436367.1_Silent_p.S26S	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	26					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				CCTTCTCCTCGGAGGACCGGC	0.692																																																	0								A	,	1,4403		0,1,2201	39.0	43.0	42.0		78,78	-10.0	0.1	6		42	0,8594		0,0,4297	no	coding-synonymous,coding-synonymous	ATXN1	NM_000332.3,NM_001128164.1	,	0,1,6498	AA,AG,GG		0.0,0.0227,0.0077	,	26/816,26/816	16328464	1,12997	2202	4297	6499	SO:0001819	synonymous_variant	0			X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.78C>T	6.37:g.16328464G>A			Q17S02|Q9UJG2|Q9Y4J1	Silent	SNP	pfam_Ataxin-1_HBP1,pfam_Capicua_tscrpt_rep_mod,superfamily_Ataxin-1_HBP1,smart_Ataxin_AXH_dom,pfscan_Ataxin-1_HBP1	p.S26	ENST00000244769.4	37	c.78	CCDS34342.1	6																																																																																			ATXN1	-	NULL	ENSG00000124788		0.692	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN1	HGNC	protein_coding	OTTHUMT00000039943.3	-	0.00	50	0	G	NM_000332		16328464	-1	tier1	-	no_errors	ENST00000244769	ensembl	human	known	74_37	silent	27.27	16	6	SNP	0.001	A
BDP1	55814	genome.wustl.edu	37	5	70791147	70791147	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:70791147G>T	ENST00000358731.4	+	12	1974	c.1711G>T	c.(1711-1713)Gaa>Taa	p.E571*	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	571					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		GCCTTCATTCGAAGTTGGAAT	0.328																																																	0													115.0	109.0	111.0					5																	70791147		1838	4088	5926	SO:0001587	stop_gained	0			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.1711G>T	5.37:g.70791147G>T	ENSP00000351575:p.Glu571*		Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Nonsense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.E571*	ENST00000358731.4	37	c.1711	CCDS43328.1	5	.	.	.	.	.	.	.	.	.	.	G	38	6.743401	0.97805	.	.	ENSG00000145734	ENST00000358731;ENST00000437938;ENST00000451951;ENST00000444711	.	.	.	5.61	4.51	0.55191	.	0.588496	0.17945	N	0.156708	.	.	.	.	.	.	0.31524	N	0.662068	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	7.2368	0.26074	0.1425:0.0:0.8575:0.0	.	.	.	.	X	571;571;151;571	.	ENSP00000351575:E571X	E	+	1	0	BDP1	70826903	0.979000	0.34478	0.028000	0.17463	0.007000	0.05969	2.818000	0.48041	2.793000	0.96121	0.655000	0.94253	GAA	BDP1	-	NULL	ENSG00000145734		0.328	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BDP1	HGNC	protein_coding	OTTHUMT00000374681.2	-	0.00	35	0	G	NM_018429		70791147	+1	tier1	-	no_errors	ENST00000358731	ensembl	human	known	74_37	nonsense	6.56	57	4	SNP	0.045	T
BEND4	389206	genome.wustl.edu	37	4	42153694	42153694	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr4:42153694G>T	ENST00000502486.1	-	2	1046	c.467C>A	c.(466-468)gCc>gAc	p.A156D	BEND4_ENST00000504360.1_Missense_Mutation_p.A152D	NM_207406.3	NP_997289.2	Q6ZU67	BEND4_HUMAN	BEN domain containing 4	156										NS(2)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26						CTCCAGGCTGGCGCTGTCGCT	0.736																																																	0													1.0	1.0	1.0					4																	42153694		511	1178	1689	SO:0001583	missense	0			AK092951	CCDS47048.1	4p13	2012-11-22	2008-10-03	2008-10-03	ENSG00000188848	ENSG00000188848		"""BEN domain containing"""	23815	protein-coding gene	gene with protein product			"""coiled-coil domain containing 4"""	CCDC4			Standard	NM_207406		Approved	FLJ35632, FLJ43965	uc003gwn.3	Q6ZU67	OTTHUMG00000160531	ENST00000502486.1:c.467C>A	4.37:g.42153694G>T	ENSP00000421169:p.Ala156Asp		A1A5D6|A1A5D7|C9JQZ5|Q58A26|Q58A27	Missense_Mutation	SNP	pfam_BEN_domain	p.A156D	ENST00000502486.1	37	c.467	CCDS47048.1	4	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469935	0.43839	.	.	ENSG00000188848	ENST00000502486;ENST00000504360	.	.	.	3.32	1.5	0.22942	.	0.789612	0.11024	N	0.608015	T	0.31513	0.0799	N	0.19112	0.55	0.33530	D	0.593504	B;B;B	0.17465	0.006;0.004;0.022	B;B;B	0.25291	0.059;0.02;0.059	T	0.33445	-0.9868	9	0.72032	D	0.01	-12.0706	5.3573	0.16067	0.1505:0.4939:0.3556:0.0	.	78;156;156	Q6ZU67-3;Q6ZU67;Q6ZU67-2	.;BEND4_HUMAN;.	D	156;152	.	ENSP00000421169:A156D	A	-	2	0	BEND4	41848451	0.998000	0.40836	0.997000	0.53966	0.942000	0.58702	0.284000	0.18864	0.094000	0.17404	0.491000	0.48974	GCC	BEND4	-	NULL	ENSG00000188848		0.736	BEND4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND4	HGNC	protein_coding	OTTHUMT00000360975.2	-	0.00	15	0	G	NM_207406		42153694	-1	tier1	-	no_errors	ENST00000502486	ensembl	human	known	74_37	missense	30.77	9	4	SNP	1.000	T
BIRC3	330	genome.wustl.edu	37	11	102198860	102198860	+	Splice_Site	SNP	A	A	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:102198860A>G	ENST00000263464.3	+	4	3781	c.1031A>G	c.(1030-1032)cAg>cGg	p.Q344R	BIRC3_ENST00000532808.1_Splice_Site_p.Q344R	NM_001165.4	NP_001156.1	Q13489	BIRC3_HUMAN	baculoviral IAP repeat containing 3	344					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of necroptotic process (GO:0060546)|negative regulation of phosphorylation (GO:0042326)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|protein heterooligomerization (GO:0051291)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|spermatogenesis (GO:0007283)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|ovary(3)|skin(1)	21	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0146)		CTACTTGAACAGGTAGGGCAA	0.343			T	MALT1	MALT																																			Dom	yes		11	11q22-q23	330	baculoviral IAP repeat-containing 3		L	0													84.0	82.0	83.0					11																	102198860		2203	4299	6502	SO:0001630	splice_region_variant	0			L49432	CCDS8315.1	11q22	2011-01-25	2011-01-25			ENSG00000023445		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	591	protein-coding gene	gene with protein product	"""apoptosis inhibitor 2"", ""TNFR2-TRAF signaling complex protein"", ""mammalian IAP homolog C"", ""inhibitor of apoptosis protein 1"""	601721	"""baculoviral IAP repeat-containing 3"""	API2		8552191, 8548810	Standard	NM_001165		Approved	cIAP2, hiap-1, MIHC, RNF49, MALT2, c-IAP2	uc001pgx.3	Q13489		ENST00000263464.3:c.1032+1A>G	11.37:g.102198860A>G			Q16628|Q9HC27|Q9UP46	Missense_Mutation	SNP	pfam_BIR,pfam_CARD,superfamily_DEATH-like_dom,smart_BIR,smart_CARD,smart_Znf_RING,pfscan_CARD,pfscan_BIR,pfscan_Znf_RING	p.Q344R	ENST00000263464.3	37	c.1031	CCDS8315.1	11	.	.	.	.	.	.	.	.	.	.	A	17.27	3.347806	0.61183	.	.	ENSG00000023445	ENST00000263464;ENST00000532808;ENST00000532609;ENST00000527309	T;T;T	0.66815	1.96;1.96;-0.23	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.70675	0.3251	M	0.73753	2.245	0.80722	D	1	P	0.40230	0.708	B	0.43194	0.411	T	0.73528	-0.3954	10	0.45353	T	0.12	.	15.2378	0.73443	1.0:0.0:0.0:0.0	.	344	Q13489	BIRC3_HUMAN	R	344;344;193;148	ENSP00000263464:Q344R;ENSP00000432907:Q344R;ENSP00000431718:Q148R	ENSP00000263464:Q344R	Q	+	2	0	BIRC3	101704070	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	8.169000	0.89672	2.248000	0.74166	0.533000	0.62120	CAG	BIRC3	-	NULL	ENSG00000023445		0.343	BIRC3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BIRC3	HGNC	protein_coding	OTTHUMT00000394159.1		0.00	38	0	A	NM_001165	Missense_Mutation	102198860	+1			no_errors	ENST00000263464	ensembl	human	known	74_37	missense	5.88	63	4	SNP	1.000	G
BMX	660	genome.wustl.edu	37	X	15549481	15549481	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chrX:15549481T>A	ENST00000357607.2	+	11	1158	c.970T>A	c.(970-972)Tcg>Acg	p.S324T	BMX_ENST00000348343.6_Missense_Mutation_p.S324T|BMX_ENST00000342014.6_Missense_Mutation_p.S324T			P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	324	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)|signal transduction (GO:0007165)	cytosol (GO:0005829)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(14)|ovary(2)|urinary_tract(3)	30	Hepatocellular(33;0.183)					GGTTAGAAATTCGAGCCAAGT	0.328																																																	0													158.0	156.0	157.0					X																	15549481		2203	4300	6503	SO:0001583	missense	0			AF045459	CCDS14168.1	Xp22.2	2013-05-14			ENSG00000102010	ENSG00000102010		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1079	protein-coding gene	gene with protein product	"""BTK-like on X chromosome"""	300101				7970727	Standard	NM_203281		Approved	ETK, PSCTK3	uc004cwx.4	P51813	OTTHUMG00000021180	ENST00000357607.2:c.970T>A	X.37:g.15549481T>A	ENSP00000350224:p.Ser324Thr		A6NIH9|O60564|Q12871	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_Pleckstrin_homology,pfam_Znf_Btk_motif,superfamily_Kinase-like_dom,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_Znf_Btk_motif	p.S324T	ENST00000357607.2	37	c.970	CCDS14168.1	X	.	.	.	.	.	.	.	.	.	.	T	24.9	4.578588	0.86645	.	.	ENSG00000102010	ENST00000357607;ENST00000348343;ENST00000342014	D;D;D	0.94931	-3.56;-3.56;-3.56	5.56	5.56	0.83823	SH2 motif (5);	0.102779	0.43919	D	0.000506	D	0.96858	0.8974	M	0.89287	3.02	0.44254	D	0.997106	D	0.56968	0.978	P	0.57911	0.829	D	0.97303	0.9932	10	0.87932	D	0	.	12.4963	0.55929	0.0:0.0:0.0:1.0	.	324	P51813	BMX_HUMAN	T	324	ENSP00000350224:S324T;ENSP00000308774:S324T;ENSP00000340082:S324T	ENSP00000340082:S324T	S	+	1	0	BMX	15459402	1.000000	0.71417	0.978000	0.43139	0.868000	0.49771	7.470000	0.80973	1.857000	0.53885	0.486000	0.48141	TCG	BMX	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	ENSG00000102010		0.328	BMX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	BMX	HGNC	protein_coding	OTTHUMT00000055877.1	-	0.00	41	0	T	NM_001721		15549481	+1	tier1	-	no_errors	ENST00000342014	ensembl	human	known	74_37	missense	56.25	21	27	SNP	1.000	A
BOLA1	51027	genome.wustl.edu	37	1	149871805	149871805	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:149871805G>T	ENST00000369153.2	+	3	857	c.193G>T	c.(193-195)Gag>Tag	p.E65*	BOLA1_ENST00000369152.5_Nonsense_Mutation_p.E65*|BOLA1_ENST00000369150.1_Nonsense_Mutation_p.E65*|BOLA1_ENST00000476344.1_3'UTR			Q9Y3E2	BOLA1_HUMAN	bolA family member 1	65						extracellular region (GO:0005576)|mitochondrion (GO:0005739)		p.E65K(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	10	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			GCCTGGCAGTGAGACTCACTT	0.677																																																	1	Substitution - Missense(1)	lung(1)											39.0	36.0	37.0					1																	149871805		2203	4298	6501	SO:0001587	stop_gained	0			AF151901	CCDS939.1	1q21	2013-09-02	2013-09-02		ENSG00000178096	ENSG00000178096			24263	protein-coding gene	gene with protein product		613181	"""bolA-like 1 (E. coli)"", ""bolA homolog 1 (E. coli)"""			14718656	Standard	NM_016074		Approved	CGI-143	uc001etf.3	Q9Y3E2	OTTHUMG00000012087	ENST00000369153.2:c.193G>T	1.37:g.149871805G>T	ENSP00000358149:p.Glu65*		B2R7K2|D3DUZ4|Q5QNY0	Nonsense_Mutation	SNP	pfam_BolA,superfamily_BolA	p.E65*	ENST00000369153.2	37	c.193	CCDS939.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.476784	0.97598	.	.	ENSG00000178096	ENST00000369153;ENST00000369152;ENST00000369150	.	.	.	5.35	4.43	0.53597	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	0.0065	11.3972	0.49849	0.0881:0.0:0.9119:0.0	.	.	.	.	X	65	.	ENSP00000358146:E65X	E	+	1	0	BOLA1	148138429	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	6.527000	0.73803	2.668000	0.90789	0.462000	0.41574	GAG	BOLA1	-	pfam_BolA,superfamily_BolA	ENSG00000178096		0.677	BOLA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BOLA1	HGNC	protein_coding	OTTHUMT00000033443.2		0.00	72	0	G	NM_016074		149871805	+1			no_errors	ENST00000369150	ensembl	human	known	74_37	nonsense	5.26	36	2	SNP	1.000	T
BRPF1	7862	genome.wustl.edu	37	3	9788006	9788006	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:9788006G>A	ENST00000457855.1	+	12	3340	c.3329G>A	c.(3328-3330)cGa>cAa	p.R1110Q	BRPF1_ENST00000433861.2_Missense_Mutation_p.R1015Q|BRPF1_ENST00000424362.1_Missense_Mutation_p.R1109Q|BRPF1_ENST00000302054.3_Missense_Mutation_p.R1110Q|BRPF1_ENST00000383829.2_Missense_Mutation_p.R1116Q			P55201	BRPF1_HUMAN	bromodomain and PHD finger containing, 1	1110	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R1116Q(1)		central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	49	Medulloblastoma(99;0.227)					AAGATGCCCCGAGAAGGTATG	0.517																																																	1	Substitution - Missense(1)	urinary_tract(1)											101.0	102.0	102.0					3																	9788006		2203	4300	6503	SO:0001583	missense	0			M91585	CCDS2575.1, CCDS33692.1	3p26-p25	2008-07-18			ENSG00000156983	ENSG00000156983			14255	protein-coding gene	gene with protein product	"""peregrin"", ""bromodomain-containing protein, 140kD"""	602410				8946209, 7906940	Standard	NM_001003694		Approved	BR140	uc003bsf.3	P55201	OTTHUMG00000097033	ENST00000457855.1:c.3329G>A	3.37:g.9788006G>A	ENSP00000410210:p.Arg1110Gln		B4DEZ6|Q7Z6E0|Q8TCM6|Q9UHI0	Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Bromodomain,pfam_PWWP_dom,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP_dom,pfscan_PWWP_dom,pfscan_Znf_PHD-finger,pfscan_Znf_C2H2,pfscan_Bromodomain,prints_Bromodomain	p.R1116Q	ENST00000457855.1	37	c.3347	CCDS2575.1	3	.	.	.	.	.	.	.	.	.	.	G	31	5.100257	0.94245	.	.	ENSG00000156983	ENST00000433861;ENST00000424362;ENST00000383829;ENST00000302054;ENST00000457855	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	6.06	6.06	0.98353	PWWP (3);	0.000000	0.85682	D	0.000000	T	0.53658	0.1810	L	0.53249	1.67	0.80722	D	1	D;D;D;D	0.89917	0.997;1.0;1.0;0.998	P;D;D;D	0.69824	0.876;0.966;0.966;0.948	T	0.42481	-0.9449	10	0.51188	T	0.08	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	1015;1109;1116;1110	P55201-4;P55201-3;P55201-2;P55201	.;.;.;BRPF1_HUMAN	Q	1015;1109;1116;1110;1110	ENSP00000402485:R1015Q;ENSP00000398863:R1109Q;ENSP00000373340:R1116Q;ENSP00000306297:R1110Q;ENSP00000410210:R1110Q	ENSP00000306297:R1110Q	R	+	2	0	BRPF1	9763006	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.882000	0.98803	0.655000	0.94253	CGA	BRPF1	-	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom	ENSG00000156983		0.517	BRPF1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BRPF1	HGNC	protein_coding	OTTHUMT00000338485.1	-	0.00	93	0	G	NM_001003694		9788006	+1	tier1	-	no_errors	ENST00000383829	ensembl	human	known	74_37	missense	14.52	53	9	SNP	1.000	A
BTNL9	153579	genome.wustl.edu	37	5	180480869	180480869	+	Intron	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:180480869C>T	ENST00000327705.9	+	6	1117				BTNL9_ENST00000376841.2_Intron|BTNL9_ENST00000511589.1_3'UTR|BTNL9_ENST00000515271.1_3'UTR|BTNL9_ENST00000376842.3_Intron	NM_152547.4	NP_689760.2	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9							integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(10)|ovary(1)	19	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGATGCGCAACATCTCCGCAC	0.607																																																	0																																										SO:0001627	intron_variant	0			AK057097	CCDS4460.2	5q35.3	2014-01-14			ENSG00000165810	ENSG00000165810		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	24176	protein-coding gene	gene with protein product							Standard	NM_152547		Approved	FLJ32535, BTN8	uc003mmt.3	Q6UXG8	OTTHUMG00000133152	ENST00000327705.9:c.886+368C>T	5.37:g.180480869C>T			A6NL42|Q6P660|Q96DM5	RNA	SNP	-	NULL	ENST00000327705.9	37	NULL	CCDS4460.2	5																																																																																			BTNL9	-	-	ENSG00000165810		0.607	BTNL9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BTNL9	HGNC	protein_coding	OTTHUMT00000157342.3	-	0.00	97	0	C	NM_152547		180480869	+1	tier1	-	no_errors	ENST00000511589	ensembl	human	putative	74_37	rna	46.15	21	18	SNP	0.003	T
C11orf70	85016	genome.wustl.edu	37	11	101946692	101946692	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:101946692G>A	ENST00000434758.2	+	5	552	c.524G>A	c.(523-525)tGc>tAc	p.C175Y	C11orf70_ENST00000526781.1_Missense_Mutation_p.C175Y|C11orf70_ENST00000534360.1_3'UTR	NM_032930.2	NP_116319.2	Q9BRQ4	CK070_HUMAN	chromosome 11 open reading frame 70	175										breast(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|skin(2)	12	all_epithelial(12;0.0137)	Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.0137)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0335)		AAACATCTTTGCCTTGGTGGA	0.383																																																	0													159.0	153.0	155.0					11																	101946692		2203	4299	6502	SO:0001583	missense	0			AK094851	CCDS8313.1, CCDS8313.2, CCDS53698.1	11q22.1	2012-05-31			ENSG00000137691	ENSG00000137691			28188	protein-coding gene	gene with protein product							Standard	NM_032930		Approved	MGC13040	uc001pgp.3	Q9BRQ4	OTTHUMG00000167320	ENST00000434758.2:c.524G>A	11.37:g.101946692G>A	ENSP00000414390:p.Cys175Tyr		E9PJU1	Missense_Mutation	SNP	NULL	p.C175Y	ENST00000434758.2	37	c.524	CCDS8313.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.36|19.36	3.813656|3.813656	0.70912|0.70912	.|.	.|.	ENSG00000137691|ENSG00000137691	ENST00000529204|ENST00000434758;ENST00000526781;ENST00000423732	.|.	.|.	.|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	.|0.083749	.|0.85682	.|D	.|0.000000	D|D	0.82467|0.82467	0.5043|0.5043	M|M	0.76574|0.76574	2.34|2.34	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.73380	.|0.98	D|D	0.83641|0.83641	0.0150|0.0150	5|9	.|0.87932	.|D	.|0	-12.1894|-12.1894	19.8575|19.8575	0.96767|0.96767	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|175	.|Q9BRQ4	.|CK070_HUMAN	T|Y	67|175;175;137	.|.	.|ENSP00000392150:C137Y	A|C	+|+	1|2	0|0	C11orf70|C11orf70	101451902|101451902	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.907000|0.907000	0.53573|0.53573	7.024000|7.024000	0.76443|0.76443	2.767000|2.767000	0.95098|0.95098	0.563000|0.563000	0.77884|0.77884	GCC|TGC	C11orf70	-	NULL	ENSG00000137691		0.383	C11orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf70	HGNC	protein_coding	OTTHUMT00000394144.1	-	0.00	38	0	G	NM_032930		101946692	+1	tier1	-	no_errors	ENST00000434758	ensembl	human	known	74_37	missense	25.76	49	17	SNP	1.000	A
C12orf66	144577	genome.wustl.edu	37	12	64609598	64609598	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:64609598C>T	ENST00000398055.3	-	2	434	c.381G>A	c.(379-381)gaG>gaA	p.E127E	C12orf66_ENST00000544871.1_Silent_p.E74E|C12orf66_ENST00000311915.8_Silent_p.E127E	NM_152440.4	NP_689653	Q96MD2	CL066_HUMAN	chromosome 12 open reading frame 66	127										central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)	5						AGCAGAGCTGCTCTGACAGGT	0.517																																																	0													60.0	63.0	62.0					12																	64609598		2041	4202	6243	SO:0001819	synonymous_variant	0				CCDS41803.1, CCDS73490.1	12q14.2	2008-08-08			ENSG00000174206	ENSG00000174206			26517	protein-coding gene	gene with protein product						12477932	Standard	NM_152440		Approved	FLJ32549	uc001srw.4	Q96MD2	OTTHUMG00000168763	ENST00000398055.3:c.381G>A	12.37:g.64609598C>T			C9JX54|Q8IYA0	Silent	SNP	pfam_DUF2003	p.E127	ENST00000398055.3	37	c.381	CCDS41803.1	12																																																																																			C12orf66	-	pfam_DUF2003	ENSG00000174206		0.517	C12orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf66	HGNC	protein_coding	OTTHUMT00000400921.1	-	0.00	58	0	C	NM_152440		64609598	-1	tier1	-	no_errors	ENST00000398055	ensembl	human	known	74_37	silent	46.15	21	18	SNP	1.000	T
C14orf37	145407	genome.wustl.edu	37	14	58471477	58471477	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr14:58471477C>A	ENST00000267485.7	-	8	2496	c.2302G>T	c.(2302-2304)Gac>Tac	p.D768Y		NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	768						integral component of membrane (GO:0016021)				breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						TCAGAGCTGTCGGCTAAGAGC	0.358																																																	0													135.0	140.0	138.0					14																	58471477		2203	4300	6503	SO:0001583	missense	0				CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.2302G>T	14.37:g.58471477C>A	ENSP00000267485:p.Asp768Tyr		A8K8Z8|Q6P5Q1|Q86TY1	Missense_Mutation	SNP	NULL	p.D768Y	ENST00000267485.7	37	c.2302	CCDS32089.1	14	.	.	.	.	.	.	.	.	.	.	C	18.30	3.593929	0.66219	.	.	ENSG00000139971	ENST00000267485;ENST00000438670	T	0.50001	0.76	5.64	5.64	0.86602	.	0.065952	0.64402	D	0.000009	T	0.67335	0.2882	L	0.58101	1.795	0.48511	D	0.999669	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.68667	-0.5348	10	0.87932	D	0	-15.6423	18.7057	0.91637	0.0:1.0:0.0:0.0	.	806;768;768	B4DMS4;A8K990;Q86TY3	.;.;CN037_HUMAN	Y	768;806	ENSP00000267485:D768Y	ENSP00000267485:D768Y	D	-	1	0	C14orf37	57541230	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	5.076000	0.64413	2.662000	0.90505	0.655000	0.94253	GAC	C14orf37	-	NULL	ENSG00000139971		0.358	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf37	HGNC	protein_coding	OTTHUMT00000412059.1	-	0.00	40	0	C	NM_001001872		58471477	-1	tier1	-	no_errors	ENST00000267485	ensembl	human	known	74_37	missense	55.34	46	57	SNP	1.000	A
C15orf52	388115	genome.wustl.edu	37	15	40631782	40631782	+	Frame_Shift_Del	DEL	C	C	-	rs199693415		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:40631782delC	ENST00000559313.1	-	3	309	c.294delG	c.(292-294)gggfs	p.G98fs	C15orf52_ENST00000557973.1_5'Flank|C15orf52_ENST00000397536.2_5'Flank	NM_207380.2	NP_997263.2	Q6ZUT6	CO052_HUMAN	chromosome 15 open reading frame 52	98							poly(A) RNA binding (GO:0044822)	p.M99fs*3(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	19		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		TCACAGCCATCCCCCCCTGCT	0.647																																																	1	Deletion - Frameshift(1)	large_intestine(1)											81.0	90.0	87.0					15																	40631782		2125	4232	6357	SO:0001589	frameshift_variant	0			AK124643	CCDS10055.2	15q15.1	2007-06-14			ENSG00000188549	ENSG00000188549			33488	protein-coding gene	gene with protein product							Standard	NM_207380		Approved	FLJ43339	uc001zlh.4	Q6ZUT6	OTTHUMG00000129981	ENST00000559313.1:c.294delG	15.37:g.40631782delC	ENSP00000453969:p.Gly98fs		B9EIQ8|Q68DG9|Q6ZTM3|Q6ZU22	Frame_Shift_Del	DEL	NULL	p.M99fs	ENST00000559313.1	37	c.294	CCDS10055.2	15																																																																																			C15orf52	-	NULL	ENSG00000188549		0.647	C15orf52-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf52	HGNC	protein_coding	OTTHUMT00000319567.2		0.00	36	0	C	NM_207380		40631782	-1	tier1		no_errors	ENST00000559313	ensembl	human	known	74_37	frame_shift_del	8.00	23	2	DEL	0.991	-
C17orf80	55028	genome.wustl.edu	37	17	71231802	71231802	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:71231802G>T	ENST00000535032.2	+	2	294	c.181G>T	c.(181-183)Gat>Tat	p.D61Y	C17orf80_ENST00000426147.2_Missense_Mutation_p.D61Y|FAM104A_ENST00000583178.1_Intron|C17orf80_ENST00000255557.4_Missense_Mutation_p.D61Y|C17orf80_ENST00000359042.2_Missense_Mutation_p.D61Y|C17orf80_ENST00000582793.1_Intron|C17orf80_ENST00000268942.8_Missense_Mutation_p.D61Y|C17orf80_ENST00000577615.1_Missense_Mutation_p.D61Y			Q9BSJ5	CQ080_HUMAN	chromosome 17 open reading frame 80	61						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(2)|skin(2)|stomach(2)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(166;0.197)			ACCAATCAAAGATTTAATTAA	0.393																																																	0													56.0	55.0	55.0					17																	71231802		2203	4300	6503	SO:0001583	missense	0			AY163812	CCDS11694.1, CCDS42377.1, CCDS45767.1, CCDS74145.1	17q25.1	2012-02-24	2012-02-24	2012-02-24	ENSG00000141219	ENSG00000141219			29601	protein-coding gene	gene with protein product	"""sperm-expressed protein 1"", ""migration-inducing protein 3"""					12477932	Standard	NM_017941		Approved	HLC-8, MIG3, FLJ20721, SPEP1	uc002jjl.4	Q9BSJ5		ENST00000535032.2:c.181G>T	17.37:g.71231802G>T	ENSP00000440551:p.Asp61Tyr		A8K9X3|Q5JB45|Q6YAU3|Q9H0L9|Q9H5E6|Q9NWN5	Missense_Mutation	SNP	NULL	p.D61Y	ENST00000535032.2	37	c.181	CCDS11694.1	17	.	.	.	.	.	.	.	.	.	.	G	18.57	3.652890	0.67472	.	.	ENSG00000141219	ENST00000255557;ENST00000359042;ENST00000268942;ENST00000426147;ENST00000535032	D;D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36;-2.36	5.17	1.98	0.26296	.	0.581545	0.16418	N	0.215302	D	0.90916	0.7145	L	0.59436	1.845	0.09310	N	1	D;D;D;D	0.76494	0.996;0.996;0.999;0.999	D;D;D;D	0.71656	0.939;0.939;0.964;0.974	T	0.81185	-0.1048	10	0.87932	D	0	-5.2844	5.5368	0.17016	0.183:0.1626:0.6544:0.0	.	61;61;61;61	B7Z7E5;Q9BSJ5;Q9BSJ5-2;Q9BSJ5-3	.;CQ080_HUMAN;.;.	Y	61	ENSP00000255557:D61Y;ENSP00000351937:D61Y;ENSP00000268942:D61Y;ENSP00000396970:D61Y;ENSP00000440551:D61Y	ENSP00000255557:D61Y	D	+	1	0	C17orf80	68743397	0.065000	0.20965	0.002000	0.10522	0.733000	0.41908	1.809000	0.38922	0.548000	0.28955	0.561000	0.74099	GAT	C17orf80	-	NULL	ENSG00000141219		0.393	C17orf80-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf80	HGNC	protein_coding	OTTHUMT00000441893.1	-	0.00	38	0	G	NM_017941		71231802	+1	tier1	-	no_errors	ENST00000359042	ensembl	human	known	74_37	missense	42.86	36	27	SNP	0.002	T
C18orf42	642597	genome.wustl.edu	37	18	5145660	5145660	+	Silent	SNP	G	G	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr18:5145660G>C	ENST00000434239.3	-	2	282	c.111C>G	c.(109-111)gtC>gtG	p.V37V	C18orf42_ENST00000580650.1_Silent_p.V44V	NM_001145194.1	NP_001138666.1	P0CW23	CR042_HUMAN	chromosome 18 open reading frame 42	37																	TCTCCTGGGAGACTTGCTGCA	0.512																																																	0													157.0	134.0	141.0					18																	5145660		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS54179.1	18p11.31	2012-10-24			ENSG00000231824	ENSG00000231824			28285	protein-coding gene	gene with protein product							Standard	NM_001145194		Approved		uc010wzc.1	P0CW23	OTTHUMG00000178457	ENST00000434239.3:c.111C>G	18.37:g.5145660G>C				Silent	SNP	pfam_Kinase-A_anchor_RI-RII-bd_dom	p.V37	ENST00000434239.3	37	c.111	CCDS54179.1	18																																																																																			C18orf42	-	pfam_Kinase-A_anchor_RI-RII-bd_dom	ENSG00000231824		0.512	C18orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C18orf42	HGNC	protein_coding	OTTHUMT00000442071.1	-	0.00	38	0	G	NM_001145194		5145660	-1	tier1	-	no_errors	ENST00000434239	ensembl	human	known	74_37	silent	37.84	23	14	SNP	1.000	C
DCANP1	140947	genome.wustl.edu	37	5	134782217	134782217	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:134782217C>T	ENST00000503143.2	-	1	821	c.582G>A	c.(580-582)tgG>tgA	p.W194*	TIFAB_ENST00000537858.1_3'UTR	NM_130848.2	NP_570900.1	Q8TF63	DCNP1_HUMAN		194	Ser-rich.					nucleus (GO:0005634)				endometrium(1)|lung(1)|prostate(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCTGACGGTTCCAGCTGTTAG	0.512																																																	0													84.0	85.0	85.0					5																	134782217		2203	4300	6503	SO:0001587	stop_gained	0																														ENST00000503143.2:c.582G>A	5.37:g.134782217C>T	ENSP00000421871:p.Trp194*			Nonsense_Mutation	SNP	NULL	p.W194*	ENST00000503143.2	37	c.582	CCDS4186.1	5	.	.	.	.	.	.	.	.	.	.	C	16.57	3.159827	0.57368	.	.	ENSG00000251380	ENST00000503143	.	.	.	3.39	-1.93	0.07594	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	4.7145	0.12889	0.1477:0.4341:0.0:0.4182	.	.	.	.	X	194	.	ENSP00000421871:W194X	W	-	3	0	C5orf20	134810116	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.437000	0.06914	-0.847000	0.04168	-2.697000	0.00138	TGG	C5orf20	-	NULL	ENSG00000251380		0.512	C5orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf20	HGNC	protein_coding	OTTHUMT00000372531.1	-	0.00	70	0	C			134782217	-1	tier1	-	no_errors	ENST00000503143	ensembl	human	known	74_37	nonsense	40.48	25	17	SNP	0.000	T
CACNA1C	775	genome.wustl.edu	37	12	2693763	2693763	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:2693763G>T	ENST00000347598.4	+	16	2319	c.2319G>T	c.(2317-2319)aaG>aaT	p.K773N	CACNA1C_ENST00000399649.1_Missense_Mutation_p.K773N|CACNA1C_ENST00000399644.1_Missense_Mutation_p.K773N|CACNA1C_ENST00000399597.1_Missense_Mutation_p.K773N|CACNA1C_ENST00000399638.1_Missense_Mutation_p.K773N|CACNA1C_ENST00000344100.3_Missense_Mutation_p.K773N|CACNA1C_ENST00000399591.1_Missense_Mutation_p.K773N|CACNA1C_ENST00000399617.1_Missense_Mutation_p.K773N|CACNA1C_ENST00000399603.1_Missense_Mutation_p.K773N|CACNA1C_ENST00000399595.1_Missense_Mutation_p.K773N|CACNA1C_ENST00000335762.5_Missense_Mutation_p.K798N|CACNA1C_ENST00000399606.1_Missense_Mutation_p.K773N|CACNA1C_ENST00000406454.3_Missense_Mutation_p.K773N|CACNA1C_ENST00000402845.3_Missense_Mutation_p.K773N|CACNA1C_ENST00000399641.1_Missense_Mutation_p.K773N|CACNA1C_ENST00000327702.7_Missense_Mutation_p.K773N|CACNA1C_ENST00000399634.1_Missense_Mutation_p.K773N|CACNA1C_ENST00000399637.1_Missense_Mutation_p.K773N|CACNA1C_ENST00000399601.1_Missense_Mutation_p.K773N|CACNA1C_ENST00000399621.1_Missense_Mutation_p.K773N|CACNA1C_ENST00000399629.1_Missense_Mutation_p.K773N|CACNA1C_ENST00000480911.1_Missense_Mutation_p.K773N|CACNA1C_ENST00000399655.1_Missense_Mutation_p.K773N	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	773	Poly-Glu.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	aagaggagaaggagagaaaga	0.547																																																	0													67.0	73.0	71.0					12																	2693763		1965	4176	6141	SO:0001583	missense	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.2319G>T	12.37:g.2693763G>T	ENSP00000266376:p.Lys773Asn		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.K773N	ENST00000347598.4	37	c.2319	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	G	15.26	2.779786	0.49891	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96587	-4.0;-4.0;-4.0;-3.99;-4.01;-4.0;-4.03;-3.91;-3.94;-4.0;-3.91;-3.91;-3.99;-4.06;-3.92;-3.84;-4.06;-4.01;-4.0;-4.05;-3.95;-4.04;-4.06	4.71	-1.84	0.07809	.	0.106914	0.64402	D	0.000008	D	0.96027	0.8706	L	0.45051	1.395	0.49213	D	0.999766	D;D;B;D;D;D;D;D;B;B;D;D;B;D;D;D;D;B;D;B;D;D;D;D;D;D	0.89917	0.998;1.0;0.206;0.993;0.997;1.0;1.0;1.0;0.08;0.09;1.0;1.0;0.165;0.999;0.999;1.0;0.996;0.309;1.0;0.309;0.996;1.0;1.0;0.996;0.989;1.0	D;D;B;D;D;D;D;D;B;B;D;D;B;D;D;D;D;B;D;B;D;D;D;D;D;D	0.91635	0.995;0.996;0.038;0.977;0.995;0.998;0.996;0.998;0.251;0.124;0.998;0.996;0.051;0.999;0.991;0.996;0.99;0.083;0.998;0.083;0.99;0.998;0.998;0.922;0.985;0.996	D	0.93383	0.6745	10	0.49607	T	0.09	.	11.5211	0.50551	0.5258:0.0:0.4742:0.0	.	773;770;773;773;773;773;773;773;773;773;773;773;744;773;773;773;773;773;773;773;773;773;773;773;773;773	Q13936-14;Q13936-35;Q13936;E9PDI6;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;F5H638;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	N	798;773;773;773;773;773;773;773;773;773;773;773;773;773;773;773;773;773;773;773;773;773;773;614	ENSP00000336982:K798N;ENSP00000382563:K773N;ENSP00000437936:K773N;ENSP00000382552:K773N;ENSP00000382547:K773N;ENSP00000382506:K773N;ENSP00000382530:K773N;ENSP00000382546:K773N;ENSP00000382500:K773N;ENSP00000382549:K773N;ENSP00000266376:K773N;ENSP00000382515:K773N;ENSP00000382510:K773N;ENSP00000341092:K773N;ENSP00000382537:K773N;ENSP00000329877:K773N;ENSP00000382557:K773N;ENSP00000385724:K773N;ENSP00000382512:K773N;ENSP00000382542:K773N;ENSP00000382526:K773N;ENSP00000385896:K773N;ENSP00000382504:K773N	ENSP00000323129:K614N	K	+	3	2	CACNA1C	2564024	0.998000	0.40836	0.994000	0.49952	0.858000	0.48976	0.399000	0.20916	-0.230000	0.09840	-0.254000	0.11334	AAG	CACNA1C	-	NULL	ENSG00000151067		0.547	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1	-	0.00	52	0	G	NM_000719		2693763	+1	tier1	-	no_errors	ENST00000399634	ensembl	human	known	74_37	missense	47.37	30	27	SNP	0.955	T
CACNA2D3	55799	genome.wustl.edu	37	3	55038855	55038855	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:55038855G>T	ENST00000474759.1	+	32	2804	c.2756G>T	c.(2755-2757)gGc>gTc	p.G919V	CACNA2D3_ENST00000490478.1_Missense_Mutation_p.G825V|CACNA2D3_ENST00000288197.5_Missense_Mutation_p.G919V|CACNA2D3_ENST00000478261.1_3'UTR|CACNA2D3_ENST00000415676.2_Missense_Mutation_p.G919V	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	919						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	GGCGCCCATGGCCTCCTGGAT	0.448																																																	0													107.0	103.0	104.0					3																	55038855		1960	4150	6110	SO:0001583	missense	0			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.2756G>T	3.37:g.55038855G>T	ENSP00000419101:p.Gly919Val		B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.G919V	ENST00000474759.1	37	c.2756	CCDS54598.1	3	.	.	.	.	.	.	.	.	.	.	G	12.67	2.006226	0.35415	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624	T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47	6.17	5.29	0.74685	.	0.355474	0.33075	N	0.005315	T	0.48314	0.1493	N	0.08118	0	0.24725	N	0.993127	B	0.16396	0.017	B	0.20184	0.028	T	0.22556	-1.0213	10	0.16420	T	0.52	.	11.579	0.50881	0.1334:0.0:0.8666:0.0	.	919	Q8IZS8	CA2D3_HUMAN	V	919;919;919;825;825	ENSP00000389506:G919V;ENSP00000419101:G919V;ENSP00000288197:G919V;ENSP00000417279:G825V	ENSP00000288197:G919V	G	+	2	0	CACNA2D3	55013895	0.927000	0.31430	0.131000	0.22000	0.994000	0.84299	2.797000	0.47877	2.941000	0.99782	0.655000	0.94253	GGC	CACNA2D3	-	NULL	ENSG00000157445		0.448	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA2D3	HGNC	protein_coding	OTTHUMT00000351402.1	-	0.00	42	0	G			55038855	+1	tier1	-	no_errors	ENST00000288197	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.122	T
CATSPERG	57828	genome.wustl.edu	37	19	38845408	38845408	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:38845408C>T	ENST00000409235.3	+	9	1171	c.1056C>T	c.(1054-1056)ttC>ttT	p.F352F	CATSPERG_ENST00000410018.1_Silent_p.F352F|CATSPERG_ENST00000215069.4_Silent_p.F365F	NM_021185.4	NP_067008.3	Q6ZRH7	CTSRG_HUMAN	catsper channel auxiliary subunit gamma	352					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)				breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|pancreas(2)|prostate(6)|skin(3)|stomach(1)|urinary_tract(2)	40						CTGTGTATTTCCATAGCAATG	0.542																																																	0													204.0	185.0	192.0					19																	38845408		2203	4300	6503	SO:0001819	synonymous_variant	0			AK128220	CCDS12514.2	19q13.1	2014-05-13	2012-02-22	2009-07-17	ENSG00000099338	ENSG00000099338			25243	protein-coding gene	gene with protein product		613452	"""chromosome 19 open reading frame 15"", ""cation channel, sperm-associated, gamma"""	C19orf15		19516020	Standard	NM_021185		Approved	DKFZp434A1022, FLJ46353	uc002oih.4	Q6ZRH7	OTTHUMG00000153223	ENST00000409235.3:c.1056C>T	19.37:g.38845408C>T			A6NEG6|Q659E1	Missense_Mutation	SNP	NULL	p.S285F	ENST00000409235.3	37	c.854	CCDS12514.2	19																																																																																			CATSPERG	-	NULL	ENSG00000099338		0.542	CATSPERG-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CATSPERG	HGNC	protein_coding	OTTHUMT00000330204.1	-	0.00	71	0	C	NM_021185		38845408	+1	tier1	-	no_errors	ENST00000312265	ensembl	human	known	74_37	missense	38.46	40	25	SNP	0.079	T
CCDC116	164592	genome.wustl.edu	37	22	21991274	21991274	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr22:21991274G>T	ENST00000292779.3	+	5	1918	c.1757G>T	c.(1756-1758)cGt>cTt	p.R586L		NM_152612.2	NP_689825.2	Q8IYX3	CC116_HUMAN	coiled-coil domain containing 116	0										endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(5)	22	Colorectal(54;0.105)					AATGAGGGCCGTGATAAAGCC	0.552																																																	0													63.0	56.0	59.0					22																	21991274		2203	4300	6503	SO:0001583	missense	0			BC033499	CCDS13791.1	22q11.21	2006-06-27			ENSG00000161180	ENSG00000161180			26688	protein-coding gene	gene with protein product						12477932	Standard	NM_152612		Approved	FLJ36046	uc002zve.3	Q8IYX3	OTTHUMG00000150821	ENST00000292779.3:c.1757G>T	22.37:g.21991274G>T	ENSP00000292779:p.Arg586Leu		Q8N9Y9	Missense_Mutation	SNP	NULL	p.R586L	ENST00000292779.3	37	c.1757	CCDS13791.1	22	.	.	.	.	.	.	.	.	.	.	G	13.42	2.232296	0.39498	.	.	ENSG00000161180	ENST00000292779	T	0.11930	2.73	3.35	-6.71	0.01760	.	4.361770	0.00589	N	0.000349	T	0.10078	0.0247	.	.	.	0.09310	N	1	B	0.19817	0.039	B	0.14578	0.011	T	0.28170	-1.0052	9	0.62326	D	0.03	-0.1315	7.2875	0.26348	0.1802:0.2297:0.5901:0.0	.	586	Q8IYX3-2	.	L	586	ENSP00000292779:R586L	ENSP00000292779:R586L	R	+	2	0	CCDC116	20321274	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.577000	0.00909	-1.752000	0.01325	-0.458000	0.05436	CGT	CCDC116	-	NULL	ENSG00000161180		0.552	CCDC116-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC116	HGNC	protein_coding	OTTHUMT00000320199.1		0.00	38	0	G	NM_152612		21991274	+1			no_errors	ENST00000292779	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.000	T
CCDC178	374864	genome.wustl.edu	37	18	30926332	30926332	+	Silent	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr18:30926332G>T	ENST00000383096.3	-	9	683	c.501C>A	c.(499-501)ctC>ctA	p.L167L	CCDC178_ENST00000579947.1_Silent_p.L167L|CCDC178_ENST00000406524.2_Silent_p.L167L|CCDC178_ENST00000300227.8_Silent_p.L167L|CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000583930.1_Silent_p.L167L|CCDC178_ENST00000403303.1_Silent_p.L167L|CCDC178_ENST00000402325.1_Silent_p.L167L			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	167																	TGGCCTCTGAGAGCAATGTTT	0.348																																																	0													89.0	84.0	86.0					18																	30926332		2203	4300	6503	SO:0001819	synonymous_variant	0			AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.501C>A	18.37:g.30926332G>T			A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Silent	SNP	NULL	p.L167	ENST00000383096.3	37	c.501	CCDS42424.1	18																																																																																			CCDC178	-	NULL	ENSG00000166960		0.348	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC178	HGNC	protein_coding	OTTHUMT00000255373.2		0.00	16	0	G	NM_198995		30926332	-1			no_errors	ENST00000406524	ensembl	human	known	74_37	silent	7.41	25	2	SNP	0.093	T
CCDC180	100499483	genome.wustl.edu	37	9	100092636	100092636	+	Frame_Shift_Del	DEL	A	A	-			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr9:100092636delA	ENST00000357054.1	+	32	3345	c.2410delA	c.(2410-2412)aaafs	p.K805fs	RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000411667.2_Frame_Shift_Del_p.K663fs|CCDC180_ENST00000375202.2_Frame_Shift_Del_p.K666fs|CCDC180_ENST00000529487.1_Frame_Shift_Del_p.K666fs|CCDC180_ENST00000460482.2_3'UTR			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	805						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GAAGAGAGTGAAAAAACTGAG	0.463																																																	0													70.0	71.0	71.0					9																	100092636		2203	4300	6503	SO:0001589	frameshift_variant	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.2410delA	9.37:g.100092636delA	ENSP00000349562:p.Lys805fs		Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Frame_Shift_Del	DEL	NULL	p.K666fs	ENST00000357054.1	37	c.1993		9																																																																																			CCDC180	-	NULL	ENSG00000197816		0.463	CCDC180-201	KNOWN	basic	protein_coding	CCDC180	HGNC	protein_coding			0.00	42	0	A	NM_020893		100092636	+1	tier1		no_errors	ENST00000375202	ensembl	human	known	74_37	frame_shift_del	39.53	26	17	DEL	0.001	-
CCDC80	151887	genome.wustl.edu	37	3	112324432	112324432	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:112324432C>T	ENST00000206423.3	-	8	3638	c.2685G>A	c.(2683-2685)tcG>tcA	p.S895S	CCDC80_ENST00000439685.2_Silent_p.S895S	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	895					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						GAAGTTGCATCGAATCAATTA	0.468																																																	0													126.0	103.0	110.0					3																	112324432		2203	4300	6503	SO:0001819	synonymous_variant	0			AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.2685G>A	3.37:g.112324432C>T			D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Silent	SNP	NULL	p.S895	ENST00000206423.3	37	c.2685	CCDS2968.1	3																																																																																			CCDC80	-	NULL	ENSG00000091986		0.468	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC80	HGNC	protein_coding	OTTHUMT00000354219.1	-	0.00	51	0	C	NM_199511		112324432	-1	tier1	-	no_errors	ENST00000206423	ensembl	human	known	74_37	silent	37.70	38	23	SNP	0.843	T
CCDC93	54520	genome.wustl.edu	37	2	118704391	118704391	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:118704391T>A	ENST00000376300.2	-	16	1429	c.1292A>T	c.(1291-1293)gAa>gTa	p.E431V	CCDC93_ENST00000319432.5_Missense_Mutation_p.E430V	NM_019044.4	NP_061917.3	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	431										breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(2)	29						CTTTACCTTTTCATCTCCACG	0.413																																																	0													166.0	141.0	149.0					2																	118704391		2203	4300	6503	SO:0001583	missense	0			BC028609	CCDS2121.2	2q14.1	2008-02-05			ENSG00000125633	ENSG00000125633			25611	protein-coding gene	gene with protein product						12477932	Standard	NM_019044		Approved	FLJ10996	uc002tlj.3	Q567U6	OTTHUMG00000058517	ENST00000376300.2:c.1292A>T	2.37:g.118704391T>A	ENSP00000365477:p.Glu431Val		A8K3V7|Q4LE78|Q53TJ2|Q8TBX5|Q9H6R5|Q9NV15	Missense_Mutation	SNP	pfam_DUF2037	p.E431V	ENST00000376300.2	37	c.1292	CCDS2121.2	2	.	.	.	.	.	.	.	.	.	.	T	12.74	2.028092	0.35797	.	.	ENSG00000125633	ENST00000376300;ENST00000319432	T;T	0.23552	1.9;1.93	5.39	1.74	0.24563	.	0.359821	0.31246	N	0.007986	T	0.17109	0.0411	L	0.37630	1.12	0.35873	D	0.828352	B	0.15930	0.015	B	0.17098	0.017	T	0.08249	-1.0731	10	0.49607	T	0.09	-3.5585	5.096	0.14733	0.1369:0.1281:0.0:0.735	.	431	Q567U6	CCD93_HUMAN	V	431;430	ENSP00000365477:E431V;ENSP00000324135:E430V	ENSP00000324135:E430V	E	-	2	0	CCDC93	118420861	0.995000	0.38212	0.337000	0.25536	0.533000	0.34776	1.804000	0.38873	0.145000	0.18977	0.533000	0.62120	GAA	CCDC93	-	NULL	ENSG00000125633		0.413	CCDC93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC93	HGNC	protein_coding	OTTHUMT00000129615.1	-	0.00	40	0	T	NM_019044		118704391	-1	tier1	-	no_errors	ENST00000376300	ensembl	human	known	74_37	missense	32.69	35	17	SNP	0.898	A
CD163L1	283316	genome.wustl.edu	37	12	7528563	7528563	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:7528563G>T	ENST00000313599.3	-	10	2476	c.2419C>A	c.(2419-2421)Cgt>Agt	p.R807S	CD163L1_ENST00000544331.1_5'UTR|CD163L1_ENST00000416109.2_Missense_Mutation_p.R817S|CD163L1_ENST00000396630.1_Missense_Mutation_p.R807S			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	807	SRCR 8. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.R807C(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						ACTTCAACACGTCCAGAGCAG	0.448																																																	1	Substitution - Missense(1)	breast(1)											77.0	78.0	78.0					12																	7528563		2203	4300	6503	SO:0001583	missense	0			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.2419C>A	12.37:g.7528563G>T	ENSP00000315945:p.Arg807Ser		B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.R807S	ENST00000313599.3	37	c.2419	CCDS8577.1	12	.	.	.	.	.	.	.	.	.	.	G	16.12	3.032013	0.54790	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.35789	1.29;1.29;1.29	2.84	0.654	0.17833	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.282600	0.22410	U	0.060430	T	0.64994	0.2649	H	0.98048	4.135	0.24444	N	0.994514	D;D	0.69078	0.997;0.992	D;D	0.68765	0.96;0.96	T	0.55444	-0.8140	10	0.66056	D	0.02	.	3.2598	0.06845	0.1501:0.0:0.4665:0.3835	.	817;807	E7EVK4;Q9NR16	.;C163B_HUMAN	S	807;817;807	ENSP00000315945:R807S;ENSP00000393474:R817S;ENSP00000379871:R807S	ENSP00000315945:R807S	R	-	1	0	CD163L1	7419830	0.044000	0.20184	0.109000	0.21407	0.311000	0.27955	2.135000	0.42112	0.503000	0.28060	0.455000	0.32223	CGT	CD163L1	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000177675		0.448	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD163L1	HGNC	protein_coding	OTTHUMT00000399329.1		0.00	17	0	G	NM_174941		7528563	-1			no_errors	ENST00000313599	ensembl	human	known	74_37	missense	8.33	22	2	SNP	0.824	T
CD244	51744	genome.wustl.edu	37	1	160811229	160811229	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:160811229G>A	ENST00000368033.3	-	3	523	c.441C>T	c.(439-441)gaC>gaT	p.D147D	CD244_ENST00000368034.4_Silent_p.D142D|CD244_ENST00000322302.7_Intron|CD244_ENST00000481677.1_5'Flank|CD244_ENST00000368032.2_Silent_p.D142D			Q9BZW8	CD244_HUMAN	CD244 molecule, natural killer cell receptor 2B4	147	Ig-like 2.				blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	18	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			ATCTCCCTCTGTCCAGGATCT	0.522																																																	0													100.0	96.0	97.0					1																	160811229		2203	4300	6503	SO:0001819	synonymous_variant	0			AF105261	CCDS1210.1, CCDS53398.1, CCDS53399.1	1q23.1	2013-01-11	2006-03-29		ENSG00000122223	ENSG00000122223		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18171	protein-coding gene	gene with protein product		605554	"""natural killer cell receptor 2B4"", ""CD244 natural killer cell receptor 2B4"""			3772297, 10458320	Standard	NM_016382		Approved	2B4, NAIL, NKR2B4, Nmrk, SLAMF4	uc009wtq.3	Q9BZW8	OTTHUMG00000028606	ENST00000368033.3:c.441C>T	1.37:g.160811229G>A			Q5VYI2|Q5VYI6|Q5VYI7|Q96T47|Q9NQD2|Q9NQD3|Q9Y288	Silent	SNP	pfam_NK_rcpt_2B4_Ig_dom,pfscan_Ig-like_dom	p.D147	ENST00000368033.3	37	c.441	CCDS53399.1	1																																																																																			CD244	-	pfscan_Ig-like_dom	ENSG00000122223		0.522	CD244-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD244	HGNC	protein_coding	OTTHUMT00000071469.1	-	0.00	35	0	G	NM_016382		160811229	-1	tier1	-	no_errors	ENST00000368033	ensembl	human	known	74_37	silent	34.48	19	10	SNP	0.000	A
CD33	945	genome.wustl.edu	37	19	51728475	51728475	+	Splice_Site	SNP	G	G	T	rs143114570	byFrequency	TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:51728475G>T	ENST00000262262.4	+	2	60	c.39G>T	c.(37-39)ggG>ggT	p.G13G	CD33_ENST00000436584.2_Intron|CD33_ENST00000391796.3_Splice_Site_p.G13G|CD33_ENST00000421133.2_Intron	NM_001772.3	NP_001763.3	P20138	CD33_HUMAN	CD33 molecule	13					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(15)|skin(1)|stomach(1)	24		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	TCCCCACAGGGGCCCTGGCTA	0.622																																																	0													38.0	42.0	40.0					19																	51728475		2203	4300	6503	SO:0001630	splice_region_variant	0			M23197	CCDS33084.1, CCDS46157.1, CCDS54299.1	19q13.3	2013-01-29	2006-03-28		ENSG00000105383	ENSG00000105383		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1659	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 3"""	159590	"""CD33 antigen (gp67)"""			3139766, 9465907	Standard	NM_001772		Approved	SIGLEC3, SIGLEC-3, p67, FLJ00391	uc002pwa.2	P20138		ENST00000262262.4:c.38-1G>T	19.37:g.51728475G>T			B4E3P8|C9JEN7|F8WAL2|Q8TD24	Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like_dom	p.G13	ENST00000262262.4	37	c.39	CCDS33084.1	19																																																																																			CD33	-	NULL	ENSG00000105383		0.622	CD33-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD33	HGNC	protein_coding	OTTHUMT00000464199.2	-	0.00	76	0	G	NM_001772	Silent	51728475	+1	tier1	-	no_errors	ENST00000262262	ensembl	human	known	74_37	silent	32.43	25	12	SNP	0.000	T
CD46	4179	genome.wustl.edu	37	1	207943560	207943560	+	Intron	SNP	T	T	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:207943560T>A	ENST00000358170.2	+	9	1102				CD46_ENST00000361067.1_Intron|CD46_ENST00000480003.1_Intron|CD46_ENST00000360212.2_Intron|CD46_ENST00000469535.1_3'UTR|CD46_ENST00000367047.1_Intron|CD46_ENST00000441839.2_Intron|CD46_ENST00000357714.1_Intron|CD46_ENST00000354848.1_Intron|CD46_ENST00000367041.1_Intron|CD46_ENST00000322918.5_Intron|CD46_ENST00000322875.4_Intron|CD46_ENST00000367042.1_Intron	NM_002389.4	NP_002380.3	P15529	MCP_HUMAN	CD46 molecule, complement regulatory protein						adaptive immune response (GO:0002250)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|interleukin-10 production (GO:0032613)|negative regulation of complement activation (GO:0045916)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transforming growth factor beta production (GO:0071636)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)|regulation of Notch signaling pathway (GO:0008593)|sequestering of extracellular ligand from receptor (GO:0035581)|single fertilization (GO:0007338)|T cell mediated immunity (GO:0002456)|viral process (GO:0016032)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|inner acrosomal membrane (GO:0002079)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cadherin binding (GO:0045296)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	19						TTGTAAAGTGTGTAGTTTTCA	0.264																																																	0																																										SO:0001627	intron_variant	0			BC030594	CCDS1479.1, CCDS1480.1, CCDS1481.1, CCDS1482.1, CCDS1484.1, CCDS1485.1, CCDS31008.1, CCDS31009.1	1q32	2014-09-17	2006-03-28	2006-02-09	ENSG00000117335	ENSG00000117335		"""CD molecules"", ""Complement system"""	6953	protein-coding gene	gene with protein product		120920	"""antigen identified by monoclonal antibody TRA-2-10"", ""membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)"", ""CD46 antigen, complement regulatory protein"""	MIC10, MCP		7929741	Standard	NM_002389		Approved	TRA2.10, MGC26544, TLX	uc001hgj.3	P15529	OTTHUMG00000036397	ENST00000358170.2:c.947-106T>A	1.37:g.207943560T>A			A0T1T0|A0T1T1|A0T1T2|Q15429|Q53GV9|Q5HY94|Q5VWS6|Q5VWS7|Q5VWS8|Q5VWS9|Q5VWT0|Q5VWT1|Q5VWT2|Q6N0A1|Q7Z3R5|Q9NNW2|Q9NNW3|Q9NNW4|Q9UCJ4	RNA	SNP	-	NULL	ENST00000358170.2	37	NULL	CCDS1485.1	1																																																																																			CD46	-	-	ENSG00000117335		0.264	CD46-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD46	HGNC	protein_coding	OTTHUMT00000088588.3	-	0.00	161	0	T	NM_172361		207943560	+1	tier1	-	no_errors	ENST00000469535	ensembl	human	known	74_37	rna	25.18	204	69	SNP	0.000	A
CDH23	64072	genome.wustl.edu	37	10	73199634	73199634	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:73199634G>T	ENST00000224721.6	+	1	51	c.46G>T	c.(46-48)Gtg>Ttg	p.V16L	CDH23_ENST00000398809.4_Missense_Mutation_p.V16L|CDH23_ENST00000398842.3_Missense_Mutation_p.V16L|CDH23_ENST00000461841.3_Missense_Mutation_p.V61L|CDH23_ENST00000299366.7_Missense_Mutation_p.V61L	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	16					calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CTGGCTTTTGGTGCTGATCTC	0.622																																																	0													58.0	62.0	61.0					10																	73199634		2086	4189	6275	SO:0001583	missense	0			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.46G>T	10.37:g.73199634G>T	ENSP00000224721:p.Val16Leu		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V61L	ENST00000224721.6	37	c.181		10	.	.	.	.	.	.	.	.	.	.	G	10.34	1.323285	0.24080	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000398809;ENST00000398842;ENST00000299366;ENST00000224721	T;T	0.57107	0.42;0.47	4.59	1.54	0.23209	.	0.262850	0.24547	N	0.037595	T	0.25158	0.0611	N	0.08118	0	0.46874	D	0.999237	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.03086	-1.1074	10	0.26408	T	0.33	.	4.4694	0.11704	0.217:0.1862:0.5968:0.0	.	16;16;16	A5D6V9;Q9H251;Q9H251-5	.;CAD23_HUMAN;.	L	16	ENSP00000381789:V16L;ENSP00000381822:V16L	ENSP00000224721:V16L	V	+	1	0	CDH23	72869640	0.067000	0.21026	0.571000	0.28486	0.891000	0.51852	-0.018000	0.12568	0.511000	0.28236	0.313000	0.20887	GTG	CDH23	-	NULL	ENSG00000107736		0.622	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000051227.4	-	0.00	62	0	G	NM_052836		73199634	+1	tier1	-	no_errors	ENST00000461841	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.419	T
CELSR1	9620	genome.wustl.edu	37	22	46787549	46787549	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr22:46787549G>A	ENST00000262738.3	-	15	6128	c.6129C>T	c.(6127-6129)gtC>gtT	p.V2043V		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2043	Laminin EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00460}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CGAGCGTGGTGACCTCGGCAA	0.682																																																	0													32.0	31.0	31.0					22																	46787549		2203	4297	6500	SO:0001819	synonymous_variant	0			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.6129C>T	22.37:g.46787549G>A			O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Silent	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.V2043	ENST00000262738.3	37	c.6129	CCDS14076.1	22																																																																																			CELSR1	-	smart_EGF_laminin,pfscan_EGF_laminin,pfscan_GPCR_2_extracellular_dom	ENSG00000075275		0.682	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	HGNC	protein_coding	OTTHUMT00000318037.1	-	0.00	94	0	G	NM_014246		46787549	-1	tier1	-	no_errors	ENST00000262738	ensembl	human	known	74_37	silent	9.43	48	5	SNP	1.000	A
CEP192	55125	genome.wustl.edu	37	18	13049675	13049675	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr18:13049675A>G	ENST00000325971.8	+	14	2690	c.1097A>G	c.(1096-1098)aAt>aGt	p.N366S	CEP192_ENST00000506447.1_Missense_Mutation_p.N962S|CEP192_ENST00000430049.2_Missense_Mutation_p.N487S			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	366					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TCACCTAAAAATAGTGGTAAG	0.343																																																	0													91.0	94.0	93.0					18																	13049675		2195	4296	6491	SO:0001583	missense	0			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.1097A>G	18.37:g.13049675A>G	ENSP00000317156:p.Asn366Ser		A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	NULL	p.N962S	ENST00000325971.8	37	c.2885		18	.	.	.	.	.	.	.	.	.	.	A	0.300	-0.974254	0.02215	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.77489	-1.1;-1.1;-1.1	5.52	-7.32	0.01436	.	1.941400	0.02021	N	0.047762	T	0.50854	0.1640	N	0.12182	0.205	0.09310	N	1	B;B;B	0.13594	0.003;0.008;0.003	B;B;B	0.11329	0.002;0.003;0.006	T	0.55976	-0.8055	10	0.02654	T	1	0.0395	4.4934	0.11824	0.1609:0.4448:0.2929:0.1014	.	487;962;366	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	S	962;366;366;487	ENSP00000427550:N962S;ENSP00000317156:N366S;ENSP00000389190:N487S	ENSP00000317156:N366S	N	+	2	0	CEP192	13039675	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.473000	0.06615	-1.474000	0.01879	-0.321000	0.08615	AAT	CEP192	-	NULL	ENSG00000101639		0.343	CEP192-201	KNOWN	basic	protein_coding	CEP192	HGNC	protein_coding		-	0.00	43	0	A	NM_032142		13049675	+1	tier1	-	no_errors	ENST00000506447	ensembl	human	known	74_37	missense	40.00	57	38	SNP	0.003	G
CFTR	1080	genome.wustl.edu	37	7	117246747	117246747	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:117246747C>A	ENST00000003084.6	+	18	3060	c.2928C>A	c.(2926-2928)ttC>ttA	p.F976L	AC000111.6_ENST00000456270.1_RNA|CFTR_ENST00000454343.1_Missense_Mutation_p.F915L	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	976	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	TTAATAGATTCTCCAAAGATA	0.284									Cystic Fibrosis																																								0													134.0	140.0	138.0					7																	117246747		2203	4294	6497	SO:0001583	missense	0	Familial Cancer Database	CF	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.2928C>A	7.37:g.117246747C>A	ENSP00000003084:p.Phe976Leu		Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM,tigrfam_cAMP_cl_channel	p.F976L	ENST00000003084.6	37	c.2928	CCDS5773.1	7	.	.	.	.	.	.	.	.	.	.	C	20.5	3.993228	0.74703	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.86097	-2.07;-2.07;-2.07	5.4	4.46	0.54185	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.90546	0.7037	M	0.86953	2.85	0.58432	D	0.999999	P	0.47191	0.891	P	0.55303	0.773	D	0.91062	0.4886	10	0.87932	D	0	-19.7035	9.7224	0.40311	0.0:0.8313:0.0:0.1687	.	976	P13569	CFTR_HUMAN	L	976;915;946	ENSP00000003084:F976L;ENSP00000403677:F915L;ENSP00000389119:F946L	ENSP00000003084:F976L	F	+	3	2	CFTR	117033983	0.997000	0.39634	1.000000	0.80357	0.999000	0.98932	0.502000	0.22594	1.290000	0.44636	0.650000	0.86243	TTC	CFTR	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom,tigrfam_cAMP_cl_channel	ENSG00000001626		0.284	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFTR	HGNC	protein_coding	OTTHUMT00000059397.3	-	0.00	39	0	C	NM_000492		117246747	+1	tier1	-	no_errors	ENST00000003084	ensembl	human	known	74_37	missense	36.51	40	23	SNP	1.000	A
CHD6	84181	genome.wustl.edu	37	20	40033753	40033753	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr20:40033753G>T	ENST00000373233.3	-	37	7805	c.7628C>A	c.(7627-7629)gCa>gAa	p.A2543E	CHD6_ENST00000480022.1_5'UTR	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2543					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GCAGGTGGTTGCCATGGGTGG	0.562																																																	0													95.0	89.0	91.0					20																	40033753		2203	4300	6503	SO:0001583	missense	0			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.7628C>A	20.37:g.40033753G>T	ENSP00000362330:p.Ala2543Glu		Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_BRK_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.A2543E	ENST00000373233.3	37	c.7628	CCDS13317.1	20	.	.	.	.	.	.	.	.	.	.	G	14.56	2.571376	0.45798	.	.	ENSG00000124177	ENST00000373233	D	0.86097	-2.07	5.55	5.55	0.83447	.	0.237073	0.30142	N	0.010309	T	0.77751	0.4177	L	0.28014	0.82	0.80722	D	1	P	0.35433	0.501	B	0.27608	0.081	T	0.77913	-0.2410	10	0.51188	T	0.08	-6.1907	19.7069	0.96076	0.0:0.0:1.0:0.0	.	2543	Q8TD26	CHD6_HUMAN	E	2543	ENSP00000362330:A2543E	ENSP00000362330:A2543E	A	-	2	0	CHD6	39467167	1.000000	0.71417	0.939000	0.37840	0.921000	0.55340	6.126000	0.71635	2.894000	0.99253	0.591000	0.81541	GCA	CHD6	-	NULL	ENSG00000124177		0.562	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	HGNC	protein_coding	OTTHUMT00000079270.1	-	0.00	30	0	G			40033753	-1	tier1	-	no_errors	ENST00000373233	ensembl	human	known	74_37	missense	34.62	17	9	SNP	0.953	T
CILP	8483	genome.wustl.edu	37	15	65499281	65499281	+	Missense_Mutation	SNP	C	C	T	rs376150356		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:65499281C>T	ENST00000261883.4	-	4	429	c.263G>A	c.(262-264)cGt>cAt	p.R88H		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	88					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						CCGCAGGGGACGGGCACATAC	0.617																																																	0								C	HIS/ARG	1,4401	2.1+/-5.4	0,1,2200	42.0	36.0	38.0		263	1.5	1.0	15		38	0,8598		0,0,4299	no	missense	CILP	NM_003613.3	29	0,1,6499	TT,TC,CC		0.0,0.0227,0.0077	benign	88/1185	65499281	1,12999	2201	4299	6500	SO:0001583	missense	0			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.263G>A	15.37:g.65499281C>T	ENSP00000261883:p.Arg88His		B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.R88H	ENST00000261883.4	37	c.263	CCDS10203.1	15	.	.	.	.	.	.	.	.	.	.	C	14.27	2.486358	0.44147	2.27E-4	0.0	ENSG00000138615	ENST00000261883	T	0.16897	2.31	5.58	1.51	0.23008	.	0.441491	0.25777	N	0.028366	T	0.12732	0.0309	L	0.37697	1.125	0.19300	N	0.99997	B	0.14012	0.009	B	0.10450	0.005	T	0.19943	-1.0290	10	0.54805	T	0.06	-18.7403	8.5221	0.33282	0.0:0.6663:0.0:0.3337	.	88	O75339	CILP1_HUMAN	H	88	ENSP00000261883:R88H	ENSP00000261883:R88H	R	-	2	0	CILP	63286334	0.007000	0.16637	0.971000	0.41717	0.925000	0.55904	0.143000	0.16115	0.022000	0.15160	0.561000	0.74099	CGT	CILP	-	NULL	ENSG00000138615		0.617	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CILP	HGNC	protein_coding	OTTHUMT00000256829.1	-	0.00	84	0	C	NM_003613		65499281	-1	tier1	-	no_errors	ENST00000261883	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.338	T
CHSY1	22856	genome.wustl.edu	37	15	101775550	101775550	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:101775550G>T	ENST00000254190.3	-	2	1028	c.553C>A	c.(553-555)Ctg>Atg	p.L185M		NM_014918.4	NP_055733.2	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	185					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of ossification (GO:0030279)|response to nutrient levels (GO:0031667)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(5)|skin(1)	24	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AAACTCCTCAGGAAGTTCTCC	0.512																																																	0													73.0	71.0	72.0					15																	101775550		2203	4300	6503	SO:0001583	missense	0			AB023207	CCDS10390.1	15q26.3	2013-02-19	2008-01-24	2008-01-24	ENSG00000131873	ENSG00000131873	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	17198	protein-coding gene	gene with protein product		608183	"""carbohydrate (chondroitin) synthase 1"""			11514575	Standard	NM_014918		Approved	KIAA0990, CSS1	uc021sxt.1	Q86X52	OTTHUMG00000149873	ENST00000254190.3:c.553C>A	15.37:g.101775550G>T	ENSP00000254190:p.Leu185Met		Q6UX38|Q7LFU5|Q9Y2J5	Missense_Mutation	SNP	pfam_Chond_GalNAc,pfam_Fringe-like	p.L185M	ENST00000254190.3	37	c.553	CCDS10390.1	15	.	.	.	.	.	.	.	.	.	.	G	21.2	4.115965	0.77323	.	.	ENSG00000131873	ENST00000254190	D	0.87650	-2.28	5.48	4.57	0.56435	.	0.000000	0.64402	D	0.000018	D	0.94245	0.8152	M	0.92784	3.345	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94555	0.7757	10	0.87932	D	0	-24.8062	10.4458	0.44493	0.1478:0.0:0.8522:0.0	.	185	Q86X52	CHSS1_HUMAN	M	185	ENSP00000254190:L185M	ENSP00000254190:L185M	L	-	1	2	CHSY1	99593073	1.000000	0.71417	0.918000	0.36340	0.969000	0.65631	4.870000	0.63035	1.317000	0.45149	0.655000	0.94253	CTG	CHSY1	-	pfam_Fringe-like	ENSG00000131873		0.512	CHSY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHSY1	HGNC	protein_coding	OTTHUMT00000313624.1	-	0.00	50	0	G	NM_014918		101775550	-1	tier1	-	no_errors	ENST00000254190	ensembl	human	known	74_37	missense	7.69	47	4	SNP	1.000	T
CLEC16A	23274	genome.wustl.edu	37	16	11097121	11097121	+	Missense_Mutation	SNP	A	A	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:11097121A>C	ENST00000409790.1	+	11	1492	c.1262A>C	c.(1261-1263)gAg>gCg	p.E421A	CLEC16A_ENST00000409552.3_Intron	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A											breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						AAAGGTACAGAGGGTGGTTCA	0.582																																																	0													76.0	89.0	85.0					16																	11097121		2045	4186	6231	SO:0001583	missense	0			AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.1262A>C	16.37:g.11097121A>C	ENSP00000387122:p.Glu421Ala			Missense_Mutation	SNP	pfam_Uncharacterised_FPL	p.E421A	ENST00000409790.1	37	c.1262	CCDS45409.1	16	.	.	.	.	.	.	.	.	.	.	A	22.6	4.308267	0.81247	.	.	ENSG00000038532	ENST00000409790;ENST00000542102	T	0.49139	0.79	5.62	5.62	0.85841	.	0.069428	0.56097	D	0.000031	T	0.52025	0.1709	L	0.54323	1.7	0.80722	D	1	P	0.51351	0.944	P	0.49085	0.6	T	0.49303	-0.8954	10	0.33141	T	0.24	-20.5721	14.9985	0.71451	1.0:0.0:0.0:0.0	.	421	Q2KHT3	CL16A_HUMAN	A	421	ENSP00000387122:E421A	ENSP00000387122:E421A	E	+	2	0	CLEC16A	11004622	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.229000	0.72294	2.151000	0.67156	0.533000	0.62120	GAG	CLEC16A	-	NULL	ENSG00000038532		0.582	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC16A	HGNC	protein_coding	OTTHUMT00000328540.2	-	0.00	108	0	A	NM_015226		11097121	+1	tier1	-	no_errors	ENST00000409790	ensembl	human	known	74_37	missense	30.30	46	20	SNP	1.000	C
CLSTN3	9746	genome.wustl.edu	37	12	7308935	7308936	+	Intron	DEL	TG	TG	-	rs141591357		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:7308935_7308936delTG	ENST00000266546.6	+	17	2977				CLSTN3_ENST00000537408.1_Intron|CLSTN3_ENST00000331148.5_3'UTR	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3						homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						CTTCGAGAGCTGTGTGTGTGTG	0.634																																																	0																																										SO:0001627	intron_variant	0			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.2528-1149TG>-	12.37:g.7308945_7308946delTG			D3DUT6|O94831|Q2T9J5|Q5UE57	RNA	DEL	-	NULL	ENST00000266546.6	37	NULL	CCDS8575.1	12																																																																																			CLSTN3	-	-	ENSG00000139182		0.634	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN3	HGNC	protein_coding	OTTHUMT00000398560.2		0.00	39	0	TG	NM_014718		7308936	+1	tier1		no_errors	ENST00000331148	ensembl	human	known	74_37	rna	5.88	32	2	DEL	0.062:0.004	-
CNOT3	4849	genome.wustl.edu	37	19	54652456	54652456	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:54652456C>A	ENST00000406403.1	+	11	2987	c.1384C>A	c.(1384-1386)Cac>Aac	p.H462N	CNOT3_ENST00000358389.3_Missense_Mutation_p.H281N|CNOT3_ENST00000221232.5_Missense_Mutation_p.H462N			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	462	Pro-rich.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TTCCGGCCCCCACAACCCACC	0.652																																																	0													18.0	22.0	21.0					19																	54652456		2202	4300	6502	SO:0001583	missense	0			AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.1384C>A	19.37:g.54652456C>A	ENSP00000383954:p.His462Asn		Q9NZN7|Q9UF76	Missense_Mutation	SNP	pfam_Not_N,pfam_NOT,pirsf_CCR4-NOT_su3/5	p.H462N	ENST00000406403.1	37	c.1384	CCDS12880.1	19	.	.	.	.	.	.	.	.	.	.	C	15.37	2.812487	0.50527	.	.	ENSG00000088038	ENST00000221232;ENST00000358389;ENST00000406403	T;T	0.41400	1.0;1.0	3.91	3.91	0.45181	.	0.474289	0.21731	N	0.069964	T	0.27765	0.0683	N	0.19112	0.55	0.44927	D	0.997944	P;B;P	0.47409	0.808;0.436;0.895	B;B;B	0.41236	0.161;0.057;0.351	T	0.04347	-1.0958	10	0.14252	T	0.57	-19.2338	15.2101	0.73214	0.0:1.0:0.0:0.0	.	462;462;386	B7Z6J7;O75175;Q6ZMJ6	.;CNOT3_HUMAN;.	N	462;281;462	ENSP00000221232:H462N;ENSP00000383954:H462N	ENSP00000221232:H462N	H	+	1	0	CNOT3	59344268	0.998000	0.40836	1.000000	0.80357	0.982000	0.71751	3.875000	0.56108	2.174000	0.68829	0.585000	0.79938	CAC	CNOT3	-	pirsf_CCR4-NOT_su3/5	ENSG00000088038		0.652	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNOT3	HGNC	protein_coding	OTTHUMT00000142130.3	-	0.00	95	0	C	NM_014516		54652456	+1	tier1	-	no_errors	ENST00000221232	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	A
COL11A1	1301	genome.wustl.edu	37	1	103355076	103355076	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:103355076G>C	ENST00000370096.3	-	59	4711	c.4399C>G	c.(4399-4401)Caa>Gaa	p.Q1467E	COL11A1_ENST00000358392.2_Missense_Mutation_p.Q1479E|COL11A1_ENST00000512756.1_Missense_Mutation_p.Q1351E|COL11A1_ENST00000353414.4_Missense_Mutation_p.Q1428E	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1467	Collagen-like 7.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTTTCCCCTTGTTCTCCTGGA	0.398																																																	0													72.0	69.0	70.0					1																	103355076		2203	4300	6503	SO:0001583	missense	0			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4399C>G	1.37:g.103355076G>C	ENSP00000359114:p.Gln1467Glu		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.Q1479E	ENST00000370096.3	37	c.4435	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.527228	0.64860	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.96041	-3.89;-3.89;-3.89;-3.89	5.46	5.46	0.80206	.	0.065538	0.64402	D	0.000005	D	0.95004	0.8383	N	0.25426	0.745	0.80722	D	1	P;P;D;D;P	0.59357	0.924;0.954;0.982;0.985;0.954	P;D;D;D;D	0.73708	0.9;0.954;0.968;0.981;0.954	D	0.93979	0.7256	10	0.30854	T	0.27	.	19.3074	0.94169	0.0:0.0:1.0:0.0	.	1351;1428;1479;1467;687	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	E	1467;1479;1428;687;1351	ENSP00000359114:Q1467E;ENSP00000351163:Q1479E;ENSP00000302551:Q1428E;ENSP00000426533:Q1351E	ENSP00000302551:Q1428E	Q	-	1	0	COL11A1	103127664	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.560000	0.86352	0.563000	0.77884	CAA	COL11A1	-	pfam_Collagen	ENSG00000060718		0.398	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1	-	0.00	89	0	G	NM_080630		103355076	-1	tier1	-	no_errors	ENST00000358392	ensembl	human	known	74_37	missense	35.71	80	45	SNP	1.000	C
CORO2B	10391	genome.wustl.edu	37	15	69003150	69003150	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:69003150G>A	ENST00000566799.1	+	4	442	c.413G>A	c.(412-414)cGg>cAg	p.R138Q	CORO2B_ENST00000261861.5_Missense_Mutation_p.R133Q|CORO2B_ENST00000540068.1_Missense_Mutation_p.R133Q|CORO2B_ENST00000543950.1_Missense_Mutation_p.R133Q			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	138					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						GGGCACAGCCGGCGTGTGGGG	0.652																																																	0													38.0	35.0	36.0					15																	69003150		2200	4297	6497	SO:0001583	missense	0			AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.413G>A	15.37:g.69003150G>A	ENSP00000454783:p.Arg138Gln		A8K0W3|O94767|Q8TAN1	Missense_Mutation	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R138Q	ENST00000566799.1	37	c.413	CCDS10229.2	15	.	.	.	.	.	.	.	.	.	.	G	36	5.958119	0.97145	.	.	ENSG00000103647	ENST00000261861;ENST00000540068;ENST00000543950	T;T	0.60171	0.21;0.21	5.56	5.56	0.83823	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.71195	0.3311	L	0.45051	1.395	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73107	-0.4087	10	0.87932	D	0	-25.1393	18.5079	0.90904	0.0:0.0:1.0:0.0	.	138	Q9UQ03	COR2B_HUMAN	Q	138;133;133	ENSP00000446250:R133Q;ENSP00000443819:R133Q	ENSP00000261861:R138Q	R	+	2	0	CORO2B	66790204	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.611000	0.98342	2.608000	0.88229	0.561000	0.74099	CGG	CORO2B	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000103647		0.652	CORO2B-203	KNOWN	basic|CCDS	protein_coding	CORO2B	HGNC	protein_coding		-	0.00	58	0	G	NM_006091		69003150	+1	tier1	-	no_errors	ENST00000566799	ensembl	human	known	74_37	missense	31.03	20	9	SNP	1.000	A
CPAMD8	27151	genome.wustl.edu	37	19	17039991	17039991	+	Missense_Mutation	SNP	G	G	A	rs200258917	byFrequency	TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:17039991G>A	ENST00000443236.1	-	24	3077	c.3046C>T	c.(3046-3048)Cgc>Tgc	p.R1016C		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	969						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CGGGTGAGGCGCAGTGGCCGC	0.582													G|||	2	0.000399361	0.0	0.0	5008	,	,		21102	0.0		0.0	False		,,,				2504	0.002																0								G	CYS/ARG	0,4222		0,0,2111	47.0	54.0	51.0		3046	1.1	0.0	19		51	1,8459		0,1,4229	yes	missense	CPAMD8	NM_015692.2	180	0,1,6340	AA,AG,GG		0.0118,0.0,0.0079	benign	1016/1933	17039991	1,12681	2111	4230	6341	SO:0001583	missense	0			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3046C>T	19.37:g.17039991G>A	ENSP00000402505:p.Arg1016Cys		Q8NC09|Q9ULD7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal_dom,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Kazal_dom	p.R1016C	ENST00000443236.1	37	c.3046	CCDS42519.1	19	.	.	.	.	.	.	.	.	.	.	G	6.462	0.453433	0.12283	0.0	1.18E-4	ENSG00000160111	ENST00000291440	.	.	.	3.4	1.1	0.20463	.	0.577212	0.15329	N	0.268138	T	0.28001	0.0690	L	0.31294	0.92	0.18873	N	0.999982	B	0.14438	0.01	B	0.06405	0.002	T	0.18053	-1.0349	9	0.52906	T	0.07	.	7.6081	0.28113	0.0957:0.1666:0.7377:0.0	.	969	Q8IZJ3	CPMD8_HUMAN	C	1016	.	ENSP00000291440:R1016C	R	-	1	0	CPAMD8	16900991	0.311000	0.24536	0.001000	0.08648	0.398000	0.30690	2.314000	0.43743	0.002000	0.14630	0.655000	0.94253	CGC	CPAMD8	-	NULL	ENSG00000160111		0.582	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	-	0.00	82	0	G	NM_015692		17039991	-1	tier1	rs200258917	no_errors	ENST00000443236	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.034	A
CRYBB3	1417	genome.wustl.edu	37	22	25603066	25603066	+	Missense_Mutation	SNP	C	C	T	rs373833533		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr22:25603066C>T	ENST00000215855.2	+	6	603	c.523C>T	c.(523-525)Cgg>Tgg	p.R175W	CRYBB3_ENST00000404334.1_3'UTR	NM_004076.3	NP_004067.1	P26998	CRBB3_HUMAN	crystallin, beta B3	175	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			large_intestine(2)|lung(2)|prostate(1)	5						CGTGTTTGAGCGGGGCGAGTA	0.647																																																	0													49.0	46.0	47.0					22																	25603066		2203	4299	6502	SO:0001583	missense	0				CCDS13830.1	22q11.23	2008-06-10			ENSG00000100053	ENSG00000100053			2400	protein-coding gene	gene with protein product		123630		CRYB3		8999933	Standard	NM_004076		Approved		uc003abo.2	P26998	OTTHUMG00000150869	ENST00000215855.2:c.523C>T	22.37:g.25603066C>T	ENSP00000215855:p.Arg175Trp		Q3B7S9|Q3T1B7|Q6ISK6|Q92965|Q9UH09	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.R175W	ENST00000215855.2	37	c.523	CCDS13830.1	22	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998248	0.74818	.	.	ENSG00000100053	ENST00000215855	T	0.77489	-1.1	4.87	2.52	0.30459	Beta/gamma crystallin (5);Gamma-crystallin-related (1);	0.498297	0.21676	N	0.070797	D	0.83225	0.5208	M	0.86097	2.795	0.80722	D	1	D	0.58620	0.983	P	0.51999	0.687	D	0.86063	0.1533	10	0.72032	D	0.01	.	11.217	0.48831	0.3527:0.6473:0.0:0.0	.	175	P26998	CRBB3_HUMAN	W	175	ENSP00000215855:R175W	ENSP00000215855:R175W	R	+	1	2	CRYBB3	23933066	0.138000	0.22547	0.982000	0.44146	0.930000	0.56654	0.450000	0.21762	2.223000	0.72356	0.561000	0.74099	CGG	CRYBB3	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	ENSG00000100053		0.647	CRYBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYBB3	HGNC	protein_coding	OTTHUMT00000320352.1	-	0.00	232	0	C	NM_004076		25603066	+1	tier1	-	no_errors	ENST00000215855	ensembl	human	known	74_37	missense	44.53	70	57	SNP	0.997	T
CSDE1	7812	genome.wustl.edu	37	1	115268876	115268877	+	Frame_Shift_Ins	INS	-	-	AATC			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:115268876_115268877insAATC	ENST00000358528.4	-	14	2021_2022	c.1595_1596insGATT	c.(1594-1596)tttfs	p.F532fs	CSDE1_ENST00000339438.6_Frame_Shift_Ins_p.F501fs|CSDE1_ENST00000438362.2_Frame_Shift_Ins_p.F578fs|Y_RNA_ENST00000365030.1_RNA|CSDE1_ENST00000369530.1_Frame_Shift_Ins_p.F547fs|CSDE1_ENST00000530886.1_Frame_Shift_Ins_p.F402fs|CSDE1_ENST00000261443.5_Frame_Shift_Ins_p.F501fs|CSDE1_ENST00000534699.1_Frame_Shift_Ins_p.F532fs	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	532	CSD 7.				male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGTTTCAATAAATCCAAAATT	0.406																																																	0																																										SO:0001589	frameshift_variant	0				CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.1592_1595dupGATT	1.37:g.115268877_115268880dupAATC	ENSP00000351329:p.Phe532fs		A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Frame_Shift_Ins	INS	pfam_CSP_DNA-bd,superfamily_NA-bd_OB-fold,smart_Cold_shock_prot	p.F547fs	ENST00000358528.4	37	c.1641_1640	CCDS30812.1	1																																																																																			CSDE1	-	pfam_CSP_DNA-bd,superfamily_NA-bd_OB-fold,smart_Cold_shock_prot	ENSG00000009307		0.406	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CSDE1	HGNC	protein_coding	OTTHUMT00000033397.1		0.00	58	0	-	NM_007158		115268877	-1	tier1		no_errors	ENST00000369530	ensembl	human	known	74_37	frame_shift_ins	23.94	54	17	INS	1.000:1.000	AATC
CSMD3	114788	genome.wustl.edu	37	8	113516192	113516192	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr8:113516192G>C	ENST00000297405.5	-	30	5154	c.4910C>G	c.(4909-4911)cCa>cGa	p.P1637R	CSMD3_ENST00000352409.3_Missense_Mutation_p.P1637R|CSMD3_ENST00000343508.3_Missense_Mutation_p.P1597R|CSMD3_ENST00000455883.2_Missense_Mutation_p.P1533R	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1637	CUB 9. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTCATAGTTTGGTTCTATGCT	0.328										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													93.0	88.0	90.0					8																	113516192		2203	4300	6503	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4910C>G	8.37:g.113516192G>C	ENSP00000297405:p.Pro1637Arg		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.P1637R	ENST00000297405.5	37	c.4910	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	21.2	4.117451	0.77323	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27	4.96	4.96	0.65561	CUB (5);	0.000000	0.64402	D	0.000001	T	0.37073	0.0990	L	0.49256	1.55	0.44976	D	0.997995	D;D;D	0.67145	0.975;0.98;0.996	P;D;D	0.72625	0.894;0.936;0.978	T	0.02610	-1.1134	10	0.42905	T	0.14	.	18.378	0.90441	0.0:0.0:1.0:0.0	.	1533;1637;1597	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	R	1597;1637;977;1533;1637	ENSP00000345799:P1597R;ENSP00000297405:P1637R;ENSP00000341558:P977R;ENSP00000412263:P1533R;ENSP00000343124:P1637R	ENSP00000297405:P1637R	P	-	2	0	CSMD3	113585368	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.387000	0.97232	2.560000	0.86352	0.557000	0.71058	CCA	CSMD3	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000164796		0.328	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1		0.00	18	0	G	NM_052900		113516192	-1			no_errors	ENST00000297405	ensembl	human	known	74_37	missense	12.50	63	9	SNP	1.000	C
CSMD3	114788	genome.wustl.edu	37	8	113529308	113529308	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr8:113529308C>T	ENST00000297405.5	-	28	4955	c.4711G>A	c.(4711-4713)Gta>Ata	p.V1571I	CSMD3_ENST00000352409.3_Missense_Mutation_p.V1571I|CSMD3_ENST00000343508.3_Missense_Mutation_p.V1531I|CSMD3_ENST00000455883.2_Missense_Mutation_p.V1467I	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1571	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CGATTTTCTACCTGAATGCAG	0.383										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													142.0	133.0	136.0					8																	113529308		2203	4300	6503	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4711G>A	8.37:g.113529308C>T	ENSP00000297405:p.Val1571Ile		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.V1571I	ENST00000297405.5	37	c.4711	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	10.52	1.372382	0.24857	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87	4.88	3.99	0.46301	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000004	T	0.25158	0.0611	N	0.04820	-0.15	0.25447	N	0.988046	D;D;P	0.55172	0.963;0.97;0.606	P;P;B	0.59487	0.778;0.858;0.352	T	0.20107	-1.0285	10	0.36615	T	0.2	.	14.5563	0.68103	0.1475:0.8525:0.0:0.0	.	1467;1571;1531	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	I	1531;1571;911;1467;1571	ENSP00000345799:V1531I;ENSP00000297405:V1571I;ENSP00000341558:V911I;ENSP00000412263:V1467I;ENSP00000343124:V1571I	ENSP00000297405:V1571I	V	-	1	0	CSMD3	113598484	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.990000	0.49401	1.249000	0.43950	0.585000	0.79938	GTA	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.383	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	92	0	C	NM_052900		113529308	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	20.25	130	33	SNP	1.000	T
CSRP2BP	57325	genome.wustl.edu	37	20	18165377	18165377	+	Missense_Mutation	SNP	G	G	A	rs369048963		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr20:18165377G>A	ENST00000435364.3	+	9	2457	c.2116G>A	c.(2116-2118)Gtc>Atc	p.V706I	CSRP2BP_ENST00000489634.2_Missense_Mutation_p.V578I|CSRP2BP_ENST00000377681.3_Missense_Mutation_p.V705I	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	706	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						ATTTCTGTTCGTCCACCCTGA	0.383																																																	0													208.0	174.0	185.0					20																	18165377		2203	4300	6503	SO:0001583	missense	0			AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.2116G>A	20.37:g.18165377G>A	ENSP00000392318:p.Val706Ile		A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.V706I	ENST00000435364.3	37	c.2116	CCDS13133.1	20	.	.	.	.	.	.	.	.	.	.	G	34	5.320306	0.95682	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.62498	0.02;0.02;0.02;0.02	5.99	5.99	0.97316	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.76169	0.3950	L	0.48935	1.535	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.983;0.99	T	0.75932	-0.3143	10	0.72032	D	0.01	-22.9877	20.4777	0.99188	0.0:0.0:1.0:0.0	.	578;706	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	I	706;705;706;578	ENSP00000278816:V706I;ENSP00000366909:V705I;ENSP00000392318:V706I;ENSP00000425909:V578I	ENSP00000278816:V706I	V	+	1	0	CSRP2BP	18113377	1.000000	0.71417	0.982000	0.44146	0.948000	0.59901	9.750000	0.98875	2.840000	0.97914	0.655000	0.94253	GTC	CSRP2BP	-	pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000149474		0.383	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSRP2BP	HGNC	protein_coding	OTTHUMT00000078152.5	-	0.00	24	0	G	NM_020536		18165377	+1	tier1	-	no_errors	ENST00000435364	ensembl	human	known	74_37	missense	34.62	17	9	SNP	1.000	A
CX3CR1	1524	genome.wustl.edu	37	3	39307429	39307429	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:39307429C>T	ENST00000541347.1	-	2	811	c.572G>A	c.(571-573)cGc>cAc	p.R191H	CX3CR1_ENST00000358309.3_Missense_Mutation_p.R223H|CX3CR1_ENST00000542107.1_Missense_Mutation_p.R191H|CX3CR1_ENST00000399220.2_Missense_Mutation_p.R191H	NM_001171171.1	NP_001164642.1	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	191					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cerebral cortex cell migration (GO:0021795)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|macrophage chemotaxis (GO:0048246)|microglial cell activation involved in immune response (GO:0002282)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of angiogenesis (GO:0045766)|response to wounding (GO:0009611)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|neuronal cell body membrane (GO:0032809)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-X3-C chemokine receptor activity (GO:0016495)|chemokine receptor activity (GO:0004950)			endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		TTCCACATTGCGGAGCACGGG	0.478																																																	0													102.0	102.0	102.0					3																	39307429		1897	4109	6006	SO:0001583	missense	0			BC028078	CCDS43069.1, CCDS54571.1	3p21.3	2012-08-08	2002-08-22		ENSG00000168329	ENSG00000168329		"""GPCR / Class A : Chemokine receptors : C-X-3-C motif"""	2558	protein-coding gene	gene with protein product		601470	"""chemokine (C-X3-C) receptor 1"""	GPR13, CMKBRL1		9726990, 7646814	Standard	NM_001171171		Approved	CMKDR1, V28, CCRL1	uc021wwc.1	P49238	OTTHUMG00000156249	ENST00000541347.1:c.572G>A	3.37:g.39307429C>T	ENSP00000439140:p.Arg191His		A0N0N6|B2R5Z4|J3KP17	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CX3CR1,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Duffy_chemokine_rcpt,prints_Chemokine_CXCR4	p.R223H	ENST00000541347.1	37	c.668	CCDS43069.1	3	.	.	.	.	.	.	.	.	.	.	C	7.548	0.662087	0.14645	.	.	ENSG00000168329	ENST00000399220;ENST00000538756;ENST00000358309;ENST00000541347;ENST00000542107	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	5.62	2.82	0.32997	GPCR, rhodopsin-like superfamily (1);	0.559772	0.19091	N	0.122950	T	0.19765	0.0475	N	0.11201	0.11	0.09310	N	1	D	0.56287	0.975	P	0.47102	0.537	T	0.06463	-1.0825	10	0.16896	T	0.51	.	5.8438	0.18652	0.1513:0.6844:0.0:0.1643	.	191	P49238	CX3C1_HUMAN	H	191;199;223;191;191	ENSP00000382166:R191H;ENSP00000351059:R223H;ENSP00000439140:R191H;ENSP00000444928:R191H	ENSP00000351059:R223H	R	-	2	0	CX3CR1	39282433	0.000000	0.05858	0.086000	0.20670	0.214000	0.24535	-0.048000	0.11944	0.719000	0.32188	0.655000	0.94253	CGC	CX3CR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CX3CR1	ENSG00000168329		0.478	CX3CR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CX3CR1	HGNC	protein_coding	OTTHUMT00000343613.1	-	0.00	61	0	C	NM_001337		39307429	-1	tier1	-	no_errors	ENST00000358309	ensembl	human	known	74_37	missense	32.20	40	19	SNP	0.003	T
CXXC1	30827	genome.wustl.edu	37	18	47809897	47809897	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr18:47809897G>T	ENST00000285106.6	-	12	2276	c.1562C>A	c.(1561-1563)aCa>aAa	p.T521K	MBD1_ENST00000591416.1_5'Flank|MBD1_ENST00000269471.5_5'Flank|MBD1_ENST00000457839.2_5'Flank|MBD1_ENST00000436910.1_5'Flank|MBD1_ENST00000269468.5_5'Flank|MBD1_ENST00000585595.1_5'Flank|CXXC1_ENST00000589940.1_Missense_Mutation_p.T521K|MBD1_ENST00000347968.3_5'Flank|MBD1_ENST00000349085.2_5'Flank|MBD1_ENST00000424334.2_5'Flank|CXXC1_ENST00000412036.2_Missense_Mutation_p.T525K|CXXC1_ENST00000587396.1_5'Flank|MBD1_ENST00000398493.1_5'Flank|MBD1_ENST00000353909.3_5'Flank|MBD1_ENST00000339998.6_5'Flank|MBD1_ENST00000590208.1_5'Flank|MBD1_ENST00000587605.1_5'Flank|MBD1_ENST00000382948.5_5'Flank|MBD1_ENST00000585672.1_5'Flank	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	521					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						TTCAATGCGTGTGGGGTACAT	0.597																																																	0													87.0	61.0	70.0					18																	47809897		2203	4300	6503	SO:0001583	missense	0			BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.1562C>A	18.37:g.47809897G>T	ENSP00000285106:p.Thr521Lys		B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Missense_Mutation	SNP	pfam_CpG-bd_C,pfam_Znf_CXXC,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.T525K	ENST00000285106.6	37	c.1574	CCDS11945.1	18	.	.	.	.	.	.	.	.	.	.	G	23.1	4.375953	0.82682	.	.	ENSG00000154832	ENST00000285106;ENST00000412036	T;T	0.25085	1.82;1.82	4.65	4.65	0.58169	CpG binding protein, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.50497	0.1619	M	0.72118	2.19	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.87578	0.962;0.978;0.998	T	0.55101	-0.8193	10	0.87932	D	0	-15.0297	15.3793	0.74641	0.0:0.0:1.0:0.0	.	525;521;388	Q9P0U4-2;Q9P0U4;Q59EC8	.;CXXC1_HUMAN;.	K	521;525	ENSP00000285106:T521K;ENSP00000390475:T525K	ENSP00000285106:T521K	T	-	2	0	CXXC1	46063895	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.906000	0.92626	2.290000	0.77057	0.467000	0.42956	ACA	CXXC1	-	pfam_CpG-bd_C	ENSG00000154832		0.597	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CXXC1	HGNC	protein_coding	OTTHUMT00000255927.2	-	0.00	83	0	G	NM_014593		47809897	-1	tier1	-	no_errors	ENST00000412036	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
CXXC5	51523	genome.wustl.edu	37	5	139060532	139060532	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:139060532G>T	ENST00000302517.3	+	2	1138	c.424G>T	c.(424-426)Gcc>Tcc	p.A142S	CXXC5_ENST00000511048.1_Missense_Mutation_p.A142S	NM_016463.7	NP_057547.5	Q7LFL8	CXXC5_HUMAN	CXXC finger protein 5	142					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTGCTGTGGCCAGCCTGCT	0.637																																																	0													57.0	70.0	66.0					5																	139060532		2119	4244	6363	SO:0001583	missense	0			AK024338	CCDS43370.1	5q31.3	2014-02-18	2011-12-01						26943	protein-coding gene	gene with protein product	"""retinoid-inducible nuclear factor"", ""WT1-induced Inhibitor of Dishevelled"""	612752				11042152, 19001364, 19182210, 20220130	Standard	NM_016463		Approved	HSPC195, RINF, WID	uc010jfg.1	Q7LFL8		ENST00000302517.3:c.424G>T	5.37:g.139060532G>T	ENSP00000302543:p.Ala142Ser		B3KND0|C8CBA8|Q8TB79|Q9NV51|Q9P0S8	Missense_Mutation	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.A142S	ENST00000302517.3	37	c.424	CCDS43370.1	5	.	.	.	.	.	.	.	.	.	.	G	14.40	2.525112	0.44969	.	.	ENSG00000171604	ENST00000302517;ENST00000504844;ENST00000511048;ENST00000502716;ENST00000511457	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	5.68	5.68	0.88126	.	0.382594	0.26995	N	0.021447	T	0.39172	0.1068	L	0.27053	0.805	0.43830	D	0.996403	B	0.21452	0.056	B	0.18263	0.021	T	0.17561	-1.0365	9	.	.	.	-7.2395	13.8587	0.63545	0.0:0.0:0.838:0.1619	.	142	Q7LFL8	CXXC5_HUMAN	S	142	ENSP00000302543:A142S;ENSP00000427379:A142S;ENSP00000424219:A142S;ENSP00000430949:A142S	.	A	+	1	0	CXXC5	139040716	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.224000	0.51238	2.681000	0.91329	0.561000	0.74099	GCC	CXXC5	-	NULL	ENSG00000171604		0.637	CXXC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXXC5	HGNC	protein_coding	OTTHUMT00000372744.1	-	0.00	132	0	G	NM_016463		139060532	+1	tier1	-	no_errors	ENST00000302517	ensembl	human	known	74_37	missense	41.38	34	24	SNP	1.000	T
CYTH2	9266	genome.wustl.edu	37	19	48981804	48981804	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:48981804C>T	ENST00000452733.2	+	11	1543	c.1067C>T	c.(1066-1068)tCg>tTg	p.S356L	CYTH2_ENST00000427476.1_Missense_Mutation_p.S357L|CTC-273B12.8_ENST00000599877.1_lincRNA			Q99418	CYH2_HUMAN	cytohesin 2	357	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|inositol 1,4,5 trisphosphate binding (GO:0070679)|lipid binding (GO:0008289)	p.S357L(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						TACCGGATCTCGGCCCCCACG	0.612																																																	1	Substitution - Missense(1)	lung(1)											56.0	55.0	55.0					19																	48981804		2203	4300	6503	SO:0001583	missense	0			X99753	CCDS12722.1	19q13.32	2014-05-02	2008-08-14	2008-08-14	ENSG00000105443	ENSG00000105443		"""Pleckstrin homology (PH) domain containing"""	9502	protein-coding gene	gene with protein product		602488	"""pleckstrin homology, Sec7 and coiled/coil domains 2 (cytohesin-2)"", ""pleckstrin homology, Sec7 and coiled-coil domains 2"""	PSCD2L, PSCD2		8706128, 8945478, 20525696	Standard	NM_004228		Approved	CTS18.1, Sec7p-L, ARNO, Sec7p-like, cytohesin-2	uc002pjj.4	Q99418	OTTHUMG00000150245	ENST00000452733.2:c.1067C>T	19.37:g.48981804C>T	ENSP00000408236:p.Ser356Leu		A8K8P0|Q8IXY9|Q92958	Missense_Mutation	SNP	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom	p.S357L	ENST00000452733.2	37	c.1070	CCDS12722.1	19	.	.	.	.	.	.	.	.	.	.	C	19.35	3.810800	0.70797	.	.	ENSG00000105443	ENST00000452733;ENST00000427476	T;T	0.77620	-1.11;-1.11	4.47	3.43	0.39272	.	0.072620	0.56097	D	0.000028	T	0.80325	0.4602	M	0.84585	2.705	0.58432	D	0.999999	P	0.39003	0.654	B	0.41510	0.359	T	0.82390	-0.0481	10	0.72032	D	0.01	.	10.6794	0.45804	0.0:0.9052:0.0:0.0948	.	356	Q99418-2	.	L	356;357	ENSP00000408236:S356L;ENSP00000391648:S357L	ENSP00000391648:S357L	S	+	2	0	CYTH2	53673616	1.000000	0.71417	0.991000	0.47740	0.978000	0.69477	5.807000	0.69157	1.227000	0.43598	0.655000	0.94253	TCG	CYTH2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000105443		0.612	CYTH2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYTH2	HGNC	protein_coding	OTTHUMT00000317060.1		0.00	94	0	C	NM_004228		48981804	+1			no_errors	ENST00000427476	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.999	T
DCAF4	26094	genome.wustl.edu	37	14	73422300	73422300	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr14:73422300G>T	ENST00000358377.2	+	12	1295	c.1075G>T	c.(1075-1077)Ggc>Tgc	p.G359C	DCAF4_ENST00000553457.1_Missense_Mutation_p.G259C|DCAF4_ENST00000509153.1_Missense_Mutation_p.G299C|DCAF4_ENST00000394234.2_Missense_Mutation_p.G259C|DCAF4_ENST00000555042.1_Missense_Mutation_p.G353C|DCAF4_ENST00000353777.3_Missense_Mutation_p.G189C	NM_001163509.1|NM_015604.3	NP_001156981.1|NP_056419.2	Q8WV16	DCAF4_HUMAN	DDB1 and CUL4 associated factor 4	359					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|skin(1)	22						TGGAAATCAAGGCAAGGGATG	0.542																																																	0													212.0	199.0	203.0					14																	73422300		2203	4300	6503	SO:0001583	missense	0			BC018979	CCDS9809.1, CCDS9810.1, CCDS41968.1, CCDS41968.2, CCDS55926.1	14q24.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000119599		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20229	protein-coding gene	gene with protein product			"""WD repeat domain 21"", ""WD repeat domain 21A"""	WDR21, WDR21A			Standard	NM_015604		Approved	DKFZp434K114	uc010ttr.2	Q8WV16		ENST00000358377.2:c.1075G>T	14.37:g.73422300G>T	ENSP00000351147:p.Gly359Cys		B4DUT6|G3V522|Q86U31|Q8IV10|Q96K22|Q9Y4P5	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G359C	ENST00000358377.2	37	c.1075	CCDS9809.1	14	.	.	.	.	.	.	.	.	.	.	G	16.87	3.242839	0.58995	.	.	ENSG00000119599	ENST00000358377;ENST00000353777;ENST00000394234;ENST00000509153;ENST00000555042;ENST00000553457	T;T;T;T;T;T	0.71103	-0.54;1.93;1.93;1.93;1.93;1.93	5.64	3.81	0.43845	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.244180	0.48767	D	0.000166	T	0.70168	0.3193	L	0.39020	1.185	0.36447	D	0.865867	B;D;D;D;B;D	0.61080	0.399;0.977;0.987;0.975;0.223;0.989	B;P;P;P;B;P	0.60068	0.141;0.832;0.853;0.853;0.132;0.868	T	0.73597	-0.3932	10	0.45353	T	0.12	.	6.9068	0.24313	0.144:0.0:0.7146:0.1414	.	299;338;359;353;189;359	B4DUT6;B4DN30;Q8WV16-2;G3V522;Q86SY2;Q8WV16	.;.;.;.;.;DCAF4_HUMAN	C	359;189;259;299;353;259	ENSP00000351147:G359C;ENSP00000345176:G189C;ENSP00000377781:G259C;ENSP00000426178:G299C;ENSP00000452131:G353C;ENSP00000451186:G259C	ENSP00000345176:G189C	G	+	1	0	DCAF4	72492053	1.000000	0.71417	0.971000	0.41717	0.894000	0.52154	5.332000	0.65911	1.388000	0.46506	0.561000	0.74099	GGC	DCAF4	-	superfamily_WD40_repeat_dom	ENSG00000119599		0.542	DCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCAF4	HGNC	protein_coding	OTTHUMT00000361058.1	-	0.00	37	0	G	NM_015604		73422300	+1	tier1	-	no_errors	ENST00000358377	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.998	T
DCAF4L1	285429	genome.wustl.edu	37	4	41984704	41984704	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr4:41984704C>A	ENST00000333141.5	+	1	992	c.895C>A	c.(895-897)Ctg>Atg	p.L299M		NM_001029955.3	NP_001025126.2	Q3SXM0	DC4L1_HUMAN	DDB1 and CUL4 associated factor 4-like 1	299										breast(1)|endometrium(5)|kidney(6)|large_intestine(11)|lung(12)|prostate(1)|skin(1)	37						GCTGTGGGATCTGAGGGCCAC	0.527																																																	0													133.0	108.0	117.0					4																	41984704		2203	4300	6503	SO:0001583	missense	0			BC035027	CCDS33978.1	4p13	2013-01-09	2009-07-17	2009-07-17		ENSG00000182308		"""WD repeat domain containing"""	27723	protein-coding gene	gene with protein product			"""WD repeat domain 21B"""	WDR21B			Standard	NM_001029955		Approved		uc003gwk.2	Q3SXM0		ENST00000333141.5:c.895C>A	4.37:g.41984704C>A	ENSP00000327796:p.Leu299Met		B3KVI3|Q3ZCW8|Q499Y5|Q9UFI0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L299M	ENST00000333141.5	37	c.895	CCDS33978.1	4	.	.	.	.	.	.	.	.	.	.	C	10.80	1.452114	0.26074	.	.	ENSG00000182308	ENST00000333141	T	0.28255	1.62	0.97	0.97	0.19692	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.075804	0.53938	D	0.000046	T	0.27900	0.0687	M	0.74258	2.255	0.32779	N	0.502731	D	0.54964	0.969	B	0.41332	0.354	T	0.46693	-0.9173	10	0.72032	D	0.01	.	4.8876	0.13710	0.0:0.6049:0.395:0.0	.	299	Q3SXM0	DC4L1_HUMAN	M	299	ENSP00000327796:L299M	ENSP00000327796:L299M	L	+	1	2	DCAF4L1	41679461	0.971000	0.33674	0.869000	0.34112	0.312000	0.27988	0.326000	0.19646	0.821000	0.34540	0.313000	0.20887	CTG	DCAF4L1	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000182308		0.527	DCAF4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L1	HGNC	protein_coding	OTTHUMT00000360958.1	-	0.00	77	0	C	NM_001029955		41984704	+1	tier1	-	no_errors	ENST00000333141	ensembl	human	known	74_37	missense	33.33	34	17	SNP	0.997	A
DCLK3	85443	genome.wustl.edu	37	3	36779064	36779064	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:36779064C>A	ENST00000416516.2	-	2	1577	c.1087G>T	c.(1087-1089)Ggg>Tgg	p.G363W		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	363	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						TTCCCATCCCCAATGACCCGG	0.567																																																	0													86.0	84.0	85.0					3																	36779064		2102	4241	6343	SO:0001583	missense	0			AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.1087G>T	3.37:g.36779064C>A	ENSP00000394484:p.Gly363Trp			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G363W	ENST00000416516.2	37	c.1087	CCDS43064.1	3	.	.	.	.	.	.	.	.	.	.	C	17.00	3.276994	0.59758	.	.	ENSG00000163673	ENST00000416516	D	0.83075	-1.68	5.64	5.64	0.86602	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.33438	N	0.004920	D	0.95771	0.8624	H	0.99573	4.635	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97300	0.9930	10	0.87932	D	0	.	20.0957	0.97842	0.0:1.0:0.0:0.0	.	363	Q9C098	DCLK3_HUMAN	W	363	ENSP00000394484:G363W	ENSP00000394484:G363W	G	-	1	0	DCLK3	36754068	1.000000	0.71417	0.951000	0.38953	0.074000	0.17049	7.769000	0.85360	2.837000	0.97791	0.655000	0.94253	GGG	DCLK3	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000163673		0.567	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLK3	HGNC	protein_coding	OTTHUMT00000341727.1	-	0.00	52	0	C	XM_047355		36779064	-1	tier1	-	no_errors	ENST00000416516	ensembl	human	known	74_37	missense	26.19	31	11	SNP	1.000	A
DENND4B	9909	genome.wustl.edu	37	1	153905768	153905768	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:153905768C>T	ENST00000361217.4	-	21	3776	c.3358G>A	c.(3358-3360)Gac>Aac	p.D1120N	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	1120	Ser-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCTGAGAGGTCCCACTCACTG	0.557																																																	0													47.0	52.0	50.0					1																	153905768		2048	4197	6245	SO:0001583	missense	0			AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.3358G>A	1.37:g.153905768C>T	ENSP00000354597:p.Asp1120Asn		Q5T4K0	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.D1120N	ENST00000361217.4	37	c.3358	CCDS44228.1	1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.573345	0.65765	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.08720	3.09;3.06	5.17	4.26	0.50523	.	0.228496	0.43919	D	0.000505	T	0.05044	0.0135	N	0.24115	0.695	0.42866	D	0.994125	D	0.55172	0.97	P	0.51297	0.665	T	0.42965	-0.9420	10	0.45353	T	0.12	-22.3444	12.4829	0.55854	0.0:0.9183:0.0:0.0817	.	1120	O75064	DEN4B_HUMAN	N	1120;1131	ENSP00000354597:D1120N;ENSP00000357635:D1131N	ENSP00000354597:D1120N	D	-	1	0	DENND4B	152172392	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.706000	0.61845	1.411000	0.46957	0.455000	0.32223	GAC	DENND4B	-	NULL	ENSG00000198837		0.557	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4B	HGNC	protein_coding	OTTHUMT00000090278.2	-	0.00	50	0	C	XM_375806		153905768	-1	tier1	-	no_errors	ENST00000361217	ensembl	human	known	74_37	missense	38.71	19	12	SNP	1.000	T
DEGS1	8560	genome.wustl.edu	37	1	224380109	224380109	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:224380109G>T	ENST00000323699.4	+	3	1067	c.901G>T	c.(901-903)Gtg>Ttg	p.V301L	DEGS1_ENST00000391877.3_Missense_Mutation_p.V301L	NM_003676.3	NP_003667.1	O15121	DEGS1_HUMAN	delta(4)-desaturase, sphingolipid 1	301					small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|unsaturated fatty acid biosynthetic process (GO:0006636)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|kidney(3)|large_intestine(2)|lung(4)	10	Breast(184;0.193)			GBM - Glioblastoma multiforme(131;0.00643)		GTATGATTTTGTGATGGATGA	0.393																																																	0													86.0	79.0	81.0					1																	224380109		2203	4300	6503	SO:0001583	missense	0			AF002668	CCDS1540.1	1q42.11	2013-09-02	2011-12-09	2004-12-14	ENSG00000143753	ENSG00000143753		"""Fatty acid desaturases"""	13709	protein-coding gene	gene with protein product	"""sphingolipid delta(4)-desaturase 1"", ""dihydroceramide desaturase 1"""	615843	"""degenerative spermatocyte homolog 1, lipid desaturase (Drosophila)"""			9188692, 20105137	Standard	NM_003676		Approved	MLD, Des-1, DES1, FADS7, DEGS-1	uc001hoj.3	O15121	OTTHUMG00000037496	ENST00000323699.4:c.901G>T	1.37:g.224380109G>T	ENSP00000316476:p.Val301Leu			Missense_Mutation	SNP	pfam_Fatty_acid_desaturase-1,pfam_Sphingolipid_d4-desaturase_N,pirsf_Sphingolipid_d4-desaturase	p.V301L	ENST00000323699.4	37	c.901	CCDS1540.1	1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.214316	0.58452	.	.	ENSG00000143753	ENST00000323699;ENST00000391877	T;T	0.34275	1.37;1.37	5.85	4.94	0.65067	.	0.114376	0.64402	D	0.000010	T	0.35885	0.0947	L	0.54863	1.705	0.54753	D	0.999987	B	0.16396	0.017	B	0.23852	0.049	T	0.11084	-1.0602	9	.	.	.	.	14.8418	0.70230	0.0688:0.0:0.9312:0.0	.	301	O15121	DEGS1_HUMAN	L	301	ENSP00000316476:V301L;ENSP00000375749:V301L	.	V	+	1	0	DEGS1	222446732	1.000000	0.71417	0.994000	0.49952	0.986000	0.74619	5.200000	0.65158	1.470000	0.48102	0.561000	0.74099	GTG	DEGS1	-	pirsf_Sphingolipid_d4-desaturase	ENSG00000143753		0.393	DEGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEGS1	HGNC	protein_coding	OTTHUMT00000091285.2	-	0.00	39	0	G			224380109	+1	tier1	-	no_errors	ENST00000323699	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
DEPTOR	64798	genome.wustl.edu	37	8	120977610	120977610	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr8:120977610G>T	ENST00000286234.5	+	4	694	c.564G>T	c.(562-564)caG>caT	p.Q188H	DEPTOR_ENST00000523492.1_Missense_Mutation_p.Q87H	NM_022783.2	NP_073620.2	Q8TB45	DPTOR_HUMAN	DEP domain containing MTOR-interacting protein	188	DEP 2. {ECO:0000255|PROSITE- ProRule:PRU00066}.				intracellular signal transduction (GO:0035556)|negative regulation of cell size (GO:0045792)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of TOR signaling (GO:0032007)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)	intracellular (GO:0005622)				endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	18						AGGCAGAGCAGCTTTGCCACC	0.547																																																	0													114.0	92.0	99.0					8																	120977610		2203	4300	6503	SO:0001583	missense	0				CCDS6331.1, CCDS64960.1	8q24.12	2011-12-13	2010-12-08	2010-12-08	ENSG00000155792	ENSG00000155792			22953	protein-coding gene	gene with protein product		612974	"""DEP domain containing 6"""	DEPDC6		19446321	Standard	NM_022783		Approved	DEP.6, FLJ12428	uc003yow.4	Q8TB45	OTTHUMG00000165052	ENST00000286234.5:c.564G>T	8.37:g.120977610G>T	ENSP00000286234:p.Gln188His		B2RCL9|B4DN97|E7EV87|Q96EQ1|Q9H0R7|Q9H894|Q9HA07	Missense_Mutation	SNP	pfam_DEP_dom,superfamily_PDZ,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ	p.Q188H	ENST00000286234.5	37	c.564	CCDS6331.1	8	.	.	.	.	.	.	.	.	.	.	G	14.56	2.570748	0.45798	.	.	ENSG00000155792	ENST00000523492;ENST00000286234	T;T	0.21932	1.98;1.98	5.31	2.09	0.27110	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.053581	0.85682	D	0.000000	T	0.30039	0.0752	L	0.38953	1.18	0.58432	D	0.999999	D;D	0.69078	0.997;0.973	D;P	0.64595	0.927;0.747	T	0.01409	-1.1362	10	0.45353	T	0.12	-29.5009	10.7729	0.46334	0.2989:0.0:0.7011:0.0	.	87;188	E7EV87;Q8TB45	.;DPTOR_HUMAN	H	87;188	ENSP00000430457:Q87H;ENSP00000286234:Q188H	ENSP00000286234:Q188H	Q	+	3	2	DEPTOR	121046791	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	2.597000	0.46214	0.632000	0.30432	0.655000	0.94253	CAG	DEPTOR	-	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	ENSG00000155792		0.547	DEPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEPTOR	HGNC	protein_coding	OTTHUMT00000381601.1		0.00	17	0	G	NM_022783		120977610	+1			no_errors	ENST00000286234	ensembl	human	known	74_37	missense	16.13	26	5	SNP	1.000	T
DHDH	27294	genome.wustl.edu	37	19	49442849	49442850	+	Frame_Shift_Ins	INS	-	-	G	rs3830420|rs397960489|rs78637763	byFrequency	TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:49442849_49442850insG	ENST00000221403.2	+	4	550_551	c.510_511insG	c.(511-513)gggfs	p.G171fs	DHDH_ENST00000522614.1_Frame_Shift_Ins_p.G171fs|DHDH_ENST00000523250.1_Intron	NM_014475.3	NP_055290.1	Q9UQ10	DHDH_HUMAN	dihydrodiol dehydrogenase (dimeric)	171					carbohydrate metabolic process (GO:0005975)|D-xylose catabolic process (GO:0042843)		D-xylose 1-dehydrogenase (NADP+) activity (GO:0047837)|electron carrier activity (GO:0009055)|NAD(P)+ transhydrogenase activity (GO:0008746)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			central_nervous_system(1)|large_intestine(3)|lung(3)|ovary(1)|soft_tissue(1)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		GGGCCCAGGCTGGGGGGGCCCT	0.604													GGGGGGG|GGGGGGG|GGGGGGGG|insertion	1276	0.254792	0.0575	0.232	5008	,	,		18577	0.5417		0.1759	False		,,,				2504	0.3231																0																																										SO:0001589	frameshift_variant	0			AB021933	CCDS12741.1	19q13.3	2008-02-05			ENSG00000104808	ENSG00000104808	1.3.1.20		17887	protein-coding gene	gene with protein product		606377				10477285	Standard	NM_014475		Approved	HUM2DD	uc002ple.1	Q9UQ10	OTTHUMG00000165029	ENST00000221403.2:c.517dupG	19.37:g.49442856_49442856dupG	ENSP00000221403:p.Gly171fs			Frame_Shift_Ins	INS	pfam_Oxidoreductase_N	p.A172fs	ENST00000221403.2	37	c.510_511	CCDS12741.1	19																																																																																			DHDH	-	NULL	ENSG00000104808		0.604	DHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHDH	HGNC	protein_coding	OTTHUMT00000381477.1		0.00	81	0	-	NM_014475		49442850	+1	tier1		no_errors	ENST00000221403	ensembl	human	known	74_37	frame_shift_ins	37.93	36	22	INS	0.093:0.998	G
DLGAP3	58512	genome.wustl.edu	37	1	35334651	35334651	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:35334651G>A	ENST00000373347.1	-	9	2308	c.2040C>T	c.(2038-2040)ggC>ggT	p.G680G	DLGAP3_ENST00000235180.4_Silent_p.G680G			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	680					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				CTGCCTGCACGCCAGCCGTCA	0.657																																																	0													16.0	15.0	15.0					1																	35334651		2122	4078	6200	SO:0001819	synonymous_variant	0			AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.2040C>T	1.37:g.35334651G>A			Q5TDD5|Q9H3X7	Silent	SNP	pfam_GKAP	p.G680	ENST00000373347.1	37	c.2040	CCDS30670.1	1																																																																																			DLGAP3	-	pfam_GKAP	ENSG00000116544		0.657	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP3	HGNC	protein_coding	OTTHUMT00000011554.1	-	0.00	51	0	G	NM_021234		35334651	-1	tier1	-	no_errors	ENST00000235180	ensembl	human	known	74_37	silent	42.42	18	14	SNP	0.615	A
DMD	1756	genome.wustl.edu	37	X	31676247	31676247	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chrX:31676247G>T	ENST00000357033.4	-	54	8093	c.7887C>A	c.(7885-7887)gaC>gaA	p.D2629E	DMD_ENST00000359836.1_Missense_Mutation_p.D169E|DMD_ENST00000474231.1_Missense_Mutation_p.D169E|DMD_ENST00000378707.3_Missense_Mutation_p.D169E|DMD_ENST00000541735.1_Missense_Mutation_p.D169E|DMD_ENST00000343523.2_Missense_Mutation_p.D169E|DMD_ENST00000378677.2_Missense_Mutation_p.D2625E	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2629					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ACTGGCGGAGGTCTTTGGCCA	0.388																																																	0													80.0	75.0	76.0					X																	31676247		2202	4300	6502	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.7887C>A	X.37:g.31676247G>T	ENSP00000354923:p.Asp2629Glu		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.D2629E	ENST00000357033.4	37	c.7887	CCDS14233.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.452|2.452	-0.326251|-0.326251	0.05350|0.05350	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000474231|ENST00000465285	T;T;T;T;T;T;T;T|.	0.26957|.	1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7|.	5.29|5.29	2.99|2.99	0.34606|0.34606	.|.	0.201627|.	0.23452|.	U|.	0.048040|.	T|T	0.12944|0.12944	0.0314|0.0314	N|N	0.01576|0.01576	-0.805|-0.805	0.36140|0.36140	D|D	0.846727|0.846727	B;B;B;B;B;B;B;B;B;B|.	0.19583|.	0.037;0.004;0.004;0.005;0.005;0.001;0.001;0.001;0.004;0.001|.	B;B;B;B;B;B;B;B;B;B|.	0.23574|.	0.047;0.01;0.007;0.009;0.009;0.005;0.012;0.012;0.01;0.004|.	T|T	0.20739|0.20739	-1.0266|-1.0266	10|5	0.02654|.	T|.	1|.	.|.	2.3677|2.3677	0.04323|0.04323	0.0931:0.2931:0.2861:0.3277|0.0931:0.2931:0.2861:0.3277	.|.	2621;2629;2625;1288;1285;169;169;169;169;169|.	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3|.	.;DMD_HUMAN;.;.;.;.;.;.;.;.|.	E|T	2621;1288;1285;325;2625;2629;169;169;2629;2506;169;169;169|358	ENSP00000350765:D325E;ENSP00000367948:D2625E;ENSP00000354923:D2629E;ENSP00000352894:D169E;ENSP00000340057:D169E;ENSP00000367979:D169E;ENSP00000444119:D169E;ENSP00000417123:D169E|.	ENSP00000340057:D169E|.	D|P	-|-	3|1	2|0	DMD|DMD	31586168|31586168	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	0.498000|0.498000	0.22530|0.22530	2.212000|2.212000	0.71576|0.71576	0.529000|0.529000	0.55759|0.55759	GAC|CCT	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.388	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2		0.00	24	0	G	NM_004006		31676247	-1			no_errors	ENST00000357033	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
DNAH11	8701	genome.wustl.edu	37	7	21788289	21788289	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:21788289G>T	ENST00000409508.3	+	52	8633	c.8602G>T	c.(8602-8604)Gca>Tca	p.A2868S	DNAH11_ENST00000328843.6_Missense_Mutation_p.A2875S	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2875	AAA 4. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GTCCAGGCTGGCAGCTTACCT	0.567									Kartagener syndrome																																								0													93.0	97.0	96.0					7																	21788289		2014	4180	6194	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.8602G>T	7.37:g.21788289G>T	ENSP00000475939:p.Ala2868Ser		Q9UJ82	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A2875S	ENST00000409508.3	37	c.8623		7	.	.	.	.	.	.	.	.	.	.	G	33	5.265864	0.95399	.	.	ENSG00000105877	ENST00000328843	T	0.40756	1.02	5.95	5.07	0.68467	Dynein heavy chain, P-loop containing D4 domain (1);ATPase, AAA+ type, core (1);	0.046011	0.85682	D	0.000000	T	0.65375	0.2685	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68625	-0.5359	9	0.51188	T	0.08	.	14.8948	0.70636	0.0683:0.0:0.9317:0.0	.	2875	Q96DT5	DYH11_HUMAN	S	2875	ENSP00000330671:A2875S	ENSP00000330671:A2875S	A	+	1	0	DNAH11	21754814	1.000000	0.71417	0.991000	0.47740	0.949000	0.60115	9.728000	0.98792	1.516000	0.48900	0.650000	0.86243	GCA	DNAH11	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000105877		0.567	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	-	0.00	63	0	G	NM_003777		21788289	+1	tier1	-	no_errors	ENST00000328843	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
PGS1	9489	genome.wustl.edu	37	17	76423012	76423012	+	IGR	SNP	G	G	C	rs147136333		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:76423012G>C	ENST00000262764.6	+	0	2201				DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.L4279V|DNAH17_ENST00000585328.1_Missense_Mutation_p.L4251V	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1						cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			TTTACCTTCAGCCCCAGGTTC	0.582																																					Esophageal Squamous(45;182 1126 10685 43198)												0													49.0	38.0	42.0					17																	76423012		2203	4300	6503	SO:0001628	intergenic_variant	0				CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8			17.37:g.76423012G>C			B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_HR1_rho-bd	p.L4279V	ENST00000262764.6	37	c.12835	CCDS42391.1	17	.	.	.	.	.	.	.	.	.	.	G	18.12	3.552371	0.65311	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.10005	2.92	4.99	3.8	0.43715	.	0.000000	0.42548	D	0.000698	T	0.30634	0.0771	M	0.81942	2.565	0.43439	D	0.995618	D	0.76494	0.999	D	0.74674	0.984	T	0.02942	-1.1091	10	0.87932	D	0	.	9.3489	0.38126	0.2305:0.0:0.7695:0.0	.	4251	E7EUM8	.	V	4251;4279	ENSP00000374490:L4279V	ENSP00000300671:L4251V	L	-	1	2	DNAH17	73934607	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.998000	0.57024	2.319000	0.78375	0.655000	0.94253	CTG	DNAH17	-	pfam_Dynein_heavy_dom	ENSG00000187775		0.582	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000437301.1	-	0.00	51	0	G	NM_024419		76423012	-1	tier1	-	no_errors	ENST00000389840	ensembl	human	known	74_37	missense	30.77	18	8	SNP	0.977	C
DNAJC1	64215	genome.wustl.edu	37	10	22193537	22193537	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:22193537G>T	ENST00000376980.3	-	7	1024	c.734C>A	c.(733-735)gCt>gAt	p.A245D		NM_022365.3	NP_071760.2	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	245					negative regulation of proteolysis (GO:0045861)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)|regulation of protein secretion (GO:0050708)|regulation of translation (GO:0006417)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(13)|skin(2)|upper_aerodigestive_tract(2)	21		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				AAACTGCCCAGCATCCTTAAG	0.274																																																	0													86.0	76.0	80.0					10																	22193537		2201	4288	6489	SO:0001583	missense	0			AK026062	CCDS7136.1	10p11.23	2011-09-02			ENSG00000136770	ENSG00000136770		"""Heat shock proteins / DNAJ (HSP40)"""	20090	protein-coding gene	gene with protein product		611207					Standard	NM_022365		Approved	DNAJL1, ERdj1, MTJ1	uc001irc.3	Q96KC8	OTTHUMG00000017800	ENST00000376980.3:c.734C>A	10.37:g.22193537G>T	ENSP00000366179:p.Ala245Asp		B0YIZ8|Q5VX89|Q9H6B8	Missense_Mutation	SNP	pfam_DnaJ_domain,pfam_SANT/Myb,superfamily_DnaJ_domain,superfamily_Homeodomain-like,smart_DnaJ_domain,smart_SANT/Myb,pfscan_Myb-like_dom,pfscan_DnaJ_domain,prints_DnaJ_domain	p.A245D	ENST00000376980.3	37	c.734	CCDS7136.1	10	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860813	0.71834	.	.	ENSG00000136770	ENST00000376980	T	0.67865	-0.29	5.76	5.76	0.90799	.	0.107460	0.64402	D	0.000007	T	0.69043	0.3067	M	0.66939	2.045	0.80722	D	1	P	0.51653	0.947	P	0.44990	0.466	T	0.67313	-0.5702	10	0.26408	T	0.33	-5.3619	18.1465	0.89656	0.0:0.0:1.0:0.0	.	245	Q96KC8	DNJC1_HUMAN	D	245	ENSP00000366179:A245D	ENSP00000366179:A245D	A	-	2	0	DNAJC1	22233543	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	6.360000	0.73064	2.711000	0.92665	0.650000	0.86243	GCT	DNAJC1	-	NULL	ENSG00000136770		0.274	DNAJC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC1	HGNC	protein_coding	OTTHUMT00000047149.1		0.00	19	0	G	NM_022365		22193537	-1			no_errors	ENST00000376980	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
DNM1P47	100216544	genome.wustl.edu	37	15	102303563	102303563	+	RNA	SNP	A	A	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:102303563A>G	ENST00000561463.1	+	0	11609									DNM1 pseudogene 47																		CGGTGTGACGAGACTCGCGTG	0.572																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102303563A>G				RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			DNM1P47	-	-	ENSG00000259660		0.572	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	-	0.00	18	0	A	NG_009149		102303563	+1	tier1	-	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	57.14	3	4	SNP	1.000	G
DNM1P47	100216544	genome.wustl.edu	37	15	102304524	102304524	+	RNA	SNP	A	A	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:102304524A>G	ENST00000561463.1	+	0	12570									DNM1 pseudogene 47																		CGGTGTGACGAGACTCGCGTG	0.567																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102304524A>G				RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			DNM1P47	-	-	ENSG00000259660		0.567	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	-	0.00	94	0	A	NG_009149		102304524	+1	tier1	-	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	11.11	48	6	SNP	1.000	G
DTX3L	151636	genome.wustl.edu	37	3	122289345	122289345	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:122289345G>A	ENST00000296161.4	+	4	2168	c.1979G>A	c.(1978-1980)cGa>cAa	p.R660Q	DTX3L_ENST00000383661.3_Missense_Mutation_p.R148Q	NM_138287.3	NP_612144.1	Q8TDB6	DTX3L_HUMAN	deltex 3 like, E3 ubiquitin ligase	660					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone monoubiquitination (GO:0010390)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0459)		GGAATACAGCGAACTGCATAC	0.418																																																	0													105.0	108.0	107.0					3																	122289345		2203	4300	6503	SO:0001583	missense	0				CCDS3015.1	3q21.1	2014-01-28	2014-01-28		ENSG00000163840	ENSG00000163840		"""RING-type (C3HC4) zinc fingers"""	30323	protein-coding gene	gene with protein product	"""rhysin 2"""	613143	"""deltex 3-like (Drosophila)"""			12670957, 22411408	Standard	NM_138287		Approved	BBAP	uc003efk.3	Q8TDB6	OTTHUMG00000159524	ENST00000296161.4:c.1979G>A	3.37:g.122289345G>A	ENSP00000296161:p.Arg660Gln		B3KWH6|Q53ZZ3|Q5MJP7	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.R660Q	ENST00000296161.4	37	c.1979	CCDS3015.1	3	.	.	.	.	.	.	.	.	.	.	G	26.2	4.718311	0.89205	.	.	ENSG00000163840	ENST00000296161;ENST00000383661	T;T	0.63096	-0.02;-0.02	5.07	5.07	0.68467	.	0.000000	0.42682	D	0.000662	D	0.84884	0.5571	H	0.94925	3.6	0.46376	D	0.99901	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.88764	0.3259	10	0.66056	D	0.02	-44.0125	17.1797	0.86851	0.0:0.0:1.0:0.0	.	148;660	Q8TDB6-2;Q8TDB6	.;DTX3L_HUMAN	Q	660;148	ENSP00000296161:R660Q;ENSP00000373157:R148Q	ENSP00000296161:R660Q	R	+	2	0	DTX3L	123772035	1.000000	0.71417	0.826000	0.32828	0.523000	0.34469	9.523000	0.98034	2.637000	0.89404	0.561000	0.74099	CGA	DTX3L	-	NULL	ENSG00000163840		0.418	DTX3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX3L	HGNC	protein_coding	OTTHUMT00000355966.1	-	0.00	35	0	G	NM_138287		122289345	+1	tier1	-	no_errors	ENST00000296161	ensembl	human	known	74_37	missense	35.38	42	23	SNP	0.745	A
DUSP13	51207	genome.wustl.edu	37	10	76861652	76861652	+	5'Flank	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:76861652C>T	ENST00000472493.2	-	0	0				DUSP13_ENST00000605915.1_5'Flank|DUSP13_ENST00000491677.2_Missense_Mutation_p.C120Y|DUSP13_ENST00000372702.3_3'UTR|DUSP13_ENST00000478873.2_5'Flank|DUSP13_ENST00000607009.1_Intron|DUSP13_ENST00000607131.1_Missense_Mutation_p.C84Y|DUSP13_ENST00000372700.3_Intron	NM_016364.3	NP_057448.3	Q9UII6	DS13B_HUMAN	dual specificity phosphatase 13						meiotic nuclear division (GO:0007126)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	8	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					CCAGGCTGTGCACTTCTCTGA	0.522																																					NSCLC(174;1655 2059 12324 40663 42963)												0													120.0	114.0	116.0					10																	76861652		2203	4300	6503	SO:0001631	upstream_gene_variant	0			AB027004	CCDS7346.1, CCDS31224.1, CCDS53542.1	10q23.1	2013-10-25			ENSG00000079393	ENSG00000079393		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	19681	protein-coding gene	gene with protein product		613191				10585869	Standard	XM_005269883		Approved	BEDP, TMDP, FLJ32450, DUSP13A, DUSP13B	uc001jwu.3	Q6B8I1	OTTHUMG00000018516		10.37:g.76861652C>T	Exception_encountered		A8K776|A8K782|B3KPY1|B3KXT0|B4DUK0|Q5JSC6|Q6IAR0|Q96GC2	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.C120Y	ENST00000472493.2	37	c.359	CCDS7346.1	10	.	.	.	.	.	.	.	.	.	.	C	6.823	0.521065	0.13005	.	.	ENSG00000079393	ENST00000491677;ENST00000372698	T	0.04234	3.67	4.14	-2.89	0.05665	.	3.385780	0.00853	N	0.001848	T	0.02304	0.0071	N	0.08118	0	0.19945	N	0.999946	B	0.02656	0.0	B	0.01281	0.0	T	0.37820	-0.9689	10	0.10902	T	0.67	-5.2851	2.3005	0.04161	0.2031:0.4287:0.2274:0.1408	.	120	F2Z2C4	.	Y	120;84	ENSP00000436312:C120Y	ENSP00000361783:C84Y	C	-	2	0	DUSP13	76531658	0.140000	0.22579	0.100000	0.21137	0.026000	0.11368	-0.424000	0.07025	-0.584000	0.05913	-1.072000	0.02254	TGC	DUSP13	-	NULL	ENSG00000079393		0.522	DUSP13-004	KNOWN	basic|CCDS	protein_coding	DUSP13	HGNC	protein_coding	OTTHUMT00000048786.3	-	0.00	89	0	C			76861652	-1	tier1	-	no_errors	ENST00000491677	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.137	T
DYRK1A	1859	genome.wustl.edu	37	21	38845005	38845005	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr21:38845005C>A	ENST00000398960.2	+	2	105	c.30C>A	c.(28-30)tgC>tgA	p.C10*	DYRK1A_ENST00000339659.4_Nonsense_Mutation_p.C10*|DYRK1A_ENST00000462274.1_3'UTR|DYRK1A_ENST00000398956.2_Nonsense_Mutation_p.C10*|DYRK1A_ENST00000321219.8_Nonsense_Mutation_p.C10*|DYRK1A_ENST00000451934.1_Nonsense_Mutation_p.C10*|DYRK1A_ENST00000338785.3_Nonsense_Mutation_p.C10*	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	10					circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						CTTCAGCATGCAAACCTTCAT	0.423																																					Melanoma(114;464 1602 31203 43785 45765)												0													107.0	104.0	105.0					21																	38845005		2203	4300	6503	SO:0001587	stop_gained	0			U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.30C>A	21.37:g.38845005C>A	ENSP00000381932:p.Cys10*		O60769|Q92582|Q92810|Q9UNM5	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.C10*	ENST00000398960.2	37	c.30	CCDS42925.1	21	.	.	.	.	.	.	.	.	.	.	C	48	14.640644	0.99804	.	.	ENSG00000157540	ENST00000338785;ENST00000455097;ENST00000426672;ENST00000339659;ENST00000321219;ENST00000451934;ENST00000398960;ENST00000398956	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	.	.	.	X	10	.	ENSP00000319032:C10X	C	+	3	2	DYRK1A	37766875	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.937000	0.99478	0.650000	0.86243	TGC	DYRK1A	-	NULL	ENSG00000157540		0.423	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK1A	HGNC	protein_coding	OTTHUMT00000194804.1	-	0.00	39	0	C	NM_001396		38845005	+1	tier1	-	no_errors	ENST00000398960	ensembl	human	known	74_37	nonsense	21.74	36	10	SNP	1.000	A
E2F5	1875	genome.wustl.edu	37	8	86119673	86119673	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr8:86119673G>A	ENST00000416274.2	+	5	598	c.564G>A	c.(562-564)ttG>ttA	p.L188L	E2F5_ENST00000521429.1_Silent_p.L15L|E2F5_ENST00000256117.5_Silent_p.L189L|E2F5_ENST00000519128.1_3'UTR|E2F5_ENST00000517476.1_Silent_p.L27L|E2F5_ENST00000418930.2_Silent_p.L188L	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding	188	Dimerization. {ECO:0000255}.				gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						ATACACTTTTGGCCATTCAGG	0.373																																																	0													43.0	43.0	43.0					8																	86119673		1813	4069	5882	SO:0001819	synonymous_variant	0			X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.564G>A	8.37:g.86119673G>A			E9PBN9|Q16601|Q92756	Silent	SNP	pfam_E2F_TDP	p.L189	ENST00000416274.2	37	c.567	CCDS47885.1	8																																																																																			E2F5	-	NULL	ENSG00000133740		0.373	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	E2F5	HGNC	protein_coding	OTTHUMT00000380274.1	-	0.00	44	0	G	NM_001951		86119673	+1	tier1	-	no_errors	ENST00000256117	ensembl	human	known	74_37	silent	25.71	26	9	SNP	0.998	A
E2F7	144455	genome.wustl.edu	37	12	77421782	77421783	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:77421782_77421783delAG	ENST00000322886.7	-	11	2255_2256	c.2020_2021delCT	c.(2020-2022)cttfs	p.L674fs	E2F7_ENST00000416496.2_Frame_Shift_Del_p.L674fs	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	674					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						AGAAGAAACAAGAGAGTTTGCT	0.416																																																	0																																										SO:0001589	frameshift_variant	0			BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.2020_2021delCT	12.37:g.77421786_77421787delAG	ENSP00000323246:p.Leu674fs		A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Frame_Shift_Del	DEL	pfam_E2F_TDP	p.L674fs	ENST00000322886.7	37	c.2021_2020	CCDS9016.1	12																																																																																			E2F7	-	NULL	ENSG00000165891		0.416	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F7	HGNC	protein_coding	OTTHUMT00000406716.1		0.00	48	0	AG	XM_084871		77421783	-1	tier1		no_errors	ENST00000322886	ensembl	human	known	74_37	frame_shift_del	24.32	28	9	DEL	0.000:0.000	-
EFCAB14	9813	genome.wustl.edu	37	1	47157529	47157529	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:47157529C>T	ENST00000371933.3	-	5	1636	c.660G>A	c.(658-660)aaG>aaA	p.K220K	EFCAB14_ENST00000544071.1_Silent_p.K220K|EFCAB14-AS1_ENST00000418985.1_RNA|EFCAB14_ENST00000484461.1_5'UTR|EFCAB14-AS1_ENST00000442839.1_RNA	NM_014774.2	NP_055589.1	O75071	EFC14_HUMAN	EF-hand calcium binding domain 14	220							calcium ion binding (GO:0005509)										CCATCGTTTTCTTGTGTTCAT	0.428																																																	0													215.0	174.0	188.0					1																	47157529		2203	4300	6503	SO:0001819	synonymous_variant	0			AB007963	CCDS30706.1	1p33	2013-01-10	2012-11-29	2012-11-29	ENSG00000159658	ENSG00000159658		"""EF-hand domain containing"""	29051	protein-coding gene	gene with protein product			"""KIAA0494"""	KIAA0494		9455484	Standard	NM_014774		Approved		uc001cqk.4	O75071	OTTHUMG00000007992	ENST00000371933.3:c.660G>A	1.37:g.47157529C>T			D3DQ23|Q5SXB8	Silent	SNP	pfscan_EF_hand_dom	p.K220	ENST00000371933.3	37	c.660	CCDS30706.1	1																																																																																			EFCAB14	-	NULL	ENSG00000159658		0.428	EFCAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB14	HGNC	protein_coding	OTTHUMT00000021931.1	-	0.00	43	0	C	NM_014774		47157529	-1	tier1	-	no_errors	ENST00000371933	ensembl	human	known	74_37	silent	12.28	50	7	SNP	1.000	T
CRACR2A	84766	genome.wustl.edu	37	12	3782646	3782646	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:3782646C>T	ENST00000252322.1	-	7	1105	c.637G>A	c.(637-639)Gag>Aag	p.E213K	EFCAB4B_ENST00000444507.1_Missense_Mutation_p.E213K|EFCAB4B_ENST00000440314.2_Missense_Mutation_p.E213K	NM_032680.3	NP_116069.1	Q9BSW2	EFC4B_HUMAN		213					activation of store-operated calcium channel activity (GO:0032237)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			TTCTTCTCCTCATGGGCTTCT	0.488																																																	0													148.0	141.0	143.0					12																	3782646		2203	4300	6503	SO:0001583	missense	0																														ENST00000252322.1:c.637G>A	12.37:g.3782646C>T	ENSP00000252322:p.Glu213Lys		B4E1X0|B9EK63	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_EF_hand_dom,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,pfscan_EF_hand_dom,tigrfam_Small_GTP-bd_dom	p.E213K	ENST00000252322.1	37	c.637	CCDS8522.1	12	.	.	.	.	.	.	.	.	.	.	C	2.504	-0.314450	0.05422	.	.	ENSG00000130038	ENST00000440314;ENST00000444507;ENST00000252322	T;T;T	0.22134	1.97;2.57;2.59	4.55	1.16	0.20824	.	0.507841	0.21131	N	0.079650	T	0.13114	0.0318	L	0.41824	1.3	0.24682	N	0.993353	B;B;B	0.22003	0.013;0.063;0.003	B;B;B	0.15484	0.007;0.013;0.003	T	0.35151	-0.9800	10	0.08179	T	0.78	-8.2697	8.9877	0.36003	0.0:0.6892:0.0:0.3108	.	213;213;213	D7UEQ6;Q9BSW2-2;Q9BSW2	.;.;EFC4B_HUMAN	K	213	ENSP00000409382:E213K;ENSP00000412496:E213K;ENSP00000252322:E213K	ENSP00000252322:E213K	E	-	1	0	EFCAB4B	3652907	0.875000	0.30112	0.525000	0.27900	0.561000	0.35649	1.339000	0.33885	0.361000	0.24292	0.650000	0.86243	GAG	EFCAB4B	-	NULL	ENSG00000130038		0.488	EFCAB4B-005	KNOWN	basic|CCDS	protein_coding	EFCAB4B	HGNC	protein_coding	OTTHUMT00000398673.1	-	0.00	65	0	C			3782646	-1	tier1	-	no_errors	ENST00000440314	ensembl	human	known	74_37	missense	6.52	86	6	SNP	0.810	T
P2RY11	5032	genome.wustl.edu	37	19	10225804	10225804	+	3'UTR	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:10225804G>T	ENST00000321826.4	+	0	1699				EIF3G_ENST00000253108.4_Splice_Site_p.P317T	NM_002566.4	NP_002557.2	Q96G91	P2Y11_HUMAN	purinergic receptor P2Y, G-protein coupled, 11						activation of adenylate cyclase activity (GO:0007190)|adenosine receptor signaling pathway (GO:0001973)|calcium-mediated signaling (GO:0019722)|cellular response to ATP (GO:0071318)|defense response (GO:0006952)|G-protein coupled receptor signaling pathway (GO:0007186)|neuronal signal transduction (GO:0023041)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|neurotransmitter receptor activity (GO:0030594)|receptor activity (GO:0004872)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)	16			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)			TTGGTGGACGGCCTGGGGTAG	0.642																																																	0													46.0	50.0	49.0					19																	10225804		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AF030335	CCDS12226.1	19p13.2	2012-08-08			ENSG00000244165	ENSG00000244165		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8540	protein-coding gene	gene with protein product		602697				9405388	Standard	NM_002566		Approved	P2Y11		Q96G91	OTTHUMG00000150166	ENST00000321826.4:c.*390G>T	19.37:g.10225804G>T			B2R8X9|O43190|Q9BYU4|Q9H170	Missense_Mutation	SNP	pfam_eIF3g_N,pfam_RRM_dom,smart_RRM_dom,pirsf_eIF3_g,pfscan_RRM_dom	p.P317T	ENST00000321826.4	37	c.949	CCDS12226.1	19	.	.	.	.	.	.	.	.	.	.	G	20.3	3.970893	0.74246	.	.	ENSG00000130811	ENST00000253108	T	0.36878	1.23	2.86	2.86	0.33363	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.64402	D	0.000001	T	0.56514	0.1990	M	0.78344	2.41	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	T	0.61038	-0.7143	10	0.87932	D	0	-8.4522	9.4074	0.38471	0.0:0.0:1.0:0.0	.	317	O75821	EIF3G_HUMAN	T	317	ENSP00000253108:P317T	ENSP00000253108:P317T	P	-	1	0	EIF3G	10086804	0.958000	0.32768	0.998000	0.56505	0.587000	0.36485	1.232000	0.32636	1.914000	0.55421	0.561000	0.74099	CCG	EIF3G	-	pirsf_eIF3_g,pfscan_RRM_dom	ENSG00000130811		0.642	P2RY11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3G	HGNC	protein_coding	OTTHUMT00000316664.2	-	0.00	183	0	G	NM_002566		10225804	-1	tier1	-	no_errors	ENST00000253108	ensembl	human	known	74_37	missense	46.32	51	44	SNP	0.998	T
ELF2	1998	genome.wustl.edu	37	4	139981500	139981500	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr4:139981500C>T	ENST00000394235.2	-	9	1601	c.1099G>A	c.(1099-1101)Gtg>Atg	p.V367M	ELF2_ENST00000515489.1_5'UTR|ELF2_ENST00000379549.2_Missense_Mutation_p.V290M|ELF2_ENST00000265495.4_Missense_Mutation_p.V367M|ELF2_ENST00000510408.1_Missense_Mutation_p.V307M|ELF2_ENST00000379550.1_Missense_Mutation_p.V379M|ELF2_ENST00000358635.3_Missense_Mutation_p.V319M	NM_001276458.1	NP_001263387.1			E74-like factor 2 (ets domain transcription factor)											endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	19	all_hematologic(180;0.162)					GTTGCTGACACAGATGCAGTG	0.428																																																	0													65.0	61.0	62.0					4																	139981500		2203	4300	6503	SO:0001583	missense	0			AF256222	CCDS3744.1, CCDS3745.1, CCDS64062.1, CCDS64063.1	4q28	2008-02-05			ENSG00000109381	ENSG00000109381			3317	protein-coding gene	gene with protein product						8756667	Standard	NM_201999		Approved	EU32, NERF, NERF-2, NERF-1A, NERF-1B	uc003ihm.2	Q15723	OTTHUMG00000133383	ENST00000394235.2:c.1099G>A	4.37:g.139981500C>T	ENSP00000377782:p.Val367Met			Missense_Mutation	SNP	pfam_TF_Elf_N,pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.V379M	ENST00000394235.2	37	c.1135	CCDS3744.1	4	.	.	.	.	.	.	.	.	.	.	C	13.10	2.137299	0.37728	.	.	ENSG00000109381	ENST00000358635;ENST00000394235;ENST00000379550;ENST00000265495;ENST00000379549;ENST00000540754;ENST00000510408	T;T;T;T;T;T	0.13657	2.61;2.75;2.77;2.75;2.79;2.57	5.96	5.1	0.69264	.	0.245105	0.41938	D	0.000797	T	0.13713	0.0332	L	0.27053	0.805	0.21967	N	0.999441	P;B;P;B;P	0.40875	0.472;0.429;0.472;0.38;0.731	B;B;B;B;B	0.43478	0.106;0.421;0.173;0.265;0.421	T	0.10823	-1.0613	9	.	.	.	.	15.4201	0.75003	0.0:0.8617:0.1383:0.0	.	182;367;290;307;319	B7Z8R4;Q15723-1;E9PCX3;B7Z720;Q15723-3	.;.;.;.;.	M	319;367;379;367;290;182;307	ENSP00000351458:V319M;ENSP00000377782:V367M;ENSP00000368868:V379M;ENSP00000265495:V367M;ENSP00000368867:V290M;ENSP00000426997:V307M	.	V	-	1	0	ELF2	140200950	1.000000	0.71417	0.017000	0.16124	0.011000	0.07611	4.976000	0.63785	1.478000	0.48253	0.650000	0.86243	GTG	ELF2	-	NULL	ENSG00000109381		0.428	ELF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELF2	HGNC	protein_coding	OTTHUMT00000257233.2	-	0.00	22	0	C	NM_006874		139981500	-1	tier1	-	no_errors	ENST00000379550	ensembl	human	known	74_37	missense	29.41	24	10	SNP	0.317	T
LINC01098	285501	genome.wustl.edu	37	4	178896971	178896971	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr4:178896971G>T	ENST00000507870.1	+	5	636	c.174G>T	c.(172-174)atG>atT	p.M58I																	lung(8)|prostate(1)	9						AGAAGACAATGAGGTCAGCTA	0.428																																																	0													154.0	155.0	154.0					4																	178896971		1880	4096	5976	SO:0001583	missense	0																														ENST00000507870.1:c.174G>T	4.37:g.178896971G>T	ENSP00000421352:p.Met58Ile			Missense_Mutation	SNP	NULL	p.M58I	ENST00000507870.1	37	c.174		4	.	.	.	.	.	.	.	.	.	.	G	6.112	0.388984	0.11581	.	.	ENSG00000231171	ENST00000507870	T	0.13196	2.61	3.93	1.61	0.23674	.	.	.	.	.	T	0.09158	0.0226	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36456	-0.9747	5	.	.	.	.	3.7528	0.08573	0.1915:0.2274:0.5812:0.0	.	.	.	.	I	58	ENSP00000421352:M58I	.	M	+	3	0	RP11-389E17.1	179133965	0.005000	0.15991	0.000000	0.03702	0.130000	0.20726	0.597000	0.24059	0.350000	0.24002	0.650000	0.86243	ATG	RP11-389E17.1	-	NULL	ENSG00000231171		0.428	RP11-389E17.1-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	ENSG00000231171	Clone_based_vega_gene	protein_coding	OTTHUMT00000361922.1	-	0.00	41	0	G			178896971	+1	tier1	-	no_errors	ENST00000507870	ensembl	human	putative	74_37	missense	43.33	17	13	SNP	0.000	T
RP11-680F20.6	0	genome.wustl.edu	37	11	125820816	125820816	+	RNA	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:125820816G>T	ENST00000531193.1	+	0	0				RP11-680F20.6_ENST00000529072.1_RNA|RP11-680F20.6_ENST00000524962.2_RNA																							TCCCCCTGAGGGACAGCCCTC	0.697																																																	0																																												0																															11.37:g.125820816G>T				RNA	SNP	-	NULL	ENST00000531193.1	37	NULL		11																																																																																			RP11-680F20.6	-	-	ENSG00000254967		0.697	RP11-680F20.6-002	KNOWN	basic	antisense	ENSG00000254967	Clone_based_vega_gene	antisense	OTTHUMT00000386745.1	-	0.00	152	0	G			125820816	+1	tier1	-	no_errors	ENST00000529072	ensembl	human	known	74_37	rna	6.45	58	4	SNP	0.976	T
LY6G5B	58496	genome.wustl.edu	37	6	31638955	31638955	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:31638955G>A	ENST00000375864.4	+	2	865	c.81G>A	c.(79-81)acG>acA	p.T27T	LY6G5B_ENST00000409525.1_5'UTR|CSNK2B-LY6G5B-1181_ENST00000375880.2_Missense_Mutation_p.V194M	NM_021221.2	NP_067044.2	Q8NDX9	LY65B_HUMAN	lymphocyte antigen 6 complex, locus G5B	27	UPAR/Ly6.					extracellular region (GO:0005576)				lung(4)	4						ACATCCGGACGTGCCACTTCT	0.547																																																	0													250.0	238.0	242.0					6																	31638955		1511	2709	4220	SO:0001819	synonymous_variant	0			AF129756	CCDS34400.1	6p21.3	2008-08-01	2002-07-29	2002-08-01	ENSG00000240053	ENSG00000240053			13931	protein-coding gene	gene with protein product		610433	"""chromosome 6 open reading frame 19"""	C6orf19		8812450, 12079290, 17008713	Standard	NM_021221		Approved	G5b		Q8NDX9	OTTHUMG00000031227	ENST00000375864.4:c.81G>A	6.37:g.31638955G>A			B0UXB2|B0UZ65|B0UZP8|B7ZCA3|Q5SQ62|Q5SST3|Q9UKT0|Q9UMQ0	Missense_Mutation	SNP	pfam_Casein_kinase_II_reg-sub,superfamily_Casein_kinase_II_reg-sub,prints_Casein_kinase_II_reg-sub	p.V194M	ENST00000375864.4	37	c.580	CCDS34400.1	6	.	.	.	.	.	.	.	.	.	.	G	9.886	1.202984	0.22121	.	.	ENSG00000204435	ENST00000375880	.	.	.	4.44	0.538	0.17150	.	.	.	.	.	T	0.10035	0.0246	.	.	.	0.18873	N	0.999988	B	0.27853	0.191	B	0.19148	0.024	T	0.14783	-1.0460	6	0.36615	T	0.2	-9.3205	4.5258	0.11981	0.0:0.4258:0.3681:0.206	.	194	Q5SRQ3	.	M	194	.	ENSP00000365040:V194M	V	+	1	0	CSNK2B	31746934	0.432000	0.25554	0.998000	0.56505	0.480000	0.33159	-0.278000	0.08490	0.210000	0.20664	-0.234000	0.12200	GTG	CSNK2B-LY6G5B-1181	-	NULL	ENSG00000263020		0.547	LY6G5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000263020	Uniprot_gn	protein_coding	OTTHUMT00000124389.4	-	0.00	73	0	G			31638955	+1	tier1	-	no_errors	ENST00000375880	ensembl	human	putative	74_37	missense	31.88	47	22	SNP	0.985	A
MAGEA5	4104	genome.wustl.edu	37	X	151284037	151284037	+	RNA	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chrX:151284037C>A	ENST00000509345.2	-	0	299																											CCGCAACAGGCAGGAGTGTGG	0.577																																																	0													58.0	61.0	60.0					X																	151284037		2203	4293	6496			0																															X.37:g.151284037C>A				RNA	SNP	-	NULL	ENST00000509345.2	37	NULL		X																																																																																			RP11-1007I13.4	-	-	ENSG00000266560		0.577	RP11-1007I13.4-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000266560	Clone_based_vega_gene	processed_transcript	OTTHUMT00000445981.1	-	0.00	87	0	C			151284037	-1	tier1	-	no_errors	ENST00000509345	ensembl	human	known	74_37	rna	71.83	20	51	SNP	0.000	A
EPB41	2035	genome.wustl.edu	37	1	29365939	29365939	+	Splice_Site	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:29365939G>A	ENST00000343067.4	+	11	1763		c.e11+1		EPB41_ENST00000373798.1_Splice_Site|EPB41_ENST00000373797.1_Splice_Site|EPB41_ENST00000398863.2_Splice_Site|EPB41_ENST00000349460.4_Splice_Site|EPB41_ENST00000356093.2_Splice_Site|EPB41_ENST00000347529.3_Splice_Site|EPB41_ENST00000373800.3_Splice_Site	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1						actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		CTCGATGGAGGTTTGTATTGA	0.438																																																	0													51.0	55.0	53.0					1																	29365939		2203	4300	6503	SO:0001630	splice_region_variant	0			BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.1636+1G>A	1.37:g.29365939G>A			B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Splice_Site	SNP	-	e10+1	ENST00000343067.4	37	c.1636+1	CCDS53288.1	1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.887175	0.91814	.	.	ENSG00000159023	ENST00000358989;ENST00000343067;ENST00000356093;ENST00000398863;ENST00000398861;ENST00000398865;ENST00000349460;ENST00000373800;ENST00000347529;ENST00000373798;ENST00000373797	.	.	.	5.16	5.16	0.70880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0001	0.89196	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EPB41	29238526	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.813000	0.99286	2.571000	0.86741	0.484000	0.47621	.	EPB41	-	-	ENSG00000159023		0.438	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41	HGNC	protein_coding	OTTHUMT00000010312.1	-	0.00	64	0	G	NM_203342	Intron	29365939	+1	tier1	-	no_errors	ENST00000343067	ensembl	human	known	74_37	splice_site	29.82	40	17	SNP	1.000	A
EPHB4	2050	genome.wustl.edu	37	7	100417397	100417397	+	Missense_Mutation	SNP	C	C	T	rs202006098	byFrequency	TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:100417397C>T	ENST00000358173.3	-	6	1547	c.1079G>A	c.(1078-1080)cGc>cAc	p.R360H	RN7SL750P_ENST00000582814.1_RNA|EPHB4_ENST00000360620.3_Missense_Mutation_p.R360H|EPHB4_ENST00000477446.1_5'UTR	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	360	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					CTCCCGGCAGCGGAGGGCGTA	0.711													C|||	3	0.000599042	0.0	0.0	5008	,	,		14363	0.0		0.003	False		,,,				2504	0.0				GBM(200;2113 3072 25865 52728)												0								C	HIS/ARG	0,4354		0,0,2177	8.0	10.0	9.0		1079	5.5	1.0	7		9	2,8502		0,2,4250	yes	missense	EPHB4	NM_004444.4	29	0,2,6427	TT,TC,CC		0.0235,0.0,0.0156	probably-damaging	360/988	100417397	2,12856	2177	4252	6429	SO:0001583	missense	0			AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.1079G>A	7.37:g.100417397C>T	ENSP00000350896:p.Arg360His		B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.R360H	ENST00000358173.3	37	c.1079	CCDS5706.1	7	4	0.0018315018315018315	0	0.0	0	0.0	0	0.0	4	0.005277044854881266	C	14.94	2.684030	0.47991	0.0	2.35E-4	ENSG00000196411	ENST00000360620;ENST00000358173	T;T	0.58210	0.35;0.35	5.46	5.46	0.80206	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000073	T	0.50154	0.1599	L	0.36672	1.1	0.34470	D	0.70273	D;D;D;D	0.76494	0.998;0.999;0.995;0.998	P;D;P;P	0.66602	0.903;0.945;0.862;0.899	T	0.64364	-0.6425	10	0.39692	T	0.17	.	10.2669	0.43460	0.0:0.9097:0.0:0.0903	.	360;360;360;360	B5A972;B5A970;Q96L35;P54760	.;.;.;EPHB4_HUMAN	H	360	ENSP00000353833:R360H;ENSP00000350896:R360H	ENSP00000350896:R360H	R	-	2	0	EPHB4	100255333	1.000000	0.71417	0.993000	0.49108	0.097000	0.18754	2.132000	0.42083	2.563000	0.86464	0.655000	0.94253	CGC	EPHB4	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000196411		0.711	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB4	HGNC	protein_coding	OTTHUMT00000347222.1		0.00	69	0	C	NM_004444		100417397	-1			no_errors	ENST00000358173	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.941	T
ERN2	10595	genome.wustl.edu	37	16	23713995	23713995	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:23713995T>G	ENST00000457008.2	-	9	921	c.883A>C	c.(883-885)Act>Cct	p.T295P	ERN2_ENST00000256797.4_Missense_Mutation_p.T343P					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		TAGAAGCCAGTTTCATCCTTC	0.473																																																	0													144.0	130.0	135.0					16																	23713995		2197	4300	6497	SO:0001583	missense	0			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.883A>C	16.37:g.23713995T>G	ENSP00000413812:p.Thr295Pro			Missense_Mutation	SNP	pfam_KEN_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like_supfam,smart_PQQ_beta_propeller_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PUG-dom,pfscan_Prot_kinase_dom	p.T343P	ENST00000457008.2	37	c.1027		16	.	.	.	.	.	.	.	.	.	.	T	11.10	1.540329	0.27563	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.61158	0.13;0.19	6.07	2.99	0.34606	.	0.407958	0.29624	N	0.011629	T	0.43010	0.1228	L	0.42245	1.32	0.21325	N	0.999723	P;B;B	0.35944	0.529;0.026;0.108	B;B;B	0.33392	0.163;0.028;0.046	T	0.18808	-1.0325	10	0.23891	T	0.37	.	8.0798	0.30737	0.0:0.6871:0.0:0.3129	.	295;295;295	Q76MJ5;E7ETG2;A5YM65	ERN2_HUMAN;.;.	P	343;295	ENSP00000256797:T343P;ENSP00000413812:T295P	ENSP00000256797:T343P	T	-	1	0	ERN2	23621496	0.001000	0.12720	0.853000	0.33588	0.964000	0.63967	-0.115000	0.10741	0.458000	0.26988	-0.182000	0.12963	ACT	ERN2	-	NULL	ENSG00000134398		0.473	ERN2-002	NOVEL	basic|exp_conf	protein_coding	ERN2	HGNC	protein_coding	OTTHUMT00000434886.1	-	0.00	38	0	T			23713995	-1	tier1	-	no_errors	ENST00000256797	ensembl	human	known	74_37	missense	36.67	19	11	SNP	0.246	G
ERV3-1	2086	genome.wustl.edu	37	7	64453295	64453295	+	Missense_Mutation	SNP	G	G	A	rs376520157		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:64453295G>A	ENST00000394323.2	-	2	610	c.110C>T	c.(109-111)tCg>tTg	p.S37L	ZNF117_ENST00000282869.6_5'Flank	NM_001007253.3	NP_001007254.2	Q14264	ENR1_HUMAN	endogenous retrovirus group 3, member 1	37						extracellular vesicular exosome (GO:0070062)|viral envelope (GO:0019031)				breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(8)	16						gatgttccccgaccacgtagt	0.478																																																	0								G	LEU/SER	0,3848		0,0,1924	96.0	92.0	93.0		110	0.1	0.8	7		93	1,8273		0,1,4136	no	missense	ERV3-1	NM_001007253.3	145	0,1,6060	AA,AG,GG		0.0121,0.0,0.0082	benign	37/605	64453295	1,12121	1924	4137	6061	SO:0001583	missense	0			AK295189	CCDS47595.1	7p12-q11	2014-05-02	2011-05-05	2011-05-05	ENSG00000213462	ENSG00000213462			3454	other	endogenous retrovirus		131170	"""endogenous retroviral sequence 3 (includes zinc finger protein H-plk/HPF9)"", ""endogenous retroviral sequence 3"""	ERV3		2115127, 6495650, 21542922	Standard	NM_001007253		Approved	H-PLK, HERV-R, ERV-R, envR	uc011kdr.2	Q14264	OTTHUMG00000165023	ENST00000394323.2:c.110C>T	7.37:g.64453295G>A	ENSP00000391594:p.Ser37Leu			Missense_Mutation	SNP	NULL	p.S37L	ENST00000394323.2	37	c.110	CCDS47595.1	7	.	.	.	.	.	.	.	.	.	.	.	11.40	1.626307	0.28978	0.0	1.21E-4	ENSG00000213462	ENST00000394323	T	0.16457	2.34	0.109	0.109	0.14578	.	.	.	.	.	T	0.07503	0.0189	N	0.08118	0	0.20703	N	0.999861	B	0.14012	0.009	B	0.01281	0.0	T	0.35400	-0.9790	8	0.34782	T	0.22	.	.	.	.	.	37	Q14264	ENR1_HUMAN	L	37	ENSP00000391594:S37L	ENSP00000391594:S37L	S	-	2	0	ERV3-1	64090730	0.776000	0.28616	0.785000	0.31869	0.789000	0.44602	0.230000	0.17852	0.181000	0.19994	0.184000	0.17185	TCG	ERV3-1	-	NULL	ENSG00000213462		0.478	ERV3-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERV3-1	HGNC	protein_coding	OTTHUMT00000381468.1	-	0.00	36	0	G	NM_001007253		64453295	-1	tier1	-	no_errors	ENST00000394323	ensembl	human	known	74_37	missense	23.81	32	10	SNP	0.820	A
ERV3-1	2086	genome.wustl.edu	37	7	64453327	64453327	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:64453327C>A	ENST00000394323.2	-	2	578	c.78G>T	c.(76-78)gaG>gaT	p.E26D	ZNF117_ENST00000282869.6_5'Flank	NM_001007253.3	NP_001007254.2	Q14264	ENR1_HUMAN	endogenous retrovirus group 3, member 1	26						extracellular vesicular exosome (GO:0070062)|viral envelope (GO:0019031)				breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(8)	16						ggaggcatccctcccagggtt	0.483																																																	0													68.0	67.0	67.0					7																	64453327		1895	4125	6020	SO:0001583	missense	0			AK295189	CCDS47595.1	7p12-q11	2014-05-02	2011-05-05	2011-05-05	ENSG00000213462	ENSG00000213462			3454	other	endogenous retrovirus		131170	"""endogenous retroviral sequence 3 (includes zinc finger protein H-plk/HPF9)"", ""endogenous retroviral sequence 3"""	ERV3		2115127, 6495650, 21542922	Standard	NM_001007253		Approved	H-PLK, HERV-R, ERV-R, envR	uc011kdr.2	Q14264	OTTHUMG00000165023	ENST00000394323.2:c.78G>T	7.37:g.64453327C>A	ENSP00000391594:p.Glu26Asp			Missense_Mutation	SNP	NULL	p.E26D	ENST00000394323.2	37	c.78	CCDS47595.1	7	.	.	.	.	.	.	.	.	.	.	.	13.10	2.135276	0.37728	.	.	ENSG00000213462	ENST00000394323	T	0.12361	2.69	0.109	0.109	0.14578	.	.	.	.	.	T	0.07369	0.0186	N	0.08118	0	0.19775	N	0.999957	.	.	.	.	.	.	T	0.36407	-0.9749	6	0.87932	D	0	.	.	.	.	.	26	Q14264	ENR1_HUMAN	D	26	ENSP00000391594:E26D	ENSP00000391594:E26D	E	-	3	2	ERV3-1	64090762	0.953000	0.32496	0.885000	0.34714	0.888000	0.51559	0.195000	0.17155	0.181000	0.19994	0.184000	0.17185	GAG	ERV3-1	-	NULL	ENSG00000213462		0.483	ERV3-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERV3-1	HGNC	protein_coding	OTTHUMT00000381468.1	-	0.00	36	0	C	NM_001007253		64453327	-1	tier1	-	no_errors	ENST00000394323	ensembl	human	known	74_37	missense	24.44	34	11	SNP	0.908	A
ERV3-1	2086	genome.wustl.edu	37	7	64453347	64453347	+	Missense_Mutation	SNP	A	A	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:64453347A>C	ENST00000394323.2	-	2	558	c.58T>G	c.(58-60)Tta>Gta	p.L20V	ZNF117_ENST00000282869.6_5'Flank	NM_001007253.3	NP_001007254.2	Q14264	ENR1_HUMAN	endogenous retrovirus group 3, member 1	20						extracellular vesicular exosome (GO:0070062)|viral envelope (GO:0019031)				breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(8)	16						tctccttttaacatggataag	0.478																																																	0													54.0	52.0	52.0					7																	64453347		1876	4122	5998	SO:0001583	missense	0			AK295189	CCDS47595.1	7p12-q11	2014-05-02	2011-05-05	2011-05-05	ENSG00000213462	ENSG00000213462			3454	other	endogenous retrovirus		131170	"""endogenous retroviral sequence 3 (includes zinc finger protein H-plk/HPF9)"", ""endogenous retroviral sequence 3"""	ERV3		2115127, 6495650, 21542922	Standard	NM_001007253		Approved	H-PLK, HERV-R, ERV-R, envR	uc011kdr.2	Q14264	OTTHUMG00000165023	ENST00000394323.2:c.58T>G	7.37:g.64453347A>C	ENSP00000391594:p.Leu20Val			Missense_Mutation	SNP	NULL	p.L20V	ENST00000394323.2	37	c.58	CCDS47595.1	7	.	.	.	.	.	.	.	.	.	.	.	11.61	1.689724	0.29962	.	.	ENSG00000213462	ENST00000394323	T	0.12569	2.67	0.109	0.109	0.14578	.	.	.	.	.	T	0.07234	0.0183	N	0.08118	0	0.18873	N	0.999988	.	.	.	.	.	.	T	0.36089	-0.9762	6	0.87932	D	0	.	.	.	.	.	20	Q14264	ENR1_HUMAN	V	20	ENSP00000391594:L20V	ENSP00000391594:L20V	L	-	1	2	ERV3-1	64090782	0.956000	0.32656	0.863000	0.33907	0.865000	0.49528	0.222000	0.17699	0.156000	0.19299	0.155000	0.16302	TTA	ERV3-1	-	NULL	ENSG00000213462		0.478	ERV3-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERV3-1	HGNC	protein_coding	OTTHUMT00000381468.1	-	0.00	30	0	A	NM_001007253		64453347	-1	tier1	-	no_errors	ENST00000394323	ensembl	human	known	74_37	missense	29.73	26	11	SNP	0.889	C
F5	2153	genome.wustl.edu	37	1	169519183	169519183	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:169519183C>A	ENST00000367797.3	-	10	1668	c.1467G>T	c.(1465-1467)gaG>gaT	p.E489D	F5_ENST00000367796.3_Missense_Mutation_p.E489D|F5_ENST00000546081.1_3'UTR	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	489	F5/8 type A 2.|Plastocyanin-like 3.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GTTCATCAAACTCTAAGATGT	0.413																																																	0													229.0	204.0	213.0					1																	169519183		2203	4300	6503	SO:0001583	missense	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.1467G>T	1.37:g.169519183C>A	ENSP00000356771:p.Glu489Asp		A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.E489D	ENST00000367797.3	37	c.1467	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	C	11.76	1.734883	0.30774	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.99051	-5.37;-5.37	5.64	2.72	0.32119	Cupredoxin (2);	0.308545	0.36591	N	0.002510	D	0.91439	0.7298	L	0.35414	1.06	0.35181	D	0.772479	B	0.29936	0.262	B	0.28139	0.086	D	0.84395	0.0557	9	0.17369	T	0.5	-8.1998	1.2553	0.01990	0.1458:0.4107:0.1417:0.3018	.	489	P12259	FA5_HUMAN	D	489	ENSP00000356771:E489D;ENSP00000356770:E489D	ENSP00000356770:E489D	E	-	3	2	F5	167785807	0.726000	0.28059	0.941000	0.38009	0.771000	0.43674	-0.138000	0.10374	0.314000	0.23086	0.609000	0.83330	GAG	F5	-	superfamily_Cupredoxin	ENSG00000198734		0.413	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	-	0.00	54	0	C	NM_000130		169519183	-1	tier1	-	no_errors	ENST00000367797	ensembl	human	known	74_37	missense	43.48	39	30	SNP	0.860	A
FAM179B	23116	genome.wustl.edu	37	14	45513927	45513927	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr14:45513927G>T	ENST00000361577.3	+	13	4222	c.4008G>T	c.(4006-4008)gaG>gaT	p.E1336D	FAM179B_ENST00000382233.2_3'UTR|KLHL28_ENST00000553817.1_5'Flank|FAM179B_ENST00000361462.2_Missense_Mutation_p.E1336D	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1336										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						TGGATCAAGAGCTAGATACCA	0.343																																																	0													93.0	93.0	93.0					14																	45513927		2203	4300	6503	SO:0001583	missense	0			AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.4008G>T	14.37:g.45513927G>T	ENSP00000355045:p.Glu1336Asp		Q68D66|Q6PG27	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E1336D	ENST00000361577.3	37	c.4008	CCDS9681.1	14	.	.	.	.	.	.	.	.	.	.	G	16.77	3.216335	0.58452	.	.	ENSG00000198718	ENST00000361577;ENST00000361462	T;T	0.33865	1.39;1.39	5.83	0.713	0.18173	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.36166	0.0957	L	0.35854	1.095	0.80722	D	1	B;P	0.46859	0.08;0.885	B;P	0.53722	0.237;0.733	T	0.03829	-1.1000	10	0.33141	T	0.24	-22.6321	9.5841	0.39506	0.5937:0.0:0.4063:0.0	.	1336;1336	G3XAE9;Q9Y4F4	.;F179B_HUMAN	D	1336	ENSP00000355045:E1336D;ENSP00000354917:E1336D	ENSP00000354917:E1336D	E	+	3	2	FAM179B	44583677	1.000000	0.71417	0.998000	0.56505	0.837000	0.47467	1.960000	0.40422	0.130000	0.18549	-0.300000	0.09419	GAG	FAM179B	-	superfamily_ARM-type_fold	ENSG00000198718		0.343	FAM179B-001	KNOWN	basic|CCDS	protein_coding	FAM179B	HGNC	protein_coding	OTTHUMT00000276791.1	-	0.00	46	0	G	XM_113781		45513927	+1	tier1	-	no_errors	ENST00000361577	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.998	T
FAM65B	9750	genome.wustl.edu	37	6	24809943	24809943	+	Splice_Site	SNP	A	A	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:24809943A>T	ENST00000259698.4	-	22	3282		c.e22+1		FAM65B_ENST00000538035.1_Splice_Site	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B						cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						AATAAAACTCACCCAGAGACA	0.413																																																	0													120.0	99.0	105.0					6																	24809943		692	1591	2283	SO:0001630	splice_region_variant	0			U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.3106+1T>A	6.37:g.24809943A>T			A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Splice_Site	SNP	-	e21+2	ENST00000259698.4	37	c.3106+2	CCDS47383.1	6	.	.	.	.	.	.	.	.	.	.	A	18.00	3.524434	0.64747	.	.	ENSG00000111913	ENST00000259698;ENST00000538035	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7847	0.63102	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAM65B	24917922	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.020000	0.70826	1.955000	0.56771	0.533000	0.62120	.	FAM65B	-	-	ENSG00000111913		0.413	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM65B	HGNC	protein_coding	OTTHUMT00000040024.2		0.00	43	0	A		Intron	24809943	-1			no_errors	ENST00000259698	ensembl	human	known	74_37	splice_site	18.82	68	16	SNP	1.000	T
FAM83F	113828	genome.wustl.edu	37	22	40391301	40391301	+	Silent	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr22:40391301C>A	ENST00000333407.6	+	1	349	c.255C>A	c.(253-255)ggC>ggA	p.G85G		NM_138435.2	NP_612444.2	Q8NEG4	FA83F_HUMAN	family with sequence similarity 83, member F	85										breast(1)|endometrium(2)|large_intestine(1)|lung(4)|skin(4)|urinary_tract(2)	14						ACGCCCGGGGCAAGAGCAAGG	0.756																																																	0													2.0	3.0	2.0					22																	40391301		1308	3039	4347	SO:0001819	synonymous_variant	0				CCDS14000.2	22q13.1	2006-03-22			ENSG00000133477	ENSG00000133477			25148	protein-coding gene	gene with protein product						12477932	Standard	NM_138435		Approved		uc003ayk.1	Q8NEG4	OTTHUMG00000150688	ENST00000333407.6:c.255C>A	22.37:g.40391301C>A			Q96FD6	Silent	SNP	pfam_DUF1669	p.G85	ENST00000333407.6	37	c.255	CCDS14000.2	22																																																																																			FAM83F	-	pfam_DUF1669	ENSG00000133477		0.756	FAM83F-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83F	HGNC	protein_coding	OTTHUMT00000319624.3	-	0.00	19	0	C	NM_138435		40391301	+1	tier1	-	no_errors	ENST00000333407	ensembl	human	known	74_37	silent	46.67	8	7	SNP	0.682	A
FAT3	120114	genome.wustl.edu	37	11	92538510	92538510	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:92538510G>A	ENST00000298047.6	+	10	9105	c.9088G>A	c.(9088-9090)Gat>Aat	p.D3030N	FAT3_ENST00000409404.2_Missense_Mutation_p.D3030N|FAT3_ENST00000525166.1_Missense_Mutation_p.D2880N			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3030	Cadherin 28. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CCCAGTGTGTGATCAGGTGAG	0.423										TCGA Ovarian(4;0.039)																																							0													57.0	56.0	56.0					11																	92538510		1939	4147	6086	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.9088G>A	11.37:g.92538510G>A	ENSP00000298047:p.Asp3030Asn		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.D3030N	ENST00000298047.6	37	c.9088		11	.	.	.	.	.	.	.	.	.	.	G	15.61	2.885877	0.51908	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.01725	4.67;4.67;4.67	5.91	5.01	0.66863	.	.	.	.	.	T	0.01800	0.0057	N	0.17872	0.535	0.80722	D	1	B	0.15930	0.015	B	0.15870	0.014	T	0.60362	-0.7278	9	0.24483	T	0.36	.	15.154	0.72726	0.0675:0.0:0.9325:0.0	.	3030	Q8TDW7-3	.	N	3030;3030;2880	ENSP00000298047:D3030N;ENSP00000387040:D3030N;ENSP00000432586:D2880N	ENSP00000298047:D3030N	D	+	1	0	FAT3	92178158	1.000000	0.71417	0.999000	0.59377	0.796000	0.44982	5.656000	0.67988	1.518000	0.48934	0.650000	0.86243	GAT	FAT3	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000165323		0.423	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		-	0.00	35	0	G	NM_001008781		92538510	+1	tier1	-	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	7.58	59	5	SNP	1.000	A
FBRS	64319	genome.wustl.edu	37	16	30675640	30675640	+	5'Flank	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:30675640C>T	ENST00000287468.5	+	0	0				FBRS_ENST00000395073.2_5'Flank|FBRS_ENST00000356166.6_Missense_Mutation_p.A387V|FBRS_ENST00000482749.1_3'UTR|FBRS_ENST00000568722.1_Intron	NM_001105079.1	NP_001098549.1	Q9HAH7	FBRS_HUMAN	fibrosin											ovary(1)	1			Colorectal(24;0.103)			tcctcgtccGCGCAGCTCACC	0.731																																																	0																																										SO:0001631	upstream_gene_variant	0			AK021680		16p11.2	2008-02-05	2007-04-18	2007-04-18	ENSG00000156860	ENSG00000156860			20442	protein-coding gene	gene with protein product		608601	"""fibrosin 1"""	FBS1		7892239, 9809749	Standard	NM_001105079		Approved	FBS, FLJ11618	uc002dzd.4	Q9HAH7	OTTHUMG00000132390		16.37:g.30675640C>T	Exception_encountered		B4DP86|Q96CI9|Q9H9X4	Missense_Mutation	SNP	prints_AUTS2	p.A387V	ENST00000287468.5	37	c.1160		16	.	.	.	.	.	.	.	.	.	.	C	12.66	2.005286	0.35415	.	.	ENSG00000156860	ENST00000356166	T	0.39406	1.08	4.15	2.07	0.26955	.	.	.	.	.	T	0.33789	0.0875	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.05468	-1.0883	6	0.22706	T	0.39	-0.003	4.8743	0.13648	0.2104:0.675:0.0:0.1146	.	.	.	.	V	387	ENSP00000348489:A387V	ENSP00000348489:A387V	A	+	2	0	FBRS	30583141	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.156000	0.42310	0.293000	0.22520	0.644000	0.83932	GCG	FBRS	-	NULL	ENSG00000156860		0.731	FBRS-201	KNOWN	basic|appris_principal	protein_coding	FBRS	HGNC	protein_coding		-	0.00	189	0	C	NM_022452		30675640	+1	tier1	-	no_errors	ENST00000356166	ensembl	human	known	74_37	missense	35.62	47	26	SNP	0.991	T
FBXO34	55030	genome.wustl.edu	37	14	55818294	55818294	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr14:55818294G>A	ENST00000313833.4	+	2	1431	c.1186G>A	c.(1186-1188)Gcc>Acc	p.A396T	FBXO34_ENST00000440021.1_Missense_Mutation_p.A396T	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	396										breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						TTCGCAAACTGCCGTGAAAAA	0.517																																																	0													128.0	111.0	117.0					14																	55818294		2203	4300	6503	SO:0001583	missense	0			AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.1186G>A	14.37:g.55818294G>A	ENSP00000313159:p.Ala396Thr		Q2VPB5|Q4VBP5|Q86TY4	Missense_Mutation	SNP	superfamily_F-box_dom,pfscan_F-box_dom	p.A396T	ENST00000313833.4	37	c.1186	CCDS32086.1	14	.	.	.	.	.	.	.	.	.	.	G	2.624	-0.287802	0.05605	.	.	ENSG00000178974	ENST00000313833;ENST00000440021	T;T	0.19394	2.15;2.15	5.48	2.64	0.31445	.	0.646310	0.14542	N	0.313201	T	0.17238	0.0414	L	0.57536	1.79	0.09310	N	1	B	0.20052	0.041	B	0.16722	0.016	T	0.28996	-1.0026	10	0.28530	T	0.3	-8.804	2.6796	0.05090	0.1391:0.1253:0.4775:0.258	.	396	Q9NWN3	FBX34_HUMAN	T	396	ENSP00000313159:A396T;ENSP00000394117:A396T	ENSP00000313159:A396T	A	+	1	0	FBXO34	54888047	0.004000	0.15560	0.009000	0.14445	0.007000	0.05969	0.563000	0.23547	0.418000	0.25898	-0.145000	0.13849	GCC	FBXO34	-	NULL	ENSG00000178974		0.517	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO34	HGNC	protein_coding	OTTHUMT00000411322.1	-	0.00	41	0	G			55818294	+1	tier1	-	no_errors	ENST00000313833	ensembl	human	known	74_37	missense	59.38	26	38	SNP	0.003	A
FBXO40	51725	genome.wustl.edu	37	3	121341286	121341286	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:121341286G>T	ENST00000338040.4	+	3	1424	c.1010G>T	c.(1009-1011)gGc>gTc	p.G337V		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	337					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		TTTGTTTATGGCAAGCTGGAG	0.468																																																	0													92.0	79.0	83.0					3																	121341286		2203	4300	6503	SO:0001583	missense	0			AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.1010G>T	3.37:g.121341286G>T	ENSP00000337510:p.Gly337Val		B2RAX7|Q32M70|Q9ULM5	Missense_Mutation	SNP	superfamily_F-box_dom,superfamily_TRAF-like,pfscan_F-box_dom,pfscan_Znf_TRAF	p.G337V	ENST00000338040.4	37	c.1010	CCDS33835.1	3	.	.	.	.	.	.	.	.	.	.	G	18.49	3.635880	0.67130	.	.	ENSG00000163833	ENST00000338040	T	0.53423	0.62	5.73	5.73	0.89815	.	0.101878	0.64402	D	0.000001	T	0.68247	0.2980	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69281	-0.5186	10	0.66056	D	0.02	-19.9495	17.4071	0.87476	0.0:0.0:1.0:0.0	.	337	Q9UH90	FBX40_HUMAN	V	337	ENSP00000337510:G337V	ENSP00000337510:G337V	G	+	2	0	FBXO40	122823976	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	9.476000	0.97823	2.721000	0.93114	0.655000	0.94253	GGC	FBXO40	-	NULL	ENSG00000163833		0.468	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO40	HGNC	protein_coding	OTTHUMT00000355158.1	-	0.00	21	0	G	NM_016298		121341286	+1	tier1	-	no_errors	ENST00000338040	ensembl	human	known	74_37	missense	37.14	22	13	SNP	1.000	T
FBXW5	54461	genome.wustl.edu	37	9	139836492	139836492	+	Intron	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr9:139836492G>T	ENST00000325285.3	-	6	1176				FBXW5_ENST00000483559.1_Intron	NM_018998.3	NP_061871.1	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5						centrosome duplication (GO:0051298)|mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		GGCGGCAGGGGTGTACCGATC	0.657																																																	0													83.0	95.0	91.0					9																	139836492		2195	4299	6494	SO:0001627	intron_variant	0			BC014130	CCDS7014.1	9q34.3	2013-01-09	2007-02-08		ENSG00000159069	ENSG00000159069		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13613	protein-coding gene	gene with protein product		609072	"""F-box and WD-40 domain protein 5"""				Standard	NM_018998		Approved	DKFZP434B205, MGC20962, Fbw5	uc004cjx.3	Q969U6	OTTHUMG00000020967	ENST00000325285.3:c.1096+5C>A	9.37:g.139836492G>T			B2RDZ6|Q59ET5|Q5SPZ8|Q5SPZ9|Q5SQ00|Q5SQ02|Q5SQ03|Q5SQ04|Q8WY79|Q96GJ6|Q9BSU8|Q9H6A8|Q9HBQ6|Q9NSZ3	RNA	SNP	-	NULL	ENST00000325285.3	37	NULL	CCDS7014.1	9																																																																																			FBXW5	-	-	ENSG00000159069		0.657	FBXW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW5	HGNC	protein_coding	OTTHUMT00000055227.1	-	0.00	86	0	G	NM_018998		139836492	-1	tier1	-	no_errors	ENST00000487794	ensembl	human	known	74_37	rna	8.62	53	5	SNP	0.001	T
FIGN	55137	genome.wustl.edu	37	2	164468131	164468132	+	Frame_Shift_Ins	INS	-	-	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:164468131_164468132insT	ENST00000333129.3	-	3	524_525	c.210_211insA	c.(208-213)aaatatfs	p.Y71fs	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'UTR	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	71					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						TTCTCTGCATATTTTTTTAGTA	0.48																																																	0																																										SO:0001589	frameshift_variant	0			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.211dupA	2.37:g.164468138_164468138dupT	ENSP00000333836:p.Tyr71fs		B3KWM0|Q9H6M5|Q9NVZ9	Frame_Shift_Ins	INS	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.Y70fs	ENST00000333129.3	37	c.211_210	CCDS2221.2	2																																																																																			FIGN	-	NULL	ENSG00000182263		0.480	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGN	HGNC	protein_coding	OTTHUMT00000157220.2		0.00	39	0	-	NM_018086		164468132	-1	tier1		no_errors	ENST00000333129	ensembl	human	known	74_37	frame_shift_ins	26.53	36	13	INS	1.000:0.998	T
FLG	2312	genome.wustl.edu	37	1	152278839	152278841	+	In_Frame_Del	DEL	TGT	TGT	-	rs576152401	byFrequency	TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	TGT	TGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:152278839_152278841delTGT	ENST00000368799.1	-	3	8556_8558	c.8521_8523delACA	c.(8521-8523)acadel	p.T2841del	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2841	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTCATTACGTGTTGTTCTGCTT	0.567									Ichthyosis																																								0																																										SO:0001651	inframe_deletion	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8521_8523delACA	1.37:g.152278842_152278844delTGT	ENSP00000357789:p.Thr2841del		Q01720|Q5T583|Q9UC71	In_Frame_Del	DEL	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.T2841in_frame_del	ENST00000368799.1	37	c.8523_8521	CCDS30860.1	1																																																																																			FLG	-	NULL	ENSG00000143631		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1		0.00	197	0	TGT	NM_002016		152278841	-1	tier1		no_errors	ENST00000368799	ensembl	human	known	74_37	in_frame_del	14.58	123	21	DEL	0.000:0.000:0.000	-
FLNC	2318	genome.wustl.edu	37	7	128491646	128491646	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:128491646C>A	ENST00000325888.8	+	35	6067	c.5806C>A	c.(5806-5808)Cac>Aac	p.H1936N	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Missense_Mutation_p.H1903N	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1936					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CGATGACAAGCACATCCCGGG	0.572																																																	0													82.0	89.0	87.0					7																	128491646		2203	4300	6503	SO:0001583	missense	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5806C>A	7.37:g.128491646C>A	ENSP00000327145:p.His1936Asn		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.H1936N	ENST00000325888.8	37	c.5806	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	C	28.5	4.925153	0.92319	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.86030	-2.06;-2.06	5.7	5.7	0.88788	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.051747	0.85682	D	0.000000	D	0.92593	0.7647	M	0.79258	2.445	0.58432	D	0.999999	P;D	0.57257	0.503;0.979	P;D	0.68621	0.586;0.959	D	0.92860	0.6305	10	0.87932	D	0	.	19.8471	0.96713	0.0:1.0:0.0:0.0	.	1903;1936	Q14315-2;Q14315	.;FLNC_HUMAN	N	1936;1903	ENSP00000327145:H1936N;ENSP00000344002:H1903N	ENSP00000327145:H1936N	H	+	1	0	FLNC	128278882	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	5.978000	0.70501	2.688000	0.91661	0.655000	0.94253	CAC	FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.572	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	-	0.00	42	0	C			128491646	+1	tier1	-	no_errors	ENST00000325888	ensembl	human	known	74_37	missense	35.14	24	13	SNP	1.000	A
FLT1	2321	genome.wustl.edu	37	13	28897002	28897002	+	Missense_Mutation	SNP	C	C	T	rs554058758		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr13:28897002C>T	ENST00000282397.4	-	21	3129	c.2878G>A	c.(2878-2880)Gtc>Atc	p.V960I	FLT1_ENST00000540678.1_Missense_Mutation_p.V178I|FLT1_ENST00000543394.1_5'Flank	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	960	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTGCTGGTGACGCTATCTAGT	0.473																																																	0													223.0	196.0	205.0					13																	28897002		2203	4300	6503	SO:0001583	missense	0			AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.2878G>A	13.37:g.28897002C>T	ENSP00000282397:p.Val960Ile		A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR1_rcpt	p.V960I	ENST00000282397.4	37	c.2878	CCDS9330.1	13	.	.	.	.	.	.	.	.	.	.	C	9.527	1.109896	0.20714	.	.	ENSG00000102755	ENST00000282397;ENST00000540678	T;T	0.78481	-0.93;-1.18	5.9	3.29	0.37713	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.347511	0.29587	N	0.011734	T	0.55433	0.1920	N	0.12637	0.245	0.80722	D	1	B	0.30439	0.279	B	0.26094	0.066	T	0.40701	-0.9549	10	0.18276	T	0.48	.	8.7246	0.34460	0.0:0.6543:0.0:0.3457	.	960	P17948	VGFR1_HUMAN	I	960;178	ENSP00000282397:V960I;ENSP00000443311:V178I	ENSP00000282397:V960I	V	-	1	0	FLT1	27795002	0.793000	0.28825	0.636000	0.29352	0.828000	0.46876	1.445000	0.35079	0.433000	0.26313	-0.264000	0.10439	GTC	FLT1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000102755		0.473	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT1	HGNC	protein_coding	OTTHUMT00000044322.1	-	0.00	45	0	C			28897002	-1	tier1	-	no_errors	ENST00000282397	ensembl	human	known	74_37	missense	42.22	26	19	SNP	0.980	T
FMN1	342184	genome.wustl.edu	37	15	33358786	33358786	+	Intron	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:33358786C>T	ENST00000559047.1	-	3	2043				FMN1_ENST00000558197.1_Missense_Mutation_p.E434K|FMN1_ENST00000561249.1_Intron|FMN1_ENST00000559150.1_Intron|FMN1_ENST00000334528.9_Missense_Mutation_p.E434K			Q68DA7	FMN1_HUMAN	formin 1						actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		GACTCCTTCTCATGTCTCATC	0.507																																																	0													53.0	53.0	53.0					15																	33358786		1967	4163	6130	SO:0001627	intron_variant	0			AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2044-1511G>A	15.37:g.33358786C>T			Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	pfam_FH2_Formin,smart_FH2_Formin,prints_Formin_Cappuccino_subfam	p.E434K	ENST00000559047.1	37	c.1300		15	.	.	.	.	.	.	.	.	.	.	C	23.7	4.448568	0.84101	.	.	ENSG00000248905	ENST00000334528	T	0.53423	0.62	5.96	5.96	0.96718	.	0.049723	0.85682	D	0.000000	T	0.71600	0.3359	.	.	.	0.20563	N	0.99989	D;D	0.89917	1.0;0.999	D;D	0.79784	0.993;0.942	T	0.69781	-0.5052	8	0.46703	T	0.11	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	434;434	Q68DA7-3;Q68DA7-5	.;.	K	434	ENSP00000333950:E434K	ENSP00000333950:E434K	E	-	1	0	FMN1	31146078	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.805000	0.75191	2.832000	0.97577	0.655000	0.94253	GAG	FMN1	-	NULL	ENSG00000248905		0.507	FMN1-005	NOVEL	basic|exp_conf	protein_coding	FMN1	HGNC	protein_coding	OTTHUMT00000417414.1	-	0.00	54	0	C	NM_001103184		33358786	-1	tier1	-	no_errors	ENST00000334528	ensembl	human	known	74_37	missense	7.81	59	5	SNP	1.000	T
FMO6P	388714	genome.wustl.edu	37	1	171121381	171121381	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:171121381G>T	ENST00000236166.3	+	6	1270	c.1160G>T	c.(1159-1161)tGg>tTg	p.W387L				O60774	FMO6_HUMAN	flavin containing monooxygenase 6 pseudogene	387						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)										CTGCAAGCCTGGTGGGCTGCT	0.483																																																	0																																										SO:0001583	missense	0			AK130511		1q24.3	2011-08-04	2006-12-04	2006-12-04	ENSG00000117507	ENSG00000117507			24024	pseudogene	pseudogene			"""flavin containing monooxygenase 6"""	FMO6		15077013	Standard	NR_002601		Approved		uc001ghj.1	O60774	OTTHUMG00000035503	ENST00000236166.3:c.1160G>T	1.37:g.171121381G>T	ENSP00000236166:p.Trp387Leu			Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Flavin_mOase,prints_Flavin_mOase_3,prints_Flavin_mOase_1	p.W387L	ENST00000236166.3	37	c.1160		1	.	.	.	.	.	.	.	.	.	.	G	8.932	0.963780	0.18583	.	.	ENSG00000117507	ENST00000236166	.	.	.	5.4	0.368	0.16146	.	0.057544	0.64402	D	0.000001	T	0.17789	0.0427	.	.	.	0.09310	N	0.999996	B	0.10296	0.003	B	0.01281	0.0	T	0.30880	-0.9963	8	0.72032	D	0.01	-2.1234	10.1635	0.42866	0.3327:0.0:0.6673:0.0	.	387	O60774	FMO6_HUMAN	L	387	.	ENSP00000236166:W387L	W	+	2	0	FMO6P	169388005	1.000000	0.71417	0.404000	0.26397	0.054000	0.15201	1.990000	0.40717	-0.173000	0.10761	-0.479000	0.04858	TGG	FMO6P	-	pfam_Flavin_mOase-like,prints_Flavin_mOase	ENSG00000117507		0.483	FMO6P-003	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	FMO6P	HGNC	protein_coding	OTTHUMT00000385941.4	-	0.00	29	0	G	XM_371326		171121381	+1	tier1	-	no_errors	ENST00000236166	ensembl	human	novel	74_37	missense	25.64	28	10	SNP	1.000	T
FUT8	2530	genome.wustl.edu	37	14	66188719	66188719	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr14:66188719C>T	ENST00000360689.5	+	8	2789	c.1062C>T	c.(1060-1062)ggC>ggT	p.G354G	FUT8_ENST00000394586.2_Silent_p.G354G|FUT8_ENST00000417683.1_Intron|FUT8_ENST00000394585.1_Silent_p.G354G|FUT8_ENST00000358307.2_Silent_p.G225G|FUT8_ENST00000557164.1_Silent_p.G191G	NM_004480.4|NM_178155.2	NP_004471.4|NP_835368.1	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 (alpha (1,6) fucosyltransferase)	354	GT23. {ECO:0000255|PROSITE- ProRule:PRU00992}.				cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|GDP-L-fucose metabolic process (GO:0046368)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|L-fucose catabolic process (GO:0042355)|N-glycan fucosylation (GO:0036071)|N-glycan processing (GO:0006491)|oligosaccharide biosynthetic process (GO:0009312)|post-translational protein modification (GO:0043687)|protein glycosylation in Golgi (GO:0033578)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|receptor metabolic process (GO:0043112)|respiratory gaseous exchange (GO:0007585)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycoprotein 6-alpha-L-fucosyltransferase activity (GO:0008424)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		AGAAGCTTGGCTTCAAACATC	0.393																																																	0													76.0	77.0	77.0					14																	66188719		2203	4300	6503	SO:0001819	synonymous_variant	0			AB049740	CCDS9775.1, CCDS9776.1, CCDS9776.2	14q24.3	2013-02-26			ENSG00000033170	ENSG00000033170		"""Fucosyltransferases"""	4019	protein-coding gene	gene with protein product		602589				9368041	Standard	NM_178155		Approved		uc001xio.3	Q9BYC5	OTTHUMG00000142818	ENST00000360689.5:c.1062C>T	14.37:g.66188719C>T			B4DFS7|G3V5N0|O00235|Q8IUA5|Q9BYC6|Q9P2U5|Q9P2U6	Silent	SNP	superfamily_SH3_domain,smart_SH3_domain,pirsf_Alpha1_6FUT_euk	p.G354	ENST00000360689.5	37	c.1062	CCDS9775.1	14																																																																																			FUT8	-	pirsf_Alpha1_6FUT_euk	ENSG00000033170		0.393	FUT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT8	HGNC	protein_coding	OTTHUMT00000286406.1	-	0.00	55	0	C	NM_004480		66188719	+1	tier1	-	no_errors	ENST00000360689	ensembl	human	known	74_37	silent	30.56	50	22	SNP	1.000	T
FZD1	8321	genome.wustl.edu	37	7	90895863	90895863	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:90895863C>A	ENST00000287934.2	+	1	2081	c.1668C>A	c.(1666-1668)ttC>ttA	p.F556L		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	556					autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			CCTGCTACTTCTACGAGCAGG	0.632																																																	0													74.0	59.0	64.0					7																	90895863		2203	4300	6503	SO:0001583	missense	0			AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.1668C>A	7.37:g.90895863C>A	ENSP00000287934:p.Phe556Leu		A4D1E8|O94815|Q549T8	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.F556L	ENST00000287934.2	37	c.1668	CCDS5620.1	7	.	.	.	.	.	.	.	.	.	.	C	17.15	3.317131	0.60524	.	.	ENSG00000157240	ENST00000287934	T	0.81415	-1.49	5.03	3.07	0.35406	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000002	T	0.75561	0.3866	L	0.42581	1.335	0.53005	D	0.999965	P	0.39022	0.655	P	0.47015	0.534	T	0.69687	-0.5078	10	0.27082	T	0.32	.	6.6994	0.23217	0.0:0.7004:0.0:0.2996	.	556	Q9UP38	FZD1_HUMAN	L	556	ENSP00000287934:F556L	ENSP00000287934:F556L	F	+	3	2	FZD1	90733799	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.237000	0.32695	1.341000	0.45600	0.655000	0.94253	TTC	FZD1	-	pfam_Frizzled,pfscan_GPCR_2-like	ENSG00000157240		0.632	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD1	HGNC	protein_coding	OTTHUMT00000059367.2	-	0.00	42	0	C	NM_003505		90895863	+1	tier1	-	no_errors	ENST00000287934	ensembl	human	known	74_37	missense	34.62	17	9	SNP	1.000	A
FZD6	8323	genome.wustl.edu	37	8	104341947	104341947	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr8:104341947A>G	ENST00000358755.4	+	6	1923	c.1606A>G	c.(1606-1608)Aaa>Gaa	p.K536E	FZD6_ENST00000523739.1_Missense_Mutation_p.K504E|FZD6_ENST00000540287.1_Missense_Mutation_p.K231E|FZD6_ENST00000522566.1_Missense_Mutation_p.K536E	NM_001164616.1|NM_003506.3	NP_001158088.1|NP_003497.2	O60353	FZD6_HUMAN	frizzled class receptor 6	536					angiogenesis (GO:0001525)|axonogenesis (GO:0007409)|cell proliferation in midbrain (GO:0033278)|embryonic nail plate morphogenesis (GO:0035880)|establishment of planar polarity (GO:0001736)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|platelet activation (GO:0030168)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(57;2.86e-05)|STAD - Stomach adenocarcinoma(118;0.197)			GCACAATTCTAAAGTTAAACA	0.368																																																	0													55.0	54.0	54.0					8																	104341947		2203	4300	6503	SO:0001583	missense	0			AB012911	CCDS6298.1, CCDS55268.1	8q22.3-q23.1	2014-01-29	2014-01-29		ENSG00000164930	ENSG00000164930		"""GPCR / Class F : Frizzled receptors"""	4044	protein-coding gene	gene with protein product		603409	"""frizzled (Drosophila) homolog 6"", ""frizzled homolog 6 (Drosophila)"", ""frizzled 6, seven transmembrane spanning receptor"", ""frizzled family receptor 6"""			9480858, 14747478	Standard	NM_003506		Approved	Hfz6	uc003ylh.3	O60353	OTTHUMG00000164840	ENST00000358755.4:c.1606A>G	8.37:g.104341947A>G	ENSP00000351605:p.Lys536Glu		B4DRN0|Q6N0A5|Q6P9C3|Q8WXR9	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.K536E	ENST00000358755.4	37	c.1606	CCDS6298.1	8	.	.	.	.	.	.	.	.	.	.	A	16.76	3.212250	0.58452	.	.	ENSG00000164930	ENST00000522566;ENST00000358755;ENST00000523739;ENST00000540287;ENST00000539487	T;T;T;T	0.76578	-1.0;-1.0;-1.03;-1.0	5.4	5.4	0.78164	.	0.318212	0.36665	N	0.002475	T	0.66499	0.2795	L	0.32530	0.975	0.37040	D	0.897105	P;P;P	0.41848	0.651;0.763;0.501	B;B;B	0.39119	0.058;0.291;0.058	T	0.68070	-0.5506	10	0.08381	T	0.77	.	15.7249	0.77747	1.0:0.0:0.0:0.0	.	481;231;536	B4E236;F5H831;O60353	.;.;FZD6_HUMAN	E	536;536;504;231;481	ENSP00000429055:K536E;ENSP00000351605:K536E;ENSP00000429528:K504E;ENSP00000443757:K231E	ENSP00000351605:K536E	K	+	1	0	FZD6	104411123	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.268000	0.65536	2.177000	0.69029	0.459000	0.35465	AAA	FZD6	-	NULL	ENSG00000164930		0.368	FZD6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD6	HGNC	protein_coding	OTTHUMT00000380560.1	-	0.00	29	0	A	NM_003506		104341947	+1	tier1	-	no_errors	ENST00000358755	ensembl	human	known	74_37	missense	19.01	98	23	SNP	1.000	G
FZR1	51343	genome.wustl.edu	37	19	3530789	3530789	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:3530789G>T	ENST00000395095.3	+	7	654		c.e7-1		FZR1_ENST00000441788.2_Splice_Site|FZR1_ENST00000313639.8_Splice_Site	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)						activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTGCCTCCAGGTGACGCGGC	0.612																																																	0													88.0	63.0	71.0					19																	3530789		2200	4300	6500	SO:0001630	splice_region_variant	0			AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.655-1G>T	19.37:g.3530789G>T			O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Splice_Site	SNP	-	e7-1	ENST00000395095.3	37	c.655-1	CCDS45916.1	19	.	.	.	.	.	.	.	.	.	.	G	20.3	3.968504	0.74131	.	.	ENSG00000105325	ENST00000441788;ENST00000395095;ENST00000313639	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7674	0.85528	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FZR1	3481789	1.000000	0.71417	0.997000	0.53966	0.746000	0.42486	9.460000	0.97641	2.309000	0.77851	0.655000	0.94253	.	FZR1	-	-	ENSG00000105325		0.612	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FZR1	HGNC	protein_coding	OTTHUMT00000452869.2	-	0.00	50	0	G	NM_016263	Intron	3530789	+1	tier1	-	no_errors	ENST00000395095	ensembl	human	known	74_37	splice_site	9.76	37	4	SNP	1.000	T
GALNT3	2591	genome.wustl.edu	37	2	166611182	166611182	+	Silent	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:166611182G>T	ENST00000392701.3	-	9	2356	c.1581C>A	c.(1579-1581)ggC>ggA	p.G527G	GALNT3_ENST00000409882.1_Silent_p.G265G	NM_004482.3	NP_004473.2	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	527	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(1)	20						TTAATGGTTTGCCTCCTTGAT	0.363																																																	0													101.0	95.0	97.0					2																	166611182		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2226.1	2q24-q31	2014-03-13	2014-03-13		ENSG00000115339	ENSG00000115339	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4125	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 3"""	601756	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)"""			9592121, 15133511	Standard	NM_004482		Approved	GalNAc-T3, HHS, HFTC	uc010fph.1	Q14435	OTTHUMG00000132157	ENST00000392701.3:c.1581C>A	2.37:g.166611182G>T			Q53TG9|Q7Z476	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.G527	ENST00000392701.3	37	c.1581	CCDS2226.1	2																																																																																			GALNT3	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000115339		0.363	GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT3	HGNC	protein_coding	OTTHUMT00000255205.2	-	0.00	62	0	G	NM_004482		166611182	-1	tier1	-	no_errors	ENST00000392701	ensembl	human	known	74_37	silent	5.00	95	5	SNP	1.000	T
MTX1	4580	genome.wustl.edu	37	1	155184007	155184007	+	IGR	SNP	A	A	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:155184007A>C	ENST00000368376.3	+	0	1632				GBAP1_ENST00000486869.1_RNA|RP11-263K19.6_ENST00000455788.1_RNA	NM_002455.3	NP_002446.2	Q13505	MTX1_HUMAN	metaxin 1						cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TAGAGGGGAAAGTGAGTCACC	0.577																																																	0																																										SO:0001628	intergenic_variant	0				CCDS1100.1, CCDS1101.1	1q21	2008-07-18			ENSG00000173171	ENSG00000173171			7504	protein-coding gene	gene with protein product		600605		MTX		7753840	Standard	XM_006711338		Approved	MTXN	uc001fjb.3	Q13505	OTTHUMG00000035708		1.37:g.155184007A>C			B1AVR9|B1AVS0|B2R9P4|Q9BUU3	RNA	SNP	-	NULL	ENST00000368376.3	37	NULL	CCDS1100.1	1																																																																																			GBAP1	-	-	ENSG00000160766		0.577	MTX1-001	KNOWN	basic|CCDS	protein_coding	GBAP1	HGNC	protein_coding	OTTHUMT00000086844.1		0.00	13	0	A	NM_198883		155184007	-1			no_errors	ENST00000368374	ensembl	human	known	74_37	rna	33.33	6	3	SNP	0.994	C
GCNT4	51301	genome.wustl.edu	37	5	74325367	74325367	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:74325367G>T	ENST00000322348.4	-	1	1357	c.496C>A	c.(496-498)Cgt>Agt	p.R166S		NM_016591.2	NP_057675.1	Q9P109	GCNT4_HUMAN	glucosaminyl (N-acetyl) transferase 4, core 2	166					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|homeostasis of number of cells (GO:0048872)|inter-male aggressive behavior (GO:0002121)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|thyroid hormone metabolic process (GO:0042403)|tissue morphogenesis (GO:0048729)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)	p.R166C(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|skin(1)|stomach(2)	19		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		GGTGCCTTACGATCATAATGG	0.378																																																	1	Substitution - Missense(1)	large_intestine(1)											153.0	148.0	149.0					5																	74325367		2203	4300	6503	SO:0001583	missense	0			AF132035	CCDS4026.1	5q12	2013-02-25	2010-03-16		ENSG00000176928	ENSG00000176928	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	17973	protein-coding gene	gene with protein product	"""core 2 beta-1,6-N-acetylglucosaminyltransferase 3"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 4"""		"""glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""			10753916	Standard	NM_016591		Approved	C2GNT3	uc003kdn.3	Q9P109	OTTHUMG00000131272	ENST00000322348.4:c.496C>A	5.37:g.74325367G>T	ENSP00000317027:p.Arg166Ser			Missense_Mutation	SNP	pfam_Glyco_trans_14	p.R166S	ENST00000322348.4	37	c.496	CCDS4026.1	5	.	.	.	.	.	.	.	.	.	.	.	12.01	1.810832	0.32053	.	.	ENSG00000176928	ENST00000322348	T	0.09445	2.98	6.17	5.31	0.75309	.	0.565448	0.20533	N	0.090470	T	0.08133	0.0203	N	0.12569	0.235	0.28184	N	0.928049	B	0.22746	0.074	B	0.28385	0.089	T	0.26815	-1.0092	10	0.21014	T	0.42	-16.1396	15.7563	0.78030	0.065:0.0:0.935:0.0	.	166	Q9P109	GCNT4_HUMAN	S	166	ENSP00000317027:R166S	ENSP00000317027:R166S	R	-	1	0	GCNT4	74361123	1.000000	0.71417	0.895000	0.35142	0.931000	0.56810	4.719000	0.61937	1.626000	0.50381	0.655000	0.94253	CGT	GCNT4	-	pfam_Glyco_trans_14	ENSG00000176928		0.378	GCNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCNT4	HGNC	protein_coding	OTTHUMT00000254040.1		0.00	18	0	G	NM_016591		74325367	-1			no_errors	ENST00000322348	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.997	T
GDA	9615	genome.wustl.edu	37	9	74825650	74825650	+	Silent	SNP	A	A	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr9:74825650A>G	ENST00000358399.3	+	4	525	c.432A>G	c.(430-432)acA>acG	p.T144T	GDA_ENST00000477618.1_3'UTR|GDA_ENST00000376986.1_Silent_p.T102T|GDA_ENST00000376989.3_Silent_p.T119T|GDA_ENST00000238018.4_Silent_p.T144T|GDA_ENST00000545168.1_Silent_p.T70T	NM_001242505.2|NM_001242506.2|NM_004293.4	NP_001229434.1|NP_001229435.1|NP_004284.1	Q9Y2T3	GUAD_HUMAN	guanine deaminase	144					guanine catabolic process (GO:0006147)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	guanine deaminase activity (GO:0008892)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(20)|ovary(2)|skin(2)|urinary_tract(1)	32		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		ACTTTGCAACAATTCACACTG	0.438																																																	0													168.0	126.0	140.0					9																	74825650		2203	4300	6503	SO:0001819	synonymous_variant	0			AF095286	CCDS6641.1, CCDS56576.1, CCDS56577.1	9q21.13	2008-05-14			ENSG00000119125	ENSG00000119125			4212	protein-coding gene	gene with protein product		139260				10075721, 3966794	Standard	NM_001242507		Approved		uc004air.3	Q9Y2T3	OTTHUMG00000020005	ENST00000358399.3:c.432A>G	9.37:g.74825650A>G			B4DTY5|Q5SZC7|Q9H335|Q9ULG2	Silent	SNP	pfam_Amidohydro_1,tigrfam_Guanine_deaminase	p.T144	ENST00000358399.3	37	c.432	CCDS6641.1	9																																																																																			GDA	-	pfam_Amidohydro_1,tigrfam_Guanine_deaminase	ENSG00000119125		0.438	GDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDA	HGNC	protein_coding	OTTHUMT00000052633.1	-	0.00	22	0	A			74825650	+1	tier1	-	no_errors	ENST00000238018	ensembl	human	known	74_37	silent	30.00	28	12	SNP	1.000	G
GFI1	2672	genome.wustl.edu	37	1	92948423	92948423	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:92948423G>T	ENST00000370332.1	-	3	614	c.296C>A	c.(295-297)cCa>cAa	p.P99Q	GFI1_ENST00000427103.1_Missense_Mutation_p.P99Q|GFI1_ENST00000483490.1_5'Flank|GFI1_ENST00000294702.5_Missense_Mutation_p.P99Q	NM_001127215.1	NP_001120687.1	Q99684	GFI1_HUMAN	growth factor independent 1 transcription repressor	99					auditory receptor cell differentiation (GO:0042491)|cell fate commitment (GO:0045165)|cellular response to lipopolysaccharide (GO:0071222)|inner ear morphogenesis (GO:0042472)|mechanosensory behavior (GO:0007638)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cell fate specification (GO:0009996)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vitamin D biosynthetic process (GO:0010957)|positive regulation of cell fate specification (GO:0042660)|positive regulation of interleukin-6-mediated signaling pathway (GO:0070105)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|viral process (GO:0016032)	nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	15		all_lung(203;0.00292)|Lung NSC(277;0.0115)|all_neural(321;0.185)|Glioma(108;0.203)		OV - Ovarian serous cystadenocarcinoma(397;9.04e-07)|Epithelial(280;1.17e-05)|all cancers(265;5.61e-05)|GBM - Glioblastoma multiforme(16;0.0191)		GTTCCTACCTGGAGACGCGGA	0.657																																																	0													27.0	33.0	31.0					1																	92948423		2203	4300	6503	SO:0001583	missense	0			U67369	CCDS30773.1	1p22	2014-09-17	2007-10-04		ENSG00000162676	ENSG00000162676		"""Zinc fingers, C2H2-type"""	4237	protein-coding gene	gene with protein product		600871	"""growth factor independent 1"""	ZNF163		7789186	Standard	NM_005263		Approved	GFI1A, GFI-1	uc001dov.4	Q99684	OTTHUMG00000010897	ENST00000370332.1:c.296C>A	1.37:g.92948423G>T	ENSP00000359357:p.Pro99Gln		Q8N564	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P99Q	ENST00000370332.1	37	c.296	CCDS30773.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.492937	0.96339	.	.	ENSG00000162676	ENST00000370332;ENST00000427103;ENST00000294702	T;T;T	0.12465	2.68;2.68;2.68	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.32346	0.0826	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.04078	-1.0979	10	0.72032	D	0.01	-17.3598	19.5896	0.95503	0.0:0.0:1.0:0.0	.	99	Q99684	GFI1_HUMAN	Q	99	ENSP00000359357:P99Q;ENSP00000399719:P99Q;ENSP00000294702:P99Q	ENSP00000294702:P99Q	P	-	2	0	GFI1	92721011	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.234000	0.95347	2.706000	0.92434	0.561000	0.74099	CCA	GFI1	-	NULL	ENSG00000162676		0.657	GFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFI1	HGNC	protein_coding	OTTHUMT00000030054.1		0.00	170	0	G	NM_005263		92948423	-1			no_errors	ENST00000294702	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
GLI1	2735	genome.wustl.edu	37	12	57860033	57860033	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:57860033G>A	ENST00000228682.2	+	8	864	c.773G>A	c.(772-774)aGc>aAc	p.S258N	GLI1_ENST00000543426.1_Missense_Mutation_p.S130N|GLI1_ENST00000546141.1_Missense_Mutation_p.S217N	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	258					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			CACATCAACAGCGAGCACATC	0.597																																					Pancreas(157;841 1936 10503 41495 50368)												0													181.0	177.0	178.0					12																	57860033		2203	4300	6503	SO:0001583	missense	0				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.773G>A	12.37:g.57860033G>A	ENSP00000228682:p.Ser258Asn		D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S258N	ENST00000228682.2	37	c.773	CCDS8940.1	12	.	.	.	.	.	.	.	.	.	.	G	0.453	-0.892981	0.02491	.	.	ENSG00000111087	ENST00000532291;ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467;ENST00000443131	D;D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9;-2.9	4.03	4.03	0.46877	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.109197	0.39759	N	0.001265	T	0.64659	0.2618	N	0.00223	-1.815	0.40369	D	0.97932	B	0.06786	0.001	B	0.08055	0.003	T	0.69442	-0.5144	10	0.02654	T	1	.	6.2844	0.21025	0.2068:0.0:0.7932:0.0	.	258	P08151	GLI1_HUMAN	N	130;130;258;217;217;130	ENSP00000436671:S130N;ENSP00000437607:S130N;ENSP00000228682:S258N;ENSP00000441006:S217N;ENSP00000434408:S217N	ENSP00000228682:S258N	S	+	2	0	GLI1	56146300	1.000000	0.71417	0.997000	0.53966	0.220000	0.24768	6.146000	0.71777	2.247000	0.74100	0.591000	0.81541	AGC	GLI1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000111087		0.597	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI1	HGNC	protein_coding	OTTHUMT00000394197.1	-	0.00	61	0	G	NM_005269		57860033	+1	tier1	-	no_errors	ENST00000228682	ensembl	human	known	74_37	missense	46.00	27	23	SNP	1.000	A
GIT2	9815	genome.wustl.edu	37	12	110399130	110399130	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:110399130C>T	ENST00000355312.3	-	11	939	c.940G>A	c.(940-942)Gtc>Atc	p.V314I	GIT2_ENST00000551209.1_Missense_Mutation_p.V313I|GIT2_ENST00000343646.5_Missense_Mutation_p.V314I|GIT2_ENST00000360185.4_Missense_Mutation_p.V314I|GIT2_ENST00000361006.5_Missense_Mutation_p.V314I|TCHP_ENST00000550780.1_Intron|GIT2_ENST00000457474.2_Missense_Mutation_p.V316I|GIT2_ENST00000547815.1_Missense_Mutation_p.V314I|GIT2_ENST00000356259.4_Missense_Mutation_p.V314I|GIT2_ENST00000338373.5_Missense_Mutation_p.V314I|GIT2_ENST00000320063.9_Missense_Mutation_p.V314I|GIT2_ENST00000354574.4_Missense_Mutation_p.V316I|GIT2_ENST00000553118.1_Missense_Mutation_p.V314I	NM_057169.3	NP_476510.1	Q14161	GIT2_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 2	314					behavioral response to pain (GO:0048266)|regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|skin(4)	27						AGAAAGGGGACGACCGTTGTC	0.522																																																	0													141.0	102.0	115.0					12																	110399130		2203	4300	6503	SO:0001583	missense	0			AF124491	CCDS9138.1, CCDS9139.1, CCDS44968.1, CCDS44969.1, CCDS55884.1	12q24.1	2013-01-10	2008-09-05			ENSG00000139436		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4273	protein-coding gene	gene with protein product		608564	"""G protein-coupled receptor kinase interactor 2"""			9826657, 10896954	Standard	NM_139201		Approved	KIAA0148	uc001tps.2	Q14161	OTTHUMG00000169313	ENST00000355312.3:c.940G>A	12.37:g.110399130C>T	ENSP00000347464:p.Val314Ile		Q86U59|Q96CI2|Q9BV91|Q9Y5V2	Missense_Mutation	SNP	pfam_GIT1_C,pfam_GIT_SHD,pfam_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_ArfGAP,smart_Ankyrin_rpt,smart_GIT_SHD,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_ArfGAP,prints_ArfGAP	p.V314I	ENST00000355312.3	37	c.940	CCDS9138.1	12	.	.	.	.	.	.	.	.	.	.	C	34	5.376649	0.95945	.	.	ENSG00000139436	ENST00000355312;ENST00000360185;ENST00000354574;ENST00000338373;ENST00000343646;ENST00000356259;ENST00000457474;ENST00000361006;ENST00000553118;ENST00000551209;ENST00000542273;ENST00000547815;ENST00000320063	T;T;T;T;T;T;T;T;T;T;T;T	0.75154	-0.91;-0.75;-0.69;-0.72;-0.77;-0.75;-0.67;-0.89;-0.78;-0.77;-0.72;-0.71	5.72	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.82217	0.4989	M	0.69823	2.125	0.80722	D	1	P;P;D;D;D;P;D	0.61080	0.703;0.82;0.987;0.987;0.987;0.947;0.989	B;B;P;P;P;P;P	0.57548	0.219;0.298;0.53;0.53;0.677;0.557;0.823	D	0.84350	0.0532	10	0.62326	D	0.03	.	14.3366	0.66595	0.0:0.9287:0.0:0.0713	.	314;314;316;316;314;314;314	B4E2E7;Q6FI58;Q14161-10;F8WAK2;Q14161-11;Q14161;Q14161-5	.;.;.;.;.;GIT2_HUMAN;.	I	314;314;316;314;314;314;316;314;314;313;252;314;314	ENSP00000347464:V314I;ENSP00000353312:V314I;ENSP00000346585:V316I;ENSP00000340342:V314I;ENSP00000340938:V314I;ENSP00000348595:V314I;ENSP00000391813:V316I;ENSP00000354282:V314I;ENSP00000447465:V314I;ENSP00000448832:V313I;ENSP00000450348:V314I;ENSP00000323833:V314I	ENSP00000323833:V314I	V	-	1	0	GIT2	108883513	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.747000	0.85070	1.561000	0.49584	0.655000	0.94253	GTC	GIT2	-	NULL	ENSG00000139436		0.522	GIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIT2	HGNC	protein_coding	OTTHUMT00000403407.1	-	0.00	70	0	C	NM_057169		110399130	-1	tier1	-	no_errors	ENST00000355312	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
GNAS	2778	genome.wustl.edu	37	20	57484421	57484421	+	Missense_Mutation	SNP	G	G	A	rs121913495		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr20:57484421G>A	ENST00000371085.3	+	8	1026	c.602G>A	c.(601-603)cGt>cAt	p.R201H	GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000371100.4_Missense_Mutation_p.R844H|GNAS_ENST00000306090.10_Missense_Mutation_p.R187H|GNAS_ENST00000265620.7_Missense_Mutation_p.R186H|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000354359.7_Missense_Mutation_p.R202H|GNAS_ENST00000371095.3_Missense_Mutation_p.R187H|GNAS_ENST00000371102.4_Missense_Mutation_p.R830H	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	201			R -> C (in MAS and somatotrophinoma; dbSNP:rs11554273). {ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> G (in MAS). {ECO:0000269|PubMed:10571700}.|R -> H (in MAS, somatotrophinoma and AIMAH1). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:1594625, ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> L (in non-MAS endocrine tumors). {ECO:0000269|PubMed:7751320}.|R -> S (in AIMAH1, pituitary tumor and polyostotic fibrous dysplasia). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:8766942, ECO:0000269|PubMed:9267696}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R201H(81)|p.R844H(4)|p.R201L(2)|p.R844L(1)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CTTCGCTGCCGTGTCCTGACT	0.423			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	88	Substitution - Missense(88)	pancreas(28)|large_intestine(19)|thyroid(12)|pituitary(12)|liver(6)|biliary_tract(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|stomach(1)|small_intestine(1)|ovary(1)											80.0	78.0	79.0					20																	57484421		2203	4300	6503	SO:0001583	missense	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.602G>A	20.37:g.57484421G>A	ENSP00000360126:p.Arg201His		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_S,prints_Gprotein_alpha_su	p.R202H	ENST00000371085.3	37	c.605	CCDS13472.1	20	.	.	.	.	.	.	.	.	.	.	G	35	5.430570	0.96150	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	D;D;D;D;D;D;D	0.99458	-5.93;-5.93;-5.93;-5.93;-5.93;-2.96;-5.93	5.53	5.53	0.82687	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.99799	0.9914	H	0.98965	4.385	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.994;0.983;1.0	D	0.96812	0.9597	10	0.87932	D	0	.	19.4606	0.94915	0.0:0.0:1.0:0.0	.	201;202;186;844	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	H	844;830;187;201;202;186;187	ENSP00000360141:R844H;ENSP00000360143:R830H;ENSP00000360136:R187H;ENSP00000360126:R201H;ENSP00000346328:R202H;ENSP00000265620:R186H;ENSP00000304472:R187H	ENSP00000265620:R186H	R	+	2	0	GNAS	56917816	1.000000	0.71417	0.963000	0.40424	0.936000	0.57629	9.291000	0.96070	2.596000	0.87737	0.563000	0.77884	CGT	GNAS	-	pfam_Gprotein_alpha_su,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su	ENSG00000087460		0.423	GNAS-015	KNOWN	basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080431.2	-	0.00	68	0	G	NM_000516		57484421	+1	tier1	rs121913495	no_errors	ENST00000354359	ensembl	human	known	74_37	missense	46.97	34	31	SNP	1.000	A
GMEB2	26205	genome.wustl.edu	37	20	62250679	62250679	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr20:62250679G>A	ENST00000266068.1	-	1	550	c.72C>T	c.(70-72)gaC>gaT	p.D24D	GMEB2_ENST00000370077.1_Silent_p.D24D			Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding protein 2	24				DGSGVEGVKTVLVTTNLAPHG -> CPAGCALRDPDSILSS LHFTR (in Ref. 6). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	18	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)			CACCACTGCCGTCCACTGCAG	0.647																																																	0													160.0	93.0	115.0					20																	62250679		2203	4300	6503	SO:0001819	synonymous_variant	0			AF173867	CCDS13528.1	20q13.33	2008-07-02			ENSG00000101216	ENSG00000101216			4371	protein-coding gene	gene with protein product		607451				10523663, 11743720	Standard	NM_012384		Approved	P79PIF, KIAA1269, PIF79	uc002yfq.1	Q9UKD1	OTTHUMG00000032988	ENST00000266068.1:c.72C>T	20.37:g.62250679G>A			E1P5J3|Q5TDS0|Q9H431|Q9H4X7|Q9H4X8|Q9UF78|Q9ULF1	Silent	SNP	pfam_SAND_dom,superfamily_SAND_dom-like,superfamily_Sig_transdc_His_kin_Hpt_dom,smart_SAND_dom,pfscan_SAND_dom	p.D24	ENST00000266068.1	37	c.72	CCDS13528.1	20																																																																																			GMEB2	-	NULL	ENSG00000101216		0.647	GMEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMEB2	HGNC	protein_coding	OTTHUMT00000080166.1	-	0.00	101	0	G	NM_012384		62250679	-1	tier1	-	no_errors	ENST00000266068	ensembl	human	known	74_37	silent	40.00	27	18	SNP	0.297	A
GPAA1	8733	genome.wustl.edu	37	8	145138344	145138344	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr8:145138344G>A	ENST00000355091.4	+	3	428	c.307G>A	c.(307-309)Gtc>Atc	p.V103I	GPAA1_ENST00000361036.6_Missense_Mutation_p.V43I|GPAA1_ENST00000527144.1_3'UTR	NM_003801.3	NP_003792.1	O43292	GPAA1_HUMAN	glycosylphosphatidylinositol anchor attachment 1	103					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein complex assembly (GO:0006461)|protein retention in ER lumen (GO:0006621)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	tubulin binding (GO:0015631)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(2)	19	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.02e-40)|all cancers(56;2.11e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			AGGGCTGGAGGTCTACACGCA	0.627																																																	0													60.0	64.0	62.0					8																	145138344		2023	4174	6197	SO:0001583	missense	0			AB006969	CCDS43776.1	8q24.3	2012-12-10	2012-12-10		ENSG00000197858	ENSG00000197858			4446	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	603048	"""anchor attachment protein 1 (Gaa1p, yeast) homolog"", ""GPAA1P anchor attachment protein 1 homolog (yeast)"", ""glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast)"""			9828142	Standard	NM_003801		Approved	GAA1, hGAA1	uc003zax.3	O43292	OTTHUMG00000165438	ENST00000355091.4:c.307G>A	8.37:g.145138344G>A	ENSP00000347206:p.Val103Ile		Q9NSS0|Q9UQ31	Missense_Mutation	SNP	pfam_Gaa1,pirsf_GPI_prot_transamidse_cplx_GAA1	p.V103I	ENST00000355091.4	37	c.307	CCDS43776.1	8	.	.	.	.	.	.	.	.	.	.	G	34	5.332563	0.95733	.	.	ENSG00000197858	ENST00000355091;ENST00000361036;ENST00000524418;ENST00000530258	.	.	.	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.77765	0.4179	M	0.72894	2.215	0.58432	D	0.999999	D;D	0.67145	0.993;0.996	P;D	0.77557	0.708;0.99	T	0.77493	-0.2567	9	0.42905	T	0.14	-42.2124	16.3831	0.83481	0.0:0.0:1.0:0.0	.	103;43	O43292;O43292-2	GPAA1_HUMAN;.	I	103;43;103;54	.	ENSP00000347206:V103I	V	+	1	0	GPAA1	145210332	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.901000	0.75693	2.462000	0.83206	0.561000	0.74099	GTC	GPAA1	-	pirsf_GPI_prot_transamidse_cplx_GAA1	ENSG00000197858		0.627	GPAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAA1	HGNC	protein_coding	OTTHUMT00000384070.1	-	0.00	110	0	G	NM_003801		145138344	+1	tier1	-	no_errors	ENST00000355091	ensembl	human	known	74_37	missense	15.20	105	19	SNP	1.000	A
GPR149	344758	genome.wustl.edu	37	3	154139187	154139187	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:154139187C>T	ENST00000389740.2	-	3	1363	c.1264G>A	c.(1264-1266)Gaa>Aaa	p.E422K		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	422					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			ATGGAATTTTCATCATCATCA	0.323																																																	0													88.0	83.0	84.0					3																	154139187		1835	4094	5929	SO:0001583	missense	0			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.1264G>A	3.37:g.154139187C>T	ENSP00000374390:p.Glu422Lys			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.E422K	ENST00000389740.2	37	c.1264	CCDS43162.1	3	.	.	.	.	.	.	.	.	.	.	C	13.85	2.361614	0.41801	.	.	ENSG00000174948	ENST00000389740	.	.	.	4.56	2.69	0.31865	.	0.516231	0.21113	N	0.079941	T	0.40743	0.1129	L	0.60455	1.87	0.27603	N	0.948913	B	0.09022	0.002	B	0.08055	0.003	T	0.41324	-0.9515	9	0.87932	D	0	-6.11	6.7491	0.23477	0.0:0.6851:0.1479:0.167	.	422	Q86SP6	GP149_HUMAN	K	422	.	ENSP00000374390:E422K	E	-	1	0	GPR149	155621881	1.000000	0.71417	0.938000	0.37757	0.790000	0.44656	4.820000	0.62671	0.448000	0.26722	0.454000	0.30748	GAA	GPR149	-	NULL	ENSG00000174948		0.323	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR149	HGNC	protein_coding	OTTHUMT00000353430.1	-	0.00	12	0	C	XM_293580		154139187	-1	tier1	-	no_errors	ENST00000389740	ensembl	human	known	74_37	missense	50.00	9	9	SNP	0.959	T
GPR98	84059	genome.wustl.edu	37	5	89981726	89981726	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:89981726G>C	ENST00000405460.2	+	29	6500	c.6404G>C	c.(6403-6405)gGa>gCa	p.G2135A		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2135	Calx-beta 15. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AATCATGTTGGACCCATTATC	0.408																																																	0													94.0	85.0	88.0					5																	89981726		1925	4135	6060	SO:0001583	missense	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.6404G>C	5.37:g.89981726G>C	ENSP00000384582:p.Gly2135Ala		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.G2135A	ENST00000405460.2	37	c.6404	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	G	29.2	4.986327	0.93044	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.26957	1.7	5.8	5.8	0.92144	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.48960	0.1529	L	0.52573	1.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.35943	-0.9768	10	0.59425	D	0.04	.	20.0503	0.97624	0.0:0.0:1.0:0.0	.	2135	Q8WXG9	GPR98_HUMAN	A	2135	ENSP00000384582:G2135A	ENSP00000296619:G2135A	G	+	2	0	GPR98	90017482	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.624000	0.98398	2.736000	0.93811	0.591000	0.81541	GGA	GPR98	-	pfam_Calx_beta,smart_Calx_beta	ENSG00000164199		0.408	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	-	0.00	37	0	G	NM_032119		89981726	+1	tier1	-	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	31.03	40	18	SNP	1.000	C
GRAMD2	196996	genome.wustl.edu	37	15	72456023	72456023	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:72456023G>C	ENST00000309731.7	-	9	689	c.676C>G	c.(676-678)Cct>Gct	p.P226A	GRAMD2_ENST00000564184.1_5'UTR	NM_001012642.2	NP_001012660.1	Q8IUY3	GRAM2_HUMAN	GRAM domain containing 2	226						integral component of membrane (GO:0016021)				cervix(2)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	13						GGGATACAAGGGATGTTGTCT	0.532																																																	0													126.0	105.0	112.0					15																	72456023		2199	4297	6496	SO:0001583	missense	0			AK002016	CCDS32283.1	15q23	2006-11-29	2005-11-03	2005-11-03					27287	protein-coding gene	gene with protein product						12477932	Standard	NM_001012642		Approved		uc002atq.3	Q8IUY3		ENST00000309731.7:c.676C>G	15.37:g.72456023G>C	ENSP00000311657:p.Pro226Ala		B3KT68	Missense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.P226A	ENST00000309731.7	37	c.676	CCDS32283.1	15	.	.	.	.	.	.	.	.	.	.	G	7.608	0.674124	0.14841	.	.	ENSG00000175318	ENST00000309731	T	0.34072	1.38	5.19	3.29	0.37713	.	0.567041	0.17818	N	0.160966	T	0.23451	0.0567	L	0.50333	1.59	0.09310	N	0.999999	P	0.39282	0.666	B	0.30179	0.112	T	0.13045	-1.0524	10	0.10636	T	0.68	.	8.1781	0.31294	0.1903:0.0:0.8097:0.0	.	226	Q8IUY3	GRAM2_HUMAN	A	226	ENSP00000311657:P226A	ENSP00000311657:P226A	P	-	1	0	GRAMD2	70243077	1.000000	0.71417	0.018000	0.16275	0.008000	0.06430	2.155000	0.42301	0.558000	0.29135	0.655000	0.94253	CCT	GRAMD2	-	NULL	ENSG00000175318		0.532	GRAMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD2	HGNC	protein_coding	OTTHUMT00000420040.1	-	0.00	33	0	G	NM_001012642		72456023	-1	tier1	-	no_errors	ENST00000309731	ensembl	human	known	74_37	missense	26.09	17	6	SNP	0.401	C
GRID1	2894	genome.wustl.edu	37	10	87966134	87966134	+	Silent	SNP	G	G	A	rs368572646		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:87966134G>A	ENST00000327946.7	-	3	592	c.507C>T	c.(505-507)taC>taT	p.Y169Y		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	169					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						ACTCGCTGTCGTAGAACATGA	0.622										Multiple Myeloma(13;0.14)			G|||	1	0.000199681	0.0	0.0	5008	,	,		19710	0.0		0.0	False		,,,				2504	0.001																0								G		0,4406		0,0,2203	100.0	78.0	85.0		507	-0.1	1.0	10		85	1,8599		0,1,4299	no	coding-synonymous	GRID1	NM_017551.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		169/1010	87966134	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.507C>T	10.37:g.87966134G>A			B3KXD5|B7Z7L0|Q8IXT3	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.Y169	ENST00000327946.7	37	c.507	CCDS31236.1	10																																																																																			GRID1	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000182771		0.622	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3	-	0.00	40	0	G	XM_043613		87966134	-1	tier1	-	no_errors	ENST00000327946	ensembl	human	known	74_37	silent	31.82	15	7	SNP	0.981	A
GRID2IP	392862	genome.wustl.edu	37	7	6537841	6537841	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:6537841G>T	ENST00000457091.2	-	21	3417	c.3418C>A	c.(3418-3420)Cag>Aag	p.Q1140K	GRID2IP_ENST00000452113.1_Missense_Mutation_p.Q949K|GRID2IP_ENST00000435185.1_Missense_Mutation_p.Q956K	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	1140	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						AGTGCTGGCTGGGCCGTCTCC	0.662																																																	0													18.0	19.0	19.0					7																	6537841		692	1591	2283	SO:0001583	missense	0				CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.3418C>A	7.37:g.6537841G>T	ENSP00000397351:p.Gln1140Lys			Missense_Mutation	SNP	pfam_FH2_Formin,pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_FH2_Formin,pfscan_PDZ	p.Q1140K	ENST00000457091.2	37	c.3418	CCDS47537.1	7	.	.	.	.	.	.	.	.	.	.	G	19.86	3.905386	0.72868	.	.	ENSG00000215045	ENST00000452113;ENST00000435185;ENST00000457091	T;T;T	0.15017	2.46;2.46;2.46	4.45	4.45	0.53987	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.075465	0.53938	U	0.000042	T	0.15652	0.0377	L	0.37630	1.12	0.46631	D	0.99913	B	0.29481	0.245	B	0.31946	0.138	T	0.05289	-1.0894	10	0.40728	T	0.16	.	12.9662	0.58485	0.0:0.0:1.0:0.0	.	1140	A4D2P6	GRD2I_HUMAN	K	949;956;1140	ENSP00000397887:Q949K;ENSP00000408364:Q956K;ENSP00000397351:Q1140K	ENSP00000408364:Q956K	Q	-	1	0	GRID2IP	6504366	1.000000	0.71417	0.988000	0.46212	0.892000	0.51952	7.488000	0.81441	2.204000	0.70986	0.462000	0.41574	CAG	GRID2IP	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000215045		0.662	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	GRID2IP	HGNC	protein_coding	OTTHUMT00000340534.1		0.00	140	0	G	XM_294249		6537841	-1			no_errors	ENST00000457091	ensembl	human	putative	74_37	missense	5.26	72	4	SNP	1.000	T
GRIK2	2898	genome.wustl.edu	37	6	101847189	101847189	+	Silent	SNP	C	C	A	rs370229898	byFrequency	TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:101847189C>A	ENST00000421544.1	+	1	526	c.36C>A	c.(34-36)gtC>gtA	p.V12V	GRIK2_ENST00000358361.3_Silent_p.V12V|GRIK2_ENST00000318991.6_Silent_p.V12V|GRIK2_ENST00000413795.1_Silent_p.V12V|GRIK2_ENST00000369137.3_Silent_p.V12V|GRIK2_ENST00000369138.1_Silent_p.V12V	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	12					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GTAATCCAGTCTTCAGGCGCA	0.478																																																	0													167.0	151.0	157.0					6																	101847189		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.36C>A	6.37:g.101847189C>A			A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.V12	ENST00000421544.1	37	c.36	CCDS5048.1	6																																																																																			GRIK2	-	NULL	ENSG00000164418		0.478	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK2	HGNC	protein_coding	OTTHUMT00000043718.1	-	0.00	56	0	C			101847189	+1	tier1	-	no_errors	ENST00000421544	ensembl	human	known	74_37	silent	45.24	23	19	SNP	1.000	A
GTF3C2	2976	genome.wustl.edu	37	2	27551709	27551709	+	Splice_Site	SNP	A	A	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:27551709A>G	ENST00000359541.2	-	15	2557		c.e15+1		GTF3C2_ENST00000264720.3_Splice_Site			Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide 2, beta 110kDa						5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)				central_nervous_system(4)|endometrium(6)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	38	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGGGGGCTCACCCAAACGGT	0.428																																																	0													52.0	53.0	53.0					2																	27551709		2203	4300	6503	SO:0001630	splice_region_variant	0			D13636	CCDS1749.1	2p23.3	2013-01-10	2002-08-29		ENSG00000115207	ENSG00000115207		"""General transcription factors"", ""WD repeat domain containing"""	4665	protein-coding gene	gene with protein product		604883	"""general transcription factor IIIC, polypeptide 2 (beta subunit, 110kD)"""			7729686	Standard	NM_001521		Approved	KIAA0011, TFIIIC110	uc002rjw.2	Q8WUA4	OTTHUMG00000097785	ENST00000359541.2:c.2127+1T>C	2.37:g.27551709A>G			D6W557|Q16632|Q9BWI7	Splice_Site	SNP	-	e14+2	ENST00000359541.2	37	c.2127+2	CCDS1749.1	2	.	.	.	.	.	.	.	.	.	.	A	15.49	2.849430	0.51270	.	.	ENSG00000115207	ENST00000359541;ENST00000457098;ENST00000264720;ENST00000454704;ENST00000415683	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8488	0.63483	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GTF3C2	27405213	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	7.954000	0.87848	2.226000	0.72624	0.459000	0.35465	.	GTF3C2	-	-	ENSG00000115207		0.428	GTF3C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C2	HGNC	protein_coding	OTTHUMT00000215028.2	-	0.00	41	0	A		Intron	27551709	-1	tier1	-	no_errors	ENST00000264720	ensembl	human	known	74_37	splice_site	29.79	33	14	SNP	1.000	G
GUCY2F	2986	genome.wustl.edu	37	X	108641818	108641818	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chrX:108641818G>A	ENST00000218006.2	-	11	2526	c.2235C>T	c.(2233-2235)gtC>gtT	p.V745V		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	745	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						GGGTACCCCGGACCATCACTT	0.542																																																	0													105.0	86.0	92.0					X																	108641818		2203	4300	6503	SO:0001819	synonymous_variant	0			L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.2235C>T	X.37:g.108641818G>A			Q9UJF1	Silent	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Haem_no_assoc-bd,superfamily_Peripla_BP_I,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.V745	ENST00000218006.2	37	c.2235	CCDS14545.1	X																																																																																			GUCY2F	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000101890		0.542	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2F	HGNC	protein_coding	OTTHUMT00000057884.1	-	0.00	15	0	G	NM_001522		108641818	-1	tier1	-	no_errors	ENST00000218006	ensembl	human	known	74_37	silent	88.00	3	22	SNP	1.000	A
HBP1	26959	genome.wustl.edu	37	7	106829747	106829747	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:106829747C>T	ENST00000222574.4	+	7	962	c.776C>T	c.(775-777)tCt>tTt	p.S259F	HBP1_ENST00000485846.1_Missense_Mutation_p.S259F|HBP1_ENST00000461963.1_Intron|HBP1_ENST00000468410.1_Missense_Mutation_p.S259F	NM_012257.3	NP_036389.2	O60381	HBP1_HUMAN	HMG-box transcription factor 1	259	AXH. {ECO:0000255|PROSITE- ProRule:PRU00496}.				cell cycle arrest (GO:0007050)|positive regulation of potassium ion transport (GO:0043268)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			large_intestine(4)|lung(3)|prostate(1)|skin(2)	10						GGCTATGGTTCTGATGGTCTA	0.363																																																	0													181.0	155.0	164.0					7																	106829747		2203	4300	6503	SO:0001583	missense	0			BC017069	CCDS5741.1	7q22-q31	2003-10-08			ENSG00000105856	ENSG00000105856			23200	protein-coding gene	gene with protein product						9030690, 11500377	Standard	NM_001244262		Approved		uc011klv.2	O60381	OTTHUMG00000157642	ENST00000222574.4:c.776C>T	7.37:g.106829747C>T	ENSP00000222574:p.Ser259Phe		B3KVB7|Q8TBM1|Q8TE93|Q96AJ2	Missense_Mutation	SNP	pfam_Ataxin-1_HBP1,pfam_HMG_box_dom,superfamily_Ataxin-1_HBP1,superfamily_HMG_box_dom,smart_Ataxin_AXH_dom,smart_HMG_box_dom,pfscan_Ataxin-1_HBP1,pfscan_HMG_box_dom	p.S259F	ENST00000222574.4	37	c.776	CCDS5741.1	7	.	.	.	.	.	.	.	.	.	.	C	25.1	4.602519	0.87157	.	.	ENSG00000105856	ENST00000468410;ENST00000222574;ENST00000485846;ENST00000498408	D;D;D	0.99277	-5.67;-5.67;-5.67	5.94	5.94	0.96194	Ataxin, AXH domain (1);Ataxin-1/HBP1 module (AXH) (3);	0.000000	0.85682	D	0.000000	D	0.99408	0.9791	M	0.77820	2.39	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.74348	0.983;0.963;0.978	D	0.99486	1.0949	10	0.87932	D	0	-5.4957	20.3736	0.98901	0.0:1.0:0.0:0.0	.	269;259;259	B4DJ36;O60381-3;O60381	.;.;HBP1_HUMAN	F	259;259;259;251	ENSP00000420500:S259F;ENSP00000222574:S259F;ENSP00000418738:S259F	ENSP00000222574:S259F	S	+	2	0	HBP1	106616983	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.862000	0.69560	2.820000	0.97059	0.650000	0.86243	TCT	HBP1	-	pfam_Ataxin-1_HBP1,superfamily_Ataxin-1_HBP1,smart_Ataxin_AXH_dom,pfscan_Ataxin-1_HBP1	ENSG00000105856		0.363	HBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBP1	HGNC	protein_coding	OTTHUMT00000349297.1	-	0.00	57	0	C	NM_012257		106829747	+1	tier1	-	no_errors	ENST00000222574	ensembl	human	known	74_37	missense	10.71	75	9	SNP	1.000	T
HDLBP	3069	genome.wustl.edu	37	2	242181874	242181874	+	Splice_Site	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:242181874C>A	ENST00000391975.1	-	17	2397		c.e17+1		HDLBP_ENST00000427183.2_Splice_Site|AC104841.1_ENST00000578965.1_RNA|HDLBP_ENST00000391976.2_Splice_Site|HDLBP_ENST00000310931.4_Splice_Site	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein						cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		CCCATGCTCACCTTCTCCTCC	0.577																																																	0													52.0	43.0	46.0					2																	242181874		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.2169+1G>T	2.37:g.242181874C>A			B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Splice_Site	SNP	-	e15+1	ENST00000391975.1	37	c.2169+1	CCDS2547.1	2	.	.	.	.	.	.	.	.	.	.	C	13.52	2.261686	0.39995	.	.	ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183;ENST00000373292;ENST00000427487;ENST00000452931	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3001	0.90160	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HDLBP	241830547	1.000000	0.71417	1.000000	0.80357	0.197000	0.23852	7.755000	0.85180	2.338000	0.79540	0.585000	0.79938	.	HDLBP	-	-	ENSG00000115677		0.577	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDLBP	HGNC	protein_coding	OTTHUMT00000257245.5		0.00	47	0	C	NM_203346	Intron	242181874	-1			no_errors	ENST00000310931	ensembl	human	known	74_37	splice_site	5.41	35	2	SNP	1.000	A
HDX	139324	genome.wustl.edu	37	X	83724053	83724053	+	Silent	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chrX:83724053C>A	ENST00000297977.5	-	3	789	c.678G>T	c.(676-678)ggG>ggT	p.G226G	HDX_ENST00000506585.2_Silent_p.G168G|HDX_ENST00000373177.2_Silent_p.G226G	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	226						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						ACCTTTGAATCCCAACTGGTT	0.408																																					Pancreas(53;231 1169 36156 43751 51139)												0													133.0	116.0	122.0					X																	83724053		2203	4300	6503	SO:0001819	synonymous_variant	0			BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.678G>T	X.37:g.83724053C>A			A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.G226	ENST00000297977.5	37	c.678	CCDS35342.1	X																																																																																			HDX	-	NULL	ENSG00000165259		0.408	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HDX	HGNC	protein_coding	OTTHUMT00000057379.2	-	0.00	19	0	C	NM_144657		83724053	-1	tier1	-	no_errors	ENST00000297977	ensembl	human	known	74_37	silent	82.14	5	23	SNP	0.997	A
HELB	92797	genome.wustl.edu	37	12	66718883	66718883	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:66718883G>A	ENST00000247815.4	+	11	2706	c.2647G>A	c.(2647-2649)Gca>Aca	p.A883T		NM_033647.3	NP_387467.2	Q8NG08	HELB_HUMAN	helicase (DNA) B	883					DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication, synthesis of RNA primer (GO:0006269)		ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|single-stranded DNA-dependent ATP-dependent DNA helicase activity (GO:0017116)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	40			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		ACATGCATGGGCAAGAACTAT	0.338																																																	0													102.0	102.0	102.0					12																	66718883		2203	4300	6503	SO:0001583	missense	0			AF319995	CCDS8976.1	12q14.2	2009-01-15			ENSG00000127311	ENSG00000127311			17196	protein-coding gene	gene with protein product		614539				12181327	Standard	NM_033647		Approved		uc001sti.3	Q8NG08	OTTHUMG00000169006	ENST00000247815.4:c.2647G>A	12.37:g.66718883G>A	ENSP00000247815:p.Ala883Thr		A8K4C9|Q4G0T2|Q9H7L5	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.A883T	ENST00000247815.4	37	c.2647	CCDS8976.1	12	.	.	.	.	.	.	.	.	.	.	G	21.0	4.080044	0.76528	.	.	ENSG00000127311	ENST00000247815	T	0.35789	1.29	5.42	4.51	0.55191	.	0.000000	0.85682	D	0.000000	T	0.62392	0.2424	M	0.85041	2.73	0.45161	D	0.998176	D	0.69078	0.997	D	0.68943	0.961	T	0.66925	-0.5800	9	.	.	.	-25.4639	15.1946	0.73078	0.0715:0.0:0.9285:0.0	.	883	Q8NG08	HELB_HUMAN	T	883	ENSP00000247815:A883T	.	A	+	1	0	HELB	65005150	1.000000	0.71417	1.000000	0.80357	0.576000	0.36127	7.704000	0.84595	2.711000	0.92665	0.609000	0.83330	GCA	HELB	-	superfamily_P-loop_NTPase	ENSG00000127311		0.338	HELB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELB	HGNC	protein_coding	OTTHUMT00000401919.1		0.00	68	0	G			66718883	+1			no_errors	ENST00000247815	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	A
HERC2	8924	genome.wustl.edu	37	15	28441632	28441632	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:28441632C>G	ENST00000261609.7	-	51	8203	c.8095G>C	c.(8095-8097)Gta>Cta	p.V2699L		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ATACTGGGTACCAACTCCATT	0.408																																																	0													107.0	106.0	107.0					15																	28441632		2203	4300	6503	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.8095G>C	15.37:g.28441632C>G	ENSP00000261609:p.Val2699Leu			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.V2699L	ENST00000261609.7	37	c.8095	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	C	17.30	3.354037	0.61293	.	.	ENSG00000128731	ENST00000261609	T	0.44482	0.92	5.3	5.3	0.74995	.	0.139056	0.47093	D	0.000244	T	0.59582	0.2204	L	0.49350	1.555	0.80722	D	1	D;D	0.64830	0.994;0.984	D;D	0.70716	0.97;0.956	T	0.53129	-0.8482	10	0.33940	T	0.23	.	19.3101	0.94184	0.0:1.0:0.0:0.0	.	166;2699	A8KAQ8;O95714	.;HERC2_HUMAN	L	2699	ENSP00000261609:V2699L	ENSP00000261609:V2699L	V	-	1	0	HERC2	26115227	1.000000	0.71417	1.000000	0.80357	0.035000	0.12851	6.051000	0.71072	2.649000	0.89929	0.484000	0.47621	GTA	HERC2	-	NULL	ENSG00000128731		0.408	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	-	0.00	104	0	C	NM_004667		28441632	-1	tier1	-	no_errors	ENST00000261609	ensembl	human	known	74_37	missense	34.39	103	54	SNP	1.000	G
HIPK1	204851	genome.wustl.edu	37	1	114508756	114508756	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:114508756C>T	ENST00000369558.1	+	11	2475	c.2243C>T	c.(2242-2244)gCg>gTg	p.A748V	HIPK1_ENST00000340480.4_Missense_Mutation_p.A374V|HIPK1_ENST00000406344.1_Missense_Mutation_p.A354V|HIPK1_ENST00000369561.4_Missense_Mutation_p.A714V|HIPK1_ENST00000369554.2_Missense_Mutation_p.A703V|HIPK1_ENST00000369553.1_Missense_Mutation_p.A354V|HIPK1_ENST00000369555.2_Missense_Mutation_p.A703V|HIPK1_ENST00000426820.2_Missense_Mutation_p.A748V|HIPK1_ENST00000369559.4_Missense_Mutation_p.A748V			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	748					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTACAGCAGGCGTGGCCTGGA	0.418																																																	0													92.0	85.0	87.0					1																	114508756		2203	4300	6503	SO:0001583	missense	0			AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.2243C>T	1.37:g.114508756C>T	ENSP00000358571:p.Ala748Val		A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A748V	ENST00000369558.1	37	c.2243	CCDS867.1	1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.612914	0.87258	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000340480;ENST00000369553;ENST00000406344	T;T;T;T;T;T;T;T;T;T	0.60548	0.24;0.18;0.31;0.48;0.48;0.31;0.24;3.34;2.43;2.43	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000001	T	0.61999	0.2392	L	0.29908	0.895	0.80722	D	1	D;D;D;P	0.89917	1.0;1.0;0.996;0.89	D;D;P;B	0.87578	0.998;0.95;0.716;0.364	T	0.61559	-0.7038	10	0.46703	T	0.11	.	20.0991	0.97865	0.0:1.0:0.0:0.0	.	40;354;748;748	E9PCF6;Q86Z02-4;Q86Z02;Q86Z02-2	.;.;HIPK1_HUMAN;.	V	819;748;748;703;703;748;714;374;354;354	ENSP00000407442:A819V;ENSP00000358572:A748V;ENSP00000409673:A748V;ENSP00000358567:A703V;ENSP00000358568:A703V;ENSP00000358571:A748V;ENSP00000358574:A714V;ENSP00000340956:A374V;ENSP00000358566:A354V;ENSP00000384960:A354V	ENSP00000340956:A374V	A	+	2	0	HIPK1	114310279	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.400000	0.52594	2.752000	0.94435	0.655000	0.94253	GCG	HIPK1	-	NULL	ENSG00000163349		0.418	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HIPK1	HGNC	protein_coding	OTTHUMT00000033127.1		0.00	54	0	C	NM_198268		114508756	+1			no_errors	ENST00000369558	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
HIST1H4E	8367	genome.wustl.edu	37	6	26204991	26204991	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:26204991G>C	ENST00000360441.4	+	1	134	c.119G>C	c.(118-120)cGt>cCt	p.R40P		NM_003545.3	NP_003536.1	P62805	H4_HUMAN	histone cluster 1, H4e	40					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	18		all_hematologic(11;0.196)				CGCCTTGCTCGTCGCGGGGGT	0.567																																																	0													86.0	86.0	86.0					6																	26204991		2203	4300	6503	SO:0001583	missense	0			Z80787	CCDS4593.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198518	ENSG00000276966		"""Histones / Replication-dependent"""	4790	protein-coding gene	gene with protein product		602830	"""H4 histone family, member J"", ""histone 1, H4e"""	H4FJ		9119399, 12408966	Standard	NM_003545		Approved	H4/j	uc003ngy.3	P62805	OTTHUMG00000014441	ENST00000360441.4:c.119G>C	6.37:g.26204991G>C	ENSP00000353624:p.Arg40Pro		A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.R40P	ENST00000360441.4	37	c.119	CCDS4593.1	6	.	.	.	.	.	.	.	.	.	.	.	14.96	2.691642	0.48097	.	.	ENSG00000198518	ENST00000360441	T	0.77358	-1.09	2.2	2.2	0.27929	.	0.000000	0.64402	U	0.000001	T	0.78786	0.4338	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.82261	-0.0545	7	0.87932	D	0	.	12.403	0.55424	0.0:0.0:1.0:0.0	.	.	.	.	P	40	ENSP00000353624:R40P	ENSP00000353624:R40P	R	+	2	0	HIST1H4E	26312970	1.000000	0.71417	0.719000	0.30619	0.023000	0.10783	7.254000	0.78329	1.521000	0.48983	0.655000	0.94253	CGT	HIST1H4E	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	ENSG00000198518		0.567	HIST1H4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4E	HGNC	protein_coding	OTTHUMT00000040104.1	-	0.00	94	0	G	NM_003545		26204991	+1	tier1	-	no_errors	ENST00000360441	ensembl	human	known	74_37	missense	32.43	50	24	SNP	1.000	C
HLA-B	3106	genome.wustl.edu	37	6	31322980	31322980	+	Missense_Mutation	SNP	C	C	A	rs1131500	byFrequency	TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:31322980C>A	ENST00000412585.2	-	5	944	c.916G>T	c.(916-918)Gtc>Ttc	p.V306F		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	306	Connecting peptide.		V -> I (in dbSNP:rs1131500).		antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						ACGATGGGGACGGTGGACTGG	0.587									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																																								0													73.0	74.0	74.0					6																	31322980		1511	2709	4220	SO:0001583	missense	0	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.916G>T	6.37:g.31322980C>A	ENSP00000399168:p.Val306Phe		Q29764	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom,prints_MHC_I_a	p.V306F	ENST00000412585.2	37	c.916	CCDS34394.1	6	.	.	.	.	.	.	.	.	.	.	N	8.327	0.825574	0.16749	.	.	ENSG00000234745	ENST00000412585;ENST00000428231	T	0.00638	6.04	3.69	-3.9	0.04181	Immunoglobulin-like fold (1);	2.155470	0.02842	U	0.128113	T	0.00666	0.0022	M	0.91196	3.185	0.09310	N	1	P	0.38767	0.646	B	0.43301	0.415	T	0.25152	-1.0140	10	0.87932	D	0	.	3.0764	0.06248	0.1483:0.4867:0.1499:0.2152	.	306	P01889	1B07_HUMAN	F	306;185	ENSP00000399168:V306F	ENSP00000399168:V306F	V	-	1	0	HLA-B	31430959	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-1.343000	0.02642	-0.635000	0.05531	-0.570000	0.04155	GTC	HLA-B	-	NULL	ENSG00000234745		0.587	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-B	HGNC	protein_coding	OTTHUMT00000076280.4	-	0.00	107	0	C	NM_005514		31322980	-1	tier1	-	no_errors	ENST00000412585	ensembl	human	known	74_37	missense	35.23	56	31	SNP	0.000	A
HLA-DOA	3111	genome.wustl.edu	37	6	32975251	32975251	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:32975251G>A	ENST00000229829.5	-	3	525	c.450C>T	c.(448-450)aaC>aaT	p.N150N	HLA-DOA_ENST00000495532.1_5'UTR|HLA-DOA_ENST00000450833.2_Silent_p.N120N	NM_002119.3	NP_002110.1	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO alpha	150	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|negative regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002587)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)	p.N150N(1)		NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)	9						CAGTTTGGCCGTTGCGCAGCC	0.587																																																	1	Substitution - coding silent(1)	large_intestine(1)											184.0	173.0	177.0					6																	32975251		1511	2709	4220	SO:0001819	synonymous_variant	0			M31525	CCDS4763.1	6p21.3	2013-01-11		2001-10-05	ENSG00000204252	ENSG00000204252		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4936	protein-coding gene	gene with protein product		142930		HLA-DZA, HLA-DNA		2370084	Standard	XM_005272804		Approved	HLA-D0-alpha	uc003ocr.3	P06340	OTTHUMG00000031211	ENST00000229829.5:c.450C>T	6.37:g.32975251G>A			Q58HU0|Q58HU1|Q5STC7|Q9TQC6|Q9TQC7|Q9TQC8|Q9TQC9|Q9TQD0|Q9TQD1|Q9TQD2|Q9TQD3	Silent	SNP	pfam_MHC_II_a_N,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.N150	ENST00000229829.5	37	c.450	CCDS4763.1	6																																																																																			HLA-DOA	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like_dom	ENSG00000204252		0.587	HLA-DOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DOA	HGNC	protein_coding	OTTHUMT00000076426.2	-	0.00	91	0	G	NM_002119		32975251	-1	tier1	-	no_errors	ENST00000229829	ensembl	human	known	74_37	silent	37.93	36	22	SNP	0.823	A
HMMR	3161	genome.wustl.edu	37	5	162917425	162917426	+	Frame_Shift_Ins	INS	-	-	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:162917425_162917426insA	ENST00000358715.3	+	17	2025_2026	c.1989_1990insA	c.(1990-1992)aaafs	p.K664fs	HMMR_ENST00000393915.4_Frame_Shift_Ins_p.K665fs|HMMR_ENST00000432118.2_Frame_Shift_Ins_p.K578fs|RP11-80G7.1_ENST00000521666.1_RNA|RP11-80G7.1_ENST00000514724.2_RNA|HMMR_ENST00000353866.3_Frame_Shift_Ins_p.K649fs			O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor (RHAMM)	664	Hyaluronic acid-binding. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)			cervix(1)|kidney(3)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	23	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	Hyaluronan(DB08818)	GTCAGCTTGCTAAAAAAAAACA	0.307																																																	0																																										SO:0001589	frameshift_variant	0			U29343	CCDS4362.1, CCDS4363.1, CCDS47334.1, CCDS47335.1	5q34	2013-09-19			ENSG00000072571	ENSG00000072571		"""CD molecules"""	5012	protein-coding gene	gene with protein product		600936					Standard	NM_001142556		Approved	RHAMM, CD168	uc003lzh.3	O75330	OTTHUMG00000130381	ENST00000358715.3:c.1998dupA	5.37:g.162917434_162917434dupA	ENSP00000351554:p.Lys664fs		A8K3G2|B4E114|D3DQK9|D3DQL0|E9PCS0|Q32N02|Q92767	Frame_Shift_Ins	INS	NULL	p.Q667fs	ENST00000358715.3	37	c.1992_1993	CCDS4362.1	5																																																																																			HMMR	-	NULL	ENSG00000072571		0.307	HMMR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HMMR	HGNC	protein_coding	OTTHUMT00000252752.1		0.00	46	0	0	NM_012484		162917426	+1			no_errors	ENST00000393915	ensembl	human	known	74_37	frame_shift_ins	11.39	70	9	INS	0.976:1.000	A
HNF4A	3172	genome.wustl.edu	37	20	43057081	43057081	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr20:43057081C>T	ENST00000316099.4	+	9	1325	c.1236C>T	c.(1234-1236)ctC>ctT	p.L412L	HNF4A_ENST00000457232.1_Silent_p.L390L|HNF4A_ENST00000316673.4_Silent_p.L390L|HNF4A_ENST00000415691.2_Silent_p.L412L	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	412					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CCACTCACCTCAGCAACGGAC	0.582																																					Colon(79;2 1269 8820 14841 52347)												0													96.0	67.0	77.0					20																	43057081		2203	4300	6503	SO:0001819	synonymous_variant	0			X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.1236C>T	20.37:g.43057081C>T			A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF,prints_Retinoid-X_rcpt/HNF4	p.L412	ENST00000316099.4	37	c.1236	CCDS13330.1	20																																																																																			HNF4A	-	NULL	ENSG00000101076		0.582	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF4A	HGNC	protein_coding	OTTHUMT00000079363.3	-	0.00	50	0	C			43057081	+1	tier1	-	no_errors	ENST00000316099	ensembl	human	known	74_37	silent	14.71	29	5	SNP	1.000	T
HOXA2	3199	genome.wustl.edu	37	7	27140789	27140789	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:27140789C>G	ENST00000222718.5	-	2	997	c.687G>C	c.(685-687)gaG>gaC	p.E229D	HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000428939.3_RNA|HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000593300.1_RNA|HOTAIRM1_ENST00000429611.3_RNA	NM_006735.3	NP_006726.1	O43364	HXA2_HUMAN	homeobox A2	229					anterior/posterior pattern specification (GO:0009952)|brain segmentation (GO:0035284)|cell fate determination (GO:0001709)|dorsal/ventral pattern formation (GO:0009953)|embryonic viscerocranium morphogenesis (GO:0048703)|middle ear morphogenesis (GO:0042474)|motor neuron axon guidance (GO:0008045)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoblast development (GO:0002076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|rhombomere 2 development (GO:0021568)|rhombomere 3 morphogenesis (GO:0021658)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|cervix(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	22						AGAGCGTCTTCTCTTCCTCGT	0.527																																																	0													118.0	106.0	110.0					7																	27140789		2203	4300	6503	SO:0001583	missense	0				CCDS5403.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105996	ENSG00000105996		"""Homeoboxes / ANTP class : HOXL subclass"""	5103	protein-coding gene	gene with protein product		604685	"""homeo box A2"""	HOX1K		1358459	Standard	NM_006735		Approved		uc003syh.3	O43364	OTTHUMG00000023208	ENST00000222718.5:c.687G>C	7.37:g.27140789C>G	ENSP00000222718:p.Glu229Asp		A1L4K3|B2RMW3	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.E229D	ENST00000222718.5	37	c.687	CCDS5403.1	7	.	.	.	.	.	.	.	.	.	.	C	9.542	1.113548	0.20795	.	.	ENSG00000105996	ENST00000222718	T	0.09630	2.96	5.45	4.57	0.56435	.	0.000000	0.56097	D	0.000030	T	0.09247	0.0228	L	0.31926	0.97	0.43729	D	0.99621	B	0.09022	0.002	B	0.09377	0.004	T	0.15464	-1.0436	10	0.19147	T	0.46	.	13.8612	0.63561	0.0:0.9261:0.0:0.0739	.	229	O43364	HXA2_HUMAN	D	229	ENSP00000222718:E229D	ENSP00000222718:E229D	E	-	3	2	HOXA2	27107314	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.820000	0.69250	1.437000	0.47472	0.655000	0.94253	GAG	HOXA2	-	NULL	ENSG00000105996		0.527	HOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA2	HGNC	protein_coding	OTTHUMT00000358508.2		0.00	22	0	C			27140789	-1			no_errors	ENST00000222718	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	G
HSP90AB1	3326	genome.wustl.edu	37	6	44217808	44217811	+	Frame_Shift_Del	DEL	CAGA	CAGA	-			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	CAGA	CAGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:44217808_44217811delCAGA	ENST00000371554.1	+	5	779_782	c.565_568delCAGA	c.(565-570)cagacafs	p.QT189fs	HSP90AB1_ENST00000353801.3_Frame_Shift_Del_p.QT189fs|HSP90AB1_ENST00000371646.5_Frame_Shift_Del_p.QT189fs			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	189					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TAAAGAAGATCAGACAGAGTACCT	0.422																																																	0																																										SO:0001589	frameshift_variant	0			AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.565_568delCAGA	6.37:g.44217812_44217815delCAGA	ENSP00000360609:p.Gln189fs		B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Frame_Shift_Del	DEL	pfam_Hsp90_fam,pfam_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HATPase_ATP-bd,smart_HATPase_ATP-bd,pirsf_Hsp90_fam,prints_Hsp90_N	p.T190fs	ENST00000371554.1	37	c.565_568	CCDS4909.1	6																																																																																			HSP90AB1	-	superfamily_HATPase_ATP-bd,pirsf_Hsp90_fam,prints_Hsp90_N	ENSG00000096384		0.422	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HSP90AB1	HGNC	protein_coding	OTTHUMT00000040730.1		0.00	46	0	CAGA	NM_007355		44217811	+1	tier1		no_errors	ENST00000353801	ensembl	human	known	74_37	frame_shift_del	18.75	52	12	DEL	1.000:1.000:1.000:1.000	-
HUNK	30811	genome.wustl.edu	37	21	33370907	33370907	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr21:33370907G>T	ENST00000270112.2	+	11	1915	c.1555G>T	c.(1555-1557)Gag>Tag	p.E519*		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	519					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						TTCTTCCATGGAGTTCATCCC	0.537																																																	0													110.0	104.0	106.0					21																	33370907		2203	4300	6503	SO:0001587	stop_gained	0			AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.1555G>T	21.37:g.33370907G>T	ENSP00000270112:p.Glu519*			Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E519*	ENST00000270112.2	37	c.1555	CCDS13610.1	21	.	.	.	.	.	.	.	.	.	.	G	41	8.971257	0.99021	.	.	ENSG00000142149	ENST00000270112	.	.	.	4.55	4.55	0.56014	.	0.058430	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-27.7318	17.5126	0.87764	0.0:0.0:1.0:0.0	.	.	.	.	X	519	.	ENSP00000270112:E519X	E	+	1	0	HUNK	32292778	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	6.186000	0.72026	2.352000	0.79861	0.491000	0.48974	GAG	HUNK	-	NULL	ENSG00000142149		0.537	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUNK	HGNC	protein_coding	OTTHUMT00000192782.1	-	0.00	48	0	G	NM_014586		33370907	+1	tier1	-	no_errors	ENST00000270112	ensembl	human	known	74_37	nonsense	8.51	43	4	SNP	1.000	T
IFT140	9742	genome.wustl.edu	37	16	1621406	1621406	+	Splice_Site	SNP	A	A	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:1621406A>G	ENST00000426508.2	-	14	2016		c.e14+1		IFT140_ENST00000439987.2_Splice_Site	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140						cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				AAAAAAATTTACCTTCGGGAA	0.428																																																	0													46.0	47.0	47.0					16																	1621406		2199	4300	6499	SO:0001630	splice_region_variant	0			AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.1652+1T>C	16.37:g.1621406A>G			A2A2A8|D3DU75|O60332|Q9UG52	Splice_Site	SNP	-	e12+2	ENST00000426508.2	37	c.1652+2	CCDS10439.1	16	.	.	.	.	.	.	.	.	.	.	A	16.77	3.215028	0.58452	.	.	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7486	0.77967	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	IFT140	1561407	1.000000	0.71417	0.994000	0.49952	0.768000	0.43524	8.070000	0.89493	2.202000	0.70862	0.533000	0.62120	.	IFT140	-	-	ENSG00000187535		0.428	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT140	HGNC	protein_coding	OTTHUMT00000250438.2	-	0.00	102	0	A	NM_014714	Intron	1621406	-1	tier1	-	no_errors	ENST00000426508	ensembl	human	known	74_37	splice_site	42.53	49	37	SNP	1.000	G
HYDIN	54768	genome.wustl.edu	37	16	70897063	70897063	+	Missense_Mutation	SNP	G	G	A	rs201571332	byFrequency	TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:70897063G>A	ENST00000393567.2	-	68	11644	c.11494C>T	c.(11494-11496)Cgt>Tgt	p.R3832C		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3832					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.R3831S(2)|p.R3783S(2)|p.R3831C(1)|p.R3783C(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				AGCTGGACACGTCCTGAATTA	0.463													G|||	2	0.000399361	0.0	0.0	5008	,	,		17275	0.001		0.001	False		,,,				2504	0.0																6	Substitution - Missense(6)	lung(4)|endometrium(2)						G	CYS/ARG	0,3768		0,0,1884	64.0	58.0	60.0		11491	-0.0	0.2	16		60	5,8197		0,5,4096	yes	missense	HYDIN	NM_032821.2	180	0,5,5980	AA,AG,GG		0.061,0.0,0.0418	probably-damaging	3831/5121	70897063	5,11965	1884	4101	5985	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.11494C>T	16.37:g.70897063G>A	ENSP00000377197:p.Arg3832Cys		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_PapD-like	p.R3832C	ENST00000393567.2	37	c.11494	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	G	9.075	0.997889	0.19043	0.0	6.1E-4	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00892	5.57	5.36	-0.0206	0.13955	.	1.091040	0.07492	U	0.905798	T	0.00754	0.0025	N	0.08118	0	0.27332	N	0.956731	D	0.63046	0.992	B	0.42851	0.4	T	0.55711	-0.8098	10	0.56958	D	0.05	.	8.0021	0.30304	0.0:0.1037:0.3633:0.5331	.	3831	F8WD23	.	C	3832;3831	ENSP00000377197:R3832C	ENSP00000313052:R3831C	R	-	1	0	HYDIN	69454564	0.031000	0.19500	0.159000	0.22649	0.181000	0.23173	-0.081000	0.11321	0.104000	0.17725	0.511000	0.50034	CGT	HYDIN	-	NULL	ENSG00000157423		0.463	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	-	0.00	17	0	G			70897063	-1	tier1	rs201571332	no_errors	ENST00000393567	ensembl	human	putative	74_37	missense	32.00	17	8	SNP	0.043	A
IFT52	51098	genome.wustl.edu	37	20	42275603	42275603	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr20:42275603G>T	ENST00000373030.3	+	14	1424	c.1294G>T	c.(1294-1296)Gca>Tca	p.A432S	IFT52_ENST00000373039.4_Missense_Mutation_p.A432S|IFT52_ENST00000471199.1_3'UTR	NM_016004.2	NP_057088.2	Q9Y366	IFT52_HUMAN	intraflagellar transport 52	432					cilium morphogenesis (GO:0060271)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube formation (GO:0001841)|regulation of protein processing (GO:0070613)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)	protein C-terminus binding (GO:0008022)			endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AAGTGAAACAGCATTCCAGAA	0.348																																																	0													173.0	163.0	166.0					20																	42275603		2203	4300	6503	SO:0001583	missense	0			AF151811	CCDS33470.1	20q12-q13.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000101052	ENSG00000101052		"""Intraflagellar transport homologs"""	15901	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 9"", ""intraflagellar transport 52 homolog (Chlamydomonas)"""	C20orf9		10810093	Standard	NM_016004		Approved	CGI-53, NGD5, dJ1028D15.1, NGD2	uc002xkw.3	Q9Y366	OTTHUMG00000032513	ENST00000373030.3:c.1294G>T	20.37:g.42275603G>T	ENSP00000362121:p.Ala432Ser		B3KMA1|E1P5W9|Q5H8Z0|Q9H1G3|Q9H1G4|Q9H1H2	Missense_Mutation	SNP	pfam_ABC_transp_unknown	p.A432S	ENST00000373030.3	37	c.1294	CCDS33470.1	20	.	.	.	.	.	.	.	.	.	.	G	9.830	1.188055	0.21954	.	.	ENSG00000101052	ENST00000373030;ENST00000373039	.	.	.	4.93	2.91	0.33838	.	0.597033	0.15530	N	0.257552	T	0.15262	0.0368	N	0.02802	-0.49	0.20764	N	0.999855	B	0.06786	0.001	B	0.04013	0.001	T	0.19289	-1.0310	9	0.15499	T	0.54	0.5114	11.6266	0.51149	0.1613:0.0:0.8387:0.0	.	432	Q9Y366	IFT52_HUMAN	S	432	.	ENSP00000362121:A432S	A	+	1	0	IFT52	41709017	1.000000	0.71417	0.775000	0.31657	0.943000	0.58893	2.061000	0.41403	1.189000	0.43028	0.655000	0.94253	GCA	IFT52	-	NULL	ENSG00000101052		0.348	IFT52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT52	HGNC	protein_coding	OTTHUMT00000079317.1	-	0.00	56	0	G	NM_016004		42275603	+1	tier1	-	no_errors	ENST00000373030	ensembl	human	known	74_37	missense	6.41	73	5	SNP	0.869	T
IFT80	57560	genome.wustl.edu	37	3	160037578	160037578	+	Silent	SNP	T	T	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:160037578T>C	ENST00000326448.7	-	9	1359	c.927A>G	c.(925-927)caA>caG	p.Q309Q	IFT80_ENST00000483465.1_Silent_p.Q172Q|IFT80_ENST00000496589.1_Silent_p.Q172Q|RP11-432B6.3_ENST00000483754.1_Silent_p.Q480Q	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	309					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TTAATGTTACTTGAAAATTTT	0.383																																																	0													126.0	124.0	125.0					3																	160037578		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.927A>G	3.37:g.160037578T>C			B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Silent	SNP	pfam_WD40_repeat,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_WD40_repeat_dom,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_B-box,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q480	ENST00000326448.7	37	c.1440	CCDS3188.1	3																																																																																			RP11-432B6.3	-	superfamily_WD40_repeat_dom	ENSG00000248710		0.383	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT80	Clone_based_vega_gene	protein_coding	OTTHUMT00000352651.2	-	0.00	28	0	T	NM_020800		160037578	-1	tier1	-	no_errors	ENST00000483754	ensembl	human	known	74_37	silent	33.33	38	19	SNP	1.000	C
IFT88	8100	genome.wustl.edu	37	13	21265270	21265270	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr13:21265270G>A	ENST00000319980.6	+	28	2785	c.2458G>A	c.(2458-2460)Gat>Aat	p.D820N	IFT88_ENST00000382778.4_3'UTR|IFT88_ENST00000351808.5_Missense_Mutation_p.D811N|IFT88_ENST00000537103.1_Missense_Mutation_p.D792N	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	820					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		CGATGAGGATGATTTTGCTGA	0.383																																																	0													85.0	89.0	87.0					13																	21265270		2203	4300	6503	SO:0001583	missense	0			AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.2458G>A	13.37:g.21265270G>A	ENSP00000323580:p.Asp820Asn		A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat,smart_Sel1-like,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D820N	ENST00000319980.6	37	c.2458	CCDS31944.1	13	.	.	.	.	.	.	.	.	.	.	G	33	5.267016	0.95399	.	.	ENSG00000032742	ENST00000351808;ENST00000319980;ENST00000537103	T;T;T	0.76316	-1.01;-1.01;-1.01	5.56	5.56	0.83823	.	0.161114	0.53938	D	0.000051	T	0.80696	0.4672	M	0.62723	1.935	0.80722	D	1	B;P	0.46395	0.103;0.877	B;P	0.45829	0.025;0.494	T	0.83050	-0.0153	10	0.72032	D	0.01	-15.0186	19.1155	0.93336	0.0:0.0:1.0:0.0	.	792;820	F5H6C2;Q13099	.;IFT88_HUMAN	N	811;820;792	ENSP00000261632:D811N;ENSP00000323580:D820N;ENSP00000437719:D792N	ENSP00000323580:D820N	D	+	1	0	IFT88	20163270	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	8.949000	0.93012	2.598000	0.87819	0.655000	0.94253	GAT	IFT88	-	NULL	ENSG00000032742		0.383	IFT88-002	KNOWN	basic|CCDS	protein_coding	IFT88	HGNC	protein_coding	OTTHUMT00000044075.3	-	0.00	101	0	G	NM_006531		21265270	+1	tier1	-	no_errors	ENST00000319980	ensembl	human	known	74_37	missense	5.68	83	5	SNP	1.000	A
IGF1	3479	genome.wustl.edu	37	12	102813302	102813302	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:102813302C>A	ENST00000307046.8	-	3	568	c.387G>T	c.(385-387)atG>atT	p.M129I	IGF1_ENST00000392904.1_Missense_Mutation_p.M129I|IGF1_ENST00000424202.2_Missense_Mutation_p.M113I|IGF1_ENST00000456098.1_Missense_Mutation_p.M129I|IGF1_ENST00000337514.6_Missense_Mutation_p.M129I	NM_001111285.1	NP_001104755.1	P05019	IGF1_HUMAN	insulin-like growth factor 1 (somatomedin C)	129					blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|bone mineralization involved in bone maturation (GO:0035630)|branching morphogenesis of an epithelial tube (GO:0048754)|cell activation (GO:0001775)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|DNA replication (GO:0006260)|exocrine pancreas development (GO:0031017)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|glial cell differentiation (GO:0010001)|glycolate metabolic process (GO:0009441)|inner ear development (GO:0048839)|insulin-like growth factor receptor signaling pathway (GO:0048009)|lung alveolus development (GO:0048286)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|mammary gland development (GO:0030879)|multicellular organism growth (GO:0035264)|muscle hypertrophy (GO:0014896)|muscle organ development (GO:0007517)|myoblast differentiation (GO:0045445)|myoblast proliferation (GO:0051450)|myotube cell development (GO:0014904)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate gland growth (GO:0060736)|prostate gland stromal morphogenesis (GO:0060741)|proteoglycan biosynthetic process (GO:0030166)|Ras protein signal transduction (GO:0007265)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of multicellular organism growth (GO:0040014)|signal transduction (GO:0007165)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|skeletal system development (GO:0001501)|Type I pneumocyte differentiation (GO:0060509)|Type II pneumocyte differentiation (GO:0060510)|water homeostasis (GO:0030104)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|insulin-like growth factor binding protein complex (GO:0016942)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	hormone activity (GO:0005179)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|integrin binding (GO:0005178)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)	11						GGGTCTTGGGCATGTCGGTGT	0.602																																																	0													83.0	85.0	84.0					12																	102813302		2203	4300	6503	SO:0001583	missense	0			X00173	CCDS9091.1, CCDS44960.1, CCDS44961.1, CCDS44962.1	12q23.2	2014-09-16			ENSG00000017427	ENSG00000017427		"""Endogenous ligands"""	5464	protein-coding gene	gene with protein product		147440				2982726, 6358902	Standard	NM_001111283		Approved	IGF1A, IGFI, IGF-I	uc001tjp.4	P05019	OTTHUMG00000149910	ENST00000307046.8:c.387G>T	12.37:g.102813302C>A	ENSP00000302665:p.Met129Ile		B2RWM7|E9PD02|P01343|Q14620	Missense_Mutation	SNP	pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like,prints_IGF-I,prints_Insulin_family,prints_Insulin-like_growth_factor	p.M129I	ENST00000307046.8	37	c.387	CCDS44962.1	12	.	.	.	.	.	.	.	.	.	.	C	14.23	2.474098	0.43942	.	.	ENSG00000017427	ENST00000456098;ENST00000337514;ENST00000392904;ENST00000424202;ENST00000392905;ENST00000307046	D;D;D;D;D;D	0.96554	-4.01;-4.05;-4.01;-4.05;-3.99;-3.07	5.85	4.96	0.65561	.	0.195107	0.64402	D	0.000007	D	0.93135	0.7814	L	0.34521	1.04	0.45150	D	0.998163	B;B;B;B	0.22480	0.0;0.07;0.07;0.017	B;B;B;B	0.18263	0.001;0.021;0.021;0.02	D	0.89859	0.4015	10	0.31617	T	0.26	-13.011	16.9944	0.86362	0.0:0.8725:0.1275:0.0	.	129;160;113;129	P05019;Q59GC5;Q14620;E9PD02	IGF1_HUMAN;.;.;.	I	129;129;129;113;110;129	ENSP00000394999:M129I;ENSP00000337612:M129I;ENSP00000376637:M129I;ENSP00000416811:M113I;ENSP00000376638:M110I;ENSP00000302665:M129I	ENSP00000302665:M129I	M	-	3	0	IGF1	101337432	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	2.973000	0.49264	1.448000	0.47680	0.655000	0.94253	ATG	IGF1	-	prints_IGF-I	ENSG00000017427		0.602	IGF1-002	KNOWN	basic|CCDS	protein_coding	IGF1	HGNC	protein_coding	OTTHUMT00000313855.1	-	0.00	39	0	C	NM_000618		102813302	-1	tier1	-	no_errors	ENST00000307046	ensembl	human	known	74_37	missense	19.05	17	4	SNP	1.000	A
IGLL5	100423062	genome.wustl.edu	37	22	23237782	23237782	+	Missense_Mutation	SNP	G	G	A	rs371694135	byFrequency	TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr22:23237782G>A	ENST00000526893.1	+	3	827	c.553G>A	c.(553-555)Gag>Aag	p.E185K	IGLL5_ENST00000531372.1_3'UTR|IGLC1_ENST00000390321.2_RNA|IGLJ1_ENST00000390320.2_RNA|IGLL5_ENST00000532223.2_Missense_Mutation_p.E186K	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	185	C region (By similarity to lambda light- chain).|Ig-like C1-type.					extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CCTGACGCCCGAGCAGTGGAA	0.592													g|||	2	0.000399361	0.0	0.0	5008	,	,		13425	0.002		0.0	False		,,,				2504	0.0																0								G	LYS/GLU	1,4403	2.1+/-5.4	0,1,2201	65.0	67.0	67.0		553	-5.5	0.0	22		67	0,8586		0,0,4293	no	missense	IGLL5	NM_001178126.1	56	0,1,6494	AA,AG,GG		0.0,0.0227,0.0077	benign	185/215	23237782	1,12989	2202	4293	6495	SO:0001583	missense	0			M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.553G>A	22.37:g.23237782G>A	ENSP00000431254:p.Glu185Lys			Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like_dom	p.E186K	ENST00000526893.1	37	c.556	CCDS54506.1	22	.	.	.	.	.	.	.	.	.	.	G	12.10	1.837614	0.32513	2.27E-4	0.0	ENSG00000254709	ENST00000532223;ENST00000526893	T;T	0.00616	6.2;6.2	3.98	-5.47	0.02600	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00496	0.0016	L	0.29908	0.895	0.09310	N	0.999999	B	0.19200	0.034	B	0.16722	0.016	T	0.47368	-0.9123	9	0.66056	D	0.02	.	1.2878	0.02054	0.3747:0.2496:0.2494:0.1263	.	185	B9A064	IGLL5_HUMAN	K	186;185	ENSP00000436353:E186K;ENSP00000431254:E185K	ENSP00000431254:E185K	E	+	1	0	IGLL5	21567782	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.009000	0.01455	-1.051000	0.03226	0.650000	0.86243	GAG	IGLL5	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like_dom	ENSG00000254709		0.592	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	IGLL5	HGNC	protein_coding	OTTHUMT00000385699.1	-	0.00	197	0	G	NM_001178126		23237782	+1	tier1	-	no_errors	ENST00000532223	ensembl	human	known	74_37	missense	10.57	110	13	SNP	0.000	A
IL15	3600	genome.wustl.edu	37	4	142642320	142642320	+	Intron	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr4:142642320G>T	ENST00000296545.7	+	4	954				IL15_ENST00000529613.1_Intron|IL15_ENST00000514653.1_Missense_Mutation_p.D7Y|IL15_ENST00000394159.1_Missense_Mutation_p.D7Y|IL15_ENST00000320650.4_Intron|IL15_ENST00000477265.1_Missense_Mutation_p.D7Y			P40933	IL15_HUMAN	interleukin 15						aging (GO:0007568)|cell maturation (GO:0048469)|cell-cell signaling (GO:0007267)|cellular response to vitamin D (GO:0071305)|extrathymic T cell selection (GO:0045062)|hyaluronan metabolic process (GO:0030212)|immune response (GO:0006955)|inflammatory response (GO:0006954)|lymph node development (GO:0048535)|natural killer cell differentiation (GO:0001779)|negative regulation of smooth muscle cell proliferation (GO:0048662)|NK T cell proliferation (GO:0001866)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immune response (GO:0050778)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of defense response to virus by host (GO:0050691)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)				kidney(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_hematologic(180;0.158)					GGGAACCATAGATTTGTGCAG	0.373																																					Pancreas(10;184 986 25902)												0													23.0	23.0	23.0					4																	142642320		874	1989	2863	SO:0001627	intron_variant	0			U14407	CCDS3755.1, CCDS3756.1	4q31	2011-07-14			ENSG00000164136	ENSG00000164136		"""Interleukins and interleukin receptors"""	5977	protein-coding gene	gene with protein product		600554				8178155	Standard	NM_000585		Approved	IL-15, MGC9721	uc003iis.3	P40933	OTTHUMG00000133418	ENST00000296545.7:c.110+601G>T	4.37:g.142642320G>T			D3DNZ2|O00440|O43512|Q495Z8|Q6FGX7|Q93058|Q9UBA3	Missense_Mutation	SNP	pfam_IL-15/IL-21_fam,prints_IL-15	p.D7Y	ENST00000296545.7	37	c.19	CCDS3755.1	4	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334965	0.60853	.	.	ENSG00000164136	ENST00000514653;ENST00000477265;ENST00000394159	.	.	.	3.47	1.63	0.23807	.	.	.	.	.	T	0.32346	0.0826	N	0.22421	0.69	0.09310	N	1	.	.	.	.	.	.	T	0.28554	-1.0040	6	0.87932	D	0	.	8.1067	0.30890	0.0:0.0:0.5621:0.4379	.	.	.	.	Y	7	.	ENSP00000377714:D7Y	D	+	1	0	IL15	142861770	0.007000	0.16637	0.003000	0.11579	0.992000	0.81027	1.771000	0.38542	0.409000	0.25649	0.563000	0.77884	GAT	IL15	-	pfam_IL-15/IL-21_fam	ENSG00000164136		0.373	IL15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IL15	HGNC	protein_coding	OTTHUMT00000257278.2	-	0.00	43	0	G	NM_172175		142642320	+1	tier1	-	no_errors	ENST00000394159	ensembl	human	known	74_37	missense	35.90	25	14	SNP	0.003	T
INF2	64423	genome.wustl.edu	37	14	105180911	105180911	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr14:105180911C>T	ENST00000392634.4	+	21	3524	c.3412C>T	c.(3412-3414)Ctg>Ttg	p.L1138L	INF2_ENST00000330634.7_Silent_p.L1138L	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	1138					actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		CACGTCCTTGCTGGGCGTCCT	0.657																																																	0													53.0	62.0	59.0					14																	105180911		2056	4193	6249	SO:0001819	synonymous_variant	0			AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.3412C>T	14.37:g.105180911C>T			Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Silent	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_WH2_dom,superfamily_ARM-type_fold,smart_FH2_Formin,pfscan_WH2_dom	p.L1138	ENST00000392634.4	37	c.3412	CCDS9989.2	14																																																																																			INF2	-	NULL	ENSG00000203485		0.657	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INF2	HGNC	protein_coding	OTTHUMT00000074371.4		0.00	92	0	C	NM_022489		105180911	+1			no_errors	ENST00000392634	ensembl	human	known	74_37	silent	6.06	62	4	SNP	0.000	T
IPO11	51194	genome.wustl.edu	37	5	61923185	61923185	+	3'UTR	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:61923185G>T	ENST00000325324.6	+	0	3137				IPO11_ENST00000409296.3_3'UTR|IPO11_ENST00000512177.1_3'UTR|IPO11_ENST00000409534.1_3'UTR	NM_016338.4	NP_057422.3	Q9UI26	IPO11_HUMAN	importin 11						ribosomal protein import into nucleus (GO:0006610)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			endometrium(2)|kidney(3)|large_intestine(5)|lung(14)|skin(4)|stomach(2)	30		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		TCAGAAACAAGCTGAGTAACC	0.438																																																	0													53.0	59.0	57.0					5																	61923185		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AF111109	CCDS34167.1, CCDS47217.1	5q12.1	2008-09-19			ENSG00000086200	ENSG00000086200		"""Importins"""	20628	protein-coding gene	gene with protein product		610889					Standard	NM_016338		Approved	RanBP11	uc011cqr.2	Q9UI26	OTTHUMG00000154400	ENST00000325324.6:c.*40G>T	5.37:g.61923185G>T			A6NGJ5|B4DZ73|D3DW98|Q8N5R2|Q9NSJ6|Q9NVB1	RNA	SNP	-	NULL	ENST00000325324.6	37	NULL	CCDS34167.1	5																																																																																			IPO11	-	-	ENSG00000086200		0.438	IPO11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO11	HGNC	protein_coding	OTTHUMT00000335062.1	-	0.00	52	0	G	NM_016338		61923185	+1	tier1	-	no_errors	ENST00000512177	ensembl	human	known	74_37	rna	7.41	50	4	SNP	0.001	T
IQCE	23288	genome.wustl.edu	37	7	2611943	2611943	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:2611943G>A	ENST00000402050.2	+	5	561	c.377G>A	c.(376-378)aGg>aAg	p.R126K	IQCE_ENST00000325979.7_Missense_Mutation_p.R61K|IQCE_ENST00000438376.2_Missense_Mutation_p.R110K|IQCE_ENST00000404984.1_Missense_Mutation_p.R75K	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	126						mitochondrion (GO:0005739)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		CCACATCTCAGGCGCTCTGCC	0.617																																																	0													37.0	39.0	38.0					7																	2611943		2065	4217	6282	SO:0001583	missense	0			AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.377G>A	7.37:g.2611943G>A	ENSP00000385597:p.Arg126Lys		Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.R126K	ENST00000402050.2	37	c.377	CCDS43542.1	7	.	.	.	.	.	.	.	.	.	.	G	2.983	-0.209852	0.06140	.	.	ENSG00000106012	ENST00000402050;ENST00000404984;ENST00000415271;ENST00000438376;ENST00000325979;ENST00000423395;ENST00000422276	T;T;T;T;T;T	0.43294	3.26;3.26;0.95;3.26;3.26;3.26	3.99	3.99	0.46301	.	1.202990	0.05734	N	0.600074	T	0.55673	0.1935	L	0.48362	1.52	0.21256	N	0.999746	P;P;P;D;P;D	0.67145	0.92;0.92;0.94;0.972;0.92;0.996	B;B;P;P;B;D	0.76071	0.345;0.345;0.465;0.6;0.345;0.987	T	0.44757	-0.9307	10	0.10111	T	0.7	-20.0535	11.2104	0.48795	0.0:0.3127:0.6872:0.0	.	61;110;61;126;126;110	B4DXN1;B4DDX4;Q6IPM2-2;Q6IPM2;B3KRY4;Q6IPM2-4	.;.;.;IQCE_HUMAN;.;.	K	126;75;126;110;61;61;61	ENSP00000385597:R126K;ENSP00000385945:R75K;ENSP00000404643:R126K;ENSP00000396178:R110K;ENSP00000313772:R61K;ENSP00000413570:R61K	ENSP00000313772:R61K	R	+	2	0	IQCE	2578469	0.857000	0.29778	0.797000	0.32132	0.114000	0.19823	3.433000	0.52834	2.163000	0.67991	0.591000	0.81541	AGG	IQCE	-	NULL	ENSG00000106012		0.617	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IQCE	HGNC	protein_coding	OTTHUMT00000325063.2	-	0.00	49	0	G	NM_152558		2611943	+1	tier1	-	no_errors	ENST00000402050	ensembl	human	known	74_37	missense	30.77	17	8	SNP	0.592	A
IQCE	23288	genome.wustl.edu	37	7	2625840	2625840	+	Splice_Site	SNP	A	A	G	rs373779920		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:2625840A>G	ENST00000402050.2	+	12	1008		c.e12-1		IQCE_ENST00000325979.7_Splice_Site|IQCE_ENST00000438376.2_Splice_Site|IQCE_ENST00000404984.1_Splice_Site	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E							mitochondrion (GO:0005739)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		TGGTTGTTCCAGGCCCCTGGG	0.547																																																	0								A	,	0,3902		0,0,1951	38.0	44.0	42.0		,	4.5	0.7	7		42	1,8267		0,1,4133	no	splice-3,splice-3	IQCE	NM_001100390.1,NM_152558.3	,	0,1,6084	GG,GA,AA		0.0121,0.0,0.0082	,	,	2625840	1,12169	1951	4134	6085	SO:0001630	splice_region_variant	0			AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.825-1A>G	7.37:g.2625840A>G			Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Splice_Site	SNP	-	e12-2	ENST00000402050.2	37	c.825-2	CCDS43542.1	7	.	.	.	.	.	.	.	.	.	.	A	12.13	1.846320	0.32606	0.0	1.21E-4	ENSG00000106012	ENST00000402050;ENST00000404984;ENST00000438376;ENST00000325979;ENST00000427817	.	.	.	4.52	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.4106	0.44291	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IQCE	2592366	0.997000	0.39634	0.712000	0.30502	0.020000	0.10135	2.734000	0.47368	2.026000	0.59711	0.533000	0.62120	.	IQCE	-	-	ENSG00000106012		0.547	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IQCE	HGNC	protein_coding	OTTHUMT00000325063.2	-	0.00	49	0	A	NM_152558	Intron	2625840	+1	tier1	-	no_errors	ENST00000402050	ensembl	human	known	74_37	splice_site	8.51	43	4	SNP	0.625	G
ISPD	729920	genome.wustl.edu	37	7	16255711	16255711	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:16255711G>T	ENST00000407010.2	-	9	1230	c.1231C>A	c.(1231-1233)Ctt>Att	p.L411I	ISPD-AS1_ENST00000579293.1_RNA|ISPD-AS1_ENST00000438573.1_RNA|ISPD_ENST00000399310.3_Missense_Mutation_p.L361I|ISPD-AS1_ENST00000582683.1_RNA|ISPD-AS1_ENST00000457112.1_RNA	NM_001101426.3	NP_001094896.1	A4D126	ISPD_HUMAN	isoprenoid synthase domain containing	411					axon guidance (GO:0007411)|isoprenoid biosynthetic process (GO:0008299)|protein O-linked mannosylation (GO:0035269)		nucleotidyltransferase activity (GO:0016779)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9						GATATGAGAAGCCCATATAAC	0.323										Multiple Myeloma(15;0.18)																																							0													85.0	85.0	85.0					7																	16255711		1798	4058	5856	SO:0001583	missense	0			AK124805		7p21.2	2010-03-19			ENSG00000214960	ENSG00000214960			37276	protein-coding gene	gene with protein product	"""notch1-induced protein"", ""4-diphosphocytidyl-2C-methyl-D-erythritol synthase homolog (Arabidopsis)"""	614631				11181995	Standard	NM_001101417		Approved	hCG_1745121, IspD, Nip	uc010ktx.2	A4D126	OTTHUMG00000152447	ENST00000407010.2:c.1231C>A	7.37:g.16255711G>T	ENSP00000385478:p.Leu411Ile		A8MU35|H9KVB2	Missense_Mutation	SNP	pfam_IspD	p.L411I	ENST00000407010.2	37	c.1231		7	.	.	.	.	.	.	.	.	.	.	G	9.571	1.120978	0.20877	.	.	ENSG00000214960	ENST00000407010;ENST00000399310	D;D	0.87256	-2.22;-2.23	5.07	3.19	0.36642	.	.	.	.	.	T	0.78175	0.4242	N	0.19112	0.55	0.27923	N	0.938173	B	0.21821	0.061	B	0.17433	0.018	T	0.65853	-0.6067	9	0.36615	T	0.2	-5.8477	12.1136	0.53854	0.0:0.3305:0.6695:0.0	.	411	A4D126	ISPD_HUMAN	I	411;361	ENSP00000385478:L411I;ENSP00000382249:L361I	ENSP00000382249:L361I	L	-	1	0	ISPD	16222236	0.999000	0.42202	0.076000	0.20297	0.894000	0.52154	3.275000	0.51639	0.590000	0.29694	0.650000	0.86243	CTT	ISPD	-	NULL	ENSG00000214960		0.323	ISPD-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ISPD	HGNC	protein_coding	OTTHUMT00000326252.4	-	0.00	52	0	G	NM_001101426		16255711	-1	tier1	-	no_errors	ENST00000407010	ensembl	human	known	74_37	missense	32.61	31	15	SNP	0.858	T
ITGA1	3672	genome.wustl.edu	37	5	52206093	52206093	+	Silent	SNP	C	C	T	rs565973897		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:52206093C>T	ENST00000282588.6	+	14	2159	c.1701C>T	c.(1699-1701)tgC>tgT	p.C567C		NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	567					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				ATGAGCCATGCGGGGCTCGTT	0.453																																																	0													69.0	73.0	72.0					5																	52206093		2203	4300	6503	SO:0001819	synonymous_variant	0			X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.1701C>T	5.37:g.52206093C>T			B2RNU0	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.C567	ENST00000282588.6	37	c.1701	CCDS3955.1	5																																																																																			ITGA1	-	smart_Int_alpha_beta-p	ENSG00000213949		0.453	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA1	HGNC	protein_coding	OTTHUMT00000253855.3		0.00	28	0	C	NM_181501		52206093	+1			no_errors	ENST00000282588	ensembl	human	known	74_37	silent	7.41	25	2	SNP	0.084	T
ITK	3702	genome.wustl.edu	37	5	156638349	156638349	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:156638349C>T	ENST00000422843.3	+	3	447	c.295C>T	c.(295-297)Cgg>Tgg	p.R99W	CTB-4E7.1_ENST00000519375.1_RNA	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	99	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	TCGTGAGAGCCGGCAGCGCTG	0.493			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)			Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	0													118.0	110.0	113.0					5																	156638349		2203	4300	6503	SO:0001583	missense	0			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.295C>T	5.37:g.156638349C>T	ENSP00000398655:p.Arg99Trp		B2R752|Q32ML7	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_Znf_Btk_motif,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.R99W	ENST00000422843.3	37	c.295	CCDS4336.1	5	.	.	.	.	.	.	.	.	.	.	C	21.0	4.077806	0.76528	.	.	ENSG00000113263	ENST00000422843	T	0.78246	-1.16	5.8	4.03	0.46877	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.88926	0.6570	M	0.92077	3.27	0.53688	D	0.999978	D	0.89917	1.0	D	0.74674	0.984	D	0.88754	0.3252	10	0.87932	D	0	.	8.6618	0.34097	0.2751:0.654:0.0:0.0709	.	99	Q08881	ITK_HUMAN	W	99	ENSP00000398655:R99W	ENSP00000398655:R99W	R	+	1	2	ITK	156570927	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.335000	0.33839	0.791000	0.33826	-0.122000	0.15005	CGG	ITK	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000113263		0.493	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITK	HGNC	protein_coding	OTTHUMT00000252569.2	-	0.00	50	0	C			156638349	+1	tier1	-	no_errors	ENST00000422843	ensembl	human	known	74_37	missense	18.18	27	6	SNP	1.000	T
JPH1	56704	genome.wustl.edu	37	8	75171619	75171619	+	Splice_Site	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr8:75171619C>T	ENST00000342232.4	-	3	1299		c.e3+1			NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1						calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			CACTGTTTTACCTGGTTGGTA	0.557																																																	0													66.0	69.0	68.0					8																	75171619		2203	4300	6503	SO:0001630	splice_region_variant	0			AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.1258+1G>A	8.37:g.75171619C>T			B2RTZ0	Splice_Site	SNP	-	e3+1	ENST00000342232.4	37	c.1258+1	CCDS6217.1	8	.	.	.	.	.	.	.	.	.	.	C	22.9	4.354086	0.82243	.	.	ENSG00000104369	ENST00000342232	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7907	0.88551	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	JPH1	75334173	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	6.390000	0.73204	2.809000	0.96659	0.655000	0.94253	.	JPH1	-	-	ENSG00000104369		0.557	JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH1	HGNC	protein_coding	OTTHUMT00000379102.1	-	0.00	39	0	C		Intron	75171619	-1	tier1	-	no_errors	ENST00000342232	ensembl	human	known	74_37	splice_site	37.50	10	6	SNP	1.000	T
KALRN	8997	genome.wustl.edu	37	3	124390534	124390534	+	Missense_Mutation	SNP	G	G	A	rs374234847		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:124390534G>A	ENST00000291478.5	+	15	1800	c.1637G>A	c.(1636-1638)cGg>cAg	p.R546Q	KALRN_ENST00000393496.1_Missense_Mutation_p.R584Q|KALRN_ENST00000360013.3_Missense_Mutation_p.R2243Q|KALRN_ENST00000459915.1_Missense_Mutation_p.R335Q|KALRN_ENST00000428018.2_Missense_Mutation_p.R514Q	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2242					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GAGTATCAACGGAAAGAAAGG	0.552																																																	0								G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	94.0	102.0	99.0		6728,1637	4.3	1.0	3		99	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	KALRN	NM_001024660.3,NM_007064.3	43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	2243/2987,546/1290	124390534	1,13005	2203	4300	6503	SO:0001583	missense	0			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.1637G>A	3.37:g.124390534G>A	ENSP00000291478:p.Arg546Gln		A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.R2243Q	ENST00000291478.5	37	c.6728	CCDS3028.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.87|15.87	2.961478|2.961478	0.53400|0.53400	0.0|0.0	1.16E-4|1.16E-4	ENSG00000160145|ENSG00000160145	ENST00000354186|ENST00000360013;ENST00000393496;ENST00000291478;ENST00000428018;ENST00000459915	.|T;T;T;T;T	.|0.43688	.|0.94;0.94;0.94;0.94;0.94	4.35|4.35	4.35|4.35	0.52113|0.52113	.|Pleckstrin homology-type (1);	.|0.094329	.|0.43110	.|D	.|0.000618	T|T	0.37839|0.37839	0.1018|0.1018	M|M	0.67397|0.67397	2.05|2.05	0.30381|0.30381	N|N	0.7819|0.7819	.|B;P;D;P	.|0.53619	.|0.383;0.864;0.961;0.605	.|B;B;B;B	.|0.32090	.|0.04;0.049;0.14;0.007	T|T	0.57165|0.57165	-0.7858|-0.7858	5|10	.|0.62326	.|D	.|0.03	.|.	16.8893|16.8893	0.86083|0.86083	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|335;546;584;2242	.|E7EUZ8;C9JQ37;O60229-5;O60229	.|.;.;.;KALRN_HUMAN	R|Q	2212|2243;584;546;514;335	.|ENSP00000353109:R2243Q;ENSP00000377134:R584Q;ENSP00000291478:R546Q;ENSP00000402419:R514Q;ENSP00000420318:R335Q	.|ENSP00000291478:R546Q	G|R	+|+	1|2	0|0	KALRN|KALRN	125873224|125873224	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.907000|0.907000	0.53573|0.53573	4.823000|4.823000	0.62694|0.62694	1.968000|1.968000	0.57251|0.57251	0.557000|0.557000	0.71058|0.71058	GGA|CGG	KALRN	-	NULL	ENSG00000160145		0.552	KALRN-001	KNOWN	basic|CCDS	protein_coding	KALRN	HGNC	protein_coding	OTTHUMT00000246891.5	-	0.00	77	0	G	NM_003947		124390534	+1	tier1	-	no_errors	ENST00000360013	ensembl	human	known	74_37	missense	38.57	43	27	SNP	1.000	A
KCNH4	23415	genome.wustl.edu	37	17	40315780	40315780	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:40315780G>A	ENST00000264661.3	-	13	2653	c.2321C>T	c.(2320-2322)tCc>tTc	p.S774F	KCNH4_ENST00000607371.1_Missense_Mutation_p.S774F	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	774					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GGAAGGAGAGGAGACAAGGGC	0.697																																					NSCLC(117;707 1703 2300 21308 31858)												0													15.0	16.0	16.0					17																	40315780		2181	4279	6460	SO:0001583	missense	0			AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.2321C>T	17.37:g.40315780G>A	ENSP00000264661:p.Ser774Phe			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,pfam_PAS_fold,pfam_PAS_4,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.S774F	ENST00000264661.3	37	c.2321	CCDS11420.1	17	.	.	.	.	.	.	.	.	.	.	G	15.90	2.969415	0.53614	.	.	ENSG00000089558	ENST00000264661	D	0.98835	-5.17	5.25	5.25	0.73442	.	0.000000	0.33364	N	0.004994	D	0.96479	0.8851	L	0.40543	1.245	0.39058	D	0.960468	B	0.18863	0.031	B	0.15870	0.014	D	0.94805	0.7974	10	0.46703	T	0.11	.	12.9289	0.58276	0.0:0.0:0.8382:0.1618	.	774	Q9UQ05	KCNH4_HUMAN	F	774	ENSP00000264661:S774F	ENSP00000264661:S774F	S	-	2	0	KCNH4	37569306	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.489000	0.60309	2.464000	0.83262	0.484000	0.47621	TCC	KCNH4	-	NULL	ENSG00000089558		0.697	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	KCNH4	HGNC	protein_coding	OTTHUMT00000449791.2	-	0.00	84	0	G	NM_012285		40315780	-1	tier1	-	no_errors	ENST00000264661	ensembl	human	known	74_37	missense	32.43	25	12	SNP	1.000	A
KCTD16	57528	genome.wustl.edu	37	5	143586970	143586970	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:143586970G>T	ENST00000507359.3	+	2	1784	c.693G>T	c.(691-693)aaG>aaT	p.K231N	KCTD16_ENST00000512467.1_Missense_Mutation_p.K231N	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	231					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			TCAAATTCAAGCACCTGGAAA	0.428																																																	0													64.0	68.0	67.0					5																	143586970		2203	4300	6503	SO:0001583	missense	0			AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.693G>T	5.37:g.143586970G>T	ENSP00000426548:p.Lys231Asn		Q9P2M9	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.K231N	ENST00000507359.3	37	c.693	CCDS34260.1	5	.	.	.	.	.	.	.	.	.	.	G	7.726	0.698234	0.15106	.	.	ENSG00000183775	ENST00000512467;ENST00000507359	T;T	0.40756	1.02;1.02	5.69	-1.72	0.08107	.	0.047357	0.85682	D	0.000000	T	0.17238	0.0414	N	0.20574	0.59	0.42608	D	0.993302	B	0.21606	0.058	B	0.23419	0.046	T	0.21621	-1.0240	10	0.06236	T	0.91	.	3.269	0.06875	0.2114:0.2082:0.4743:0.1061	.	231	Q68DU8	KCD16_HUMAN	N	231	ENSP00000424151:K231N;ENSP00000426548:K231N	ENSP00000426548:K231N	K	+	3	2	KCTD16	143567163	1.000000	0.71417	0.792000	0.32020	0.996000	0.88848	2.037000	0.41174	-0.218000	0.10018	0.561000	0.74099	AAG	KCTD16	-	NULL	ENSG00000183775		0.428	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCTD16	HGNC	protein_coding	OTTHUMT00000371898.3	-	0.00	34	0	G	XM_098368		143586970	+1	tier1	-	no_errors	ENST00000507359	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
KCTD19	146212	genome.wustl.edu	37	16	67360597	67360597	+	Intron	SNP	G	G	A	rs377462036		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:67360597G>A	ENST00000304372.5	-	1	59				LRRC36_ENST00000329956.6_5'Flank	NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19						protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		CCGCCAGAGCGGGCTCCGTAC	0.726											OREG0023877	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													8.0	10.0	9.0					16																	67360597		1808	4051	5859	SO:0001627	intron_variant	0			AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.3+10C>T	16.37:g.67360597G>A		1098	B4DZ49|Q8N804	Missense_Mutation	SNP	NULL	p.P5L	ENST00000304372.5	37	c.14	CCDS42179.1	16																																																																																			KCTD19	-	NULL	ENSG00000168676		0.726	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD19	HGNC	protein_coding	OTTHUMT00000422061.1	-	0.00	43	0	G	XM_085367		67360597	-1	tier1	-	no_errors	ENST00000562721	ensembl	human	known	74_37	missense	31.82	15	7	SNP	0.000	A
KDM1A	23028	genome.wustl.edu	37	1	23357117	23357118	+	Frame_Shift_Ins	INS	-	-	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:23357117_23357118insG	ENST00000356634.3	+	2	656_657	c.507_508insG	c.(508-510)gaafs	p.E170fs	RP1-184J9.2_ENST00000427154.1_RNA|KDM1A_ENST00000542151.1_Frame_Shift_Ins_p.E170fs|KDM1A_ENST00000400181.4_Frame_Shift_Ins_p.E170fs	NM_015013.3	NP_055828.2	O60341	KDM1A_HUMAN	lysine (K)-specific demethylase 1A	170					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|histone H3-K4 demethylation (GO:0034720)|histone H3-K9 demethylation (GO:0033169)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of DNA binding (GO:0043392)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein demethylation (GO:0006482)|regulation of primitive erythrocyte differentiation (GO:0010725)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|demethylase activity (GO:0032451)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-K4 specific) (GO:0032453)|histone demethylase activity (H3-K9 specific) (GO:0032454)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|MRF binding (GO:0043426)|oxidoreductase activity (GO:0016491)|p53 binding (GO:0002039)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(2)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						GTGAGCCTGAAGAACCATCGGG	0.396																																																	0																																										SO:0001589	frameshift_variant	0			AL031428	CCDS30627.1, CCDS53278.1	1p36.12	2011-07-01	2009-09-29	2009-09-29	ENSG00000004487	ENSG00000004487		"""Chromatin-modifying enzymes / K-demethylases"""	29079	protein-coding gene	gene with protein product		609132	"""amine oxidase (flavin containing) domain 2"", ""lysine (K)-specific demethylase 1"""	AOF2, KDM1		9628581, 12493763	Standard	NM_015013		Approved	KIAA0601, BHC110, LSD1	uc001bgj.2	O60341	OTTHUMG00000003220	ENST00000356634.3:c.508dupG	1.37:g.23357118_23357118dupG	ENSP00000349049:p.Glu170fs		A8MWP9|Q5TH94|Q5TH95|Q86VT7|Q8IXK4|Q8NDP6|Q8TAZ3|Q96AW4	Frame_Shift_Ins	INS	pfam_Amino_oxidase,pfam_SWIRM,pfam_FAD-dep_OxRdtase,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_FAD_bind_dom,superfamily_Homeodomain-like,pirsf_Hist_Lys-spec_deMease,pfscan_SWIRM	p.E169fs	ENST00000356634.3	37	c.507_508	CCDS30627.1	1																																																																																			KDM1A	-	pirsf_Hist_Lys-spec_deMease	ENSG00000004487		0.396	KDM1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KDM1A	HGNC	protein_coding	OTTHUMT00000008880.3		0.00	30	0	-	NM_015013		23357118	+1	tier1		no_errors	ENST00000542151	ensembl	human	known	74_37	frame_shift_ins	28.57	35	14	INS	1.000:1.000	G
KDM3A	55818	genome.wustl.edu	37	2	86716722	86716722	+	Silent	SNP	A	A	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:86716722A>T	ENST00000409556.1	+	24	3878	c.3513A>T	c.(3511-3513)ggA>ggT	p.G1171G	KDM3A_ENST00000409064.1_Silent_p.G1171G|KDM3A_ENST00000312912.5_Silent_p.G1171G|KDM3A_ENST00000542128.1_Silent_p.G1119G			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	1171	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						AGAAGCCAGGAGCACTGTGGC	0.423																																					NSCLC(96;1150 1523 6936 46253 49736)												0													107.0	100.0	103.0					2																	86716722		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.3513A>T	2.37:g.86716722A>T			D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Silent	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.G1171	ENST00000409556.1	37	c.3513	CCDS1990.1	2																																																																																			KDM3A	-	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000115548		0.423	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3A	HGNC	protein_coding	OTTHUMT00000252522.2	-	0.00	27	0	A	NM_018433		86716722	+1	tier1	-	no_errors	ENST00000312912	ensembl	human	known	74_37	silent	27.78	25	10	SNP	0.966	T
KIF6	221458	genome.wustl.edu	37	6	39507786	39507786	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:39507786C>A	ENST00000287152.7	-	13	1732	c.1638G>T	c.(1636-1638)aaG>aaT	p.K546N	KIF6_ENST00000373213.4_Missense_Mutation_p.K385N|KIF6_ENST00000373216.3_Missense_Mutation_p.K546N|KIF6_ENST00000373215.3_Missense_Mutation_p.K546N|KIF6_ENST00000538893.1_Intron	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	546					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						GACCTATTTTCTTGTGGAGCA	0.423																																																	0													167.0	177.0	174.0					6																	39507786		2203	4300	6503	SO:0001583	missense	0			AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.1638G>T	6.37:g.39507786C>A	ENSP00000287152:p.Lys546Asn		Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.K546N	ENST00000287152.7	37	c.1638	CCDS4844.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.688|3.688	-0.064027|-0.064027	0.07273|0.07273	.|.	.|.	ENSG00000164627|ENSG00000164627	ENST00000287152;ENST00000373216;ENST00000373213;ENST00000373215|ENST00000458470	T;T;T;T|.	0.71698|.	-0.57;-0.59;-0.4;-0.58|.	6.04|6.04	-2.7|-2.7	0.06004|0.06004	.|.	.|.	.|.	.|.	.|.	T|T	0.19725|0.19725	0.0474|0.0474	N|N	0.22421|0.22421	0.69|0.69	0.43766|0.43766	D|D	0.996286|0.996286	B;B;B|.	0.16396|.	0.0;0.017;0.0|.	B;B;B|.	0.11329|.	0.001;0.006;0.0|.	T|T	0.14504|0.14504	-1.0470|-1.0470	9|5	0.22706|.	T|.	0.39|.	.|.	7.1025|7.1025	0.25346|0.25346	0.0:0.4202:0.1316:0.4482|0.0:0.4202:0.1316:0.4482	.|.	546;546;546|.	E7EUN7;Q6ZMV9-3;Q6ZMV9|.	.;.;KIF6_HUMAN|.	N|I	546;546;385;546|438	ENSP00000287152:K546N;ENSP00000362312:K546N;ENSP00000362309:K385N;ENSP00000362311:K546N|.	ENSP00000287152:K546N|.	K|R	-|-	3|2	2|0	KIF6|KIF6	39615764|39615764	0.001000|0.001000	0.12720|0.12720	0.621000|0.621000	0.29145|0.29145	0.163000|0.163000	0.22366|0.22366	-0.722000|-0.722000	0.04958|0.04958	-0.318000|-0.318000	0.08665|0.08665	-0.471000|-0.471000	0.05019|0.05019	AAG|AGA	KIF6	-	NULL	ENSG00000164627		0.423	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF6	HGNC	protein_coding	OTTHUMT00000040455.2	-	0.00	62	0	C	NM_145027		39507786	-1	tier1	-	no_errors	ENST00000287152	ensembl	human	known	74_37	missense	36.76	43	25	SNP	0.052	A
KIAA1586	57691	genome.wustl.edu	37	6	56918934	56918934	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:56918934G>A	ENST00000370733.4	+	4	1844	c.1637G>A	c.(1636-1638)aGa>aAa	p.R546K	KIAA1586_ENST00000545356.1_Missense_Mutation_p.R519K	NM_020931.2	NP_065982.1	Q9HCI6	K1586_HUMAN	KIAA1586	546							nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)	18	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TTACAGTCAAGATCAACTAAT	0.299																																																	0													30.0	31.0	31.0					6																	56918934		2174	4281	6455	SO:0001583	missense	0			AB046806	CCDS34480.1, CCDS69138.1	6p12.1	2014-03-27			ENSG00000168116	ENSG00000168116			21360	protein-coding gene	gene with protein product						10997877	Standard	NM_001286274		Approved		uc003pdj.3	Q9HCI6	OTTHUMG00000014915	ENST00000370733.4:c.1637G>A	6.37:g.56918934G>A	ENSP00000359768:p.Arg546Lys		A8K4M3|Q8IW25	Missense_Mutation	SNP	superfamily_RNaseH-like_dom	p.R546K	ENST00000370733.4	37	c.1637	CCDS34480.1	6	.	.	.	.	.	.	.	.	.	.	g	7.298	0.612355	0.14066	.	.	ENSG00000168116	ENST00000370733;ENST00000545356	T;T	0.21932	1.98;1.98	3.84	2.02	0.26589	Ribonuclease H-like (1);	.	.	.	.	T	0.01940	0.0061	N	0.08118	0	0.20764	N	0.99986	B;B	0.16396	0.017;0.017	B;B	0.12156	0.007;0.007	T	0.47812	-0.9088	9	0.02654	T	1	-3.9313	6.0981	0.20031	0.2414:0.0:0.7586:0.0	.	519;546	F5H2N6;Q9HCI6	.;K1586_HUMAN	K	546;519	ENSP00000359768:R546K;ENSP00000445507:R519K	ENSP00000359768:R546K	R	+	2	0	KIAA1586	57026893	0.996000	0.38824	0.944000	0.38274	0.993000	0.82548	1.282000	0.33226	0.389000	0.25086	0.650000	0.86243	AGA	KIAA1586	-	superfamily_RNaseH-like_dom	ENSG00000168116		0.299	KIAA1586-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1586	HGNC	protein_coding	OTTHUMT00000041033.1	-	0.00	42	0	G	NM_020931		56918934	+1	tier1	-	no_errors	ENST00000370733	ensembl	human	known	74_37	missense	18.52	44	10	SNP	0.997	A
KIAA1919	91749	genome.wustl.edu	37	6	111580924	111580924	+	Silent	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:111580924G>T	ENST00000368847.4	+	1	374	c.21G>T	c.(19-21)ctG>ctT	p.L7L	RP11-428F8.2_ENST00000425364.1_RNA	NM_153369.2	NP_699200.2	Q5TF39	NAGT1_HUMAN	KIAA1919	7					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			large_intestine(3)|lung(2)|ovary(4)|skin(3)	12		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		CCTCCTTCCTGGGGCTGGTGA	0.642																																																	0													47.0	39.0	42.0					6																	111580924		2203	4299	6502	SO:0001819	synonymous_variant	0			BC036115	CCDS5090.1	6q22	2013-10-02			ENSG00000173214	ENSG00000173214			21053	protein-coding gene	gene with protein product							Standard	NM_153369		Approved	MGC33953, MFSD4B	uc003puv.4	Q5TF39	OTTHUMG00000015372	ENST00000368847.4:c.21G>T	6.37:g.111580924G>T			A8K9M0|Q8IYB6|Q96PW9|Q9P0D6	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.L7	ENST00000368847.4	37	c.21	CCDS5090.1	6																																																																																			KIAA1919	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000173214		0.642	KIAA1919-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1919	HGNC	protein_coding	OTTHUMT00000041827.1	-	0.00	113	0	G	NM_153369		111580924	+1	tier1	-	no_errors	ENST00000368847	ensembl	human	known	74_37	silent	6.15	61	4	SNP	1.000	T
KIAA0408	9729	genome.wustl.edu	37	6	127767686	127767686	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:127767686G>T	ENST00000483725.3	-	5	2114	c.1778C>A	c.(1777-1779)tCt>tAt	p.S593Y	SOGA3_ENST00000481848.2_3'UTR|SOGA3_ENST00000556132.1_3'UTR	NM_014702.4	NP_055517.3	Q6ZU52	K0408_HUMAN	KIAA0408	593										endometrium(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|skin(1)	28				GBM - Glioblastoma multiforme(226;0.0217)|all cancers(137;0.13)		ACTGACATCAGAATTACATTT	0.433																																																	0													144.0	133.0	137.0					6																	127767686		2203	4300	6503	SO:0001583	missense	0			AB007868	CCDS34531.1	6q22.33	2012-11-29			ENSG00000189367	ENSG00000189367			21636	protein-coding gene	gene with protein product							Standard	NM_014702		Approved		uc011ebs.2	Q6ZU52	OTTHUMG00000166439	ENST00000483725.3:c.1778C>A	6.37:g.127767686G>T	ENSP00000435150:p.Ser593Tyr		B3KRE5|E1P573|O43158|Q5TF20|Q7L2M2	Missense_Mutation	SNP	NULL	p.S593Y	ENST00000483725.3	37	c.1778	CCDS34531.1	6	.	.	.	.	.	.	.	.	.	.	G	12.18	1.860549	0.32884	.	.	ENSG00000189367	ENST00000483725	T	0.23754	1.89	5.23	1.98	0.26296	.	0.000000	0.37178	U	0.002202	T	0.12646	0.0307	L	0.59436	1.845	0.09310	N	1	P	0.45078	0.85	P	0.46718	0.525	T	0.11616	-1.0580	10	0.72032	D	0.01	-6.1778	2.769	0.05328	0.2812:0.1323:0.4674:0.1191	.	593	Q6ZU52	K0408_HUMAN	Y	593	ENSP00000435150:S593Y	ENSP00000435150:S593Y	S	-	2	0	KIAA0408	127809379	0.215000	0.23574	0.871000	0.34182	0.538000	0.34931	0.363000	0.20301	0.492000	0.27815	-0.345000	0.07892	TCT	KIAA0408	-	NULL	ENSG00000189367		0.433	KIAA0408-003	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA0408	HGNC	protein_coding	OTTHUMT00000042145.3	-	0.00	24	0	G	NM_014702		127767686	-1	tier1	-	no_errors	ENST00000483725	ensembl	human	novel	74_37	missense	51.92	24	27	SNP	0.001	T
KLHDC7A	127707	genome.wustl.edu	37	1	18807852	18807852	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:18807852G>A	ENST00000400664.1	+	1	429	c.377G>A	c.(376-378)cGg>cAg	p.R126Q		NM_152375.2	NP_689588.2	Q5VTJ3	KLD7A_HUMAN	kelch domain containing 7A	126						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22		Colorectal(325;3.46e-05)|all_lung(284;0.000152)|Lung NSC(340;0.000185)|Breast(348;0.00046)|Renal(390;0.000518)|Ovarian(437;0.0014)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;1.41e-05)|Kidney(64;0.00017)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GGTGAGGAGCGGGGCGGGCAG	0.632																																																	0													23.0	29.0	27.0					1																	18807852		2018	4168	6186	SO:0001583	missense	0			AK096072	CCDS185.2	1p36.13	2008-02-05			ENSG00000179023	ENSG00000179023			26791	protein-coding gene	gene with protein product							Standard	NM_152375		Approved	FLJ38753	uc001bax.3	Q5VTJ3	OTTHUMG00000002431	ENST00000400664.1:c.377G>A	1.37:g.18807852G>A	ENSP00000383505:p.Arg126Gln		Q8N8W6	Missense_Mutation	SNP	pfam_Kelch_1,smart_Kelch_1	p.R126Q	ENST00000400664.1	37	c.377	CCDS185.2	1	.	.	.	.	.	.	.	.	.	.	G	0.904	-0.721408	0.03182	.	.	ENSG00000179023	ENST00000400664;ENST00000540290	T	0.71934	-0.61	5.17	-10.3	0.00346	.	.	.	.	.	T	0.37625	0.1010	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39820	-0.9595	9	0.15952	T	0.53	.	9.0696	0.36484	0.14:0.5045:0.2887:0.0667	.	126	Q5VTJ3	KLD7A_HUMAN	Q	126;63	ENSP00000383505:R126Q	ENSP00000383505:R126Q	R	+	2	0	KLHDC7A	18680439	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.151000	0.00285	-5.424000	0.00015	-3.647000	0.00026	CGG	KLHDC7A	-	NULL	ENSG00000179023		0.632	KLHDC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC7A	HGNC	protein_coding	OTTHUMT00000006923.3	-	0.00	109	0	G	NM_152375		18807852	+1	tier1	-	no_errors	ENST00000400664	ensembl	human	known	74_37	missense	33.80	46	24	SNP	0.000	A
LARGE	9215	genome.wustl.edu	37	22	33700424	33700424	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr22:33700424G>T	ENST00000354992.2	-	13	2092	c.1521C>A	c.(1519-1521)gaC>gaA	p.D507E	LARGE_ENST00000397394.2_Missense_Mutation_p.D507E|LARGE_ENST00000402320.1_Missense_Mutation_p.D455E|LARGE_ENST00000437602.2_Missense_Mutation_p.D507E|LARGE_ENST00000337431.2_Missense_Mutation_p.D455E|LARGE_ENST00000452586.2_Missense_Mutation_p.D306E	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	507					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				GGGCCTCGGCGTCTGACAGGT	0.637																																					Colon(70;397 1175 4573 19089 45288)												0													47.0	41.0	43.0					22																	33700424		2203	4300	6503	SO:0001583	missense	0			AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.1521C>A	22.37:g.33700424G>T	ENSP00000347088:p.Asp507Glu		B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.D507E	ENST00000354992.2	37	c.1521	CCDS13912.1	22	.	.	.	.	.	.	.	.	.	.	G	17.88	3.496342	0.64186	.	.	ENSG00000133424	ENST00000443693;ENST00000429788;ENST00000354992;ENST00000337431;ENST00000397394;ENST00000402320;ENST00000452586;ENST00000437602	T;T;T;T;T;T	0.55052	0.97;1.04;0.97;1.04;0.54;2.03	5.27	-7.84	0.01196	.	0.000000	0.85682	D	0.000000	T	0.69396	0.3106	M	0.86864	2.845	0.52501	D	0.999951	D;D;D;D	0.89917	1.0;0.994;0.999;1.0	D;D;D;D	0.97110	1.0;0.925;0.991;1.0	T	0.79132	-0.1929	10	0.62326	D	0.03	0.0913	15.765	0.78120	0.7462:0.0:0.2538:0.0	.	507;306;455;507	B7Z2I9;E9PH73;O95461-2;O95461	.;.;.;LARGE_HUMAN	E	184;184;507;455;507;455;306;507	ENSP00000347088:D507E;ENSP00000336636:D455E;ENSP00000380549:D507E;ENSP00000385223:D455E;ENSP00000407917:D306E;ENSP00000388544:D507E	ENSP00000336636:D455E	D	-	3	2	LARGE	32030424	0.000000	0.05858	0.689000	0.30133	0.771000	0.43674	-1.875000	0.01634	-1.284000	0.02390	-0.751000	0.03497	GAC	LARGE	-	NULL	ENSG00000133424		0.637	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARGE	HGNC	protein_coding	OTTHUMT00000320515.2		0.00	88	0	G	NM_133642		33700424	-1			no_errors	ENST00000354992	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.467	T
LINC00266-1	140849	genome.wustl.edu	37	20	62934863	62934864	+	RNA	INS	-	-	TT	rs370163240|rs4057443		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr20:62934863_62934864insTT	ENST00000279067.3	+	0	879_880					NR_040415.1				long intergenic non-protein coding RNA 266-1																		GTAATTTTAACTGTGATTTATT	0.332																																																	0																																												0			BC118988		20q13.33	2012-10-12	2011-08-11	2011-08-11	ENSG00000149656	ENSG00000149656		"""Long non-coding RNAs"""	16202	non-coding RNA	RNA, long non-coding			"""chromosome 20 open reading frame 69"", ""non-protein coding RNA 266"", ""non-protein coding RNA 266-1"""	C20orf69, NCRNA00266, NCRNA00266-1			Standard	NR_040415		Approved	bA476I15.3	uc002yio.1		OTTHUMG00000033036		20.37:g.62934863_62934864insTT				RNA	INS	-	NULL	ENST00000279067.3	37	NULL		20																																																																																			LINC00266-1	-	-	ENSG00000149656		0.332	LINC00266-1-001	KNOWN	basic	processed_transcript	LINC00266-1	HGNC	processed_transcript	OTTHUMT00000080304.2		0.00	37	0	-			62934864	+1	tier1		no_errors	ENST00000279067	ensembl	human	known	74_37	rna	12.50	63	9	INS	0.448:0.498	TT
LINC00273	649159	genome.wustl.edu	37	16	33961581	33961581	+	lincRNA	SNP	G	G	A	rs111958693		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:33961581G>A	ENST00000539813.1	-	0	922				AC136932.1_ENST00000385251.1_RNA	NR_038368.1				long intergenic non-protein coding RNA 273											lung(1)	1						TGGCCCTGGCGTTGGGTTTGT	0.682																																																	0																																												0			AY587847		16p11.2	2013-06-03	2011-08-11	2011-08-11	ENSG00000256642	ENSG00000256642		"""Long non-coding RNAs"""	38595	other	unknown	"""non-protein coding RNA 273-1"""		"""non-protein coding RNA 273"""	NCRNA00273			Standard	NR_038368		Approved	TOP, NCRNA00273-1	uc021thl.1		OTTHUMG00000176379		16.37:g.33961581G>A				RNA	SNP	-	NULL	ENST00000539813.1	37	NULL		16	.	.	.	.	.	.	.	.	.	.	N	0.883	-0.727984	0.03135	.	.	ENSG00000256642	ENST00000539813	.	.	.	0.113	-0.226	0.13106	.	.	.	.	.	T	0.20495	0.0493	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23048	-1.0199	3	.	.	.	.	.	.	.	.	.	.	.	M	287	.	.	T	-	2	0	AC136932.2	33869082	0.020000	0.18652	0.003000	0.11579	0.003000	0.03518	0.268000	0.18571	-1.200000	0.02662	-1.202000	0.01658	ACG	LINC00273	-	-	ENSG00000256642		0.682	LINC00273-001	KNOWN	basic	lincRNA	LINC00273	HGNC	lincRNA	OTTHUMT00000431840.1		0.00	83	0	G	NR_038368		33961581	-1			no_errors	ENST00000539813	ensembl	human	known	74_37	rna	6.98	37	3	SNP	0.004	A
LNX1	84708	genome.wustl.edu	37	4	54362344	54362344	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr4:54362344C>T	ENST00000263925.7	-	6	1510	c.1196G>A	c.(1195-1197)cGc>cAc	p.R399H	LNX1_ENST00000306888.2_Missense_Mutation_p.R303H|FIP1L1_ENST00000507166.1_Intron|LNX1-AS1_ENST00000502373.1_RNA	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	399	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			ATCCACCTTGCGCACCAGTTT	0.522																																																	0													144.0	129.0	134.0					4																	54362344		2203	4300	6503	SO:0001583	missense	0			AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.1196G>A	4.37:g.54362344C>T	ENSP00000263925:p.Arg399His		Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.R399H	ENST00000263925.7	37	c.1196	CCDS47057.1	4	.	.	.	.	.	.	.	.	.	.	C	16.79	3.219380	0.58560	.	.	ENSG00000072201	ENST00000306888;ENST00000538207;ENST00000263925	T;T	0.27890	1.64;1.64	5.29	4.44	0.53790	PDZ/DHR/GLGF (4);	0.049049	0.85682	D	0.000000	T	0.38612	0.1047	M	0.73753	2.245	0.80722	D	1	P;D	0.55605	0.691;0.972	B;P	0.44394	0.284;0.448	T	0.43343	-0.9397	10	0.49607	T	0.09	.	14.3286	0.66537	0.0:0.9283:0.0:0.0717	.	399;303	Q8TBB1;Q8TBB1-2	LNX1_HUMAN;.	H	303;237;399	ENSP00000302879:R303H;ENSP00000263925:R399H	ENSP00000263925:R399H	R	-	2	0	LNX1	54057101	1.000000	0.71417	1.000000	0.80357	0.317000	0.28152	5.593000	0.67550	1.443000	0.47586	0.561000	0.74099	CGC	LNX1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000072201		0.522	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNX1	HGNC	protein_coding	OTTHUMT00000219934.2	-	0.00	50	0	C			54362344	-1	tier1	-	no_errors	ENST00000263925	ensembl	human	known	74_37	missense	29.27	29	12	SNP	1.000	T
PLXDC1	57125	genome.wustl.edu	37	17	37237377	37237377	+	Intron	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:37237377G>T	ENST00000315392.4	-	10	1201				PLXDC1_ENST00000539608.1_Intron|CTD-2206N4.4_ENST00000583447.1_RNA|PLXDC1_ENST00000444911.2_Intron|PLXDC1_ENST00000493200.1_Intron|AC091178.1_ENST00000410562.1_RNA	NM_020405.4	NP_065138.2	Q8IUK5	PLDX1_HUMAN	plexin domain containing 1						angiogenesis (GO:0001525)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)	receptor activity (GO:0004872)			kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						ctgggatcctggttccagagg	0.473																																																	0																																										SO:0001627	intron_variant	0			AF279144	CCDS11333.1	17q21.1	2006-04-12			ENSG00000161381	ENSG00000161381			20945	protein-coding gene	gene with protein product	"""tumor endothelial marker 7 precursor"""	606826				10947988, 11559528	Standard	NM_020405		Approved	TEM3, TEM7	uc002hrg.2	Q8IUK5	OTTHUMG00000133183	ENST00000315392.4:c.990-1960C>A	17.37:g.37237377G>T			B2R7I8|Q5QCZ7|Q5QCZ8|Q5QCZ9|Q9HCT9	RNA	SNP	-	NULL	ENST00000315392.4	37	NULL	CCDS11333.1	17																																																																																			CTD-2206N4.4	-	-	ENSG00000263818		0.473	PLXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100131347	Clone_based_vega_gene	protein_coding	OTTHUMT00000256892.2	-	0.00	34	0	G	NM_020405		37237377	+1	tier1	-	no_errors	ENST00000583447	ensembl	human	known	74_37	rna	9.09	40	4	SNP	0.005	T
EHBP1	23301	genome.wustl.edu	37	2	63272536	63272537	+	Intron	DNP	GA	GA	TT			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G|A	G|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:63272536_63272537GA>TT	ENST00000263991.5	+	25	4087				EHBP1_ENST00000405015.3_Intron|AC009501.4_ENST00000437346.1_RNA|EHBP1_ENST00000354487.3_Intron|EHBP1_ENST00000496857.1_Intron|AC009501.4_ENST00000429952.1_RNA|AC009501.4_ENST00000412297.1_RNA|EHBP1_ENST00000405289.1_Intron|AC009501.4_ENST00000413549.1_RNA|EHBP1_ENST00000431489.1_Intron	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1							cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			CTGTTTGTCTGACATCCAGGGC	0.5																																																	0																																										SO:0001627	intron_variant	0			AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	Exception_encountered	2.37:g.63272536_63272537delinsTT			O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	RNA	SNP	-	NULL	ENST00000263991.5	37	NULL	CCDS1872.1	2																																																																																			AC009501.4	-	-	ENSG00000231609		0.500	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100132215	Clone_based_vega_gene	protein_coding	OTTHUMT00000251616.1	-	0.00	73|71	0	G|A	NM_015252		63272536|63272537	-1	tier1	-	no_errors	ENST00000412297	ensembl	human	known	74_37	rna	30.00|29.51	42|43	18	SNP	0.989|0.990	T
MAZ	4150	genome.wustl.edu	37	16	29822000	29822001	+	3'UTR	INS	-	-	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:29822000_29822001insG	ENST00000322945.6	+	0	2047_2048				MAZ_ENST00000563402.1_3'UTR|PRRT2_ENST00000358758.7_5'Flank|AC009133.14_ENST00000563806.1_RNA|AC009133.20_ENST00000569039.1_RNA|MAZ_ENST00000562337.1_3'UTR|MAZ_ENST00000568544.1_3'UTR|AC009133.14_ENST00000569981.1_RNA|AC009133.15_ENST00000566537.1_RNA|MAZ_ENST00000219782.6_3'UTR|MAZ_ENST00000545521.1_3'UTR|PRRT2_ENST00000567659.1_5'Flank|MAZ_ENST00000568282.1_3'UTR|MAZ_ENST00000566906.2_3'UTR|PRRT2_ENST00000300797.6_5'Flank	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						TTTTTTTTCCAGGGGGAGGGAG	0.584																																					Colon(72;875 1167 15364 30899 37091)												0																																										SO:0001624	3_prime_UTR_variant	0			M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.*449->G	16.37:g.29822005_29822005dupG			A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	RNA	INS	-	NULL	ENST00000322945.6	37	NULL	CCDS42143.1	16																																																																																			AC009133.14	-	-	ENSG00000238045		0.584	MAZ-001	KNOWN	basic|CCDS	protein_coding	LOC100289283	Clone_based_vega_gene	protein_coding	OTTHUMT00000435536.1		0.00	25	0	-	NM_002383		29822001	-1	tier1		no_errors	ENST00000569981	ensembl	human	known	74_37	rna	23.53	13	4	INS	0.978:0.992	G
POTEM	641455	genome.wustl.edu	37	14	20010484	20010484	+	Intron	SNP	A	A	G	rs201730464		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr14:20010484A>G	ENST00000551509.1	-	5	969				RNU6-1268P_ENST00000391214.1_RNA|RP11-244H18.1_ENST00000547584.1_lincRNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M											endometrium(4)|kidney(1)|lung(4)	9						CTACTAATTTAAAGTCCTTTG	0.353																																																	0																																										SO:0001627	intron_variant	0				CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.918-244T>C	14.37:g.20010484A>G				RNA	SNP	-	NULL	ENST00000551509.1	37	NULL	CCDS45076.1	14																																																																																			RP11-244H18.1	-	-	ENSG00000258276		0.353	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LOC100508046	Clone_based_vega_gene	protein_coding	OTTHUMT00000409490.3	-	0.00	19	0	A	NM_001145442		20010484	+1	tier1	rs201730464	no_errors	ENST00000547584	ensembl	human	known	74_37	rna	32.26	21	10	SNP	0.325	G
RP11-435B5.5	0	genome.wustl.edu	37	1	143398884	143398884	+	lincRNA	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:143398884C>A	ENST00000428624.1	+	0	2490				RP11-435B5.4_ENST00000423249.1_lincRNA																							TCTCTAGAATCCACGGGTAAG	0.318																																																	0																																												0																															1.37:g.143398884C>A				RNA	SNP	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			RP11-435B5.5	-	-	ENSG00000238261		0.318	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1	-	0.00	83	0	C			143398884	+1	tier1	-	no_errors	ENST00000428624	ensembl	human	known	74_37	rna	11.11	152	19	SNP	0.001	A
MGAT4D	152586	genome.wustl.edu	37	4	141377824	141377825	+	Frame_Shift_Ins	INS	-	-	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr4:141377824_141377825insA	ENST00000503109.2	-	9	925_926	c.926_927insT	c.(925-927)ttafs	p.L309fs	RP11-542P2.1_ENST00000511113.1_Frame_Shift_Ins_p.L309fs|RP11-542P2.1_ENST00000515354.1_Frame_Shift_Ins_p.L101fs|RP11-542P2.1_ENST00000511632.1_5'UTR																							TGTAGAACATTAAAAAAAACCG	0.332																																																	0																																										SO:0001589	frameshift_variant	0																														ENST00000503109.2:c.927dupT	4.37:g.141377832_141377832dupA	ENSP00000426225:p.Leu309fs			Frame_Shift_Ins	INS	pfam_Glyco_transf_54	p.L309fs	ENST00000503109.2	37	c.927_926		4																																																																																			RP11-542P2.1	-	pfam_Glyco_transf_54	ENSG00000205301		0.332	RP11-542P2.1-008	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	LOC152586	Clone_based_vega_gene	protein_coding	OTTHUMT00000369949.1		0.00	36	0	-			141377825	-1	tier1		no_errors	ENST00000511113	ensembl	human	putative	74_37	frame_shift_ins	35.00	39	21	INS	0.993:0.985	A
AADACL2-AS1	101928142	genome.wustl.edu	37	3	151488343	151488343	+	RNA	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:151488343G>T	ENST00000483843.2	-	0	499				RP11-454C18.2_ENST00000475855.1_RNA|RP11-64D22.2_ENST00000483636.1_RNA																							AGATAATATTGAGGAACTCTG	0.373																																																	0																																												0																															3.37:g.151488343G>T				RNA	SNP	-	NULL	ENST00000483843.2	37	NULL		3																																																																																			RP11-64D22.2	-	-	ENSG00000240602		0.373	RP11-454C18.2-001	KNOWN	basic	antisense	LOC201651	Clone_based_vega_gene	antisense	OTTHUMT00000357888.2	-	0.00	54	0	G			151488343	+1	tier1	-	no_errors	ENST00000463420	ensembl	human	known	74_37	rna	5.26	72	4	SNP	0.971	T
LRP1B	53353	genome.wustl.edu	37	2	141299445	141299445	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:141299445C>T	ENST00000389484.3	-	44	8261	c.7290G>A	c.(7288-7290)cgG>cgA	p.R2430R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2430					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACTTGTTGGACCGCAGTATAG	0.433										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													150.0	137.0	142.0					2																	141299445		2203	4299	6502	SO:0001819	synonymous_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.7290G>A	2.37:g.141299445C>T			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.R2430	ENST00000389484.3	37	c.7290	CCDS2182.1	2																																																																																			LRP1B	-	smart_LDLR_classB_rpt	ENSG00000168702		0.433	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	62	0	C	NM_018557		141299445	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	silent	30.65	43	19	SNP	0.996	T
LRP5	4041	genome.wustl.edu	37	11	68183887	68183887	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:68183887G>A	ENST00000294304.7	+	13	3025	c.2919G>A	c.(2917-2919)ctG>ctA	p.L973L		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	973	Beta-propeller 4.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TCCTGCCCCTGCATGGACTGA	0.577																																																	0													108.0	93.0	98.0					11																	68183887		2200	4294	6494	SO:0001819	synonymous_variant	0			AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.2919G>A	11.37:g.68183887G>A			Q96TD6|Q9UES7|Q9UP66	Silent	SNP	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.L973	ENST00000294304.7	37	c.2919	CCDS8181.1	11																																																																																			LRP5	-	pirsf_Low_density_Lipo_rcpt-rel_p5/6,smart_LDLR_classB_rpt	ENSG00000162337		0.577	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP5	HGNC	protein_coding	OTTHUMT00000395088.1		0.00	57	0	G	NM_002335		68183887	+1			no_errors	ENST00000294304	ensembl	human	known	74_37	silent	7.69	36	3	SNP	0.997	A
LRRC37A11P	342666	genome.wustl.edu	37	17	37187981	37187981	+	RNA	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:37187981G>T	ENST00000425901.2	+	0	1823					NR_033753.2				leucine rich repeat containing 37, member A11, pseudogene																		TAAGGAGGTTGTAGCTCAACC	0.493																																																	0																																												0					17q12	2013-05-14			ENSG00000214553	ENSG00000214553			43815	pseudogene	pseudogene							Standard	NR_033753		Approved		uc002hrd.1		OTTHUMG00000133184		17.37:g.37187981G>T				RNA	SNP	-	NULL	ENST00000425901.2	37	NULL		17																																																																																			LRRC37A11P	-	-	ENSG00000214553		0.493	LRRC37A11P-002	KNOWN	basic	processed_transcript	LRRC37A11P	HGNC	pseudogene	OTTHUMT00000444105.1	-	0.00	51	0	G	NR_033753		37187981	+1	tier1	-	no_errors	ENST00000425901	ensembl	human	known	74_37	rna	31.65	54	25	SNP	0.001	T
LRRC43	254050	genome.wustl.edu	37	12	122676049	122676049	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:122676049G>A	ENST00000339777.4	+	6	1052	c.1024G>A	c.(1024-1026)Gtg>Atg	p.V342M	LRRC43_ENST00000425921.1_Missense_Mutation_p.V157M	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	342										NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		CAACTATTACGTGACCTATGA	0.542											OREG0022219	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													81.0	81.0	81.0					12																	122676049		1906	4111	6017	SO:0001583	missense	0			AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.1024G>A	12.37:g.122676049G>A	ENSP00000344233:p.Val342Met	1520	Q6ZVT9	Missense_Mutation	SNP	NULL	p.V342M	ENST00000339777.4	37	c.1024	CCDS45001.1	12	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663068	0.67700	.	.	ENSG00000158113	ENST00000339777;ENST00000289014;ENST00000425921	T;T	0.69175	-0.38;0.09	5.39	5.39	0.77823	.	0.085942	0.48767	D	0.000178	T	0.79811	0.4510	L	0.57536	1.79	0.46478	D	0.999069	D	0.89917	1.0	D	0.87578	0.998	T	0.78112	-0.2331	9	.	.	.	-47.0621	18.772	0.91896	0.0:0.0:1.0:0.0	.	342	Q8N309	LRC43_HUMAN	M	342;213;157	ENSP00000344233:V342M;ENSP00000416628:V157M	.	V	+	1	0	LRRC43	121242002	1.000000	0.71417	0.989000	0.46669	0.266000	0.26442	6.804000	0.75186	2.548000	0.85928	0.591000	0.81541	GTG	LRRC43	-	NULL	ENSG00000158113		0.542	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC43	HGNC	protein_coding	OTTHUMT00000401589.1	-	0.00	73	0	G	NM_152759		122676049	+1	tier1	-	no_errors	ENST00000339777	ensembl	human	known	74_37	missense	56.76	32	42	SNP	1.000	A
LRRC56	115399	genome.wustl.edu	37	11	552588	552588	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:552588C>T	ENST00000270115.7	+	13	1701	c.1201C>T	c.(1201-1203)Ccg>Tcg	p.P401S		NM_198075.3	NP_932341.1	Q8IYG6	LRC56_HUMAN	leucine rich repeat containing 56	401										kidney(1)|lung(4)|skin(1)	6		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTATAGGCACCCGGAGTCCCA	0.667																																																	0													17.0	18.0	18.0					11																	552588		2181	4289	6470	SO:0001583	missense	0				CCDS7700.1	11p15.5	2005-10-18			ENSG00000161328	ENSG00000161328			25430	protein-coding gene	gene with protein product						12477932	Standard	NM_198075		Approved	FLJ00101, DKFZp761L1518	uc010qvz.2	Q8IYG6	OTTHUMG00000132003	ENST00000270115.7:c.1201C>T	11.37:g.552588C>T	ENSP00000270115:p.Pro401Ser		Q8N3Q4	Missense_Mutation	SNP	NULL	p.P401S	ENST00000270115.7	37	c.1201	CCDS7700.1	11	.	.	.	.	.	.	.	.	.	.	C	5.377	0.254825	0.10185	.	.	ENSG00000161328	ENST00000270115	T	0.07216	3.21	3.85	-0.646	0.11472	.	1.662950	0.04290	N	0.345283	T	0.04048	0.0113	N	0.08118	0	0.09310	N	1	B	0.20671	0.047	B	0.15052	0.012	T	0.40887	-0.9539	10	0.14656	T	0.56	-34.4566	5.0925	0.14715	0.5036:0.3898:0.0:0.1067	.	401	Q8IYG6	LRC56_HUMAN	S	401	ENSP00000270115:P401S	ENSP00000270115:P401S	P	+	1	0	LRRC56	542588	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	0.152000	0.16302	-0.208000	0.10171	0.561000	0.74099	CCG	LRRC56	-	NULL	ENSG00000161328		0.667	LRRC56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC56	HGNC	protein_coding	OTTHUMT00000254969.1	-	0.00	247	0	C	NM_198075		552588	+1	tier1	-	no_errors	ENST00000270115	ensembl	human	known	74_37	missense	27.27	96	36	SNP	0.000	T
LRRCC1	85444	genome.wustl.edu	37	8	86019616	86019616	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr8:86019616T>G	ENST00000360375.3	+	1	235	c.86T>G	c.(85-87)aTg>aGg	p.M29R	LRRCC1_ENST00000414626.2_5'Flank	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	29					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						GTATGCTTCATGGACAAAGGC	0.682																																																	0													34.0	50.0	45.0					8																	86019616		1963	4142	6105	SO:0001583	missense	0			BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.86T>G	8.37:g.86019616T>G	ENSP00000353538:p.Met29Arg		B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin	p.M29R	ENST00000360375.3	37	c.86	CCDS43750.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.98|13.98	2.399734|2.399734	0.42512|0.42512	.|.	.|.	ENSG00000133739|ENSG00000133739	ENST00000360375|ENST00000426019	T|.	0.29917|.	1.55|.	4.46|4.46	4.46|4.46	0.54185|0.54185	.|.	0.186554|.	0.26304|.	N|.	0.025157|.	T|T	0.32376|0.32376	0.0827|0.0827	N|N	0.04063|0.04063	-0.285|-0.285	0.80722|0.80722	D|D	1|1	P|P	0.46706|0.51791	0.883|0.948	B|P	0.34779|0.52514	0.189|0.701	T|T	0.05468|0.05468	-1.0883|-1.0883	10|8	0.62326|0.14252	D|T	0.03|0.57	-6.3419|-6.3419	10.412|10.412	0.44299|0.44299	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	29|5	Q9C099|E9PE41	LRCC1_HUMAN|.	R|G	29|5	ENSP00000353538:M29R|.	ENSP00000353538:M29R|ENSP00000400370:W5G	M|W	+|+	2|1	0|0	LRRCC1|LRRCC1	86206868|86206868	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	3.779000|3.779000	0.55379|0.55379	2.235000|2.235000	0.73313|0.73313	0.459000|0.459000	0.35465|0.35465	ATG|TGG	LRRCC1	-	NULL	ENSG00000133739		0.682	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRCC1	HGNC	protein_coding	OTTHUMT00000380267.1	-	0.00	85	0	T	NM_033402		86019616	+1	tier1	-	no_errors	ENST00000360375	ensembl	human	known	74_37	missense	27.08	35	13	SNP	1.000	G
LRRK2	120892	genome.wustl.edu	37	12	40693029	40693029	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:40693029G>C	ENST00000298910.7	+	25	3524	c.3466G>C	c.(3466-3468)Gag>Cag	p.E1156Q	LRRK2_ENST00000343742.2_Missense_Mutation_p.E1156Q	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1156					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TCCTAAAGTGGAGAGTTTCAG	0.428																																																	0													177.0	189.0	185.0					12																	40693029		2203	4300	6503	SO:0001583	missense	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.3466G>C	12.37:g.40693029G>C	ENSP00000298910:p.Glu1156Gln		A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.E1156Q	ENST00000298910.7	37	c.3466	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	G	23.0	4.357275	0.82243	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.25085	2.18;1.82	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.35653	0.0939	N	0.16066	0.365	0.53688	D	0.999972	D;D	0.89917	1.0;0.996	D;P	0.80764	0.994;0.886	T	0.32295	-0.9912	10	0.44086	T	0.13	.	18.5602	0.91097	0.0:0.0:1.0:0.0	.	1156;1156	E9PC85;Q5S007	.;LRRK2_HUMAN	Q	1156	ENSP00000341930:E1156Q;ENSP00000298910:E1156Q	ENSP00000298910:E1156Q	E	+	1	0	LRRK2	38979296	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.812000	0.86109	2.360000	0.80028	0.313000	0.20887	GAG	LRRK2	-	NULL	ENSG00000188906		0.428	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	-	0.00	64	0	G	XM_058513		40693029	+1	tier1	-	no_errors	ENST00000298910	ensembl	human	known	74_37	missense	38.89	44	28	SNP	1.000	C
LRRN1	57633	genome.wustl.edu	37	3	3886434	3886434	+	Missense_Mutation	SNP	G	G	A	rs375458276		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:3886434G>A	ENST00000319331.3	+	2	870	c.109G>A	c.(109-111)Gta>Ata	p.V37I	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	37	LRRNT.					integral component of membrane (GO:0016021)				NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		ACAACTTTGCGTATGTGAAAT	0.453																																																	0								G	ILE/VAL	2,4404	2.1+/-5.4	0,2,2201	137.0	125.0	129.0		109	5.8	0.2	3		129	0,8600		0,0,4300	no	missense	LRRN1	NM_020873.5	29	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	37/717	3886434	2,13004	2203	4300	6503	SO:0001583	missense	0			AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.109G>A	3.37:g.3886434G>A	ENSP00000314901:p.Val37Ile		Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V37I	ENST00000319331.3	37	c.109	CCDS33685.1	3	.	.	.	.	.	.	.	.	.	.	G	26.1	4.704691	0.88924	4.54E-4	0.0	ENSG00000175928	ENST00000319331	T	0.22134	1.97	5.76	5.76	0.90799	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.45316	0.1336	L	0.58810	1.83	0.58432	D	0.999999	D	0.89917	1.0	D	0.79108	0.992	T	0.06991	-1.0796	10	0.37606	T	0.19	.	19.9759	0.97304	0.0:0.0:1.0:0.0	.	37	Q6UXK5	LRRN1_HUMAN	I	37	ENSP00000314901:V37I	ENSP00000314901:V37I	V	+	1	0	LRRN1	3861434	1.000000	0.71417	0.181000	0.23098	0.977000	0.68977	7.797000	0.85911	2.713000	0.92767	0.655000	0.94253	GTA	LRRN1	-	NULL	ENSG00000175928		0.453	LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRN1	HGNC	protein_coding	OTTHUMT00000337704.2	-	0.00	53	0	G	NM_020873		3886434	+1	tier1	-	no_errors	ENST00000319331	ensembl	human	known	74_37	missense	35.53	49	27	SNP	1.000	A
LSS	4047	genome.wustl.edu	37	21	47627461	47627461	+	Missense_Mutation	SNP	C	C	T	rs375698498		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr21:47627461C>T	ENST00000397728.3	-	15	1426	c.1348G>A	c.(1348-1350)Ggc>Agc	p.G450S	LSS_ENST00000457828.2_Missense_Mutation_p.G370S|LSS_ENST00000356396.4_Missense_Mutation_p.G450S|LSS_ENST00000522411.1_Missense_Mutation_p.G439S	NM_001145436.1|NM_002340.5	NP_001138908.1|NP_002331.3	P48449	ERG7_HUMAN	lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)	450					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|lipid particle (GO:0005811)|membrane (GO:0016020)	lanosterol synthase activity (GO:0000250)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	21	Breast(49;0.214)					ACGATCCAGCCGCAGTCCAGC	0.612													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18186	0.0		0.0	False		,,,				2504	0.0				Pancreas(114;955 2313 34923 50507)												0								C	SER/GLY,SER/GLY,SER/GLY,SER/GLY	1,4405	2.1+/-5.4	0,1,2202	91.0	74.0	80.0		1348,1315,1108,1348	5.2	1.0	21		80	0,8600		0,0,4300	no	missense,missense,missense,missense	LSS	NM_001001438.2,NM_001145436.1,NM_001145437.1,NM_002340.5	56,56,56,56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	450/733,439/722,370/653,450/733	47627461	1,13005	2203	4300	6503	SO:0001583	missense	0			U22526	CCDS13733.1, CCDS46654.1, CCDS54489.1	21q22.3	1998-05-07			ENSG00000160285	ENSG00000160285	5.4.99.7		6708	protein-coding gene	gene with protein product		600909				7639730, 8655142	Standard	NM_001001438		Approved	OSC	uc002zij.3	P48449	OTTHUMG00000090633	ENST00000397728.3:c.1348G>A	21.37:g.47627461C>T	ENSP00000380837:p.Gly450Ser		B4DJZ9|D3DSN0|E9PEI9|G5E9Q9|Q8IYL6|Q9UEZ1	Missense_Mutation	SNP	pfam_Prenyltrans,superfamily_Terpenoid_cyclase/PrenylTrfase,tigrfam_Squalene_cyclase	p.G450S	ENST00000397728.3	37	c.1348	CCDS13733.1	21	.	.	.	.	.	.	.	.	.	.	C	32	5.116721	0.94385	2.27E-4	0.0	ENSG00000160285	ENST00000356396;ENST00000457828;ENST00000397728;ENST00000522411	T;T;T;T	0.38240	1.15;1.15;1.15;1.15	5.2	5.2	0.72013	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.000000	0.85682	D	0.000000	T	0.67135	0.2861	M	0.87269	2.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.71354	-0.4618	10	0.59425	D	0.04	.	19.2296	0.93833	0.0:1.0:0.0:0.0	.	439;450	E9PEI9;P48449	.;ERG7_HUMAN	S	450;370;450;439	ENSP00000348762:G450S;ENSP00000409191:G370S;ENSP00000380837:G450S;ENSP00000429133:G439S	ENSP00000348762:G450S	G	-	1	0	LSS	46451889	1.000000	0.71417	1.000000	0.80357	0.584000	0.36387	5.731000	0.68554	2.814000	0.96858	0.655000	0.94253	GGC	LSS	-	superfamily_Terpenoid_cyclase/PrenylTrfase,tigrfam_Squalene_cyclase	ENSG00000160285		0.612	LSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSS	HGNC	protein_coding	OTTHUMT00000207274.2	-	0.00	117	0	C			47627461	-1	tier1	-	no_errors	ENST00000356396	ensembl	human	known	74_37	missense	38.75	49	31	SNP	1.000	T
MAP3K12	7786	genome.wustl.edu	37	12	53877411	53877411	+	Silent	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:53877411G>T	ENST00000267079.2	-	10	1581	c.1356C>A	c.(1354-1356)ctC>ctA	p.L452L	MAP3K12_ENST00000547035.1_Silent_p.L485L|MAP3K12_ENST00000547488.1_Silent_p.L485L|MAP3K12_ENST00000547151.1_5'Flank	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	452	Leucine-zipper 2.				histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.L452L(1)		NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						CCCTCTCCTTGAGTTCCAGCT	0.552																																																	1	Substitution - coding silent(1)	NS(1)											158.0	138.0	145.0					12																	53877411		2203	4300	6503	SO:0001819	synonymous_variant	0			U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.1356C>A	12.37:g.53877411G>T			B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Silent	SNP	pirsf_MAP3K12_MAP3K13,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L452	ENST00000267079.2	37	c.1356	CCDS8860.1	12																																																																																			MAP3K12	-	pirsf_MAP3K12_MAP3K13	ENSG00000139625		0.552	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP3K12	HGNC	protein_coding	OTTHUMT00000406267.1		0.00	13	0	G	NM_006301		53877411	-1			no_errors	ENST00000267079	ensembl	human	known	74_37	silent	9.52	19	2	SNP	0.999	T
MDC1	9656	genome.wustl.edu	37	6	30672262	30672262	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:30672262C>G	ENST00000376406.3	-	10	5345	c.4698G>C	c.(4696-4698)aaG>aaC	p.K1566N	MDC1_ENST00000376405.2_Missense_Mutation_p.K1302N|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1566	Interaction with the PRKDC complex.				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						ATTCAGGGGTCTTGACAGAGG	0.592								Other conserved DNA damage response genes																																									0													130.0	144.0	139.0					6																	30672262		2203	4300	6503	SO:0001583	missense	0			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.4698G>C	6.37:g.30672262C>G	ENSP00000365588:p.Lys1566Asn		A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_BRCT_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_BRCT_dom,pfscan_FHA_dom	p.K1566N	ENST00000376406.3	37	c.4698	CCDS34384.1	6	.	.	.	.	.	.	.	.	.	.	C	13.50	2.254896	0.39896	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	T;T	0.14022	2.54;2.54	4.26	0.405	0.16361	.	.	.	.	.	T	0.12689	0.0308	M	0.70275	2.135	0.09310	N	1	B;D	0.63046	0.374;0.992	B;P	0.58210	0.283;0.835	T	0.08066	-1.0740	9	0.40728	T	0.16	-5.2109	6.9526	0.24554	0.0:0.6049:0.0:0.3951	.	1302;1566	Q14676-2;Q14676	.;MDC1_HUMAN	N	1566;1302;1279;1132	ENSP00000365588:K1566N;ENSP00000365587:K1302N	ENSP00000365587:K1302N	K	-	3	2	MDC1	30780241	0.000000	0.05858	0.000000	0.03702	0.490000	0.33462	-0.001000	0.12947	0.058000	0.16222	0.449000	0.29647	AAG	MDC1	-	NULL	ENSG00000137337		0.592	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDC1	HGNC	protein_coding	OTTHUMT00000076103.1	-	0.00	78	0	C	NM_014641		30672262	-1	tier1	-	no_errors	ENST00000376406	ensembl	human	known	74_37	missense	38.24	42	26	SNP	0.000	G
MAP3K4	4216	genome.wustl.edu	37	6	161514016	161514016	+	Silent	SNP	G	G	A	rs369504568		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:161514016G>A	ENST00000392142.4	+	14	3424	c.3276G>A	c.(3274-3276)gcG>gcA	p.A1092A	MAP3K4_ENST00000348824.7_Silent_p.A1092A|MAP3K4_ENST00000366920.2_Silent_p.A1092A|MAP3K4_ENST00000366919.2_Silent_p.A1092A	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1092					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		CCAGGTGGGCGACTCAAGGAT	0.338																																																	0								G	,	1,4405	2.1+/-5.4	0,1,2202	155.0	139.0	145.0		3276,3276	-5.8	1.0	6		145	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	MAP3K4	NM_005922.2,NM_006724.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	1092/1609,1092/1559	161514016	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.3276G>A	6.37:g.161514016G>A			A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A1092	ENST00000392142.4	37	c.3276	CCDS34565.1	6																																																																																			MAP3K4	-	NULL	ENSG00000085511		0.338	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K4	HGNC	protein_coding	OTTHUMT00000042988.3	-	0.00	57	0	G			161514016	+1	tier1	-	no_errors	ENST00000392142	ensembl	human	known	74_37	silent	46.00	54	46	SNP	1.000	A
MEGF10	84466	genome.wustl.edu	37	5	126732405	126732405	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:126732405G>C	ENST00000274473.6	+	7	861	c.594G>C	c.(592-594)caG>caC	p.Q198H	MEGF10_ENST00000503335.2_Missense_Mutation_p.Q198H|MEGF10_ENST00000418761.2_Missense_Mutation_p.Q198H|MEGF10_ENST00000508365.1_Missense_Mutation_p.Q198H	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	198	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		GCCAGTGCCAGAATGGAGCCA	0.642																																																	0													56.0	57.0	57.0					5																	126732405		2203	4300	6503	SO:0001583	missense	0			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.594G>C	5.37:g.126732405G>C	ENSP00000274473:p.Gln198His		Q68DE5|Q8WUL3	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_EGF_extracell,superfamily_Proteinase_amylase_inhib_dom,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.Q198H	ENST00000274473.6	37	c.594	CCDS4142.1	5	.	.	.	.	.	.	.	.	.	.	G	9.072	0.997184	0.19043	.	.	ENSG00000145794	ENST00000503335;ENST00000508365;ENST00000418761;ENST00000274473	T;T;T;T	0.15952	2.38;2.38;2.38;2.38	5.63	5.63	0.86233	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000001	T	0.17577	0.0422	L	0.45698	1.435	0.58432	D	0.999999	B;B	0.15141	0.008;0.012	B;B	0.20184	0.028;0.009	T	0.02173	-1.1201	10	0.36615	T	0.2	-12.7987	12.9473	0.58379	0.0739:0.0:0.9261:0.0	.	198;198	Q96KG7-2;Q96KG7	.;MEG10_HUMAN	H	198	ENSP00000423354:Q198H;ENSP00000423195:Q198H;ENSP00000416284:Q198H;ENSP00000274473:Q198H	ENSP00000274473:Q198H	Q	+	3	2	MEGF10	126760304	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.088000	0.41663	2.656000	0.90262	0.655000	0.94253	CAG	MEGF10	-	pfam_EGF_extracell,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom	ENSG00000145794		0.642	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF10	HGNC	protein_coding	OTTHUMT00000250973.2		0.00	100	0	G	NM_032446		126732405	+1			no_errors	ENST00000274473	ensembl	human	known	74_37	missense	6.82	41	3	SNP	1.000	C
MERTK	10461	genome.wustl.edu	37	2	112786094	112786094	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:112786094G>T	ENST00000295408.4	+	19	2910	c.2653G>T	c.(2653-2655)Gcc>Tcc	p.A885S	MERTK_ENST00000421804.2_Missense_Mutation_p.A885S|MERTK_ENST00000409780.1_Missense_Mutation_p.A709S			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	885					apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						TGAGGGCCTGGCCCAGGGCTC	0.537																																																	0													129.0	132.0	131.0					2																	112786094		2203	4300	6503	SO:0001583	missense	0			U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.2653G>T	2.37:g.112786094G>T	ENSP00000295408:p.Ala885Ser		Q9HBB4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Rhodanese-like_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A885S	ENST00000295408.4	37	c.2653	CCDS2094.1	2	.	.	.	.	.	.	.	.	.	.	G	11.99	1.802218	0.31869	.	.	ENSG00000153208	ENST00000295408;ENST00000421804;ENST00000393237;ENST00000409780;ENST00000449344	T;T;T;D	0.83914	-0.92;-0.92;-0.89;-1.78	5.73	2.91	0.33838	.	0.252497	0.20450	U	0.092101	T	0.76807	0.4039	M	0.64997	1.995	0.09310	N	1	B	0.20887	0.049	B	0.22386	0.039	T	0.65240	-0.6216	10	0.41790	T	0.15	-4.5217	4.2848	0.10850	0.3609:0.1625:0.4766:0.0	.	885	Q12866	MERTK_HUMAN	S	885;885;544;709;209	ENSP00000295408:A885S;ENSP00000389152:A885S;ENSP00000387277:A709S;ENSP00000412660:A209S	ENSP00000295408:A885S	A	+	1	0	MERTK	112502565	0.014000	0.17966	0.001000	0.08648	0.570000	0.35934	1.957000	0.40392	0.332000	0.23536	0.655000	0.94253	GCC	MERTK	-	superfamily_Rhodanese-like_dom	ENSG00000153208		0.537	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MERTK	HGNC	protein_coding	OTTHUMT00000254046.2	-	0.00	53	0	G			112786094	+1	tier1	-	no_errors	ENST00000295408	ensembl	human	known	74_37	missense	41.67	35	25	SNP	0.001	T
METTL5	29081	genome.wustl.edu	37	2	170681016	170681016	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:170681016G>T	ENST00000260953.5	-	1	408	c.92C>A	c.(91-93)aCc>aAc	p.T31N	METTL5_ENST00000410097.1_Missense_Mutation_p.T31N|METTL5_ENST00000409837.1_Missense_Mutation_p.T31N|METTL5_ENST00000409965.1_Missense_Mutation_p.T31N|UBR3_ENST00000272793.5_5'Flank|METTL5_ENST00000308099.3_Missense_Mutation_p.T31N|METTL5_ENST00000392640.2_Missense_Mutation_p.T31N|METTL5_ENST00000409340.1_Missense_Mutation_p.T31N	NM_014168.2	NP_054887.2	Q9NRN9	METL5_HUMAN	methyltransferase like 5	31							methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			breast(2)|central_nervous_system(1)|large_intestine(5)|lung(1)|prostate(1)	10						GTGCGGCCTGGTAGGATACTG	0.463											OREG0015052	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													163.0	161.0	162.0					2																	170681016		2203	4300	6503	SO:0001583	missense	0			AF201938	CCDS33320.1	2q31.1	2011-01-28			ENSG00000138382	ENSG00000138382			25006	protein-coding gene	gene with protein product						11042152	Standard	XM_005246478		Approved	HSPC133	uc002ufn.3	Q9NRN9	OTTHUMG00000154117	ENST00000260953.5:c.92C>A	2.37:g.170681016G>T	ENSP00000260953:p.Thr31Asn	1887	D3DPC9|Q9NVX1	Missense_Mutation	SNP	pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_RNA_methylase_dom,pfam_RNA_MeTrfase_RsmD,pfam_RNA_cap_Gua-N2-MeTrfase,pfam_Methyltransf_11	p.T31N	ENST00000260953.5	37	c.92	CCDS33320.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.499577	0.96355	.	.	ENSG00000138382	ENST00000409837;ENST00000540464;ENST00000409340;ENST00000260953;ENST00000409965;ENST00000392640;ENST00000308099;ENST00000410097;ENST00000538491	T;T;T;T;T;T;T	0.60040	0.64;0.22;0.64;0.64;0.64;0.64;0.64	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.85186	0.5639	H	0.96943	3.91	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	D	0.89836	0.3999	10	0.87932	D	0	-6.4611	19.6816	0.95965	0.0:0.0:1.0:0.0	.	31;31	B8ZZC8;Q9NRN9	.;METL5_HUMAN	N	31	ENSP00000386703:T31N;ENSP00000387106:T31N;ENSP00000260953:T31N;ENSP00000386582:T31N;ENSP00000376415:T31N;ENSP00000307903:T31N;ENSP00000387056:T31N	ENSP00000260953:T31N	T	-	2	0	METTL5	170389262	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.607000	0.98328	2.632000	0.89209	0.557000	0.71058	ACC	METTL5	-	NULL	ENSG00000138382		0.463	METTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	METTL5	HGNC	protein_coding	OTTHUMT00000333957.1	-	0.00	63	0	G	NM_014168		170681016	-1	tier1	-	no_errors	ENST00000260953	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
MICU2	221154	genome.wustl.edu	37	13	22067385	22067385	+	3'UTR	SNP	T	T	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr13:22067385T>C	ENST00000382374.4	-	0	1373				MICU2_ENST00000479790.1_5'UTR	NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2						mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										ATTATATCTTTTATTAAAAAA	0.284																																																	0													87.0	88.0	88.0					13																	22067385		2201	4295	6496	SO:0001624	3_prime_UTR_variant	0			AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.*3A>G	13.37:g.22067385T>C			Q8N0T6|Q8NAX8	RNA	SNP	-	NULL	ENST00000382374.4	37	NULL	CCDS9297.1	13																																																																																			MICU2	-	-	ENSG00000165487		0.284	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICU2	HGNC	protein_coding	OTTHUMT00000144355.1	-	0.00	31	0	T	NM_152726		22067385	-1	tier1	-	no_errors	ENST00000460488	ensembl	human	known	74_37	rna	35.90	50	28	SNP	0.343	C
MIEF2	125170	genome.wustl.edu	37	17	18166719	18166719	+	Intron	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:18166719C>A	ENST00000323019.4	+	3	521				MIEF2_ENST00000578621.1_Intron|MIEF2_ENST00000395703.4_Missense_Mutation_p.S156Y|MIEF2_ENST00000577216.1_Intron|MIEF2_ENST00000578174.1_Intron|MIEF2_ENST00000395706.2_Intron|MIEF2_ENST00000395704.4_Intron	NM_001144900.1|NM_139162.3	NP_001138372.1|NP_631901.2	Q96C03	MID49_HUMAN	mitochondrial elongation factor 2						mitochondrion organization (GO:0007005)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)											ttgccctgTTCCTGGAGCAAG	0.542																																																	0																																										SO:0001627	intron_variant	0			BC014973	CCDS11193.1, CCDS45624.1, CCDS45625.1	17p11.2	2013-09-23	2013-09-23	2013-09-23	ENSG00000177427	ENSG00000177427			17920	protein-coding gene	gene with protein product		615498	"""Smith-Magenis syndrome chromosome region, candidate 7"""	SMCR7		11997338, 21508961	Standard	NM_001144900		Approved	MGC23130, MiD49	uc010vxq.2	Q96C03	OTTHUMG00000059392	ENST00000323019.4:c.310+157C>A	17.37:g.18166719C>A			J3KPT3|Q6ZRD4|Q96N07	Missense_Mutation	SNP	NULL	p.S156Y	ENST00000323019.4	37	c.467	CCDS11193.1	17	.	.	.	.	.	.	.	.	.	.	C	1.836	-0.468625	0.04445	.	.	ENSG00000177427	ENST00000395703	T	0.35789	1.29	2.58	1.48	0.22813	.	.	.	.	.	T	0.27933	0.0688	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.22695	-1.0209	5	.	.	.	.	7.0472	0.25052	0.4843:0.5157:0.0:0.0	.	.	.	.	Y	156	ENSP00000379055:S156Y	.	S	+	2	0	SMCR7	18107444	0.000000	0.05858	0.003000	0.11579	0.004000	0.04260	-2.447000	0.01010	0.423000	0.26033	-0.521000	0.04368	TCC	MIEF2	-	NULL	ENSG00000177427		0.542	MIEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIEF2	HGNC	protein_coding	OTTHUMT00000132060.2	-	0.00	21	0	C	NM_139162		18166719	+1	tier1	-	no_errors	ENST00000395703	ensembl	human	novel	74_37	missense	42.86	8	6	SNP	0.002	A
MIR380	494329	genome.wustl.edu	37	14	101491922	101491922	+	RNA	SNP	C	C	T	rs369301464		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr14:101491922C>T	ENST00000362112.2	-	0	0				MIR758_ENST00000390227.1_RNA|MIR329-1_ENST00000385028.1_RNA|MIR411_ENST00000362239.2_RNA|MIR323A_ENST00000362199.1_RNA|MIR1197_ENST00000408818.1_RNA|MIR299_ENST00000385016.2_RNA|MIR329-2_ENST00000385029.1_RNA	NR_029872.1				microRNA 380																		TTTGAAGATGCGGTTGACCAT	0.483																																																	0								C		0,3136		0,0,1568	218.0	196.0	203.0			3.9	1.0	14		203	1,7163		0,1,3581	no	intergenic				0,1,5149	TT,TC,CC		0.014,0.0,0.0097			101491922	1,10299	1568	3582	5150			0					14q32.31	2013-02-12		2008-12-18		ENSG00000198982		"""ncRNAs / Micro RNAs"""	31873	non-coding RNA	RNA, micro		613654		MIRN380			Standard	NR_029872		Approved	hsa-mir-380	uc010awb.1				14.37:g.101491922C>T				RNA	SNP	-	NULL	ENST00000362112.2	37	NULL		14																																																																																			MIR1197	-	-	ENSG00000221745		0.483	MIR380-201	KNOWN	basic	miRNA	MIR1197	HGNC	miRNA			0.00	52	0	C	NR_029872		101491922	+1			no_errors	ENST00000408818	ensembl	human	known	74_37	rna	5.06	75	4	SNP	1.000	T
MIR194-2	406970	genome.wustl.edu	37	11	64658835	64658835	+	lincRNA	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:64658835C>T	ENST00000601517.1	-	0	0				MIR194-2_ENST00000384864.1_lincRNA|MIR192_ENST00000384915.1_RNA																							TACTGGCCCTCGCCCCAGATA	0.647																																																	0													12.0	14.0	13.0					11																	64658835		1561	3575	5136			0																															11.37:g.64658835C>T				RNA	SNP	-	NULL	ENST00000601517.1	37	NULL		11																																																																																			MIR194-2	-	-	ENSG00000229719		0.647	RP11-665N17.4-001	KNOWN	basic	lincRNA	MIR194-2	HGNC	lincRNA	OTTHUMT00000464673.1	-	0.00	74	0	C			64658835	-1	tier1	-	no_errors	ENST00000384864	ensembl	human	known	74_37	rna	38.64	27	17	SNP	0.845	T
C9orf3	84909	genome.wustl.edu	37	9	97847577	97847577	+	Intron	SNP	C	C	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr9:97847577C>G	ENST00000375315.2	+	16	2464				MIR3074_ENST00000384885.2_RNA|MIR23B_ENST00000384832.1_RNA|MIR27B_ENST00000385129.1_RNA|C9orf3_ENST00000297979.5_Intron	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3						leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		CACGCAACCACGACCTTGGCT	0.532																																																	0													33.0	34.0	34.0					9																	97847577		1563	3573	5136	SO:0001627	intron_variant	0			AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.2458-1387C>G	9.37:g.97847577C>G			Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	RNA	SNP	-	NULL	ENST00000375315.2	37	NULL	CCDS55328.1	9																																																																																			MIR23B	-	-	ENSG00000207563		0.532	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR23B	HGNC	protein_coding		-	0.00	59	0	C	NM_032823		97847577	+1	tier1	-	no_errors	ENST00000384832	ensembl	human	known	74_37	rna	25.00	21	7	SNP	0.676	G
MKI67	4288	genome.wustl.edu	37	10	129910413	129910413	+	Silent	SNP	C	C	T	rs142241283		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:129910413C>T	ENST00000368654.3	-	9	2328	c.1953G>A	c.(1951-1953)tcG>tcA	p.S651S	MKI67_ENST00000368653.3_Silent_p.S291S|MKI67_ENST00000484853.1_5'UTR	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	651					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.S651S(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GATTTGCTTCCGAAGCACCAC	0.358																																																	1	Substitution - coding silent(1)	endometrium(1)						C	,	1,4405	2.1+/-5.4	0,1,2202	81.0	79.0	80.0		873,1953	-8.9	0.1	10	dbSNP_134	80	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	MKI67	NM_001145966.1,NM_002417.4	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	291/2897,651/3257	129910413	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.1953G>A	10.37:g.129910413C>T			Q5VWH2	Silent	SNP	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.S651	ENST00000368654.3	37	c.1953	CCDS7659.1	10																																																																																			MKI67	-	NULL	ENSG00000148773		0.358	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1	-	0.00	36	0	C	NM_002417		129910413	-1	tier1	rs142241283	no_errors	ENST00000368654	ensembl	human	known	74_37	silent	31.58	52	24	SNP	0.352	T
MLLT4	4301	genome.wustl.edu	37	6	168323558	168323558	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:168323558C>T	ENST00000447894.2	+	21	2910	c.2910C>T	c.(2908-2910)caC>caT	p.H970H	MLLT4_ENST00000400822.3_Silent_p.H969H|MLLT4_ENST00000351017.4_Silent_p.H977H|MLLT4_ENST00000344191.4_Silent_p.H970H|MLLT4_ENST00000392112.1_Silent_p.H954H|MLLT4_ENST00000392108.3_Silent_p.H970H|MLLT4_ENST00000366806.2_Silent_p.H970H			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	970					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TAATTCCTCACACACGTTCAC	0.388			T	MLL	AL																																			Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	0													172.0	159.0	164.0					6																	168323558		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.2910C>T	6.37:g.168323558C>T			O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Silent	SNP	pfam_Ras-assoc,pfam_Dil_domain,pfam_PDZ,pfam_FHA_dom,superfamily_PDZ,superfamily_SMAD_FHA_domain,smart_Ras-assoc,smart_FHA_dom,smart_PDZ,pfscan_Dilute,pfscan_PDZ,pfscan_Ras-assoc	p.H970	ENST00000447894.2	37	c.2910		6																																																																																			MLLT4	-	NULL	ENSG00000130396		0.388	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	MLLT4	HGNC	protein_coding	OTTHUMT00000372077.1	-	0.00	22	0	C	NM_005936		168323558	+1	tier1	-	no_errors	ENST00000366806	ensembl	human	known	74_37	silent	38.30	29	18	SNP	0.272	T
MOCOS	55034	genome.wustl.edu	37	18	33795865	33795865	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr18:33795865C>T	ENST00000261326.5	+	8	1743	c.1722C>T	c.(1720-1722)gtC>gtT	p.V574V		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						CTGCAGGAGTCCTGGAGGGGG	0.517																																																	0													37.0	41.0	39.0					18																	33795865		2203	4300	6503	SO:0001819	synonymous_variant	0			AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.1722C>T	18.37:g.33795865C>T				Silent	SNP	pfam_MOSC_N,pfam_MoCF_Sase_C,pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase,superfamily_Pyrv_Knase-like_insert_dom	p.V574	ENST00000261326.5	37	c.1722	CCDS11919.1	18																																																																																			MOCOS	-	NULL	ENSG00000075643		0.517	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOCOS	HGNC	protein_coding	OTTHUMT00000255801.1	-	0.00	27	0	C			33795865	+1	tier1	-	no_errors	ENST00000261326	ensembl	human	known	74_37	silent	27.59	21	8	SNP	0.000	T
MOSPD1	56180	genome.wustl.edu	37	X	134033227	134033227	+	Intron	DEL	T	T	-			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chrX:134033227delT	ENST00000370783.3	-	3	341				MOSPD1_ENST00000491609.1_Intron|MOSPD1_ENST00000370779.4_Intron|MOSPD1_ENST00000370777.1_Intron	NM_019556.1	NP_062456.1	Q9UJG1	MSPD1_HUMAN	motile sperm domain containing 1						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)	9	Acute lymphoblastic leukemia(192;0.000127)					GCCATTAGTGTTTTTTTTTTT	0.353																																																	0										79,762,2880		0,0,64,15,2,555,203,971,319	70.0	70.0	70.0			2.5	0.8	X		76	131,1554,4799		0,0,77,54,0,865,689,1415,1027	no	intron	MOSPD1	NM_019556.1		0,0,141,69,2,1420,892,2386,1346	A1A1,A1A2,A1R,A1,A2A2,A2R,A2,RR,R		25.987,22.6015,24.7526			134033227	210,2316,7679	2203	4300	6503	SO:0001627	intron_variant	0			Z83826	CCDS14645.1	Xq26.3	2008-02-05			ENSG00000101928	ENSG00000101928			25235	protein-coding gene	gene with protein product		300674				15533722	Standard	XM_005262446		Approved	dJ473B4	uc004eyb.3	Q9UJG1	OTTHUMG00000035315	ENST00000370783.3:c.155-32A>-	X.37:g.134033227delT			B2RE62|D3DTG5|Q5H9C5|Q5H9C7	RNA	DEL	-	NULL	ENST00000370783.3	37	NULL	CCDS14645.1	X																																																																																			MOSPD1	-	-	ENSG00000101928		0.353	MOSPD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MOSPD1	HGNC	protein_coding	OTTHUMT00000085439.1		0.00	33	0	T	NM_019556		134033227	-1	tier1		no_errors	ENST00000462060	ensembl	human	known	74_37	rna	9.80	46	5	DEL	0.001	-
MRPS25	64432	genome.wustl.edu	37	3	15106578	15106578	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:15106578C>T	ENST00000253686.2	-	1	264	c.124G>A	c.(124-126)Gag>Aag	p.E42K	MRPS25_ENST00000444840.2_Missense_Mutation_p.E42K|MRPS25_ENST00000449354.2_Missense_Mutation_p.E42K	NM_022497.3	NP_071942.1	P82663	RT25_HUMAN	mitochondrial ribosomal protein S25	42						mitochondrion (GO:0005739)|ribosome (GO:0005840)				large_intestine(1)|lung(1)	2						CTGGCGCCCTCGCCCAGCTCC	0.642																																																	0													50.0	36.0	41.0					3																	15106578		2201	4299	6500	SO:0001583	missense	0			AB061208	CCDS2622.1	3p25	2012-09-13			ENSG00000131368	ENSG00000131368		"""Mitochondrial ribosomal proteins / small subunits"""	14511	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S25"""	611987				11279123	Standard	NM_022497		Approved	MRP-S25, FLJ00023, DKFZp313H0817, RPMS25	uc003bzl.3	P82663	OTTHUMG00000129836	ENST00000253686.2:c.124G>A	3.37:g.15106578C>T	ENSP00000253686:p.Glu42Lys		B4DFJ5|B4DQG6|Q9H7P5	Missense_Mutation	SNP	pfam_Ribosome/NADH_DH,superfamily_Thioredoxin-like_fold,smart_Ribosome/NADH_DH	p.E42K	ENST00000253686.2	37	c.124	CCDS2622.1	3	.	.	.	.	.	.	.	.	.	.	C	18.30	3.593178	0.66219	.	.	ENSG00000131368	ENST00000253686;ENST00000449354;ENST00000444840	.	.	.	4.85	4.85	0.62838	Ribosomal protein/NADH dehydrogenase domain (1);Thioredoxin-like fold (1);	0.151008	0.64402	D	0.000017	T	0.37785	0.1016	L	0.39514	1.22	0.80722	D	1	B;P;B	0.44429	0.291;0.835;0.051	B;B;B	0.28916	0.032;0.096;0.018	T	0.33163	-0.9879	9	0.15499	T	0.54	-44.8643	17.5974	0.88016	0.0:1.0:0.0:0.0	.	42;42;42	B4DFJ5;B4DQG6;P82663	.;.;RT25_HUMAN	K	42	.	ENSP00000253686:E42K	E	-	1	0	MRPS25	15081582	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	5.655000	0.67981	2.231000	0.72958	0.313000	0.20887	GAG	MRPS25	-	superfamily_Thioredoxin-like_fold,smart_Ribosome/NADH_DH	ENSG00000131368		0.642	MRPS25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS25	HGNC	protein_coding	OTTHUMT00000252076.2	-	0.00	127	0	C	NM_022497		15106578	-1	tier1	-	no_errors	ENST00000253686	ensembl	human	known	74_37	missense	14.55	47	8	SNP	1.000	T
MTMR4	9110	genome.wustl.edu	37	17	56582201	56582201	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:56582201C>T	ENST00000323456.5	-	12	1362	c.1238G>A	c.(1237-1239)cGc>cAc	p.R413H	MTMR4_ENST00000579925.1_Missense_Mutation_p.R413H	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	413	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.|Substrate binding. {ECO:0000250}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTGCGGTGTGCGGTCCCAGCC	0.532																																																	0													131.0	124.0	127.0					17																	56582201		2203	4300	6503	SO:0001583	missense	0			AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.1238G>A	17.37:g.56582201C>T	ENSP00000325285:p.Arg413His		D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	pfam_Myotubularin-like_Pase_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Tyr/Dual-sp_Pase	p.R413H	ENST00000323456.5	37	c.1238	CCDS11608.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.211568	0.95069	.	.	ENSG00000108389	ENST00000323456	D	0.91740	-2.9	5.58	4.61	0.57282	Myotubularin phosphatase domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);	0.050255	0.85682	N	0.000000	D	0.97892	0.9307	H	0.99600	4.65	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98781	1.0732	10	0.87932	D	0	.	13.7194	0.62717	0.0:0.9259:0.0:0.0741	.	413	Q9NYA4	MTMR4_HUMAN	H	413	ENSP00000325285:R413H	ENSP00000325285:R413H	R	-	2	0	MTMR4	53937200	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.776000	0.85560	1.503000	0.48686	0.591000	0.81541	CGC	MTMR4	-	pfscan_Tyr/Dual-sp_Pase	ENSG00000108389		0.532	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR4	HGNC	protein_coding	OTTHUMT00000444721.1	-	0.00	126	0	C	NM_004687		56582201	-1	tier1	-	no_errors	ENST00000323456	ensembl	human	known	74_37	missense	7.79	71	6	SNP	1.000	T
MUC12	10071	genome.wustl.edu	37	7	100634034	100634034	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:100634034G>A	ENST00000379442.3	+	5	619	c.619G>A	c.(619-621)Gca>Aca	p.A207T	MUC12_ENST00000536621.1_Missense_Mutation_p.A64T			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	207	Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						GGGCTCAACTGCAACAAAACA	0.498																																																	0													153.0	138.0	142.0					7																	100634034		692	1591	2283	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.619G>A	7.37:g.100634034G>A	ENSP00000368755:p.Ala207Thr		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.A64T	ENST00000379442.3	37	c.190		7	.	.	.	.	.	.	.	.	.	.	-	4.599	0.111337	0.08831	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12774	2.65;2.65	0.381	0.381	0.16228	.	.	.	.	.	T	0.06234	0.0161	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.43310	-0.9399	7	0.23891	T	0.37	.	6.5502	0.22429	2.0E-4:0.0:0.9998:0.0	.	.	.	.	T	207;64	ENSP00000368755:A207T;ENSP00000441929:A64T	ENSP00000368755:A207T	A	+	1	0	MUC12	100420754	0.000000	0.05858	0.009000	0.14445	0.052000	0.14988	-0.120000	0.10660	0.436000	0.26393	0.173000	0.16961	GCA	MUC12	-	NULL	ENSG00000205277		0.498	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	80	0	G	XM_379904		100634034	+1	tier1	-	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	33.33	66	33	SNP	0.062	A
MUC12	10071	genome.wustl.edu	37	7	100637915	100637916	+	Missense_Mutation	DNP	CA	CA	AG			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C|A	C|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:100637915_100637916CA>AG	ENST00000379442.3	+	5	4500_4501	c.4500_4501CA>AG	c.(4498-4503)caCAgc>caAGgc	p.1500_1501HS>QG	MUC12_ENST00000536621.1_Missense_Mutation_p.1357_1358HS>QG			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1500	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CAACTTCCCACAGCAGCCAAGG	0.559																																																	0																																										SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	Exception_encountered	7.37:g.100637915_100637916delinsAG	ENSP00000368755:p.H1500_S1501delinsQG		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.H1357Q|p.S1358G	ENST00000379442.3	37	c.4071|c.4072		7																																																																																			MUC12	-	NULL	ENSG00000205277		0.559	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	57|56	0	C|A	XM_379904		100637915|100637916	+1	tier1	-	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	79.55|79.07	9	35|34	SNP	0.003|0.019	A|G
MUC13	56667	genome.wustl.edu	37	3	124627023	124627023	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:124627023G>A	ENST00000311075.3	-	11	1545	c.1507C>T	c.(1507-1509)Cac>Tac	p.H503Y		NM_033049.3	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, cell surface associated	504			R -> S (in dbSNP:rs1127233). {ECO:0000269|PubMed:12975309}.		cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)|stomach(1)	18						ATGCTGCTGTGTCTTGAATAG	0.537																																																	0													121.0	103.0	109.0					3																	124627023		2203	4300	6503	SO:0001583	missense	0			AF286113		3q21.2	2007-01-17	2006-03-14		ENSG00000173702	ENSG00000173702		"""Mucins"""	7511	protein-coding gene	gene with protein product		612181	"""down-regulated in colon cancer 1"", ""mucin 13, epithelial transmembrane"""	DRCC1		11278439	Standard	NM_033049		Approved		uc003ehq.2	Q9H3R2	OTTHUMG00000159484	ENST00000311075.3:c.1507C>T	3.37:g.124627023G>A	ENSP00000312235:p.His503Tyr		Q6UWD9|Q9NXT5	Missense_Mutation	SNP	pfam_SEA_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom	p.H503Y	ENST00000311075.3	37	c.1507		3	.	.	.	.	.	.	.	.	.	.	G	10.57	1.386170	0.25031	.	.	ENSG00000173702	ENST00000311075	T	0.16324	2.35	4.06	3.18	0.36537	.	1.087100	0.07216	N	0.860016	T	0.16300	0.0392	L	0.42245	1.32	0.09310	N	1	B	0.31100	0.308	B	0.29353	0.101	T	0.23368	-1.0190	10	0.49607	T	0.09	0.3257	7.8915	0.29680	0.1114:0.0:0.8886:0.0	.	503	Q9H3R2	MUC13_HUMAN	Y	503	ENSP00000312235:H503Y	ENSP00000312235:H503Y	H	-	1	0	MUC13	126109713	0.002000	0.14202	0.013000	0.15412	0.001000	0.01503	0.618000	0.24373	1.305000	0.44909	0.563000	0.77884	CAC	MUC13	-	NULL	ENSG00000173702		0.537	MUC13-001	KNOWN	basic|appris_principal	protein_coding	MUC13	HGNC	protein_coding	OTTHUMT00000355714.1	-	0.00	42	0	G	NM_033049		124627023	-1	tier1	-	no_errors	ENST00000311075	ensembl	human	known	74_37	missense	27.45	37	14	SNP	0.014	A
MUC16	94025	genome.wustl.edu	37	19	9085519	9085519	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:9085519G>T	ENST00000397910.4	-	1	6499	c.6296C>A	c.(6295-6297)tCt>tAt	p.S2099Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2099	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTTAGCAGCAGATGTGGATGC	0.473																																																	0													170.0	164.0	166.0					19																	9085519		1912	4122	6034	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.6296C>A	19.37:g.9085519G>T	ENSP00000381008:p.Ser2099Tyr		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.S2099Y	ENST00000397910.4	37	c.6296	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	0.837	-0.743368	0.03088	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	0.235	0.235	0.15431	.	.	.	.	.	T	0.04048	0.0113	N	0.08118	0	.	.	.	D	0.58970	0.984	D	0.63877	0.919	T	0.45293	-0.9271	7	0.87932	D	0	.	.	.	.	.	2099	B5ME49	.	Y	2099	ENSP00000381008:S2099Y	ENSP00000381008:S2099Y	S	-	2	0	MUC16	8946519	0.007000	0.16637	0.087000	0.20705	0.089000	0.18198	0.780000	0.26760	0.308000	0.22923	0.313000	0.20887	TCT	MUC16	-	NULL	ENSG00000181143		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	60	0	G	NM_024690		9085519	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	30.77	54	24	SNP	0.113	T
MYADM	91663	genome.wustl.edu	37	19	54377604	54377604	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:54377604C>T	ENST00000391769.2	+	3	1101	c.821C>T	c.(820-822)tCg>tTg	p.S274L	MYADM_ENST00000391770.4_Missense_Mutation_p.S274L|MYADM_ENST00000391768.2_Missense_Mutation_p.S274L|AC008440.5_ENST00000413496.2_RNA|MYADM_ENST00000391771.1_Missense_Mutation_p.S274L|MYADM_ENST00000336967.3_Missense_Mutation_p.S274L	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	274	MARVEL 2. {ECO:0000255|PROSITE- ProRule:PRU00581}.				establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		CCTCGGCGCTCGAGAGATGTA	0.622																																																	0													47.0	43.0	45.0					19																	54377604		2203	4300	6503	SO:0001583	missense	0			AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.821C>T	19.37:g.54377604C>T	ENSP00000375649:p.Ser274Leu		B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	Missense_Mutation	SNP	pfam_Marvel	p.S274L	ENST00000391769.2	37	c.821	CCDS12866.1	19	.	.	.	.	.	.	.	.	.	.	C	8.609	0.888670	0.17540	.	.	ENSG00000179820	ENST00000336967;ENST00000391770;ENST00000391771;ENST00000415619;ENST00000391769;ENST00000391768	T;T;T;T;T	0.26810	1.71;1.71;1.71;1.71;1.71	3.78	-2.24	0.06909	Marvel (1);MARVEL-like domain (1);	1.186040	0.06432	N	0.724400	T	0.20780	0.0500	M	0.62723	1.935	0.09310	N	1	B	0.21688	0.059	B	0.19391	0.025	T	0.34675	-0.9819	10	0.11182	T	0.66	-12.3108	4.4664	0.11691	0.1225:0.3692:0.4106:0.0977	.	274	Q96S97	MYADM_HUMAN	L	274;274;274;237;274;274	ENSP00000337222:S274L;ENSP00000375650:S274L;ENSP00000375651:S274L;ENSP00000375649:S274L;ENSP00000375648:S274L	ENSP00000337222:S274L	S	+	2	0	MYADM	59069416	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.909000	0.04058	-0.230000	0.09840	0.305000	0.20034	TCG	MYADM	-	pfam_Marvel	ENSG00000179820		0.622	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYADM	HGNC	protein_coding	OTTHUMT00000134337.1	-	0.00	72	0	C	NM_138373		54377604	+1	tier1	-	no_errors	ENST00000336967	ensembl	human	known	74_37	missense	35.29	22	12	SNP	0.000	T
MYCBP2	23077	genome.wustl.edu	37	13	77657220	77657220	+	Silent	SNP	T	T	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr13:77657220T>G	ENST00000544440.2	-	63	10886	c.10869A>C	c.(10867-10869)tcA>tcC	p.S3623S	MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2-AS1_ENST00000422231.2_RNA|MYCBP2_ENST00000357337.6_Silent_p.S3623S|MYCBP2-AS1_ENST00000448470.2_RNA|MYCBP2_ENST00000407578.2_Silent_p.S3661S|MYCBP2-AS2_ENST00000428716.2_RNA|MYCBP2-AS1_ENST00000450627.2_RNA					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TCATAAGGTCTGAGATGGTCT	0.468																																																	0													189.0	171.0	177.0					13																	77657220		2203	4300	6503	SO:0001819	synonymous_variant	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.10869A>C	13.37:g.77657220T>G				Silent	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.S3661	ENST00000544440.2	37	c.10983		13																																																																																			MYCBP2	-	superfamily_ARM-type_fold	ENSG00000005810		0.468	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	-	0.00	56	0	T	NM_015057		77657220	-1	tier1	-	no_errors	ENST00000407578	ensembl	human	known	74_37	silent	45.16	34	28	SNP	0.032	G
MYH7	4625	genome.wustl.edu	37	14	23894041	23894041	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr14:23894041C>A	ENST00000355349.3	-	22	2778	c.2616G>T	c.(2614-2616)gaG>gaT	p.E872D		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	872					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TCTCCTCCAGCTCCTTGCGGC	0.582																																																	0													87.0	76.0	80.0					14																	23894041		2203	4300	6503	SO:0001583	missense	0			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2616G>T	14.37:g.23894041C>A	ENSP00000347507:p.Glu872Asp		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E872D	ENST00000355349.3	37	c.2616	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	C	20.4	3.977705	0.74360	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.85556	-2.0	4.73	0.904	0.19302	.	.	.	.	.	D	0.89501	0.6733	M	0.66560	2.04	0.47905	D	0.999544	D	0.69078	0.997	D	0.79108	0.992	D	0.87807	0.2629	9	0.66056	D	0.02	.	10.1646	0.42873	0.0:0.7097:0.0:0.2903	.	872	P12883	MYH7_HUMAN	D	872	ENSP00000347507:E872D	ENSP00000347507:E872D	E	-	3	2	MYH7	22963881	0.900000	0.30661	1.000000	0.80357	0.996000	0.88848	0.001000	0.13038	0.318000	0.23185	0.655000	0.94253	GAG	MYH7	-	NULL	ENSG00000092054		0.582	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	-	0.00	33	0	C	NM_000257		23894041	-1	tier1	-	no_errors	ENST00000355349	ensembl	human	known	74_37	missense	22.73	17	5	SNP	1.000	A
MYO1A	4640	genome.wustl.edu	37	12	57435072	57435072	+	Splice_Site	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:57435072C>A	ENST00000442789.2	-	15	1452	c.1165G>T	c.(1165-1167)Gat>Tat	p.D389Y	MYO1A_ENST00000476795.1_5'Flank|MYO1A_ENST00000300119.3_Splice_Site_p.D389Y|MYO1A_ENST00000544473.1_Splice_Site_p.D227Y	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	389	Myosin motor.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						AAGCTATTATCCTGAGAGAGG	0.498																																																	0													89.0	85.0	86.0					12																	57435072		2203	4300	6503	SO:0001630	splice_region_variant	0			L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.1165-1G>T	12.37:g.57435072C>A			Q9UQD7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.D389Y	ENST00000442789.2	37	c.1165	CCDS8929.1	12	.	.	.	.	.	.	.	.	.	.	C	19.28	3.796842	0.70567	.	.	ENSG00000166866	ENST00000300119;ENST00000442789;ENST00000544473	D;D;D	0.87491	-2.26;-2.26;-2.26	5.41	2.51	0.30379	Myosin head, motor domain (3);	0.231431	0.42420	D	0.000708	D	0.85344	0.5675	L	0.28740	0.885	0.48511	D	0.99966	D	0.52996	0.957	P	0.57057	0.812	D	0.83462	0.0054	10	0.72032	D	0.01	.	8.5274	0.33313	0.0:0.7335:0.0:0.2665	.	389	Q9UBC5	MYO1A_HUMAN	Y	389;389;227	ENSP00000300119:D389Y;ENSP00000393392:D389Y;ENSP00000440514:D227Y	ENSP00000300119:D389Y	D	-	1	0	MYO1A	55721339	1.000000	0.71417	0.998000	0.56505	0.752000	0.42762	2.064000	0.41432	0.323000	0.23307	0.491000	0.48974	GAT	MYO1A	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000166866		0.498	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYO1A	HGNC	protein_coding	OTTHUMT00000313833.2	-	0.00	26	0	C	NM_005379	Missense_Mutation	57435072	-1	tier1	-	no_errors	ENST00000300119	ensembl	human	known	74_37	missense	10.00	35	4	SNP	1.000	A
N4BP2	55728	genome.wustl.edu	37	4	40144359	40144359	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr4:40144359G>A	ENST00000261435.6	+	15	5268	c.4852G>A	c.(4852-4854)Gac>Aac	p.D1618N		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	1618					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						TGAGTACCCAGACTATGATGA	0.398																																																	0													103.0	102.0	102.0					4																	40144359		2203	4300	6503	SO:0001583	missense	0			AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.4852G>A	4.37:g.40144359G>A	ENSP00000261435:p.Asp1618Asn		A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	pfam_DUF1771,pfam_Smr/MutS2_C,superfamily_P-loop_NTPase,superfamily_UBA-like,smart_Smr/MutS2_C,pfscan_CUE,pfscan_Smr/MutS2_C	p.D1618N	ENST00000261435.6	37	c.4852	CCDS3457.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.48|10.48	1.362047|1.362047	0.24684|0.24684	.|.	.|.	ENSG00000078177|ENSG00000078177	ENST00000261435;ENST00000381804|ENST00000513269	T|.	0.19105|.	2.17|.	5.24|5.24	-0.718|-0.718	0.11205|0.11205	Domain of unknown function DUF1771 (1);|.	0.529813|.	0.19003|.	N|.	0.125287|.	T|T	0.31104|0.31104	0.0786|0.0786	L|L	0.34521|0.34521	1.04|1.04	0.09310|0.09310	N|N	1|1	B;B|.	0.24132|.	0.08;0.098|.	B;B|.	0.28011|.	0.051;0.085|.	T|T	0.30387|0.30387	-0.9980|-0.9980	10|5	0.56958|.	D|.	0.05|.	0.0032|0.0032	7.2745|7.2745	0.26275|0.26275	0.3169:0.218:0.4651:0.0|0.3169:0.218:0.4651:0.0	.|.	1601;1618|.	Q86UW6-2;Q86UW6|.	.;N4BP2_HUMAN|.	N|K	1618;1538|1247	ENSP00000261435:D1618N|.	ENSP00000261435:D1618N|.	D|R	+|+	1|2	0|0	N4BP2|N4BP2	39820754|39820754	0.011000|0.011000	0.17503|0.17503	0.000000|0.000000	0.03702|0.03702	0.408000|0.408000	0.30992|0.30992	1.452000|1.452000	0.35156|0.35156	-0.097000|-0.097000	0.12307|0.12307	0.462000|0.462000	0.41574|0.41574	GAC|AGA	N4BP2	-	pfam_DUF1771	ENSG00000078177		0.398	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP2	HGNC	protein_coding	OTTHUMT00000250458.2	-	0.00	52	0	G	NM_018177		40144359	+1	tier1	-	no_errors	ENST00000261435	ensembl	human	known	74_37	missense	39.47	46	30	SNP	0.000	A
NAALADL2	254827	genome.wustl.edu	37	3	175165132	175165132	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:175165132G>A	ENST00000454872.1	+	6	1334	c.1206G>A	c.(1204-1206)gcG>gcA	p.A402A	NAALADL2_ENST00000473253.1_3'UTR	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	402						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		AAAATGAAGCGTGTAGCTCTC	0.383																																																	0													56.0	52.0	53.0					3																	175165132		1875	4105	5980	SO:0001819	synonymous_variant	0				CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.1206G>A	3.37:g.175165132G>A			Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Silent	SNP	superfamily_TFR-like_dimer_dom	p.A402	ENST00000454872.1	37	c.1206	CCDS46960.1	3																																																																																			NAALADL2	-	NULL	ENSG00000177694		0.383	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALADL2	HGNC	protein_coding	OTTHUMT00000347390.2	-	0.00	31	0	G	NM_207015		175165132	+1	tier1	-	no_errors	ENST00000454872	ensembl	human	known	74_37	silent	35.71	27	15	SNP	0.385	A
NAV2	89797	genome.wustl.edu	37	11	19967974	19967974	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:19967974G>A	ENST00000396087.3	+	10	2342	c.2243G>A	c.(2242-2244)cGg>cAg	p.R748Q	NAV2_ENST00000540292.1_Missense_Mutation_p.R679Q|NAV2_ENST00000349880.4_Missense_Mutation_p.R725Q|NAV2_ENST00000396085.1_Missense_Mutation_p.R725Q|NAV2_ENST00000527559.2_Missense_Mutation_p.R677Q|NAV2_ENST00000360655.4_Missense_Mutation_p.R661Q	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	748					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						CGGCGGCTGCGGACAGTGAAG	0.483																																																	0													61.0	58.0	59.0					11																	19967974		2199	4293	6492	SO:0001583	missense	0			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.2243G>A	11.37:g.19967974G>A	ENSP00000379396:p.Arg748Gln		A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.R748Q	ENST00000396087.3	37	c.2243	CCDS58126.1	11	.	.	.	.	.	.	.	.	.	.	G	37	6.007041	0.97195	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292	T;T;T;T;T;T	0.14516	2.5;2.5;2.5;2.5;2.5;2.5	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000015	T	0.40297	0.1111	M	0.71206	2.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.01805	-1.1270	9	.	.	.	.	20.3242	0.98691	0.0:0.0:1.0:0.0	.	725;661	Q8IVL1-3;Q8IVL1-4	.;.	Q	661;725;725;748;677;679	ENSP00000353871:R661Q;ENSP00000379394:R725Q;ENSP00000309577:R725Q;ENSP00000379396:R748Q;ENSP00000435395:R677Q;ENSP00000443489:R679Q	.	R	+	2	0	NAV2	19924550	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.811000	0.96726	0.555000	0.69702	CGG	NAV2	-	NULL	ENSG00000166833		0.483	NAV2-001	KNOWN	basic|CCDS	protein_coding	NAV2	HGNC	protein_coding	OTTHUMT00000324112.1	-	0.00	77	0	G	NM_145117		19967974	+1	tier1	-	no_errors	ENST00000396087	ensembl	human	known	74_37	missense	36.62	45	26	SNP	1.000	A
NBPF12	149013	genome.wustl.edu	37	1	146465946	146465946	+	Missense_Mutation	SNP	C	C	T	rs200985386		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:146465946C>T	ENST00000442909.2	+	82	10657	c.9821C>T	c.(9820-9822)tCg>tTg	p.S3274L	NBPF12_ENST00000309471.8_3'UTR|NBPF12_ENST00000446760.2_3'UTR			Q5TAG4	NBPFC_HUMAN	neuroblastoma breakpoint family, member 12	212						cytoplasm (GO:0005737)				ovary(2)	2						AGATGTTATTCGACTCCATCA	0.453																																																	0																																										SO:0001583	missense	0			BG154169	CCDS72881.1	1q21.1	2013-01-17	2011-06-28	2011-06-28	ENSG00000186275	ENSG00000268043		"""neuroblastoma breakpoint family"""	24297	protein-coding gene	gene with protein product		608607	"""KIAA1245"""	KIAA1245		11948409	Standard	NM_001278141		Approved	COAS1		Q5TAG4	OTTHUMG00000043708	ENST00000442909.2:c.9821C>T	1.37:g.146465946C>T	ENSP00000391116:p.Ser3274Leu		O95877	Missense_Mutation	SNP	pfam_NBPF_dom	p.S3274L	ENST00000442909.2	37	c.9821		1	.	.	.	.	.	.	.	.	.	.	c	0.025	-1.376240	0.01214	.	.	ENSG00000186275	ENST00000442909	T	0.06849	3.25	0.59	-1.18	0.09617	.	.	.	.	.	T	0.00998	0.0033	L	0.38649	1.16	0.09310	N	0.999999	.	.	.	.	.	.	T	0.49437	-0.8940	6	0.02654	T	1	.	.	.	.	.	.	.	.	L	3274	ENSP00000391116:S3274L	ENSP00000391116:S3274L	S	+	2	0	NBPF12	144932569	0.210000	0.23517	0.002000	0.10522	0.064000	0.16182	-0.932000	0.03963	-1.192000	0.02691	0.162000	0.16502	TCG	NBPF12	-	pfam_NBPF_dom	ENSG00000186275		0.453	NBPF12-001	NOVEL	basic|appris_principal	protein_coding	NBPF12	HGNC	protein_coding	OTTHUMT00000102086.3	-	0.00	49	0	C	XM_003119146		146465946	+1	tier1	rs200985386	no_errors	ENST00000442909	ensembl	human	novel	74_37	missense	77.59	13	45	SNP	0.003	T
NCAM2	4685	genome.wustl.edu	37	21	22746285	22746285	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr21:22746285G>T	ENST00000400546.1	+	9	1396	c.1147G>T	c.(1147-1149)Gca>Tca	p.A383S	NCAM2_ENST00000535285.1_Missense_Mutation_p.A408S|NCAM2_ENST00000284894.7_Missense_Mutation_p.A241S	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	383	Ig-like C2-type 4.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		CTGTGAAGCTGCAAGCAGAAT	0.398																																																	0													168.0	161.0	164.0					21																	22746285		1916	4144	6060	SO:0001583	missense	0				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.1147G>T	21.37:g.22746285G>T	ENSP00000383392:p.Ala383Ser		A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom,prints_Neural_cell_adh	p.A383S	ENST00000400546.1	37	c.1147	CCDS42910.1	21	.	.	.	.	.	.	.	.	.	.	G	12.92	2.083176	0.36758	.	.	ENSG00000154654	ENST00000400546;ENST00000284894;ENST00000535285	T;T;T	0.66099	-0.19;-0.19;-0.19	5.54	5.54	0.83059	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.163816	0.56097	D	0.000038	T	0.48857	0.1523	N	0.00985	-1.075	0.42832	D	0.994029	D;D;D	0.58970	0.982;0.984;0.972	D;P;P	0.65684	0.937;0.846;0.664	T	0.54840	-0.8233	10	0.05833	T	0.94	-22.087	18.1211	0.89572	0.0:0.0:1.0:0.0	.	408;241;383	B7Z841;B7Z5K2;O15394	.;.;NCAM2_HUMAN	S	383;241;408	ENSP00000383392:A383S;ENSP00000284894:A241S;ENSP00000441887:A408S	ENSP00000284894:A241S	A	+	1	0	NCAM2	21668156	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.629000	0.67798	2.618000	0.88619	0.644000	0.83932	GCA	NCAM2	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000154654		0.398	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	HGNC	protein_coding	OTTHUMT00000170915.1	-	0.00	57	0	G	NM_004540		22746285	+1	tier1	-	no_errors	ENST00000400546	ensembl	human	known	74_37	missense	42.50	23	17	SNP	1.000	T
NCAPD3	23310	genome.wustl.edu	37	11	134073578	134073578	+	Missense_Mutation	SNP	G	G	A	rs201688313		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:134073578G>A	ENST00000534548.2	-	11	1503	c.1439C>T	c.(1438-1440)tCg>tTg	p.S480L		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	480					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GATACTCTCCGACGCACTGGT	0.488																																																	0								G	LEU/SER	0,4402		0,0,2201	54.0	54.0	54.0		1439	5.0	0.1	11		54	2,8592	2.2+/-6.3	0,2,4295	yes	missense	NCAPD3	NM_015261.2	145	0,2,6496	AA,AG,GG		0.0233,0.0,0.0154	benign	480/1499	134073578	2,12994	2201	4297	6498	SO:0001583	missense	0			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.1439C>T	11.37:g.134073578G>A	ENSP00000433681:p.Ser480Leu		A6NFS2|Q4KMQ9	Missense_Mutation	SNP	superfamily_ARM-type_fold,pirsf_NCAPD3	p.S480L	ENST00000534548.2	37	c.1439	CCDS31723.1	11	.	.	.	.	.	.	.	.	.	.	G	10.70	1.424113	0.25639	0.0	2.33E-4	ENSG00000151503	ENST00000534548	T	0.60424	0.19	5.88	4.97	0.65823	Armadillo-type fold (1);	0.187442	0.44097	D	0.000495	T	0.42449	0.1203	L	0.34521	1.04	0.21627	N	0.99962	B	0.16396	0.017	B	0.11329	0.006	T	0.13229	-1.0517	10	0.18710	T	0.47	-15.0758	9.9438	0.41596	0.2022:0.0:0.7978:0.0	.	480	P42695	CNDD3_HUMAN	L	480	ENSP00000433681:S480L	ENSP00000431612:S480L	S	-	2	0	NCAPD3	133578788	0.442000	0.25633	0.094000	0.20943	0.006000	0.05464	2.225000	0.42954	2.782000	0.95742	0.655000	0.94253	TCG	NCAPD3	-	superfamily_ARM-type_fold,pirsf_NCAPD3	ENSG00000151503		0.488	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD3	HGNC	protein_coding	OTTHUMT00000393575.2	-	0.00	63	0	G	NM_015261		134073578	-1	tier1	rs201688313	no_errors	ENST00000534548	ensembl	human	known	74_37	missense	38.10	39	24	SNP	0.007	A
NCOA2	10499	genome.wustl.edu	37	8	71075774	71075774	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr8:71075774G>T	ENST00000452400.2	-	8	939	c.758C>A	c.(757-759)gCa>gAa	p.A253E		NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	253					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			AACTCTTCTTGCCACGCAAAT	0.398			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																			Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	0													92.0	87.0	89.0					8																	71075774		1900	4118	6018	SO:0001583	missense	0			X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.758C>A	8.37:g.71075774G>T	ENSP00000399968:p.Ala253Glu		Q14CD2	Missense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.A253E	ENST00000452400.2	37	c.758	CCDS47872.1	8	.	.	.	.	.	.	.	.	.	.	G	31	5.072463	0.93950	.	.	ENSG00000140396	ENST00000452400	T	0.02446	4.29	6.17	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.17450	0.0419	M	0.82716	2.605	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00567	-1.1667	10	0.87932	D	0	.	15.6596	0.77174	0.0652:0.0:0.9348:0.0	.	253	Q15596	NCOA2_HUMAN	E	253	ENSP00000399968:A253E	ENSP00000399968:A253E	A	-	2	0	NCOA2	71238328	1.000000	0.71417	0.930000	0.37139	0.991000	0.79684	8.004000	0.88535	1.636000	0.50526	0.655000	0.94253	GCA	NCOA2	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000140396		0.398	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA2	HGNC	protein_coding	OTTHUMT00000379696.1	-	0.00	59	0	G			71075774	-1	tier1	-	no_errors	ENST00000452400	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
NDST3	9348	genome.wustl.edu	37	4	118975223	118975223	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr4:118975223G>A	ENST00000296499.5	+	2	561	c.158G>A	c.(157-159)gGc>gAc	p.G53D	NDST3_ENST00000433996.2_Missense_Mutation_p.G53D	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	53	Heparan sulfate N-deacetylase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						GTTGACTGTGGCGACCTCCAA	0.433																																																	0													116.0	114.0	114.0					4																	118975223		2203	4300	6503	SO:0001583	missense	0			AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.158G>A	4.37:g.118975223G>A	ENSP00000296499:p.Gly53Asp		B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.G53D	ENST00000296499.5	37	c.158	CCDS3708.1	4	.	.	.	.	.	.	.	.	.	.	G	13.65	2.300733	0.40694	.	.	ENSG00000164100	ENST00000296499;ENST00000433996	T;T	0.40756	1.35;1.02	5.67	4.82	0.62117	.	0.221006	0.46442	D	0.000293	T	0.48624	0.1510	M	0.65498	2.005	0.40420	D	0.979839	B;P;D	0.59357	0.005;0.635;0.985	B;B;P	0.48030	0.007;0.41;0.564	T	0.49615	-0.8921	10	0.21014	T	0.42	.	16.6721	0.85270	0.0:0.1299:0.8701:0.0	.	53;53;53	B4DI67;O95803;O95803-2	.;NDST3_HUMAN;.	D	53	ENSP00000296499:G53D;ENSP00000396625:G53D	ENSP00000296499:G53D	G	+	2	0	NDST3	119194671	0.969000	0.33509	0.981000	0.43875	0.452000	0.32318	1.707000	0.37888	1.382000	0.46385	0.650000	0.86243	GGC	NDST3	-	pfam_Heparan_SO4_deacetylase	ENSG00000164100		0.433	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST3	HGNC	protein_coding	OTTHUMT00000256517.4	-	0.00	34	0	G	NM_004784		118975223	+1	tier1	-	no_errors	ENST00000296499	ensembl	human	known	74_37	missense	42.11	22	16	SNP	0.976	A
NDST3	9348	genome.wustl.edu	37	4	118975378	118975378	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr4:118975378C>A	ENST00000296499.5	+	2	716	c.313C>A	c.(313-315)Cag>Aag	p.Q105K	NDST3_ENST00000433996.2_Missense_Mutation_p.Q105K	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	105	Heparan sulfate N-deacetylase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						AAGTAGATTCCAGTATCACAT	0.378																																																	0													51.0	51.0	51.0					4																	118975378		2203	4299	6502	SO:0001583	missense	0			AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.313C>A	4.37:g.118975378C>A	ENSP00000296499:p.Gln105Lys		B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.Q105K	ENST00000296499.5	37	c.313	CCDS3708.1	4	.	.	.	.	.	.	.	.	.	.	C	5.416	0.261978	0.10239	.	.	ENSG00000164100	ENST00000296499;ENST00000433996	T;T	0.39229	1.41;1.09	5.53	5.53	0.82687	.	0.329212	0.34484	N	0.003929	T	0.23451	0.0567	N	0.16098	0.37	0.29488	N	0.855823	B;B;B	0.13594	0.0;0.0;0.008	B;B;B	0.08055	0.003;0.001;0.003	T	0.08889	-1.0700	10	0.02654	T	1	.	14.3078	0.66395	0.1485:0.8515:0.0:0.0	.	105;105;105	B4DI67;O95803;O95803-2	.;NDST3_HUMAN;.	K	105	ENSP00000296499:Q105K;ENSP00000396625:Q105K	ENSP00000296499:Q105K	Q	+	1	0	NDST3	119194826	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.883000	0.56168	2.577000	0.86979	0.650000	0.86243	CAG	NDST3	-	pfam_Heparan_SO4_deacetylase	ENSG00000164100		0.378	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST3	HGNC	protein_coding	OTTHUMT00000256517.4		0.00	23	0	C	NM_004784		118975378	+1			no_errors	ENST00000296499	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	A
NEK3	4752	genome.wustl.edu	37	13	52718058	52718059	+	Missense_Mutation	DNP	CT	CT	TC			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C|T	C|T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr13:52718058_52718059CT>TC	ENST00000400357.2	-	9	2161_2162	c.868_869AG>GA	c.(868-870)AGa>GAa	p.R290E	NEK3_ENST00000452082.2_Missense_Mutation_p.R311E|NEK3_ENST00000339406.3_Missense_Mutation_p.R290E|NEK3_ENST00000378101.2_Missense_Mutation_p.R290E			P51956	NEK3_HUMAN	NIMA-related kinase 3	290					mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|stomach(2)	18		Breast(56;0.000207)|Lung NSC(96;0.00145)|Prostate(109;0.034)|Hepatocellular(98;0.065)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.81e-08)		TACTTTTTTTCTTGGTGTGTTA	0.248																																																	0																																										SO:0001583	missense	0			AK290259, BC019916	CCDS73576.1	13q14.2-q21.1	2014-07-17	2012-11-15		ENSG00000136098	ENSG00000136098	2.7.11.1		7746	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase NEK3"", ""phosphorylase B kinase kinase"", ""glycogen synthase A kinase"", ""hydroxyalkyl-protein kinase"""	604044	"""NIMA (never in mitosis gene a)-related kinase 3"""			8274451, 7522034	Standard	NM_002498		Approved	HSPK36, MGC29949	uc010tgy.2	P51956	OTTHUMG00000016958	ENST00000400357.2:c.868_869delinsTC	13.37:g.52718058_52718059delinsTC	ENSP00000383210:p.Arg290Glu		A8K2J4|Q5TAP2|Q8J023|Q8WUN5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R311K|p.R311G	ENST00000400357.2	37	c.932|c.931	CCDS53871.1	13																																																																																			NEK3	-	NULL	ENSG00000136098		0.248	NEK3-002	KNOWN	upstream_ATG|basic|CCDS	protein_coding	NEK3	HGNC	protein_coding	OTTHUMT00000045047.3		0.00	28	0	C|T			52718058|52718059	-1			no_errors	ENST00000452082	ensembl	human	known	74_37	missense	10.34|8.62	52|53	6|5	SNP	0.035|0.038	T|C
NEK4	6787	genome.wustl.edu	37	3	52773550	52773550	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:52773550G>A	ENST00000233027.5	-	14	2396	c.2194C>T	c.(2194-2196)Cca>Tca	p.P732S	NEK4_ENST00000535191.1_Missense_Mutation_p.P643S|NEK4_ENST00000383721.4_Missense_Mutation_p.P686S	NM_001193533.1|NM_003157.4	NP_001180462.1|NP_003148.2	P51957	NEK4_HUMAN	NIMA-related kinase 4	732					mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(10)	26				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)		TCTGACACTGGGTTTGCTACC	0.428																																																	0													203.0	203.0	203.0					3																	52773550		2203	4300	6503	SO:0001583	missense	0			L20321	CCDS2863.1, CCDS54593.1	3p21.1	2012-11-15	2012-11-15	2002-05-10	ENSG00000114904	ENSG00000114904	2.7.11.1		11399	protein-coding gene	gene with protein product	"""serine/threonine protein kinase-2"""	601959	"""serine/threonine kinase 2"", ""NIMA (never in mitosis gene a)-related kinase 4"""	STK2		8208544	Standard	NM_001193533		Approved	NRK2, pp12301	uc003dfq.4	P51957	OTTHUMG00000158836	ENST00000233027.5:c.2194C>T	3.37:g.52773550G>A	ENSP00000233027:p.Pro732Ser		A5YM70|B2R633|B7Z200|Q6P576	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P732S	ENST00000233027.5	37	c.2194	CCDS2863.1	3	.	.	.	.	.	.	.	.	.	.	G	12.87	2.067950	0.36470	.	.	ENSG00000114904	ENST00000233027;ENST00000535191;ENST00000383721;ENST00000461689	T;T;T;T	0.77229	-0.77;-0.87;-0.9;-1.08	5.87	4.06	0.47325	.	0.089967	0.49305	D	0.000155	D	0.84817	0.5556	M	0.72894	2.215	0.29653	N	0.843772	D;D;D	0.89917	0.997;1.0;0.972	P;D;P	0.74674	0.908;0.984;0.642	T	0.80616	-0.1303	10	0.72032	D	0.01	.	8.6539	0.34051	0.0774:0.0:0.7718:0.1508	.	643;686;732	B7Z200;P51957-2;P51957	.;.;NEK4_HUMAN	S	732;643;686;643	ENSP00000233027:P732S;ENSP00000437703:P643S;ENSP00000373227:P686S;ENSP00000419666:P643S	ENSP00000233027:P732S	P	-	1	0	NEK4	52748590	0.998000	0.40836	0.839000	0.33178	0.447000	0.32167	2.900000	0.48687	0.810000	0.34279	-0.142000	0.14014	CCA	NEK4	-	NULL	ENSG00000114904		0.428	NEK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEK4	HGNC	protein_coding	OTTHUMT00000352386.2	-	0.00	64	0	G	NM_003157		52773550	-1	tier1	-	no_errors	ENST00000233027	ensembl	human	known	74_37	missense	28.92	59	24	SNP	0.738	A
NEUROD4	58158	genome.wustl.edu	37	12	55420674	55420674	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:55420674G>T	ENST00000242994.3	+	2	829	c.451G>T	c.(451-453)Ggg>Tgg	p.G151W		NM_021191.2	NP_067014.2	Q9HD90	NDF4_HUMAN	neuronal differentiation 4	151					amacrine cell differentiation (GO:0035881)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch signaling pathway (GO:0007219)|positive regulation of cell differentiation (GO:0045597)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.G151R(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	41						GACACCTGAAGGGAAAGGCTT	0.507																																																	1	Substitution - Missense(1)	endometrium(1)											59.0	62.0	61.0					12																	55420674		2203	4300	6503	SO:0001583	missense	0			AF203901	CCDS8886.1	12q13.13	2013-05-21	2012-02-22			ENSG00000123307		"""Basic helix-loop-helix proteins"""	13802	protein-coding gene	gene with protein product		611635	"""neurogenic differentiation 4"""				Standard	NM_021191		Approved	Atoh3, ATH-3, MATH-3, bHLHa4	uc001sgp.4	Q9HD90		ENST00000242994.3:c.451G>T	12.37:g.55420674G>T	ENSP00000242994:p.Gly151Trp		B2RAC9	Missense_Mutation	SNP	pfam_Neurogenic_DUF,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pirsf_TF_bHLH_NeuroD,pfscan_bHLH_dom	p.G151W	ENST00000242994.3	37	c.451	CCDS8886.1	12	.	.	.	.	.	.	.	.	.	.	G	15.84	2.951607	0.53186	.	.	ENSG00000123307	ENST00000242994	T	0.63744	-0.06	5.7	5.7	0.88788	Neurogenic differentiation factor, domain of unknown function (1);Helix-loop-helix DNA-binding (1);	0.046027	0.85682	D	0.000000	T	0.71117	0.3302	L	0.44542	1.39	0.46954	D	0.999267	D	0.63046	0.992	D	0.72338	0.977	T	0.70475	-0.4861	10	0.52906	T	0.07	-36.8277	12.637	0.56689	0.0:0.0:0.8348:0.1652	.	151	Q9HD90	NDF4_HUMAN	W	151	ENSP00000242994:G151W	ENSP00000242994:G151W	G	+	1	0	NEUROD4	53706941	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.841000	0.55850	2.861000	0.98227	0.655000	0.94253	GGG	NEUROD4	-	pfam_Neurogenic_DUF,superfamily_bHLH_dom,pirsf_TF_bHLH_NeuroD	ENSG00000123307		0.507	NEUROD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROD4	HGNC	protein_coding	OTTHUMT00000406104.1		0.00	25	0	G			55420674	+1			no_errors	ENST00000242994	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
NFATC4	4776	genome.wustl.edu	37	14	24839449	24839449	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr14:24839449C>T	ENST00000250373.4	+	2	986	c.845C>T	c.(844-846)cCa>cTa	p.P282L	NFATC4_ENST00000555590.1_Missense_Mutation_p.P295L|NFATC4_ENST00000557451.1_Missense_Mutation_p.P212L|NFATC4_ENST00000413692.2_Missense_Mutation_p.P345L|NFATC4_ENST00000554966.1_Missense_Mutation_p.P295L|NFATC4_ENST00000556169.1_Missense_Mutation_p.P270L|NFATC4_ENST00000554591.1_Missense_Mutation_p.P345L|NFATC4_ENST00000555453.1_Missense_Mutation_p.P270L|NFATC4_ENST00000554473.1_5'Flank|NFATC4_ENST00000556759.1_5'Flank|NFATC4_ENST00000556279.1_Missense_Mutation_p.P314L|NFATC4_ENST00000555167.1_5'Flank|NFATC4_ENST00000554050.1_Missense_Mutation_p.P282L|NFATC4_ENST00000554344.1_Missense_Mutation_p.P212L|NFATC4_ENST00000422617.3_Missense_Mutation_p.P270L|NFATC4_ENST00000424781.2_Missense_Mutation_p.P295L|NFATC4_ENST00000553708.1_Missense_Mutation_p.P282L|NFATC4_ENST00000553469.1_Missense_Mutation_p.P314L|NFATC4_ENST00000553879.1_Missense_Mutation_p.P212L|NFATC4_ENST00000440487.2_3'UTR|NFATC4_ENST00000539237.2_Missense_Mutation_p.P314L|NFATC4_ENST00000554661.1_Missense_Mutation_p.P212L	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	282	2 approximate SP repeats.|Pro-rich.				cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		TCAGCCTCCCCAGCTCTGTCC	0.701																																																	0													16.0	19.0	18.0					14																	24839449		2198	4290	6488	SO:0001583	missense	0			BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.845C>T	14.37:g.24839449C>T	ENSP00000250373:p.Pro282Leu		B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Missense_Mutation	SNP	pfam_RHD,pfam_IPT,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.P345L	ENST00000250373.4	37	c.1034	CCDS9629.1	14	.	.	.	.	.	.	.	.	.	.	C	17.28	3.349002	0.61183	.	.	ENSG00000100968	ENST00000413692;ENST00000554591;ENST00000555590;ENST00000554966;ENST00000424781;ENST00000539237;ENST00000556279;ENST00000553469;ENST00000554050;ENST00000250373;ENST00000553708;ENST00000553879;ENST00000554344;ENST00000554661;ENST00000556169;ENST00000557451;ENST00000422617;ENST00000555453	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.13778	2.56;2.56;2.56;2.56;2.56;2.56;2.56;2.56;2.56;2.56;2.56;2.56;2.56;2.56;2.56;2.56;2.56;2.56	4.11	4.11	0.48088	.	0.148706	0.43919	D	0.000517	T	0.34861	0.0912	M	0.68952	2.095	0.80722	D	1	P;P;D;P;D;D;P;P;P;P;D;P;D;D	0.89917	0.936;0.936;1.0;0.936;1.0;1.0;0.936;0.936;0.936;0.936;1.0;0.895;1.0;1.0	P;P;D;P;D;D;P;P;P;P;D;P;D;D	0.91635	0.556;0.654;0.999;0.654;0.999;0.999;0.654;0.654;0.654;0.654;0.999;0.452;0.999;0.999	T	0.12372	-1.0550	10	0.87932	D	0	-3.9881	14.2256	0.65858	0.0:1.0:0.0:0.0	.	270;270;314;314;295;295;295;345;345;270;314;259;345;282	Q14934-17;Q14934-9;Q14934-14;Q14934-4;Q14934-15;Q14934-6;Q14934-7;Q14934-2;Q14934-3;Q14934-10;Q14934-5;B4DU09;Q14934-11;Q14934	.;.;.;.;.;.;.;.;.;.;.;.;.;NFAC4_HUMAN	L	345;345;295;295;295;314;314;314;282;282;282;212;212;212;270;212;270;270	ENSP00000388910:P345L;ENSP00000452039:P345L;ENSP00000451224:P295L;ENSP00000450644:P295L;ENSP00000388668:P295L;ENSP00000439350:P314L;ENSP00000452270:P314L;ENSP00000451502:P314L;ENSP00000451151:P282L;ENSP00000250373:P282L;ENSP00000450590:P282L;ENSP00000452349:P212L;ENSP00000450469:P212L;ENSP00000450733:P212L;ENSP00000451454:P270L;ENSP00000451284:P212L;ENSP00000396788:P270L;ENSP00000450686:P270L	ENSP00000250373:P282L	P	+	2	0	NFATC4	23909289	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	6.940000	0.75917	2.286000	0.76751	0.467000	0.42956	CCA	NFATC4	-	NULL	ENSG00000100968		0.701	NFATC4-001	KNOWN	basic|CCDS	protein_coding	NFATC4	HGNC	protein_coding	OTTHUMT00000073206.6	-	0.00	92	0	C	NM_004554		24839449	+1	tier1	-	no_errors	ENST00000413692	ensembl	human	known	74_37	missense	46.81	25	22	SNP	1.000	T
NKAIN4	128414	genome.wustl.edu	37	20	61872617	61872617	+	3'UTR	DEL	T	T	-			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr20:61872617delT	ENST00000370316.3	-	0	948				MIR3196_ENST00000579556.1_RNA|NKAIN4_ENST00000466885.1_5'UTR|NKAIN4_ENST00000370313.1_3'UTR	NM_152864.3	NP_690603.3	Q8IVV8	NKAI4_HUMAN	Na+/K+ transporting ATPase interacting 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|lung(1)|ovary(1)	4	all_cancers(38;2.72e-09)					ttttcttttcttttttttttt	0.517																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC041812	CCDS13514.1	20q13.33	2007-10-04	2007-10-04	2007-10-04	ENSG00000101198	ENSG00000101198		"""Na+/K+ transporting ATPase interacting"""	16191	protein-coding gene	gene with protein product		612873	"""chromosome 20 open reading frame 58"""	C20orf58		17606467	Standard	NM_152864		Approved	bA261N11.2, FAM77A	uc002yek.3	Q8IVV8	OTTHUMG00000032959	ENST00000370316.3:c.*232A>-	20.37:g.61872617delT			Q4VXQ6|Q9BQU8|Q9BQU9	RNA	DEL	-	NULL	ENST00000370316.3	37	NULL	CCDS13514.1	20																																																																																			NKAIN4	-	-	ENSG00000101198		0.517	NKAIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAIN4	HGNC	protein_coding	OTTHUMT00000080117.3		0.00	9	0	T	NM_152864		61872617	-1	tier1		no_errors	ENST00000466885	ensembl	human	known	74_37	rna	21.05	15	4	DEL	0.000	-
NPHS1	4868	genome.wustl.edu	37	19	36341899	36341899	+	Frame_Shift_Del	DEL	C	C	-			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:36341899delC	ENST00000378910.5	-	4	489	c.490delG	c.(490-492)gacfs	p.D164fs	NPHS1_ENST00000353632.6_Frame_Shift_Del_p.D164fs|NPHS1_ENST00000591817.1_5'Flank	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	164	Ig-like C2-type 2.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGCTTCGCGTCCCCAGACACA	0.612																																																	0													92.0	68.0	76.0					19																	36341899		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.490delG	19.37:g.36341899delC	ENSP00000368190:p.Asp164fs		A6NDH2|C3RX61	Frame_Shift_Del	DEL	pfam_CD80_C2-set,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.D164fs	ENST00000378910.5	37	c.490	CCDS32996.1	19																																																																																			NPHS1	-	pfam_CD80_C2-set	ENSG00000161270		0.612	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS1	HGNC	protein_coding	OTTHUMT00000452553.1		0.00	37	0	C			36341899	-1	tier1		no_errors	ENST00000378910	ensembl	human	known	74_37	frame_shift_del	8.00	23	2	DEL	0.572	-
NPIPB6	728741	genome.wustl.edu	37	16	28374090	28374090	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:28374090G>A	ENST00000532254.1	-	1	739	c.54C>T	c.(52-54)agC>agT	p.S18S		NM_001282524.1	NP_001269453.1	E9PJ23	NPIB6_HUMAN	nuclear pore complex interacting protein family, member B6	18																	TGGTGAGCTGGCTCTGGTCAT	0.537																																																	0																																										SO:0001819	synonymous_variant	0				CCDS61892.1	16p11.2	2013-06-11			ENSG00000198156	ENSG00000198156			37454	protein-coding gene	gene with protein product							Standard	XM_005255741		Approved			E9PJ23	OTTHUMG00000166319	ENST00000532254.1:c.54C>T	16.37:g.28374090G>A				Silent	SNP	NULL	p.S18	ENST00000532254.1	37	c.54		16																																																																																			NPIPB6	-	NULL	ENSG00000198156		0.537	NPIPB6-002	NOVEL	basic|appris_principal	protein_coding	NPIPB6	HGNC	protein_coding	OTTHUMT00000389133.1	-	0.00	224	0	G	XM_001717652		28374090	-1	tier1	-	no_errors	ENST00000532254	ensembl	human	novel	74_37	silent	44.15	105	83	SNP	0.039	A
NTM	50863	genome.wustl.edu	37	11	131530879	131530880	+	Intron	INS	-	-	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:131530879_131530880insA	ENST00000374791.3	+	2	411				NTM_ENST00000539799.1_Intron|AP003039.3_ENST00000416725.1_lincRNA|NTM_ENST00000427481.2_5'Flank	NM_001048209.1	NP_001041674.1	Q9P121	NTRI_HUMAN	neurotrimin						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						TTTTAAAGTGGAAAAAAAAATG	0.406																																																	0																																										SO:0001627	intron_variant	0			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374791.3:c.83-250578->A	11.37:g.131530888_131530888dupA			A0MTT2|Q6UXJ3|Q86VJ9	RNA	INS	-	NULL	ENST00000374791.3	37	NULL	CCDS41733.1	11																																																																																			NTM	-	-	ENSG00000182667		0.406	NTM-002	KNOWN	basic|CCDS	protein_coding	NTM	HGNC	protein_coding	OTTHUMT00000141936.2		0.00	26	0	-	NM_016522		131530880	+1	tier1		no_errors	ENST00000477098	ensembl	human	putative	74_37	rna	12.50	28	4	INS	1.000:0.999	A
NUP85	79902	genome.wustl.edu	37	17	73204645	73204645	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:73204645G>A	ENST00000245544.4	+	2	128	c.57G>A	c.(55-57)aaG>aaA	p.K19K	NUP85_ENST00000447371.2_5'UTR|NUP85_ENST00000579298.1_Silent_p.K19K|NUP85_ENST00000541827.1_Intron|NUP85_ENST00000449421.2_Intron|NUP85_ENST00000579324.1_Intron	NM_024844.3	NP_079120.1	Q9BW27	NUP85_HUMAN	nucleoporin 85kDa	19					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|lamellipodium assembly (GO:0030032)|macrophage chemotaxis (GO:0048246)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	16	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			TGAATTCCAAGAAGAACCAAA	0.338																																																	0													172.0	191.0	184.0					17																	73204645		2203	4300	6503	SO:0001819	synonymous_variant	0			AF514995	CCDS32730.1	17q25	2006-11-29	2005-11-03	2005-11-03		ENSG00000125450			8734	protein-coding gene	gene with protein product		170285				8124707	Standard	XM_005257690		Approved	NUP75, FLJ12549	uc002jng.1	Q9BW27		ENST00000245544.4:c.57G>A	17.37:g.73204645G>A			B4DMQ3|B4DPW1|Q8NDI4|Q9H9U1	Silent	SNP	pfam_Nucleoporin_Nup85	p.K19	ENST00000245544.4	37	c.57	CCDS32730.1	17																																																																																			NUP85	-	NULL	ENSG00000125450		0.338	NUP85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP85	HGNC	protein_coding	OTTHUMT00000446619.1	-	0.00	71	0	G	NM_024844		73204645	+1	tier1	-	no_errors	ENST00000245544	ensembl	human	known	74_37	silent	29.47	67	28	SNP	0.957	A
OR10AG1	282770	genome.wustl.edu	37	11	55735930	55735930	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:55735930C>A	ENST00000312345.2	-	1	60	c.10G>T	c.(10-12)Gtt>Ttt	p.V4F		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	4						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					CCCAAAAGAACAAATTCCATT	0.313																																																	0													29.0	33.0	32.0					11																	55735930		2185	4260	6445	SO:0001583	missense	0			AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.10G>T	11.37:g.55735930C>A	ENSP00000311477:p.Val4Phe		B2RNH4|Q6IEU3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V4F	ENST00000312345.2	37	c.10	CCDS31514.1	11	.	.	.	.	.	.	.	.	.	.	C	13.11	2.140665	0.37825	.	.	ENSG00000174970	ENST00000312345	T	0.00608	6.25	5.38	-0.577	0.11727	.	0.496490	0.16561	N	0.209060	T	0.00580	0.0019	L	0.42632	1.34	0.22401	N	0.999136	B	0.23937	0.094	B	0.25614	0.062	T	0.45454	-0.9260	10	0.66056	D	0.02	.	5.1955	0.15233	0.0:0.3073:0.16:0.5326	.	4	Q8NH19	O10AG_HUMAN	F	4	ENSP00000311477:V4F	ENSP00000311477:V4F	V	-	1	0	OR10AG1	55492506	0.000000	0.05858	0.938000	0.37757	0.957000	0.61999	-1.214000	0.02988	0.022000	0.15160	0.398000	0.26397	GTT	OR10AG1	-	NULL	ENSG00000174970		0.313	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10AG1	HGNC	protein_coding	OTTHUMT00000391531.1		0.00	10	0	C	NM_001005491		55735930	-1			no_errors	ENST00000312345	ensembl	human	known	74_37	missense	37.50	15	9	SNP	0.375	A
OTOG	340990	genome.wustl.edu	37	11	17578812	17578812	+	Silent	SNP	C	C	T	rs558874532		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:17578812C>T	ENST00000399391.2	+	7	843	c.843C>T	c.(841-843)acC>acT	p.T281T	OTOG_ENST00000399397.1_Silent_p.T208T	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	281	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						TGGGCTGGACCCATGGGCTGT	0.592																																																	0																																										SO:0001819	synonymous_variant	0			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.843C>T	11.37:g.17578812C>T			A8MTX6|A8MUJ0|B7WPC4	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.T281	ENST00000399391.2	37	c.843	CCDS59225.1	11																																																																																			OTOG	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000188162		0.592	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		-	0.00	40	0	C			17578812	+1	tier1	-	no_errors	ENST00000399391	ensembl	human	known	74_37	silent	23.08	20	6	SNP	1.000	T
OR8K1	390157	genome.wustl.edu	37	11	56113847	56113847	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:56113847G>T	ENST00000279783.2	+	1	427	c.333G>T	c.(331-333)gaG>gaT	p.E111D		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	111						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					CATTCTTTGAGATTTTCATCA	0.408										HNSCC(65;0.19)																																							0													181.0	182.0	182.0					11																	56113847		2201	4296	6497	SO:0001583	missense	0			AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.333G>T	11.37:g.56113847G>T	ENSP00000279783:p.Glu111Asp		B9EJB1|Q6IFC3|Q96RC1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E111D	ENST00000279783.2	37	c.333	CCDS31528.1	11	.	.	.	.	.	.	.	.	.	.	G	12.96	2.094672	0.36952	.	.	ENSG00000150261	ENST00000279783	T	0.00551	6.65	5.0	1.76	0.24704	GPCR, rhodopsin-like superfamily (1);	0.561532	0.15800	N	0.244009	T	0.00241	0.0007	N	0.01048	-1.04	0.09310	N	1	B	0.24186	0.099	B	0.12837	0.008	T	0.43048	-0.9415	10	0.45353	T	0.12	-6.9851	8.1077	0.30896	0.0:0.2251:0.269:0.506	.	111	Q8NGG5	OR8K1_HUMAN	D	111	ENSP00000279783:E111D	ENSP00000279783:E111D	E	+	3	2	OR8K1	55870423	0.000000	0.05858	0.671000	0.29857	0.967000	0.64934	-0.374000	0.07484	0.450000	0.26774	0.549000	0.68633	GAG	OR8K1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000150261		0.408	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K1	HGNC	protein_coding	OTTHUMT00000391605.1		0.00	11	0	G	NM_001002907		56113847	+1			no_errors	ENST00000279783	ensembl	human	known	74_37	missense	8.70	21	2	SNP	0.001	T
OVCH1	341350	genome.wustl.edu	37	12	29596332	29596332	+	Missense_Mutation	SNP	C	C	T	rs370805015		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:29596332C>T	ENST00000318184.5	-	25	3118	c.3119G>A	c.(3118-3120)cGt>cAt	p.R1040H	OVCH1-AS1_ENST00000549411.1_Intron|OVCH1-AS1_ENST00000551108.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	1040						extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					TTCGTAAACACGCAGATGACC	0.358																																																	0								C	HIS/ARG	1,3659		0,1,1829	137.0	137.0	137.0		3119	-0.4	0.0	12		137	0,8176		0,0,4088	no	missense	OVCH1	NM_183378.2	29	0,1,5917	TT,TC,CC		0.0,0.0273,0.0084	benign	1040/1135	29596332	1,11835	1830	4088	5918	SO:0001583	missense	0			BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.3119G>A	12.37:g.29596332C>T	ENSP00000326708:p.Arg1040His			Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,smart_Peptidase_S1,smart_CUB_dom,pfscan_CUB_dom,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R1040H	ENST00000318184.5	37	c.3119		12	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.108045	0.00353	2.73E-4	0.0	ENSG00000187950	ENST00000318184;ENST00000537054	T;T	0.34859	1.34;2.08	2.53	-0.448	0.12230	CUB (2);	.	.	.	.	T	0.14787	0.0357	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31475	-0.9942	9	0.14656	T	0.56	.	5.3874	0.16226	0.195:0.6745:0.0:0.1305	.	1040	Q7RTY7	OVCH1_HUMAN	H	1040;65	ENSP00000326708:R1040H;ENSP00000445480:R65H	ENSP00000326708:R1040H	R	-	2	0	OVCH1	29487599	0.000000	0.05858	0.006000	0.13384	0.001000	0.01503	-0.313000	0.08103	-0.108000	0.12066	-0.907000	0.02831	CGT	OVCH1	-	superfamily_CUB_dom	ENSG00000187950		0.358	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	OVCH1	HGNC	protein_coding	OTTHUMT00000395997.2	-	0.00	47	0	C	NM_183378		29596332	-1	tier1	-	no_errors	ENST00000318184	ensembl	human	known	74_37	missense	31.03	60	27	SNP	0.007	T
PAK7	57144	genome.wustl.edu	37	20	9560912	9560912	+	Silent	SNP	C	C	A	rs149925869		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr20:9560912C>A	ENST00000378429.3	-	5	1416	c.870G>T	c.(868-870)tcG>tcT	p.S290S	PAK7_ENST00000378423.1_Silent_p.S290S|PAK7_ENST00000353224.5_Silent_p.S290S|RP5-986I17.2_ENST00000428769.1_RNA	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	290	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			CCTGGAGTCCCGAGCCTGACC	0.567																																																	0													218.0	179.0	192.0					20																	9560912		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.870G>T	20.37:g.9560912C>A			A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.S290	ENST00000378429.3	37	c.870	CCDS13107.1	20																																																																																			PAK7	-	NULL	ENSG00000101349		0.567	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PAK7	HGNC	protein_coding	OTTHUMT00000077962.1	-	0.00	75	0	C			9560912	-1	tier1	-	no_errors	ENST00000353224	ensembl	human	known	74_37	silent	32.47	52	25	SNP	0.391	A
PALD1	27143	genome.wustl.edu	37	10	72292493	72292495	+	In_Frame_Del	DEL	GGA	GGA	-	rs373712496		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	GGA	GGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:72292493_72292495delGGA	ENST00000263563.6	+	6	1018_1020	c.750_752delGGA	c.(748-753)acggag>acg	p.E252del		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	252						cytosol (GO:0005829)											TGCATGTGACGGAGGAGGTGTAC	0.621																																																	0																																										SO:0001651	inframe_deletion	0			AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.750_752delGGA	10.37:g.72292496_72292498delGGA	ENSP00000263563:p.Glu252del		B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	In_Frame_Del	DEL	smart_Tyr_Pase_cat	p.E252in_frame_del	ENST00000263563.6	37	c.750_752	CCDS31215.1	10																																																																																			PALD1	-	NULL	ENSG00000107719		0.621	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALD1	HGNC	protein_coding	OTTHUMT00000048515.2		0.00	55	0	GGA	NM_014431		72292495	+1	tier1		no_errors	ENST00000263563	ensembl	human	known	74_37	in_frame_del	27.59	21	8	DEL	0.000:0.961:1.000	-
PARP11	57097	genome.wustl.edu	37	12	3935364	3935364	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:3935364G>T	ENST00000228820.4	-	4	448	c.304C>A	c.(304-306)Cgc>Agc	p.R102S	PARP11_ENST00000447133.3_Missense_Mutation_p.R21S|PARP11_ENST00000427057.2_Missense_Mutation_p.R21S|PARP11_ENST00000397096.2_Missense_Mutation_p.R95S	NM_020367.4	NP_065100.2	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11	95							NAD+ ADP-ribosyltransferase activity (GO:0003950)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	17			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			TTTATTAAGCGCTGCTTTCCA	0.358																																																	0													131.0	139.0	136.0					12																	3935364		2203	4300	6503	SO:0001583	missense	0			AF263540	CCDS8523.2, CCDS66281.1	12p13.3	2014-01-28	2004-08-25	2004-08-26	ENSG00000111224	ENSG00000111224		"""Poly (ADP-ribose) polymerases"""	1186	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 6"""	C12orf6		15273990	Standard	NM_001286522		Approved		uc001qml.2	Q9NR21	OTTHUMG00000156442	ENST00000228820.4:c.304C>A	12.37:g.3935364G>T	ENSP00000228820:p.Arg102Ser		B4DRQ0|Q68DS1|Q8N5Y9	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_WWE-dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.R102S	ENST00000228820.4	37	c.304	CCDS8523.2	12	.	.	.	.	.	.	.	.	.	.	G	19.89	3.910903	0.72983	.	.	ENSG00000111224	ENST00000397096;ENST00000427057;ENST00000228820;ENST00000447133	T;T;T;T	0.58506	0.33;1.83;0.33;1.83	5.32	5.32	0.75619	WWE domain (2);	0.000000	0.85682	D	0.000000	T	0.74030	0.3663	M	0.78456	2.415	0.53005	D	0.999969	D;D;D	0.89917	1.0;0.993;0.994	D;D;D	0.83275	0.996;0.927;0.957	T	0.74194	-0.3744	10	0.46703	T	0.11	.	11.4286	0.50027	0.0:0.0:0.8203:0.1797	.	21;102;95	Q9NR21-2;Q9NR21-4;Q9NR21	.;.;PAR11_HUMAN	S	95;21;102;21	ENSP00000380284:R95S;ENSP00000397058:R21S;ENSP00000228820:R102S;ENSP00000405385:R21S	ENSP00000228820:R102S	R	-	1	0	PARP11	3805625	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.305000	0.59110	2.773000	0.95371	0.655000	0.94253	CGC	PARP11	-	pfam_WWE-dom,pfscan_WWE-dom	ENSG00000111224		0.358	PARP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP11	HGNC	protein_coding	OTTHUMT00000344213.1		0.00	51	0	G			3935364	-1			no_errors	ENST00000228820	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
PAX4	5078	genome.wustl.edu	37	7	127251730	127251730	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:127251730G>T	ENST00000341640.2	-	8	953	c.748C>A	c.(748-750)Cag>Aag	p.Q250K	PAX4_ENST00000338516.3_Splice_Site_p.A239E|PAX4_ENST00000378740.2_Splice_Site_p.Q250K|PAX4_ENST00000463946.1_Splice_Site_p.Q248K	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	258					cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						CCAGGGGACTGCTAAAAAAAA	0.572																																					Ovarian(113;737 1605 7858 27720 34092)												0													39.0	44.0	43.0					7																	127251730		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.748-1C>A	7.37:g.127251730G>T			O95161|Q6B0H0	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Paired_dom,prints_Paired_dom	p.Q250K	ENST00000341640.2	37	c.748	CCDS5797.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.194|8.194	0.796601|0.796601	0.16327|0.16327	.|.	.|.	ENSG00000106331|ENSG00000106331	ENST00000338516|ENST00000341640;ENST00000378740;ENST00000463946	D|D;D	0.93906|0.93712	-3.31|-3.27;-3.13	5.38|5.38	2.51|2.51	0.30379|0.30379	.|.	.|0.587296	.|0.14612	.|N	.|0.308955	D|D	0.89438|0.89438	0.6715|0.6715	L|L	0.55990|0.55990	1.75|1.75	0.20196|0.20196	N|N	0.999924|0.999924	.|B;B;B	.|0.30236	.|0.274;0.085;0.217	.|B;B;B	.|0.31946	.|0.069;0.023;0.138	T|T	0.78224|0.78224	-0.2287|-0.2287	7|10	0.29301|0.29301	T|T	0.29|0.29	.|.	6.3356|6.3356	0.21294|0.21294	0.0859:0.0:0.5874:0.3267|0.0859:0.0:0.5874:0.3267	.|.	.|250;258;248	.|O43316-4;O43316;G3V4Q1	.|.;PAX4_HUMAN;.	E|K	239|250;258;248	ENSP00000344297:A239E|ENSP00000339906:Q250K;ENSP00000451923:Q248K	ENSP00000344297:A239E|ENSP00000339906:Q250K	A|Q	-|-	2|1	0|0	PAX4|PAX4	127038966|127038966	0.997000|0.997000	0.39634|0.39634	0.226000|0.226000	0.23910|0.23910	0.178000|0.178000	0.23041|0.23041	2.876000|2.876000	0.48498|0.48498	0.313000|0.313000	0.23062|0.23062	-0.181000|-0.181000	0.13052|0.13052	GCA|CAG	PAX4	-	NULL	ENSG00000106331		0.572	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAX4	HGNC	protein_coding	OTTHUMT00000349165.1	-	0.00	22	0	G		Missense_Mutation	127251730	-1	tier1	-	no_errors	ENST00000341640	ensembl	human	known	74_37	missense	34.38	21	11	SNP	0.791	T
PAXIP1	22976	genome.wustl.edu	37	7	154760267	154760269	+	In_Frame_Del	DEL	CTG	CTG	-	rs141168451		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:154760267_154760269delCTG	ENST00000404141.1	-	7	1796_1798	c.1642_1644delCAG	c.(1642-1644)cagdel	p.Q548del	PAXIP1_ENST00000473219.1_5'UTR|PAXIP1_ENST00000397192.1_In_Frame_Del_p.Q548del			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	548	Gln-rich.			Missing (in Ref. 4; AAB91434). {ECO:0000305}.	adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		GACTTTGCATctgctgctgctgc	0.626																																																	0										135,3467		9,117,1675						-0.6	0.0		dbSNP_134	18	258,6344		17,224,3060	no	coding	PAXIP1	NM_007349.3		26,341,4735	A1A1,A1R,RR		3.9079,3.7479,3.8514				393,9811				SO:0001651	inframe_deletion	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1642_1644delCAG	7.37:g.154760276_154760278delCTG	ENSP00000384048:p.Gln548del		O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	In_Frame_Del	DEL	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.Q548in_frame_del	ENST00000404141.1	37	c.1644_1642	CCDS47753.1	7																																																																																			PAXIP1	-	NULL	ENSG00000157212		0.626	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1		0.00	57	0	CTG	NM_007349		154760269	-1	tier1		no_errors	ENST00000397192	ensembl	human	known	74_37	in_frame_del	10.34	26	3	DEL	0.709:0.971:0.997	-
PBDC1	51260	genome.wustl.edu	37	X	75395330	75395330	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chrX:75395330A>G	ENST00000373358.3	+	4	382	c.179A>G	c.(178-180)cAg>cGg	p.Q60R	PBDC1_ENST00000373357.3_Missense_Mutation_p.Q60R	NM_016500.3	NP_057584.2	Q9BVG4	PBDC1_HUMAN	polysaccharide biosynthesis domain containing 1	60																	GTTGACCCACAGTTCCTGAAA	0.408																																																	0													92.0	80.0	84.0					X																	75395330		2203	4300	6503	SO:0001583	missense	0			BC001220	CCDS14432.1, CCDS75995.1	Xq13.2	2012-11-28	2012-11-28	2012-11-28	ENSG00000102390	ENSG00000102390			28790	protein-coding gene	gene with protein product			"""chromosome X open reading frame 26"""	CXorf26		11042152	Standard	NM_016500		Approved	MGC874	uc004ecl.1	Q9BVG4	OTTHUMG00000021876	ENST00000373358.3:c.179A>G	X.37:g.75395330A>G	ENSP00000362456:p.Gln60Arg			Missense_Mutation	SNP	pfam_Put_polysacc_synth	p.Q60R	ENST00000373358.3	37	c.179	CCDS14432.1	X	.	.	.	.	.	.	.	.	.	.	A	11.64	1.698388	0.30142	.	.	ENSG00000102390	ENST00000373358;ENST00000373357	.	.	.	4.77	3.52	0.40303	Yst0336-like domain (1);	0.241427	0.41294	D	0.000901	T	0.14184	0.0343	N	0.04669	-0.19	0.26190	N	0.979606	B	0.14805	0.011	B	0.12156	0.007	T	0.05257	-1.0896	9	0.39692	T	0.17	-15.0879	3.0679	0.06220	0.6739:0.0:0.1132:0.213	.	60	Q9BVG4	CX026_HUMAN	R	60	.	ENSP00000362455:Q60R	Q	+	2	0	CXorf26	75311732	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.861000	0.56002	1.875000	0.54330	0.486000	0.48141	CAG	PBDC1	-	pfam_Put_polysacc_synth	ENSG00000102390		0.408	PBDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PBDC1	HGNC	protein_coding	OTTHUMT00000057294.1	-	0.00	35	0	A	NM_016500		75395330	+1	tier1	-	no_errors	ENST00000373358	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	G
PCDH11X	27328	genome.wustl.edu	37	X	91873637	91873637	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chrX:91873637C>A	ENST00000373094.1	+	7	4587	c.3742C>A	c.(3742-3744)Cct>Act	p.P1248T	PCDH11X_ENST00000373097.1_Missense_Mutation_p.P1238T|PCDH11X_ENST00000298274.8_Missense_Mutation_p.P1211T|PCDH11X_ENST00000373088.1_Missense_Mutation_p.P1211T|PCDH11X_ENST00000504220.2_3'UTR|PCDH11X_ENST00000406881.1_Missense_Mutation_p.P1240T|PCDH11X_ENST00000361655.2_Missense_Mutation_p.P1230T	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1248					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CTACAGCCCTCCTTTAGCACA	0.572																																					NSCLC(38;925 1092 2571 38200 45895)												0													144.0	131.0	135.0					X																	91873637		2203	4300	6503	SO:0001583	missense	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3742C>A	X.37:g.91873637C>A	ENSP00000362186:p.Pro1248Thr		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P1248T	ENST00000373094.1	37	c.3742	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	C	0.229	-1.022822	0.02061	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000373088;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T	0.52057	0.69;0.7;0.73;0.68;0.7;0.73	3.81	2.9	0.33743	.	.	.	.	.	T	0.27866	0.0686	N	0.11560	0.145	0.18873	N	0.999987	B;B;B;B;B	0.06786	0.001;0.001;0.001;0.001;0.001	B;B;B;B;B	0.09377	0.004;0.004;0.004;0.004;0.002	T	0.17806	-1.0357	9	0.39692	T	0.17	.	9.3175	0.37943	0.2228:0.7772:0.0:0.0	.	1211;1230;1240;1238;1248	Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7	.;.;.;.;PC11X_HUMAN	T	1248;1238;1211;1230;1240;1248;1211	ENSP00000362186:P1248T;ENSP00000362189:P1238T;ENSP00000362180:P1211T;ENSP00000355105:P1230T;ENSP00000384758:P1240T;ENSP00000298274:P1211T	ENSP00000298274:P1211T	P	+	1	0	PCDH11X	91760293	0.000000	0.05858	0.141000	0.22245	0.126000	0.20510	0.133000	0.15912	0.688000	0.31529	0.466000	0.42574	CCT	PCDH11X	-	NULL	ENSG00000102290		0.572	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	-	0.00	43	0	C	NM_032969		91873637	+1	tier1	-	no_errors	ENST00000373094	ensembl	human	known	74_37	missense	66.67	8	16	SNP	0.565	A
PCDH15	65217	genome.wustl.edu	37	10	56423942	56423942	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:56423942C>A	ENST00000320301.6	-	2	475	c.81G>T	c.(79-81)caG>caT	p.Q27H	PCDH15_ENST00000373957.3_Missense_Mutation_p.Q27H|PCDH15_ENST00000395445.1_Missense_Mutation_p.Q27H|PCDH15_ENST00000409834.1_5'UTR|PCDH15_ENST00000373965.2_Missense_Mutation_p.Q27H|PCDH15_ENST00000395442.1_Missense_Mutation_p.Q27H|PCDH15_ENST00000395438.1_Missense_Mutation_p.Q27H|PCDH15_ENST00000395433.1_Missense_Mutation_p.Q27H|PCDH15_ENST00000395430.1_Missense_Mutation_p.Q27H|PCDH15_ENST00000395432.2_Missense_Mutation_p.Q27H|PCDH15_ENST00000395446.1_Missense_Mutation_p.Q27H|PCDH15_ENST00000373955.1_Missense_Mutation_p.Q27H|PCDH15_ENST00000395440.1_Missense_Mutation_p.Q27H|PCDH15_ENST00000414778.1_Missense_Mutation_p.Q27H|PCDH15_ENST00000361849.3_Missense_Mutation_p.Q27H|PCDH15_ENST00000437009.1_Missense_Mutation_p.Q27H	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	27					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CATCATCATACTGGCCCAAGC	0.383										HNSCC(58;0.16)																																							0													83.0	74.0	77.0					10																	56423942		2203	4300	6503	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.81G>T	10.37:g.56423942C>A	ENSP00000322604:p.Gln27His		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q27H	ENST00000320301.6	37	c.81	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	C	11.59	1.685155	0.29872	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955;ENST00000458638	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.63580	0.45;0.46;0.42;0.41;0.42;0.67;0.57;0.32;0.36;-0.04;-0.05;0.37;0.37;0.4;0.51;0.74	5.93	-0.524	0.11920	.	.	.	.	.	T	0.71273	0.3320	L	0.54323	1.7	0.21604	N	0.999625	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.76494	0.996;0.998;0.998;0.998;0.992;0.985;0.996;0.981;0.992;0.982;0.995;0.985;0.999;0.996;0.985	D;D;D;D;P;P;D;P;P;P;P;P;D;D;P	0.91635	0.993;0.991;0.991;0.976;0.887;0.897;0.993;0.779;0.868;0.812;0.868;0.868;0.999;0.993;0.897	T	0.61564	-0.7037	9	0.72032	D	0.01	.	9.6881	0.40111	0.0:0.5431:0.0:0.4569	.	27;27;27;27;27;27;27;27;27;27;27;27;27;27;27	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	H	27	ENSP00000363076:Q27H;ENSP00000410304:Q27H;ENSP00000378826:Q27H;ENSP00000378832:Q27H;ENSP00000378833:Q27H;ENSP00000378829:Q27H;ENSP00000378827:Q27H;ENSP00000378820:Q27H;ENSP00000354950:Q27H;ENSP00000378821:Q27H;ENSP00000363068:Q27H;ENSP00000322604:Q27H;ENSP00000378818:Q27H;ENSP00000412628:Q27H;ENSP00000363066:Q27H;ENSP00000394465:Q27H	ENSP00000322604:Q27H	Q	-	3	2	PCDH15	56093948	0.952000	0.32445	0.912000	0.35992	0.038000	0.13279	-0.109000	0.10840	-0.125000	0.11703	-0.229000	0.12294	CAG	PCDH15	-	NULL	ENSG00000150275		0.383	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	-	0.00	47	0	C	NM_033056		56423942	-1	tier1	-	no_errors	ENST00000320301	ensembl	human	known	74_37	missense	29.31	41	17	SNP	0.845	A
PCDHA7	56141	genome.wustl.edu	37	5	140215502	140215502	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:140215502G>A	ENST00000525929.1	+	1	1534	c.1534G>A	c.(1534-1536)Gcg>Acg	p.A512T	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.A512T|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	512	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCAGTGCACGCGGAGAGCGG	0.701																																					NSCLC(160;258 2013 5070 22440 28951)												0													68.0	73.0	71.0					5																	140215502		2203	4296	6499	SO:0001583	missense	0			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1534G>A	5.37:g.140215502G>A	ENSP00000436426:p.Ala512Thr		O75282	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A512T	ENST00000525929.1	37	c.1534	CCDS54918.1	5	.	.	.	.	.	.	.	.	.	.	G	14.04	2.417064	0.42918	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.47869	0.83;0.83	4.01	1.99	0.26369	Cadherin (4);Cadherin-like (1);	0.305910	0.16548	U	0.209624	T	0.40979	0.1139	L	0.33485	1.01	0.23101	N	0.99829	P;P	0.52692	0.955;0.653	P;P	0.47827	0.512;0.558	T	0.22452	-1.0216	10	0.62326	D	0.03	.	9.3167	0.37939	0.0:0.1097:0.5252:0.365	.	512;512	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	T	512	ENSP00000436426:A512T;ENSP00000367365:A512T	ENSP00000367365:A512T	A	+	1	0	PCDHA7	140195686	0.000000	0.05858	1.000000	0.80357	0.538000	0.34931	-0.347000	0.07750	0.781000	0.33589	0.306000	0.20318	GCG	PCDHA7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204963		0.701	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	HGNC	protein_coding	OTTHUMT00000372887.2	-	0.00	352	0	G	NM_018910		140215502	+1	tier1	-	no_errors	ENST00000525929	ensembl	human	known	74_37	missense	25.89	146	51	SNP	0.983	A
PCDHB13	56123	genome.wustl.edu	37	5	140594473	140594473	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:140594473T>C	ENST00000341948.4	+	1	965	c.778T>C	c.(778-780)Ttc>Ctc	p.F260L		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	260	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCGGTAGGCTTCCTGGTTGT	0.478																																																	0													174.0	171.0	172.0					5																	140594473		2203	4300	6503	SO:0001583	missense	0			AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.778T>C	5.37:g.140594473T>C	ENSP00000345491:p.Phe260Leu		A8K9V6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F260L	ENST00000341948.4	37	c.778	CCDS4255.1	5	.	.	.	.	.	.	.	.	.	.	t	16.82	3.228134	0.58777	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.50277	0.75	3.51	-1.14	0.09741	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.28532	0.0706	N	0.16233	0.39	0.09310	N	1	B	0.11235	0.004	B	0.23018	0.043	T	0.25222	-1.0138	9	0.66056	D	0.02	.	5.1982	0.15249	0.2975:0.0:0.2817:0.4207	.	260	Q9Y5F0	PCDBD_HUMAN	L	260	ENSP00000345491:F260L	ENSP00000345491:F260L	F	+	1	0	PCDHB13	140574657	0.000000	0.05858	0.000000	0.03702	0.783000	0.44284	-1.188000	0.03064	-0.447000	0.07138	0.254000	0.18369	TTC	PCDHB13	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000187372		0.478	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB13	HGNC	protein_coding	OTTHUMT00000251810.1	-	0.00	94	0	T	NM_018933		140594473	+1	tier1	-	no_errors	ENST00000341948	ensembl	human	known	74_37	missense	42.16	59	43	SNP	0.001	C
PCDHGB7	56099	genome.wustl.edu	37	5	140797861	140797861	+	Silent	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:140797861C>A	ENST00000398594.2	+	1	435	c.435C>A	c.(433-435)tcC>tcA	p.S145S	PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	145	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAGTGAATCCGTCAGCCTGG	0.388																																																	0													103.0	100.0	101.0					5																	140797861		1885	4119	6004	SO:0001819	synonymous_variant	0			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.435C>A	5.37:g.140797861C>A			Q9UN63	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S145	ENST00000398594.2	37	c.435	CCDS47293.1	5																																																																																			PCDHGB7	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000254122		0.388	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB7	HGNC	protein_coding	OTTHUMT00000376973.1	-	0.00	46	0	C	NM_018927		140797861	+1	tier1	-	no_errors	ENST00000398594	ensembl	human	known	74_37	silent	7.02	53	4	SNP	0.000	A
PCDHGC5	56097	genome.wustl.edu	37	5	140871075	140871075	+	Silent	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:140871075G>T	ENST00000252087.1	+	1	2268	c.2268G>T	c.(2266-2268)acG>acT	p.T756T	PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	756					homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T756T(2)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGACGGCACGCTCAAGTACA	0.637																																																	2	Substitution - coding silent(2)	breast(2)											44.0	43.0	43.0					5																	140871075		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.2268G>T	5.37:g.140871075G>T			Q9Y5C2	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T756	ENST00000252087.1	37	c.2268	CCDS4263.1	5																																																																																			PCDHGC5	-	NULL	ENSG00000240764		0.637	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGC5	HGNC	protein_coding	OTTHUMT00000251819.1		0.00	88	0	G	NM_018929		140871075	+1			no_errors	ENST00000252087	ensembl	human	known	74_37	silent	5.88	48	3	SNP	0.010	T
PCNT	5116	genome.wustl.edu	37	21	47851826	47851826	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr21:47851826G>A	ENST00000359568.5	+	38	8555	c.8448G>A	c.(8446-8448)ctG>ctA	p.L2816L	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2816					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					AGCAAGCCCTGCATTCTCAGC	0.582																																																	0													64.0	59.0	61.0					21																	47851826		2203	4300	6503	SO:0001819	synonymous_variant	0			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.8448G>A	21.37:g.47851826G>A			O43152|Q7Z7C9	Silent	SNP	pfam_PACT_domain	p.L2816	ENST00000359568.5	37	c.8448	CCDS33592.1	21																																																																																			PCNT	-	NULL	ENSG00000160299		0.582	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	-	0.00	42	0	G	NM_006031		47851826	+1	tier1	-	no_errors	ENST00000359568	ensembl	human	known	74_37	silent	55.56	16	20	SNP	0.000	A
PDE4DIP	9659	genome.wustl.edu	37	1	145075752	145075752	+	Silent	SNP	C	C	T	rs374020871		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:145075752C>T	ENST00000530740.1	-	1	149	c.111G>A	c.(109-111)acG>acA	p.T37T	PDE4DIP_ENST00000369348.3_Silent_p.T37T|PDE4DIP_ENST00000369345.4_Silent_p.T37T|PDE4DIP_ENST00000369359.4_Silent_p.T37T			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	0					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GAGGGGTTCGCGTCGCGTCCC	0.726			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0								C		0,4406		0,0,2203	41.0	53.0	49.0		111	-1.3	0.0	1		49	1,8593		0,1,4296	no	coding-synonymous	PDE4DIP	NM_022359.5		0,1,6499	TT,TC,CC		0.0116,0.0,0.0077		37/311	145075752	1,12999	2203	4297	6500	SO:0001819	synonymous_variant	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000530740.1:c.111G>A	1.37:g.145075752C>T			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Silent	SNP	pfam_Spindle_assoc	p.T37	ENST00000530740.1	37	c.111		1																																																																																			PDE4DIP	-	NULL	ENSG00000178104		0.726	PDE4DIP-036	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000384663.2		0.00	153	0	C	NM_022359		145075752	-1			no_errors	ENST00000369348	ensembl	human	known	74_37	silent	6.98	80	6	SNP	0.000	T
PDIA3	2923	genome.wustl.edu	37	15	44057747	44057747	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:44057747G>T	ENST00000300289.5	+	6	850	c.702G>T	c.(700-702)aaG>aaT	p.K234N	PDIA3_ENST00000538521.1_Missense_Mutation_p.K214N	NM_005313.4	NP_005304.3	P30101	PDIA3_HUMAN	protein disulfide isomerase family A, member 3	234					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein N-linked glycosylation via asparagine (GO:0018279)|protein retention in ER lumen (GO:0006621)|proteolysis (GO:0006508)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|phospholipase C activity (GO:0004629)|poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(2)|skin(1)	17		all_cancers(109;2.61e-15)|all_epithelial(112;1.12e-12)|Lung NSC(122;2.17e-08)|all_lung(180;2.45e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.48e-07)		AAATTAAAAAGTTTATCCAGG	0.353																																																	0													124.0	122.0	123.0					15																	44057747		2198	4298	6496	SO:0001583	missense	0				CCDS10101.1	15q15	2009-11-20	2005-06-29	2005-03-03	ENSG00000167004	ENSG00000167004	5.3.4.1	"""Protein disulfide isomerases"""	4606	protein-coding gene	gene with protein product		602046	"""glucose regulated protein, 58kDa"", ""protein disulfide isomerase-associated 3"""	GRP58		8974399	Standard	NM_005313		Approved	P58, ERp61, ERp57, ERp60, GRP57, PI-PLC, HsT17083	uc001zsu.3	P30101	OTTHUMG00000044444	ENST00000300289.5:c.702G>T	15.37:g.44057747G>T	ENSP00000300289:p.Lys234Asn		Q13453|Q14255|Q8IYF8|Q9UMU7	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,tigrfam_Prot_disulphide_isomerase,tigrfam_Disulphide_isomerase	p.K234N	ENST00000300289.5	37	c.702	CCDS10101.1	15	.	.	.	.	.	.	.	.	.	.	G	12.93	2.085630	0.36758	.	.	ENSG00000167004	ENST00000300289;ENST00000538826;ENST00000537673;ENST00000538521	T;T	0.35048	1.33;1.33	5.93	3.78	0.43462	Thioredoxin-like fold (2);	0.082718	0.85682	D	0.000000	T	0.31358	0.0794	L	0.45137	1.4	0.52501	D	0.999953	B;B	0.25609	0.027;0.13	B;B	0.34779	0.024;0.189	T	0.07947	-1.0746	10	0.37606	T	0.19	.	6.8179	0.23841	0.712:0.0:0.288:0.0	.	214;234	G5EA52;P30101	.;PDIA3_HUMAN	N	234;209;8;214	ENSP00000300289:K234N;ENSP00000438260:K214N	ENSP00000300289:K234N	K	+	3	2	PDIA3	41845039	0.998000	0.40836	1.000000	0.80357	0.975000	0.68041	0.585000	0.23879	0.643000	0.30638	0.637000	0.83480	AAG	PDIA3	-	superfamily_Thioredoxin-like_fold,tigrfam_Prot_disulphide_isomerase	ENSG00000167004		0.353	PDIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIA3	HGNC	protein_coding	OTTHUMT00000103532.3		0.00	52	0	G	NM_005313		44057747	+1			no_errors	ENST00000300289	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
PGBD5	79605	genome.wustl.edu	37	1	230498085	230498085	+	Intron	SNP	G	G	T	rs565437914		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:230498085G>T	ENST00000525115.1	-	2	148				PGBD5_ENST00000391860.1_Intron|PGBD5_ENST00000321327.2_Silent_p.R119R			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5							integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		TAGGGCGGCCGAGGCGTCGAC	0.607																																																	0													63.0	64.0	63.0					1																	230498085		2203	4300	6503	SO:0001627	intron_variant	0			AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.125-5018C>A	1.37:g.230498085G>T			A0PJF3|B9EK58|Q5SR37|Q6PJN2	Silent	SNP	NULL	p.R119	ENST00000525115.1	37	c.355		1																																																																																			PGBD5	-	NULL	ENSG00000177614		0.607	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	PGBD5	HGNC	protein_coding	OTTHUMT00000382617.1	-	0.00	85	0	G	NM_024554		230498085	-1	tier1	-	no_errors	ENST00000321327	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.000	T
PHF1	5252	genome.wustl.edu	37	6	33382137	33382137	+	Silent	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:33382137G>T	ENST00000374516.3	+	9	1141	c.870G>T	c.(868-870)ctG>ctT	p.L290L	PHF1_ENST00000374512.3_Silent_p.L290L	NM_024165.2	NP_077084.1	O43189	PHF1_HUMAN	PHD finger protein 1	290					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of histone H3-K27 methylation (GO:0061087)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19		Ovarian(999;0.0443)				GTTTGCTCCTGGGGGAGGTAA	0.493											OREG0017346	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													90.0	93.0	92.0					6																	33382137		2203	4300	6503	SO:0001819	synonymous_variant	0			AF029678	CCDS4777.1, CCDS4778.1	6p21.3	2013-01-28			ENSG00000112511	ENSG00000112511		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	8919	protein-coding gene	gene with protein product	"""tudor domain containing 19C"""	602881				9545646, 18385154	Standard	NM_024165		Approved	MTF2L2, TDRD19C	uc003oeh.3	O43189	OTTHUMG00000031105	ENST00000374516.3:c.870G>T	6.37:g.33382137G>T		839	B1AZX2|B1AZX3|O60929|Q5SU07|Q5SU08|Q96KM7	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.L290	ENST00000374516.3	37	c.870	CCDS4777.1	6																																																																																			PHF1	-	NULL	ENSG00000112511		0.493	PHF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF1	HGNC	protein_coding	OTTHUMT00000076175.3	-	0.00	53	0	G			33382137	+1	tier1	-	no_errors	ENST00000374516	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.989	T
PHIP	55023	genome.wustl.edu	37	6	79692782	79692783	+	Nonsense_Mutation	DNP	GC	GC	AA			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:79692782_79692783GC>AA	ENST00000275034.4	-	23	2756_2757	c.2589_2590GC>TT	c.(2587-2592)ctGCag>ctTTag	p.Q864*	PHIP_ENST00000479165.1_5'Flank	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	864					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TTTGGTGGCTGCAGATTAATTC	0.351																																																	0																																										SO:0001587	stop_gained	0			AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.2589_2590delinsAA	6.37:g.79692782_79692783delinsAA	ENSP00000275034:p.Gln864*		A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Nonsense_Mutation|Silent	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quinonprotein_ADH-like_supfam,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.Q864*|p.L863	ENST00000275034.4	37	c.2590|c.2589	CCDS4987.1	6																																																																																			PHIP	-	NULL	ENSG00000146247		0.351	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHIP	HGNC	protein_coding	OTTHUMT00000041297.2	-	0.00	34	0	G|C			79692782|79692783	-1	tier1	-	no_errors	ENST00000275034	ensembl	human	known	74_37	nonsense|silent	37.50|36.73	30|31	18	SNP	1.000	A
PHACTR2	9749	genome.wustl.edu	37	6	144110003	144110003	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:144110003C>T	ENST00000427704.2	+	11	1898	c.1768C>T	c.(1768-1770)Cgc>Tgc	p.R590C	PHACTR2_ENST00000305766.6_Missense_Mutation_p.R510C|PHACTR2_ENST00000440869.2_Missense_Mutation_p.R601C|PHACTR2_ENST00000367584.4_Missense_Mutation_p.R578C|PHACTR2_ENST00000367582.3_Missense_Mutation_p.R521C	NM_001100166.1|NM_014721.2	NP_001093636.1|NP_055536.2	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2	590							protein phosphatase inhibitor activity (GO:0004864)			NS(3)|breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		TGACTATGACCGCCGAGCAGA	0.507																																					Pancreas(12;292 433 7358 48260 52635)|Ovarian(20;501 618 3485 36581 49208)												0													71.0	71.0	71.0					6																	144110003		1965	4146	6111	SO:0001583	missense	0			AB014580	CCDS43512.1, CCDS47492.1, CCDS47493.1, CCDS47494.1	6q24.1	2013-01-24	2004-05-20	2004-05-20	ENSG00000112419	ENSG00000112419		"""Phosphatase and actin regulators"""	20956	protein-coding gene	gene with protein product		608724	"""chromosome 6 open reading frame 56"""	C6orf56		9734811, 15107502	Standard	NM_001100164		Approved	KIAA0680	uc010khi.3	O75167	OTTHUMG00000015732	ENST00000427704.2:c.1768C>T	6.37:g.144110003C>T	ENSP00000391763:p.Arg590Cys		A6NKP5|A7MCZ5|A8MZC0|B2RWP7|B4DN76|B4DPB5|B4DTH7|Q5TFA0|Q68DM2	Missense_Mutation	SNP	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.R601C	ENST00000427704.2	37	c.1801	CCDS47492.1	6	.	.	.	.	.	.	.	.	.	.	C	27.8	4.861059	0.91433	.	.	ENSG00000112419	ENST00000367584;ENST00000427704;ENST00000305766;ENST00000440869;ENST00000367582	T;T;T;T;T	0.66460	-0.21;0.18;-0.12;0.16;-0.14	5.8	4.93	0.64822	.	0.101073	0.64402	D	0.000002	D	0.83797	0.5332	M	0.93550	3.43	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.999;0.995	D	0.89037	0.3446	10	0.87932	D	0	.	16.4611	0.84055	0.1319:0.8681:0.0:0.0	.	601;510;521;590	O75167-4;O75167-5;O75167-2;O75167	.;.;.;PHAR2_HUMAN	C	578;590;510;601;521	ENSP00000356556:R578C;ENSP00000391763:R590C;ENSP00000305530:R510C;ENSP00000417038:R601C;ENSP00000356554:R521C	ENSP00000305530:R510C	R	+	1	0	PHACTR2	144151696	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.920000	0.63390	1.422000	0.47177	0.650000	0.86243	CGC	PHACTR2	-	NULL	ENSG00000112419		0.507	PHACTR2-001	KNOWN	basic|CCDS	protein_coding	PHACTR2	HGNC	protein_coding	OTTHUMT00000042528.2	-	0.00	48	0	C	NM_014721		144110003	+1	tier1	-	no_errors	ENST00000440869	ensembl	human	known	74_37	missense	43.59	22	17	SNP	1.000	T
PIEZO2	63895	genome.wustl.edu	37	18	10736690	10736690	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr18:10736690T>C	ENST00000503781.3	-	32	4651	c.4652A>G	c.(4651-4653)tAt>tGt	p.Y1551C	PIEZO2_ENST00000383408.2_3'UTR|PIEZO2_ENST00000580640.1_Missense_Mutation_p.Y1576C|PIEZO2_ENST00000302079.6_Missense_Mutation_p.Y1551C	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	1551					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										AAACAAATAATAATCTCCACT	0.378																																																	0													167.0	128.0	140.0					18																	10736690		692	1591	2283	SO:0001583	missense	0			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.4652A>G	18.37:g.10736690T>C	ENSP00000421377:p.Tyr1551Cys		B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	pfam_Piezo	p.Y1576C	ENST00000503781.3	37	c.4727		18	.	.	.	.	.	.	.	.	.	.	T	13.57	2.276546	0.40294	.	.	ENSG00000154864	ENST00000302079	D	0.86030	-2.06	5.87	5.87	0.94306	.	.	.	.	.	D	0.92368	0.7578	M	0.86864	2.845	0.80722	D	1	.	.	.	.	.	.	D	0.93433	0.6787	7	0.72032	D	0.01	.	15.1046	0.72310	0.0:0.0:0.0:1.0	.	.	.	.	C	1551	ENSP00000303316:Y1551C	ENSP00000303316:Y1551C	Y	-	2	0	FAM38B	10726690	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.928000	0.75846	2.248000	0.74166	0.533000	0.62120	TAT	PIEZO2	-	NULL	ENSG00000154864		0.378	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	PIEZO2	HGNC	protein_coding	OTTHUMT00000442385.4	-	0.00	32	0	T	NM_022068		10736690	-1	tier1	-	no_errors	ENST00000580640	ensembl	human	novel	74_37	missense	30.77	27	12	SNP	1.000	C
PIF1	80119	genome.wustl.edu	37	15	65108838	65108838	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:65108838C>T	ENST00000268043.4	-	12	1895	c.1801G>A	c.(1801-1803)Gtt>Att	p.V601I	PIF1_ENST00000559239.1_Missense_Mutation_p.V601I|PIF1_ENST00000333425.6_Missense_Mutation_p.V601I					PIF1 5'-to-3' DNA helicase											kidney(1)|lung(1)	2						TCACAGCGAACCGCCATGGGG	0.647																																																	0													63.0	70.0	68.0					15																	65108838		2202	4299	6501	SO:0001583	missense	0			AK026345	CCDS10195.2, CCDS66797.1	15q22.1	2013-05-13	2013-05-13	2006-11-24	ENSG00000140451	ENSG00000140451	3.6.4.12		26220	protein-coding gene	gene with protein product		610953	"""chromosome 15 open reading frame 20"", ""PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae)"""	C15orf20		10926538, 16522649	Standard	NM_025049		Approved	FLJ22692	uc002ant.2	Q9H611	OTTHUMG00000132974	ENST00000268043.4:c.1801G>A	15.37:g.65108838C>T	ENSP00000268043:p.Val601Ile			Missense_Mutation	SNP	pfam_DNA_helicase_Pif1,pfam_DNA_helicase,superfamily_P-loop_NTPase	p.V601I	ENST00000268043.4	37	c.1801	CCDS10195.2	15	.	.	.	.	.	.	.	.	.	.	C	24.9	4.579730	0.86645	.	.	ENSG00000140451	ENST00000268043;ENST00000333425	T;T	0.52057	0.68;0.68	5.88	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.44350	0.1289	N	0.11364	0.135	0.80722	D	1	D	0.58970	0.984	P	0.62184	0.899	T	0.36648	-0.9739	10	0.20519	T	0.43	-10.7972	13.198	0.59749	0.0:0.9226:0.0:0.0774	.	601	Q9H611	PIF1_HUMAN	I	601	ENSP00000268043:V601I;ENSP00000328174:V601I	ENSP00000268043:V601I	V	-	1	0	PIF1	62895891	1.000000	0.71417	1.000000	0.80357	0.586000	0.36452	4.931000	0.63469	1.482000	0.48325	0.655000	0.94253	GTT	PIF1	-	superfamily_P-loop_NTPase	ENSG00000140451		0.647	PIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIF1	HGNC	protein_coding	OTTHUMT00000256533.1	-	0.00	95	0	C	NM_025049		65108838	-1	tier1	-	no_errors	ENST00000333425	ensembl	human	known	74_37	missense	32.81	43	21	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	T	rs121913279		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:178952085A>T	ENST00000263967.3	+	21	3297	c.3140A>T	c.(3139-3141)cAt>cTt	p.H1047L	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>T	3.37:g.178952085A>T	ENSP00000263967:p.His1047Leu		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047L	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	4.518	0.096038	0.08681	.	.	ENSG00000121879	ENST00000263967	T	0.78126	-1.15	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.47002	0.1422	N	0.00611	-1.325	0.80722	D	1	B	0.14438	0.01	B	0.12156	0.007	T	0.58053	-0.7704	10	0.02654	T	1	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	L	1047	ENSP00000263967:H1047L	ENSP00000263967:H1047L	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	-	0.00	20	0	A			178952085	+1	tier1	rs121913279	no_errors	ENST00000263967	ensembl	human	known	74_37	missense	37.14	21	13	SNP	1.000	T
PLA2G12B	84647	genome.wustl.edu	37	10	74701076	74701076	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:74701076G>T	ENST00000373032.3	-	3	409	c.317C>A	c.(316-318)cCa>cAa	p.P106Q		NM_032562.2	NP_115951.2	Q9BX93	PG12B_HUMAN	phospholipase A2, group XIIB	106					cholesterol homeostasis (GO:0042632)|lipid catabolic process (GO:0016042)|triglyceride homeostasis (GO:0070328)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|skin(2)	9	Prostate(51;0.0198)					TGTCATTGCTGGAATGCCCAA	0.488																																																	0													153.0	146.0	148.0					10																	74701076		2203	4300	6503	SO:0001583	missense	0			AF349540	CCDS7319.1	10q22.1	2008-09-19	2004-01-13	2004-01-14	ENSG00000138308	ENSG00000138308	3.1.1.4		18555	protein-coding gene	gene with protein product		611653	"""phospholipase A2, group XIII"""	PLA2G13			Standard	NM_032562		Approved		uc001jtf.1	Q9BX93	OTTHUMG00000018446	ENST00000373032.3:c.317C>A	10.37:g.74701076G>T	ENSP00000362123:p.Pro106Gln		B7ZL23|Q52LB2|Q96Q99	Missense_Mutation	SNP	pfam_PLipase_A2_secretory_G12,superfamily_PLipase_A2_dom	p.P106Q	ENST00000373032.3	37	c.317	CCDS7319.1	10	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822098	0.90873	.	.	ENSG00000138308	ENST00000373032	.	.	.	5.51	5.51	0.81932	Phospholipase A2 (2);	0.049292	0.85682	D	0.000000	D	0.84070	0.5391	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.99;1.0	D	0.85847	0.1401	9	0.72032	D	0.01	-3.6077	19.4178	0.94709	0.0:0.0:1.0:0.0	.	106;106	B7ZL23;Q9BX93	.;PG12B_HUMAN	Q	106	.	ENSP00000362123:P106Q	P	-	2	0	PLA2G12B	74371082	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.120000	0.94369	2.601000	0.87937	0.655000	0.94253	CCA	PLA2G12B	-	pfam_PLipase_A2_secretory_G12,superfamily_PLipase_A2_dom	ENSG00000138308		0.488	PLA2G12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G12B	HGNC	protein_coding	OTTHUMT00000048598.1	-	0.00	49	0	G	NM_032562		74701076	-1	tier1	-	no_errors	ENST00000373032	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
PLCD1	5333	genome.wustl.edu	37	3	38049856	38049856	+	Silent	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:38049856G>T	ENST00000334661.4	-	13	2127	c.1905C>A	c.(1903-1905)gtC>gtA	p.V635V	PLCD1_ENST00000463876.1_Silent_p.V656V|PLCD1_ENST00000479619.1_5'Flank	NM_006225.3	NP_006216.2	P51178	PLCD1_HUMAN	phospholipase C, delta 1	635	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTPase activating protein binding (GO:0032794)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol phosphate binding (GO:1901981)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylserine binding (GO:0001786)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		GCCCCGAAATGACCTGAGGAA	0.562																																																	0													65.0	65.0	65.0					3																	38049856		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2671.1, CCDS46793.1	3p22-p21.3	2013-01-10			ENSG00000187091	ENSG00000187091	3.1.4.11	"""EF-hand domain containing"""	9060	protein-coding gene	gene with protein product		602142				9345909	Standard	NM_001130964		Approved		uc003chm.3	P51178	OTTHUMG00000130813	ENST00000334661.4:c.1905C>A	3.37:g.38049856G>T			B3KR14|Q86VN8	Silent	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_EF_hand_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.V656	ENST00000334661.4	37	c.1968	CCDS2671.1	3																																																																																			PLCD1	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000187091		0.562	PLCD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCD1	HGNC	protein_coding	OTTHUMT00000253359.2	-	0.00	122	0	G			38049856	-1	tier1	-	no_errors	ENST00000463876	ensembl	human	known	74_37	silent	6.25	60	4	SNP	1.000	T
PPFIBP2	8495	genome.wustl.edu	37	11	7669640	7669640	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:7669640C>A	ENST00000299492.4	+	18	2057	c.1669C>A	c.(1669-1671)Cag>Aag	p.Q557K	PPFIBP2_ENST00000528883.1_Missense_Mutation_p.Q445K|PPFIBP2_ENST00000530582.1_3'UTR|PPFIBP2_ENST00000533792.1_Missense_Mutation_p.Q399K|PPFIBP2_ENST00000530181.1_Missense_Mutation_p.Q414K	NM_003621.3	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2 (liprin beta 2)	557					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)	DNA binding (GO:0003677)|integrase activity (GO:0008907)			breast(8)|cervix(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		CCCCTTTGCCCAGTGGAGCAC	0.512																																																	0													129.0	100.0	110.0					11																	7669640		2201	4296	6497	SO:0001583	missense	0			AF034803	CCDS31419.1, CCDS58116.1, CCDS58117.1	11p15.4	2013-01-10			ENSG00000166387	ENSG00000166387		"""Sterile alpha motif (SAM) domain containing"""	9250	protein-coding gene	gene with protein product		603142				9624153	Standard	NM_003621		Approved	Cclp1	uc001mfj.5	Q8ND30	OTTHUMG00000165617	ENST00000299492.4:c.1669C>A	11.37:g.7669640C>A	ENSP00000299492:p.Gln557Lys		B7Z433|E9PK77|O75337|Q8WW26	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_Integrase_Tn916-type_DNA-bd_N,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.Q557K	ENST00000299492.4	37	c.1669	CCDS31419.1	11	.	.	.	.	.	.	.	.	.	.	C	11.77	1.737769	0.30774	.	.	ENSG00000166387	ENST00000299492;ENST00000533792;ENST00000541115;ENST00000528883;ENST00000530181	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.74	5.74	0.90152	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.64402	D	0.000001	T	0.43919	0.1269	N	0.03050	-0.425	0.48696	D	0.999691	B;P;B;D;D;P	0.69078	0.178;0.89;0.259;0.997;0.997;0.479	B;P;B;D;D;B	0.78314	0.156;0.838;0.166;0.991;0.991;0.217	T	0.49513	-0.8932	10	0.15499	T	0.54	-20.3046	17.4118	0.87488	0.0:1.0:0.0:0.0	.	445;445;480;399;414;557	E9PK77;B7Z433;F5GWB0;E9PP16;E9PMU1;Q8ND30	.;.;.;.;.;LIPB2_HUMAN	K	557;399;480;445;414	ENSP00000299492:Q557K;ENSP00000436498:Q399K;ENSP00000435469:Q445K;ENSP00000437321:Q414K	ENSP00000299492:Q557K	Q	+	1	0	PPFIBP2	7626216	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.030000	0.64128	2.716000	0.92895	0.561000	0.74099	CAG	PPFIBP2	-	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM	ENSG00000166387		0.512	PPFIBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPFIBP2	HGNC	protein_coding	OTTHUMT00000385345.2	-	0.00	28	0	C	NM_003621		7669640	+1	tier1	-	no_errors	ENST00000299492	ensembl	human	known	74_37	missense	40.62	18	13	SNP	1.000	A
PPP1R13B	23368	genome.wustl.edu	37	14	104220545	104220545	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr14:104220545G>A	ENST00000202556.9	-	6	775	c.493C>T	c.(493-495)Cgt>Tgt	p.R165C		NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	165	Gln-rich.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				tgctgctgACGGCGCTCCTGT	0.418																																																	0													115.0	106.0	109.0					14																	104220545		1851	4098	5949	SO:0001583	missense	0			AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.493C>T	14.37:g.104220545G>A	ENSP00000202556:p.Arg165Cys		B2RMX5|O94870	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SH3_domain,prints_SH3_domain	p.R165C	ENST00000202556.9	37	c.493	CCDS41997.1	14	.	.	.	.	.	.	.	.	.	.	G	20.7	4.027952	0.75390	.	.	ENSG00000088808	ENST00000202556;ENST00000380023	T	0.33216	1.42	5.66	5.66	0.87406	.	0.094530	0.85682	D	0.000000	T	0.25827	0.0629	L	0.35542	1.07	0.80722	D	1	P	0.35050	0.482	B	0.23574	0.047	T	0.04855	-1.0922	10	0.59425	D	0.04	.	20.1253	0.97977	0.0:0.0:1.0:0.0	.	165	Q96KQ4	ASPP1_HUMAN	C	165;32	ENSP00000202556:R165C	ENSP00000202556:R165C	R	-	1	0	PPP1R13B	103290298	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.338000	0.96553	2.832000	0.97577	0.655000	0.94253	CGT	PPP1R13B	-	NULL	ENSG00000088808		0.418	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R13B	HGNC	protein_coding	OTTHUMT00000414591.1	-	0.00	18	0	G	NM_015316		104220545	-1	tier1	-	no_errors	ENST00000202556	ensembl	human	known	74_37	missense	37.50	15	9	SNP	1.000	A
PPP1R3F	89801	genome.wustl.edu	37	X	49137873	49137873	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chrX:49137873G>T	ENST00000055335.6	+	2	1025	c.1009G>T	c.(1009-1011)Gcc>Tcc	p.A337S	PPP1R3F_ENST00000495799.1_5'UTR|PPP1R3F_ENST00000376188.1_5'UTR|PPP1R3F_ENST00000466508.1_5'UTR|PPP1R3F_ENST00000438316.1_Missense_Mutation_p.A9S	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F	337					regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					CTGCAGGCCTGCCGAGGAGGA	0.502																																																	0													82.0	64.0	70.0					X																	49137873		2203	4300	6503	SO:0001583	missense	0				CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.1009G>T	X.37:g.49137873G>T	ENSP00000055335:p.Ala337Ser		A2VDJ8|B3KPW2|E9PCM3	Missense_Mutation	SNP	pfam_CBM_21,pfscan_CBM_21	p.A337S	ENST00000055335.6	37	c.1009	CCDS35254.1	X	.	.	.	.	.	.	.	.	.	.	G	3.039	-0.197949	0.06219	.	.	ENSG00000049769	ENST00000438316;ENST00000055335	T;T	0.55588	0.93;0.51	4.46	-8.91	0.00778	.	2.773100	0.01223	N	0.008159	T	0.20659	0.0497	N	0.03608	-0.345	0.09310	N	1	B;B	0.14012	0.009;0.002	B;B	0.16722	0.016;0.004	T	0.21690	-1.0238	10	0.08179	T	0.78	21.989	3.8698	0.09031	0.3507:0.4462:0.1093:0.0938	.	9;337	F5H262;Q6ZSY5	.;PPR3F_HUMAN	S	9;337	ENSP00000415548:A9S;ENSP00000055335:A337S	ENSP00000055335:A337S	A	+	1	0	PPP1R3F	49024817	0.000000	0.05858	0.001000	0.08648	0.418000	0.31294	-1.864000	0.01650	-2.109000	0.00838	-0.191000	0.12829	GCC	PPP1R3F	-	NULL	ENSG00000049769		0.502	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP1R3F	HGNC	protein_coding	OTTHUMT00000060819.2	-	0.00	22	0	G	NM_033215		49137873	+1	tier1	-	no_errors	ENST00000055335	ensembl	human	known	74_37	missense	18.18	18	4	SNP	0.000	T
PPP1R9B	84687	genome.wustl.edu	37	17	48211968	48211968	+	3'UTR	SNP	G	G	C	rs8073656		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:48211968G>C	ENST00000316878.6	-	0	3178				PPP1R9B_ENST00000501501.2_5'UTR|AC002401.1_ENST00000451776.1_RNA	NM_032595.3	NP_115984.3	Q96SB3	NEB2_HUMAN	protein phosphatase 1, regulatory subunit 9B						actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to morphine (GO:0071315)|dendrite development (GO:0016358)|filopodium assembly (GO:0046847)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of cell proliferation (GO:0042127)|regulation of exit from mitosis (GO:0007096)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of protein phosphorylation (GO:0001932)|RNA splicing (GO:0008380)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|protein phosphatase type 1 complex (GO:0000164)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8						AGGAGAAATTGAGGGCTGCTG	0.557																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ401189	CCDS74102.1	17q21.33	2013-01-31	2011-10-04	2001-07-02	ENSG00000108819	ENSG00000108819		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9298	protein-coding gene	gene with protein product	"""spinophilin"", ""Neurabin-2"""	603325	"""protein phosphatase 1, regulatory subunit 9B, spinophilin"", ""protein phosphatase 1, regulatory (inhibitor) subunit 9B"""	PPP1R6, PPP1R9		9275233	Standard	NM_032595		Approved	Spn, SPINO	uc002iqh.4	Q96SB3	OTTHUMG00000162008	ENST00000316878.6:c.*728C>G	17.37:g.48211968G>C			Q8TCR9	RNA	SNP	-	NULL	ENST00000316878.6	37	NULL		17																																																																																			PPP1R9B	-	-	ENSG00000108819		0.557	PPP1R9B-201	KNOWN	basic|appris_principal	protein_coding	PPP1R9B	HGNC	protein_coding		-	0.00	92	0	G	NM_032595		48211968	-1	tier1	-	no_errors	ENST00000501501	ensembl	human	known	74_37	rna	8.06	57	5	SNP	0.063	C
PRIM2	5558	genome.wustl.edu	37	6	57183284	57183284	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:57183284C>T	ENST00000607273.1	+	2	128	c.41C>T	c.(40-42)gCa>gTa	p.A14V	PRIM2_ENST00000389488.2_3'UTR	NM_000947.3	NP_000938.2	P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)	14					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CTGAGGTTGGCAGGTGACCAG	0.413																																																	0													56.0	55.0	55.0					6																	57183284		1877	4116	5993	SO:0001583	missense	0				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000607273.1:c.41C>T	6.37:g.57183284C>T	ENSP00000475738:p.Ala14Val		Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Missense_Mutation	SNP	pfam_DNA_primase_lsu_euk/arc	p.A14V	ENST00000607273.1	37	c.41		6																																																																																			PRIM2	-	NULL	ENSG00000146143		0.413	PRIM2-201	KNOWN	basic|appris_principal	protein_coding	PRIM2	HGNC	protein_coding		-	0.00	47	0	C	NM_000947		57183284	+1	tier1	-	no_errors	ENST00000607273	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.193	T
PRLHR	2834	genome.wustl.edu	37	10	120354171	120354171	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:120354171C>T	ENST00000369169.1	-	1	585	c.586G>A	c.(586-588)Gtg>Atg	p.V196M	PRLHR_ENST00000239032.2_Missense_Mutation_p.V196M			P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	196					feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone metabolic process (GO:0042445)|neuropeptide signaling pathway (GO:0007218)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)|neuropeptide Y receptor activity (GO:0004983)			large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		TAGGTGTGCACGGCGGCGGGC	0.721																																																	0													10.0	11.0	11.0					10																	120354171		2184	4258	6442	SO:0001583	missense	0			AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973		"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10		8666380, 15885496	Standard	NM_004248		Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.586G>A	10.37:g.120354171C>T	ENSP00000358167:p.Val196Met		O75194|Q502U8|Q5VXR9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Prolrel_pep_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.V196M	ENST00000369169.1	37	c.586	CCDS7606.1	10	.	.	.	.	.	.	.	.	.	.	C	8.616	0.890366	0.17613	.	.	ENSG00000119973	ENST00000239032;ENST00000369169	T;T	0.72505	-0.66;-0.66	4.54	-9.07	0.00724	GPCR, rhodopsin-like superfamily (1);	1.180340	0.06648	N	0.762291	T	0.49729	0.1574	L	0.37697	1.125	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.40289	-0.9571	10	0.59425	D	0.04	.	1.7109	0.02891	0.2838:0.3653:0.1714:0.1795	.	196	P49683	PRLHR_HUMAN	M	196	ENSP00000239032:V196M;ENSP00000358167:V196M	ENSP00000239032:V196M	V	-	1	0	PRLHR	120344161	0.041000	0.20044	0.348000	0.25681	0.713000	0.41058	0.107000	0.15375	-1.878000	0.01128	-0.940000	0.02684	GTG	PRLHR	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000119973		0.721	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLHR	HGNC	protein_coding	OTTHUMT00000050610.1	-	0.00	33	0	C	NM_004248		120354171	-1	tier1	-	no_errors	ENST00000239032	ensembl	human	known	74_37	missense	31.58	13	6	SNP	0.014	T
PRPF8	10594	genome.wustl.edu	37	17	1582171	1582171	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:1582171C>T	ENST00000572621.1	-	11	1869	c.1604G>A	c.(1603-1605)aGa>aAa	p.R535K	PRPF8_ENST00000304992.6_Missense_Mutation_p.R535K			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	535					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		AGATTTCTTTCTTTCCTGGAG	0.468																																																	0													63.0	60.0	61.0					17																	1582171		2203	4300	6503	SO:0001583	missense	0			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.1604G>A	17.37:g.1582171C>T	ENSP00000460348:p.Arg535Lys		O14547|O75965	Missense_Mutation	SNP	pfam_PROCN,pfam_PRP8_domainIV,pfam_Prp8_U6-snRNA-bd,pfam_PRO8NT,pfam_Prp8_U5-snRNA-bd,pfam_PROCT,pfam_RRM_spliceosomal_PrP8,pfam_JAB_MPN_dom,superfamily_Cupredoxin,superfamily_Histone-fold,smart_JAB_MPN_dom	p.R535K	ENST00000572621.1	37	c.1604	CCDS11010.1	17	.	.	.	.	.	.	.	.	.	.	C	23.5	4.426451	0.83667	.	.	ENSG00000174231	ENST00000304992	D	0.82255	-1.59	6.07	6.07	0.98685	PROCN (1);	0.000000	0.85682	D	0.000000	D	0.93621	0.7963	M	0.92649	3.33	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.93184	0.6577	10	0.49607	T	0.09	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	535	Q6P2Q9	PRP8_HUMAN	K	535	ENSP00000304350:R535K	ENSP00000304350:R535K	R	-	2	0	PRPF8	1528921	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.703000	0.84585	2.890000	0.99128	0.650000	0.86243	AGA	PRPF8	-	pfam_PROCN,superfamily_Histone-fold	ENSG00000174231		0.468	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRPF8	HGNC	protein_coding	OTTHUMT00000438412.2	-	0.00	33	0	C			1582171	-1	tier1	-	no_errors	ENST00000304992	ensembl	human	known	74_37	missense	42.86	24	18	SNP	1.000	T
PRTG	283659	genome.wustl.edu	37	15	55964703	55964703	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:55964703G>A	ENST00000389286.4	-	11	2028	c.1981C>T	c.(1981-1983)Cag>Tag	p.Q661*		NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		CCATTCTCCTGCTGCCCTTCT	0.473																																																	0													129.0	132.0	131.0					15																	55964703		1950	4133	6083	SO:0001587	stop_gained	0			AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.1981C>T	15.37:g.55964703G>A	ENSP00000373937:p.Gln661*			Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Q661*	ENST00000389286.4	37	c.1981	CCDS42040.1	15	.	.	.	.	.	.	.	.	.	.	G	40	7.959969	0.98583	.	.	ENSG00000166450	ENST00000389286	.	.	.	5.52	5.52	0.82312	.	0.797682	0.12247	N	0.486021	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-12.4126	18.4581	0.90728	0.0:0.0:1.0:0.0	.	.	.	.	X	661	.	ENSP00000373937:Q661X	Q	-	1	0	PRTG	53751995	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.349000	0.73013	2.591000	0.87537	0.650000	0.86243	CAG	PRTG	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000166450		0.473	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRTG	HGNC	protein_coding	OTTHUMT00000419357.1	-	0.00	63	0	G	NM_173814		55964703	-1	tier1	-	no_errors	ENST00000389286	ensembl	human	known	74_37	nonsense	36.62	45	26	SNP	1.000	A
PSMD9	5715	genome.wustl.edu	37	12	122332686	122332686	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:122332686G>T	ENST00000541212.1	+	2	306	c.180G>T	c.(178-180)gaG>gaT	p.E60D	RP11-87C12.2_ENST00000546333.1_Missense_Mutation_p.E60D|PSMD9_ENST00000542602.1_Intron|PSMD9_ENST00000340175.5_Missense_Mutation_p.E60D|PSMD9_ENST00000261817.2_Missense_Mutation_p.E60D			O00233	PSMD9_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 9	60					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion (GO:0046676)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of insulin secretion (GO:0032024)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome regulatory particle assembly (GO:0070682)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome regulatory particle (GO:0005838)	bHLH transcription factor binding (GO:0043425)|transcription coactivator activity (GO:0003713)			endometrium(1)|large_intestine(1)|lung(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000117)|Epithelial(86;0.000415)|BRCA - Breast invasive adenocarcinoma(302;0.231)		TGGACTGTGAGGGCTACCCCC	0.542											OREG0022210	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													94.0	74.0	80.0					12																	122332686		2203	4300	6503	SO:0001583	missense	0			AB003177	CCDS9225.1, CCDS58284.1	12q24.31-q24.32	2008-05-22			ENSG00000110801	ENSG00000110801		"""Proteasome (prosome, macropain) subunits"""	9567	protein-coding gene	gene with protein product		603146				9653651	Standard	NM_002813		Approved	p27, Rpn4	uc001ubl.4	O00233	OTTHUMG00000168945	ENST00000541212.1:c.180G>T	12.37:g.122332686G>T	ENSP00000440485:p.Glu60Asp	1518	B2RD35|G3V1Q6|Q9BQ42	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ	p.E60D	ENST00000541212.1	37	c.180	CCDS9225.1	12	.	.	.	.	.	.	.	.	.	.	G	16.29	3.081275	0.55753	.	.	ENSG00000110801	ENST00000541212;ENST00000340175;ENST00000261817;ENST00000538613	T;T;T;T	0.23147	1.92;1.92;1.92;1.92	5.95	4.14	0.48551	.	0.000000	0.85682	D	0.000000	T	0.31071	0.0785	L	0.49256	1.55	0.58432	D	0.999995	P;D	0.52996	0.839;0.957	P;P	0.51974	0.686;0.542	T	0.02333	-1.1175	10	0.31617	T	0.26	-41.9954	8.813	0.34978	0.2792:0.0:0.7208:0.0	.	60;60	F8W7V8;O00233	.;PSMD9_HUMAN	D	60	ENSP00000440485:E60D;ENSP00000340847:E60D;ENSP00000261817:E60D;ENSP00000443081:E60D	ENSP00000261817:E60D	E	+	3	2	PSMD9	120817069	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.230000	0.42999	0.864000	0.35578	-0.150000	0.13652	GAG	PSMD9	-	NULL	ENSG00000110801		0.542	PSMD9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSMD9	HGNC	protein_coding	OTTHUMT00000401686.1		0.00	76	0	G	NM_002813		122332686	+1			no_errors	ENST00000541212	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
PTCD3	55037	genome.wustl.edu	37	2	86352947	86352947	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:86352947G>A	ENST00000254630.7	+	12	961	c.895G>A	c.(895-897)Gaa>Aaa	p.E299K	PTCD3_ENST00000409277.3_3'UTR	NM_017952.5	NP_060422.4	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3	299					mitochondrial translation (GO:0032543)|regulation of translation (GO:0006417)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|rRNA binding (GO:0019843)			NS(1)|breast(2)|endometrium(3)|kidney(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	22						TGCATTGATTGAAGCAACAGT	0.313																																																	0													51.0	54.0	53.0					2																	86352947		2203	4300	6503	SO:0001583	missense	0				CCDS33235.1	2p11.2	2014-02-12	2012-02-24		ENSG00000132300	ENSG00000132300			24717	protein-coding gene	gene with protein product		614918				8889548	Standard	NM_017952		Approved	FLJ20758, DKFZp666K071	uc002sqw.2	Q96EY7	OTTHUMG00000153168	ENST00000254630.7:c.895G>A	2.37:g.86352947G>A	ENSP00000254630:p.Glu299Lys		A6NHD2|D6W5M1|Q597H0|Q658Y9|Q9BUZ8|Q9NWL0	Missense_Mutation	SNP	NULL	p.E299K	ENST00000254630.7	37	c.895	CCDS33235.1	2	.	.	.	.	.	.	.	.	.	.	G	9.388	1.074691	0.20227	.	.	ENSG00000132300	ENST00000254630	T	0.28666	1.6	6.02	5.14	0.70334	.	0.715644	0.14821	N	0.296471	T	0.18045	0.0433	N	0.20445	0.575	0.80722	D	1	B	0.11235	0.004	B	0.16289	0.015	T	0.06698	-1.0812	10	0.12103	T	0.63	-15.1636	8.2798	0.31894	0.0787:0.0:0.7673:0.154	.	299	Q96EY7	PTCD3_HUMAN	K	299	ENSP00000254630:E299K	ENSP00000254630:E299K	E	+	1	0	PTCD3	86206458	0.996000	0.38824	0.995000	0.50966	0.079000	0.17450	1.426000	0.34870	1.552000	0.49463	0.655000	0.94253	GAA	PTCD3	-	NULL	ENSG00000132300		0.313	PTCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCD3	HGNC	protein_coding	OTTHUMT00000329854.1		0.00	61	0	G	NM_017952		86352947	+1			no_errors	ENST00000254630	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.998	A
PTN	5764	genome.wustl.edu	37	7	136936052	136936052	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:136936052G>T	ENST00000348225.2	-	4	803	c.376C>A	c.(376-378)Ctg>Atg	p.L126M	PTN_ENST00000393083.2_Missense_Mutation_p.L126M	NM_002825.5	NP_002816.1	P21246	PTN_HUMAN	pleiotrophin	126					bone mineralization (GO:0030282)|learning (GO:0007612)|negative regulation of catalytic activity (GO:0043086)|nervous system development (GO:0007399)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)	heparin binding (GO:0008201)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23						GCATTGTGCAGGGCTCGCTTC	0.527																																																	0													302.0	275.0	284.0					7																	136936052		2203	4300	6503	SO:0001583	missense	0			M57399	CCDS5844.1	7q33	2014-01-30	2008-07-31		ENSG00000105894	ENSG00000105894		"""Endogenous ligands"""	9630	protein-coding gene	gene with protein product	"""heparin binding growth factor 8"""	162095	"""neurite growth-promoting factor 1"""	NEGF1		1457401, 1768439	Standard	NM_002825		Approved	HBNF, HBGF8	uc003vtq.2	P21246	OTTHUMG00000155709	ENST00000348225.2:c.376C>A	7.37:g.136936052G>T	ENSP00000341170:p.Leu126Met		Q5U0B0|Q6ICQ5|Q9UCC6	Missense_Mutation	SNP	pfam_PTN/MK_C_dom,pfam_PTN/MK_N_dom,superfamily_PTN/MK_diS,smart_Midkine_heparin-bd_GF,prints_Midkine_heparin-bd_GF	p.L126M	ENST00000348225.2	37	c.376	CCDS5844.1	7	.	.	.	.	.	.	.	.	.	.	G	21.5	4.156970	0.78114	.	.	ENSG00000105894	ENST00000348225;ENST00000393083	.	.	.	6.02	6.02	0.97574	Midkine heparin-binding growth factor, C-terminal (2);Midkine heparin-binding growth factor, disulphide-rich domain (1);	0.058403	0.64402	D	0.000002	T	0.75889	0.3911	M	0.64997	1.995	0.51233	D	0.999915	D;D	0.76494	0.999;0.999	D;D	0.75484	0.986;0.977	T	0.76132	-0.3071	9	0.59425	D	0.04	-11.4516	13.6966	0.62582	0.07:0.0:0.93:0.0	.	126;126	C9JR52;P21246	.;PTN_HUMAN	M	126	.	ENSP00000341170:L126M	L	-	1	2	PTN	136586592	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.583000	0.74053	2.857000	0.98124	0.650000	0.86243	CTG	PTN	-	pfam_PTN/MK_C_dom,superfamily_PTN/MK_diS,smart_Midkine_heparin-bd_GF,prints_Midkine_heparin-bd_GF	ENSG00000105894		0.527	PTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTN	HGNC	protein_coding	OTTHUMT00000341339.1	-	0.00	55	0	G	NM_002825		136936052	-1	tier1	-	no_errors	ENST00000348225	ensembl	human	known	74_37	missense	31.58	39	18	SNP	1.000	T
PVRL1	5818	genome.wustl.edu	37	11	119535970	119535970	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:119535970C>T	ENST00000264025.3	-	6	1571	c.1041G>A	c.(1039-1041)cgG>cgA	p.R347R	PVRL1_ENST00000341398.2_Intron	NM_002855.4	NP_002846.3	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 (herpesvirus entry mediator C)	347					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|desmosome organization (GO:0002934)|enamel mineralization (GO:0070166)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|immune response (GO:0006955)|iron ion transport (GO:0006826)|lens morphogenesis in camera-type eye (GO:0002089)|regulation of synapse assembly (GO:0051963)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|viral entry into host cell (GO:0046718)	adherens junction (GO:0005912)|axon (GO:0030424)|cell-cell adherens junction (GO:0005913)|extracellular region (GO:0005576)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|protein homodimerization activity (GO:0042803)|virion binding (GO:0046790)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		GCCCGGCGCGCCGCCCATGTT	0.672																																																	0													22.0	26.0	24.0					11																	119535970		2198	4289	6487	SO:0001819	synonymous_variant	0			X76400	CCDS8425.1, CCDS8426.1, CCDS8427.1	11q23-q24	2013-01-29	2007-06-07		ENSG00000110400	ENSG00000110400		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9706	protein-coding gene	gene with protein product	"""nectin"""	600644		HVEC, ED4		7721102, 9616127	Standard	NM_203285		Approved	PRR, PRR1, PVRR1, SK-12, HIgR, CLPED1, CD111, OFC7	uc001pwv.3	Q15223	OTTHUMG00000166177	ENST00000264025.3:c.1041G>A	11.37:g.119535970C>T			O75465|Q2M3D3|Q9HBE6|Q9HBW2	Silent	SNP	pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.R347	ENST00000264025.3	37	c.1041	CCDS8426.1	11																																																																																			PVRL1	-	NULL	ENSG00000110400		0.672	PVRL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRL1	HGNC	protein_coding	OTTHUMT00000388231.1	-	0.00	25	0	C			119535970	-1	tier1	-	no_errors	ENST00000264025	ensembl	human	known	74_37	silent	37.50	15	9	SNP	1.000	T
PWP1	11137	genome.wustl.edu	37	12	108082471	108082471	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:108082471C>T	ENST00000412830.3	+	3	379	c.211C>T	c.(211-213)Cgc>Tgc	p.R71C	PWP1_ENST00000541166.1_Missense_Mutation_p.R9C	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)	71					transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.R71C(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						CACCCAGGCACGCCCAAGAGA	0.517																																																	1	Substitution - Missense(1)	urinary_tract(1)											127.0	119.0	122.0					12																	108082471		2203	4300	6503	SO:0001583	missense	0			BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.211C>T	12.37:g.108082471C>T	ENSP00000387365:p.Arg71Cys		A8K3R6|Q7Z3X9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R71C	ENST00000412830.3	37	c.211	CCDS9114.1	12	.	.	.	.	.	.	.	.	.	.	.	13.05	2.120282	0.37436	.	.	ENSG00000136045	ENST00000412830;ENST00000547995;ENST00000258531;ENST00000546068;ENST00000538327;ENST00000541166	T;T	0.70986	-0.5;-0.53	5.69	3.72	0.42706	.	0.943772	0.08976	N	0.866472	T	0.47192	0.1432	N	0.14661	0.345	0.09310	N	1	P	0.40931	0.733	B	0.31547	0.132	T	0.41251	-0.9519	10	0.59425	D	0.04	.	4.1737	0.10341	0.1527:0.4813:0.2842:0.0819	.	71	Q13610	PWP1_HUMAN	C	71;9;71;71;71;9	ENSP00000387365:R71C;ENSP00000445249:R9C	ENSP00000258531:R71C	R	+	1	0	PWP1	106606601	0.001000	0.12720	0.032000	0.17829	0.926000	0.56050	1.070000	0.30653	1.354000	0.45846	0.478000	0.44815	CGC	PWP1	-	NULL	ENSG00000136045		0.517	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PWP1	HGNC	protein_coding	OTTHUMT00000406539.1	-	0.00	35	0	C	NM_007062		108082471	+1	tier1	-	no_errors	ENST00000412830	ensembl	human	known	74_37	missense	28.26	33	13	SNP	0.000	T
PWWP2B	170394	genome.wustl.edu	37	10	134218219	134218219	+	Missense_Mutation	SNP	A	A	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:134218219A>T	ENST00000305233.5	+	2	274	c.215A>T	c.(214-216)gAg>gTg	p.E72V	PWWP2B_ENST00000368609.4_Missense_Mutation_p.E72V	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	72										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		GCTCCCGAGGAGGGGGATGCA	0.721																																																	0													62.0	70.0	67.0					10																	134218219		2140	4271	6411	SO:0001583	missense	0			AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.215A>T	10.37:g.134218219A>T	ENSP00000306324:p.Glu72Val		A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Missense_Mutation	SNP	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom	p.E72V	ENST00000305233.5	37	c.215	CCDS7667.2	10	.	.	.	.	.	.	.	.	.	.	A	12.65	2.002660	0.35320	.	.	ENSG00000171813	ENST00000305233;ENST00000368609	T;T	0.56941	0.43;1.42	4.41	3.27	0.37495	.	.	.	.	.	T	0.32315	0.0825	N	0.12182	0.205	0.09310	N	1	P	0.35077	0.483	B	0.33392	0.163	T	0.15178	-1.0446	9	0.56958	D	0.05	-2.9391	7.7293	0.28777	0.9007:0.0:0.0993:0.0	.	72	Q6NUJ5	PWP2B_HUMAN	V	72	ENSP00000306324:E72V;ENSP00000357598:E72V	ENSP00000306324:E72V	E	+	2	0	PWWP2B	134068209	0.000000	0.05858	0.030000	0.17652	0.018000	0.09664	0.452000	0.21795	0.661000	0.30985	0.460000	0.39030	GAG	PWWP2B	-	NULL	ENSG00000171813		0.721	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PWWP2B	HGNC	protein_coding	OTTHUMT00000051075.3	-	0.00	25	0	A	NM_138499		134218219	+1	tier1	-	no_errors	ENST00000305233	ensembl	human	known	74_37	missense	47.62	11	10	SNP	0.006	T
PXDNL	137902	genome.wustl.edu	37	8	52366270	52366270	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr8:52366270G>T	ENST00000356297.4	-	10	1158	c.1058C>A	c.(1057-1059)gCc>gAc	p.A353D	PXDNL_ENST00000543296.1_Missense_Mutation_p.A353D	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	353	Ig-like C2-type 2.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GTGGCCTGTGGCCATACATTC	0.507																																																	0													118.0	117.0	117.0					8																	52366270		1999	4161	6160	SO:0001583	missense	0				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1058C>A	8.37:g.52366270G>T	ENSP00000348645:p.Ala353Asp		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.A353D	ENST00000356297.4	37	c.1058	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	G	15.88	2.962271	0.53400	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.69306	-0.39;-0.39	4.14	4.14	0.48551	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.85695	0.5756	H	0.95470	3.675	0.32287	N	0.566858	D	0.67145	0.996	D	0.73380	0.98	D	0.89472	0.3744	9	0.87932	D	0	.	11.9364	0.52876	0.0:0.0:1.0:0.0	.	353	A1KZ92	PXDNL_HUMAN	D	353	ENSP00000348645:A353D;ENSP00000444865:A353D	ENSP00000348645:A353D	A	-	2	0	PXDNL	52528823	1.000000	0.71417	0.065000	0.19835	0.256000	0.26092	2.899000	0.48679	1.850000	0.53721	0.591000	0.81541	GCC	PXDNL	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000147485		0.507	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	HGNC	protein_coding	OTTHUMT00000377905.1	-	0.00	46	0	G	NM_144651		52366270	-1	tier1	-	no_errors	ENST00000356297	ensembl	human	known	74_37	missense	30.00	42	18	SNP	1.000	T
PXN	5829	genome.wustl.edu	37	12	120648834	120648834	+	3'UTR	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:120648834G>T	ENST00000228307.7	-	0	3200				PXN-AS1_ENST00000535200.1_RNA|PXN-AS1_ENST00000542265.1_RNA|PXN-AS1_ENST00000542314.1_RNA|PXN-AS1_ENST00000538804.1_RNA|PXN_ENST00000424649.2_3'UTR|PXN_ENST00000267257.7_3'UTR|PXN_ENST00000458477.2_3'UTR|PXN_ENST00000538144.1_5'Flank|PXN_ENST00000397506.3_3'UTR|PXN_ENST00000536957.1_3'UTR|PXN-AS1_ENST00000539446.1_RNA	NM_001080855.2	NP_001074324.1	P49023	PAXI_HUMAN	paxillin						activation of MAPK activity (GO:0000187)|branching morphogenesis of an epithelial tube (GO:0048754)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|growth hormone receptor signaling pathway (GO:0060396)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|muscle contraction (GO:0006936)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of cell shape (GO:0008360)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	beta-catenin binding (GO:0008013)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCAGAGTCCTGATGGCCAAAA	0.557																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U14588	CCDS44996.1, CCDS44997.1, CCDS44998.1, CCDS58281.1	12q24	2006-01-23			ENSG00000089159	ENSG00000089159			9718	protein-coding gene	gene with protein product		602505				7534286	Standard	NM_001080855		Approved		uc001txv.3	P49023	OTTHUMG00000169169	ENST00000228307.7:c.*1283C>A	12.37:g.120648834G>T			B2RAI3|B7ZMB4|O14970|O14971|O60360|Q5HYA4	RNA	SNP	-	NULL	ENST00000228307.7	37	NULL	CCDS44997.1	12																																																																																			PXN-AS1	-	-	ENSG00000255857		0.557	PXN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PXN-AS1	HGNC	protein_coding	OTTHUMT00000402679.4	-	0.00	23	0	G	NM_002859		120648834	+1	tier1	-	no_errors	ENST00000535200	ensembl	human	known	74_37	rna	72.73	9	24	SNP	0.000	T
PYDC1	260434	genome.wustl.edu	37	16	31228224	31228224	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:31228224G>A	ENST00000302964.3	-	1	456	c.126C>T	c.(124-126)ggC>ggT	p.G42G	TRIM72_ENST00000322122.3_Intron|PYDC1_ENST00000568383.1_5'Flank	NM_152901.2	NP_690865.1	Q8WXC3	PYDC1_HUMAN	PYD (pyrin domain) containing 1	42	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of interleukin-1 beta secretion (GO:0050718)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5						GCCCGAGCGCGCCCCGCGGGA	0.642																																																	0													63.0	58.0	59.0					16																	31228224		2197	4299	6496	SO:0001819	synonymous_variant	0				CCDS10710.1	16p11.2	2008-02-05	2005-12-02		ENSG00000169900	ENSG00000169900			30261	protein-coding gene	gene with protein product		615700	"""pyrin domain containing 1"""			11786556, 16905547	Standard	NM_152901		Approved	ASC2, POP1	uc002ebo.3	Q8WXC3	OTTHUMG00000132407	ENST00000302964.3:c.126C>T	16.37:g.31228224G>A			B2R8L4|Q8NFP8	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN	p.G42	ENST00000302964.3	37	c.126	CCDS10710.1	16																																																																																			PYDC1	-	pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN	ENSG00000169900		0.642	PYDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYDC1	HGNC	protein_coding	OTTHUMT00000255543.2	-	0.00	56	0	G	NM_152901		31228224	-1	tier1	-	no_errors	ENST00000302964	ensembl	human	known	74_37	silent	35.71	18	10	SNP	0.000	A
RBM24	221662	genome.wustl.edu	37	6	17291124	17291124	+	Intron	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:17291124G>T	ENST00000379052.5	+	4	583				RBM24_ENST00000318204.5_Intron|RBM24_ENST00000508508.1_3'UTR|RBM24_ENST00000425446.2_Intron	NM_001143942.1	NP_001137414.1	Q9BX46	RBM24_HUMAN	RNA binding motif protein 24						cell differentiation (GO:0030154)|regulation of mRNA stability (GO:0043488)|regulation of myotube differentiation (GO:0010830)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	13	Breast(50;0.0615)|Ovarian(93;0.0733)	all_hematologic(90;0.062)	all cancers(50;0.131)|Epithelial(50;0.15)			TAGTCAAACAGGTTTGGTTGA	0.438																																																	0																																										SO:0001627	intron_variant	0			BC040928	CCDS4538.1, CCDS47378.1, CCDS47379.1	6p22.3	2013-02-12	2004-04-23	2004-04-23	ENSG00000112183	ENSG00000112183		"""RNA binding motif (RRM) containing"""	21539	protein-coding gene	gene with protein product			"""RNA-binding region (RNP1, RRM) containing 6"""	RNPC6			Standard	NM_153020		Approved	FLJ30829, dJ259A10.1	uc003nbz.4	Q9BX46	OTTHUMG00000014306	ENST00000379052.5:c.348-863G>T	6.37:g.17291124G>T			E9PAY4|Q6QDA4|Q8N9D3|Q96NI3	RNA	SNP	-	NULL	ENST00000379052.5	37	NULL	CCDS47378.1	6																																																																																			RBM24	-	-	ENSG00000112183		0.438	RBM24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM24	HGNC	protein_coding	OTTHUMT00000039946.2	-	0.00	22	0	G	NM_153020		17291124	+1	tier1	-	no_errors	ENST00000508508	ensembl	human	known	74_37	rna	42.86	20	15	SNP	1.000	T
RBM25	58517	genome.wustl.edu	37	14	73576165	73576165	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr14:73576165G>T	ENST00000261973.7	+	14	1942	c.1657G>T	c.(1657-1659)Gaa>Taa	p.E553*	RBM25_ENST00000527432.1_Nonsense_Mutation_p.E553*|RBM25_ENST00000532483.1_3'UTR	NM_021239.2	NP_067062.1	P49756	RBM25_HUMAN	RNA binding motif protein 25	553	Glu-rich.|Necessary for nuclear speckle localization.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of apoptotic process (GO:0042981)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(6)|ovary(2)|pancreas(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		CCTTCTGGCAGAAGGGCATCC	0.532																																																	0													88.0	87.0	88.0					14																	73576165		2203	4300	6503	SO:0001587	stop_gained	0			BX647116	CCDS32113.1	14q24.3	2013-02-12	2004-04-23	2004-04-29	ENSG00000119707	ENSG00000119707		"""RNA binding motif (RRM) containing"""	23244	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 94"""	612427	"""RNA-binding region (RNP1, RRM) containing 7"""	RNPC7		9847074, 7596406	Standard	NM_021239		Approved	S164, fSAP94, NET52, Snu71	uc001xno.3	P49756	OTTHUMG00000167540	ENST00000261973.7:c.1657G>T	14.37:g.73576165G>T	ENSP00000261973:p.Glu553*		A0PJL9|B2RNA8|B3KT03|Q2TA72|Q5XJ17|Q6P665|Q9H6A1|Q9UEQ5|Q9UIE9	Nonsense_Mutation	SNP	pfam_PWI_dom,pfam_RRM_dom,superfamily_PWI_dom,smart_RRM_dom,smart_PWI_dom,pfscan_RRM_dom	p.E553*	ENST00000261973.7	37	c.1657	CCDS32113.1	14	.	.	.	.	.	.	.	.	.	.	G	42	9.310948	0.99133	.	.	ENSG00000119707	ENST00000261973;ENST00000527432	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	20.4387	0.99107	0.0:0.0:1.0:0.0	.	.	.	.	X	553	.	ENSP00000261973:E553X	E	+	1	0	RBM25	72645918	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.658000	0.98594	2.836000	0.97738	0.655000	0.94253	GAA	RBM25	-	NULL	ENSG00000119707		0.532	RBM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM25	HGNC	protein_coding	OTTHUMT00000394966.1	-	0.00	41	0	G	XM_027330		73576165	+1	tier1	-	no_errors	ENST00000261973	ensembl	human	known	74_37	nonsense	8.16	45	4	SNP	1.000	T
RELN	5649	genome.wustl.edu	37	7	103175830	103175830	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:103175830G>A	ENST00000428762.1	-	46	7441	c.7282C>T	c.(7282-7284)Cgg>Tgg	p.R2428W	RELN_ENST00000343529.5_Missense_Mutation_p.R2428W|RELN_ENST00000424685.2_Missense_Mutation_p.R2428W	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2428					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.R2428W(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACCAGGATCCGTTGCAGATGA	0.458																																					NSCLC(146;835 1944 15585 22231 52158)												1	Substitution - Missense(1)	kidney(1)											175.0	134.0	147.0					7																	103175830		2203	4300	6503	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.7282C>T	7.37:g.103175830G>A	ENSP00000392423:p.Arg2428Trp		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.R2428W	ENST00000428762.1	37	c.7282	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	G	19.41	3.821598	0.71028	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.22539	1.95;1.95;1.95	5.57	2.32	0.28847	Neuraminidase (1);	0.000000	0.85682	D	0.000000	T	0.39937	0.1097	L	0.54323	1.7	0.49915	D	0.99983	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.951	T	0.33163	-0.9879	10	0.87932	D	0	.	14.2227	0.65839	0.0:0.0:0.3047:0.6953	.	2428;2428	P78509-2;P78509	.;RELN_HUMAN	W	2428	ENSP00000392423:R2428W;ENSP00000345694:R2428W;ENSP00000388446:R2428W	ENSP00000345694:R2428W	R	-	1	2	RELN	102963066	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.032000	0.41127	0.662000	0.31006	0.655000	0.94253	CGG	RELN	-	superfamily_Sialidases	ENSG00000189056		0.458	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1		0.00	39	0	G	NM_005045		103175830	-1			no_errors	ENST00000424685	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
RGS22	26166	genome.wustl.edu	37	8	101074951	101074951	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr8:101074951A>G	ENST00000360863.6	-	9	1576	c.1382T>C	c.(1381-1383)cTa>cCa	p.L461P	RGS22_ENST00000523287.1_Missense_Mutation_p.L280P|RGS22_ENST00000523437.1_Missense_Mutation_p.L449P	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	461					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			ATTGCTCACTAGATAGCATTT	0.313																																																	0													77.0	72.0	73.0					8																	101074951		1820	4071	5891	SO:0001583	missense	0			AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.1382T>C	8.37:g.101074951A>G	ENSP00000354109:p.Leu461Pro		A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam	p.L461P	ENST00000360863.6	37	c.1382	CCDS43758.1	8	.	.	.	.	.	.	.	.	.	.	A	19.47	3.833135	0.71258	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000523437	T;T;T	0.72167	-0.63;-0.63;-0.63	4.99	4.99	0.66335	Regulator of G protein signalling superfamily (1);	0.117668	0.34200	N	0.004179	D	0.82907	0.5139	M	0.72894	2.215	0.54753	D	0.999985	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.996	D	0.85303	0.1074	10	0.87932	D	0	.	14.9912	0.71390	1.0:0.0:0.0:0.0	.	449;461;280	A8K944;Q8NE09;G3V112	.;RGS22_HUMAN;.	P	461;449;280;449	ENSP00000354109:L461P;ENSP00000429382:L280P;ENSP00000428212:L449P	ENSP00000354109:L461P	L	-	2	0	RGS22	101144127	0.999000	0.42202	1.000000	0.80357	0.975000	0.68041	6.572000	0.74005	1.987000	0.57996	0.528000	0.53228	CTA	RGS22	-	superfamily_Regulat_G_prot_signal_superfam	ENSG00000132554		0.313	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS22	HGNC	protein_coding	OTTHUMT00000380365.1	-	0.00	11	0	A	NM_015668		101074951	-1	tier1	-	no_errors	ENST00000360863	ensembl	human	known	74_37	missense	14.29	42	7	SNP	1.000	G
RHOA	387	genome.wustl.edu	37	3	49412922	49412922	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:49412922T>C	ENST00000418115.1	-	2	485	c.101A>G	c.(100-102)tAt>tGt	p.Y34C	RHOA_ENST00000454011.2_Missense_Mutation_p.Y34C|RHOA_ENST00000422781.1_Missense_Mutation_p.Y34C	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A	34					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)			cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TGTGGGCACATACACCTCTGG	0.463																																																	0													156.0	144.0	148.0					3																	49412922		2203	4300	6503	SO:0001583	missense	0			BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838	ENST00000418115.1:c.101A>G	3.37:g.49412922T>C	ENSP00000400175:p.Tyr34Cys		P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.Y34C	ENST00000418115.1	37	c.101	CCDS2795.1	3	.	.	.	.	.	.	.	.	.	.	T	24.6	4.549860	0.86127	.	.	ENSG00000067560	ENST00000418115;ENST00000454011;ENST00000422781;ENST00000445425;ENST00000431929	T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71	5.89	5.89	0.94794	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85969	0.5821	M	0.92880	3.355	0.80722	D	1	P	0.40834	0.73	P	0.54706	0.759	D	0.88567	0.3127	10	0.87932	D	0	.	15.1943	0.73075	0.0:0.0:0.0:1.0	.	34	P61586	RHOA_HUMAN	C	34	ENSP00000400175:Y34C;ENSP00000394483:Y34C;ENSP00000413587:Y34C;ENSP00000408402:Y34C;ENSP00000400747:Y34C	ENSP00000400175:Y34C	Y	-	2	0	RHOA	49387926	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.905000	0.87416	2.266000	0.75297	0.456000	0.33151	TAT	RHOA	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000067560		0.463	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOA	HGNC	protein_coding	OTTHUMT00000346157.3	-	0.00	49	0	T	NM_001664		49412922	-1	tier1	-	no_errors	ENST00000418115	ensembl	human	known	74_37	missense	20.97	49	13	SNP	1.000	C
RHO	6010	genome.wustl.edu	37	3	129251606	129251606	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:129251606G>A	ENST00000296271.3	+	4	1021	c.927G>A	c.(925-927)atG>atA	p.M309I		NM_000539.3	NP_000530.1	P08100	OPSD_HUMAN	rhodopsin	309					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction, visible light (GO:0007603)|protein phosphorylation (GO:0006468)|protein-chromophore linkage (GO:0018298)|red, far-red light phototransduction (GO:0009585)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|retinoid metabolic process (GO:0001523)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cell-cell junction (GO:0005911)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor inner segment membrane (GO:0060342)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|rough endoplasmic reticulum membrane (GO:0030867)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)|photoreceptor activity (GO:0009881)|retinal binding (GO:0016918)			breast(1)|endometrium(1)|large_intestine(10)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	22		all_neural(597;0.0227)|Myeloproliferative disorder(1037;0.0255)|Prostate(884;0.183)		GBM - Glioblastoma multiforme(114;2.58e-05)|Lung(219;0.0234)	Halothane(DB01159)	ATATCATGATGAACAAGCAGG	0.612																																					Esophageal Squamous(118;214 1623 30842 43234 46940)												0													82.0	81.0	81.0					3																	129251606		2203	4300	6503	SO:0001583	missense	0			AB065668	CCDS3063.1	3q21-q24	2014-01-28	2008-04-16		ENSG00000163914	ENSG00000163914		"""GPCR / Class A : Opsin receptors"""	10012	protein-coding gene	gene with protein product	"""opsin 2, rod pigment"""	180380	"""retinitis pigmentosa 4, autosomal dominant"""	RP4		2016091	Standard	NM_000539		Approved	OPN2, CSNBAD1	uc003emt.3	P08100	OTTHUMG00000159542	ENST00000296271.3:c.927G>A	3.37:g.129251606G>A	ENSP00000296271:p.Met309Ile		Q16414|Q2M249	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_Rhodopsin_N,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Rhodopsin,prints_GPCR_Rhodpsn,prints_Opsin	p.M309I	ENST00000296271.3	37	c.927	CCDS3063.1	3	.	.	.	.	.	.	.	.	.	.	G	16.60	3.168428	0.57584	.	.	ENSG00000163914	ENST00000296271	T	0.37752	1.18	5.67	5.67	0.87782	.	0.121462	0.85682	D	0.000000	T	0.49064	0.1535	M	0.85710	2.77	0.53688	D	0.999974	B	0.09022	0.002	B	0.06405	0.002	T	0.51568	-0.8689	10	0.87932	D	0	.	19.7824	0.96422	0.0:0.0:1.0:0.0	.	309	P08100	OPSD_HUMAN	I	309	ENSP00000296271:M309I	ENSP00000296271:M309I	M	+	3	0	RHO	130734296	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.709000	0.54853	2.677000	0.91161	0.561000	0.74099	ATG	RHO	-	pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_GPCR_Rhodpsn	ENSG00000163914		0.612	RHO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHO	HGNC	protein_coding	OTTHUMT00000356101.1	-	0.00	50	0	G	NM_000539		129251606	+1	tier1	-	no_errors	ENST00000296271	ensembl	human	known	74_37	missense	46.15	14	12	SNP	1.000	A
RNPEPL1	57140	genome.wustl.edu	37	2	241513671	241513671	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:241513671C>T	ENST00000270357.4	+	5	980	c.387C>T	c.(385-387)ttC>ttT	p.F129F		NM_018226.4	NP_060696.4	Q9HAU8	RNPL1_HUMAN	arginyl aminopeptidase (aminopeptidase B)-like 1	129					leukotriene biosynthetic process (GO:0019370)		aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	13		all_epithelial(40;1.13e-11)|Breast(86;0.000169)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.204)|Melanoma(123;0.238)		Epithelial(32;3.05e-31)|all cancers(36;8.2e-29)|OV - Ovarian serous cystadenocarcinoma(60;8.55e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.12e-06)|Lung(119;0.00168)|Colorectal(34;0.005)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.0322)		ACAGTTGGTTCGGCAACGCTG	0.612																																																	0													115.0	94.0	101.0					2																	241513671		2203	4300	6503	SO:0001819	synonymous_variant	0					2q37.3	2012-03-06			ENSG00000142327	ENSG00000142327			10079	protein-coding gene	gene with protein product		605287				19508204	Standard	NM_018226		Approved		uc002vzi.4	Q9HAU8	OTTHUMG00000133357	ENST00000270357.4:c.387C>T	2.37:g.241513671C>T			Q5XKC3|Q6NX56|Q96AC9|Q9H033|Q9NVD0	Silent	SNP	pfam_Peptidase_M1_C,pfam_Peptidase_M1_N,superfamily_ARM-type_fold,prints_Peptidase_M1_N	p.F129	ENST00000270357.4	37	c.387		2																																																																																			RNPEPL1	-	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	ENSG00000142327		0.612	RNPEPL1-001	KNOWN	basic|appris_principal	protein_coding	RNPEPL1	HGNC	protein_coding	OTTHUMT00000257190.4	-	0.00	55	0	C	NM_018226		241513671	+1	tier1	-	no_errors	ENST00000270357	ensembl	human	known	74_37	silent	40.00	18	12	SNP	0.780	T
RPAP1	26015	genome.wustl.edu	37	15	41813145	41813145	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:41813145T>C	ENST00000304330.4	-	22	3355	c.3239A>G	c.(3238-3240)gAg>gGg	p.E1080G	RPAP1_ENST00000561603.1_Intron	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	1080	Leu-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		TCGCTGTAGCTCCCCTCGGTG	0.667																																																	0													63.0	54.0	57.0					15																	41813145		2203	4300	6503	SO:0001583	missense	0			BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.3239A>G	15.37:g.41813145T>C	ENSP00000306123:p.Glu1080Gly		Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	pfam_RNA_pol_II_AP1_C,pfam_RNA_pol_II_AP1_N,superfamily_ARM-type_fold	p.E1080G	ENST00000304330.4	37	c.3239	CCDS10079.1	15	.	.	.	.	.	.	.	.	.	.	T	12.89	2.072032	0.36566	.	.	ENSG00000103932	ENST00000304330	T	0.74947	-0.89	4.95	3.81	0.43845	.	0.358767	0.30076	N	0.010474	T	0.62708	0.2450	L	0.51422	1.61	0.29196	N	0.875554	B	0.28128	0.201	B	0.19666	0.026	T	0.61744	-0.7000	10	0.87932	D	0	-9.8162	4.0799	0.09921	0.1593:0.154:0.0:0.6868	.	1080	Q9BWH6	RPAP1_HUMAN	G	1080	ENSP00000306123:E1080G	ENSP00000306123:E1080G	E	-	2	0	RPAP1	39600437	0.067000	0.21026	0.970000	0.41538	0.840000	0.47671	0.329000	0.19698	0.881000	0.35993	0.460000	0.39030	GAG	RPAP1	-	NULL	ENSG00000103932		0.667	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAP1	HGNC	protein_coding	OTTHUMT00000252694.2		0.00	162	0	T	NM_015540		41813145	-1			no_errors	ENST00000304330	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.930	C
RRP9	9136	genome.wustl.edu	37	3	51968680	51968680	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:51968680C>T	ENST00000232888.6	-	12	1220	c.1147G>A	c.(1147-1149)Gca>Aca	p.A383T		NM_004704.3	NP_004695.1	O43818	U3IP2_HUMAN	ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast)	383					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)	p.A383T(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|skin(1)	21				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		AGGAGGGCTGCCACCGACGAT	0.667																																																	1	Substitution - Missense(1)	large_intestine(1)											52.0	54.0	53.0					3																	51968680		2203	4300	6503	SO:0001583	missense	0			AJ001340	CCDS2837.1	3p21.31	2013-01-10	2008-02-26	2006-10-24	ENSG00000114767	ENSG00000114767		"""WD repeat domain containing"""	16829	protein-coding gene	gene with protein product			"""RNA, U3 small nucleolar interacting protein 2"""	RNU3IP2		9418896, 12032086	Standard	NM_004704		Approved	U3-55K	uc003dbw.2	O43818	OTTHUMG00000156930	ENST00000232888.6:c.1147G>A	3.37:g.51968680C>T	ENSP00000232888:p.Ala383Thr		B2R996|Q8IZ30	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.A383T	ENST00000232888.6	37	c.1147	CCDS2837.1	3	.	.	.	.	.	.	.	.	.	.	C	17.93	3.508780	0.64410	.	.	ENSG00000114767	ENST00000232888	D	0.82803	-1.65	5.17	3.01	0.34805	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.054851	0.64402	D	0.000001	T	0.80884	0.4709	M	0.72576	2.205	0.80722	D	1	P	0.39748	0.686	B	0.38156	0.266	T	0.81773	-0.0779	10	0.52906	T	0.07	-6.9636	12.218	0.54416	0.0:0.8314:0.0:0.1686	.	383	O43818	U3IP2_HUMAN	T	383	ENSP00000232888:A383T	ENSP00000232888:A383T	A	-	1	0	RRP9	51943720	1.000000	0.71417	0.756000	0.31282	0.930000	0.56654	5.893000	0.69798	1.186000	0.42985	0.462000	0.41574	GCA	RRP9	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000114767		0.667	RRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP9	HGNC	protein_coding	OTTHUMT00000346637.1		0.00	41	0	C	NM_004704		51968680	-1			no_errors	ENST00000232888	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.997	T
S1PR4	8698	genome.wustl.edu	37	19	3179168	3179168	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:3179168C>T	ENST00000246115.3	+	1	433	c.378C>T	c.(376-378)ttC>ttT	p.F126F	S1PR4_ENST00000591346.1_Intron	NM_003775.3	NP_003766.1	O95977	S1PR4_HUMAN	sphingosine-1-phosphate receptor 4	126					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			breast(1)|kidney(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13						GCCTGCTCTTCACCGCCCTGG	0.711																																					GBM(82;318 1638 33279 49708)												0													32.0	34.0	33.0					19																	3179168		2180	4258	6438	SO:0001819	synonymous_variant	0			AJ000479	CCDS12105.1	19p13.3	2012-08-08	2008-04-30	2008-04-30		ENSG00000125910		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3170	protein-coding gene	gene with protein product		603751	"""endothelial differentiation, G-protein-coupled receptor 6"", ""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 6"""	EDG6		9790765	Standard	NM_003775		Approved		uc002lxg.3	O95977		ENST00000246115.3:c.378C>T	19.37:g.3179168C>T			D6W612	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_EDG6_rcpt,prints_S1P_rcpt,prints_GPCR_Rhodpsn	p.F126	ENST00000246115.3	37	c.378	CCDS12105.1	19																																																																																			S1PR4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_S1P_rcpt,prints_GPCR_Rhodpsn	ENSG00000125910		0.711	S1PR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S1PR4	HGNC	protein_coding	OTTHUMT00000452517.1	-	0.00	26	0	C	NM_003775		3179168	+1	tier1	-	no_errors	ENST00000246115	ensembl	human	known	74_37	silent	63.64	4	7	SNP	1.000	T
SCAP	22937	genome.wustl.edu	37	3	47467001	47467001	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:47467001G>A	ENST00000265565.5	-	8	1423	c.1011C>T	c.(1009-1011)ttC>ttT	p.F337F	SCAP_ENST00000441517.2_Silent_p.F82F|SCAP_ENST00000545718.1_Intron	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	337	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		GCGTCAGGCCGAAGAGTGTGC	0.632																																					Pancreas(149;978 1908 29304 37806 46700)												0													71.0	68.0	69.0					3																	47467001		2203	4300	6503	SO:0001819	synonymous_variant	0			BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.1011C>T	3.37:g.47467001G>A			Q8N2E0|Q8WUA1	Silent	SNP	pfam_Patched,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_SSD,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.F337	ENST00000265565.5	37	c.1011	CCDS2755.2	3																																																																																			SCAP	-	pfam_Patched,pfscan_SSD	ENSG00000114650		0.632	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAP	HGNC	protein_coding	OTTHUMT00000246872.2		0.00	55	0	G	NM_012235		47467001	-1			no_errors	ENST00000265565	ensembl	human	known	74_37	silent	5.56	34	2	SNP	1.000	A
SEC14L2	23541	genome.wustl.edu	37	22	30812323	30812323	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr22:30812323C>T	ENST00000312932.9	+	11	1272	c.1012C>T	c.(1012-1014)Ccc>Tcc	p.P338S	RP4-539M6.19_ENST00000439838.1_Missense_Mutation_p.P172S|SEC14L2_ENST00000403484.1_Missense_Mutation_p.P264S|SEC14L2_ENST00000402592.3_Missense_Mutation_p.P255S|SEC14L2_ENST00000405717.3_Missense_Mutation_p.P338S	NM_012429.3	NP_036561.1	O76054	S14L2_HUMAN	SEC14-like 2 (S. cerevisiae)	338	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cholesterol biosynthetic process (GO:0045540)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(1)	10					Vitamin E(DB00163)	AGAGGTGCTGCCCAACCAGAG	0.542																																																	0													99.0	101.0	100.0					22																	30812323		2203	4300	6503	SO:0001583	missense	0			AL096881	CCDS13876.1, CCDS46685.1, CCDS56228.1	22q12.2	2010-08-19	2001-11-28		ENSG00000100003	ENSG00000100003			10699	protein-coding gene	gene with protein product	"""supernatant protein factor"""	607558	"""SEC14 (S. cerevisiae)-like 2"""	C22orf6		10591208	Standard	NM_033382		Approved	TAP, SPF, KIAA1186, KIAA1658	uc003ahr.3	O76054	OTTHUMG00000151024	ENST00000312932.9:c.1012C>T	22.37:g.30812323C>T	ENSP00000316203:p.Pro338Ser		B7Z8Q1|F5H3U4|Q53EQ2|Q6PD61|Q9ULN4	Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_GOLD,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,prints_CRAL-bd_toc_tran	p.P338S	ENST00000312932.9	37	c.1012	CCDS13876.1	22	.	.	.	.	.	.	.	.	.	.	C	14.45	2.537915	0.45176	.	.	ENSG00000100003;ENSG00000100003;ENSG00000100003;ENSG00000100003;ENSG00000249590	ENST00000312932;ENST00000403484;ENST00000405717;ENST00000402592;ENST00000439838	T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62	5.42	-10.2	0.00374	GOLD (2);	0.350521	0.33753	N	0.004592	T	0.41834	0.1176	M	0.73430	2.235	0.37681	D	0.923501	B;B;B;B;B;B	0.26081	0.141;0.001;0.003;0.006;0.002;0.104	B;B;B;B;B;B	0.28139	0.039;0.002;0.004;0.014;0.008;0.086	T	0.33979	-0.9847	10	0.52906	T	0.07	-18.7793	15.9935	0.80223	0.0:0.1573:0.6656:0.177	.	255;255;284;264;338;338	F5H3U4;B7Z8Q1;B7Z3Z8;B3KRD8;O76054;O76054-4	.;.;.;.;S14L2_HUMAN;.	S	338;264;338;255;172	ENSP00000316203:P338S;ENSP00000383993:P264S;ENSP00000385186:P338S;ENSP00000383882:P255S;ENSP00000415178:P172S	ENSP00000415178:P172S	P	+	1	0	RP4-539M6.19;SEC14L2	29142323	0.004000	0.15560	0.065000	0.19835	0.999000	0.98932	0.097000	0.15168	-1.807000	0.01236	0.650000	0.86243	CCC	SEC14L2	-	superfamily_GOLD,pfscan_GOLD	ENSG00000100003		0.542	SEC14L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L2	HGNC	protein_coding	OTTHUMT00000321018.4		0.00	52	0	C	NM_012429		30812323	+1			no_errors	ENST00000312932	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.021	T
SEMA3A	10371	genome.wustl.edu	37	7	83591086	83591086	+	Silent	SNP	T	T	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:83591086T>C	ENST00000265362.4	-	17	2231	c.1917A>G	c.(1915-1917)ctA>ctG	p.L639L	SEMA3A_ENST00000436949.1_Silent_p.L639L	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	639	Ig-like C2-type.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						CCTTCTGTTGTAGACTACGTA	0.403																																																	0													78.0	69.0	72.0					7																	83591086		2203	4299	6502	SO:0001819	synonymous_variant	0			L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1917A>G	7.37:g.83591086T>C				Silent	SNP	pfam_Semap_dom,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,pfscan_Semap_dom,pfscan_Ig-like_dom	p.L639	ENST00000265362.4	37	c.1917	CCDS5599.1	7																																																																																			SEMA3A	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000075213		0.403	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3A	HGNC	protein_coding	OTTHUMT00000253355.2	-	0.00	35	0	T	NM_006080		83591086	-1	tier1	-	no_errors	ENST00000265362	ensembl	human	known	74_37	silent	38.78	30	19	SNP	0.001	C
SENP8	123228	genome.wustl.edu	37	15	72432600	72432600	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:72432600G>T	ENST00000542035.2	+	2	969	c.636G>T	c.(634-636)aaG>aaT	p.K212N	SENP8_ENST00000340912.4_Missense_Mutation_p.K212N|SENP8_ENST00000544171.1_Missense_Mutation_p.K212N|SENP8_ENST00000544411.1_Missense_Mutation_p.K212N|RP11-2I17.4_ENST00000568984.1_RNA	NM_001166340.1	NP_001159812.1	Q96LD8	SENP8_HUMAN	SUMO/sentrin specific peptidase family member 8	212							cysteine-type peptidase activity (GO:0008234)			breast(1)|kidney(2)|lung(1)|ovary(1)|skin(1)	6						TTGCTAAAAAGTAGCTATTGA	0.458																																																	0													47.0	42.0	44.0					15																	72432600		2199	4297	6496	SO:0001583	missense	0			BC031411	CCDS10240.1	15q22.33	2005-08-17	2005-08-17	2004-01-30	ENSG00000166192	ENSG00000166192			22992	protein-coding gene	gene with protein product	"""NEDD8-specific protease 1"", ""sentrin/SUMO-specific protease SENP8"", ""deneddylase 1"""	608659	"""protease, cysteine, 2 (NEDD8 specific)"", ""SUMO/sentrin specific protease family member 8"""	PRSC2		12730221, 12759362	Standard	NM_145204		Approved	NEDP1, DEN1, HsT17512	uc021spt.1	Q96LD8	OTTHUMG00000133441	ENST00000542035.2:c.636G>T	15.37:g.72432600G>T	ENSP00000446057:p.Lys212Asn		Q96QA4	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.K212N	ENST00000542035.2	37	c.636	CCDS10240.1	15	.	.	.	.	.	.	.	.	.	.	G	11.44	1.640811	0.29157	.	.	ENSG00000166192	ENST00000542035;ENST00000544411;ENST00000340912;ENST00000544171	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.76	-3.08	0.05347	.	0.444472	0.24628	N	0.036903	T	0.32466	0.0830	L	0.54323	1.7	0.38162	D	0.939062	B	0.02656	0.0	B	0.01281	0.0	T	0.10154	-1.0642	10	0.72032	D	0.01	0.7309	2.4439	0.04501	0.1577:0.1503:0.4267:0.2653	.	212	Q96LD8	SENP8_HUMAN	N	212	ENSP00000446057:K212N;ENSP00000441753:K212N;ENSP00000340505:K212N;ENSP00000439415:K212N	ENSP00000340505:K212N	K	+	3	2	SENP8	70219654	0.322000	0.24634	0.767000	0.31495	0.036000	0.12997	0.395000	0.20850	-0.103000	0.12175	-0.282000	0.10007	AAG	SENP8	-	NULL	ENSG00000166192		0.458	SENP8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SENP8	HGNC	protein_coding	OTTHUMT00000420036.1	-	0.00	8	0	G	NM_145204		72432600	+1	tier1	-	no_errors	ENST00000340912	ensembl	human	known	74_37	missense	29.63	19	8	SNP	0.699	T
SERPINA9	327657	genome.wustl.edu	37	14	94935585	94935585	+	Missense_Mutation	SNP	G	G	A	rs575429531		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr14:94935585G>A	ENST00000380365.3	-	2	671	c.593C>T	c.(592-594)aCg>aTg	p.T198M	SERPINA9_ENST00000424550.2_Missense_Mutation_p.T67M|SERPINA9_ENST00000546329.1_Missense_Mutation_p.T180M|SERPINA9_ENST00000298845.7_Missense_Mutation_p.T116M|SERPINA9_ENST00000539349.1_5'Flank|SERPINA9_ENST00000337425.5_Missense_Mutation_p.T216M|SERPINA9_ENST00000448305.2_Missense_Mutation_p.T118M			Q86WD7	SPA9_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9	198					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(17)	21		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		AACCATGGCCGTCAGAAGGTC	0.403													G|||	1	0.000199681	0.0	0.0	5008	,	,		20482	0.0		0.0	False		,,,				2504	0.001																0													123.0	118.0	119.0					14																	94935585		1870	4114	5984	SO:0001583	missense	0			AY185497	CCDS41982.1, CCDS41983.1, CCDS61542.1	14q32.1	2014-02-18	2005-08-18		ENSG00000170054	ENSG00000170054		"""Serine (or cysteine) peptidase inhibitors"""	15995	protein-coding gene	gene with protein product		615677	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9"""			24172014	Standard	NM_175739		Approved	CENTERIN, SERPINA11b, GCET1	uc001ydf.3	Q86WD7	OTTHUMG00000167710	ENST00000380365.3:c.593C>T	14.37:g.94935585G>A	ENSP00000369723:p.Thr198Met		B4DVH4|B9ZVX3|Q2T9J2|Q6UWP9|Q86WD4|Q86WD5|Q86WD6|Q86YP6|Q86YP7	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.T216M	ENST00000380365.3	37	c.647		14	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954556	0.53293	.	.	ENSG00000170054	ENST00000448305;ENST00000298845;ENST00000424550;ENST00000337425;ENST00000380365;ENST00000546329	D;D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-2.32;-2.32	3.67	3.67	0.42095	Serpin domain (3);	0.187474	0.36303	N	0.002678	D	0.93171	0.7825	M	0.80422	2.495	0.20074	N	0.999936	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.982;0.998;0.994;0.998;0.974	D	0.87133	0.2198	10	0.62326	D	0.03	.	15.7603	0.78073	0.0:0.0:1.0:0.0	.	180;198;118;216;116	Q86WD7-4;Q86WD7;Q86WD7-6;Q86WD7-7;Q86WD7-2	.;SPA9_HUMAN;.;.;.	M	118;116;67;216;198;180	ENSP00000414092:T118M;ENSP00000298845:T116M;ENSP00000409012:T67M;ENSP00000337133:T216M;ENSP00000369723:T198M;ENSP00000445476:T180M	ENSP00000298845:T116M	T	-	2	0	SERPINA9	94005338	0.998000	0.40836	0.995000	0.50966	0.858000	0.48976	3.301000	0.51842	1.788000	0.52465	0.462000	0.41574	ACG	SERPINA9	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000170054		0.403	SERPINA9-008	KNOWN	basic|appris_principal	protein_coding	SERPINA9	HGNC	protein_coding	OTTHUMT00000395803.2	-	0.00	56	0	G	NM_175739		94935585	-1	tier1	-	no_errors	ENST00000337425	ensembl	human	known	74_37	missense	52.94	16	18	SNP	0.250	A
SHISA6	388336	genome.wustl.edu	37	17	11459150	11459150	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:11459150C>A	ENST00000409168.3	+	3	893	c.893C>A	c.(892-894)cCa>cAa	p.P298Q	SHISA6_ENST00000432116.3_Missense_Mutation_p.P330Q|SHISA6_ENST00000441885.3_Missense_Mutation_p.P349Q	NM_001173461.1	NP_001166932.1	Q6ZSJ9	SHSA6_HUMAN	shisa family member 6	298				PPS -> SPP (in Ref. 3; AAY68487). {ECO:0000305}.		alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)				breast(1)|endometrium(4)	5						CACCTGCCCCCATCCTACGAG	0.542																																																	0													93.0	90.0	91.0					17																	11459150		692	1591	2283	SO:0001583	missense	0			AK127379, AK128003	CCDS45615.1, CCDS54089.1, CCDS54090.1	17p13.1-p12	2013-07-31	2013-07-31		ENSG00000188803	ENSG00000188803		"""Shisa homologs"""	34491	protein-coding gene	gene with protein product			"""shisa homolog 6 (Xenopus laevis)"""				Standard	NM_207386		Approved	FLJ45455	uc002gnc.2	Q6ZSJ9	OTTHUMG00000154121	ENST00000409168.3:c.893C>A	17.37:g.11459150C>A	ENSP00000387157:p.Pro298Gln		B3KXV5|Q4PL63	Missense_Mutation	SNP	NULL	p.P349Q	ENST00000409168.3	37	c.1046	CCDS54090.1	17	.	.	.	.	.	.	.	.	.	.	C	25.6	4.659823	0.88154	.	.	ENSG00000188803	ENST00000441885;ENST00000432116;ENST00000409168;ENST00000343478	.	.	.	4.88	4.88	0.63580	.	0.070231	0.64402	D	0.000018	T	0.76256	0.3962	M	0.62723	1.935	0.58432	D	0.999992	D;D	0.89917	0.999;1.0	D;D	0.85130	0.976;0.997	T	0.75255	-0.3382	9	0.36615	T	0.2	.	16.6054	0.84827	0.0:1.0:0.0:0.0	.	349;298	Q6ZSJ9-3;Q6ZSJ9	.;SHSA6_HUMAN	Q	349;330;298;196	.	ENSP00000340821:P196Q	P	+	2	0	SHISA6	11399875	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.256000	0.74724	0.563000	0.77884	CCA	SHISA6	-	NULL	ENSG00000188803		0.542	SHISA6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHISA6	HGNC	protein_coding	OTTHUMT00000333970.2	-	0.00	56	0	C	NM_207386		11459150	+1	tier1	-	no_errors	ENST00000441885	ensembl	human	known	74_37	missense	35.09	37	20	SNP	1.000	A
SHROOM2	357	genome.wustl.edu	37	X	9905301	9905301	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chrX:9905301C>T	ENST00000380913.3	+	7	3805	c.3715C>T	c.(3715-3717)Ccc>Tcc	p.P1239S	SHROOM2_ENST00000418909.2_Missense_Mutation_p.P74S	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	1239					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				ACCTGCCCTGCCCCACGGGCT	0.637																																																	0													39.0	33.0	35.0					X																	9905301		2199	4297	6496	SO:0001583	missense	0			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.3715C>T	X.37:g.9905301C>T	ENSP00000370299:p.Pro1239Ser		B9EIQ7	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P1239S	ENST00000380913.3	37	c.3715	CCDS14135.1	X	.	.	.	.	.	.	.	.	.	.	C	12.60	1.986048	0.35036	.	.	ENSG00000146950	ENST00000380913;ENST00000418909;ENST00000452575;ENST00000540923	T;T;T	0.49432	2.35;1.39;0.78	4.98	4.98	0.66077	.	0.456026	0.24206	N	0.040577	T	0.62865	0.2463	L	0.46157	1.445	0.49483	D	0.999792	B;D	0.89917	0.298;1.0	B;D	0.83275	0.064;0.996	T	0.60919	-0.7167	10	0.36615	T	0.2	-17.0694	17.5018	0.87734	0.0:1.0:0.0:0.0	.	74;1239	Q68DU3;Q13796	.;SHRM2_HUMAN	S	1239;74;74;74	ENSP00000370299:P1239S;ENSP00000415229:P74S;ENSP00000406724:P74S	ENSP00000370299:P1239S	P	+	1	0	SHROOM2	9865301	1.000000	0.71417	0.991000	0.47740	0.422000	0.31414	3.121000	0.50438	2.059000	0.61396	0.594000	0.82650	CCC	SHROOM2	-	NULL	ENSG00000146950		0.637	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	HGNC	protein_coding	OTTHUMT00000055721.1	-	0.00	62	0	C	NM_001649		9905301	+1	tier1	-	no_errors	ENST00000380913	ensembl	human	known	74_37	missense	63.33	11	19	SNP	1.000	T
SI	6476	genome.wustl.edu	37	3	164735587	164735587	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:164735587C>A	ENST00000264382.3	-	30	3657	c.3595G>T	c.(3595-3597)Ggc>Tgc	p.G1199C		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1199	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	GGAGTTGGGCCCAAAAACATA	0.328										HNSCC(35;0.089)																																							0													58.0	57.0	57.0					3																	164735587		2203	4300	6503	SO:0001583	missense	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3595G>T	3.37:g.164735587C>A	ENSP00000264382:p.Gly1199Cys		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.G1199C	ENST00000264382.3	37	c.3595	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	C	23.0	4.356323	0.82243	.	.	ENSG00000090402	ENST00000264382	D	0.98550	-4.99	4.91	4.91	0.64330	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.85682	D	0.000000	D	0.99441	0.9802	H	0.98276	4.19	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.98126	1.0428	10	0.87932	D	0	.	18.2831	0.90104	0.0:1.0:0.0:0.0	.	1199	P14410	SUIS_HUMAN	C	1199	ENSP00000264382:G1199C	ENSP00000264382:G1199C	G	-	1	0	SI	166218281	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.465000	0.73538	2.540000	0.85666	0.491000	0.48974	GGC	SI	-	pfam_Glyco_hydro_31,superfamily_Gal_mutarotase_SF_dom	ENSG00000090402		0.328	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	-	0.00	45	0	C	NM_001041		164735587	-1	tier1	-	no_errors	ENST00000264382	ensembl	human	known	74_37	missense	37.50	35	21	SNP	1.000	A
SIX6	4990	genome.wustl.edu	37	14	60976162	60976162	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr14:60976162G>T	ENST00000327720.5	+	1	494	c.46G>T	c.(46-48)Ggg>Tgg	p.G16W		NM_007374.2	NP_031400.2	O95475	SIX6_HUMAN	SIX homeobox 6	16					organ morphogenesis (GO:0009887)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.088)		GCAAGTGGCCGGGGTATGTGA	0.682																																																	0													38.0	45.0	43.0					14																	60976162		2203	4298	6501	SO:0001583	missense	0			AF141651	CCDS9747.1	14q23.1	2011-06-20	2007-07-13		ENSG00000184302	ENSG00000184302		"""Homeoboxes / SINE class"""	10892	protein-coding gene	gene with protein product		606326	"""sine oculis homeobox (Drosophila) homolog 6"", ""sine oculis homeobox homolog 6 (Drosophila)"""	OPTX2		10512683	Standard	NM_007374		Approved	Six9	uc001xfa.4	O95475	OTTHUMG00000152339	ENST00000327720.5:c.46G>T	14.37:g.60976162G>T	ENSP00000328596:p.Gly16Trp		Q6NT42|Q9P1X8	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.G16W	ENST00000327720.5	37	c.46	CCDS9747.1	14	.	.	.	.	.	.	.	.	.	.	G	18.44	3.625249	0.66901	.	.	ENSG00000184302	ENST00000327720	D	0.97303	-4.33	5.65	4.76	0.60689	.	0.000000	0.85682	D	0.000000	D	0.95806	0.8635	N	0.22421	0.69	0.80722	D	1	D	0.64830	0.994	P	0.55824	0.785	D	0.96388	0.9287	10	0.72032	D	0.01	.	13.8454	0.63463	0.0724:0.0:0.9276:0.0	.	16	O95475	SIX6_HUMAN	W	16	ENSP00000328596:G16W	ENSP00000328596:G16W	G	+	1	0	SIX6	60045915	1.000000	0.71417	1.000000	0.80357	0.644000	0.38419	3.416000	0.52707	1.632000	0.50472	-0.140000	0.14226	GGG	SIX6	-	NULL	ENSG00000184302		0.682	SIX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX6	HGNC	protein_coding	OTTHUMT00000276952.2	-	0.00	42	0	G			60976162	+1	tier1	-	no_errors	ENST00000327720	ensembl	human	known	74_37	missense	36.36	14	8	SNP	1.000	T
SKIV2L2	23517	genome.wustl.edu	37	5	54718789	54718789	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:54718789C>G	ENST00000230640.5	+	26	3309	c.3055C>G	c.(3055-3057)Ctg>Gtg	p.L1019V	SKIV2L2_ENST00000545714.1_Missense_Mutation_p.L918V	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	1019					maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				AAACACTGAGCTGGAAAATAA	0.413																																					Melanoma(2;92 134 23744 29976 33782)												0													64.0	62.0	63.0					5																	54718789		2203	4300	6503	SO:0001583	missense	0			D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.3055C>G	5.37:g.54718789C>G	ENSP00000230640:p.Leu1019Val		Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	pfam_DSH_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pirsf_RNA_helicase_ATP-dep_SK12/DOB1,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L1019V	ENST00000230640.5	37	c.3055	CCDS3967.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.2|23.2	4.390039|4.390039	0.82902|0.82902	.|.	.|.	ENSG00000039123|ENSG00000039123	ENST00000508716|ENST00000230640;ENST00000545714	.|T;T	.|0.33654	.|1.4;1.4	5.59|5.59	5.59|5.59	0.84812|0.84812	.|DSH, C-terminal (1);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.73110|0.73110	0.3545|0.3545	H|H	0.95437|0.95437	3.67|3.67	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.999;0.998	.|D;D	.|0.76575	.|0.958;0.988	T|T	0.81495|0.81495	-0.0907|-0.0907	5|10	.|0.72032	.|D	.|0.01	-12.696|-12.696	19.5874|19.5874	0.95495|0.95495	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|918;1019	.|F5H7E2;P42285	.|.;SK2L2_HUMAN	G|V	54|1019;918	.|ENSP00000230640:L1019V;ENSP00000442583:L918V	.|ENSP00000230640:L1019V	A|L	+|+	2|1	0|2	SKIV2L2|SKIV2L2	54754546|54754546	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.009000|3.009000	0.49552|0.49552	2.622000|2.622000	0.88805|0.88805	0.655000|0.655000	0.94253|0.94253	GCT|CTG	SKIV2L2	-	pfam_DSH_C,pirsf_RNA_helicase_ATP-dep_SK12/DOB1	ENSG00000039123		0.413	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIV2L2	HGNC	protein_coding	OTTHUMT00000214108.1	-	0.00	24	0	C			54718789	+1	tier1	-	no_errors	ENST00000230640	ensembl	human	known	74_37	missense	28.33	43	17	SNP	1.000	G
SKOR1	390598	genome.wustl.edu	37	15	68119388	68119388	+	Frame_Shift_Del	DEL	A	A	-			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:68119388delA	ENST00000380035.2	+	2	1280	c.1222delA	c.(1222-1224)aaafs	p.K409fs	SKOR1_ENST00000341418.5_Frame_Shift_Del_p.K516fs|SKOR1_ENST00000389002.1_Frame_Shift_Del_p.K365fs|SKOR1_ENST00000554054.1_Frame_Shift_Del_p.K381fs|SKOR1_ENST00000554240.1_Frame_Shift_Del_p.K370fs			P84550	SKOR1_HUMAN	SKI family transcriptional corepressor 1	409					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(7)|urinary_tract(1)	23						CCTATGCCCCAAAAAGGACGA	0.697																																																	0													16.0	21.0	19.0					15																	68119388		2189	4296	6485	SO:0001589	frameshift_variant	0				CCDS58374.1	15q23	2011-08-04	2010-06-23	2010-06-23	ENSG00000188779	ENSG00000188779		"""SKI transcriptional corepressors"""	21326	protein-coding gene	gene with protein product	"""transcriptional corepressor CORL1"", ""functional smad suppressing element 15"", ""corepressor for LBX1"""	611273	"""Lbxcor1 homolog (mouse)"""	LBXCOR1		15528197	Standard	NM_001258024		Approved	CORL1, FUSSEL15	uc031qsn.1	P84550		ENST00000380035.2:c.1222delA	15.37:g.68119388delA	ENSP00000369374:p.Lys409fs		A6NIP4|A6NJY0|Q2VWA5	Frame_Shift_Del	DEL	pfam_Transform_Ski,pfam_c-SKI_SMAD4-bd_dom,superfamily_DNA-bd_dom_put,superfamily_SAND_dom-like	p.K409fs	ENST00000380035.2	37	c.1222		15																																																																																			SKOR1	-	NULL	ENSG00000188779		0.697	SKOR1-003	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	SKOR1	HGNC	protein_coding	OTTHUMT00000410832.1		0.00	16	0	A	NM_001031807		68119388	+1			no_errors	ENST00000380035	ensembl	human	known	74_37	frame_shift_del	33.33	4	2	DEL	1.000	0
SLC17A6	57084	genome.wustl.edu	37	11	22360142	22360142	+	Frame_Shift_Del	DEL	A	A	-			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:22360142delA	ENST00000263160.3	+	1	500	c.63delA	c.(61-63)ggafs	p.G21fs	CTD-2140G10.2_ENST00000531304.1_RNA|CTD-2140G10.2_ENST00000528009.1_RNA|CTD-2140G10.2_ENST00000530569.1_RNA	NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	21					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						ATTTTGCTGGAAAATCACTCG	0.453																																																	0													64.0	68.0	66.0					11																	22360142		2203	4300	6503	SO:0001589	frameshift_variant	0			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.63delA	11.37:g.22360142delA	ENSP00000263160:p.Gly21fs		A6NKS2	Frame_Shift_Del	DEL	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.K22fs	ENST00000263160.3	37	c.63	CCDS7856.1	11																																																																																			SLC17A6	-	NULL	ENSG00000091664		0.453	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	HGNC	protein_coding	OTTHUMT00000387671.1		0.00	39	0	A	NM_020346		22360142	+1	tier1		no_errors	ENST00000263160	ensembl	human	known	74_37	frame_shift_del	5.00	38	2	DEL	0.999	-
SLC19A3	80704	genome.wustl.edu	37	2	228566913	228566913	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:228566913C>A	ENST00000258403.3	-	2	193	c.122G>T	c.(121-123)gGa>gTa	p.G41V	SLC19A3_ENST00000541617.1_5'UTR|SLC19A3_ENST00000409287.1_Missense_Mutation_p.G41V	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	41					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)	p.G41V(1)		breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	TTTATCTGGTCCAGATAAATA	0.388																																																	1	Substitution - Missense(1)	lung(1)											106.0	111.0	109.0					2																	228566913		2203	4300	6503	SO:0001583	missense	0			AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.122G>T	2.37:g.228566913C>A	ENSP00000258403:p.Gly41Val			Missense_Mutation	SNP	pfam_Folate_carrier,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier	p.G41V	ENST00000258403.3	37	c.122	CCDS2468.1	2	.	.	.	.	.	.	.	.	.	.	C	19.64	3.865227	0.71949	.	.	ENSG00000135917	ENST00000409287;ENST00000258403;ENST00000456524;ENST00000419059;ENST00000409456	D;D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28;-2.28	5.67	3.87	0.44632	Major facilitator superfamily domain, general substrate transporter (1);	0.054589	0.85682	D	0.000000	D	0.94627	0.8268	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94949	0.8098	10	0.87932	D	0	-11.5939	12.4292	0.55565	0.0:0.862:0.0:0.138	.	41	Q9BZV2	S19A3_HUMAN	V	41	ENSP00000386298:G41V;ENSP00000258403:G41V;ENSP00000399001:G41V;ENSP00000398349:G41V;ENSP00000387193:G41V	ENSP00000258403:G41V	G	-	2	0	SLC19A3	228275157	1.000000	0.71417	0.973000	0.42090	0.975000	0.68041	1.572000	0.36461	0.855000	0.35359	-0.123000	0.14984	GGA	SLC19A3	-	pfam_Folate_carrier,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier,tigrfam_Folate_carrier	ENSG00000135917		0.388	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC19A3	HGNC	protein_coding	OTTHUMT00000256894.1	-	0.00	39	0	C			228566913	-1	tier1	-	no_errors	ENST00000258403	ensembl	human	known	74_37	missense	14.75	52	9	SNP	1.000	A
SLC24A1	9187	genome.wustl.edu	37	15	65916439	65916439	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:65916439G>A	ENST00000261892.6	+	2	308	c.21G>A	c.(19-21)atG>atA	p.M7I	SLC24A1_ENST00000544319.2_Missense_Mutation_p.M7I|SLC24A1_ENST00000537259.1_Missense_Mutation_p.M7I|SLC24A1_ENST00000546330.1_Missense_Mutation_p.M7I|SLC24A1_ENST00000339868.6_Missense_Mutation_p.M7I|SLC24A1_ENST00000399033.4_Missense_Mutation_p.M7I	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	7					calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						TGATCAGGATGGGGCCGCAAG	0.502																																																	0													98.0	97.0	97.0					15																	65916439		1919	4129	6048	SO:0001583	missense	0			AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.21G>A	15.37:g.65916439G>A	ENSP00000261892:p.Met7Ile		O43485|O75184|Q17RM9	Missense_Mutation	SNP	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger,tigrfam_K/Na/Ca-exchanger	p.M7I	ENST00000261892.6	37	c.21	CCDS45284.1	15	.	.	.	.	.	.	.	.	.	.	G	10.78	1.445622	0.25987	.	.	ENSG00000074621	ENST00000537259;ENST00000261892;ENST00000339868;ENST00000544319;ENST00000399033;ENST00000546330	T;T;T;T;T;T	0.64618	0.15;-0.09;-0.08;-0.09;-0.11;-0.08	5.2	0.682	0.17992	.	1.629190	0.02852	N	0.129243	T	0.52240	0.1722	L	0.35854	1.095	0.09310	N	1	B;B;B;B;B	0.20261	0.009;0.005;0.005;0.043;0.025	B;B;B;B;B	0.17722	0.002;0.002;0.002;0.019;0.008	T	0.43343	-0.9397	10	0.72032	D	0.01	.	4.6912	0.12781	0.0841:0.2562:0.5137:0.146	.	7;7;7;7;7	O60721-2;Q17RM9;O60721;F5H127;B4E1W0	.;.;NCKX1_HUMAN;.;.	I	7	ENSP00000439693:M7I;ENSP00000261892:M7I;ENSP00000341837:M7I;ENSP00000445163:M7I;ENSP00000381991:M7I;ENSP00000439190:M7I	ENSP00000261892:M7I	M	+	3	0	SLC24A1	63703492	0.978000	0.34361	0.399000	0.26333	0.579000	0.36224	0.341000	0.19909	0.312000	0.23038	0.591000	0.81541	ATG	SLC24A1	-	tigrfam_K-dep_Na/Ca-exchanger	ENSG00000074621		0.502	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A1	HGNC	protein_coding	OTTHUMT00000397304.1	-	0.00	41	0	G	NM_004727		65916439	+1	tier1	-	no_errors	ENST00000261892	ensembl	human	known	74_37	missense	34.21	25	13	SNP	0.040	A
SMARCA4	6597	genome.wustl.edu	37	19	11143993	11143993	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:11143993C>T	ENST00000429416.3	+	27	3855	c.3574C>T	c.(3574-3576)Cgc>Tgc	p.R1192C	SMARCA4_ENST00000590574.1_Missense_Mutation_p.R1192C|SMARCA4_ENST00000589677.1_Missense_Mutation_p.R1192C|SMARCA4_ENST00000450717.3_Missense_Mutation_p.R1192C|SMARCA4_ENST00000358026.2_Missense_Mutation_p.R1192C|SMARCA4_ENST00000541122.2_Missense_Mutation_p.R1192C|SMARCA4_ENST00000444061.3_Missense_Mutation_p.R1192C|SMARCA4_ENST00000344626.4_Missense_Mutation_p.R1192C|SMARCA4_ENST00000413806.3_Missense_Mutation_p.R1192C	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1192	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.R1192C(1)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CCGAGCCCACCGCATCGGGCA	0.607			"""F, N, Mis"""		NSCLC																																			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	2	Substitution - Missense(1)|Unknown(1)	lung(1)|central_nervous_system(1)											61.0	61.0	61.0					19																	11143993		2203	4300	6503	SO:0001583	missense	0			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3574C>T	19.37:g.11143993C>T	ENSP00000395654:p.Arg1192Cys		B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,prints_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain	p.R1192C	ENST00000429416.3	37	c.3574	CCDS12253.1	19	.	.	.	.	.	.	.	.	.	.	C	24.2	4.507268	0.85282	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.97888	-4.59;-4.59;-4.59;-4.59;-4.59;-4.59;-4.59	4.74	4.74	0.60224	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99498	0.9821	H	0.99982	5.21	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97352	0.9964	10	0.87932	D	0	-34.1151	16.7067	0.85374	0.0:1.0:0.0:0.0	.	1192;1192;1192;1192;1192;412;1192	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	C	1192;1192;1256;1192;1192;1192;1192;1192	ENSP00000395654:R1192C;ENSP00000350720:R1192C;ENSP00000343896:R1192C;ENSP00000445036:R1192C;ENSP00000392837:R1192C;ENSP00000397783:R1192C;ENSP00000414727:R1192C	ENSP00000343896:R1192C	R	+	1	0	SMARCA4	11004993	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.675000	0.68123	2.488000	0.83962	0.558000	0.71614	CGC	SMARCA4	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	ENSG00000127616		0.607	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SMARCA4	HGNC	protein_coding	OTTHUMT00000452638.2	-	0.00	53	0	C	NM_003072		11143993	+1	tier1	-	no_errors	ENST00000358026	ensembl	human	known	74_37	missense	48.78	20	20	SNP	1.000	T
SMC4	10051	genome.wustl.edu	37	3	160138588	160138588	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:160138588C>T	ENST00000357388.3	+	13	2369	c.1918C>T	c.(1918-1920)Ctg>Ttg	p.L640L	SMC4_ENST00000360111.2_Silent_p.L640L|SMC4_ENST00000462787.1_Silent_p.L640L|SMC4_ENST00000469762.1_Silent_p.L615L|RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000344722.5_Silent_p.L640L	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	640	Flexible hinge.				kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TTGTCATGCACTGGACTACAT	0.368																																																	0													171.0	156.0	161.0					3																	160138588		2203	4300	6503	SO:0001819	synonymous_variant	0			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.1918C>T	3.37:g.160138588C>T			A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Silent	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,superfamily_Chemotax_Me-accpt_rcpt_lig-bd,superfamily_Prefoldin,smart_SMC_hinge	p.L640	ENST00000357388.3	37	c.1918	CCDS3189.1	3																																																																																			SMC4	-	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,smart_SMC_hinge	ENSG00000113810		0.368	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC4	HGNC	protein_coding	OTTHUMT00000352862.1	-	0.00	52	0	C			160138588	+1	tier1	-	no_errors	ENST00000344722	ensembl	human	known	74_37	silent	34.58	70	37	SNP	0.434	T
SMG8	55181	genome.wustl.edu	37	17	57288293	57288293	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:57288293A>G	ENST00000543872.2	+	2	1145	c.881A>G	c.(880-882)cAt>cGt	p.H294R	SMG8_ENST00000300917.5_Missense_Mutation_p.H294R|CTD-2510F5.6_ENST00000577660.1_Intron|SMG8_ENST00000580498.1_Intron|SMG8_ENST00000578922.1_Missense_Mutation_p.H294R			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	294					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						CCCAAGAAACATTCTCCCAAA	0.502																																																	0													65.0	69.0	67.0					17																	57288293		2203	4300	6503	SO:0001583	missense	0			AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.881A>G	17.37:g.57288293A>G	ENSP00000438748:p.His294Arg		Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	pfam_Smg8/Smg9	p.H294R	ENST00000543872.2	37	c.881	CCDS11615.1	17	.	.	.	.	.	.	.	.	.	.	A	14.61	2.587544	0.46110	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.39056	1.1;1.1	5.88	5.88	0.94601	.	0.084546	0.85682	D	0.000000	T	0.54967	0.1891	L	0.43152	1.355	0.80722	D	1	D	0.62365	0.991	D	0.76071	0.987	T	0.46679	-0.9174	10	0.19147	T	0.46	-20.3244	15.4686	0.75422	1.0:0.0:0.0:0.0	.	294	Q8ND04	SMG8_HUMAN	R	294	ENSP00000300917:H294R;ENSP00000438748:H294R	ENSP00000300917:H294R	H	+	2	0	SMG8	54643075	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.957000	0.93082	2.235000	0.73313	0.533000	0.62120	CAT	SMG8	-	pfam_Smg8/Smg9	ENSG00000167447		0.502	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG8	HGNC	protein_coding	OTTHUMT00000445960.2	-	0.00	33	0	A	NM_018149		57288293	+1	tier1	-	no_errors	ENST00000300917	ensembl	human	known	74_37	missense	38.71	19	12	SNP	1.000	G
SMIM21	284274	genome.wustl.edu	37	18	73139414	73139414	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr18:73139414C>A	ENST00000579022.1	-	1	244	c.105G>T	c.(103-105)ttG>ttT	p.L35F	SMIM21_ENST00000382638.3_Missense_Mutation_p.L35F|SMIM21_ENST00000584508.1_Missense_Mutation_p.L35F	NM_001037331.2	NP_001032408.1	Q3B7S5	SMI21_HUMAN	small integral membrane protein 21	35						integral component of membrane (GO:0016021)											TCTTCTGCAGCAAATTCCCCT	0.463																																																	0													234.0	206.0	216.0					18																	73139414		2203	4300	6503	SO:0001583	missense	0				CCDS32845.1	18q23	2013-03-11	2013-03-11	2013-03-11	ENSG00000206026	ENSG00000206026			27598	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 62"""	C18orf62			Standard	NM_001037331		Approved		uc002lma.1	Q3B7S5	OTTHUMG00000179126	ENST00000579022.1:c.105G>T	18.37:g.73139414C>A	ENSP00000462106:p.Leu35Phe			Missense_Mutation	SNP	NULL	p.L35F	ENST00000579022.1	37	c.105	CCDS32845.1	18	.	.	.	.	.	.	.	.	.	.	C	1.473	-0.559331	0.03967	.	.	ENSG00000206026	ENST00000382638	.	.	.	1.77	-2.45	0.06481	.	.	.	.	.	T	0.15349	0.0370	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12837	-1.0532	8	0.87932	D	0	.	2.2103	0.03946	0.2565:0.3706:0.0:0.3729	.	35	Q3B7S5	CR062_HUMAN	F	35	.	ENSP00000372083:L35F	L	-	3	2	C18orf62	71268402	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.846000	0.04336	-2.113000	0.00833	0.260000	0.18958	TTG	SMIM21	-	NULL	ENSG00000206026		0.463	SMIM21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMIM21	HGNC	protein_coding	OTTHUMT00000444917.1	-	0.00	66	0	C	NM_001037331		73139414	-1	tier1	-	no_errors	ENST00000579022	ensembl	human	known	74_37	missense	27.54	50	19	SNP	0.000	A
SMPD1	6609	genome.wustl.edu	37	11	6413037	6413037	+	Missense_Mutation	SNP	G	G	A	rs200763423		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:6413037G>A	ENST00000342245.4	+	2	910	c.742G>A	c.(742-744)Gaa>Aaa	p.E248K	SMPD1_ENST00000527275.1_Missense_Mutation_p.E247K|SMPD1_ENST00000299397.3_Missense_Mutation_p.E248K|SMPD1_ENST00000356761.2_Missense_Mutation_p.E248K|SMPD1_ENST00000533196.1_Intron	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	246			S -> R (in NPDA and NPDB; also found in patients with an intermediate form). {ECO:0000269|PubMed:12369017, ECO:0000269|PubMed:12556236, ECO:0000269|PubMed:15877209}.		cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	ATACTGGGGCGAATACAGCAA	0.652																																																	0			GRCh37	CM041853	SMPD1	M							59.0	72.0	68.0					11																	6413037		2201	4296	6497	SO:0001583	missense	0			AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.742G>A	11.37:g.6413037G>A	ENSP00000340409:p.Glu248Lys		A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Missense_Mutation	SNP	pfam_PEstase_dom,superfamily_Saposin-like,smart_SaposinB,pirsf_Sphingomy_PDE,pfscan_SaposinB	p.E248K	ENST00000342245.4	37	c.742	CCDS44531.1	11	.	.	.	.	.	.	.	.	.	.	G	25.1	4.598738	0.87055	.	.	ENSG00000166311	ENST00000299397;ENST00000356761;ENST00000342245;ENST00000527275	D;D;D;D	0.94184	-3.37;-3.37;-3.37;-3.37	5.02	4.1	0.47936	Metallophosphoesterase domain (1);	0.300406	0.30781	N	0.008884	D	0.92831	0.7720	L	0.42245	1.32	0.32924	D	0.516272	D;D;D	0.69078	0.997;0.996;0.989	P;P;P	0.58520	0.775;0.752;0.84	D	0.93452	0.6803	10	0.72032	D	0.01	-37.2233	8.1531	0.31152	0.1803:0.0:0.8197:0.0	.	247;248;246	E9PKS3;G3XAB5;P17405	.;.;ASM_HUMAN	K	248;248;248;247	ENSP00000299397:E248K;ENSP00000349203:E248K;ENSP00000340409:E248K;ENSP00000435350:E247K	ENSP00000299397:E248K	E	+	1	0	SMPD1	6369613	0.992000	0.36948	1.000000	0.80357	0.987000	0.75469	2.635000	0.46537	2.326000	0.78906	0.561000	0.74099	GAA	SMPD1	-	pfam_PEstase_dom,pirsf_Sphingomy_PDE	ENSG00000166311		0.652	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMPD1	HGNC	protein_coding	OTTHUMT00000384205.1	-	0.00	27	0	G	NM_000543		6413037	+1	tier1	rs200763423	no_errors	ENST00000342245	ensembl	human	known	74_37	missense	37.50	10	6	SNP	0.990	A
SNHG14	104472715	genome.wustl.edu	37	15	25467313	25467313	+	RNA	SNP	C	C	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:25467313C>G	ENST00000424208.1	+	0	3047				SNHG14_ENST00000453082.2_RNA|SNORD115-28_ENST00000363931.1_RNA|SNORD115-29_ENST00000362834.1_RNA|SNORD115-27_ENST00000364430.1_RNA	NR_003305.1				small nucleolar RNA host gene 14 (non-protein coding)																		CAGATGGTGACCCTGAAGAAA	0.552																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25467313C>G				RNA	SNP	-	NULL	ENST00000424208.1	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.552	SNHG14-002	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000126729.2	-	0.00	21	0	C			25467313	+1	tier1	-	no_errors	ENST00000424208	ensembl	human	known	74_37	rna	33.33	6	3	SNP	0.253	G
SNORD3D	780854	genome.wustl.edu	37	17	19015738	19015738	+	lincRNA	SNP	T	T	C	rs530227028	byFrequency	TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:19015738T>C	ENST00000362793.1	-	0	211									small nucleolar RNA, C/D box 3D																		GAAAAaccactcagaccgcgt	0.552																																																	0													10.0	18.0	16.0					17																	19015738		846	1964	2810			0					17p11.2	2013-09-05			ENSG00000199663				33192	non-coding RNA	RNA, small nucleolar						9365252	Standard	NR_006882		Approved	U3-4					17.37:g.19015738T>C				RNA	SNP	-	NULL	ENST00000362793.1	37	NULL		17																																																																																			SNORD3D	-	-	ENSG00000262202		0.552	SNORD3D-201	KNOWN	basic	snoRNA	SNORD3D	HGNC	lincRNA		-	0.00	41	0	T	NR_006882		19015738	-1	tier1	-	no_errors	ENST00000362793	ensembl	human	known	74_37	rna	21.74	18	5	SNP	0.097	C
SNRNP40	9410	genome.wustl.edu	37	1	31732677	31732677	+	3'UTR	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:31732677G>A	ENST00000263694.4	-	0	1334				SNRNP40_ENST00000489853.1_5'UTR|SNRNP40_ENST00000373720.3_3'UTR	NM_004814.2	NP_004805.2	Q96DI7	SNR40_HUMAN	small nuclear ribonucleoprotein 40kDa (U5)						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	7						aaaagaaaaagaaaaaaaaaa	0.373																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF090988	CCDS340.1	1p35.2	2013-01-09	2008-10-29	2008-10-29	ENSG00000060688	ENSG00000060688		"""WD repeat domain containing"""	30857	protein-coding gene	gene with protein product		607797	"""WD repeat domain 57 (U5 snRNP specific)"""	WDR57		9774689, 9731529, 10788320	Standard	NM_004814		Approved	PRP8BP, SPF38, PRPF8BP, HPRP8BP	uc009vtt.3	Q96DI7	OTTHUMG00000003790	ENST00000263694.4:c.*242C>T	1.37:g.31732677G>A			B4DQJ1|O75938|O95320	RNA	SNP	-	NULL	ENST00000263694.4	37	NULL	CCDS340.1	1																																																																																			SNRNP40	-	-	ENSG00000060688		0.373	SNRNP40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP40	HGNC	protein_coding	OTTHUMT00000010657.1	-	0.00	33	0	G	NM_004814		31732677	-1	tier1	-	no_errors	ENST00000486941	ensembl	human	known	74_37	rna	10.20	44	5	SNP	0.002	A
SORBS2	8470	genome.wustl.edu	37	4	186583259	186583259	+	Splice_Site	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr4:186583259G>A	ENST00000284776.7	-	5	602	c.93C>T	c.(91-93)ctC>ctT	p.L31L	SORBS2_ENST00000319471.9_Splice_Site_p.L117L|SORBS2_ENST00000449407.2_Splice_Site_p.L117L|SORBS2_ENST00000393528.3_Splice_Site_p.L77L|SORBS2_ENST00000355634.5_Splice_Site_p.L131L|SORBS2_ENST00000437304.2_Splice_Site_p.L210L|SORBS2_ENST00000431808.1_Splice_Site_p.L31L|SORBS2_ENST00000448662.2_Splice_Site_p.L100L	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	31					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)	p.L100L(1)|p.L31L(1)		endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		ATTACTTACCGAGGGATGTGC	0.527																																					Esophageal Squamous(153;41 2433 9491 36028)												2	Substitution - coding silent(2)	large_intestine(2)											115.0	94.0	101.0					4																	186583259		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.94+1C>T	4.37:g.186583259G>A			A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.L31	ENST00000284776.7	37	c.93	CCDS3845.1	4																																																																																			SORBS2	-	NULL	ENSG00000154556		0.527	SORBS2-001	KNOWN	basic|CCDS	protein_coding	SORBS2	HGNC	protein_coding	OTTHUMT00000347944.3		0.00	77	0	G	NM_003603	Silent	186583259	-1			no_errors	ENST00000284776	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.120	A
SPAG17	200162	genome.wustl.edu	37	1	118514619	118514619	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:118514619C>A	ENST00000336338.5	-	45	6258	c.6193G>T	c.(6193-6195)Gcc>Tcc	p.A2065S	SPAG17_ENST00000492438.1_5'UTR	NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	2065						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TTATTAATGGCAGCAGATGCA	0.388																																																	0													135.0	122.0	126.0					1																	118514619		2203	4300	6503	SO:0001583	missense	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.6193G>T	1.37:g.118514619C>A	ENSP00000337804:p.Ala2065Ser		Q8NAZ1|Q9NT21	Missense_Mutation	SNP	NULL	p.A2065S	ENST00000336338.5	37	c.6193	CCDS899.1	1	.	.	.	.	.	.	.	.	.	.	C	6.115	0.389518	0.11581	.	.	ENSG00000155761	ENST00000336338;ENST00000437255	T	0.18338	2.22	5.46	3.36	0.38483	.	0.274240	0.26428	N	0.024439	T	0.06142	0.0159	L	0.55481	1.735	0.09310	N	1	P	0.41673	0.759	B	0.41860	0.368	T	0.23976	-1.0173	10	0.33141	T	0.24	.	3.8997	0.09155	0.1793:0.5981:0.0:0.2226	.	2065	Q6Q759	SPG17_HUMAN	S	2065;545	ENSP00000337804:A2065S	ENSP00000337804:A2065S	A	-	1	0	SPAG17	118316142	0.465000	0.25815	0.093000	0.20910	0.162000	0.22319	0.411000	0.21115	0.675000	0.31264	0.655000	0.94253	GCC	SPAG17	-	NULL	ENSG00000155761		0.388	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	-	0.00	43	0	C	NM_206996		118514619	-1	tier1	-	no_errors	ENST00000336338	ensembl	human	known	74_37	missense	37.84	45	28	SNP	0.170	A
SPINT2	10653	genome.wustl.edu	37	19	38780792	38780792	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:38780792G>T	ENST00000301244.7	+	5	860	c.425G>T	c.(424-426)tGc>tTc	p.C142F	CTB-102L5.4_ENST00000591889.1_Missense_Mutation_p.A20S|SPINT2_ENST00000587090.1_Missense_Mutation_p.C92F|SPINT2_ENST00000454580.3_Missense_Mutation_p.C85F	NM_021102.3	NP_066925.1	O43291	SPIT2_HUMAN	serine peptidase inhibitor, Kunitz type, 2	142	BPTI/Kunitz inhibitor 2. {ECO:0000255|PROSITE-ProRule:PRU00031}.				cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			large_intestine(2)|lung(1)|ovary(1)	4	all_cancers(60;6.83e-07)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			ACTGGGCCTTGCCGTGCATCC	0.542																																																	0													78.0	72.0	74.0					19																	38780792		2203	4300	6503	SO:0001583	missense	0			U78095	CCDS12510.1, CCDS54261.1	19q13.2	2010-05-12	2005-08-17		ENSG00000167642	ENSG00000167642			11247	protein-coding gene	gene with protein product	"""placental bikunin"""	605124	"""serine protease inhibitor, Kunitz type, 2"""			9115294, 9346890	Standard	NM_021102		Approved	Kop, HAI-2	uc002ohr.2	O43291		ENST00000301244.7:c.425G>T	19.37:g.38780792G>T	ENSP00000301244:p.Cys142Phe		A8K667|B4DLU1|O00271|O14895|Q5TZQ3|Q969E0	Missense_Mutation	SNP	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.C142F	ENST00000301244.7	37	c.425	CCDS12510.1	19	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354759	0.61293	.	.	ENSG00000167642	ENST00000301244;ENST00000454580	T;T	0.81078	-1.45;-1.45	5.55	5.55	0.83447	Proteinase inhibitor I2, Kunitz metazoa (5);	0.000000	0.64402	D	0.000002	D	0.93966	0.8068	H	0.98769	4.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.95927	0.8935	10	0.87932	D	0	.	15.0009	0.71469	0.0:0.0:1.0:0.0	.	85;142	B4DLU1;O43291	.;SPIT2_HUMAN	F	142;85	ENSP00000301244:C142F;ENSP00000389788:C85F	ENSP00000301244:C142F	C	+	2	0	SPINT2	43472632	1.000000	0.71417	1.000000	0.80357	0.097000	0.18754	8.260000	0.89857	2.620000	0.88729	0.655000	0.94253	TGC	SPINT2	-	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	ENSG00000167642		0.542	SPINT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPINT2	HGNC	protein_coding	OTTHUMT00000458151.2	-	0.00	70	0	G			38780792	+1	tier1	-	no_errors	ENST00000301244	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
SPOPL	339745	genome.wustl.edu	37	2	139308582	139308582	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:139308582T>A	ENST00000280098.4	+	4	689	c.310T>A	c.(310-312)Ttt>Att	p.F104I		NM_001001664.2	NP_001001664.1	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	104	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(2)|cervix(2)|endometrium(2)|large_intestine(2)|lung(11)|skin(2)	21				BRCA - Breast invasive adenocarcinoma(221;0.0296)		AAAATTCAAATTTTCCCTTCT	0.348																																																	0													67.0	71.0	69.0					2																	139308582		2203	4299	6502	SO:0001583	missense	0				CCDS33298.1	2q22.1	2013-01-09			ENSG00000144228	ENSG00000144228		"""BTB/POZ domain containing"""	27934	protein-coding gene	gene with protein product	"""HIB homolog 2"", ""roadkill homolog 2"""						Standard	NM_001001664		Approved	BTBD33	uc002tvh.3	Q6IQ16	OTTHUMG00000153635	ENST00000280098.4:c.310T>A	2.37:g.139308582T>A	ENSP00000280098:p.Phe104Ile			Missense_Mutation	SNP	pfam_BTB_POZ,pfam_MATH,superfamily_TRAF-like,superfamily_BTB/POZ_fold,smart_MATH,smart_BTB/POZ-like,pfscan_BTB/POZ-like,pfscan_MATH	p.F104I	ENST00000280098.4	37	c.310	CCDS33298.1	2	.	.	.	.	.	.	.	.	.	.	T	32	5.177618	0.94846	.	.	ENSG00000144228	ENST00000280098	T	0.66638	-0.22	5.48	5.48	0.80851	TRAF-type (1);TRAF-like (1);MATH (3);	0.000000	0.85682	D	0.000000	T	0.78285	0.4259	L	0.53780	1.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77978	-0.2384	10	0.44086	T	0.13	-13.3753	15.8579	0.78994	0.0:0.0:0.0:1.0	.	104	Q6IQ16	SPOPL_HUMAN	I	104	ENSP00000280098:F104I	ENSP00000280098:F104I	F	+	1	0	SPOPL	139025052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.191000	0.70037	0.528000	0.53228	TTT	SPOPL	-	pfam_MATH,superfamily_TRAF-like,smart_MATH,pfscan_MATH	ENSG00000144228		0.348	SPOPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPOPL	HGNC	protein_coding	OTTHUMT00000331897.1	-	0.00	28	0	T			139308582	+1	tier1	-	no_errors	ENST00000280098	ensembl	human	known	74_37	missense	30.56	50	22	SNP	1.000	A
SREBF1	6720	genome.wustl.edu	37	17	17719808	17719808	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:17719808G>A	ENST00000261646.5	-	10	2194	c.2010C>T	c.(2008-2010)gcC>gcT	p.A670A	SREBF1_ENST00000355815.4_Silent_p.A700A|SREBF1_ENST00000583732.1_5'Flank|SREBF1_ENST00000395757.1_Silent_p.A416A|SREBF1_ENST00000338854.5_Silent_p.A670A|MIR33B_ENST00000385104.1_RNA	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	670					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						GGTAGACCAGGGCTGCGTCTC	0.692																																																	0													12.0	11.0	11.0					17																	17719808		2178	4279	6457	SO:0001819	synonymous_variant	0			BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.2010C>T	17.37:g.17719808G>A			B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Silent	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.A700	ENST00000261646.5	37	c.2100	CCDS11189.1	17	.	.	.	.	.	.	.	.	.	.	G	6.520	0.464252	0.12402	.	.	ENSG00000072310	ENST00000395751	.	.	.	5.4	1.14	0.20703	.	.	.	.	.	T	0.43033	0.1229	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.20140	-1.0284	4	.	.	.	-19.846	2.2345	0.04004	0.2206:0.131:0.5131:0.1353	.	.	.	.	S	678	.	.	P	-	1	0	SREBF1	17660533	0.004000	0.15560	0.172000	0.22920	0.484000	0.33280	-1.076000	0.03420	0.005000	0.14708	0.561000	0.74099	CCT	SREBF1	-	NULL	ENSG00000072310		0.692	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF1	HGNC	protein_coding	OTTHUMT00000131771.1	-	0.00	96	0	G	NM_004176		17719808	-1	tier1	-	no_errors	ENST00000355815	ensembl	human	known	74_37	silent	45.28	29	24	SNP	0.981	A
ST6GALNAC6	30815	genome.wustl.edu	37	9	130656797	130656797	+	Silent	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr9:130656797G>T	ENST00000373146.1	-	4	470	c.291C>A	c.(289-291)ggC>ggA	p.G97G	ST6GALNAC6_ENST00000542456.1_Missense_Mutation_p.A33E|ST6GALNAC6_ENST00000373141.1_Silent_p.G63G|ST6GALNAC6_ENST00000485320.1_5'UTR|ST6GALNAC6_ENST00000373144.3_Silent_p.G63G|ST6GALNAC6_ENST00000291839.5_Silent_p.G97G|ST6GALNAC6_ENST00000373142.1_Silent_p.G97G			Q969X2	SIA7F_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6	97					cell-cell recognition (GO:0009988)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						CTACCTTGTTGCCGAGAATGG	0.582																																																	0													85.0	82.0	83.0					9																	130656797		2203	4300	6503	SO:0001819	synonymous_variant	0			BC006564	CCDS6882.1, CCDS69668.1, CCDS69669.1, CCDS75908.1	9q34.13	2013-03-01		2005-02-07	ENSG00000160408	ENSG00000160408		"""Sialyltransferases"""	23364	protein-coding gene	gene with protein product		610135	"""sialytransferase 7 ((alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F"""	SIAT7F		12668675	Standard	XM_005251952		Approved	ST6GALNACVI	uc004bso.1	Q969X2	OTTHUMG00000020718	ENST00000373146.1:c.291C>A	9.37:g.130656797G>T			B3KQ01|Q5T9C4|Q5T9C5|Q9H8A2|Q9ULB8	Missense_Mutation	SNP	pfam_Glyco_trans_29	p.A33E	ENST00000373146.1	37	c.98	CCDS6882.1	9	.	.	.	.	.	.	.	.	.	.	G	14.13	2.443118	0.43326	.	.	ENSG00000160408	ENST00000542456	T	0.44881	0.91	4.88	2.9	0.33743	.	.	.	.	.	T	0.49729	0.1574	.	.	.	0.22811	N	0.998704	P	0.44380	0.834	P	0.52856	0.711	T	0.35226	-0.9797	8	0.66056	D	0.02	-13.6651	7.636	0.28267	0.0947:0.1673:0.738:0.0	.	33	B4DU80	.	E	33	ENSP00000438109:A33E	ENSP00000438109:A33E	A	-	2	0	ST6GALNAC6	129696618	0.963000	0.33076	0.999000	0.59377	0.682000	0.39822	-0.052000	0.11865	1.052000	0.40392	0.555000	0.69702	GCA	ST6GALNAC6	-	NULL	ENSG00000160408		0.582	ST6GALNAC6-007	KNOWN	basic|CCDS	protein_coding	ST6GALNAC6	HGNC	protein_coding	OTTHUMT00000054278.1	-	0.00	92	0	G	NM_013443		130656797	-1	tier1	-	no_errors	ENST00000542456	ensembl	human	known	74_37	missense	36.54	33	19	SNP	1.000	T
PILRB	29990	genome.wustl.edu	37	7	99933888	99933888	+	5'UTR	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:99933888C>T	ENST00000610247.1	+	0	152				STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA|STAG3L5P_ENST00000493499.1_RNA			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTGTGGAGCCCACCTGCATGT	0.692																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	ENST00000610247.1:c.-2345C>T	7.37:g.99933888C>T			Q69YF9|Q9HBS0	RNA	SNP	-	NULL	ENST00000610247.1	37	NULL	CCDS43622.1	7																																																																																			STAG3L5P-PVRIG2P-PILRB	-	-	ENSG00000272752		0.692	PILRB-202	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG3L5P-PVRIG2P-PILRB	HGNC	protein_coding		-	0.00	200	0	C	NM_178238		99933888	+1	tier1	-	no_errors	ENST00000310771	ensembl	human	known	74_37	rna	35.78	70	39	SNP	0.712	T
STK19	8859	genome.wustl.edu	37	6	31948477	31948477	+	Silent	SNP	A	A	G	rs7743469	byFrequency	TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:31948477A>G	ENST00000375333.2	+	7	1013	c.960A>G	c.(958-960)gaA>gaG	p.E320E	C4A_ENST00000498271.1_5'Flank|C4A_ENST00000537134.1_5'Flank|C4A_ENST00000428956.2_5'Flank|STK19_ENST00000375331.2_Silent_p.E316E	NM_032454.1	NP_115830.1	P49842	STK19_HUMAN	serine/threonine kinase 19	320					protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			skin(5)|upper_aerodigestive_tract(2)	7						AGTACCGGGAACTGCTCCTAT	0.617													G|||	131	0.0261581	0.0295	0.0159	5008	,	,		16365	0.0268		0.0348	False		,,,				2504	0.0194																0													48.0	60.0	56.0					6																	31948477		1509	2707	4216	SO:0001819	synonymous_variant	0			X77474	CCDS4733.1, CCDS34417.1	6p21.33	2011-09-15			ENSG00000204344	ENSG00000204344			11398	protein-coding gene	gene with protein product		604977				8012361, 9812991	Standard	NM_032454		Approved	D6S60, G11, RP1	uc003nyv.3	P49842	OTTHUMG00000166424	ENST00000375333.2:c.960A>G	6.37:g.31948477A>G			A6NF95|A6NFW8|B0QZR5|Q13159|Q31617|Q5JP77|Q5ST72|Q5ST75	Silent	SNP	pfam_Ser/Thr_kinase_19	p.E320	ENST00000375333.2	37	c.960	CCDS4733.1	6																																																																																			STK19	-	pfam_Ser/Thr_kinase_19	ENSG00000204344		0.617	STK19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STK19	HGNC	protein_coding	OTTHUMT00000076484.3	-	0.00	83	0	A			31948477	+1	tier1	rs7743469	no_errors	ENST00000375333	ensembl	human	known	74_37	silent	15.15	56	10	SNP	0.997	G
STK4	6789	genome.wustl.edu	37	20	43607120	43607120	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr20:43607120G>A	ENST00000372806.3	+	3	248	c.153G>A	c.(151-153)gaG>gaA	p.E51E	STK4_ENST00000372801.1_Silent_p.E51E|STK4_ENST00000396731.4_Silent_p.E51E|STK4_ENST00000499879.2_Silent_p.E51E	NM_006282.2	NP_006273.1	Q13043	STK4_HUMAN	serine/threonine kinase 4	51	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|cell morphogenesis (GO:0000902)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|keratinocyte differentiation (GO:0030216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Myeloproliferative disorder(115;0.0122)				TTCATAAAGAGACCGGCCAGA	0.393																																					GBM(187;1039 2137 11798 21916 33213)												0													76.0	77.0	76.0					20																	43607120		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13341.1	20q11.2-q13.2	2014-09-17			ENSG00000101109	ENSG00000101109			11408	protein-coding gene	gene with protein product	"""mammalian sterile 20-like 1"", ""yeast Ste20-like"", ""kinase responsive to stress 2"""	604965				8816758, 9545236, 11517310	Standard	NM_006282		Approved	MST1, KRS2, YSK3	uc002xnb.3	Q13043	OTTHUMG00000033059	ENST00000372806.3:c.153G>A	20.37:g.43607120G>A			B2RCR8|Q15802|Q4G156|Q5H982|Q6PD60|Q9BR32|Q9NTZ4	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Mst1_SARAH_domain,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SARAH_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E51	ENST00000372806.3	37	c.153	CCDS13341.1	20																																																																																			STK4	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000101109		0.393	STK4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	STK4	HGNC	protein_coding	OTTHUMT00000080401.4	-	0.00	37	0	G	NM_006282		43607120	+1	tier1	-	no_errors	ENST00000372806	ensembl	human	known	74_37	silent	40.74	48	33	SNP	1.000	A
SYNE1	23345	genome.wustl.edu	37	6	152680459	152680459	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:152680459C>G	ENST00000367255.5	-	65	11035	c.10434G>C	c.(10432-10434)gaG>gaC	p.E3478D	SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000265368.4_Missense_Mutation_p.E3478D|SYNE1_ENST00000423061.1_Missense_Mutation_p.E3485D|SYNE1_ENST00000448038.1_Missense_Mutation_p.E3485D	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3478					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCTTGGCCCTCTCTTGGATGG	0.483										HNSCC(10;0.0054)																																							0													226.0	198.0	207.0					6																	152680459		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10434G>C	6.37:g.152680459C>G	ENSP00000356224:p.Glu3478Asp		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E3478D	ENST00000367255.5	37	c.10434	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	5.990	0.366517	0.11352	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038	T;T;T;T	0.54479	0.64;1.32;0.57;1.32	5.06	0.434	0.16539	.	0.328337	0.25578	N	0.029716	T	0.09992	0.0245	N	0.02802	-0.49	0.80722	D	1	B;B;B;B	0.09022	0.001;0.001;0.001;0.002	B;B;B;B	0.10450	0.003;0.003;0.003;0.005	T	0.20107	-1.0285	10	0.10111	T	0.7	.	13.3824	0.60775	0.0:0.3568:0.5687:0.0745	.	3478;3478;3478;3485	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	D	3478;3485;3478;3485	ENSP00000356224:E3478D;ENSP00000396024:E3485D;ENSP00000265368:E3478D;ENSP00000390975:E3485D	ENSP00000265368:E3478D	E	-	3	2	SYNE1	152722152	0.602000	0.26916	0.993000	0.49108	0.250000	0.25880	0.044000	0.13992	0.203000	0.20529	-0.182000	0.12963	GAG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom	ENSG00000131018		0.483	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2		0.00	78	0	C	NM_182961		152680459	-1			no_errors	ENST00000265368	ensembl	human	known	74_37	missense	5.88	96	6	SNP	0.993	G
SYNE1	23345	genome.wustl.edu	37	6	152751308	152751308	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:152751308G>A	ENST00000367255.5	-	36	5328	c.4727C>T	c.(4726-4728)gCt>gTt	p.A1576V	SYNE1_ENST00000367253.4_Missense_Mutation_p.A1576V|SYNE1_ENST00000341594.5_Missense_Mutation_p.A1646V|SYNE1_ENST00000265368.4_Missense_Mutation_p.A1576V|SYNE1_ENST00000423061.1_Missense_Mutation_p.A1583V|SYNE1_ENST00000448038.1_Missense_Mutation_p.A1583V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1576					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AATTGGAACAGCAAGTTTATC	0.303										HNSCC(10;0.0054)																																							0													56.0	53.0	54.0					6																	152751308		2201	4291	6492	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.4727C>T	6.37:g.152751308G>A	ENSP00000356224:p.Ala1576Val		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.A1576V	ENST00000367255.5	37	c.4727	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	13.28	2.189210	0.38707	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253	T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6	5.97	2.87	0.33458	.	0.638247	0.14715	N	0.302686	T	0.24774	0.0601	L	0.43152	1.355	0.80722	D	1	P;B;P;B;B	0.45827	0.791;0.222;0.867;0.222;0.33	B;B;B;B;B	0.35971	0.154;0.058;0.215;0.058;0.124	T	0.04360	-1.0957	10	0.30854	T	0.27	.	12.563	0.56293	0.0:0.0995:0.633:0.2675	.	1559;1576;1576;1576;1583	B3W695;Q8NF91;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	V	1576;1583;1576;1583;1646;1576	ENSP00000356224:A1576V;ENSP00000396024:A1583V;ENSP00000265368:A1576V;ENSP00000390975:A1583V;ENSP00000341887:A1646V;ENSP00000356222:A1576V	ENSP00000265368:A1576V	A	-	2	0	SYNE1	152793001	0.767000	0.28508	1.000000	0.80357	0.997000	0.91878	0.475000	0.22164	0.811000	0.34303	0.650000	0.86243	GCT	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.303	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2		0.00	33	0	G	NM_182961		152751308	-1			no_errors	ENST00000265368	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.994	A
SYTL2	54843	genome.wustl.edu	37	11	85435209	85435209	+	Intron	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:85435209G>T	ENST00000528231.1	-	8	1737				SYTL2_ENST00000316356.4_Intron|SYTL2_ENST00000524452.1_Intron|SYTL2_ENST00000389960.4_Intron|SYTL2_ENST00000359152.5_Missense_Mutation_p.T1288K|SYTL2_ENST00000527523.1_Intron|SYTL2_ENST00000525423.1_Missense_Mutation_p.T764K|SYTL2_ENST00000354566.3_Missense_Mutation_p.T764K	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		AACTTTACTTGTTTTTGTAGA	0.398																																																	0													80.0	82.0	81.0					11																	85435209		2203	4299	6502	SO:0001627	intron_variant	0			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1460-3207C>A	11.37:g.85435209G>T			B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.T1288K	ENST00000528231.1	37	c.3863	CCDS53688.1	11	.	.	.	.	.	.	.	.	.	.	G	11.68	1.711434	0.30322	.	.	ENSG00000137501	ENST00000359152;ENST00000354566;ENST00000525423;ENST00000530351	T;T;T;T	0.37411	1.68;1.68;1.68;1.2	6.02	-0.931	0.10438	.	1.346840	0.04335	N	0.353007	T	0.28995	0.0720	L	0.32530	0.975	0.09310	N	1	P;B;B	0.37276	0.589;0.435;0.435	B;B;B	0.36186	0.219;0.219;0.219	T	0.33701	-0.9858	9	.	.	.	1.7408	10.7101	0.45977	0.492:0.0:0.508:0.0	.	764;764;764	Q9HCH5-11;Q9HCH5-7;Q9HCH5-8	.;.;.	K	1288;764;764;183	ENSP00000352065:T1288K;ENSP00000346576:T764K;ENSP00000432694:T764K;ENSP00000435009:T183K	.	T	-	2	0	SYTL2	85112857	0.000000	0.05858	0.000000	0.03702	0.969000	0.65631	-0.119000	0.10676	-0.046000	0.13446	-0.142000	0.14014	ACA	SYTL2	-	NULL	ENSG00000137501		0.398	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL2	HGNC	protein_coding	OTTHUMT00000392192.1		0.00	16	0	G	NM_206927		85435209	-1			no_errors	ENST00000359152	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.000	T
TBC1D22B	55633	genome.wustl.edu	37	6	37281657	37281657	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:37281657C>T	ENST00000373491.3	+	10	1301	c.1155C>T	c.(1153-1155)agC>agT	p.S385S		NM_017772.2	NP_060242.2	Q9NU19	TB22B_HUMAN	TBC1 domain family, member 22B	385	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)	15			OV - Ovarian serous cystadenocarcinoma(102;0.241)			AGCTTGTCAGCCGGATTGATG	0.498																																																	0													191.0	170.0	177.0					6																	37281657		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096340	CCDS4832.1	6p21.2	2005-01-05	2005-01-05	2005-01-05	ENSG00000065491	ENSG00000065491			21602	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 197"""	C6orf197			Standard	NM_017772		Approved	FLJ20337, dJ744I24.2	uc003onn.3	Q9NU19	OTTHUMG00000014619	ENST00000373491.3:c.1155C>T	6.37:g.37281657C>T			A8KA28|Q32MQ8|Q5VUK9|Q6P4C3|Q7Z6P7|Q9BPV6|Q9BUT5|Q9NXB6	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.S385	ENST00000373491.3	37	c.1155	CCDS4832.1	6																																																																																			TBC1D22B	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000065491		0.498	TBC1D22B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D22B	HGNC	protein_coding	OTTHUMT00000040402.1		0.00	47	0	C	NM_017772		37281657	+1			no_errors	ENST00000373491	ensembl	human	known	74_37	silent	6.35	59	4	SNP	1.000	T
TBC1D31	93594	genome.wustl.edu	37	8	124140537	124140537	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr8:124140537G>A	ENST00000287380.1	+	14	1991	c.1901G>A	c.(1900-1902)cGg>cAg	p.R634Q	TBC1D31_ENST00000327098.5_Missense_Mutation_p.R634Q|TBC1D31_ENST00000518805.1_Intron|TBC1D31_ENST00000378080.2_Missense_Mutation_p.R529Q|TBC1D31_ENST00000522420.1_Missense_Mutation_p.R529Q|TBC1D31_ENST00000309336.3_Missense_Mutation_p.R634Q|TBC1D31_ENST00000521676.1_Missense_Mutation_p.R511Q	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	634						centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										TTTCACCATCGGAATAACCTG	0.323																																																	0													98.0	95.0	96.0					8																	124140537		2203	4300	6503	SO:0001583	missense	0			AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.1901G>A	8.37:g.124140537G>A	ENSP00000287380:p.Arg634Gln		B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Rab-GTPase-TBC_dom,smart_WD40_repeat,pfscan_Rab-GTPase-TBC_dom,pfscan_WD40_repeat_dom	p.R634Q	ENST00000287380.1	37	c.1901	CCDS6338.1	8	.	.	.	.	.	.	.	.	.	.	G	25.2	4.614876	0.87359	.	.	ENSG00000156787	ENST00000287380;ENST00000309336;ENST00000327098;ENST00000522420;ENST00000521676;ENST00000378080	T;T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0;2.0	5.73	5.73	0.89815	Rab-GAP/TBC domain (1);	0.000000	0.85682	D	0.000000	T	0.28599	0.0708	L	0.45581	1.43	0.80722	D	1	P;P;D	0.60160	0.888;0.882;0.987	B;P;P	0.46585	0.28;0.471;0.521	T	0.00740	-1.1586	10	0.46703	T	0.11	-24.4139	19.8939	0.96942	0.0:0.0:1.0:0.0	.	634;634;634	B7ZL19;Q96DN5-2;Q96DN5	.;.;WDR67_HUMAN	Q	634;634;634;529;511;529	ENSP00000287380:R634Q;ENSP00000308358:R634Q;ENSP00000312701:R634Q;ENSP00000429334:R529Q;ENSP00000430628:R511Q;ENSP00000367320:R529Q	ENSP00000287380:R634Q	R	+	2	0	WDR67	124209718	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.416000	0.80143	2.706000	0.92434	0.585000	0.79938	CGG	TBC1D31	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000156787		0.323	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D31	HGNC	protein_coding	OTTHUMT00000381721.1	-	0.00	18	0	G	NM_145647		124140537	+1	tier1	-	no_errors	ENST00000287380	ensembl	human	known	74_37	missense	29.49	55	23	SNP	1.000	A
TBC1D5	9779	genome.wustl.edu	37	3	17470011	17470011	+	Splice_Site	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:17470011C>A	ENST00000253692.7	-	4	1762	c.98G>T	c.(97-99)gGa>gTa	p.G33V	TBC1D5_ENST00000429383.4_Splice_Site_p.G33V|TBC1D5_ENST00000414318.2_Intron|TBC1D5_ENST00000446818.2_Splice_Site_p.G33V	NM_014744.2	NP_055559.1	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5	33						retromer complex (GO:0030904)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	36						ATTTGAATCTCCTGGAGAAAA	0.299																																																	0													30.0	34.0	33.0					3																	17470011		2197	4275	6472	SO:0001630	splice_region_variant	0			D86965	CCDS33714.1, CCDS46770.1	3p24.3	2013-07-09			ENSG00000131374	ENSG00000131374			19166	protein-coding gene	gene with protein product		615740				19531583	Standard	NM_014744		Approved	KIAA0210	uc003cbe.3	Q92609	OTTHUMG00000155488	ENST00000253692.7:c.98-1G>T	3.37:g.17470011C>A			A6NP25|C9JP52	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.G33V	ENST00000253692.7	37	c.98	CCDS33714.1	3	.	.	.	.	.	.	.	.	.	.	C	13.13	2.145828	0.37923	.	.	ENSG00000131374	ENST00000253692;ENST00000429383;ENST00000446818;ENST00000415814;ENST00000428355;ENST00000425944;ENST00000445294;ENST00000414349;ENST00000507877;ENST00000446863;ENST00000434420	T;T;T;T;T;T;T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16;2.16	5.71	3.88	0.44766	.	0.600069	0.17526	N	0.171071	T	0.15782	0.0380	L	0.40543	1.245	0.80722	D	1	B;B	0.32245	0.361;0.309	B;B	0.29785	0.107;0.107	T	0.05257	-1.0896	10	0.38643	T	0.18	.	6.9909	0.24755	0.0:0.584:0.2701:0.1459	.	33;33	C9JP52;Q92609	.;TBCD5_HUMAN	V	33	ENSP00000253692:G33V;ENSP00000398127:G33V;ENSP00000402935:G33V;ENSP00000396239:G33V;ENSP00000387395:G33V;ENSP00000399967:G33V;ENSP00000410596:G33V;ENSP00000393882:G33V;ENSP00000424998:G33V;ENSP00000415379:G33V;ENSP00000414159:G33V	ENSP00000253692:G33V	G	-	2	0	TBC1D5	17445015	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	1.057000	0.30492	0.735000	0.32537	0.585000	0.79938	GGA	TBC1D5	-	NULL	ENSG00000131374		0.299	TBC1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D5	HGNC	protein_coding	OTTHUMT00000340301.3	-	0.00	86	0	C	NM_014744	Missense_Mutation	17470011	-1	tier1	-	no_errors	ENST00000253692	ensembl	human	known	74_37	missense	40.27	89	60	SNP	0.996	A
TCP10	6953	genome.wustl.edu	37	6	167794750	167794750	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:167794750T>G	ENST00000397829.4	-	3	305	c.138A>C	c.(136-138)agA>agC	p.R46S	TCP10_ENST00000476779.2_Missense_Mutation_p.R46S|TCP10_ENST00000366827.2_Missense_Mutation_p.R46S	NM_004610.3	NP_004601.3	Q12799	TCP10_HUMAN	t-complex 10	73						cytosol (GO:0005829)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(6)	18		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		TCTGGAGTTTTCTGTGAATAT	0.557																																																	0													4.0	4.0	4.0					6																	167794750		1356	3103	4459	SO:0001583	missense	0			U03399	CCDS43527.1	6q27	2012-09-20	2012-09-20		ENSG00000203690	ENSG00000203690			11656	protein-coding gene	gene with protein product		187020	"""t-complex 10 (a murine tcp homolog)"", ""t-complex 10 (mouse)"", ""t-complex 10 homolog (mouse)"""			8111376	Standard	NM_004610		Approved		uc003qvv.1	Q12799	OTTHUMG00000016026	ENST00000397829.4:c.138A>C	6.37:g.167794750T>G	ENSP00000380929:p.Arg46Ser		Q5JR60|Q6P4F4	Missense_Mutation	SNP	NULL	p.R46S	ENST00000397829.4	37	c.138	CCDS43527.1	6	.	.	.	.	.	.	.	.	.	.	T	10.92	1.486001	0.26686	.	.	ENSG00000203690	ENST00000366827;ENST00000397829;ENST00000476779;ENST00000485157	T;T;T;T	0.16457	2.34;2.34;2.34;2.34	2.04	-4.08	0.03963	.	.	.	.	.	T	0.01940	0.0061	L	0.31926	0.97	0.09310	N	1	B;B	0.33103	0.397;0.187	B;B	0.28638	0.092;0.039	T	0.40478	-0.9561	9	0.15952	T	0.53	.	0.8389	0.01145	0.1527:0.1747:0.2914:0.3813	.	73;73	Q12799;Q12799-2	TCP10_HUMAN;.	S	46	ENSP00000355792:R46S;ENSP00000380929:R46S;ENSP00000427675:R46S;ENSP00000423829:R46S	ENSP00000355792:R46S	R	-	3	2	TCP10	167714740	0.000000	0.05858	0.000000	0.03702	0.113000	0.19764	0.508000	0.22692	-1.773000	0.01290	-0.760000	0.03462	AGA	TCP10	-	NULL	ENSG00000203690		0.557	TCP10-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCP10	HGNC	protein_coding	OTTHUMT00000365570.1	-	0.00	32	0	T	NM_004610		167794750	-1	tier1	-	no_errors	ENST00000397829	ensembl	human	known	74_37	missense	42.86	8	6	SNP	0.000	G
TENM4	26011	genome.wustl.edu	37	11	78369429	78369429	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:78369429G>T	ENST00000278550.7	-	34	8446	c.7984C>A	c.(7984-7986)Cgc>Agc	p.R2662S		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2662					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										TCTGTGTAGCGTCTAGTCCTG	0.602																																																	0													61.0	69.0	66.0					11																	78369429		2118	4253	6371	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.7984C>A	11.37:g.78369429G>T	ENSP00000278550:p.Arg2662Ser		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.R2662S	ENST00000278550.7	37	c.7984	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	G	26.9	4.779947	0.90195	.	.	ENSG00000149256	ENST00000278550	D	0.89810	-2.57	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.94122	0.8115	M	0.72894	2.215	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	D	0.92961	0.6389	9	.	.	.	.	19.769	0.96353	0.0:0.0:1.0:0.0	.	2662	Q6N022	TEN4_HUMAN	S	2662	ENSP00000278550:R2662S	.	R	-	1	0	ODZ4	78047077	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.541000	0.73865	2.906000	0.99361	0.655000	0.94253	CGC	TENM4	-	NULL	ENSG00000149256		0.602	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2	-	0.00	42	0	G			78369429	-1	tier1	-	no_errors	ENST00000278550	ensembl	human	known	74_37	missense	37.14	21	13	SNP	1.000	T
TET1	80312	genome.wustl.edu	37	10	70332885	70332885	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:70332885G>T	ENST00000373644.4	+	2	999	c.790G>T	c.(790-792)Gga>Tga	p.G264*		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	264					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						TACCTCTCAAGGAAACCCCAG	0.428																																																	0													66.0	69.0	68.0					10																	70332885		2203	4300	6503	SO:0001587	stop_gained	0			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.790G>T	10.37:g.70332885G>T	ENSP00000362748:p.Gly264*		Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Nonsense_Mutation	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.G264*	ENST00000373644.4	37	c.790	CCDS7281.1	10	.	.	.	.	.	.	.	.	.	.	G	37	6.427846	0.97559	.	.	ENSG00000138336	ENST00000373644	.	.	.	5.53	0.337	0.15966	.	0.728700	0.11905	N	0.518208	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	0.5256	0.00620	0.224:0.1475:0.3069:0.3216	.	.	.	.	X	264	.	ENSP00000362748:G264X	G	+	1	0	TET1	70002891	0.977000	0.34250	0.789000	0.31954	0.987000	0.75469	0.621000	0.24418	0.493000	0.27837	-0.471000	0.05019	GGA	TET1	-	NULL	ENSG00000138336		0.428	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TET1	HGNC	protein_coding	OTTHUMT00000048354.1		0.00	67	0	G	NM_030625		70332885	+1			no_errors	ENST00000373644	ensembl	human	known	74_37	nonsense	6.06	62	4	SNP	0.986	T
TFAP2A	7020	genome.wustl.edu	37	6	10400783	10400783	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:10400783C>A	ENST00000482890.1	-	7	1275	c.923G>T	c.(922-924)tGc>tTc	p.C308F	TFAP2A_ENST00000379604.2_Missense_Mutation_p.C308F|TFAP2A_ENST00000379608.3_Missense_Mutation_p.C302F|TFAP2A_ENST00000497266.1_5'UTR|TFAP2A_ENST00000319516.4_Missense_Mutation_p.C304F|TFAP2A_ENST00000379613.3_Missense_Mutation_p.C310F			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	308	H-S-H (helix-span-helix), dimerization.				anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				TTCGGTTTCGCACACGTACCC	0.512																																																	0													130.0	116.0	121.0					6																	10400783		2203	4300	6503	SO:0001583	missense	0			X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.923G>T	6.37:g.10400783C>A	ENSP00000418541:p.Cys308Phe		Q13777|Q5TAV5|Q8N1C6	Missense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_C,prints_TF_AP2_alpha_N	p.C308F	ENST00000482890.1	37	c.923	CCDS4510.1	6	.	.	.	.	.	.	.	.	.	.	C	22.6	4.317246	0.81469	.	.	ENSG00000137203	ENST00000379613;ENST00000379604;ENST00000319516;ENST00000379608;ENST00000482890	D;D;D;D;D	0.97279	-4.32;-4.32;-4.32;-4.32;-4.32	5.29	5.29	0.74685	Transcription factor AP-2, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98732	0.9574	M	0.91920	3.255	0.80722	D	1	D;P;D	0.61697	0.966;0.927;0.99	P;P;D	0.69142	0.69;0.596;0.962	D	0.99727	1.1011	10	0.87932	D	0	-7.4764	18.9454	0.92620	0.0:1.0:0.0:0.0	.	304;308;302	Q5TAV5;P05549;Q8N1C6	.;AP2A_HUMAN;.	F	310;308;304;302;308	ENSP00000368933:C310F;ENSP00000368924:C308F;ENSP00000316516:C304F;ENSP00000368928:C302F;ENSP00000418541:C308F	ENSP00000316516:C304F	C	-	2	0	TFAP2A	10508769	1.000000	0.71417	0.998000	0.56505	0.927000	0.56198	7.818000	0.86416	2.463000	0.83235	0.655000	0.94253	TGC	TFAP2A	-	pfam_TF_AP2_C	ENSG00000137203		0.512	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	TFAP2A	HGNC	protein_coding	OTTHUMT00000353619.2	-	0.00	40	0	C	NM_003220		10400783	-1	tier1	-	no_errors	ENST00000379604	ensembl	human	known	74_37	missense	25.58	32	11	SNP	1.000	A
TGFBR1	7046	genome.wustl.edu	37	9	101907161	101907161	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr9:101907161G>A	ENST00000374994.4	+	6	1238	c.1121G>A	c.(1120-1122)gGa>gAa	p.G374E	TGFBR1_ENST00000550253.1_Missense_Mutation_p.G305E|RNA5SP290_ENST00000517133.1_RNA|TGFBR1_ENST00000552516.1_Missense_Mutation_p.G378E|TGFBR1_ENST00000374990.2_Missense_Mutation_p.G297E	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	374	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				CACAGAGTGGGAACAAAAAGG	0.358																																																	0			GRCh37	CM064322	TGFBR1	M							92.0	85.0	87.0					9																	101907161		2203	4300	6503	SO:0001583	missense	0				CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.1121G>A	9.37:g.101907161G>A	ENSP00000364133:p.Gly374Glu		Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,superfamily_Quinolinate_PRibosylTrfase_C,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G374E	ENST00000374994.4	37	c.1121	CCDS6738.1	9	.	.	.	.	.	.	.	.	.	.	G	29.3	4.992406	0.93167	.	.	ENSG00000106799	ENST00000374994;ENST00000540092;ENST00000374990;ENST00000552516;ENST00000550253	T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87	5.73	5.73	0.89815	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.148056	0.64402	D	0.000010	D	0.91978	0.7459	H	0.98027	4.13	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.94280	0.7519	10	0.87932	D	0	.	19.0403	0.92995	0.0:0.0:1.0:0.0	.	297;374	P36897-3;P36897	.;TGFR1_HUMAN	E	374;336;297;378;305	ENSP00000364133:G374E;ENSP00000364129:G297E;ENSP00000447297:G378E;ENSP00000450052:G305E	ENSP00000364129:G297E	G	+	2	0	TGFBR1	100946982	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.796000	0.99103	2.854000	0.98071	0.655000	0.94253	GGA	TGFBR1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000106799		0.358	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR1	HGNC	protein_coding	OTTHUMT00000053390.3	-	0.00	52	0	G			101907161	+1	tier1	-	no_errors	ENST00000374994	ensembl	human	known	74_37	missense	33.87	41	21	SNP	1.000	A
THSD7B	80731	genome.wustl.edu	37	2	138033559	138033559	+	Silent	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:138033559C>A	ENST00000409968.1	+	12	2641	c.2463C>A	c.(2461-2463)ggC>ggA	p.G821G	THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000272643.3_Silent_p.G821G|THSD7B_ENST00000413152.2_Silent_p.G790G			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	821	TSP type-1 10. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		GAATAACGGGCAGCAGTGAAG	0.393																																																	0													93.0	101.0	98.0					2																	138033559		1885	4108	5993	SO:0001819	synonymous_variant	0					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.2463C>A	2.37:g.138033559C>A				Silent	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.G821	ENST00000409968.1	37	c.2463		2																																																																																			THSD7B	-	superfamily_Thrombospondin_1_rpt	ENSG00000144229		0.393	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	-	0.00	68	0	C	XM_046570.9		138033559	+1	tier1	-	no_errors	ENST00000272643	ensembl	human	known	74_37	silent	44.94	49	40	SNP	0.190	A
TJP3	27134	genome.wustl.edu	37	19	3734314	3734314	+	Intron	SNP	T	T	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:3734314T>C	ENST00000541714.2	+	8	1339				TJP3_ENST00000587686.1_Intron|TJP3_ENST00000262968.9_Silent_p.S322S|TJP3_ENST00000382008.3_Silent_p.S303S|TJP3_ENST00000589378.1_Intron|TJP3_ENST00000539908.2_Intron	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3						regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		AGATGTCCTCTCCCCCTGCAG	0.597																																																	0													90.0	78.0	82.0					19																	3734314		2203	4300	6503	SO:0001627	intron_variant	0			AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.878-11T>C	19.37:g.3734314T>C			A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Silent	SNP	pfam_PDZ,pfam_SH3_2,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like,prints_ZonOcculS3,prints_ZonOcculdens	p.S322	ENST00000541714.2	37	c.966	CCDS32873.2	19																																																																																			TJP3	-	NULL	ENSG00000105289		0.597	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP3	HGNC	protein_coding	OTTHUMT00000453434.1	-	0.00	122	0	T			3734314	+1	tier1	-	no_errors	ENST00000262968	ensembl	human	known	74_37	silent	7.81	59	5	SNP	0.000	C
TMA7	51372	genome.wustl.edu	37	3	48482033	48482033	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr3:48482033C>T	ENST00000438607.2	+	3	195	c.155C>T	c.(154-156)cCc>cTc	p.P52L	CCDC51_ENST00000412398.2_5'Flank|RP11-24C3.2_ENST00000438872.1_RNA|CCDC51_ENST00000442740.1_5'Flank|CCDC51_ENST00000447018.1_5'Flank|RP11-24C3.2_ENST00000435578.1_RNA|CCDC51_ENST00000395696.1_5'Flank|CCDC51_ENST00000395694.2_5'Flank	NM_015933.3	NP_057017.1	Q9Y2S6	TMA7_HUMAN	translation machinery associated 7 homolog (S. cerevisiae)	52										lung(1)	1						GGGAAGGGGCCCTTGGGTAAG	0.562																																																	0													15.0	21.0	19.0					3																	48482033		1876	4077	5953	SO:0001583	missense	0			AF077202	CCDS46823.1	3p21.31	2013-02-22	2013-02-22	2012-06-07	ENSG00000232112	ENSG00000232112			26932	protein-coding gene	gene with protein product		615808	"""coiled-coil domain containing 72"""	CCDC72		11042152, 15740594	Standard	NM_015933		Approved	HSPC016	uc003cte.1	Q9Y2S6	OTTHUMG00000156588	ENST00000438607.2:c.155C>T	3.37:g.48482033C>T	ENSP00000397843:p.Pro52Leu		Q9P052	Missense_Mutation	SNP	pfam_TMA7	p.P52L	ENST00000438607.2	37	c.155	CCDS46823.1	3	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957864	0.53400	.	.	ENSG00000232112	ENST00000438607	.	.	.	4.57	4.57	0.56435	.	.	.	.	.	T	0.78323	0.4265	.	.	.	0.80722	D	1	D	0.69078	0.997	D	0.71870	0.975	T	0.81881	-0.0729	7	0.87932	D	0	-5.0187	14.8666	0.70422	0.0:1.0:0.0:0.0	.	52	Q9Y2S6	CCD72_HUMAN	L	52	.	ENSP00000397843:P52L	P	+	2	0	CCDC72	48457037	0.993000	0.37304	1.000000	0.80357	0.880000	0.50808	3.649000	0.54417	2.261000	0.74972	0.462000	0.41574	CCC	TMA7	-	pfam_TMA7	ENSG00000232112		0.562	TMA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMA7	HGNC	protein_coding	OTTHUMT00000344688.1	-	0.00	85	0	C	NM_015933		48482033	+1	tier1	-	no_errors	ENST00000438607	ensembl	human	known	74_37	missense	30.00	28	12	SNP	1.000	T
TMEM101	84336	genome.wustl.edu	37	17	42092301	42092301	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:42092301G>T	ENST00000589334.1	-	2	335	c.20C>A	c.(19-21)tCg>tAg	p.S7*	TMEM101_ENST00000206380.3_Nonsense_Mutation_p.S7*|TMEM101_ENST00000542039.1_Intron|TMEM101_ENST00000587529.1_Nonsense_Mutation_p.S7*			Q96IK0	TM101_HUMAN	transmembrane protein 101	7					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		Breast(137;0.0264)|Prostate(33;0.0861)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CCACCGTCTCGAACCTATCTT	0.612																																																	0													95.0	83.0	87.0					17																	42092301		2203	4300	6503	SO:0001587	stop_gained	0			AK172826	CCDS11474.1	17q21.31	2005-12-16							28653	protein-coding gene	gene with protein product						12761501	Standard	NM_032376		Approved	MGC4251, FLJ23987	uc002ieu.3	Q96IK0		ENST00000589334.1:c.20C>A	17.37:g.42092301G>T	ENSP00000468025:p.Ser7*		B2R9N6	Nonsense_Mutation	SNP	NULL	p.S7*	ENST00000589334.1	37	c.20	CCDS11474.1	17	.	.	.	.	.	.	.	.	.	.	G	36	5.644007	0.96704	.	.	ENSG00000091947	ENST00000206380	.	.	.	5.76	2.46	0.29980	.	0.726789	0.13067	N	0.416425	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-15.9849	14.8278	0.70128	0.0:0.6284:0.3715:0.0	.	.	.	.	X	7	.	ENSP00000206380:S7X	S	-	2	0	TMEM101	39447827	0.988000	0.35896	0.999000	0.59377	0.986000	0.74619	1.158000	0.31737	0.732000	0.32470	-0.282000	0.10007	TCG	TMEM101	-	NULL	ENSG00000091947		0.612	TMEM101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM101	HGNC	protein_coding	OTTHUMT00000457665.1	-	0.00	52	0	G	NM_032376		42092301	-1	tier1	-	no_errors	ENST00000206380	ensembl	human	known	74_37	nonsense	57.69	11	15	SNP	1.000	T
TMEM161A	54929	genome.wustl.edu	37	19	19243553	19243553	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:19243553C>T	ENST00000162044.9	-	4	263	c.199G>A	c.(199-201)Ggc>Agc	p.G67S	TMEM161A_ENST00000587583.2_Missense_Mutation_p.G67S|TMEM161A_ENST00000450333.2_Missense_Mutation_p.G67S|TMEM161A_ENST00000592147.1_5'UTR	NM_017814.2	NP_060284.1	Q9NX61	T161A_HUMAN	transmembrane protein 161A	67					cellular response to oxidative stress (GO:0034599)|cellular response to UV (GO:0034644)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of DNA repair (GO:0045739)|response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(5;1.19e-05)|Epithelial(12;0.0011)			TCACTAAGGCCATTGGCCCAC	0.627																																																	0													72.0	48.0	56.0					19																	19243553		2203	4300	6503	SO:0001583	missense	0			BC005210	CCDS12393.1, CCDS58656.1	19p13.11	2008-02-05				ENSG00000064545			26020	protein-coding gene	gene with protein product						12975309	Standard	NM_017814		Approved	FLJ39645, FLJ20422	uc002nlg.4	Q9NX61		ENST00000162044.9:c.199G>A	19.37:g.19243553C>T	ENSP00000162044:p.Gly67Ser		B3KUE0|G5E9M6|Q7L2Y1	Missense_Mutation	SNP	pfam_Transmembrane_161A/B	p.G67S	ENST00000162044.9	37	c.199	CCDS12393.1	19	.	.	.	.	.	.	.	.	.	.	C	17.54	3.414270	0.62511	.	.	ENSG00000064545	ENST00000450333;ENST00000162044	.	.	.	3.86	2.78	0.32641	.	0.285572	0.38381	N	0.001716	T	0.51958	0.1705	M	0.69823	2.125	0.80722	D	1	P;P;P	0.40431	0.522;0.577;0.717	B;B;B	0.37144	0.109;0.175;0.242	T	0.50276	-0.8847	9	0.36615	T	0.2	.	9.8151	0.40846	0.0:0.8908:0.0:0.1092	.	67;67;67	G5E9M6;B3KUE0;Q9NX61	.;.;T161A_HUMAN	S	67	.	ENSP00000162044:G67S	G	-	1	0	TMEM161A	19104553	0.983000	0.35010	0.833000	0.33012	0.647000	0.38526	3.067000	0.50010	0.701000	0.31803	0.462000	0.41574	GGC	TMEM161A	-	pfam_Transmembrane_161A/B	ENSG00000064545		0.627	TMEM161A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM161A	HGNC	protein_coding	OTTHUMT00000460089.2	-	0.00	55	0	C	NM_017814		19243553	-1	tier1	-	no_errors	ENST00000162044	ensembl	human	known	74_37	missense	34.29	23	12	SNP	1.000	T
TMEM35	59353	genome.wustl.edu	37	X	100349693	100349693	+	Silent	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chrX:100349693G>T	ENST00000372930.4	+	2	535	c.252G>T	c.(250-252)ggG>ggT	p.G84G	TRMT2B-AS1_ENST00000443801.2_RNA|TMEM35_ENST00000478351.1_3'UTR	NM_021637.2	NP_067650.1	Q53FP2	TMM35_HUMAN	transmembrane protein 35	84						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)				NS(1)|large_intestine(3)|liver(1)|skin(1)|urinary_tract(1)	7						TTGTGCCTGGGCGTCCCAAAG	0.537																																																	0													283.0	215.0	238.0					X																	100349693		2203	4300	6503	SO:0001819	synonymous_variant	0			AK024146	CCDS14478.1	Xq22	2008-02-05			ENSG00000126950	ENSG00000126950			25864	protein-coding gene	gene with protein product							Standard	NM_021637		Approved	FLJ14084	uc004egw.3	Q53FP2	OTTHUMG00000022016	ENST00000372930.4:c.252G>T	X.37:g.100349693G>T			Q9H7Y3	Silent	SNP	NULL	p.G84	ENST00000372930.4	37	c.252	CCDS14478.1	X																																																																																			TMEM35	-	NULL	ENSG00000126950		0.537	TMEM35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM35	HGNC	protein_coding	OTTHUMT00000057508.1		0.00	24	0	G	NM_021637		100349693	+1			no_errors	ENST00000372930	ensembl	human	known	74_37	silent	17.39	19	4	SNP	0.383	T
TMEM72	643236	genome.wustl.edu	37	10	45430542	45430542	+	Missense_Mutation	SNP	C	C	T	rs374225789		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:45430542C>T	ENST00000544540.1	+	4	918	c.434C>T	c.(433-435)cCa>cTa	p.P145L	RP11-285G1.9_ENST00000425541.2_lincRNA|TMEM72-AS1_ENST00000450287.2_RNA			A0PK05	TMM72_HUMAN	transmembrane protein 72	263						integral component of membrane (GO:0016021)				breast(2)|kidney(1)|large_intestine(2)|lung(10)	15						CCCCAGGCCCCACTCTTCCTG	0.622																																																	0													62.0	62.0	62.0					10																	45430542		1568	3582	5150	SO:0001583	missense	0			AB235418	CCDS41504.1	10q11.21	2008-10-24	2008-08-21	2008-08-21	ENSG00000187783	ENSG00000187783			31658	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 127"""	C10orf127			Standard	NM_001123376		Approved	bA285G1.3, KSP37	uc001jbn.2	A0PK05	OTTHUMG00000018067	ENST00000544540.1:c.434C>T	10.37:g.45430542C>T	ENSP00000439911:p.Pro145Leu		A1L181|Q5T740	Missense_Mutation	SNP	NULL	p.P145L	ENST00000544540.1	37	c.434		10	.	.	.	.	.	.	.	.	.	.	C	5.402	0.259352	0.10239	.	.	ENSG00000187783	ENST00000389583;ENST00000544540	.	.	.	5.41	4.51	0.55191	.	0.000000	0.49305	D	0.000145	T	0.42154	0.1190	L	0.60455	1.87	0.19575	N	0.999962	B	0.11235	0.004	B	0.11329	0.006	T	0.36939	-0.9727	9	0.46703	T	0.11	-31.6789	8.4333	0.32771	0.0:0.8236:0.0:0.1764	.	263	A0PK05	TMM72_HUMAN	L	263;145	.	ENSP00000374234:P263L	P	+	2	0	TMEM72	44750548	0.008000	0.16893	0.033000	0.17914	0.015000	0.08874	1.198000	0.32223	1.431000	0.47355	0.655000	0.94253	CCA	TMEM72	-	NULL	ENSG00000187783		0.622	TMEM72-201	KNOWN	basic	protein_coding	TMEM72	HGNC	protein_coding		-	0.00	33	0	C	NM_001123376		45430542	+1	tier1	-	no_errors	ENST00000544540	ensembl	human	known	74_37	missense	29.17	17	7	SNP	0.105	T
TP53	7157	genome.wustl.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576						67.0	58.0	61.0					17																	7577120		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R273H	ENST00000269305.4	37	c.818	CCDS11118.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	GMAF=0.0005	0.00	36	0	C	NM_000546		7577120	-1	tier1	rs28934576	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	42.42	19	14	SNP	0.864	T
TPH1	7166	genome.wustl.edu	37	11	18062306	18062306	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:18062306T>A	ENST00000250018.2	-	1	566	c.4A>T	c.(4-6)Att>Ttt	p.I2F	TPH1_ENST00000341556.2_Missense_Mutation_p.I2F	NM_004179.2	NP_004170.1	P17752	TPH1_HUMAN	tryptophan hydroxylase 1	2					aromatic amino acid family metabolic process (GO:0009072)|bone remodeling (GO:0046849)|cellular nitrogen compound metabolic process (GO:0034641)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|mammary gland alveolus development (GO:0060749)|negative regulation of ossification (GO:0030279)|response to immobilization stress (GO:0035902)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(14)|prostate(1)|stomach(1)	25					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	TTGTCTTCAATCATGATGAAT	0.338																																																	0													59.0	56.0	57.0					11																	18062306		2199	4291	6490	SO:0001583	missense	0			X52836	CCDS7829.1	11p15.3-p14	2012-10-02	2008-07-31	2003-04-04	ENSG00000129167	ENSG00000129167	1.14.16.4		12008	protein-coding gene	gene with protein product	"""tryptophan 5-monooxygenase"""	191060	"""tryptophan hydroxylase (tryptophan 5-monooxygenase)"""	TPRH, TPH		1463016	Standard	NM_004179		Approved		uc001mnp.2	P17752	OTTHUMG00000166421	ENST00000250018.2:c.4A>T	11.37:g.18062306T>A	ENSP00000250018:p.Ile2Phe		D3DQX6|O95188|O95189|Q16736|Q3KPG8	Missense_Mutation	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_ACT_dom,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Trp_5_mOase	p.I2F	ENST00000250018.2	37	c.4	CCDS7829.1	11	.	.	.	.	.	.	.	.	.	.	T	19.97	3.925905	0.73327	.	.	ENSG00000129167	ENST00000250018;ENST00000341556;ENST00000528338	D;D;D	0.99656	-6.27;-6.31;-5.03	5.28	5.28	0.74379	.	0.046333	0.85682	D	0.000000	D	0.99266	0.9744	M	0.84433	2.695	0.80722	D	1	P	0.43885	0.82	P	0.45037	0.467	D	0.98994	1.0809	10	0.72032	D	0.01	-9.0253	15.1867	0.73009	0.0:0.0:0.0:1.0	.	2	P17752	TPH1_HUMAN	F	2;2;12	ENSP00000250018:I2F;ENSP00000343550:I2F;ENSP00000436081:I12F	ENSP00000250018:I2F	I	-	1	0	TPH1	18018882	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.107000	0.64603	2.003000	0.58678	0.402000	0.26972	ATT	TPH1	-	pirsf_Tyrosine_3-monooxygenase-like	ENSG00000129167		0.338	TPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPH1	HGNC	protein_coding	OTTHUMT00000389696.1	-	0.00	59	0	T	NM_004179		18062306	-1	tier1	-	no_errors	ENST00000341556	ensembl	human	known	74_37	missense	50.00	40	40	SNP	1.000	A
TRAF3IP1	26146	genome.wustl.edu	37	2	239242647	239242647	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:239242647C>T	ENST00000373327.4	+	7	1256	c.1034C>T	c.(1033-1035)tCa>tTa	p.S345L	TRAF3IP1_ENST00000391993.3_Missense_Mutation_p.S345L|TRAF3IP1_ENST00000391994.2_Missense_Mutation_p.S345L	NM_015650.3	NP_056465.2	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting protein 1	345	DISC1-interaction domain.				cilium assembly (GO:0042384)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic heart tube development (GO:0035050)|intraciliary transport (GO:0042073)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube patterning (GO:0021532)|post-anal tail morphogenesis (GO:0036342)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(2)	23		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)		ACAAAAACATCAAAACGGCGA	0.294																																																	0													57.0	56.0	56.0					2																	239242647		2202	4300	6502	SO:0001583	missense	0			AF230877	CCDS33415.1, CCDS46557.1	2q37.3	2014-02-21			ENSG00000204104	ENSG00000204104		"""Intraflagellar transport homologs"""	17861	protein-coding gene	gene with protein product	"""microtubule interacting protein that associates with TRAF3"""	607380				10791955, 12935900	Standard	NM_015650		Approved	MIP-T3, DKFZP434F124, MIPT3, IFT54	uc002vye.3	Q8TDR0	OTTHUMG00000152872	ENST00000373327.4:c.1034C>T	2.37:g.239242647C>T	ENSP00000362424:p.Ser345Leu		Q6PCT1|Q7L8N9|Q9NRD6|Q9Y4Q1	Missense_Mutation	SNP	NULL	p.S345L	ENST00000373327.4	37	c.1034	CCDS33415.1	2	.	.	.	.	.	.	.	.	.	.	C	6.049	0.377305	0.11466	.	.	ENSG00000204104	ENST00000391993;ENST00000373327;ENST00000391994;ENST00000440998	T;T;T	0.24151	1.87;1.87;1.87	4.55	3.68	0.42216	.	0.740145	0.12835	N	0.435334	T	0.28532	0.0706	M	0.71581	2.175	0.43673	D	0.996109	B;B	0.26258	0.045;0.145	B;B	0.26416	0.006;0.069	T	0.02676	-1.1125	10	0.30854	T	0.27	-1.3718	9.4063	0.38464	0.0:0.8985:0.0:0.1015	.	345;345	Q8TDR0-2;Q8TDR0	.;MIPT3_HUMAN	L	345	ENSP00000375851:S345L;ENSP00000362424:S345L;ENSP00000375852:S345L	ENSP00000362424:S345L	S	+	2	0	TRAF3IP1	238907386	0.272000	0.24172	0.014000	0.15608	0.106000	0.19336	1.477000	0.35431	0.910000	0.36722	0.491000	0.48974	TCA	TRAF3IP1	-	NULL	ENSG00000204104		0.294	TRAF3IP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRAF3IP1	HGNC	protein_coding	OTTHUMT00000328312.1		0.00	75	0	C	NM_015650		239242647	+1			no_errors	ENST00000373327	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.570	T
TRIB3	57761	genome.wustl.edu	37	20	377203	377203	+	Nonsense_Mutation	SNP	C	C	T	rs371072439		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr20:377203C>T	ENST00000217233.3	+	4	1499	c.946C>T	c.(946-948)Cga>Tga	p.R316*	TRIB3_ENST00000422053.2_Nonsense_Mutation_p.R343*	NM_021158.3	NP_066981.2	Q96RU7	TRIB3_HUMAN	tribbles pseudokinase 3	316	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of protein binding (GO:0032092)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|regulation of glucose transport (GO:0010827)|regulation of MAP kinase activity (GO:0043405)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|transcription corepressor activity (GO:0003714)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase regulator activity (GO:0055106)			breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|skin(1)	21		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)		CCCCTGGCTGCGACAGGACCC	0.672																																					Melanoma(101;421 2374 19538)												0								C	stop/ARG	1,4393		0,1,2196	50.0	47.0	48.0		946	3.1	0.2	20		48	0,8582		0,0,4291	no	stop-gained	TRIB3	NM_021158.3		0,1,6487	TT,TC,CC		0.0,0.0228,0.0077		316/359	377203	1,12975	2197	4291	6488	SO:0001587	stop_gained	0			AF250311	CCDS12997.1	20p13-p12.2	2013-10-03	2013-10-03	2004-05-04	ENSG00000101255	ENSG00000101255			16228	protein-coding gene	gene with protein product		607898	"""chromosome 20 open reading frame 97"", ""tribbles homolog 3 (Drosophila)"""	C20orf97		12791994, 16715410	Standard	XM_005260773		Approved	dJ1103G7.3, TRB3	uc002wdm.3	Q96RU7	OTTHUMG00000031627	ENST00000217233.3:c.946C>T	20.37:g.377203C>T	ENSP00000217233:p.Arg316*		Q53GU4|Q53ZW7|Q6I9Y9|Q8TAI6|Q9H5M8|Q9NUD2	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.R343*	ENST00000217233.3	37	c.1027	CCDS12997.1	20	.	.	.	.	.	.	.	.	.	.	C	36	5.964372	0.97151	2.28E-4	0.0	ENSG00000101255	ENST00000217233;ENST00000422053	.	.	.	5.12	3.08	0.35506	.	0.357887	0.20615	N	0.088887	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-13.3492	7.4748	0.27369	0.3833:0.4654:0.1513:0.0	.	.	.	.	X	316;343	.	ENSP00000217233:R316X	R	+	1	2	TRIB3	325203	0.200000	0.23398	0.216000	0.23742	0.298000	0.27526	0.545000	0.23268	0.639000	0.30564	0.650000	0.86243	CGA	TRIB3	-	superfamily_Kinase-like_dom	ENSG00000101255		0.672	TRIB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIB3	HGNC	protein_coding	OTTHUMT00000077441.2	-	0.00	59	0	C	NM_021158		377203	+1	tier1	-	no_errors	ENST00000422053	ensembl	human	known	74_37	nonsense	35.71	18	10	SNP	0.013	T
TRIM66	9866	genome.wustl.edu	37	11	8665968	8665968	+	Intron	SNP	T	T	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:8665968T>G	ENST00000299550.6	-	8	864				TRIM66_ENST00000531498.1_5'UTR|TRIM66_ENST00000402157.2_Intron	NM_014818.1	NP_055633.1	O15016	TRI66_HUMAN	tripartite motif containing 66							aggresome (GO:0016235)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|kidney(1)|lung(1)|skin(2)	9						accctcttattatcacctcct	0.368																																																	0																																										SO:0001627	intron_variant	0			AB002296		11p15.4	2013-01-28	2011-01-25		ENSG00000166436	ENSG00000166436		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"""	29005	protein-coding gene	gene with protein product		612000	"""chromosome 11 open reading frame 29"", ""tripartite motif-containing 66"""	C11orf29		9205841	Standard	NM_014818		Approved	KIAA0298, TIF1D	uc010rbo.2	O15016	OTTHUMG00000150481	ENST00000299550.6:c.670-1295A>C	11.37:g.8665968T>G			Q9BQQ4	RNA	SNP	-	NULL	ENST00000299550.6	37	NULL		11																																																																																			TRIM66	-	-	ENSG00000166436		0.368	TRIM66-201	KNOWN	basic|appris_candidate	protein_coding	TRIM66	HGNC	protein_coding		-	0.00	18	0	T	XM_084529		8665968	-1	tier1	-	no_errors	ENST00000531498	ensembl	human	known	74_37	rna	32.50	27	13	SNP	0.875	G
TRIO	7204	genome.wustl.edu	37	5	14358418	14358418	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:14358418C>T	ENST00000344204.4	+	12	2202	c.2178C>T	c.(2176-2178)aaC>aaT	p.N726N	TRIO_ENST00000537187.1_Silent_p.N726N|TRIO_ENST00000509967.2_Silent_p.N677N	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	726					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					TGACTGTCAACGTGATCAAGG	0.612																																																	0													121.0	97.0	105.0					5																	14358418		2203	4300	6503	SO:0001819	synonymous_variant	0			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.2178C>T	5.37:g.14358418C>T			D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.N726	ENST00000344204.4	37	c.2178	CCDS3883.1	5																																																																																			TRIO	-	smart_Spectrin/alpha-actinin	ENSG00000038382		0.612	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	HGNC	protein_coding	OTTHUMT00000253711.2	-	0.00	60	0	C	NM_007118		14358418	+1	tier1	-	no_errors	ENST00000344204	ensembl	human	known	74_37	silent	29.73	26	11	SNP	1.000	T
TRPM6	140803	genome.wustl.edu	37	9	77397639	77397639	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr9:77397639G>T	ENST00000360774.1	-	22	3287	c.3050C>A	c.(3049-3051)cCa>cAa	p.P1017Q	TRPM6_ENST00000449912.2_Missense_Mutation_p.P1012Q|TRPM6_ENST00000361255.3_Missense_Mutation_p.P1012Q|TRPM6_ENST00000451710.3_Missense_Mutation_p.P1017Q|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.P1017Q|TRPM6_ENST00000376872.3_Intron	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1017					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						CATCCAGTATGGCTCAAATAC	0.453																																																	0			GRCh37	CM071116	TRPM6	M							143.0	122.0	129.0					9																	77397639		2203	4300	6503	SO:0001583	missense	0			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.3050C>A	9.37:g.77397639G>T	ENSP00000354006:p.Pro1017Gln		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.P1017Q	ENST00000360774.1	37	c.3050	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	G	24.0	4.483014	0.84747	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.62498	0.09;0.08;0.09;0.09;0.02	5.92	5.92	0.95590	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.86075	0.5846	H	0.94385	3.53	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.88879	0.3338	10	0.87932	D	0	.	20.3206	0.98668	0.0:0.0:1.0:0.0	.	680;1017;1012	F5H7D1;Q9BX84;Q9BX84-3	.;TRPM6_HUMAN;.	Q	1017;1017;1012;1012;1017;680;680	ENSP00000354006:P1017Q;ENSP00000407341:P1017Q;ENSP00000396672:P1012Q;ENSP00000354962:P1012Q;ENSP00000366060:P1017Q	ENSP00000309693:P680Q	P	-	2	0	TRPM6	76587459	1.000000	0.71417	1.000000	0.80357	0.622000	0.37654	9.808000	0.99193	2.813000	0.96785	0.561000	0.74099	CCA	TRPM6	-	pfam_Ion_trans_dom	ENSG00000119121		0.453	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1		0.00	23	0	G	NM_017662		77397639	-1			no_errors	ENST00000451710	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
TRUB1	142940	genome.wustl.edu	37	10	116735069	116735069	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:116735069G>T	ENST00000298746.3	+	8	1042	c.981G>T	c.(979-981)caG>caT	p.Q327H		NM_139169.4	NP_631908.1	Q8WWH5	TRUB1_HUMAN	TruB pseudouridine (psi) synthase family member 1	327					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			breast(2)|kidney(2)|large_intestine(1)|lung(5)|urinary_tract(2)	12		Colorectal(252;0.09)|Breast(234;0.174)|Lung NSC(174;0.245)		Epithelial(162;0.00879)|all cancers(201;0.0243)		CTAATGAACAGGTTTTGAGCT	0.373																																																	0													106.0	107.0	107.0					10																	116735069		2203	4299	6502	SO:0001583	missense	0			AF448144	CCDS7591.1	10q25.3	2013-09-02	2013-09-02		ENSG00000165832	ENSG00000165832			16060	protein-coding gene	gene with protein product		610726	"""TruB pseudouridine (psi) synthase homolog 1 (E. coli)"""			12736709	Standard	NM_139169		Approved	PUS4	uc001lcd.3	Q8WWH5	OTTHUMG00000019094	ENST00000298746.3:c.981G>T	10.37:g.116735069G>T	ENSP00000298746:p.Gln327His		B2R716|Q53ES2	Missense_Mutation	SNP	pfam_PsdUridine_synth,superfamily_PsdUridine_synth_cat_dom,tigrfam_tRNA_psdUridine_synth_TruB	p.Q327H	ENST00000298746.3	37	c.981	CCDS7591.1	10	.	.	.	.	.	.	.	.	.	.	G	12.18	1.861521	0.32884	.	.	ENSG00000165832	ENST00000298746	T	0.46819	0.86	5.7	0.112	0.14623	Pseudouridine synthase, catalytic domain (1);	0.831321	0.11295	N	0.578859	T	0.32734	0.0839	L	0.44542	1.39	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.34601	-0.9822	10	0.59425	D	0.04	-2.8982	1.0922	0.01665	0.2292:0.1218:0.4034:0.2456	.	327	Q8WWH5	TRUB1_HUMAN	H	327	ENSP00000298746:Q327H	ENSP00000298746:Q327H	Q	+	3	2	TRUB1	116725059	0.108000	0.22018	0.206000	0.23566	0.995000	0.86356	0.228000	0.17814	0.346000	0.23899	0.655000	0.94253	CAG	TRUB1	-	superfamily_PsdUridine_synth_cat_dom	ENSG00000165832		0.373	TRUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRUB1	HGNC	protein_coding	OTTHUMT00000050504.1		0.00	19	0	G	NM_139169		116735069	+1			no_errors	ENST00000298746	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.046	T
TSHZ3	57616	genome.wustl.edu	37	19	31770039	31770039	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:31770039G>A	ENST00000240587.4	-	2	987	c.660C>T	c.(658-660)agC>agT	p.S220S		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	220					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					CGTAGGCAGCGCTGCAGTCCT	0.597																																																	0													135.0	123.0	127.0					19																	31770039		2203	4300	6503	SO:0001819	synonymous_variant	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.660C>T	19.37:g.31770039G>A			Q9H0G6|Q9P254	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.S220	ENST00000240587.4	37	c.660	CCDS12421.2	19																																																																																			TSHZ3	-	smart_Znf_C2H2-like	ENSG00000121297		0.597	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	-	0.00	84	0	G	NM_020856		31770039	-1	tier1	-	no_errors	ENST00000240587	ensembl	human	known	74_37	silent	31.11	31	14	SNP	0.997	A
TSLP	85480	genome.wustl.edu	37	5	110411672	110411672	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:110411672G>T	ENST00000344895.3	+	4	579	c.380G>T	c.(379-381)aGg>aTg	p.R127M	TSLP_ENST00000420978.2_Missense_Mutation_p.R127M|TSLP_ENST00000379706.4_Missense_Mutation_p.R31M|CTC-551A13.2_ENST00000507269.3_RNA	NM_033035.4	NP_149024.1	Q969D9	TSLP_HUMAN	thymic stromal lymphopoietin	127						extracellular space (GO:0005615)				breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	11		all_cancers(142;2.72e-05)|all_epithelial(76;4.39e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0417)|Ovarian(225;0.0443)|Colorectal(57;0.0464)|all_lung(232;0.0507)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.24e-08)|Epithelial(69;1.54e-07)|all cancers(49;1.73e-05)|COAD - Colon adenocarcinoma(37;0.109)		ATGAAGAAGAGGAGAAAAAGG	0.353																																																	0													109.0	108.0	108.0					5																	110411672		2202	4300	6502	SO:0001583	missense	0			BC040592	CCDS4101.1	5q22.1	2007-08-24			ENSG00000145777	ENSG00000145777			30743	protein-coding gene	gene with protein product		607003				11418668, 11480573	Standard	NM_033035		Approved		uc003kpb.2	Q969D9	OTTHUMG00000128791	ENST00000344895.3:c.380G>T	5.37:g.110411672G>T	ENSP00000339804:p.Arg127Met		Q8IW99	Missense_Mutation	SNP	NULL	p.R127M	ENST00000344895.3	37	c.380	CCDS4101.1	5	.	.	.	.	.	.	.	.	.	.	G	7.973	0.749474	0.15778	.	.	ENSG00000145777	ENST00000420978;ENST00000344895;ENST00000379706	.	.	.	3.29	-1.05	0.10036	.	1.199990	0.06299	N	0.700572	T	0.32556	0.0833	N	0.19112	0.55	0.09310	N	1	D	0.53745	0.962	P	0.51550	0.673	T	0.36601	-0.9741	9	0.72032	D	0.01	-1.4043	7.7886	0.29106	0.0:0.5153:0.3094:0.1753	.	127	Q969D9	TSLP_HUMAN	M	127;127;31	.	ENSP00000339804:R127M	R	+	2	0	TSLP	110439571	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.115000	0.15540	-0.236000	0.09753	-0.951000	0.02657	AGG	TSLP	-	NULL	ENSG00000145777		0.353	TSLP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSLP	HGNC	protein_coding	OTTHUMT00000250717.1	-	0.00	28	0	G	NM_033035		110411672	+1	tier1	-	no_errors	ENST00000344895	ensembl	human	known	74_37	missense	51.35	18	19	SNP	0.000	T
TSSC2	650368	genome.wustl.edu	37	11	3423919	3423919	+	RNA	SNP	C	C	G	rs2412182	byFrequency	TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:3423919C>G	ENST00000529482.1	+	0	763									tumor suppressing subtransferable candidate 2 pseudogene																		TGCGCCTCCGCGAGCGGCCAG	0.627																																																	0																																												0					11p15.4	2014-06-05	2008-06-30		ENSG00000223756	ENSG00000223756			12384	pseudogene	pseudogene	"""tumor-supressing STF cDNA 2"", ""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase) (ALG1) pseudogene"""	608999	"""tumor suppressing subtransferable candidate 2"""			9403053	Standard	NR_024248		Approved				OTTHUMG00000011705		11.37:g.3423919C>G				RNA	SNP	-	NULL	ENST00000529482.1	37	NULL		11																																																																																			TSSC2	-	-	ENSG00000223756		0.627	TSSC2-003	KNOWN	basic	processed_transcript	TSSC2	HGNC	pseudogene	OTTHUMT00000392020.1	-	0.00	147	0	C			3423919	+1	tier1	-	no_errors	ENST00000529482	ensembl	human	known	74_37	rna	38.16	47	29	SNP	0.005	G
NGRN	51335	genome.wustl.edu	37	15	90807287	90807288	+	5'Flank	DNP	AG	AG	TC			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A|G	A|G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:90807287_90807288AG>TC	ENST00000379095.3	+	0	0				RP11-697E2.6_ENST00000561573.1_3'UTR|TTLL13_ENST00000438251.1_Silent_p.S733S	NM_001033088.1	NP_001028260.2	Q9NPE2	NGRN_HUMAN	neugrin, neurite outgrowth associated						neuron differentiation (GO:0030182)	extracellular region (GO:0005576)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			CAGGCTCACTAGCCGTAAGTAT	0.45																																																	0																																										SO:0001631	upstream_gene_variant	0			AB029315	CCDS32329.1	15q26.1	2008-02-05			ENSG00000182768	ENSG00000182768			18077	protein-coding gene	gene with protein product						11118320	Standard	NR_028052		Approved	DSC92	uc002bpf.1	Q9NPE2	OTTHUMG00000149807	Exception_encountered	15.37:g.90807287_90807288delinsTC	Exception_encountered		B2R6M8|Q4V9L7|Q9HBL4	Missense_Mutation	SNP	pfam_TTL/TTLL_fam	p.S733C|p.S733T	ENST00000379095.3	37	c.2197|c.2198	CCDS32329.1	15																																																																																			TTLL13	-	NULL	ENSG00000213471		0.450	NGRN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL13	HGNC	protein_coding	OTTHUMT00000313418.1	-	0.00	54|53	0	A|G			90807287|90807288	+1	tier1	-	no_errors	ENST00000438251	ensembl	human	known	74_37	missense	37.50|34.55	35|36	21|19	SNP	0.328|0.843	T|C
TTN	7273	genome.wustl.edu	37	2	179527477	179527478	+	Intron	INS	-	-	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:179527477_179527478insT	ENST00000591111.1	-	154	34489				TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Intron|TTN_ENST00000589042.1_Frame_Shift_Ins_p.P12285fs|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGGCTTCCGGTTTTTTGGGCA	0.386																																																	0																																										SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34265-3956->A	2.37:g.179527483_179527483dupT			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Ins	INS	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_PPAK_motif,pfam_Titin_Z,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,superfamily_ARM-type_fold,superfamily_P-loop_NTPase,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P12284fs	ENST00000591111.1	37	c.36853_36852		2																																																																																			TTN	-	pfam_PPAK_motif,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.386	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	24	0	0	NM_133378		179527478	-1			no_errors	ENST00000589042	ensembl	human	putative	74_37	frame_shift_ins	23.81	16	5	INS	0.016:0.007	T
TTN	7273	genome.wustl.edu	37	2	179540447	179540447	+	Intron	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:179540447C>A	ENST00000591111.1	-	145	33640				TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.K11496N|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGGGACCTTCTTTTCTGGCT	0.423																																																	0																																										SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.33415+200G>T	2.37:g.179540447C>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_PPAK_motif,pfam_Titin_Z,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,superfamily_ARM-type_fold,superfamily_P-loop_NTPase,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K11496N	ENST00000591111.1	37	c.34488		2																																																																																			TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	25	0	C	NM_133378		179540447	-1	tier1	-	no_errors	ENST00000589042	ensembl	human	putative	74_37	missense	38.71	19	12	SNP	1.000	A
TUBB	203068	genome.wustl.edu	37	6	30690400	30690401	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:30690400_30690401delTG	ENST00000327892.8	+	2	450_451	c.144_145delTG	c.(142-147)tctgtgfs	p.V49fs	TUBB_ENST00000396389.1_Frame_Shift_Del_p.V31fs|TUBB_ENST00000435534.1_Frame_Shift_Del_p.V49fs|TUBB_ENST00000330914.3_5'UTR|TUBB_ENST00000396384.1_5'UTR|XXbac-BPG252P9.9_ENST00000607476.1_RNA	NM_178014.2	NP_821133.1	P07437	TBB5_HUMAN	tubulin, beta class I	49					cell division (GO:0051301)|cellular component movement (GO:0006928)|cellular process (GO:0009987)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cell body (GO:0044297)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nuclear envelope lumen (GO:0005641)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(1)|endometrium(1)|kidney(8)|large_intestine(3)|lung(1)|ovary(1)|urinary_tract(1)	16					Colchicine(DB01394)|Podofilox(DB01179)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)	ACCGCATCTCTGTGTACTACAA	0.594																																																	0																																										SO:0001589	frameshift_variant	0			AB062393	CCDS4687.1	6p21.33	2011-10-10	2011-10-10		ENSG00000196230	ENSG00000196230		"""Tubulins"""	20778	protein-coding gene	gene with protein product	"""class I beta-tubulin"", ""beta1-tubulin"""	191130	"""tubulin, beta polypeptide"", ""tubulin, beta"""			11504633, 8270253	Standard	NM_001293212		Approved	OK/SW-cl.56, MGC16435, M40, Tubb5	uc003nrl.3	P07437	OTTHUMG00000031059	ENST00000327892.8:c.144_145delTG	6.37:g.30690402_30690403delTG	ENSP00000339001:p.Val49fs		P05218|Q8WUC1|Q9CY33	Frame_Shift_Del	DEL	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.Y50fs	ENST00000327892.8	37	c.144_145	CCDS4687.1	6																																																																																			TUBB	-	pfam_Tubulin_FtsZ_GTPase,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Beta_tubulin	ENSG00000196230		0.594	TUBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB	HGNC	protein_coding	OTTHUMT00000076074.2		0.00	106	0	TG	NM_178014		30690401	+1	tier1		no_errors	ENST00000327892	ensembl	human	known	74_37	frame_shift_del	39.73	44	29	DEL	0.999:1.000	-
TULP3	7289	genome.wustl.edu	37	12	3000140	3000140	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:3000140T>G	ENST00000448120.2	+	1	78	c.27T>G	c.(25-27)agT>agG	p.S9R	TULP3_ENST00000397132.2_Missense_Mutation_p.S9R	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	9					anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)			endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			GCCGGCTCAGTCCCAGCGGCG	0.711																																																	0													24.0	25.0	25.0					12																	3000140		2194	4298	6492	SO:0001583	missense	0			AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.27T>G	12.37:g.3000140T>G	ENSP00000410051:p.Ser9Arg		B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Missense_Mutation	SNP	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_C,prints_Tubby_N	p.S9R	ENST00000448120.2	37	c.27	CCDS8519.1	12	.	.	.	.	.	.	.	.	.	.	T	11.07	1.531412	0.27387	.	.	ENSG00000078246	ENST00000228245;ENST00000448120;ENST00000397132	D;D	0.92647	-3.0;-3.08	4.84	-7.46	0.01369	.	1.344630	0.04809	N	0.434862	T	0.80259	0.4590	N	0.14661	0.345	0.21445	N	0.999685	B;B	0.19583	0.037;0.018	B;B	0.15484	0.006;0.013	T	0.67213	-0.5727	10	0.52906	T	0.07	-9.3178	2.658	0.05018	0.1729:0.1145:0.47:0.2425	.	9;9	O75386;F8WBZ9	TULP3_HUMAN;.	R	9	ENSP00000410051:S9R;ENSP00000380321:S9R	ENSP00000228245:S9R	S	+	3	2	TULP3	2870401	0.000000	0.05858	0.000000	0.03702	0.125000	0.20455	-1.128000	0.03247	-1.554000	0.01700	-0.527000	0.04329	AGT	TULP3	-	NULL	ENSG00000078246		0.711	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TULP3	HGNC	protein_coding	OTTHUMT00000398468.1	-	0.00	142	0	T	NM_003324		3000140	+1	tier1	-	no_errors	ENST00000448120	ensembl	human	known	74_37	missense	23.26	33	10	SNP	0.002	G
TYR	7299	genome.wustl.edu	37	11	88961100	88961100	+	Missense_Mutation	SNP	C	C	A	rs104894315		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:88961100C>A	ENST00000263321.5	+	3	1648	c.1146C>A	c.(1144-1146)aaC>aaA	p.N382K		NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	382			N -> K (in OCA1A).		cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	GATCTGCCAACGATCCTATCT	0.423																																																	0			GRCh37	CM920696	TYR	M	rs104894315						184.0	152.0	163.0					11																	88961100		2201	4298	6499	SO:0001583	missense	0			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.1146C>A	11.37:g.88961100C>A	ENSP00000263321:p.Asn382Lys		Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.N382K	ENST00000263321.5	37	c.1146	CCDS8284.1	11	.	.	.	.	.	.	.	.	.	.	C	19.84	3.901653	0.72754	.	.	ENSG00000077498	ENST00000263321	D	0.99014	-5.33	5.38	-8.43	0.00953	Tyrosinase (2);Uncharacterised domain, di-copper centre (2);	0.000000	0.85682	D	0.000000	D	0.98887	0.9623	M	0.84433	2.695	0.58432	A	0.999991	D	0.89917	1.0	D	0.87578	0.998	D	0.99959	1.1683	8	.	.	.	.	14.654	0.68820	0.0:0.3954:0.0:0.6046	rs62645910	382	P14679	TYRO_HUMAN	K	382	ENSP00000263321:N382K	.	N	+	3	2	TYR	88600748	0.002000	0.14202	0.804000	0.32291	0.961000	0.63080	-1.437000	0.02419	-1.452000	0.01931	-0.290000	0.09829	AAC	TYR	-	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	ENSG00000077498		0.423	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYR	HGNC	protein_coding	OTTHUMT00000394045.2	-	0.00	51	0	C	NM_000372		88961100	+1	tier1	rs62645910	no_errors	ENST00000263321	ensembl	human	known	74_37	missense	37.50	35	21	SNP	0.882	A
UBR3	130507	genome.wustl.edu	37	2	170806482	170806482	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:170806482G>A	ENST00000272793.5	+	23	3502	c.3452G>A	c.(3451-3453)cGc>cAc	p.R1151H	UBR3_ENST00000418381.1_Missense_Mutation_p.R1151H			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1151					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						ATGAACAAACGCATCATTGAA	0.373																																																	0													75.0	76.0	76.0					2																	170806482		2203	4300	6503	SO:0001583	missense	0			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.3452G>A	2.37:g.170806482G>A	ENSP00000272793:p.Arg1151His		B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	pfam_Znf_N-recognin,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.R1151H	ENST00000272793.5	37	c.3452		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.05|17.05	3.289999|3.289999	0.59976|0.59976	.|.	.|.	ENSG00000144357|ENSG00000144357	ENST00000392632|ENST00000272793;ENST00000442603;ENST00000418381	.|T;T	.|0.55930	.|0.49;0.49	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	.|0.054812	.|0.85682	.|D	.|0.000000	T|T	0.40247|0.40247	0.1109|0.1109	L|L	0.38175|0.38175	1.15|1.15	0.80722|0.80722	D|D	1|1	.|B;B	.|0.16396	.|0.017;0.007	.|B;B	.|0.10450	.|0.005;0.003	T|T	0.21075|0.21075	-1.0256|-1.0256	5|10	.|0.21540	.|T	.|0.41	.|.	10.2995|10.2995	0.43644|0.43644	0.1452:0.0:0.8548:0.0|0.1452:0.0:0.8548:0.0	.|.	.|1151;1151	.|Q6ZT12;E7EVK3	.|UBR3_HUMAN;.	T|H	209|1151	.|ENSP00000272793:R1151H;ENSP00000396068:R1151H	.|ENSP00000272793:R1151H	A|R	+|+	1|2	0|0	UBR3|UBR3	170514728|170514728	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	6.614000|6.614000	0.74197|0.74197	2.712000|2.712000	0.92718|0.92718	0.650000|0.650000	0.86243|0.86243	GCA|CGC	UBR3	-	NULL	ENSG00000144357		0.373	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	UBR3	HGNC	protein_coding	OTTHUMT00000255290.2	-	0.00	36	0	G	NM_172070		170806482	+1	tier1	-	no_errors	ENST00000272793	ensembl	human	known	74_37	missense	26.83	30	11	SNP	1.000	A
UGT3A1	133688	genome.wustl.edu	37	5	35954387	35954387	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:35954387G>T	ENST00000274278.3	-	7	1846	c.1489C>A	c.(1489-1491)Ctg>Atg	p.L497M	UGT3A1_ENST00000513233.1_5'Flank	NM_152404.3	NP_689617.3	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	497						integral component of membrane (GO:0016021)|UDP-N-acetylglucosamine transferase complex (GO:0043541)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|skin(4)	46	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATAGTGCCCAGAGTGAGCCCC	0.587																																																	0													101.0	76.0	84.0					5																	35954387		2203	4300	6503	SO:0001583	missense	0				CCDS3913.1, CCDS54841.1	5p13.2	2014-05-20			ENSG00000145626	ENSG00000145626		"""UDP glucuronosyltransferases"""	26625	protein-coding gene	gene with protein product							Standard	NM_152404		Approved	FLJ34658	uc003jjv.2	Q6NUS8	OTTHUMG00000131107	ENST00000274278.3:c.1489C>A	5.37:g.35954387G>T	ENSP00000274278:p.Leu497Met		G5E961|Q8IYS9|Q8NAW4|Q96DM6	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.L497M	ENST00000274278.3	37	c.1489	CCDS3913.1	5	.	.	.	.	.	.	.	.	.	.	.	6.652	0.488781	0.12641	.	.	ENSG00000145626	ENST00000274278	T	0.62364	0.03	3.88	0.94	0.19513	.	401.830000	0.00166	U	0.000011	T	0.80964	0.4725	M	0.88570	2.965	0.09310	N	0.999999	D	0.69078	0.997	D	0.73708	0.981	T	0.50171	-0.8859	10	0.41790	T	0.15	.	5.741	0.18094	0.1789:0.3037:0.5174:0.0	.	497	Q6NUS8	UD3A1_HUMAN	M	497	ENSP00000274278:L497M	ENSP00000274278:L497M	L	-	1	2	UGT3A1	35990144	0.837000	0.29446	0.104000	0.21259	0.020000	0.10135	0.842000	0.27627	0.040000	0.15660	-0.474000	0.04947	CTG	UGT3A1	-	pfam_UDP_glucos_trans	ENSG00000145626		0.587	UGT3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT3A1	HGNC	protein_coding	OTTHUMT00000253770.2		0.00	83	0	G	NM_152404		35954387	-1			no_errors	ENST00000274278	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.041	T
UNC45B	146862	genome.wustl.edu	37	17	33481676	33481676	+	Silent	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr17:33481676G>A	ENST00000268876.5	+	6	652	c.555G>A	c.(553-555)ctG>ctA	p.L185L	UNC45B_ENST00000394570.2_Silent_p.L185L|UNC45B_ENST00000591048.1_Silent_p.L185L|UNC45B_ENST00000378449.1_Silent_p.L185L|UNC45B_ENST00000433649.1_Silent_p.L185L	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	185					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				CCTTGCTACTGCAGCTTCTGG	0.582																																																	0													92.0	79.0	84.0					17																	33481676		2203	4300	6503	SO:0001819	synonymous_variant	0			AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.555G>A	17.37:g.33481676G>A			Q495Q8|Q495Q9	Silent	SNP	pfam_UNC-45/Ring3,superfamily_ARM-type_fold,smart_TPR_repeat,smart_Armadillo,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L185	ENST00000268876.5	37	c.555	CCDS11292.1	17																																																																																			UNC45B	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000141161		0.582	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UNC45B	HGNC	protein_coding	OTTHUMT00000256458.2		0.00	69	0	G	NM_173167		33481676	+1			no_errors	ENST00000268876	ensembl	human	known	74_37	silent	6.45	29	2	SNP	1.000	A
USHBP1	83878	genome.wustl.edu	37	19	17367447	17367447	+	Missense_Mutation	SNP	G	G	T	rs201299465		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:17367447G>T	ENST00000252597.3	-	9	1476	c.1303C>A	c.(1303-1305)Cgc>Agc	p.R435S	USHBP1_ENST00000431146.2_Missense_Mutation_p.R371S|AC010646.3_ENST00000594059.1_5'Flank	NM_031941.3	NP_114147.2			Usher syndrome 1C binding protein 1									p.R435C(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(10)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44						AGAGAACGGCGCTCCTGGAGA	0.577																																																	1	Substitution - Missense(1)	large_intestine(1)											68.0	68.0	68.0					19																	17367447		2203	4300	6503	SO:0001583	missense	0			AK096028	CCDS12353.1	19p13.11	2013-06-10			ENSG00000130307	ENSG00000130307			24058	protein-coding gene	gene with protein product		611810				11311560	Standard	XM_005260093		Approved	MCC2, AIEBP, FLJ38709	uc002nfs.1	Q8N6Y0	OTTHUMG00000182730	ENST00000252597.3:c.1303C>A	19.37:g.17367447G>T	ENSP00000252597:p.Arg435Ser			Missense_Mutation	SNP	pfam_USH1C-bd_PDZ_domain	p.R435S	ENST00000252597.3	37	c.1303	CCDS12353.1	19	.	.	.	.	.	.	.	.	.	.	G	12.43	1.936310	0.34189	.	.	ENSG00000130307	ENST00000252597;ENST00000431146	T;T	0.18810	2.2;2.19	4.9	3.86	0.44501	.	0.439796	0.22930	N	0.053915	T	0.22475	0.0542	M	0.64997	1.995	0.53005	D	0.99996	P;P	0.43024	0.798;0.798	B;B	0.42738	0.324;0.396	T	0.03130	-1.1069	10	0.19147	T	0.46	-8.4245	9.2958	0.37815	0.1005:0.0:0.8995:0.0	.	371;435	B4DUE8;Q8N6Y0	.;USBP1_HUMAN	S	435;371	ENSP00000252597:R435S;ENSP00000407902:R371S	ENSP00000252597:R435S	R	-	1	0	USHBP1	17228447	0.006000	0.16342	0.919000	0.36401	0.428000	0.31595	1.392000	0.34486	1.069000	0.40788	0.655000	0.94253	CGC	USHBP1	-	NULL	ENSG00000130307		0.577	USHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USHBP1	HGNC	protein_coding	OTTHUMT00000463328.1		0.00	24	0	G	NM_031941		17367447	-1			no_errors	ENST00000252597	ensembl	human	known	74_37	missense	8.70	21	2	SNP	0.701	T
USP28	57646	genome.wustl.edu	37	11	113700044	113700044	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr11:113700044T>C	ENST00000003302.4	-	10	1002	c.934A>G	c.(934-936)Acc>Gcc	p.T312A	USP28_ENST00000260188.5_Missense_Mutation_p.T312A|USP28_ENST00000537706.1_Missense_Mutation_p.T312A|USP28_ENST00000544967.1_Missense_Mutation_p.T20A|USP28_ENST00000545540.1_Missense_Mutation_p.T187A|USP28_ENST00000542033.1_5'Flank	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	312	USP.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		TGGCCGAAGGTCTCATTGTTA	0.453																																					Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)												0													147.0	134.0	138.0					11																	113700044		2201	4296	6497	SO:0001583	missense	0			AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.934A>G	11.37:g.113700044T>C	ENSP00000003302:p.Thr312Ala		B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_UBA-like,pfscan_Peptidase_C19/C67	p.T312A	ENST00000003302.4	37	c.934	CCDS31680.1	11	.	.	.	.	.	.	.	.	.	.	T	19.06	3.754482	0.69648	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000544967;ENST00000545540;ENST00000538475;ENST00000537706;ENST00000537642	T;T;T;T;T;T;T	0.74315	1.41;1.41;0.86;1.41;0.92;-0.83;3.41	5.36	5.36	0.76844	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.110606	0.64402	D	0.000007	T	0.76248	0.3961	L	0.39514	1.22	0.42876	D	0.994155	P;P;P;D	0.61080	0.843;0.771;0.592;0.989	P;P;P;P	0.57776	0.462;0.549;0.579;0.827	T	0.72268	-0.4343	10	0.15499	T	0.54	-18.022	15.3591	0.74457	0.0:0.0:0.0:1.0	.	187;312;312;20	B4E3L3;Q6NZX9;Q96RU2;G3V1N5	.;.;UBP28_HUMAN;.	A	312;312;20;187;76;312;211	ENSP00000003302:T312A;ENSP00000260188:T312A;ENSP00000442431:T20A;ENSP00000444991:T187A;ENSP00000442257:T76A;ENSP00000445743:T312A;ENSP00000440799:T211A	ENSP00000003302:T312A	T	-	1	0	USP28	113205254	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	3.319000	0.51983	2.020000	0.59435	0.379000	0.24179	ACC	USP28	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000048028		0.453	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP28	HGNC	protein_coding	OTTHUMT00000398789.1	-	0.00	74	0	T			113700044	-1	tier1	-	no_errors	ENST00000003302	ensembl	human	known	74_37	missense	26.76	52	19	SNP	1.000	C
USP31	57478	genome.wustl.edu	37	16	23091494	23091494	+	Splice_Site	SNP	T	T	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:23091494T>G	ENST00000219689.7	-	13	1950		c.e13-2			NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31						ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		GTCTCCTTCCTGTTGCAAGAA	0.478																																																	0													81.0	77.0	79.0					16																	23091494		2197	4300	6497	SO:0001630	splice_region_variant	0			AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.1951-2A>C	16.37:g.23091494T>G			B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Splice_Site	SNP	-	e13-2	ENST00000219689.7	37	c.1951-2	CCDS10607.1	16	.	.	.	.	.	.	.	.	.	.	T	21.2	4.111069	0.77210	.	.	ENSG00000103404	ENST00000219689	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9063	0.63839	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	USP31	22998995	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.336000	0.79245	1.878000	0.54408	0.455000	0.32223	.	USP31	-	-	ENSG00000103404		0.478	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP31	HGNC	protein_coding	OTTHUMT00000211607.1	-	0.00	21	0	T	NM_020718	Intron	23091494	-1	tier1	-	no_errors	ENST00000219689	ensembl	human	known	74_37	splice_site	33.33	24	12	SNP	1.000	G
UTP23	84294	genome.wustl.edu	37	8	117778864	117778864	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr8:117778864C>T	ENST00000309822.2	+	1	123	c.22C>T	c.(22-24)Cat>Tat	p.H8Y	UTP23_ENST00000357148.3_Missense_Mutation_p.H8Y|UTP23_ENST00000517820.1_Missense_Mutation_p.H8Y|EIF3H_ENST00000276682.4_5'Flank	NM_032334.2	NP_115710.2	Q9BRU9	UTP23_HUMAN	UTP23, small subunit (SSU) processome component, homolog (yeast)	8					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	12						AAGGCAGAAACATGCCAAGAA	0.607											OREG0018934	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													50.0	48.0	49.0					8																	117778864		2203	4300	6503	SO:0001583	missense	0				CCDS6320.1	8q24.11	2008-06-12	2008-06-12	2008-06-12		ENSG00000147679			28224	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 53"""	C8orf53		16769905	Standard	NM_032334		Approved	MGC14595	uc003yoc.3	Q9BRU9		ENST00000309822.2:c.22C>T	8.37:g.117778864C>T	ENSP00000308332:p.His8Tyr	1483	B2RE25|Q96NJ8	Missense_Mutation	SNP	pfam_Fcf1/Utp23	p.H8Y	ENST00000309822.2	37	c.22	CCDS6320.1	8	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918334	0.92249	.	.	ENSG00000147679	ENST00000309822;ENST00000357148;ENST00000517814;ENST00000517820	T	0.22336	1.96	5.45	5.45	0.79879	.	0.092655	0.85682	D	0.000000	T	0.29524	0.0736	L	0.50333	1.59	0.80722	D	1	D	0.54601	0.967	P	0.46629	0.522	T	0.01316	-1.1387	10	0.54805	T	0.06	-26.9539	19.4672	0.94948	0.0:1.0:0.0:0.0	.	8	Q9BRU9	UTP23_HUMAN	Y	8	ENSP00000308332:H8Y	ENSP00000308332:H8Y	H	+	1	0	UTP23	117848045	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.975000	0.76128	2.833000	0.97629	0.585000	0.79938	CAT	UTP23	-	NULL	ENSG00000147679		0.607	UTP23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP23	HGNC	protein_coding	OTTHUMT00000381173.1	-	0.00	50	0	C	NM_032334		117778864	+1	tier1	-	no_errors	ENST00000309822	ensembl	human	known	74_37	missense	12.96	47	7	SNP	1.000	T
UTRN	7402	genome.wustl.edu	37	6	145124230	145124230	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:145124230C>T	ENST00000367545.3	+	64	9304	c.9304C>T	c.(9304-9306)Cga>Tga	p.R3102*	UTRN_ENST00000367526.4_Nonsense_Mutation_p.R657*	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	3102	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		CTTTTCGGGTCGAACAGCAAA	0.343																																																	0													114.0	109.0	110.0					6																	145124230		2203	4300	6503	SO:0001587	stop_gained	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.9304C>T	6.37:g.145124230C>T	ENSP00000356515:p.Arg3102*		Q5SYY1|Q5SZ57|Q9UJ40	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.R3102*	ENST00000367545.3	37	c.9304	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	C	36	5.709222	0.96821	.	.	ENSG00000152818	ENST00000367545;ENST00000367526;ENST00000545166;ENST00000432686;ENST00000417142;ENST00000455022	.	.	.	5.63	4.74	0.60224	.	0.000000	0.40469	N	0.001084	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3047	0.60345	0.2969:0.7031:0.0:0.0	.	.	.	.	X	3102;657;61;61;61;27	.	ENSP00000356496:R657X	R	+	1	2	UTRN	145165923	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.820000	0.55693	1.327000	0.45338	0.655000	0.94253	CGA	UTRN	-	pfam_Znf_ZZ,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_Znf_ZZ	ENSG00000152818		0.343	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	-	0.00	44	0	C			145124230	+1	tier1	-	no_errors	ENST00000367545	ensembl	human	known	74_37	nonsense	48.45	50	47	SNP	1.000	T
VCAN	1462	genome.wustl.edu	37	5	82816578	82816578	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr5:82816578C>A	ENST00000265077.3	+	7	3018	c.2453C>A	c.(2452-2454)aCa>aAa	p.T818K	VCAN_ENST00000342785.4_Missense_Mutation_p.T818K|VCAN_ENST00000343200.5_Intron|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000512590.2_Missense_Mutation_p.T770K	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	818	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TTAGAGTCTACAGAACCTTCA	0.438																																																	0													107.0	106.0	107.0					5																	82816578		2203	4300	6503	SO:0001583	missense	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.2453C>A	5.37:g.82816578C>A	ENSP00000265077:p.Thr818Lys		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EG-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Link,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.T818K	ENST00000265077.3	37	c.2453	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	C	11.12	1.546522	0.27652	.	.	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	T;T;T	0.35973	1.28;1.28;1.28	6.06	4.28	0.50868	.	0.417886	0.23173	N	0.051113	T	0.55321	0.1913	M	0.69823	2.125	0.31163	N	0.70406	D;D	0.89917	1.0;1.0	D;D	0.71870	0.975;0.963	T	0.62072	-0.6931	10	0.66056	D	0.02	.	10.1352	0.42701	0.0:0.8481:0.0:0.1519	.	818;818	P13611-3;P13611	.;CSPG2_HUMAN	K	818;818;770	ENSP00000265077:T818K;ENSP00000342768:T818K;ENSP00000425959:T770K	ENSP00000265077:T818K	T	+	2	0	VCAN	82852334	0.969000	0.33509	0.786000	0.31890	0.026000	0.11368	0.992000	0.29667	1.575000	0.49775	-0.157000	0.13467	ACA	VCAN	-	NULL	ENSG00000038427		0.438	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	-	0.00	31	0	C	NM_004385		82816578	+1	tier1	-	no_errors	ENST00000265077	ensembl	human	known	74_37	missense	28.95	27	11	SNP	0.894	A
VWF	7450	genome.wustl.edu	37	12	6132813	6132813	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr12:6132813C>T	ENST00000261405.5	-	25	3617	c.3363G>A	c.(3361-3363)agG>agA	p.R1121R		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1121					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	ATGTGGCCGTCCTCCAGGTCA	0.587																																																	0													71.0	63.0	66.0					12																	6132813		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.3363G>A	12.37:g.6132813C>T			Q8TCE8|Q99806	Silent	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.R1121	ENST00000261405.5	37	c.3363	CCDS8539.1	12																																																																																			VWF	-	pirsf_VWF,pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich	ENSG00000110799		0.587	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	-	0.00	235	0	C	NM_000552		6132813	-1	tier1	-	no_errors	ENST00000261405	ensembl	human	known	74_37	silent	33.73	112	57	SNP	1.000	T
WDFY4	57705	genome.wustl.edu	37	10	49935564	49935564	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:49935564C>T	ENST00000325239.5	+	6	858	c.831C>T	c.(829-831)gaC>gaT	p.D277D	WDFY4_ENST00000360890.2_Silent_p.D277D|WDFY4_ENST00000413659.2_Silent_p.D277D	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	277						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						GGCTCACGGACACTCTCCCTG	0.582																																																	0													78.0	73.0	75.0					10																	49935564		692	1591	2283	SO:0001819	synonymous_variant	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.831C>T	10.37:g.49935564C>T			B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D277	ENST00000325239.5	37	c.831	CCDS44385.1	10																																																																																			WDFY4	-	superfamily_ARM-type_fold	ENSG00000128815		0.582	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		-	0.00	57	0	C	XM_033379		49935564	+1	tier1	-	no_errors	ENST00000325239	ensembl	human	known	74_37	silent	30.36	39	17	SNP	0.967	T
WDR90	197335	genome.wustl.edu	37	16	708985	708985	+	Silent	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:708985C>A	ENST00000293879.4	+	24	2985	c.2985C>A	c.(2983-2985)ctC>ctA	p.L995L	LA16c-349E10.1_ENST00000573609.1_RNA|WDR90_ENST00000549091.1_Silent_p.L995L			Q96KV7	WDR90_HUMAN	WD repeat domain 90	995										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				CCGTCTTCCTCTGGGATGTCC	0.642																																																	0													77.0	95.0	89.0					16																	708985		2110	4220	6330	SO:0001819	synonymous_variant	0			AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.2985C>A	16.37:g.708985C>A			Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Silent	SNP	pfam_WD40_repeat,pfam_DUF667,pfam_Nucleoporin_Nup160,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L995	ENST00000293879.4	37	c.2985	CCDS42092.1	16																																																																																			WDR90	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000161996		0.642	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	WDR90	HGNC	protein_coding	OTTHUMT00000404335.1	-	0.00	92	0	C	NM_145294		708985	+1	tier1	-	no_errors	ENST00000549091	ensembl	human	novel	74_37	silent	46.77	33	29	SNP	0.969	A
WIPF1	7456	genome.wustl.edu	37	2	175436784	175436784	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:175436784G>A	ENST00000392547.2	-	5	848	c.749C>T	c.(748-750)cCt>cTt	p.P250L	WIPF1_ENST00000392546.2_Missense_Mutation_p.P250L|AC018890.6_ENST00000442996.1_RNA|WIPF1_ENST00000359761.3_Missense_Mutation_p.P250L|WIPF1_ENST00000467149.1_5'Flank|WIPF1_ENST00000272746.5_Missense_Mutation_p.P250L|WIPF1_ENST00000409891.1_Missense_Mutation_p.P250L|AC018890.6_ENST00000412835.1_RNA|WIPF1_ENST00000409415.3_Missense_Mutation_p.P250L	NM_003387.4	NP_003378.3	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	250					actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|response to other organism (GO:0051707)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	actin binding (GO:0003779)|profilin binding (GO:0005522)	p.P250L(1)		NS(1)|breast(1)|endometrium(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)	32						CGGCAGGGGAGGCCGGTTGGA	0.657																																																	1	Substitution - Missense(1)	lung(1)											16.0	19.0	18.0					2																	175436784		2200	4296	6496	SO:0001583	missense	0			AF031588	CCDS2260.1	2q31.2	2014-09-17	2006-10-12	2006-10-12	ENSG00000115935	ENSG00000115935			12736	protein-coding gene	gene with protein product		602357	"""Wiskott-Aldrich syndrome protein interacting protein"""	WASPIP		9405671	Standard	NM_001077269		Approved	WIP	uc002uiz.3	O43516	OTTHUMG00000132334	ENST00000392547.2:c.749C>T	2.37:g.175436784G>A	ENSP00000376330:p.Pro250Leu		B8ZZM1|D3DPE4|Q15220|Q53TA9|Q6MZU9|Q9BU37|Q9UNP1	Missense_Mutation	SNP	smart_WH2_dom,pfscan_WH2_dom	p.P250L	ENST00000392547.2	37	c.749	CCDS2260.1	2	.	.	.	.	.	.	.	.	.	.	G	16.09	3.023456	0.54683	.	.	ENSG00000115935	ENST00000392547;ENST00000272746;ENST00000359761;ENST00000392546;ENST00000409891;ENST00000409415	T;T;T;T;T;T	0.63255	1.16;1.13;1.16;1.16;0.65;-0.03	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.68778	0.3038	M	0.68952	2.095	0.80722	D	1	P;D;P;P	0.60160	0.827;0.987;0.827;0.734	B;P;B;B	0.49528	0.439;0.614;0.439;0.254	T	0.75133	-0.3425	10	0.66056	D	0.02	.	16.8507	0.85993	0.0:0.0:1.0:0.0	.	250;250;250;250	O43516-3;E9PB87;O43516-2;O43516	.;.;.;WIPF1_HUMAN	L	250	ENSP00000376330:P250L;ENSP00000272746:P250L;ENSP00000352802:P250L;ENSP00000376329:P250L;ENSP00000386431:P250L;ENSP00000387150:P250L	ENSP00000272746:P250L	P	-	2	0	WIPF1	175145030	1.000000	0.71417	0.996000	0.52242	0.272000	0.26649	8.197000	0.89727	2.062000	0.61559	0.511000	0.50034	CCT	WIPF1	-	NULL	ENSG00000115935		0.657	WIPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WIPF1	HGNC	protein_coding	OTTHUMT00000255453.1	-	0.00	92	0	G	NM_003387		175436784	-1	tier1	-	no_errors	ENST00000272746	ensembl	human	known	74_37	missense	26.83	30	11	SNP	0.998	A
ZC3H12B	340554	genome.wustl.edu	37	X	64709147	64709147	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chrX:64709147G>T	ENST00000338957.4	+	1	533	c.466G>T	c.(466-468)Ggg>Tgg	p.G156W	ZC3H12B_ENST00000423889.3_Missense_Mutation_p.G145W	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	156							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TGATTCAGAAGGGCAGATCAA	0.448																																																	0													85.0	82.0	83.0					X																	64709147		1935	4130	6065	SO:0001583	missense	0			BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.466G>T	X.37:g.64709147G>T	ENSP00000340839:p.Gly156Trp		B2RTQ3|E9PAJ6|Q5H9C0	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.G156W	ENST00000338957.4	37	c.466	CCDS48131.2	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.29|14.29	2.491676|2.491676	0.44249|0.44249	.|.	.|.	ENSG00000102053|ENSG00000102053	ENST00000338957;ENST00000423889|ENST00000218172	T;T|.	0.25085|.	1.82;1.82|.	5.15|5.15	4.29|4.29	0.51040|0.51040	.|.	.|0.514735	.|0.21854	.|N	.|0.068124	T|T	0.24084|0.24084	0.0583|0.0583	N|N	0.24115|0.24115	0.695|0.695	0.23834|0.23834	N|N	0.996713|0.996713	P|.	0.47106|.	0.89|.	B|.	0.43155|.	0.41|.	T|T	0.16808|0.16808	-1.0390|-1.0390	9|7	0.66056|0.19590	D|T	0.02|0.45	-11.8794|-11.8794	7.9818|7.9818	0.30188|0.30188	0.1896:0.0:0.8104:0.0|0.1896:0.0:0.8104:0.0	.|.	145|.	Q5HYM0|.	ZC12B_HUMAN|.	W|N	156;145|103	ENSP00000340839:G156W;ENSP00000408077:G145W|.	ENSP00000340839:G156W|ENSP00000218172:K103N	G|K	+|+	1|3	0|2	ZC3H12B|ZC3H12B	64625872|64625872	0.999000|0.999000	0.42202|0.42202	0.875000|0.875000	0.34327|0.34327	0.959000|0.959000	0.62525|0.62525	2.547000|2.547000	0.45786|0.45786	1.155000|1.155000	0.42497|0.42497	0.506000|0.506000	0.49869|0.49869	GGG|AAG	ZC3H12B	-	NULL	ENSG00000102053		0.448	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H12B	HGNC	protein_coding	OTTHUMT00000378734.2		0.00	23	0	G	XM_293334		64709147	+1			no_errors	ENST00000338957	ensembl	human	known	74_37	missense	12.12	28	4	SNP	0.703	T
ZFP42	132625	genome.wustl.edu	37	4	188924336	188924336	+	Silent	SNP	A	A	G	rs561833686		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr4:188924336A>G	ENST00000326866.4	+	4	783	c.375A>G	c.(373-375)aaA>aaG	p.K125K	ZFP42_ENST00000509524.1_Silent_p.K125K	NM_174900.3	NP_777560.2	Q96MM3	ZFP42_HUMAN	ZFP42 zinc finger protein	125					female gonad development (GO:0008585)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|meiotic nuclear division (GO:0007126)|regulation of genetic imprinting (GO:2000653)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V127fs*1(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		ACATGAAAAAAGGGGTAAAGA	0.413													A|||	1	0.000199681	0.0	0.0014	5008	,	,		19490	0.0		0.0	False		,,,				2504	0.0																1	Deletion - Frameshift(1)	skin(1)											87.0	95.0	93.0					4																	188924336		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056719	CCDS3849.1	4q35.2	2014-09-04	2012-11-27		ENSG00000179059	ENSG00000179059		"""Zinc fingers, C2H2-type"""	30949	protein-coding gene	gene with protein product		614572	"""zinc finger protein 42 homolog (mouse)"", ""zinc finger protein 42"""			12110702	Standard	NM_174900		Approved	REX1, ZNF754	uc003izh.1	Q96MM3	OTTHUMG00000160235	ENST00000326866.4:c.375A>G	4.37:g.188924336A>G			D3DP65|Q8WXE2	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K125	ENST00000326866.4	37	c.375	CCDS3849.1	4																																																																																			ZFP42	-	NULL	ENSG00000179059		0.413	ZFP42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP42	HGNC	protein_coding	OTTHUMT00000359794.1		0.00	30	0	A	NM_174900		188924336	+1			no_errors	ENST00000326866	ensembl	human	known	74_37	silent	5.00	38	2	SNP	0.000	G
ZNF174	7727	genome.wustl.edu	37	16	3454446	3454446	+	Silent	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:3454446G>T	ENST00000268655.4	+	2	1008	c.423G>T	c.(421-423)ggG>ggT	p.G141G	ZNF174_ENST00000572544.1_Silent_p.G141G|ZNF174_ENST00000571936.1_Silent_p.G141G|ZNF174_ENST00000575752.1_Silent_p.G141G|ZNF174_ENST00000344823.5_Silent_p.G141G	NM_003450.2	NP_003441.1	Q15697	ZN174_HUMAN	zinc finger protein 174	141					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|urinary_tract(2)	12						GTATGCAGGGGCAAAAGGTGC	0.502																																																	0													116.0	125.0	122.0					16																	3454446		2197	4300	6497	SO:0001819	synonymous_variant	0			U31248	CCDS10504.1, CCDS32380.1	16p13	2013-01-09			ENSG00000103343	ENSG00000103343		"""-"", ""Zinc fingers, C2H2-type"""	12963	protein-coding gene	gene with protein product		603900					Standard	NM_003450		Approved	ZSCAN8	uc002cvc.3	Q15697	OTTHUMG00000129358	ENST00000268655.4:c.423G>T	16.37:g.3454446G>T			Q53Y68|Q9BQ34	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.G141	ENST00000268655.4	37	c.423	CCDS10504.1	16																																																																																			ZNF174	-	smart_Tscrpt_reg_SCAN	ENSG00000103343		0.502	ZNF174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF174	HGNC	protein_coding	OTTHUMT00000251510.1		0.00	67	0	G	NM_003450		3454446	+1			no_errors	ENST00000268655	ensembl	human	known	74_37	silent	5.26	54	3	SNP	1.000	T
ZNF180	7733	genome.wustl.edu	37	19	44980661	44980661	+	Silent	SNP	A	A	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:44980661A>G	ENST00000221327.4	-	5	2318	c.2037T>C	c.(2035-2037)caT>caC	p.H679H	ZNF180_ENST00000391956.4_Silent_p.H654H|ZNF180_ENST00000585514.1_5'Flank|AC069278.4_ENST00000591684.1_lincRNA|ZNF180_ENST00000592529.1_Silent_p.H652H	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	679					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				GAGTTGCCTGATGCCTAATAA	0.313																																					Esophageal Squamous(180;1353 2003 32862 46574 49854)												0													82.0	87.0	85.0					19																	44980661		2202	4299	6501	SO:0001819	synonymous_variant	0			AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.2037T>C	19.37:g.44980661A>G			B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H679	ENST00000221327.4	37	c.2037	CCDS12639.1	19																																																																																			ZNF180	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167384		0.313	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF180	HGNC	protein_coding	OTTHUMT00000451601.1	-	0.00	27	0	A	NM_013256		44980661	-1	tier1	-	no_errors	ENST00000221327	ensembl	human	known	74_37	silent	30.77	36	16	SNP	0.994	G
ZNF200	7752	genome.wustl.edu	37	16	3283719	3283719	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr16:3283719G>T	ENST00000431561.3	-	2	649	c.37C>A	c.(37-39)Cca>Aca	p.P13T	ZNF200_ENST00000396868.3_Missense_Mutation_p.P13T|ZNF200_ENST00000414144.2_Missense_Mutation_p.P13T|ZNF200_ENST00000575948.1_Missense_Mutation_p.P13T|ZNF200_ENST00000396871.4_Missense_Mutation_p.P13T|ZNF200_ENST00000396870.4_Missense_Mutation_p.P13T	NM_001145447.1|NM_003454.3	NP_001138919.1|NP_003445.2	P98182	ZN200_HUMAN	zinc finger protein 200	13					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	17						GACTGCTTTGGCTTTGGGGGC	0.547																																																	0													140.0	133.0	135.0					16																	3283719		2197	4300	6497	SO:0001583	missense	0			AF060866	CCDS10497.1, CCDS42112.1, CCDS45395.1	16p13.3	2013-01-08			ENSG00000010539	ENSG00000010539		"""Zinc fingers, C2H2-type"""	12993	protein-coding gene	gene with protein product		603231				9288094, 9787081	Standard	NM_003454		Approved		uc002cuk.2	P98182	OTTHUMG00000129317	ENST00000431561.3:c.37C>A	16.37:g.3283719G>T	ENSP00000395723:p.Pro13Thr		D3DUB7|D3DUB8|O15361|Q5XKM5|Q7Z5V1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P13T	ENST00000431561.3	37	c.37	CCDS10497.1	16	.	.	.	.	.	.	.	.	.	.	G	10.59	1.392766	0.25118	.	.	ENSG00000010539	ENST00000396870;ENST00000396868;ENST00000396871;ENST00000414144;ENST00000431561	T;T;T;T;T	0.06933	3.24;3.25;3.24;3.32;3.32	4.89	2.85	0.33270	.	0.183522	0.26828	N	0.022299	T	0.07548	0.0190	L	0.36672	1.1	0.23913	N	0.996484	B;B;B	0.26809	0.099;0.099;0.16	B;B;B	0.31337	0.06;0.06;0.128	T	0.27905	-1.0060	10	0.49607	T	0.09	-0.1147	7.0147	0.24881	0.2265:0.0:0.7735:0.0	.	13;13;13	D3DUB7;P98182;P98182-2	.;ZN200_HUMAN;.	T	13	ENSP00000380079:P13T;ENSP00000380077:P13T;ENSP00000380080:P13T;ENSP00000405786:P13T;ENSP00000395723:P13T	ENSP00000380077:P13T	P	-	1	0	ZNF200	3223720	0.954000	0.32549	0.995000	0.50966	0.836000	0.47400	0.295000	0.19065	0.521000	0.28445	0.609000	0.83330	CCA	ZNF200	-	NULL	ENSG00000010539		0.547	ZNF200-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF200	HGNC	protein_coding	OTTHUMT00000437545.1	-	0.00	89	0	G			3283719	-1	tier1	-	no_errors	ENST00000414144	ensembl	human	known	74_37	missense	5.71	65	4	SNP	0.996	T
ZNF251	90987	genome.wustl.edu	37	8	145947949	145947949	+	Missense_Mutation	SNP	G	G	C	rs552920738		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr8:145947949G>C	ENST00000292562.7	-	5	1371	c.1096C>G	c.(1096-1098)Cag>Gag	p.Q366E	ZNF251_ENST00000524394.1_Intron	NM_138367.1	NP_612376.1	Q9BRH9	ZN251_HUMAN	zinc finger protein 251	366					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|kidney(1)|large_intestine(5)|lung(9)|stomach(1)	17	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)		CTCTCATGCTGAATAAGGCTG	0.507																																																	0													78.0	87.0	84.0					8																	145947949		2192	4298	6490	SO:0001583	missense	0			AK000435	CCDS47944.1	8q24.3	2013-01-08			ENSG00000198169	ENSG00000198169		"""Zinc fingers, C2H2-type"", ""-"""	13045	protein-coding gene	gene with protein product							Standard	NM_138367		Approved		uc003zdv.4	Q9BRH9	OTTHUMG00000165189	ENST00000292562.7:c.1096C>G	8.37:g.145947949G>C	ENSP00000292562:p.Gln366Glu		Q2M219	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q366E	ENST00000292562.7	37	c.1096	CCDS47944.1	8	.	.	.	.	.	.	.	.	.	.	G	5.156	0.214340	0.09810	.	.	ENSG00000198169	ENST00000292562	T	0.16324	2.35	3.0	2.1	0.27182	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04182	0.0116	N	0.01771	-0.73	0.09310	N	1	B	0.25850	0.136	B	0.20955	0.032	T	0.42224	-0.9464	9	0.02654	T	1	-10.6375	3.5509	0.07845	0.1351:0.0:0.4658:0.3991	.	366	Q9BRH9	ZN251_HUMAN	E	366	ENSP00000292562:Q366E	ENSP00000292562:Q366E	Q	-	1	0	ZNF251	145918758	0.000000	0.05858	0.991000	0.47740	0.988000	0.76386	-0.605000	0.05661	1.667000	0.50832	0.563000	0.77884	CAG	ZNF251	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198169		0.507	ZNF251-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF251	HGNC	protein_coding	OTTHUMT00000382541.1	-	0.00	28	0	G	NM_138367		145947949	-1	tier1	-	no_errors	ENST00000292562	ensembl	human	known	74_37	missense	12.63	82	12	SNP	0.000	C
ZNF280D	54816	genome.wustl.edu	37	15	56946703	56946704	+	Splice_Site	INS	-	-	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr15:56946703_56946704insA	ENST00000267807.7	-	18	2274		c.e18-2		ZNF280D_ENST00000559237.1_Splice_Site|ZNF280D_ENST00000559000.1_Splice_Site	NM_017661.2	NP_060131.2	Q6N043	Z280D_HUMAN	zinc finger protein 280D						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(4)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	30				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		GTAATGCCCCTAAAAAAAAAAG	0.287																																																	0																																										SO:0001630	splice_region_variant	0			AB046804	CCDS32245.1, CCDS42041.1, CCDS58364.1	15q21.2	2008-05-02	2007-09-20	2007-09-20					25953	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 4 (Drosophila)"""	SUHW4		10997877	Standard	XM_005254481		Approved	FLJ20086, ZNF634	uc002adu.3	Q6N043		ENST00000267807.7:c.2058-2->T	15.37:g.56946713_56946713dupA			A1L495|B2RMT6|Q6MZM6|Q6N085|Q6P2R6|Q7Z6J5|Q9H0U5|Q9HCI8|Q9NXS0	Splice_Site	INS	-	e16-2	ENST00000267807.7	37	c.2058-3_2058-2	CCDS32245.1	15																																																																																			ZNF280D	-	-	ENSG00000137871		0.287	ZNF280D-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF280D	HGNC	protein_coding	OTTHUMT00000418891.2		0.00	38	0	-	XM_370867	Intron	56946704	-1	tier1		no_errors	ENST00000267807	ensembl	human	known	74_37	splice_site_ins	27.50	58	22	INS	1.000:0.001	A
ZNF32	7580	genome.wustl.edu	37	10	44139887	44139887	+	Silent	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr10:44139887G>T	ENST00000395797.1	-	3	621	c.433C>A	c.(433-435)Cga>Aga	p.R145R	ZNF32_ENST00000485351.1_5'Flank|ZNF32-AS1_ENST00000453284.1_RNA|ZNF32_ENST00000374433.2_Silent_p.R145R|ZNF32-AS3_ENST00000458063.1_RNA|ZNF32-AS2_ENST00000418966.1_RNA	NM_001005368.1	NP_001005368.1	P17041	ZNF32_HUMAN	zinc finger protein 32	145					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R145*(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	14		all_neural(218;0.0182)|Ovarian(717;0.0443)|Renal(717;0.157)		Lung(62;0.179)		AGACTACCTCGTTGACTGAAG	0.483																																																	1	Substitution - Nonsense(1)	large_intestine(1)											145.0	134.0	138.0					10																	44139887		2203	4300	6503	SO:0001819	synonymous_variant	0			U69645	CCDS7206.1	10q22-q25	2013-01-08	2006-05-11		ENSG00000169740	ENSG00000169740		"""Zinc fingers, C2H2-type"""	13095	protein-coding gene	gene with protein product		194539	"""zinc finger protein 32 (KOX 30)"""				Standard	XM_005271822		Approved	KOX30	uc001jbc.3	P17041	OTTHUMG00000018043	ENST00000395797.1:c.433C>A	10.37:g.44139887G>T			Q92951	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R145	ENST00000395797.1	37	c.433	CCDS7206.1	10																																																																																			ZNF32	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000169740		0.483	ZNF32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF32	HGNC	protein_coding	OTTHUMT00000047723.1		0.00	25	0	G	NM_006973		44139887	-1			no_errors	ENST00000374433	ensembl	human	known	74_37	silent	5.13	37	2	SNP	0.147	T
ZNF461	92283	genome.wustl.edu	37	19	37128585	37128586	+	IGR	DEL	AA	AA	-	rs377169661		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:37128585_37128586delAA	ENST00000588268.1	-	0	2584				ZNF461_ENST00000540605.2_5'Flank	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			ggtgtgtctcaaaaaaaaaaaa	0.406																																																	0																																										SO:0001628	intergenic_variant	0			BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7			19.37:g.37128595_37128596delAA			A8K9W9|Q6VSF7|Q9ULZ8	RNA	DEL	-	NULL	ENST00000588268.1	37	NULL	CCDS54257.1	19																																																																																			ZNF461	-	-	ENSG00000197808		0.406	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF461	HGNC	protein_coding	OTTHUMT00000453202.1		0.00	29	0	AA	NM_153257		37128586	-1	tier1		no_errors	ENST00000589442	ensembl	human	known	74_37	rna	21.82	43	12	DEL	0.035:0.037	-
ZNF578	147660	genome.wustl.edu	37	19	52954490	52954490	+	5'Flank	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:52954490C>T	ENST00000421239.2	+	0	0				ZNF534_ENST00000432303.2_Missense_Mutation_p.R65C|ZNF534_ENST00000301085.4_Missense_Mutation_p.R108C	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		GGAAGCCTGGCGCGCGTCCGG	0.547																																																	0													2.0	2.0	2.0					19																	52954490		735	1665	2400	SO:0001631	upstream_gene_variant	0			AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468		19.37:g.52954490C>T	Exception_encountered		B4DR51|I3L1Y6	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.R108C	ENST00000421239.2	37	c.322	CCDS54310.1	19	.	.	.	.	.	.	.	.	.	.	C	11.84	1.758297	0.31137	.	.	ENSG00000198633	ENST00000301085;ENST00000432303	T;T	0.01560	5.41;4.77	0.85	0.85	0.18980	.	.	.	.	.	T	0.01254	0.0041	.	.	.	0.09310	N	1	P;D	0.62365	0.713;0.991	B;B	0.35039	0.035;0.194	T	0.53005	-0.8499	8	0.66056	D	0.02	.	4.9697	0.14110	0.0:1.0:0.0:0.0	.	65;108	Q1T7F6;Q1T7F5	.;.	C	108;65	ENSP00000301085:R108C;ENSP00000409421:R65C	ENSP00000301085:R108C	R	+	1	0	ZNF534	57646302	0.018000	0.18449	0.004000	0.12327	0.076000	0.17211	0.212000	0.17497	0.722000	0.32252	0.205000	0.17691	CGC	ZNF534	-	NULL	ENSG00000198633		0.547	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF534	HGNC	protein_coding	OTTHUMT00000344298.3	-	0.00	129	0	C	NM_152472		52954490	+1	tier1	-	no_errors	ENST00000301085	ensembl	human	putative	74_37	missense	44.44	40	32	SNP	0.005	T
ZNF320	162967	genome.wustl.edu	37	19	53385108	53385108	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:53385108C>T	ENST00000595635.1	-	8	772	c.271G>A	c.(271-273)Gag>Aag	p.E91K	ZNF320_ENST00000597909.1_Intron|ZNF320_ENST00000391781.2_Missense_Mutation_p.E91K|ZNF320_ENST00000600930.1_Intron	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	91					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		ATGTCTTTCTCAATTTCCTGG	0.403																																																	0													142.0	142.0	142.0					19																	53385108		2203	4300	6503	SO:0001583	missense	0			AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.271G>A	19.37:g.53385108C>T	ENSP00000473091:p.Glu91Lys		Q8NDR6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E91K	ENST00000595635.1	37	c.271	CCDS33095.1	19	.	.	.	.	.	.	.	.	.	.	-	2.900	-0.227737	0.06022	.	.	ENSG00000182986	ENST00000391781	T	0.06608	3.28	1.18	-2.36	0.06663	.	.	.	.	.	T	0.03608	0.0103	L	0.41236	1.265	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.49570	-0.8926	9	0.07813	T	0.8	.	0.4832	0.00551	0.1999:0.2389:0.3328:0.2284	.	91	A2RRD8	ZN320_HUMAN	K	91	ENSP00000375660:E91K	ENSP00000375660:E91K	E	-	1	0	ZNF320	58076920	0.000000	0.05858	0.000000	0.03702	0.310000	0.27922	-1.196000	0.03041	-1.571000	0.01663	0.184000	0.17185	GAG	ZNF320	-	NULL	ENSG00000182986		0.403	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF320	HGNC	protein_coding	OTTHUMT00000463771.1	-	0.00	56	0	C	NM_207333		53385108	-1	tier1	-	no_errors	ENST00000391781	ensembl	human	known	74_37	missense	29.36	76	32	SNP	0.000	T
ZNF644	84146	genome.wustl.edu	37	1	91405831	91405831	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:91405831G>T	ENST00000370440.1	-	3	1297	c.1080C>A	c.(1078-1080)ttC>ttA	p.F360L	ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000337393.5_Missense_Mutation_p.F360L|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000347275.5_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	360					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TTAGATGTTGGAAGGCATCCA	0.353																																																	0													117.0	115.0	115.0					1																	91405831		2203	4300	6503	SO:0001583	missense	0			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.1080C>A	1.37:g.91405831G>T	ENSP00000359469:p.Phe360Leu		A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F360L	ENST00000370440.1	37	c.1080	CCDS731.1	1	.	.	.	.	.	.	.	.	.	.	G	5.164	0.215790	0.09810	.	.	ENSG00000122482	ENST00000370440;ENST00000337393	T;T	0.00563	6.58;6.58	5.44	1.74	0.24563	.	0.100699	0.64402	D	0.000002	T	0.00109	0.0003	N	0.19112	0.55	0.34070	D	0.658369	B	0.12630	0.006	B	0.09377	0.004	T	0.08066	-1.0740	10	0.09843	T	0.71	-13.0045	3.8931	0.09127	0.4876:0.1885:0.3239:0.0	.	360	Q9H582	ZN644_HUMAN	L	360	ENSP00000359469:F360L;ENSP00000337008:F360L	ENSP00000337008:F360L	F	-	3	2	ZNF644	91178419	1.000000	0.71417	1.000000	0.80357	0.574000	0.36063	0.841000	0.27613	0.901000	0.36495	-0.459000	0.05422	TTC	ZNF644	-	NULL	ENSG00000122482		0.353	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	HGNC	protein_coding	OTTHUMT00000027846.2	-	0.00	31	0	G	NM_032186		91405831	-1	tier1	-	no_errors	ENST00000337393	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.985	T
ZNF714	148206	genome.wustl.edu	37	19	21300459	21300460	+	Frame_Shift_Del	DEL	AT	AT	-	rs373730153		TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	AT	AT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:21300459_21300460delAT	ENST00000596143.1	+	5	1314_1315	c.989_990delAT	c.(988-990)catfs	p.H330fs	ZNF714_ENST00000596053.1_Intron|ZNF714_ENST00000291770.7_3'UTR|ZNF714_ENST00000601416.1_3'UTR	NM_182515.3	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	330					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|urinary_tract(2)	18						CTTACAAAACATAAAAGAATTC	0.347																																																	0																																										SO:0001589	frameshift_variant	0			AK056006	CCDS54239.1	19p12	2013-01-08				ENSG00000160352		"""Zinc fingers, C2H2-type"""	27124	protein-coding gene	gene with protein product						12477932	Standard	NM_182515		Approved		uc002npo.4	Q96N38		ENST00000596143.1:c.989_990delAT	19.37:g.21300459_21300460delAT	ENSP00000472368:p.His330fs		Q49AI1|Q86W65|Q8ND40	Frame_Shift_Del	DEL	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H330fs	ENST00000596143.1	37	c.989_990	CCDS54239.1	19																																																																																			ZNF714	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160352		0.347	ZNF714-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF714	HGNC	protein_coding	OTTHUMT00000463930.1		0.00	25	0	AT	NM_182515		21300460	+1			no_errors	ENST00000596143	ensembl	human	known	74_37	frame_shift_del	20.51	31	8	DEL	0.995:0.991	0
ZNF775	285971	genome.wustl.edu	37	7	150093755	150093755	+	Silent	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr7:150093755C>T	ENST00000329630.5	+	3	293	c.186C>T	c.(184-186)gcC>gcT	p.A62A		NM_173680.3	NP_775951.2	Q96BV0	ZN775_HUMAN	zinc finger protein 775	62					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(7)|skin(1)	11	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.0173)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GGCCTCGAGCCCTGGGGGGAC	0.711																																																	0													10.0	14.0	13.0					7																	150093755		1935	4126	6061	SO:0001819	synonymous_variant	0			BC038111	CCDS43678.1	7q36.1	2013-01-08			ENSG00000196456	ENSG00000196456		"""Zinc fingers, C2H2-type"""	28501	protein-coding gene	gene with protein product						12477932	Standard	NM_173680		Approved	MGC33584	uc003whf.1	Q96BV0	OTTHUMG00000158324	ENST00000329630.5:c.186C>T	7.37:g.150093755C>T			Q8IY24	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A62	ENST00000329630.5	37	c.186	CCDS43678.1	7																																																																																			ZNF775	-	NULL	ENSG00000196456		0.711	ZNF775-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF775	HGNC	protein_coding	OTTHUMT00000350679.1		0.00	27	0	C	NM_173680		150093755	+1			no_errors	ENST00000329630	ensembl	human	known	74_37	silent	23.08	10	3	SNP	0.002	T
ZNF790	388536	genome.wustl.edu	37	19	37314712	37314712	+	Intron	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr19:37314712C>A	ENST00000356725.4	-	3	130				CTD-2162K18.5_ENST00000588906.1_RNA|CTD-2162K18.5_ENST00000587278.1_RNA	NM_001242802.1|NM_206894.3	NP_001229731.1|NP_996777.2	Q6PG37	ZN790_HUMAN	zinc finger protein 790						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	32	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			AGAATAATTCCAAGTATTAAT	0.423																																																	0													48.0	49.0	49.0					19																	37314712		2203	4300	6503	SO:0001627	intron_variant	0			BC057245	CCDS12496.1	19q13.12	2013-01-08			ENSG00000197863	ENSG00000197863		"""Zinc fingers, C2H2-type"", ""-"""	33114	protein-coding gene	gene with protein product							Standard	NM_206894		Approved	MGC62100, FLJ20350	uc021utm.1	Q6PG37	OTTHUMG00000165616	ENST00000356725.4:c.10-20G>T	19.37:g.37314712C>A				RNA	SNP	-	NULL	ENST00000356725.4	37	NULL	CCDS12496.1	19																																																																																			CTD-2162K18.5	-	-	ENSG00000267254		0.423	ZNF790-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF790-AS1	Clone_based_vega_gene	protein_coding	OTTHUMT00000385341.2	-	0.00	35	0	C	NM_206894		37314712	+1	tier1	-	no_errors	ENST00000588906	ensembl	human	known	74_37	rna	7.02	53	4	SNP	0.007	A
ZNF804A	91752	genome.wustl.edu	37	2	185801665	185801665	+	Silent	SNP	A	A	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr2:185801665A>G	ENST00000302277.6	+	4	2136	c.1542A>G	c.(1540-1542)ggA>ggG	p.G514G		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	514							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						ATGAAATTGGAAGTAGCAAAA	0.398																																																	0													85.0	90.0	88.0					2																	185801665		2188	4295	6483	SO:0001819	synonymous_variant	0			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.1542A>G	2.37:g.185801665A>G			A7E253|Q6ZN26	Silent	SNP	pfam_Znf_C2H2_jaz	p.G514	ENST00000302277.6	37	c.1542	CCDS2291.1	2																																																																																			ZNF804A	-	NULL	ENSG00000170396		0.398	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	HGNC	protein_coding	OTTHUMT00000255871.1		0.00	33	0	A	NM_194250		185801665	+1			no_errors	ENST00000302277	ensembl	human	known	74_37	silent	5.17	55	3	SNP	0.001	G
ZSWIM5	57643	genome.wustl.edu	37	1	45484252	45484252	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:45484252C>A	ENST00000359600.5	-	14	3637	c.3432G>T	c.(3430-3432)aaG>aaT	p.K1144N		NM_020883.1	NP_065934.1	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM-type containing 5	1144						extracellular space (GO:0005615)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|liver(1)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					TCTCCCGAGCCTTGCTTAGAA	0.502											OREG0013450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													190.0	187.0	188.0					1																	45484252		2074	4209	6283	SO:0001583	missense	0			AB040944	CCDS41319.1	1p34.1	2010-06-16			ENSG00000162415	ENSG00000162415		"""Zinc fingers, SWIM-type"""	29299	protein-coding gene	gene with protein product						10819331	Standard	NM_020883		Approved	KIAA1511	uc001cnd.2	Q9P217	OTTHUMG00000008950	ENST00000359600.5:c.3432G>T	1.37:g.45484252C>A	ENSP00000352614:p.Lys1144Asn	932	Q5SXQ9	Missense_Mutation	SNP	pfscan_Znf_SWIM	p.K1144N	ENST00000359600.5	37	c.3432	CCDS41319.1	1	.	.	.	.	.	.	.	.	.	.	C	14.69	2.611848	0.46631	.	.	ENSG00000162415	ENST00000359600	T	0.52295	0.67	4.94	-0.31	0.12765	.	0.000000	0.85682	D	0.000000	T	0.64405	0.2595	M	0.81942	2.565	0.58432	D	0.999993	D	0.76494	0.999	D	0.72625	0.978	T	0.65175	-0.6232	10	0.87932	D	0	-19.474	10.2064	0.43116	0.0:0.5855:0.0:0.4144	.	1144	Q9P217	ZSWM5_HUMAN	N	1144	ENSP00000352614:K1144N	ENSP00000352614:K1144N	K	-	3	2	ZSWIM5	45256839	0.953000	0.32496	0.995000	0.50966	0.997000	0.91878	0.092000	0.15066	-0.139000	0.11414	0.561000	0.74099	AAG	ZSWIM5	-	NULL	ENSG00000162415		0.502	ZSWIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM5	HGNC	protein_coding	OTTHUMT00000024823.2	-	0.00	85	0	C	XM_046581		45484252	-1	tier1	-	no_errors	ENST00000359600	ensembl	human	known	74_37	missense	30.16	44	19	SNP	1.000	A
ZUFSP	221302	genome.wustl.edu	37	6	116987880	116987880	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr6:116987880C>G	ENST00000368576.3	-	2	719	c.476G>C	c.(475-477)tGt>tCt	p.C159S	ZUFSP_ENST00000368573.1_Missense_Mutation_p.C159S|ZUFSP_ENST00000471919.1_5'UTR	NM_145062.2	NP_659499.2	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain	159							metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(6)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		TATTTTTCCACAGAATGGACA	0.368																																																	0													117.0	106.0	110.0					6																	116987880		2203	4300	6503	SO:0001583	missense	0			AK054582	CCDS5110.1	6q22.31	2013-01-28	2008-03-25	2008-03-25	ENSG00000153975	ENSG00000153975		"""Zinc fingers, C2H2-type"""	21224	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 113"""	C6orf113			Standard	NM_145062		Approved	dJ412I7.3	uc003pxf.2	Q96AP4	OTTHUMG00000015445	ENST00000368576.3:c.476G>C	6.37:g.116987880C>G	ENSP00000357565:p.Cys159Ser		Q5TD92|Q6PJH7|Q96NV6	Missense_Mutation	SNP	pfam_Peptidase_C78_UfSP1/2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C159S	ENST00000368576.3	37	c.476	CCDS5110.1	6	.	.	.	.	.	.	.	.	.	.	C	18.17	3.564542	0.65651	.	.	ENSG00000153975	ENST00000368576;ENST00000368573	T;T	0.59906	0.29;0.23	5.75	5.75	0.90469	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.70842	0.3270	M	0.66939	2.045	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.73065	-0.4100	10	0.87932	D	0	-14.3381	17.4446	0.87574	0.0:1.0:0.0:0.0	.	159	Q96AP4	ZUFSP_HUMAN	S	159	ENSP00000357565:C159S;ENSP00000357562:C159S	ENSP00000357562:C159S	C	-	2	0	ZUFSP	117094573	1.000000	0.71417	1.000000	0.80357	0.645000	0.38454	4.178000	0.58284	2.705000	0.92388	0.655000	0.94253	TGT	ZUFSP	-	smart_Znf_C2H2-like	ENSG00000153975		0.368	ZUFSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZUFSP	HGNC	protein_coding	OTTHUMT00000041961.1	-	0.00	39	0	C	NM_145062		116987880	-1	tier1	-	no_errors	ENST00000368576	ensembl	human	known	74_37	missense	30.99	49	22	SNP	1.000	G
ZYG11B	79699	genome.wustl.edu	37	1	53222263	53222263	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FG-01A-11D-A33E-09	TCGA-JY-A6FG-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c8cfef47-b2bf-4243-ba74-b5450dd7b169	56632598-9ac5-4421-9af1-e982f8aeeabc	g.chr1:53222263C>T	ENST00000294353.6	+	2	309	c.164C>T	c.(163-165)gCt>gTt	p.A55V	ZYG11B_ENST00000443756.2_Missense_Mutation_p.A55V|ZYG11B_ENST00000545132.1_Missense_Mutation_p.A55V|RNU2-30P_ENST00000516209.1_RNA	NM_024646.2	NP_078922.1	Q9C0D3	ZY11B_HUMAN	zyg-11 family member B, cell cycle regulator	55										breast(1)|endometrium(1)|kidney(6)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	30						CAGGAGGTGGCTGATCGACTG	0.408																																																	0													112.0	109.0	110.0					1																	53222263		2203	4300	6503	SO:0001583	missense	0			AB051517	CCDS30717.1	1p32.3	2013-01-17	2012-12-10	2005-07-11	ENSG00000162378	ENSG00000162378		"""ZYG11 cell cycle regulator family"""	25820	protein-coding gene	gene with protein product			"""zyg-11 homolog (C. elegans)"", ""zyg-11 homolog B (C. elegans)"""	ZYG11		11214970	Standard	NM_024646		Approved	FLJ13456	uc001cuj.3	Q9C0D3	OTTHUMG00000008938	ENST00000294353.6:c.164C>T	1.37:g.53222263C>T	ENSP00000294353:p.Ala55Val		Q8N2X3|Q9H8L8	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A55V	ENST00000294353.6	37	c.164	CCDS30717.1	1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.928960	0.92389	.	.	ENSG00000162378	ENST00000443756;ENST00000545132;ENST00000294353	T;T	0.52295	0.68;0.67	4.89	4.89	0.63831	.	0.107664	0.64402	D	0.000006	T	0.67154	0.2863	M	0.68952	2.095	0.46586	D	0.999119	D;D	0.89917	0.996;1.0	P;D	0.70935	0.871;0.971	T	0.68368	-0.5427	10	0.51188	T	0.08	.	18.253	0.90011	0.0:1.0:0.0:0.0	.	55;55	B4DK95;Q9C0D3	.;ZY11B_HUMAN	V	55	ENSP00000441315:A55V;ENSP00000294353:A55V	ENSP00000294353:A55V	A	+	2	0	ZYG11B	52994851	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.327000	0.65881	2.549000	0.85964	0.650000	0.86243	GCT	ZYG11B	-	NULL	ENSG00000162378		0.408	ZYG11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZYG11B	HGNC	protein_coding	OTTHUMT00000024749.1		0.00	28	0	C	NM_024646		53222263	+1			no_errors	ENST00000294353	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
