#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AATF	26574	genome.wustl.edu	37	17	35346670	35346670	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr17:35346670C>A	ENST00000225402.5	+	7	1525	c.1274C>A	c.(1273-1275)cCa>cAa	p.P425Q		NM_012138.3	NP_036270.1	Q9NY61	AATF_HUMAN	apoptosis antagonizing transcription factor	425	RB1 and SP1 binding.				apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|embryonic cleavage (GO:0040016)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of apoptotic process (GO:0043066)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of superoxide anion generation (GO:0032929)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mitotic cell cycle (GO:0007346)|ribosome biogenesis (GO:0042254)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	leucine zipper domain binding (GO:0043522)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)	18		Breast(25;0.00607)				AAACCTGAGCCAGCAGCTCAG	0.473																																					NSCLC(49;901 1159 19183 41572 46244)												0													128.0	133.0	131.0					17																	35346670		2203	4300	6503	SO:0001583	missense	0			AF083208	CCDS32632.1	17q12	2014-05-06			ENSG00000108270	ENSG00000275700			19235	protein-coding gene	gene with protein product		608463				11027528, 10783144	Standard	NM_012138		Approved	DED, CHE-1, CHE1, BFR2	uc002hni.3	Q9NY61	OTTHUMG00000188458	ENST00000225402.5:c.1274C>A	17.37:g.35346670C>A	ENSP00000225402:p.Pro425Gln		A6NCJ6|B3KQ26|Q9P0A4|Q9UNX5	Missense_Mutation	SNP	pfam_AATF_C	p.P425Q	ENST00000225402.5	37	c.1274	CCDS32632.1	17	.	.	.	.	.	.	.	.	.	.	C	3.628	-0.076094	0.07184	.	.	ENSG00000108270	ENST00000225402	.	.	.	5.2	3.14	0.36123	.	0.612651	0.17841	N	0.160191	T	0.18676	0.0448	N	0.21448	0.665	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.25502	-1.0130	9	0.12430	T	0.62	0.0385	4.0916	0.09972	0.2026:0.522:0.0:0.2754	.	425	Q9NY61	AATF_HUMAN	Q	425	.	ENSP00000225402:P425Q	P	+	2	0	AATF	32420783	0.000000	0.05858	0.000000	0.03702	0.605000	0.37080	0.661000	0.25023	0.519000	0.28406	0.467000	0.42956	CCA	AATF	-	NULL	ENSG00000108270		0.473	AATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AATF	HGNC	protein_coding	OTTHUMT00000451543.1	-	0.00	49	0	C	NM_012138		35346670	+1	tier1	-	no_errors	ENST00000225402	ensembl	human	known	74_37	missense	13.51	32	5	SNP	0.000	A
ABT1	29777	genome.wustl.edu	37	6	26598526	26598526	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr6:26598526G>T	ENST00000274849.1	+	3	503	c.472G>T	c.(472-474)Gag>Tag	p.E158*		NM_013375.3	NP_037507.1	Q9ULW3	ABT1_HUMAN	activator of basal transcription 1	158					regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord motor neuron differentiation (GO:0021522)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)	p.E158*(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	11						CCACCTCAGCGAGCACCTCGC	0.542																																																	1	Substitution - Nonsense(1)	lung(1)											121.0	122.0	122.0					6																	26598526		2203	4300	6503	SO:0001587	stop_gained	0			AB027258	CCDS4616.1	6p21.31	2008-07-07			ENSG00000146109	ENSG00000146109			17369	protein-coding gene	gene with protein product						10648625	Standard	NM_013375		Approved		uc003nii.3	Q9ULW3	OTTHUMG00000016319	ENST00000274849.1:c.472G>T	6.37:g.26598526G>T	ENSP00000274849:p.Glu158*			Nonsense_Mutation	SNP	NULL	p.E158*	ENST00000274849.1	37	c.472	CCDS4616.1	6	.	.	.	.	.	.	.	.	.	.	G	36	5.696983	0.96802	.	.	ENSG00000146109	ENST00000274849	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-6.207	17.3171	0.87227	0.0:0.0:1.0:0.0	.	.	.	.	X	158	.	ENSP00000274849:E158X	E	+	1	0	ABT1	26706505	1.000000	0.71417	0.982000	0.44146	0.823000	0.46562	8.557000	0.90700	2.765000	0.95021	0.563000	0.77884	GAG	ABT1	-	NULL	ENSG00000146109		0.542	ABT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABT1	HGNC	protein_coding	OTTHUMT00000043698.1		0.00	49	0	G			26598526	+1			no_errors	ENST00000274849	ensembl	human	known	74_37	nonsense	5.00	38	2	SNP	1.000	T
ADAMTS6	11174	genome.wustl.edu	37	5	64468749	64468749	+	5'UTR	SNP	T	T	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr5:64468749T>A	ENST00000314351.5	-	0	656							Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6							proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		CCTCTGGACATTGTGCAGCTG	0.532																																																	0													164.0	142.0	149.0					5																	64468749		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000314351.5:c.-666A>T	5.37:g.64468749T>A			Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.Q999H	ENST00000314351.5	37	c.2997		5	.	.	.	.	.	.	.	.	.	.	T	9.469	1.095069	0.20471	.	.	ENSG00000049192	ENST00000381055	T	0.60672	0.17	5.56	-11.1	0.00147	.	0.310612	0.35207	N	0.003368	T	0.27489	0.0675	N	0.16307	0.4	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.11421	-1.0588	10	0.31617	T	0.26	.	8.909	0.35541	0.1021:0.5525:0.1329:0.2124	.	999	Q9UKP5	ATS6_HUMAN	H	999	ENSP00000370443:Q999H	ENSP00000370443:Q999H	Q	-	3	2	ADAMTS6	64504505	0.090000	0.21635	0.694000	0.30210	0.987000	0.75469	-0.927000	0.03984	-1.691000	0.01430	-0.256000	0.11100	CAA	ADAMTS6	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt	ENSG00000049192		0.532	ADAMTS6-006	KNOWN	basic	processed_transcript	ADAMTS6	HGNC	protein_coding	OTTHUMT00000157334.2	-	0.00	54	0	T	NM_197941		64468749	-1	tier1	-	no_errors	ENST00000381055	ensembl	human	known	74_37	missense	13.04	40	6	SNP	0.056	A
ADAMTS19	171019	genome.wustl.edu	37	5	129072844	129072844	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr5:129072844G>A	ENST00000274487.4	+	23	3702	c.3557G>A	c.(3556-3558)cGg>cAg	p.R1186Q	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	1186	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CAGGACATGCGGTGGTATCAG	0.517																																																	0													117.0	101.0	106.0					5																	129072844		2203	4300	6503	SO:0001583	missense	0			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.3557G>A	5.37:g.129072844G>A	ENSP00000274487:p.Arg1186Gln			Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R1186Q	ENST00000274487.4	37	c.3557	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	G	24.4	4.524312	0.85600	.	.	ENSG00000145808	ENST00000274487	T	0.43688	0.94	4.12	4.12	0.48240	PLAC (2);	0.084240	0.43110	N	0.000617	T	0.49167	0.1541	N	0.19112	0.55	0.49915	D	0.999835	D	0.89917	1.0	D	0.91635	0.999	T	0.45469	-0.9259	9	.	.	.	.	17.6813	0.88243	0.0:0.0:1.0:0.0	.	1186	Q8TE59	ATS19_HUMAN	Q	1186	ENSP00000274487:R1186Q	.	R	+	2	0	ADAMTS19	129100743	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.679000	0.91220	2.599000	0.87857	0.650000	0.86243	CGG	ADAMTS19	-	pfam_PLAC,pfscan_PLAC	ENSG00000145808		0.517	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	HGNC	protein_coding	OTTHUMT00000250979.2	-	0.00	62	0	G	NM_133638		129072844	+1	tier1	-	no_errors	ENST00000274487	ensembl	human	known	74_37	missense	10.91	49	6	SNP	1.000	A
ADCY7	113	genome.wustl.edu	37	16	50342672	50342672	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr16:50342672G>A	ENST00000394697.2	+	17	2370	c.2030G>A	c.(2029-2031)gGc>gAc	p.G677D	ADCY7_ENST00000537579.1_3'UTR|ADCY7_ENST00000566433.2_Missense_Mutation_p.G677D|ADCY7_ENST00000538642.1_Missense_Mutation_p.G677D|ADCY7_ENST00000254235.3_Missense_Mutation_p.G677D			P51828	ADCY7_HUMAN	adenylate cyclase 7	677					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		CTGACCATCGGCAGCCTGCTC	0.647																																																	0													49.0	45.0	46.0					16																	50342672		2198	4300	6498	SO:0001583	missense	0			D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.2030G>A	16.37:g.50342672G>A	ENSP00000378187:p.Gly677Asp		A0AVA6	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.G677D	ENST00000394697.2	37	c.2030	CCDS10741.1	16	.	.	.	.	.	.	.	.	.	.	G	14.08	2.429543	0.43122	.	.	ENSG00000121281	ENST00000538642;ENST00000394697;ENST00000254235	T;D;D	0.81579	0.99;-1.51;-1.51	5.27	5.27	0.74061	.	0.000000	0.45361	U	0.000371	D	0.82688	0.5091	M	0.69823	2.125	0.80722	D	1	B;P	0.48230	0.161;0.907	B;P	0.48677	0.091;0.586	T	0.82655	-0.0350	10	0.40728	T	0.16	.	12.5493	0.56218	0.0:0.0:0.8334:0.1666	.	677;677	P51828;F5H4D1	ADCY7_HUMAN;.	D	677	ENSP00000445046:G677D;ENSP00000378187:G677D;ENSP00000254235:G677D	ENSP00000254235:G677D	G	+	2	0	ADCY7	48900173	0.999000	0.42202	0.996000	0.52242	0.526000	0.34562	2.208000	0.42797	2.467000	0.83353	0.561000	0.74099	GGC	ADCY7	-	NULL	ENSG00000121281		0.647	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY7	HGNC	protein_coding	OTTHUMT00000256877.3	-	0.00	93	0	G			50342672	+1	tier1	-	no_errors	ENST00000254235	ensembl	human	known	74_37	missense	5.56	85	5	SNP	0.962	A
ADRA1A	148	genome.wustl.edu	37	8	26721788	26721788	+	Silent	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr8:26721788C>T	ENST00000519229.1	-	1	705	c.699G>A	c.(697-699)acG>acA	p.T233T	ADRA1A_ENST00000380587.1_Silent_p.T233T|ADRA1A_ENST00000380586.1_Silent_p.T233T|ADRA1A_ENST00000380572.3_Silent_p.T233T|ADRA1A_ENST00000358857.5_Silent_p.T233T|ADRA1A_ENST00000380582.3_Silent_p.T233T|ADRA1A_ENST00000354550.4_Silent_p.T233T|ADRA1A_ENST00000380573.3_Silent_p.T233T|ADRA1A_ENST00000276393.4_Silent_p.T233T|ADRA1A_ENST00000380581.2_Silent_p.T233T			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	303					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	GGATGCGGAGCGTCACTTGCT	0.632																																																	0													49.0	46.0	47.0					8																	26721788		2203	4300	6503	SO:0001819	synonymous_variant	0			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.699G>A	8.37:g.26721788C>T			Q9NPY0	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ADRA1A_rcpt,prints_GPCR_Rhodpsn,prints_ADR_fam	p.T233	ENST00000519229.1	37	c.699		8																																																																																			ADRA1A	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ADRA1A_rcpt	ENSG00000120907		0.632	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	ADRA1A	HGNC	protein_coding	OTTHUMT00000376207.1	-	0.00	40	0	C	NM_033303		26721788	-1	tier1	-	no_errors	ENST00000380586	ensembl	human	known	74_37	silent	8.33	44	4	SNP	0.969	T
ANAPC5	51433	genome.wustl.edu	37	12	121783796	121783796	+	Missense_Mutation	SNP	G	G	T	rs372186574		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:121783796G>T	ENST00000261819.3	-	4	557	c.436C>A	c.(436-438)Ctt>Att	p.L146I	ANAPC5_ENST00000541887.1_Missense_Mutation_p.L146I|ANAPC5_ENST00000536366.1_Missense_Mutation_p.L25I|ANAPC5_ENST00000344395.4_Missense_Mutation_p.L47I|ANAPC5_ENST00000441917.2_Missense_Mutation_p.L47I	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	146					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CTGAAAGAAAGCTTACTGTAG	0.448																																																	0													144.0	128.0	133.0					12																	121783796		2203	4300	6503	SO:0001583	missense	0			AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.436C>A	12.37:g.121783796G>T	ENSP00000261819:p.Leu146Ile		E9PFB2|Q8N4H7|Q9BQD4	Missense_Mutation	SNP	smart_TPR_repeat	p.L146I	ENST00000261819.3	37	c.436	CCDS9220.1	12	.	.	.	.	.	.	.	.	.	.	G	27.7	4.857071	0.91433	.	.	ENSG00000089053	ENST00000441917;ENST00000541887;ENST00000261819;ENST00000344395;ENST00000536366;ENST00000544442;ENST00000539871	T;T;T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14;1.14;1.14	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.63248	0.2495	M	0.74258	2.255	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.955	T	0.65772	-0.6087	10	0.87932	D	0	.	19.6299	0.95698	0.0:0.0:1.0:0.0	.	47;146	E9PFB2;Q9UJX4	.;APC5_HUMAN	I	47;146;146;47;25;47;194	ENSP00000415061:L47I;ENSP00000439875:L146I;ENSP00000261819:L146I;ENSP00000343787:L47I;ENSP00000445310:L25I;ENSP00000440800:L47I;ENSP00000445191:L194I	ENSP00000261819:L146I	L	-	1	0	ANAPC5	120268179	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.118000	0.64673	2.639000	0.89480	0.655000	0.94253	CTT	ANAPC5	-	NULL	ENSG00000089053		0.448	ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC5	HGNC	protein_coding	OTTHUMT00000402582.1	-	0.00	72	0	G			121783796	-1	tier1	-	no_errors	ENST00000261819	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
ANKRD27	84079	genome.wustl.edu	37	19	33130348	33130348	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr19:33130348C>A	ENST00000306065.4	-	12	1188	c.1030G>T	c.(1030-1032)Gca>Tca	p.A344S	ANKRD27_ENST00000587352.1_Missense_Mutation_p.A344S	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	344	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					TCATCCTTTGCCAAGCTGCTA	0.428																																																	0													166.0	154.0	158.0					19																	33130348		2203	4300	6503	SO:0001583	missense	0			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.1030G>T	19.37:g.33130348C>A	ENSP00000304292:p.Ala344Ser		Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_VPS9,superfamily_Ankyrin_rpt-contain_dom,smart_VPS9_subgr,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_VPS9,prints_Ankyrin_rpt	p.A344S	ENST00000306065.4	37	c.1030	CCDS32986.1	19	.	.	.	.	.	.	.	.	.	.	C	5.139	0.211249	0.09757	.	.	ENSG00000105186	ENST00000306065	T	0.29142	1.58	4.93	1.55	0.23275	Vacuolar sorting protein 9, subgroup (1);Vacuolar sorting protein 9 (2);	0.339974	0.25101	N	0.033121	T	0.09992	0.0245	N	0.02142	-0.665	0.20074	N	0.999937	B	0.21520	0.057	B	0.20955	0.032	T	0.24190	-1.0167	10	0.30078	T	0.28	-7.5276	5.8318	0.18584	0.0:0.6328:0.1415:0.2257	.	344	Q96NW4	ANR27_HUMAN	S	344	ENSP00000304292:A344S	ENSP00000304292:A344S	A	-	1	0	ANKRD27	37822188	0.573000	0.26676	0.237000	0.24090	0.713000	0.41058	1.117000	0.31234	0.571000	0.29365	0.563000	0.77884	GCA	ANKRD27	-	pfam_VPS9,smart_VPS9_subgr,pfscan_VPS9	ENSG00000105186		0.428	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD27	HGNC	protein_coding	OTTHUMT00000450329.1	-	0.00	51	0	C	NM_032139		33130348	-1	tier1	-	no_errors	ENST00000306065	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.365	A
ANKRD50	57182	genome.wustl.edu	37	4	125599956	125599956	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr4:125599956G>A	ENST00000504087.1	-	3	1654	c.617C>T	c.(616-618)aCg>aTg	p.T206M	ANKRD50_ENST00000515641.1_Missense_Mutation_p.T27M	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	206										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						GCTGGTAGACGTTTGTTCACC	0.473																																																	0													202.0	197.0	199.0					4																	125599956		2203	4300	6503	SO:0001583	missense	0			AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.617C>T	4.37:g.125599956G>A	ENSP00000425658:p.Thr206Met		A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.T206M	ENST00000504087.1	37	c.617	CCDS34060.1	4	.	.	.	.	.	.	.	.	.	.	G	6.878	0.531386	0.13127	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.66995	2.51;-0.24	5.81	4.96	0.65561	.	0.205916	0.41500	D	0.000866	T	0.46889	0.1416	N	0.19112	0.55	0.09310	N	1	P	0.51653	0.947	B	0.34452	0.183	T	0.39313	-0.9620	10	0.31617	T	0.26	.	15.2429	0.73485	0.0:0.2662:0.7338:0.0	.	206	Q9ULJ7	ANR50_HUMAN	M	206;27	ENSP00000425658:T206M;ENSP00000425355:T27M	ENSP00000425658:T206M	T	-	2	0	ANKRD50	125819406	0.995000	0.38212	0.010000	0.14722	0.003000	0.03518	3.209000	0.51122	1.454000	0.47793	-0.283000	0.09986	ACG	ANKRD50	-	NULL	ENSG00000151458		0.473	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD50	HGNC	protein_coding	OTTHUMT00000364775.1	-	0.00	26	0	G	NM_020337		125599956	-1	tier1	-	no_errors	ENST00000504087	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.142	A
ANKRD52	283373	genome.wustl.edu	37	12	56649607	56649607	+	Silent	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:56649607G>A	ENST00000267116.7	-	5	544	c.423C>T	c.(421-423)cgC>cgT	p.R141R		NM_173595.3	NP_775866.2	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	141										endometrium(9)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(1)	29						GCAGAGCACTGCGCCCGCTCC	0.602																																																	0													14.0	16.0	15.0					12																	56649607		2034	4183	6217	SO:0001819	synonymous_variant	0			AK091555	CCDS44920.1	12q13.3	2013-01-10			ENSG00000139645	ENSG00000139645		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	26614	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit C"""						Standard	NM_173595		Approved	FLJ34236, PP6-ARS-C	uc001skm.4	Q8NB46	OTTHUMG00000170329	ENST00000267116.7:c.423C>T	12.37:g.56649607G>A			A6NE79|B1Q2K2	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R141	ENST00000267116.7	37	c.423	CCDS44920.1	12																																																																																			ANKRD52	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000139645		0.602	ANKRD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD52	HGNC	protein_coding	OTTHUMT00000408539.1		0.00	57	0	G	NM_173595		56649607	-1			no_errors	ENST00000267116	ensembl	human	known	74_37	silent	7.04	66	5	SNP	1.000	A
ARHGEF7	8874	genome.wustl.edu	37	13	111935432	111935432	+	Intron	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr13:111935432G>T	ENST00000375741.2	+	17	2038				ARHGEF7_ENST00000426073.2_Intron|ARHGEF7_ENST00000375736.4_Intron|ARHGEF7_ENST00000478679.1_Intron|ARHGEF7_ENST00000375737.5_Intron|ARHGEF7_ENST00000370623.3_Intron|ARHGEF7_ENST00000375723.1_Intron|ARHGEF7_ENST00000218789.5_Intron|ARHGEF7_ENST00000375739.2_Intron|ARHGEF7_ENST00000544132.1_Intron|ARHGEF7_ENST00000317133.5_Intron	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7						apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GCCCTTTCGCGGTGAGCACGC	0.537																																																	0																																										SO:0001627	intron_variant	0			D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.1789-54G>T	13.37:g.111935432G>T			B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	RNA	SNP	-	NULL	ENST00000375741.2	37	NULL	CCDS45068.1	13																																																																																			ARHGEF7	-	-	ENSG00000102606		0.537	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	ARHGEF7	HGNC	protein_coding		-	0.00	72	0	G	NM_001113511		111935432	+1	tier1	-	no_errors	ENST00000491688	ensembl	human	known	74_37	rna	8.51	43	4	SNP	0.000	T
ARID1A	8289	genome.wustl.edu	37	1	27106648	27106648	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:27106648G>A	ENST00000324856.7	+	20	6630	c.6259G>A	c.(6259-6261)Gga>Aga	p.G2087R	ARID1A_ENST00000457599.2_Missense_Mutation_p.G1870R|ARID1A_ENST00000540690.1_Missense_Mutation_p.G415R|ARID1A_ENST00000374152.2_Missense_Mutation_p.G1704R	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2087			G -> R (found in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:22009941}.		androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.G2087R(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TGTCCTGGACGGACTCCTACA	0.592			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	1	Substitution - Missense(1)	breast(1)											89.0	88.0	88.0					1																	27106648		2203	4300	6503	SO:0001583	missense	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6259G>A	1.37:g.27106648G>A	ENSP00000320485:p.Gly2087Arg		D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.G2087R	ENST00000324856.7	37	c.6259	CCDS285.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.30|18.30	3.594610|3.594610	0.66219|0.66219	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690|ENST00000430799	T;T;T;T|.	0.56941|.	0.43;0.43;0.43;0.43|.	5.07|5.07	5.07|5.07	0.68467|0.68467	.|.	0.051909|.	0.85682|.	N|.	0.000000|.	D|D	0.82337|0.82337	0.5015|0.5015	M|M	0.83953|0.83953	2.67|2.67	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.999;1.0;1.0|.	T|T	0.83271|0.83271	-0.0043|-0.0043	10|5	0.87932|.	D|.	0|.	-4.2604|-4.2604	19.0485|19.0485	0.93032|0.93032	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1704;2087;1870|.	O14497-3;O14497;O14497-2|.	.;ARI1A_HUMAN;.|.	R|Q	2087;1870;1704;415|983	ENSP00000320485:G2087R;ENSP00000387636:G1870R;ENSP00000363267:G1704R;ENSP00000442437:G415R|.	ENSP00000320485:G2087R|.	G|R	+|+	1|2	0|0	ARID1A|ARID1A	26979235|26979235	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.997000|0.997000	0.91878|0.91878	9.413000|9.413000	0.97351|0.97351	2.814000|2.814000	0.96858|0.96858	0.585000|0.585000	0.79938|0.79938	GGA|CGG	ARID1A	-	pfam_DUF3518	ENSG00000117713		0.592	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	-	0.00	53	0	G	NM_139135		27106648	+1	tier1	-	no_errors	ENST00000324856	ensembl	human	known	74_37	missense	16.13	26	5	SNP	1.000	A
ARL11	115761	genome.wustl.edu	37	13	50204836	50204836	+	Missense_Mutation	SNP	G	G	A	rs374531869		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr13:50204836G>A	ENST00000282026.1	+	2	588	c.253G>A	c.(253-255)Gtg>Atg	p.V85M	ARL11_ENST00000490932.1_Intron	NM_138450.5	NP_612459.1	Q969Q4	ARL11_HUMAN	ADP-ribosylation factor-like 11	85					hematopoietic progenitor cell differentiation (GO:0002244)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			kidney(1)|large_intestine(4)|ovary(1)	6		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.119)|Kidney(9;0.169)	GBM - Glioblastoma multiforme(99;1.67e-09)		AGATATCCTCGTGTACGTGCT	0.607																																																	0													83.0	81.0	82.0					13																	50204836		2203	4300	6503	SO:0001583	missense	0			AF441378	CCDS9419.1	13q14.12	2014-05-09			ENSG00000152213	ENSG00000152213		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	24046	protein-coding gene	gene with protein product		609351				12477932	Standard	NM_138450		Approved	ARLTS1, FLJ33930	uc001vdf.2	Q969Q4	OTTHUMG00000016919	ENST00000282026.1:c.253G>A	13.37:g.50204836G>A	ENSP00000282026:p.Val85Met			Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gtr1_RagA,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom	p.V85M	ENST00000282026.1	37	c.253	CCDS9419.1	13	.	.	.	.	.	.	.	.	.	.	G	11.53	1.664743	0.29604	.	.	ENSG00000152213	ENST00000282026	D	0.84730	-1.89	5.42	2.48	0.30137	Small GTP-binding protein domain (1);	0.202270	0.42172	D	0.000757	D	0.88934	0.6572	M	0.81614	2.55	0.36652	D	0.877444	D	0.76494	0.999	P	0.60286	0.872	D	0.89685	0.3893	10	0.87932	D	0	-12.9946	6.0434	0.19746	0.2202:0.2347:0.5451:0.0	.	85	Q969Q4	ARL11_HUMAN	M	85	ENSP00000282026:V85M	ENSP00000282026:V85M	V	+	1	0	ARL11	49102837	0.701000	0.27806	0.557000	0.28306	0.018000	0.09664	1.097000	0.30988	1.288000	0.44600	0.655000	0.94253	GTG	ARL11	-	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gtr1_RagA,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom	ENSG00000152213		0.607	ARL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL11	HGNC	protein_coding	OTTHUMT00000044929.2		0.00	37	0	G	NM_138450		50204836	+1			no_errors	ENST00000282026	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.247	A
ASCL1	429	genome.wustl.edu	37	12	103352171	103352172	+	In_Frame_Ins	INS	-	-	GCA	rs71438488|rs3832799|rs369257660		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:103352171_103352172insGCA	ENST00000266744.3	+	1	708_709	c.149_150insGCA	c.(148-153)gcgcag>gcGCAgcag	p.62_63insQ		NM_004316.3	NP_004307.2	P50553	ASCL1_HUMAN	achaete-scute family bHLH transcription factor 1	62	Poly-Gln.			Q -> QQQ (in Ref. 1; AAA58376). {ECO:0000305}.	adrenal chromaffin cell differentiation (GO:0061104)|carotid body glomus cell differentiation (GO:0061103)|cell maturation (GO:0048469)|cellular response to magnetism (GO:0071259)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|cerebral cortex GABAergic interneuron differentiation (GO:0021892)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|lung epithelial cell differentiation (GO:0060487)|lung neuroendocrine cell differentiation (GO:0061100)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroblast fate determination (GO:0007400)|neuroblast proliferation (GO:0007405)|neurogenesis (GO:0022008)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|noradrenergic neuron development (GO:0003358)|noradrenergic neuron fate commitment (GO:0003359)|Notch signaling pathway (GO:0007219)|olfactory pit development (GO:0060166)|oligodendrocyte development (GO:0014003)|positive regulation of cell cycle (GO:0045787)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epithelial cell differentiation (GO:0030856)|regulation of gene expression (GO:0010468)|regulation of mitotic cell cycle (GO:0007346)|regulation of timing of subpallium neuron differentiation (GO:0060165)|response to epidermal growth factor (GO:0070849)|response to folic acid (GO:0051593)|response to lithium ion (GO:0010226)|response to retinoic acid (GO:0032526)|spinal cord association neuron differentiation (GO:0021527)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|stomach neuroendocrine cell differentiation (GO:0061102)|subpallium neuron fate commitment (GO:0060163)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)|vestibular nucleus development (GO:0021750)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)			NS(3)|large_intestine(1)|lung(1)	5						gcgcagagcgcgcagcagcagc	0.757																																																	0																																										SO:0001652	inframe_insertion	0			L08424	CCDS31886.1	12q22-q23	2013-10-17	2013-10-17			ENSG00000139352		"""Basic helix-loop-helix proteins"""	738	protein-coding gene	gene with protein product		100790	"""achaete-scute complex (Drosophila) homolog-like 1"", ""achaete-scute complex-like 1 (Drosophila)"", ""achaete-scute complex homolog 1 (Drosophila)"""			8390674	Standard	NM_004316		Approved	ASH1, HASH1, bHLHa46	uc001tjr.4	P50553		ENST00000266744.3:c.183_185dupGCA	12.37:g.103352178_103352180dupGCA	ENSP00000266744:p.Gln62_Gln62dup		A8K3C4|Q9BQ30	In_Frame_Ins	INS	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.54in_frame_insQ	ENST00000266744.3	37	c.149_150	CCDS31886.1	12																																																																																			ASCL1	-	NULL	ENSG00000139352		0.757	ASCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASCL1	HGNC	protein_coding	OTTHUMT00000406707.1		0.00	17	0	-			103352172	+1	tier1		no_errors	ENST00000266744	ensembl	human	known	74_37	in_frame_ins	28.57	10	4	INS	0.997:0.997	GCA
ASTE1	28990	genome.wustl.edu	37	3	130733046	130733047	+	Frame_Shift_Ins	INS	-	-	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr3:130733046_130733047insT	ENST00000264992.3	-	6	2335_2336	c.1894_1895insA	c.(1894-1896)aggfs	p.R632fs	ATP2C1_ENST00000359644.3_Intron|ATP2C1_ENST00000328560.8_Intron|ATP2C1_ENST00000507488.2_Intron|ATP2C1_ENST00000422190.2_Intron|ATP2C1_ENST00000513801.1_Intron|ASTE1_ENST00000514044.1_Frame_Shift_Ins_p.R657fs|ATP2C1_ENST00000393221.4_Intron|ATP2C1_ENST00000533801.2_Intron|ATP2C1_ENST00000504381.1_Intron	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	632					DNA repair (GO:0006281)		nuclease activity (GO:0004518)	p.R632fs*33(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						TTTCTTCTGCCTTTTTTTTTTT	0.406																																																	2	Deletion - Frameshift(2)	ovary(2)																																								SO:0001589	frameshift_variant	0			AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.1895dupA	3.37:g.130733057_130733057dupT	ENSP00000264992:p.Arg632fs		B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Frame_Shift_Ins	INS	pfam_XPG_DNA_repair_N	p.R632fs	ENST00000264992.3	37	c.1895_1894	CCDS3068.1	3																																																																																			ASTE1	-	NULL	ENSG00000034533		0.406	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTE1	HGNC	protein_coding	OTTHUMT00000356659.1		0.00	51	0	-	NM_014065		130733047	-1	tier1		no_errors	ENST00000264992	ensembl	human	known	74_37	frame_shift_ins	9.52	38	4	INS	0.003:0.014	T
ATM	472	genome.wustl.edu	37	11	108155199	108155199	+	Splice_Site	SNP	A	A	G			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr11:108155199A>G	ENST00000452508.2	+	27	4181	c.3992A>G	c.(3991-3993)cAg>cGg	p.Q1331R	ATM_ENST00000278616.4_Splice_Site_p.Q1331R			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1331					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.V1292_Q1331del(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TTGGGAAAACAGGTATGGCTT	0.343			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)											93.0	90.0	91.0					11																	108155199		2201	4298	6499	SO:0001630	splice_region_variant	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.3993+1A>G	11.37:g.108155199A>G			B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.Q1331R	ENST00000452508.2	37	c.3992	CCDS31669.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.90|15.90	2.968976|2.968976	0.53614|0.53614	.|.	.|.	ENSG00000149311|ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508|ENST00000531525	T;T;T|.	0.72051|.	-0.62;-0.62;-0.62|.	5.43|5.43	5.43|5.43	0.79202|0.79202	Armadillo-type fold (1);|.	0.053029|.	0.85682|.	D|.	0.000000|.	T|T	0.55386|0.55386	0.1917|0.1917	L|L	0.29908|0.29908	0.895|0.895	0.38679|0.38679	D|D	0.952498|0.952498	D|.	0.54207|.	0.965|.	P|.	0.50860|.	0.652|.	T|T	0.56189|0.56189	-0.8020|-0.8020	10|5	0.33141|.	T|.	0.24|.	.|.	15.4694|15.4694	0.75429|0.75429	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1331|.	Q13315|.	ATM_HUMAN|.	R|G	1331|1	ENSP00000435747:Q1331R;ENSP00000278616:Q1331R;ENSP00000388058:Q1331R|.	ENSP00000278616:Q1331R|.	Q|R	+|+	2|1	0|2	ATM|ATM	107660409|107660409	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.881000|0.881000	0.50899|0.50899	6.798000|6.798000	0.75155|0.75155	2.070000|2.070000	0.61991|0.61991	0.455000|0.455000	0.32223|0.32223	CAG|AGA	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.343	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	-	0.00	43	0	A	NM_000051	Missense_Mutation	108155199	+1	tier1	-	no_errors	ENST00000278616	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	G
ATP2C1	27032	genome.wustl.edu	37	3	130672735	130672735	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr3:130672735C>T	ENST00000510168.1	+	9	1152	c.602C>T	c.(601-603)cCt>cTt	p.P201L	ATP2C1_ENST00000508532.1_Missense_Mutation_p.P201L|ATP2C1_ENST00000359644.3_Missense_Mutation_p.P201L|ATP2C1_ENST00000328560.8_Missense_Mutation_p.P201L|ATP2C1_ENST00000507488.2_Missense_Mutation_p.P185L|ATP2C1_ENST00000422190.2_Missense_Mutation_p.P201L|ATP2C1_ENST00000513801.1_Missense_Mutation_p.P185L|ATP2C1_ENST00000393221.4_Missense_Mutation_p.P235L|ATP2C1_ENST00000533801.2_Missense_Mutation_p.P196L|ATP2C1_ENST00000504381.1_Missense_Mutation_p.P146L|ATP2C1_ENST00000428331.2_Missense_Mutation_p.P201L|ATP2C1_ENST00000504948.1_Missense_Mutation_p.P185L|ATP2C1_ENST00000505330.1_Missense_Mutation_p.P185L			P98194	AT2C1_HUMAN	ATPase, Ca++ transporting, type 2C, member 1	201			P -> L (in HHD). {ECO:0000269|PubMed:10767338}.		actin cytoskeleton reorganization (GO:0031532)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cellular calcium ion homeostasis (GO:0006874)|cellular manganese ion homeostasis (GO:0030026)|epidermis development (GO:0008544)|Golgi calcium ion homeostasis (GO:0032468)|Golgi calcium ion transport (GO:0032472)|ion transmembrane transport (GO:0034220)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|manganese ion binding (GO:0030145)|manganese-transporting ATPase activity (GO:0015410)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|prostate(2)|skin(2)|urinary_tract(1)	39					Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GTGACAGCTCCTCAGCCAGCT	0.443									Hailey-Hailey disease																												Esophageal Squamous(99;456 1443 27647 34099 42636)												0			GRCh37	CM003651	ATP2C1	M							133.0	126.0	128.0					3																	130672735		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	HHD, Familial Benign Chronic Pemphigus, Benign Familial Pemphigus	AF181120	CCDS33856.1, CCDS46912.1, CCDS46913.1, CCDS46914.1, CCDS56278.1, CCDS56279.1, CCDS56280.1, CCDS56281.1, CCDS75006.1	3q21.3	2012-10-22			ENSG00000017260	ENSG00000017260	3.6.3.8	"""ATPases / P-type"""	13211	protein-coding gene	gene with protein product	"""secretory pathway Ca2+/Mn2+ ATPase 1"", ""calcium-transporting ATPase type 2C member 1"""	604384	"""benign chronic pemphigus (Hailey-Hailey disease)"""	BCPM		10615129, 10767338	Standard	NM_001001485		Approved	KIAA1347, ATP2C1A, PMR1, SPCA1	uc011bli.2	P98194	OTTHUMG00000136802	ENST00000510168.1:c.602C>T	3.37:g.130672735C>T	ENSP00000427461:p.Pro201Leu		B2RAT7|B4DSW3|B7Z3X9|G3XAH8|G8JLN9|O76005|Q86V72|Q86V73|Q8N6V1|Q8NCJ7	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_PMR1,tigrfam_Cation_transp_P_typ_ATPase	p.P235L	ENST00000510168.1	37	c.704	CCDS46914.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.71|17.71	3.457784|3.457784	0.63401|0.63401	.|.	.|.	ENSG00000017260|ENSG00000017260	ENST00000504612|ENST00000505330;ENST00000504381;ENST00000507488;ENST00000393221;ENST00000533801;ENST00000510168;ENST00000508532;ENST00000504948;ENST00000513801;ENST00000328560;ENST00000428331;ENST00000359644;ENST00000422190;ENST00000347421	.|D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.87729	.|-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29;-2.29	5.42|5.42	5.42|5.42	0.78866|0.78866	.|ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	.|0.055003	.|0.64402	.|D	.|0.000001	T|T	0.81800|0.81800	0.4899|0.4899	L|L	0.28014|0.28014	0.82|0.82	0.80722|0.80722	D|D	1|1	.|B;B;B;B;B;B;B	.|0.16166	.|0.016;0.009;0.003;0.007;0.003;0.004;0.005	.|B;B;B;B;B;B;B	.|0.17979	.|0.019;0.02;0.02;0.005;0.02;0.005;0.008	T|T	0.75545|0.75545	-0.3280|-0.3280	5|10	.|0.33940	.|T	.|0.23	.|.	19.2162|19.2162	0.93780|0.93780	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|235;196;235;201;235;201;201	.|G3XAH8;B4DSW3;B4E2Q0;P98194-5;B7Z3X9;P98194-2;P98194	.|.;.;.;.;.;.;AT2C1_HUMAN	F|L	155|185;146;185;235;196;201;201;185;185;201;201;201;201;200	.|ENSP00000423774:P185L;ENSP00000425320:P146L;ENSP00000421326:P185L;ENSP00000376914:P235L;ENSP00000432956:P196L;ENSP00000427461:P201L;ENSP00000424783:P201L;ENSP00000423330:P185L;ENSP00000422872:P185L;ENSP00000329664:P201L;ENSP00000395809:P201L;ENSP00000352665:P201L;ENSP00000402677:P201L	.|ENSP00000329664:P201L	L|P	+|+	1|2	0|0	ATP2C1|ATP2C1	132155425|132155425	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	4.584000|4.584000	0.60971|0.60971	2.550000|2.550000	0.86006|0.86006	0.650000|0.650000	0.86243|0.86243	CTC|CCT	ATP2C1	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Ca-transp_PMR1,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000017260		0.443	ATP2C1-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ATP2C1	HGNC	protein_coding	OTTHUMT00000356648.2	-	0.00	50	0	C	NM_001001486		130672735	+1	tier1	-	no_errors	ENST00000393221	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
BAHCC1	57597	genome.wustl.edu	37	17	79428891	79428891	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr17:79428891G>T	ENST00000307745.7	+	30	7202	c.7202G>T	c.(7201-7203)gGt>gTt	p.G2401V	RP11-1055B8.8_ENST00000572590.1_RNA																							GCTGGCACCGGTGCGGGCTCA	0.697																																																	0													7.0	9.0	8.0					17																	79428891		2101	4167	6268	SO:0001583	missense	0																														ENST00000307745.7:c.7202G>T	17.37:g.79428891G>T	ENSP00000303486:p.Gly2401Val			Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.G2401V	ENST00000307745.7	37	c.7202		17	.	.	.	.	.	.	.	.	.	.	G	6.877	0.531130	0.13127	.	.	ENSG00000171282	ENST00000307745	T	0.11604	2.76	2.9	1.89	0.25635	.	0.000000	0.35585	N	0.003111	T	0.24005	0.0581	M	0.63843	1.955	0.09310	N	0.999996	D;D	0.76494	0.999;0.999	D;D	0.74674	0.946;0.984	T	0.01444	-1.1353	10	0.59425	D	0.04	.	7.767	0.28986	0.0:0.2604:0.7396:0.0	.	2401;2401	Q9P281;F8WBW8	BAHC1_HUMAN;.	V	2401	ENSP00000303486:G2401V	ENSP00000303486:G2401V	G	+	2	0	AC110285.1	77043486	0.001000	0.12720	0.005000	0.12908	0.002000	0.02628	0.174000	0.16743	0.737000	0.32582	0.491000	0.48974	GGT	RP11-1055B8.7	-	NULL	ENSG00000171282		0.697	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	BAHCC1	Clone_based_vega_gene	protein_coding		-	0.00	96	0	G			79428891	+1	tier1	-	no_errors	ENST00000307745	ensembl	human	known	74_37	missense	7.58	61	5	SNP	0.007	T
BOD1L1	259282	genome.wustl.edu	37	4	13615149	13615149	+	Silent	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr4:13615149C>T	ENST00000040738.5	-	5	1446	c.1311G>A	c.(1309-1311)gaG>gaA	p.E437E		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	437	Lys-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)										CTGACGTAATCTCTCCTTCTT	0.388																																																	0													174.0	165.0	168.0					4																	13615149		2203	4300	6503	SO:0001819	synonymous_variant	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.1311G>A	4.37:g.13615149C>T			Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	NULL	p.E437	ENST00000040738.5	37	c.1311	CCDS3411.2	4																																																																																			BOD1L1	-	NULL	ENSG00000038219		0.388	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1		0.00	34	0	C	NM_148894		13615149	-1			no_errors	ENST00000040738	ensembl	human	known	74_37	silent	5.56	34	2	SNP	1.000	T
BTBD10	84280	genome.wustl.edu	37	11	13410443	13410443	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr11:13410443G>A	ENST00000278174.5	-	9	1608	c.1363C>T	c.(1363-1365)Ctc>Ttc	p.L455F	BTBD10_ENST00000528120.1_Missense_Mutation_p.L407F|BTBD10_ENST00000530907.1_Missense_Mutation_p.L463F	NM_032320.5	NP_115696.2	Q9BSF8	BTBDA_HUMAN	BTB (POZ) domain containing 10	455	Interaction with AKT family members. {ECO:0000250|UniProtKB:Q80X66}.					nucleus (GO:0005634)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|prostate(1)	20				Epithelial(150;0.0214)		TGGATAGGGAGAATATCCAGC	0.493																																																	0													163.0	133.0	143.0					11																	13410443		2200	4294	6494	SO:0001583	missense	0			AY221959	CCDS7811.1, CCDS73261.1	11p15.2	2013-01-24			ENSG00000148925	ENSG00000148925		"""BTB/POZ domain containing"""	21445	protein-coding gene	gene with protein product		615933				15556295	Standard	XM_005253164		Approved	GMRP1, GMRP-1, MGC13007	uc001mkz.3	Q9BSF8	OTTHUMG00000165787	ENST00000278174.5:c.1363C>T	11.37:g.13410443G>A	ENSP00000278174:p.Leu455Phe		B7Z228|Q86WG1	Missense_Mutation	SNP	superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.L455F	ENST00000278174.5	37	c.1363	CCDS7811.1	11	.	.	.	.	.	.	.	.	.	.	G	18.22	3.574788	0.65878	.	.	ENSG00000148925	ENST00000278174;ENST00000530907;ENST00000528120	T;T;T	0.38887	1.13;1.11;1.17	5.03	4.13	0.48395	.	0.000000	0.85682	D	0.000000	T	0.48314	0.1493	L	0.36672	1.1	0.80722	D	1	D;D;D	0.63880	0.993;0.993;0.993	D;D;D	0.66351	0.943;0.943;0.943	T	0.38542	-0.9656	10	0.36615	T	0.2	-25.8875	9.3832	0.38327	0.1629:0.0:0.8371:0.0	.	463;455;455	B7Z228;D3DQW7;Q9BSF8	.;.;BTBDA_HUMAN	F	455;463;407	ENSP00000278174:L455F;ENSP00000431186:L463F;ENSP00000435257:L407F	ENSP00000278174:L455F	L	-	1	0	BTBD10	13367019	1.000000	0.71417	0.606000	0.28943	0.894000	0.52154	4.786000	0.62425	1.345000	0.45676	0.555000	0.69702	CTC	BTBD10	-	NULL	ENSG00000148925		0.493	BTBD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD10	HGNC	protein_coding	OTTHUMT00000386200.1		0.00	45	0	G	NM_032320		13410443	-1			no_errors	ENST00000278174	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	A
C12orf54	121273	genome.wustl.edu	37	12	48882278	48882279	+	Intron	INS	-	-	AAC	rs67325885|rs200977170|rs77875864	byFrequency	TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:48882278_48882279insAAC	ENST00000548364.1	+	4	192				RP11-722P11.4_ENST00000551847.1_RNA|C12orf54_ENST00000548913.1_3'UTR|C12orf54_ENST00000314014.2_Intron			Q6X4T0	CL054_HUMAN	chromosome 12 open reading frame 54											endometrium(1)|large_intestine(4)	5						AAAAAAAAAAAGAAAGAAAGAA	0.332																																																	0																																										SO:0001627	intron_variant	0			BC031670	CCDS8764.1	12q13.11	2011-01-31			ENSG00000177627	ENSG00000177627			28553	protein-coding gene	gene with protein product						12477932	Standard	NM_152319		Approved	MGC35033	uc001rrr.3	Q6X4T0	OTTHUMG00000170019	ENST00000548364.1:c.136-428->AAC	12.37:g.48882278_48882279insAAC			Q6X4S9|Q8N5S2	RNA	INS	-	NULL	ENST00000548364.1	37	NULL	CCDS8764.1	12																																																																																			C12orf54	-	-	ENSG00000177627		0.332	C12orf54-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	C12orf54	HGNC	protein_coding	OTTHUMT00000406875.1		0.00	25	0	-	NM_152319		48882279	+1	tier1		no_errors	ENST00000548913	ensembl	human	known	74_37	rna	12.00	22	3	INS	0.033:0.007	AAC
C16orf62	57020	genome.wustl.edu	37	16	19663298	19663298	+	Splice_Site	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr16:19663298G>T	ENST00000251143.5	+	26	2119	c.2107G>T	c.(2107-2109)Gcc>Tcc	p.A703S	C16orf62_ENST00000544275.1_3'UTR|C16orf62_ENST00000438132.3_Splice_Site_p.A792S|C16orf62_ENST00000417362.2_Splice_Site_p.A610S|C16orf62_ENST00000448695.1_Splice_Site_p.A553S|C16orf62_ENST00000543152.1_Splice_Site_p.A452S|C16orf62_ENST00000542263.1_Splice_Site_p.A699S			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	703						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						CTTCTCCTAGGCCTGTGTTGC	0.498																																																	0													142.0	119.0	127.0					16																	19663298		2197	4300	6497	SO:0001630	splice_region_variant	0				CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.2107-1G>T	16.37:g.19663298G>T			A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Missense_Mutation	SNP	NULL	p.A792S	ENST00000251143.5	37	c.2374		16	.	.	.	.	.	.	.	.	.	.	G	31	5.073880	0.94000	.	.	ENSG00000103544	ENST00000438132;ENST00000542263;ENST00000251143;ENST00000417362;ENST00000448695	T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;0.17	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.74876	0.3774	M	0.65677	2.01	0.80722	D	1	D;D	0.71674	0.996;0.998	D;D	0.80764	0.99;0.994	T	0.72200	-0.4362	9	.	.	.	-26.0372	18.0345	0.89296	0.0:0.0:1.0:0.0	.	699;703	F5H7K1;Q7Z3J2	.;CP062_HUMAN	S	792;699;703;610;553	ENSP00000400815:A792S;ENSP00000442468:A699S;ENSP00000251143:A703S;ENSP00000395973:A610S;ENSP00000398009:A553S	.	A	+	1	0	C16orf62	19570799	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.119000	0.94362	2.865000	0.98341	0.655000	0.94253	GCC	C16orf62	-	NULL	ENSG00000103544		0.498	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	C16orf62	HGNC	protein_coding		-	0.00	46	0	G	NM_020314	Missense_Mutation	19663298	+1	tier1	-	no_errors	ENST00000438132	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
C1orf147	574431	genome.wustl.edu	37	1	206666242	206666242	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:206666242G>T	ENST00000367119.1	-	2	302	c.292C>A	c.(292-294)Ctc>Atc	p.L98I	IKBKE_ENST00000537984.1_Intron|IKBKE_ENST00000367120.3_Intron			Q96MC9	CA147_HUMAN	chromosome 1 open reading frame 147	98										central_nervous_system(1)	1						CAGCGAGGGAGGCAAATACCC	0.622																																																	0																																										SO:0001583	missense	0			AK057159		1q32.1	2012-04-19			ENSG00000162888	ENSG00000162888			32061	protein-coding gene	gene with protein product							Standard			Approved	FLJ32597		Q96MC9	OTTHUMG00000036338	ENST00000367119.1:c.292C>A	1.37:g.206666242G>T	ENSP00000356086:p.Leu98Ile		Q5JTS5	Missense_Mutation	SNP	NULL	p.L98I	ENST00000367119.1	37	c.292		1	.	.	.	.	.	.	.	.	.	.	G	11.44	1.640594	0.29157	.	.	ENSG00000162888	ENST00000367119	T	0.77098	-1.07	4.96	-5.32	0.02722	.	.	.	.	.	T	0.65238	0.2672	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.59931	-0.7361	6	0.87932	D	0	.	0.3073	0.00282	0.2869:0.213:0.2742:0.2259	.	.	.	.	I	98	ENSP00000356086:L98I	ENSP00000356086:L98I	L	-	1	0	C1orf147	204732865	0.009000	0.17119	0.000000	0.03702	0.001000	0.01503	0.078000	0.14761	-0.959000	0.03618	-1.367000	0.01198	CTC	C1orf147	-	NULL	ENSG00000162888		0.622	C1orf147-001	KNOWN	basic|appris_principal	protein_coding	C1orf147	HGNC	protein_coding	OTTHUMT00000088457.1	-	0.00	60	0	G			206666242	-1	tier1	-	no_errors	ENST00000367119	ensembl	human	known	74_37	missense	8.89	40	4	SNP	0.000	T
C20orf203	284805	genome.wustl.edu	37	20	31238642	31238642	+	lincRNA	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr20:31238642G>A	ENST00000608990.1	-	0	749							Q8NBC4	CT203_HUMAN	chromosome 20 open reading frame 203							cytoplasm (GO:0005737)											CACCGCCAAGGTCCCAGAGGT	0.622																																																	0																																												0			AK091025		20q11.21	2013-12-06			ENSG00000198547	ENSG00000198547			26592	protein-coding gene	gene with protein product						20376170	Standard	NM_182584		Approved	FLJ33706	uc021wbx.1	Q8NBC4	OTTHUMG00000032224		20.37:g.31238642G>A			B8JHY2	RNA	SNP	-	NULL	ENST00000608990.1	37	NULL		20																																																																																			C20orf203	-	-	ENSG00000198547		0.622	C20orf203-001	KNOWN	basic	lincRNA	C20orf203	HGNC	lincRNA	OTTHUMT00000078641.3	-	0.00	87	0	G	NM_182584		31238642	-1	tier1	-	no_errors	ENST00000360785	ensembl	human	known	74_37	rna	7.00	93	7	SNP	0.000	A
C9orf41	138199	genome.wustl.edu	37	9	77632354	77632354	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr9:77632354G>A	ENST00000376834.3	-	2	393	c.241C>T	c.(241-243)Cat>Tat	p.H81Y	C9orf41_ENST00000376830.3_Missense_Mutation_p.H81Y|C9orf41_ENST00000376837.3_Missense_Mutation_p.H81Y|RP11-197P3.5_ENST00000455336.2_RNA	NM_152420.1	NP_689633.1	Q8N4J0	CI041_HUMAN	chromosome 9 open reading frame 41	81										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|urinary_tract(2)	17						ACCCGCTCATGCATACTGGTG	0.383																																																	0													120.0	111.0	114.0					9																	77632354		2203	4300	6503	SO:0001583	missense	0			AK098661	CCDS6649.1	9q21.31	2012-03-15			ENSG00000156017	ENSG00000156017			23435	protein-coding gene	gene with protein product						12477932	Standard	NM_152420		Approved	FLJ25795	uc004ajq.3	Q8N4J0	OTTHUMG00000020032	ENST00000376834.3:c.241C>T	9.37:g.77632354G>A	ENSP00000366030:p.His81Tyr		Q7Z383|Q8N7C5	Missense_Mutation	SNP	pfam_N2227	p.H81Y	ENST00000376834.3	37	c.241	CCDS6649.1	9	.	.	.	.	.	.	.	.	.	.	G	6.982	0.551238	0.13374	.	.	ENSG00000156017	ENST00000376834;ENST00000376837;ENST00000451153;ENST00000376830	.	.	.	6.06	6.06	0.98353	.	0.043558	0.85682	D	0.000000	T	0.33177	0.0854	N	0.20685	0.6	0.58432	D	0.999999	P	0.43826	0.818	B	0.32465	0.146	T	0.38265	-0.9669	9	0.02654	T	1	-19.2903	20.6397	0.99537	0.0:0.0:1.0:0.0	.	81	Q8N4J0	CI041_HUMAN	Y	81;81;20;81	.	ENSP00000366026:H81Y	H	-	1	0	C9orf41	76822174	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.925000	0.75829	2.880000	0.98712	0.650000	0.86243	CAT	C9orf41	-	NULL	ENSG00000156017		0.383	C9orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf41	HGNC	protein_coding	OTTHUMT00000052703.1		0.00	73	0	G	NM_152420		77632354	-1			no_errors	ENST00000376834	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	A
C9orf9	11092	genome.wustl.edu	37	9	135759394	135759394	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr9:135759394G>T	ENST00000372136.3	+	2	507	c.60G>T	c.(58-60)caG>caT	p.Q20H	C9orf9_ENST00000356311.5_Missense_Mutation_p.Q20H|C9orf9_ENST00000350499.6_Missense_Mutation_p.Q20H			Q96E40	CI009_HUMAN	chromosome 9 open reading frame 9	20	Poly-Gln.					cytoplasmic microtubule (GO:0005881)		p.?(1)		cervix(1)|large_intestine(1)|lung(1)|prostate(1)	4				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|GBM - Glioblastoma multiforme(294;4.84e-07)|Epithelial(140;1.28e-06)		TCTTCCAGCAGCAGCAGCTCA	0.557																																																	1	Unknown(1)	bone(1)											92.0	86.0	88.0					9																	135759394		2203	4300	6503	SO:0001583	missense	0				CCDS6955.1	9q34.13	2012-03-06			ENSG00000165698	ENSG00000165698			1367	protein-coding gene	gene with protein product							Standard	NM_018956		Approved		uc004cby.1	Q96E40	OTTHUMG00000020847	ENST00000372136.3:c.60G>T	9.37:g.135759394G>T	ENSP00000361209:p.Gln20His		Q9UGQ0	Missense_Mutation	SNP	NULL	p.Q20H	ENST00000372136.3	37	c.60		9	.	.	.	.	.	.	.	.	.	.	G	20.6	4.020382	0.75275	.	.	ENSG00000165698	ENST00000372136;ENST00000356311;ENST00000350499	T;T;T	0.58940	0.3;0.3;0.3	5.46	4.37	0.52481	.	0.000000	0.85682	D	0.000000	T	0.73791	0.3632	M	0.72894	2.215	0.47476	D	0.999439	D;D	0.89917	0.998;1.0	D;D	0.85130	0.994;0.997	T	0.76694	-0.2865	10	0.72032	D	0.01	-32.6764	14.2202	0.65820	0.0846:0.0:0.9154:0.0	.	20;20	Q96E40-2;Q96E40	.;CI009_HUMAN	H	20	ENSP00000361209:Q20H;ENSP00000348659:Q20H;ENSP00000298546:Q20H	ENSP00000298546:Q20H	Q	+	3	2	C9orf9	134749215	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.032000	0.41127	2.573000	0.86826	0.655000	0.94253	CAG	C9orf9	-	NULL	ENSG00000165698		0.557	C9orf9-001	KNOWN	basic	protein_coding	C9orf9	HGNC	protein_coding	OTTHUMT00000054806.1	-	0.00	49	0	G	NM_018956		135759394	+1	tier1	-	no_errors	ENST00000356311	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
CACNA1E	777	genome.wustl.edu	37	1	181684509	181684509	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:181684509G>T	ENST00000367573.2	+	9	1207	c.1207G>T	c.(1207-1209)Gga>Tga	p.G403*	CACNA1E_ENST00000360108.3_Nonsense_Mutation_p.G403*|CACNA1E_ENST00000367570.1_Nonsense_Mutation_p.G403*|CACNA1E_ENST00000367567.4_Nonsense_Mutation_p.G10*|CACNA1E_ENST00000526775.1_Nonsense_Mutation_p.G403*|CACNA1E_ENST00000357570.5_Nonsense_Mutation_p.G354*|CACNA1E_ENST00000358338.5_Nonsense_Mutation_p.G354*	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	403					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TAAAAATGCTGGAACATCCGC	0.373																																																	0													55.0	53.0	54.0					1																	181684509		1849	4114	5963	SO:0001587	stop_gained	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1207G>T	1.37:g.181684509G>T	ENSP00000356545:p.Gly403*		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.G403*	ENST00000367573.2	37	c.1207	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	G	48	13.924480	0.99770	.	.	ENSG00000198216	ENST00000524607;ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	19.0518	0.93050	0.0:0.0:1.0:0.0	.	.	.	.	X	403;403;403;354;354;10;403;403	.	ENSP00000350183:G354X	G	+	1	0	CACNA1E	179951132	1.000000	0.71417	0.306000	0.25113	0.913000	0.54294	8.662000	0.91130	2.673000	0.90976	0.650000	0.86243	GGA	CACNA1E	-	NULL	ENSG00000198216		0.373	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2		0.00	42	0	G	NM_000721		181684509	+1			no_errors	ENST00000367573	ensembl	human	known	74_37	nonsense	7.55	49	4	SNP	1.000	T
CCDC13	152206	genome.wustl.edu	37	3	42771960	42771960	+	Splice_Site	SNP	G	G	A	rs200289473		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr3:42771960G>A	ENST00000310232.6	-	13	1800	c.1717C>T	c.(1717-1719)Cgg>Tgg	p.R573W	CCDC13-AS1_ENST00000446950.1_RNA|CCDC13-AS1_ENST00000418161.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	573										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						ATGTGTTACCGTTTCTGCAGG	0.597																																																	0													95.0	86.0	89.0					3																	42771960		2203	4300	6503	SO:0001630	splice_region_variant	0			AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.1718+1C>T	3.37:g.42771960G>A				Missense_Mutation	SNP	superfamily_Prefoldin	p.R573W	ENST00000310232.6	37	c.1717	CCDS2705.1	3	.	.	.	.	.	.	.	.	.	.	G	20.4	3.979380	0.74360	.	.	ENSG00000244607	ENST00000310232	T	0.12774	2.65	5.76	2.6	0.31112	.	0.167523	0.49916	D	0.000127	T	0.36441	0.0967	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.26744	-1.0094	10	0.87932	D	0	.	12.7853	0.57500	0.0:0.0:0.3363:0.6637	.	573	Q8IYE1	CCD13_HUMAN	W	573	ENSP00000309836:R573W	ENSP00000309836:R573W	R	-	1	2	CCDC13	42746964	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	2.230000	0.42999	0.733000	0.32492	0.655000	0.94253	CGG	CCDC13	-	NULL	ENSG00000244607		0.597	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC13	HGNC	protein_coding	OTTHUMT00000256652.1	-	0.00	65	0	G	NM_144719	Missense_Mutation	42771960	-1	tier1	rs200289473	no_errors	ENST00000310232	ensembl	human	known	74_37	missense	8.06	57	5	SNP	1.000	A
CCDC40	55036	genome.wustl.edu	37	17	78055517	78055517	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr17:78055517C>A	ENST00000397545.4	+	11	1762	c.1735C>A	c.(1735-1737)Ctg>Atg	p.L579M	CCDC40_ENST00000374877.3_Missense_Mutation_p.L579M	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	579					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			GCAGGTGGCCCTGCAGAGCCA	0.617																																																	0													34.0	40.0	38.0					17																	78055517		2093	4218	6311	SO:0001583	missense	0			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.1735C>A	17.37:g.78055517C>A	ENSP00000380679:p.Leu579Met		A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	pfam_E3_ubiquit_lig_BRE1	p.L579M	ENST00000397545.4	37	c.1735	CCDS42395.1	17	.	.	.	.	.	.	.	.	.	.	C	14.93	2.683135	0.47991	.	.	ENSG00000141519	ENST00000374877;ENST00000397545	T;T	0.58210	0.35;0.37	5.25	2.19	0.27852	.	.	.	.	.	T	0.62245	0.2412	M	0.82923	2.615	0.36986	D	0.894544	D;D	0.63046	0.963;0.992	P;P	0.56042	0.621;0.79	T	0.64748	-0.6334	9	0.45353	T	0.12	-25.582	4.5562	0.12138	0.1451:0.4814:0.0:0.3735	.	579;362	Q4G0X9;Q4G0X9-3	CCD40_HUMAN;.	M	579	ENSP00000364011:L579M;ENSP00000380679:L579M	ENSP00000364011:L579M	L	+	1	2	CCDC40	75670112	0.009000	0.17119	0.960000	0.40013	0.822000	0.46500	0.088000	0.14979	0.589000	0.29677	0.655000	0.94253	CTG	CCDC40	-	NULL	ENSG00000141519		0.617	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC40	HGNC	protein_coding	OTTHUMT00000256005.2		0.00	42	0	C	XM_371082		78055517	+1			no_errors	ENST00000397545	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.865	A
CCDC67	159989	genome.wustl.edu	37	11	93118682	93118682	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr11:93118682G>T	ENST00000298050.3	+	8	1008	c.908G>T	c.(907-909)tGc>tTc	p.C303F	CCDC67_ENST00000525646.1_Missense_Mutation_p.C45F	NM_181645.3	NP_857596.2	Q05D60	DEUP1_HUMAN	coiled-coil domain containing 67	303					cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)	cytoplasm (GO:0005737)|deuterosome (GO:0098536)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)				ATAGGAGAGTGCCAAAATGCT	0.303																																																	0													59.0	57.0	58.0					11																	93118682		1808	4068	5876	SO:0001583	missense	0			AK058122	CCDS44707.1	11q21	2014-02-20				ENSG00000165325			26344	protein-coding gene	gene with protein product						24240477	Standard	NM_181645		Approved	FLJ25393	uc001pdq.3	Q05D60		ENST00000298050.3:c.908G>T	11.37:g.93118682G>T	ENSP00000298050:p.Cys303Phe		Q8NEF1|Q96LL7	Missense_Mutation	SNP	superfamily_MHC_II-assoc_invariant_trimer	p.C303F	ENST00000298050.3	37	c.908	CCDS44707.1	11	.	.	.	.	.	.	.	.	.	.	G	4.650	0.120828	0.08881	.	.	ENSG00000165325	ENST00000534747;ENST00000298050;ENST00000532819;ENST00000525646	T;T;T;T	0.41400	2.28;2.28;1.0;2.01	5.94	-0.498	0.12019	.	1.460460	0.03740	N	0.254894	T	0.27384	0.0672	L	0.40543	1.245	0.18873	N	0.999982	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.06516	-1.0822	10	0.10111	T	0.7	.	0.444	0.00490	0.3176:0.1335:0.1602:0.3888	.	303;303;295	Q05D60;E9PJR5;Q6ZRU6	CCD67_HUMAN;.;.	F	303;303;303;45	ENSP00000432111:C303F;ENSP00000298050:C303F;ENSP00000434635:C303F;ENSP00000435079:C45F	ENSP00000298050:C303F	C	+	2	0	CCDC67	92758330	0.000000	0.05858	0.574000	0.28523	0.955000	0.61496	-0.278000	0.08490	0.018000	0.15052	0.557000	0.71058	TGC	CCDC67	-	NULL	ENSG00000165325		0.303	CCDC67-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC67	HGNC	protein_coding		-	0.00	61	0	G	NM_181645		93118682	+1	tier1	-	no_errors	ENST00000298050	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.447	T
CCDC77	84318	genome.wustl.edu	37	12	527717	527717	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:527717G>T	ENST00000239830.4	+	5	507	c.328G>T	c.(328-330)Gct>Tct	p.A110S	CCDC77_ENST00000422000.1_Missense_Mutation_p.A78S|CCDC77_ENST00000412006.2_Missense_Mutation_p.A78S|CCDC77_ENST00000540344.1_3'UTR|CCDC77_ENST00000540180.1_Missense_Mutation_p.A78S	NM_032358.3	NP_115734.1	Q9BR77	CCD77_HUMAN	coiled-coil domain containing 77	110						centrosome (GO:0005813)|membrane (GO:0016020)				cervix(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(10;0.0149)|all_epithelial(11;0.035)|all_lung(10;0.111)|Ovarian(42;0.142)|Lung NSC(10;0.156)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.033)			ATTGCAGAAAGCTCTAAGTGA	0.423																																																	0													166.0	152.0	157.0					12																	527717		2203	4300	6503	SO:0001583	missense	0			AK027638	CCDS8503.1, CCDS44781.1	12p13.33	2006-02-16			ENSG00000120647	ENSG00000120647			28203	protein-coding gene	gene with protein product						12477932	Standard	NM_001130148		Approved	MGC13183	uc001qig.3	Q9BR77	OTTHUMG00000129214	ENST00000239830.4:c.328G>T	12.37:g.527717G>T	ENSP00000239830:p.Ala110Ser		B4DDE8	Missense_Mutation	SNP	NULL	p.A110S	ENST00000239830.4	37	c.328	CCDS8503.1	12	.	.	.	.	.	.	.	.	.	.	g	34	5.293798	0.95546	.	.	ENSG00000120647	ENST00000540180;ENST00000422000;ENST00000543504;ENST00000239830;ENST00000412006	T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.64472	0.2601	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.62025	-0.6941	10	0.31617	T	0.26	-11.7199	19.2175	0.93783	0.0:0.0:1.0:0.0	.	110	Q9BR77	CCD77_HUMAN	S	78;78;78;110;78	ENSP00000440554:A78S;ENSP00000391870:A78S;ENSP00000445873:A78S;ENSP00000239830:A110S;ENSP00000412925:A78S	ENSP00000239830:A110S	A	+	1	0	CCDC77	397978	1.000000	0.71417	0.987000	0.45799	0.826000	0.46750	9.419000	0.97397	2.707000	0.92482	0.558000	0.71614	GCT	CCDC77	-	NULL	ENSG00000120647		0.423	CCDC77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC77	HGNC	protein_coding	OTTHUMT00000251296.1	-	0.00	66	0	G	NM_032358		527717	+1	tier1	-	no_errors	ENST00000239830	ensembl	human	known	74_37	missense	6.15	59	4	SNP	1.000	T
CCDC88C	440193	genome.wustl.edu	37	14	91770137	91770137	+	Silent	SNP	T	T	C			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr14:91770137T>C	ENST00000389857.6	-	20	3629	c.3543A>G	c.(3541-3543)caA>caG	p.Q1181Q		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1181					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				ACTCGGCCGATTGCCGCTCGT	0.642																																																	0													54.0	58.0	57.0					14																	91770137		2135	4235	6370	SO:0001819	synonymous_variant	0				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.3543A>G	14.37:g.91770137T>C			Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	pfam_Hook-related_fam,superfamily_Prefoldin,superfamily_Fum_Rdtase/Succ_DH_flav-like_C	p.Q1181	ENST00000389857.6	37	c.3543	CCDS45151.1	14																																																																																			CCDC88C	-	NULL	ENSG00000015133		0.642	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	HGNC	protein_coding	OTTHUMT00000411650.1		0.00	42	0	T	XM_029353		91770137	-1			no_errors	ENST00000389857	ensembl	human	known	74_37	silent	8.33	55	5	SNP	1.000	C
CCER1	196477	genome.wustl.edu	37	12	91348412	91348412	+	Silent	SNP	C	C	T	rs370822454		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:91348412C>T	ENST00000358859.2	-	1	541	c.108G>A	c.(106-108)tcG>tcA	p.S36S	CCER1_ENST00000548187.1_Intron	NM_152638.2	NP_689851.1	Q8TC90	CCER1_HUMAN	coiled-coil glutamate-rich protein 1	36																	GATGGCAGGACGACCAGGAGC	0.657																																																	0													18.0	17.0	18.0					12																	91348412		2202	4300	6502	SO:0001819	synonymous_variant	0			BC024183	CCDS9036.1	12q21.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000197651	ENSG00000197651			28373	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 12"""	C12orf12		17967063	Standard	NM_152638		Approved	MGC26598	uc001tbj.3	Q8TC90	OTTHUMG00000170070	ENST00000358859.2:c.108G>A	12.37:g.91348412C>T			Q8TC47	Silent	SNP	NULL	p.S36	ENST00000358859.2	37	c.108	CCDS9036.1	12																																																																																			CCER1	-	NULL	ENSG00000197651		0.657	CCER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCER1	HGNC	protein_coding	OTTHUMT00000407142.2		0.00	34	0	C	NM_152638		91348412	-1			no_errors	ENST00000358859	ensembl	human	known	74_37	silent	12.90	27	4	SNP	0.057	T
CD96	10225	genome.wustl.edu	37	3	111319605	111319605	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr3:111319605A>G	ENST00000283285.5	+	8	1110	c.979A>G	c.(979-981)Aaa>Gaa	p.K327E	CD96_ENST00000438817.2_Missense_Mutation_p.K311E|CD96_ENST00000352690.4_Missense_Mutation_p.K311E	NM_198196.2	NP_937839.1	P40200	TACT_HUMAN	CD96 molecule	327	Ig-like C2-type.				cell adhesion (GO:0007155)|immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(4)|liver(2)|lung(14)|skin(5)	35						GAGAAAAGGCAAAGATGGATT	0.378									Opitz Trigonocephaly syndrome																																								0													104.0	104.0	104.0					3																	111319605		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	C syndrome, Trigonocephaly syndrome	M88282	CCDS2958.1, CCDS2959.1	3p13-q13.2	2013-01-11	2006-03-28		ENSG00000153283	ENSG00000153283		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16892	protein-coding gene	gene with protein product		606037	"""CD96 antigen"""			1313846	Standard	XR_241462		Approved	TACTILE	uc003dxx.3	P40200	OTTHUMG00000159275	ENST00000283285.5:c.979A>G	3.37:g.111319605A>G	ENSP00000283285:p.Lys327Glu		Q5JPB3	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like_dom	p.K327E	ENST00000283285.5	37	c.979	CCDS2959.1	3	.	.	.	.	.	.	.	.	.	.	A	11.06	1.528829	0.27387	.	.	ENSG00000153283	ENST00000352690;ENST00000283285;ENST00000438817	T;T;T	0.00603	6.28;6.28;6.28	4.92	-0.677	0.11357	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.870680	0.09917	N	0.739006	T	0.00412	0.0013	N	0.24115	0.695	0.09310	N	1	P;P;P;P	0.48089	0.626;0.573;0.905;0.905	B;B;B;B	0.42030	0.253;0.164;0.253;0.373	T	0.33803	-0.9854	10	0.08179	T	0.78	-4.2897	4.0515	0.09798	0.4326:0.3648:0.2026:0.0	.	311;311;327;311	E9PEJ1;P40200-2;P40200;Q8WUE2	.;.;TACT_HUMAN;.	E	311;327;311	ENSP00000342040:K311E;ENSP00000283285:K327E;ENSP00000389801:K311E	ENSP00000283285:K327E	K	+	1	0	CD96	112802295	0.002000	0.14202	0.002000	0.10522	0.093000	0.18481	0.644000	0.24766	0.270000	0.21984	-0.263000	0.10527	AAA	CD96	-	pfscan_Ig-like_dom	ENSG00000153283		0.378	CD96-001	KNOWN	basic|CCDS	protein_coding	CD96	HGNC	protein_coding	OTTHUMT00000354312.2	-	0.00	56	0	A			111319605	+1	tier1	-	no_errors	ENST00000283285	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.000	G
CLIP4	79745	genome.wustl.edu	37	2	29356672	29356672	+	Silent	SNP	G	G	A	rs150045383		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:29356672G>A	ENST00000320081.5	+	5	774	c.519G>A	c.(517-519)tcG>tcA	p.S173S	CLIP4_ENST00000401617.2_Silent_p.S66S|CLIP4_ENST00000404424.1_Silent_p.S173S|CLIP4_ENST00000401605.1_Silent_p.S173S	NM_024692.4	NP_078968.3	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family, member 4	173								p.S173S(1)		endometrium(4)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(1)	26	Acute lymphoblastic leukemia(172;0.155)					TGAAAACATCGAAACCAAAAG	0.328																																																	1	Substitution - coding silent(1)	large_intestine(1)						G		1,4405		0,1,2202	94.0	90.0	91.0		519	-10.6	0.8	2	dbSNP_134	91	0,8600		0,0,4300	no	coding-synonymous	CLIP4	NM_024692.4		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		173/706	29356672	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AK024722	CCDS1770.1, CCDS74502.1	2p23	2013-01-10	2007-01-04	2007-01-04	ENSG00000115295	ENSG00000115295		"""Ankyrin repeat domain containing"""	26108	protein-coding gene	gene with protein product			"""restin-like 2"""	RSNL2			Standard	XM_005264562		Approved	FLJ21069	uc002rmv.3	Q8N3C7	OTTHUMG00000097837	ENST00000320081.5:c.519G>A	2.37:g.29356672G>A			A0AV10|B2RMQ3|B7Z7N8|Q7Z4U3|Q96BR7|Q96MA5|Q9H7C0	Silent	SNP	pfam_CAP-Gly_domain,pfam_Ankyrin_rpt,superfamily_CAP-Gly_domain,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_CAP-Gly_domain	p.S173	ENST00000320081.5	37	c.519	CCDS1770.1	2																																																																																			CLIP4	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000115295		0.328	CLIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP4	HGNC	protein_coding	OTTHUMT00000215123.2	-	0.00	83	0	G	NM_024692		29356672	+1	tier1	rs150045383	no_errors	ENST00000320081	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.216	A
CNPY4	245812	genome.wustl.edu	37	7	99717419	99717419	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr7:99717419G>T	ENST00000262932.3	+	1	184	c.52G>T	c.(52-54)Gag>Tag	p.E18*	TAF6_ENST00000344095.4_5'Flank|TAF6_ENST00000497233.1_5'Flank|TAF6_ENST00000452041.1_5'Flank|RP11-506M12.1_ENST00000494221.1_RNA|TAF6_ENST00000418432.2_5'Flank|TAF6_ENST00000437822.2_5'UTR|TAF6_ENST00000453269.2_5'Flank	NM_152755.1	NP_689968.1	Q8N129	CNPY4_HUMAN	canopy FGF signaling regulator 4	18						extracellular region (GO:0005576)				breast(2)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGCCGTGCACGAGGCTTGGGC	0.532																																																	0													215.0	194.0	201.0					7																	99717419		2203	4300	6503	SO:0001587	stop_gained	0			AK075537	CCDS34701.1	7q22.1	2013-07-23	2013-07-23		ENSG00000166997	ENSG00000166997			28631	protein-coding gene	gene with protein product	"""protein associated with TLR4"""	610047	"""canopy 4 homolog (zebrafish)"""			12975309	Standard	NM_152755		Approved	MGC40499, PRAT4B	uc003uto.3	Q8N129	OTTHUMG00000154817	ENST00000262932.3:c.52G>T	7.37:g.99717419G>T	ENSP00000262932:p.Glu18*		Q8WUN9	Nonsense_Mutation	SNP	pfam_DUF3456	p.E18*	ENST00000262932.3	37	c.52	CCDS34701.1	7	.	.	.	.	.	.	.	.	.	.	G	16.36	3.100038	0.56183	.	.	ENSG00000166997	ENST00000262932	.	.	.	4.91	3.1	0.35709	.	0.819399	0.11488	N	0.559006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-4.6607	6.7073	0.23258	0.2058:0.0:0.7942:0.0	.	.	.	.	X	18	.	ENSP00000262932:E18X	E	+	1	0	CNPY4	99555355	0.011000	0.17503	0.007000	0.13788	0.115000	0.19883	0.154000	0.16343	1.434000	0.47414	0.462000	0.41574	GAG	CNPY4	-	NULL	ENSG00000166997		0.532	CNPY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNPY4	HGNC	protein_coding	OTTHUMT00000337224.4		0.00	70	0	G	NM_152755		99717419	+1			no_errors	ENST00000262932	ensembl	human	known	74_37	nonsense	5.56	51	3	SNP	0.004	T
CTTNBP2NL	55917	genome.wustl.edu	37	1	112998846	112998846	+	Silent	SNP	C	C	T	rs551998213		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:112998846C>T	ENST00000271277.6	+	6	957	c.732C>T	c.(730-732)atC>atT	p.I244I		NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	244					negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGTTTGACATCGAAAGGGAAC	0.463													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18354	0.0		0.0	False		,,,				2504	0.0																0													93.0	104.0	100.0					1																	112998846		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.732C>T	1.37:g.112998846C>T			B3KMS5|Q96B40	Silent	SNP	pfam_Cortactin-binding_p2_N	p.I244	ENST00000271277.6	37	c.732	CCDS845.1	1																																																																																			CTTNBP2NL	-	NULL	ENSG00000143079		0.463	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2NL	HGNC	protein_coding	OTTHUMT00000030686.1		0.00	34	0	C	NM_018704		112998846	+1			no_errors	ENST00000271277	ensembl	human	known	74_37	silent	5.00	38	2	SNP	0.310	T
DAB2IP	153090	genome.wustl.edu	37	9	124535012	124535012	+	Silent	SNP	T	T	C			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr9:124535012T>C	ENST00000408936.3	+	12	2387	c.2205T>C	c.(2203-2205)ccT>ccC	p.P735P	DAB2IP_ENST00000309989.1_Silent_p.P611P|DAB2IP_ENST00000259371.2_Silent_p.P707P			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	735	Necessary for interaction with AKT1.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						CCAACGAGCCTGATCTTCAGA	0.642																																																	0													39.0	41.0	40.0					9																	124535012		2203	4300	6503	SO:0001819	synonymous_variant	0			AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.2205T>C	9.37:g.124535012T>C			A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Silent	SNP	pfam_DUF3498,pfam_RasGAP,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.P735	ENST00000408936.3	37	c.2205		9																																																																																			DAB2IP	-	pfam_DUF3498	ENSG00000136848		0.642	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	DAB2IP	HGNC	protein_coding	OTTHUMT00000317857.1		0.00	66	0	T	NM_032552		124535012	+1			no_errors	ENST00000408936	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.604	C
DACH1	1602	genome.wustl.edu	37	13	72255964	72255964	+	Silent	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr13:72255964G>T	ENST00000359684.2	-	2	932	c.933C>A	c.(931-933)gtC>gtA	p.V311V	DACH1_ENST00000354591.4_Silent_p.V311V|DACH1_ENST00000313174.7_Silent_p.V311V|DACH1_ENST00000305425.4_Silent_p.V311V			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	311	Interaction with SIX6 and HDAC3. {ECO:0000250}.				cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		TGAGACCAGGGACAGAATGCG	0.423																																																	0													114.0	114.0	114.0					13																	72255964		1931	4139	6070	SO:0001819	synonymous_variant	0			AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.933C>A	13.37:g.72255964G>T			D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Silent	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.V311	ENST00000359684.2	37	c.933		13																																																																																			DACH1	-	NULL	ENSG00000165659		0.423	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	DACH1	HGNC	protein_coding	OTTHUMT00000045240.1	-	0.00	72	0	G	NM_004392		72255964	-1	tier1	-	no_errors	ENST00000359684	ensembl	human	known	74_37	silent	6.67	56	4	SNP	1.000	T
DCC	1630	genome.wustl.edu	37	18	51013172	51013172	+	Missense_Mutation	SNP	G	G	A	rs201242417		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr18:51013172G>A	ENST00000442544.2	+	26	4358	c.3742G>A	c.(3742-3744)Gtg>Atg	p.V1248M	DCC_ENST00000581580.1_Missense_Mutation_p.V883M|RP11-671P2.1_ENST00000582064.1_RNA	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1248					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)	p.V1248M(1)		NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TGCAGCTGTCGTGAGCGCCAT	0.488																																																	1	Substitution - Missense(1)	urinary_tract(1)											96.0	88.0	90.0					18																	51013172		2203	4300	6503	SO:0001583	missense	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3742G>A	18.37:g.51013172G>A	ENSP00000389140:p.Val1248Met			Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V1248M	ENST00000442544.2	37	c.3742	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	G	11.97	1.797157	0.31777	.	.	ENSG00000187323	ENST00000442544	T	0.52526	0.66	5.34	5.34	0.76211	Neogenin, C-terminal (1);	0.000000	0.64402	D	0.000014	T	0.65626	0.2709	L	0.56769	1.78	0.54753	D	0.999983	D	0.76494	0.999	D	0.75484	0.986	T	0.63242	-0.6681	10	0.39692	T	0.17	-6.2316	17.8261	0.88666	0.0:0.0:1.0:0.0	.	1248	P43146	DCC_HUMAN	M	1248	ENSP00000389140:V1248M	ENSP00000389140:V1248M	V	+	1	0	DCC	49267170	1.000000	0.71417	0.962000	0.40283	0.522000	0.34438	8.174000	0.89682	2.499000	0.84300	0.462000	0.41574	GTG	DCC	-	pfam_Neogenin_C	ENSG00000187323		0.488	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3		0.00	71	0	G	NM_005215		51013172	+1			no_errors	ENST00000442544	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.999	A
DCHS2	54798	genome.wustl.edu	37	4	155155708	155155708	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr4:155155708C>T	ENST00000357232.4	-	25	8730	c.8731G>A	c.(8731-8733)Gaa>Aaa	p.E2911K		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2911					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ACTTCATCTTCTGCTTTAAGT	0.428																																																	0													150.0	126.0	134.0					4																	155155708		2203	4300	6503	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.8731G>A	4.37:g.155155708C>T	ENSP00000349768:p.Glu2911Lys		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E2911K	ENST00000357232.4	37	c.8731	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	C	17.33	3.362326	0.61403	.	.	ENSG00000197410	ENST00000357232	T	0.55930	0.49	5.5	5.5	0.81552	.	0.269961	0.32640	N	0.005831	T	0.35740	0.0942	N	0.04508	-0.205	0.80722	D	1	P	0.52316	0.952	P	0.44422	0.449	T	0.44329	-0.9335	10	0.62326	D	0.03	.	15.1217	0.72450	0.0:0.8592:0.1408:0.0	.	2911	Q6V1P9	PCD23_HUMAN	K	2911	ENSP00000349768:E2911K	ENSP00000349768:E2911K	E	-	1	0	DCHS2	155375158	0.979000	0.34478	0.992000	0.48379	0.432000	0.31715	1.877000	0.39598	2.854000	0.98071	0.655000	0.94253	GAA	DCHS2	-	NULL	ENSG00000197410		0.428	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	-	0.00	44	0	C	NM_001142552		155155708	-1	tier1	-	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
DCTN1	1639	genome.wustl.edu	37	2	74596337	74596337	+	Missense_Mutation	SNP	A	A	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:74596337A>T	ENST00000361874.3	-	15	1906	c.1589T>A	c.(1588-1590)gTg>gAg	p.V530E	DCTN1_ENST00000394003.3_Missense_Mutation_p.V523E|DCTN1_ENST00000409240.1_Missense_Mutation_p.V493E|DCTN1_ENST00000409868.1_Missense_Mutation_p.V513E|DCTN1_ENST00000495643.1_5'Flank|DCTN1_ENST00000409438.1_Missense_Mutation_p.V396E|DCTN1_ENST00000409567.3_Missense_Mutation_p.V510E|DCTN1_ENST00000407639.2_Missense_Mutation_p.V396E	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	530					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						TTCCCGATTCACATCCTAGGA	0.522																																																	0													138.0	129.0	132.0					2																	74596337		2203	4300	6503	SO:0001583	missense	0				CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.1589T>A	2.37:g.74596337A>T	ENSP00000354791:p.Val530Glu		A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	pfam_Dynactin,pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_Polyketide_synth_docking,superfamily_P-loop_NTPase,pfscan_CAP-Gly_domain	p.V530E	ENST00000361874.3	37	c.1589	CCDS1939.1	2	.	.	.	.	.	.	.	.	.	.	A	11.98	1.799918	0.31869	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	D;D;D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65	5.38	5.38	0.77491	.	0.000000	0.39083	N	0.001478	D	0.84973	0.5591	L	0.57536	1.79	0.80722	D	1	P;B;D;B;B;D	0.63046	0.673;0.044;0.992;0.001;0.004;0.99	B;B;P;B;B;P	0.59221	0.396;0.048;0.854;0.003;0.017;0.772	T	0.81885	-0.0727	10	0.02654	T	1	-10.6772	14.5192	0.67840	1.0:0.0:0.0:0.0	.	510;493;530;523;396;396	E9PGE1;E9PFS5;Q14203;A8MY36;Q14203-2;G5E9H4	.;.;DCTN1_HUMAN;.;.;.	E	530;523;513;396;396;493;513;510	ENSP00000354791:V530E;ENSP00000377571:V523E;ENSP00000384844:V396E;ENSP00000387270:V396E;ENSP00000386406:V493E;ENSP00000387327:V513E;ENSP00000386843:V510E	ENSP00000354791:V530E	V	-	2	0	DCTN1	74449845	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	4.090000	0.57693	2.254000	0.74563	0.533000	0.62120	GTG	DCTN1	-	pfam_Dynactin,superfamily_P-loop_NTPase	ENSG00000204843		0.522	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCTN1	HGNC	protein_coding	OTTHUMT00000252227.3		0.00	75	0	A	NM_004082		74596337	-1			no_errors	ENST00000361874	ensembl	human	known	74_37	missense	5.41	69	4	SNP	1.000	T
DENND4B	9909	genome.wustl.edu	37	1	153914579	153914579	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:153914579G>T	ENST00000361217.4	-	6	1239	c.821C>A	c.(820-822)gCc>gAc	p.A274D		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	274	UDENN.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CTGCAGGGCGGCACCATACAC	0.662																																																	0													25.0	30.0	28.0					1																	153914579		2083	4185	6268	SO:0001583	missense	0			AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.821C>A	1.37:g.153914579G>T	ENSP00000354597:p.Ala274Asp		Q5T4K0	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.A274D	ENST00000361217.4	37	c.821	CCDS44228.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.96|16.96	3.266305|3.266305	0.59540|0.59540	.|.	.|.	ENSG00000198837|ENSG00000198837	ENST00000361217;ENST00000368646|ENST00000472932	T;T|.	0.45668|.	0.89;0.89|.	4.39|4.39	4.39|4.39	0.52855|0.52855	uDENN (3);|.	.|.	.|.	.|.	.|.	T|T	0.80701|0.80701	0.4673|0.4673	M|M	0.89715|0.89715	3.055|3.055	0.54753|0.54753	D|D	0.999986|0.999986	D|.	0.67145|.	0.996|.	D|.	0.67382|.	0.951|.	D|D	0.84621|0.84621	0.0684|0.0684	9|5	0.72032|.	D|.	0.01|.	0.2483|0.2483	15.8831|15.8831	0.79219|0.79219	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	274|.	O75064|.	DEN4B_HUMAN|.	D|T	274;285|123	ENSP00000354597:A274D;ENSP00000357635:A285D|.	ENSP00000354597:A274D|.	A|P	-|-	2|1	0|0	DENND4B|DENND4B	152181203|152181203	1.000000|1.000000	0.71417|0.71417	0.965000|0.965000	0.40720|0.40720	0.992000|0.992000	0.81027|0.81027	7.703000|7.703000	0.84585|0.84585	2.292000|2.292000	0.77174|0.77174	0.462000|0.462000	0.41574|0.41574	GCC|CCG	DENND4B	-	pfam_uDENN_dom,smart_uDENN_dom,pfscan_uDENN_dom	ENSG00000198837		0.662	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4B	HGNC	protein_coding	OTTHUMT00000090278.2	-	0.00	84	0	G	XM_375806		153914579	-1	tier1	-	no_errors	ENST00000361217	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.984	T
DIAPH1	1729	genome.wustl.edu	37	5	140896575	140896575	+	Splice_Site	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr5:140896575G>A	ENST00000398557.4	-	28	3802	c.3662C>T	c.(3661-3663)gCc>gTc	p.A1221V	DIAPH1_ENST00000253811.6_Splice_Site_p.A1222V|DIAPH1_ENST00000398566.3_Splice_Site_p.A1213V|DIAPH1_ENST00000518047.1_Splice_Site_p.A1209V|DIAPH1_ENST00000389054.3_Splice_Site_p.A1218V|DIAPH1_ENST00000520569.1_Splice_Site_p.A1164V|DIAPH1_ENST00000398562.2_Splice_Site_p.A1197V|DIAPH1_ENST00000389057.5_Splice_Site_p.A1212V	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	1221	DAD. {ECO:0000255|PROSITE- ProRule:PRU00577}.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTCCTGTTGGCTGCAAGAGA	0.493																																																	0													57.0	55.0	56.0					5																	140896575		2005	4174	6179	SO:0001630	splice_region_variant	0			BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.3662-1C>T	5.37:g.140896575G>A			A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_Formin_homology_1,pfam_Drf_DAD,superfamily_ARM-type_fold,superfamily_tRNA-bd_arm,smart_FH2_Formin	p.A1222V	ENST00000398557.4	37	c.3665	CCDS43374.1	5	.	.	.	.	.	.	.	.	.	.	G	15.57	2.871693	0.51695	.	.	ENSG00000131504	ENST00000389054;ENST00000520569;ENST00000398562;ENST00000389057;ENST00000398566;ENST00000398557;ENST00000253811;ENST00000448451;ENST00000518047	D;D;T;D;D;D;D;D	0.81659	-1.52;-1.52;-1.39;-1.52;-1.52;-1.52;-1.52;-1.52	5.19	-1.56	0.08532	Diaphanous autoregulatory (1);	0.642322	0.14062	N	0.343971	T	0.68751	0.3035	L	0.34521	1.04	0.32508	N	0.53793	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.58075	-0.7700	10	0.27785	T	0.31	.	13.5165	0.61543	0.0717:0.6296:0.2987:0.0	.	1212;1221	E9PEZ2;O60610	.;DIAP1_HUMAN	V	1218;1164;1197;1212;1213;1221;1222;84;1209	ENSP00000373706:A1218V;ENSP00000429282:A1164V;ENSP00000381570:A1197V;ENSP00000373709:A1212V;ENSP00000381572:A1213V;ENSP00000381565:A1221V;ENSP00000253811:A1222V;ENSP00000428268:A1209V	ENSP00000253811:A1222V	A	-	2	0	DIAPH1	140876759	1.000000	0.71417	0.980000	0.43619	0.972000	0.66771	0.329000	0.19698	-0.528000	0.06366	0.563000	0.77884	GCC	DIAPH1	-	NULL	ENSG00000131504		0.493	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	DIAPH1	HGNC	protein_coding		-	0.00	27	0	G	NM_005219	Missense_Mutation	140896575	-1	tier1	-	no_errors	ENST00000253811	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.998	A
DLX5	1749	genome.wustl.edu	37	7	96650277	96650277	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr7:96650277G>T	ENST00000222598.4	-	3	1114	c.641C>A	c.(640-642)gCg>gAg	p.A214E	DLX5_ENST00000493764.1_5'UTR	NM_005221.5	NP_005212.1	P56178	DLX5_HUMAN	distal-less homeobox 5	214					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell proliferation (GO:0008283)|cellular response to BMP stimulus (GO:0071773)|embryonic limb morphogenesis (GO:0030326)|endochondral ossification (GO:0001958)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|olfactory pit development (GO:0060166)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)	20	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					CGAGTTACACGCCATTGGGTC	0.597																																																	0													71.0	69.0	69.0					7																	96650277		2203	4300	6503	SO:0001583	missense	0				CCDS5647.1	7q21.3	2011-06-20	2005-12-22		ENSG00000105880	ENSG00000105880		"""Homeoboxes / ANTP class : NKL subclass"""	2918	protein-coding gene	gene with protein product		600028	"""distal-less homeo box 5"""			7907794	Standard	XM_005250185		Approved		uc003uon.3	P56178	OTTHUMG00000154200	ENST00000222598.4:c.641C>A	7.37:g.96650277G>T	ENSP00000222598:p.Ala214Glu		B7Z4P3|Q9UPL1	Missense_Mutation	SNP	pfam_Distal-less_N,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.A214E	ENST00000222598.4	37	c.641	CCDS5647.1	7	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112386	0.77210	.	.	ENSG00000105880	ENST00000222598	D	0.89939	-2.59	5.08	5.08	0.68730	.	0.051938	0.85682	D	0.000000	D	0.91713	0.7380	M	0.80616	2.505	0.80722	D	1	P	0.46064	0.872	P	0.47346	0.544	D	0.91942	0.5564	10	0.46703	T	0.11	-9.1488	18.6767	0.91531	0.0:0.0:1.0:0.0	.	214	P56178	DLX5_HUMAN	E	214	ENSP00000222598:A214E	ENSP00000222598:A214E	A	-	2	0	DLX5	96488213	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.702000	0.84576	2.640000	0.89533	0.655000	0.94253	GCG	DLX5	-	NULL	ENSG00000105880		0.597	DLX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX5	HGNC	protein_coding	OTTHUMT00000334371.2		0.00	68	0	G			96650277	-1			no_errors	ENST00000222598	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	T
DNAH17	8632	genome.wustl.edu	37	17	76562801	76562801	+	Silent	SNP	A	A	G			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr17:76562801A>G	ENST00000585328.1	-	11	1588	c.1464T>C	c.(1462-1464)cgT>cgC	p.R488R	DNAH17_ENST00000389840.5_Silent_p.R488R	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	488	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CAGCATAATCACGGTCAAAAT	0.483																																																	0													57.0	54.0	55.0					17																	76562801		2202	4300	6502	SO:0001819	synonymous_variant	0			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.1464T>C	17.37:g.76562801A>G			O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_HR1_rho-bd	p.R488	ENST00000585328.1	37	c.1464		17																																																																																			DNAH17	-	pfam_Dynein_heavy_dom-1	ENSG00000187775		0.483	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000318962.2		0.00	45	0	A	NM_173628		76562801	-1			no_errors	ENST00000389840	ensembl	human	known	74_37	silent	8.16	44	4	SNP	0.000	G
DNM1P46	196968	genome.wustl.edu	37	15	100340361	100340361	+	RNA	SNP	G	G	A	rs536716167	byFrequency	TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr15:100340361G>A	ENST00000341853.1	-	0	565					NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										GCATCTCGTCGCGCCGCTGTG	0.612													.|||	34	0.00678914	0.0197	0.0014	5008	,	,		21710	0.003		0.002	False		,,,				2504	0.002																0																																												0			AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100340361G>A			Q3ZCN3	RNA	SNP	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			DNM1P46	-	-	ENSG00000182397		0.612	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	HGNC	pseudogene	OTTHUMT00000313543.1	-	0.00	47	0	G	NR_003260		100340361	-1	tier1	-	no_errors	ENST00000341853	ensembl	human	known	74_37	rna	9.86	64	7	SNP	0.996	A
DSCAM	1826	genome.wustl.edu	37	21	42080670	42080670	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr21:42080670A>G	ENST00000400454.1	-	2	548	c.71T>C	c.(70-72)cTc>cCc	p.L24P		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	24					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GACAAAGTAGAGGCTGGAGTG	0.517																																					Melanoma(134;970 1778 1785 21664 32388)												0													96.0	99.0	98.0					21																	42080670		1983	4146	6129	SO:0001583	missense	0			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.71T>C	21.37:g.42080670A>G	ENSP00000383303:p.Leu24Pro		O60468	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L24P	ENST00000400454.1	37	c.71	CCDS42929.1	21	.	.	.	.	.	.	.	.	.	.	A	18.29	3.592149	0.66219	.	.	ENSG00000171587	ENST00000400454	T	0.60672	0.17	4.95	4.95	0.65309	.	0.085098	0.48286	D	0.000193	T	0.71787	0.3381	M	0.72894	2.215	0.58432	D	0.999999	D	0.65815	0.995	D	0.75484	0.986	T	0.68949	-0.5274	10	0.19590	T	0.45	.	13.4949	0.61419	1.0:0.0:0.0:0.0	.	24	O60469	DSCAM_HUMAN	P	24	ENSP00000383303:L24P	ENSP00000383303:L24P	L	-	2	0	DSCAM	41002540	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.798000	0.91888	1.997000	0.58415	0.477000	0.44152	CTC	DSCAM	-	NULL	ENSG00000171587		0.517	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	HGNC	protein_coding	OTTHUMT00000195029.1	-	0.00	39	0	A	NM_001389		42080670	-1	tier1	-	no_errors	ENST00000400454	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	G
EBF4	57593	genome.wustl.edu	37	20	2686660	2686660	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr20:2686660G>A	ENST00000609451.1	+	3	407	c.335G>A	c.(334-336)cGc>cAc	p.R112H	EBF4_ENST00000380648.4_Missense_Mutation_p.R108H			Q9BQW3	COE4_HUMAN	early B-cell factor 4	112					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										ATCCATTACCGCCTCCGGCTG	0.612																																																	0													68.0	80.0	76.0					20																	2686660		692	1591	2283	SO:0001583	missense	0			BC019106	CCDS46573.1	20p13	2008-10-23			ENSG00000088881	ENSG00000088881			29278	protein-coding gene	gene with protein product		609935				10718198	Standard	NM_001110514		Approved	KIAA1442, COE4, RP5-860F19.3, O/E-4	uc002wgt.4	Q9BQW3	OTTHUMG00000031709	ENST00000609451.1:c.335G>A	20.37:g.2686660G>A	ENSP00000477023:p.Arg112His		Q1MTP7|Q5JY53|Q9NUB6|Q9P2A6	Missense_Mutation	SNP	pfam_IPT,superfamily_Ig_E-set,smart_IPT	p.R108H	ENST00000609451.1	37	c.323		20	.	.	.	.	.	.	.	.	.	.	G	22.4	4.285696	0.80803	.	.	ENSG00000088881	ENST00000380648;ENST00000342725	T;T	0.55930	0.49;0.49	4.86	4.86	0.63082	.	0.000000	0.49916	D	0.000124	T	0.62636	0.2444	M	0.64997	1.995	0.38345	D	0.944175	D	0.76494	0.999	P	0.59012	0.85	T	0.69075	-0.5241	10	0.87932	D	0	-17.4171	9.4951	0.38984	0.0978:0.0:0.9022:0.0	.	108	E9PEI2	.	H	108;112	ENSP00000370022:R108H;ENSP00000345030:R112H	ENSP00000345030:R112H	R	+	2	0	EBF4	2634660	0.018000	0.18449	1.000000	0.80357	0.946000	0.59487	1.172000	0.31908	2.399000	0.81585	0.591000	0.81541	CGC	EBF4	-	NULL	ENSG00000088881		0.612	EBF4-011	PUTATIVE	basic|appris_candidate_longest	protein_coding	EBF4	HGNC	protein_coding	OTTHUMT00000471930.1	-	0.00	39	0	G	XM_938882		2686660	+1	tier1	-	no_errors	ENST00000380648	ensembl	human	known	74_37	missense	16.07	47	9	SNP	1.000	A
EDIL3	10085	genome.wustl.edu	37	5	83402504	83402504	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr5:83402504C>T	ENST00000296591.5	-	6	1032	c.614G>A	c.(613-615)tGg>tAg	p.W205*	EDIL3_ENST00000380138.3_Nonsense_Mutation_p.W195*	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	205	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		TGCAGCTGTCCACGCATTTAT	0.413																																																	0													169.0	160.0	163.0					5																	83402504		2203	4300	6503	SO:0001587	stop_gained	0			U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.614G>A	5.37:g.83402504C>T	ENSP00000296591:p.Trp205*		B2R763|O43855|Q5D094|Q8N610	Nonsense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_EG-like_dom,pfam_EGF_extracell,superfamily_Galactose-bd-like,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Coagulation_fac_5/8-C_type_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.W205*	ENST00000296591.5	37	c.614	CCDS4062.1	5	.	.	.	.	.	.	.	.	.	.	C	39	7.630596	0.98399	.	.	ENSG00000164176	ENST00000296591;ENST00000380138	.	.	.	5.55	5.55	0.83447	.	0.169261	0.56097	D	0.000031	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.2045	19.5157	0.95162	0.0:1.0:0.0:0.0	.	.	.	.	X	205;195	.	ENSP00000296591:W205X	W	-	2	0	EDIL3	83438260	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.277000	0.78572	2.630000	0.89119	0.650000	0.86243	TGG	EDIL3	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000164176		0.413	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EDIL3	HGNC	protein_coding	OTTHUMT00000239258.1	-	0.00	73	0	C	NM_005711		83402504	-1	tier1	-	no_errors	ENST00000296591	ensembl	human	known	74_37	nonsense	5.00	76	4	SNP	1.000	T
EFCAB1	79645	genome.wustl.edu	37	8	49647703	49647703	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr8:49647703C>T	ENST00000262103.3	-	1	88	c.8G>A	c.(7-9)cGc>cAc	p.R3H	EFCAB1_ENST00000523092.1_Missense_Mutation_p.R3H|EFCAB1_ENST00000521002.1_5'UTR|EFCAB1_ENST00000433756.1_Missense_Mutation_p.R3H	NM_024593.3	NP_078869.1	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1	3							calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(2)	14		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				CAGTTTCTTGCGGTTCATGTC	0.622																																																	0													154.0	143.0	147.0					8																	49647703		2203	4300	6503	SO:0001583	missense	0				CCDS6145.1, CCDS47853.1	8q11.21	2013-01-10			ENSG00000034239	ENSG00000034239		"""EF-hand domain containing"""	25678	protein-coding gene	gene with protein product						12477932	Standard	NM_024593		Approved	FLJ11767	uc003xqo.2	Q9HAE3	OTTHUMG00000164203	ENST00000262103.3:c.8G>A	8.37:g.49647703C>T	ENSP00000262103:p.Arg3His		B4DSB4|E7EVN7	Missense_Mutation	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.R3H	ENST00000262103.3	37	c.8	CCDS6145.1	8	.	.	.	.	.	.	.	.	.	.	C	23.7	4.442902	0.83993	.	.	ENSG00000034239	ENST00000433756;ENST00000262103;ENST00000450553;ENST00000523092	T;T;T	0.72835	-0.69;-0.62;-0.69	5.04	5.04	0.67666	.	0.290949	0.34853	N	0.003630	D	0.82309	0.5009	M	0.65975	2.015	0.46927	D	0.99925	D;D	0.76494	0.999;0.999	D;P	0.74674	0.984;0.894	D	0.83601	0.0128	10	0.59425	D	0.04	.	16.2538	0.82501	0.0:1.0:0.0:0.0	.	3;3	Q9HAE3-2;Q9HAE3	.;EFCB1_HUMAN	H	3	ENSP00000400873:R3H;ENSP00000262103:R3H;ENSP00000430765:R3H	ENSP00000262103:R3H	R	-	2	0	EFCAB1	49810256	1.000000	0.71417	1.000000	0.80357	0.685000	0.39939	4.469000	0.60169	2.516000	0.84829	0.462000	0.41574	CGC	EFCAB1	-	NULL	ENSG00000034239		0.622	EFCAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB1	HGNC	protein_coding	OTTHUMT00000377778.1		0.00	73	0	C	NM_024593		49647703	-1			no_errors	ENST00000262103	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
EIF2A	83939	genome.wustl.edu	37	3	150280436	150280436	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr3:150280436A>G	ENST00000460851.1	+	4	390	c.281A>G	c.(280-282)cAg>cGg	p.Q94R	EIF2A_ENST00000406576.3_Missense_Mutation_p.Q94R|EIF2A_ENST00000487799.1_Missense_Mutation_p.Q69R|SERP1_ENST00000479209.1_Intron|EIF2A_ENST00000273435.5_Missense_Mutation_p.Q89R			Q9BY44	EIF2A_HUMAN	eukaryotic translation initiation factor 2A, 65kDa	94					positive regulation of signal transduction (GO:0009967)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|ribosome assembly (GO:0042255)|SREBP signaling pathway (GO:0032933)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|eukaryotic translation initiation factor 2 complex (GO:0005850)|extracellular space (GO:0005615)	ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)|tRNA binding (GO:0000049)			cervix(1)|endometrium(2)|kidney(1)|lung(3)	7		Melanoma(1037;0.0575)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GCAACGTGGCAGCCTTACACT	0.408																																																	0													72.0	66.0	68.0					3																	150280436		1879	4108	5987	SO:0001583	missense	0			AF212241	CCDS46935.1	3q25.1	2011-01-19	2006-01-24		ENSG00000144895	ENSG00000144895			3254	protein-coding gene	gene with protein product		609234				12133843, 1620067	Standard	NM_032025		Approved	EIF-2A	uc003eya.3	Q9BY44	OTTHUMG00000159775	ENST00000460851.1:c.281A>G	3.37:g.150280436A>G	ENSP00000417229:p.Gln94Arg		A8MPS6|B4DF96|B4DQ14|D3DNI9|Q5QTR2|Q7Z4E9|Q8NFM1|Q96EW9|Q96K81	Missense_Mutation	SNP	pfam_TIF_beta_prop-like,pirsf_TIF2A	p.Q94R	ENST00000460851.1	37	c.281	CCDS46935.1	3	.	.	.	.	.	.	.	.	.	.	A	27.3	4.820455	0.90873	.	.	ENSG00000144895	ENST00000487799;ENST00000460851;ENST00000406576;ENST00000482093;ENST00000273435	T;T;T;T;T	0.53640	0.99;0.99;0.61;0.99;0.99	5.86	5.86	0.93980	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.58495	0.2126	M	0.69358	2.11	0.33656	D	0.609108	D;B;P	0.58620	0.983;0.035;0.609	P;B;B	0.50791	0.65;0.025;0.168	T	0.73646	-0.3917	10	0.87932	D	0	-2.7643	16.2578	0.82526	1.0:0.0:0.0:0.0	.	94;69;94	B4DF96;B4DQ14;Q9BY44	.;.;EIF2A_HUMAN	R	69;94;94;94;89	ENSP00000420537:Q69R;ENSP00000417229:Q94R;ENSP00000385292:Q94R;ENSP00000418698:Q94R;ENSP00000273435:Q89R	ENSP00000273435:Q89R	Q	+	2	0	EIF2A	151763126	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.717000	0.91425	2.245000	0.73994	0.482000	0.46254	CAG	EIF2A	-	pirsf_TIF2A	ENSG00000144895		0.408	EIF2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EIF2A	HGNC	protein_coding	OTTHUMT00000357259.2	-	0.00	61	0	A	NM_032025		150280436	+1	tier1	-	no_errors	ENST00000460851	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	G
ANKRD19P	138649	genome.wustl.edu	37	9	95644924	95644924	+	RNA	SNP	A	A	G			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr9:95644924A>G	ENST00000446878.1	+	0	0				ANKRD19P_ENST00000473204.1_RNA																							TTAGTCCCTCATCGCTAAACA	0.493																																																	0																																												0																															9.37:g.95644924A>G				RNA	SNP	-	NULL	ENST00000446878.1	37	NULL		9																																																																																			RP11-526D8.7	-	-	ENSG00000226668		0.493	RP11-526D8.7-006	PUTATIVE	basic	processed_transcript	ENSG00000226668	Clone_based_vega_gene	pseudogene	OTTHUMT00000316907.1	-	0.00	365	0	A			95644924	+1	tier1	-	no_errors	ENST00000411450	ensembl	human	known	74_37	rna	5.75	410	25	SNP	0.001	G
AC023490.2	0	genome.wustl.edu	37	22	20378616	20378628	+	lincRNA	DEL	GGGATCCGGGGGT	GGGATCCGGGGGT	-			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	GGGATCCGGGGGT	GGGATCCGGGGGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr22:20378616_20378628delGGGATCCGGGGGT	ENST00000426653.1	+	0	666_678				AC023490.1_ENST00000438669.1_lincRNA																							ggaagggggcgggatccgggggtggggtgaggt	0.704																																																	0																																												0																															22.37:g.20378616_20378628delGGGATCCGGGGGT				RNA	DEL	-	NULL	ENST00000426653.1	37	NULL		22																																																																																			AC023490.2	-	-	ENSG00000235704		0.704	AC023490.2-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000235704	Clone_based_vega_gene	lincRNA	OTTHUMT00000322210.1		0.00	28	0	GGGATCCGGGGGT			20378628	+1			no_errors	ENST00000426653	ensembl	human	known	74_37	rna	15.69	43	8	DEL	0.009:0.014:0.006:0.004:0.011:0.028:0.217:0.219:0.178:0.177:0.193:0.194:0.213	0
CCAR2	57805	genome.wustl.edu	37	8	22472281	22472281	+	Intron	SNP	A	A	T	rs113423385		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr8:22472281A>T	ENST00000308511.4	+	11	1290				CCAR2_ENST00000520861.1_Intron|CCAR2_ENST00000389279.3_Intron|RP11-582J16.5_ENST00000521025.1_RNA			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2						cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										GATGGGTGGCAGCCTTGCCCT	0.522																																																	0																																										SO:0001627	intron_variant	0			AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.1042-70A>T	8.37:g.22472281A>T			A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	RNA	SNP	-	NULL	ENST00000308511.4	37	NULL	CCDS34863.1	8																																																																																			RP11-582J16.5	-	-	ENSG00000253200		0.522	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000253200	Clone_based_vega_gene	protein_coding	OTTHUMT00000375865.1	-	0.00	19	0	A	NM_021174		22472281	-1	tier1	rs113423385	no_errors	ENST00000521025	ensembl	human	known	74_37	rna	31.25	11	5	SNP	0.000	T
RP11-420N3.2	0	genome.wustl.edu	37	16	5289918	5289918	+	RNA	SNP	A	A	C	rs4110169		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr16:5289918A>C	ENST00000569895.1	+	0	116																											CTCCGAAGCCACTGGCAAGCC	0.726																																																	0																																												0																															16.37:g.5289918A>C				RNA	SNP	-	NULL	ENST00000569895.1	37	NULL		16																																																																																			RP11-420N3.2	-	-	ENSG00000260411		0.726	RP11-420N3.2-001	KNOWN	basic	processed_transcript	ENSG00000260411	Clone_based_vega_gene	processed_transcript	OTTHUMT00000435404.2		0.00	58	0	A			5289918	+1			no_errors	ENST00000569895	ensembl	human	known	74_37	rna	5.45	52	3	SNP	0.819	C
EPHA6	285220	genome.wustl.edu	37	3	97185294	97185294	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr3:97185294G>T	ENST00000514100.1	+	4	280	c.38G>T	c.(37-39)tGg>tTg	p.W13L	EPHA6_ENST00000502694.1_Missense_Mutation_p.W13L|EPHA6_ENST00000442602.2_Intron|EPHA6_ENST00000389672.5_Intron	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	0						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						aaactgtactggcttaatgaa	0.428																																																	0													116.0	110.0	112.0					3																	97185294		1849	4099	5948	SO:0001583	missense	0			AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.38G>T	3.37:g.97185294G>T	ENSP00000421711:p.Trp13Leu		D6RAL5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.W13L	ENST00000514100.1	37	c.38		3	.	.	.	.	.	.	.	.	.	.	G	10.75	1.439131	0.25900	.	.	ENSG00000080224	ENST00000514100;ENST00000502694	T;T	0.80994	-1.44;-1.2	3.58	-0.719	0.11201	.	.	.	.	.	T	0.58206	0.2106	N	0.08118	0	0.09310	N	1	B;B	0.13145	0.0;0.007	B;B	0.15052	0.0;0.012	T	0.46498	-0.9187	9	0.51188	T	0.08	.	4.0235	0.09677	0.2485:0.3833:0.3682:0.0	.	13;13	Q9UF33-2;D6RAL5	.;.	L	13	ENSP00000421711:W13L;ENSP00000423950:W13L	ENSP00000423950:W13L	W	+	2	0	EPHA6	98667984	0.002000	0.14202	0.000000	0.03702	0.040000	0.13550	0.328000	0.19681	-0.151000	0.11176	0.603000	0.83216	TGG	EPHA6	-	NULL	ENSG00000080224		0.428	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	EPHA6	HGNC	protein_coding	OTTHUMT00000359997.1	-	0.00	40	0	G	NM_001080448		97185294	+1	tier1	-	no_errors	ENST00000502694	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.000	T
EPHA7	2045	genome.wustl.edu	37	6	94120570	94120570	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr6:94120570C>A	ENST00000369303.4	-	3	665	c.481G>T	c.(481-483)Ggt>Tgt	p.G161C	EPHA7_ENST00000369297.1_Missense_Mutation_p.G161C	NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	161	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TTTCTTTCACCAAGGTCACCT	0.408																																																	0													133.0	133.0	133.0					6																	94120570		2203	4300	6503	SO:0001583	missense	0			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.481G>T	6.37:g.94120570C>A	ENSP00000358309:p.Gly161Cys		A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.G161C	ENST00000369303.4	37	c.481	CCDS5031.1	6	.	.	.	.	.	.	.	.	.	.	C	22.5	4.296965	0.81025	.	.	ENSG00000135333	ENST00000369303;ENST00000369297	T;T	0.03889	3.77;3.77	5.32	5.32	0.75619	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.24122	0.0584	M	0.91090	3.175	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;1.0;1.0	T	0.14008	-1.0488	10	0.87932	D	0	.	19.4211	0.94721	0.0:1.0:0.0:0.0	.	161;161;161;161	Q15375-4;Q15375-3;Q15375-2;Q15375	.;.;.;EPHA7_HUMAN	C	161	ENSP00000358309:G161C;ENSP00000358303:G161C	ENSP00000358303:G161C	G	-	1	0	EPHA7	94177291	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.676000	0.91093	0.650000	0.86243	GGT	EPHA7	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom	ENSG00000135333		0.408	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA7	HGNC	protein_coding	OTTHUMT00000041545.1	-	0.00	54	0	C			94120570	-1	tier1	-	no_errors	ENST00000369303	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	A
ERC1	23085	genome.wustl.edu	37	12	1481019	1481019	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:1481019C>T	ENST00000397203.2	+	16	3207	c.2801C>T	c.(2800-2802)gCc>gTc	p.A934V	ERC1_ENST00000355446.5_Missense_Mutation_p.A934V|ERC1_ENST00000546231.2_Missense_Mutation_p.A938V|ERC1_ENST00000589028.1_Missense_Mutation_p.A934V|ERC1_ENST00000360905.4_Missense_Mutation_p.A934V|ERC1_ENST00000543086.3_Missense_Mutation_p.A906V			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	934					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			CTTCTGGCTGCCATTAGTGAA	0.483																																																	0													62.0	56.0	58.0					12																	1481019		2203	4300	6503	SO:0001583	missense	0			AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.2801C>T	12.37:g.1481019C>T	ENSP00000380386:p.Ala934Val		A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Missense_Mutation	SNP	pfam_CAZ_cplx_RIM-bd_prot,pfam_Rab-bd_FIP-RBD,superfamily_Prefoldin	p.A934V	ENST00000397203.2	37	c.2801	CCDS8508.1	12	.	.	.	.	.	.	.	.	.	.	C	35	5.498089	0.96355	.	.	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000299183;ENST00000543086;ENST00000542302;ENST00000545948;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394;ENST00000538971	T;T;T;T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.62;0.36;0.36;0.36	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.72795	0.3505	M	0.69823	2.125	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.998;1.0	D;D;D;D	0.91635	0.999;0.994;0.994;0.997	T	0.69577	-0.5108	10	0.35671	T	0.21	-12.1045	19.6853	0.95977	0.0:1.0:0.0:0.0	.	642;910;906;934	F5H327;Q8IUD2-2;Q8IUD2-3;Q8IUD2	.;.;.;RB6I2_HUMAN	V	866;934;910;866;638;906;910;638;934;934;934;910;642	ENSP00000340054:A866V;ENSP00000380386:A934V;ENSP00000438546:A906V;ENSP00000442976:A638V;ENSP00000442739:A934V;ENSP00000347621:A934V;ENSP00000354158:A934V;ENSP00000410064:A910V	ENSP00000299183:A638V	A	+	2	0	ERC1	1351280	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.642000	0.89623	0.655000	0.94253	GCC	ERC1	-	pfam_CAZ_cplx_RIM-bd_prot	ENSG00000082805		0.483	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC1	HGNC	protein_coding	OTTHUMT00000398380.2	-	0.00	70	0	C	NM_015064		1481019	+1	tier1	-	no_errors	ENST00000360905	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
ERC2	26059	genome.wustl.edu	37	3	56207521	56207521	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr3:56207521G>A	ENST00000288221.6	-	4	1357	c.1102C>T	c.(1102-1104)Ccg>Tcg	p.P368S		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	368						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		GCTGGCTCCGGCTGAAGTTGG	0.483																																																	0													72.0	79.0	77.0					3																	56207521		2132	4251	6383	SO:0001583	missense	0			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.1102C>T	3.37:g.56207521G>A	ENSP00000288221:p.Pro368Ser		Q2T9F6|Q86TK4	Missense_Mutation	SNP	pfam_CAZ_cplx_RIM-bd_prot,superfamily_Prefoldin	p.P368S	ENST00000288221.6	37	c.1102	CCDS46851.1	3	.	.	.	.	.	.	.	.	.	.	G	20.3	3.972963	0.74246	.	.	ENSG00000187672	ENST00000288221	T	0.45276	0.9	5.43	5.43	0.79202	.	0.219302	0.48767	D	0.000171	T	0.47948	0.1473	M	0.69823	2.125	0.36288	D	0.856193	B	0.09022	0.002	B	0.10450	0.005	T	0.52533	-0.8563	10	0.48119	T	0.1	-8.7614	19.6011	0.95561	0.0:0.0:1.0:0.0	.	368	O15083	ERC2_HUMAN	S	368	ENSP00000288221:P368S	ENSP00000288221:P368S	P	-	1	0	ERC2	56182561	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.807000	0.62576	2.703000	0.92315	0.557000	0.71058	CCG	ERC2	-	pfam_CAZ_cplx_RIM-bd_prot	ENSG00000187672		0.483	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	HGNC	protein_coding	OTTHUMT00000350884.2	-	0.00	63	0	G	NM_015576		56207521	-1	tier1	-	no_errors	ENST00000288221	ensembl	human	known	74_37	missense	7.25	64	5	SNP	1.000	A
ETV4	2118	genome.wustl.edu	37	17	41607045	41607045	+	Splice_Site	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr17:41607045C>T	ENST00000319349.5	-	11	1254		c.e11-1		ETV4_ENST00000545954.1_Splice_Site|ETV4_ENST00000586826.1_Splice_Site|ETV4_ENST00000538265.1_Splice_Site|ETV4_ENST00000545089.1_Splice_Site|ETV4_ENST00000591713.1_Splice_Site|ETV4_ENST00000393664.2_Splice_Site	NM_001079675.2	NP_001073143.1	P43268	ETV4_HUMAN	ets variant 4						branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|motor neuron axon guidance (GO:0008045)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)		EWSR1/ETV4(6)|CANT1/ETV4(3)|TMPRSS2/ETV4(13)|DDX5_ENST00000540698/ETV4(2)|KLK2/ETV4(2)	ovary(2)|upper_aerodigestive_tract(1)	3		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0798)		TTGATGTCTCCTGGGGAACAC	0.612			T	"""EWSR1, TMPRSS2, DDX5, KLK2, CANT1"""	"""Ewing sarcoma, Prostate carcinoma"""																																Esophageal Squamous(116;1540 1611 12927 31103 34118)			Dom	yes		17	17q21	2118	"""ets variant gene 4 (E1A enhancer binding protein, E1AF)"""		"""M, E"""	0													49.0	55.0	53.0					17																	41607045		2203	4300	6503	SO:0001630	splice_region_variant	0			U18018	CCDS11465.1, CCDS58553.1, CCDS59292.1	17q21	2014-04-30	2008-09-12			ENSG00000175832			3493	protein-coding gene	gene with protein product	"""E1A enhancer binding protein"""	600711	"""ets variant gene 4 (E1A enhancer-binding protein, E1AF)"""			8530053, 1547944	Standard	NM_001986		Approved	E1A-F, E1AF, PEA3	uc002idw.3	P43268		ENST00000319349.5:c.956-1G>A	17.37:g.41607045C>T			A8K314|B7Z5J3|B7Z9J6|Q96AW9	Splice_Site	SNP	-	e10-1	ENST00000319349.5	37	c.956-1	CCDS11465.1	17	.	.	.	.	.	.	.	.	.	.	C	16.17	3.048011	0.55110	.	.	ENSG00000175832	ENST00000319349;ENST00000393664;ENST00000538265;ENST00000545954;ENST00000545089	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ETV4	38962571	1.000000	0.71417	1.000000	0.80357	0.150000	0.21749	6.055000	0.71103	2.941000	0.99782	0.655000	0.94253	.	ETV4	-	-	ENSG00000175832		0.612	ETV4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV4	HGNC	protein_coding	OTTHUMT00000453489.1	-	0.00	54	0	C	NM_001986	Intron	41607045	-1	tier1	-	no_errors	ENST00000319349	ensembl	human	known	74_37	splice_site	8.57	64	6	SNP	1.000	T
FAM124A	220108	genome.wustl.edu	37	13	51854621	51854621	+	Silent	SNP	C	C	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr13:51854621C>A	ENST00000322475.8	+	4	1005	c.870C>A	c.(868-870)ggC>ggA	p.G290G	FAM124A_ENST00000280057.6_Silent_p.G326G	NM_001242312.1	NP_001229241.1	Q86V42	F124A_HUMAN	family with sequence similarity 124A	290										breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|skin(1)	26		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		CTAAACCTGGCAGAGTACATC	0.517																																																	0													95.0	83.0	87.0					13																	51854621		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096364	CCDS9427.1, CCDS55900.1	13q14.3	2006-08-11			ENSG00000150510	ENSG00000150510			26413	protein-coding gene	gene with protein product						12975309	Standard	NM_145019		Approved	FLJ30707	uc001vff.2	Q86V42	OTTHUMG00000016942	ENST00000322475.8:c.870C>A	13.37:g.51854621C>A			A2A324|Q8N8P9|Q8NE66|Q96NJ9	Silent	SNP	NULL	p.G326	ENST00000322475.8	37	c.978	CCDS55900.1	13																																																																																			FAM124A	-	NULL	ENSG00000150510		0.517	FAM124A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM124A	HGNC	protein_coding	OTTHUMT00000045019.3	-	0.00	48	0	C	NM_145019		51854621	+1	tier1	-	no_errors	ENST00000280057	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.001	A
FAM13C	220965	genome.wustl.edu	37	10	61022288	61022288	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr10:61022288G>T	ENST00000373868.2	-	10	1229	c.1142C>A	c.(1141-1143)cCg>cAg	p.P381Q	FAM13C_ENST00000442566.3_Missense_Mutation_p.P402Q|FAM13C_ENST00000435852.2_Missense_Mutation_p.P381Q|FAM13C_ENST00000468840.2_Missense_Mutation_p.P298Q|FAM13C_ENST00000373867.3_Missense_Mutation_p.P298Q|FAM13C_ENST00000419214.2_Intron|FAM13C_ENST00000422313.2_Missense_Mutation_p.P381Q|FAM13C_ENST00000277705.6_Missense_Mutation_p.P402Q	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	381								p.P381L(1)		NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GCTTGGCTCCGGGCCCGCAGC	0.542																																																	1	Substitution - Missense(1)	urinary_tract(1)											68.0	71.0	70.0					10																	61022288		2203	4300	6503	SO:0001583	missense	0			U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.1142C>A	10.37:g.61022288G>T	ENSP00000362975:p.Pro381Gln		B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	NULL	p.P381Q	ENST00000373868.2	37	c.1142	CCDS7255.1	10	.	.	.	.	.	.	.	.	.	.	G	7.505	0.653533	0.14580	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000468840;ENST00000435852;ENST00000422313	T;T;T;T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98;-0.98;-0.98;-0.98	5.93	5.02	0.67125	.	0.473844	0.21842	N	0.068318	T	0.73697	0.3620	L	0.47716	1.5	0.23681	N	0.997122	P;B;B;P	0.50272	0.933;0.001;0.089;0.887	P;B;B;P	0.49683	0.619;0.006;0.037;0.497	T	0.63559	-0.6610	10	0.17832	T	0.49	-2.7884	14.7326	0.69393	0.1395:0.0:0.8605:0.0	.	381;298;381;381	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31	.;.;.;FA13C_HUMAN	Q	298;381;402;402;298;381;381	ENSP00000362974:P298Q;ENSP00000362975:P381Q;ENSP00000395661:P402Q;ENSP00000277705:P402Q;ENSP00000423896:P298Q;ENSP00000392302:P381Q;ENSP00000400241:P381Q	ENSP00000277705:P402Q	P	-	2	0	FAM13C	60692294	0.771000	0.28555	1.000000	0.80357	0.201000	0.24016	2.430000	0.44766	0.862000	0.35528	-1.119000	0.02030	CCG	FAM13C	-	NULL	ENSG00000148541		0.542	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM13C	HGNC	protein_coding	OTTHUMT00000048162.2		0.00	55	0	G			61022288	-1			no_errors	ENST00000373868	ensembl	human	known	74_37	missense	5.00	55	3	SNP	0.999	T
FAM160B2	64760	genome.wustl.edu	37	8	21957265	21957265	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr8:21957265G>A	ENST00000289921.7	+	10	1248	c.1202G>A	c.(1201-1203)cGc>cAc	p.R401H		NM_022749.5	NP_073586.5	Q86V87	F16B2_HUMAN	family with sequence similarity 160, member B2	401										endometrium(2)|kidney(1)|lung(2)|prostate(3)|urinary_tract(1)	9						GCCATGCTGCGCCAGCTTCGC	0.667																																																	0													47.0	53.0	51.0					8																	21957265		2091	4216	6307	SO:0001583	missense	0			AK025454	CCDS6021.2	8p21.3	2012-11-30	2008-06-05	2008-06-05	ENSG00000158863	ENSG00000158863			16492	protein-coding gene	gene with protein product			"""retinoic acid induced 16"""	RAI16		22971576, 15626329	Standard	XR_247128		Approved	FLJ21801	uc011kyx.2	Q86V87	OTTHUMG00000097088	ENST00000289921.7:c.1202G>A	8.37:g.21957265G>A	ENSP00000289921:p.Arg401His		B2RDQ5|B3KNX1|Q2M211|Q71JB5|Q7L3J6|Q969T0|Q9H6W4	Missense_Mutation	SNP	pfam_RetinoicA-induced_16-like	p.R401H	ENST00000289921.7	37	c.1202	CCDS6021.2	8	.	.	.	.	.	.	.	.	.	.	.	15.72	2.918050	0.52546	.	.	ENSG00000158863	ENST00000289921	T	0.34072	1.38	5.64	4.66	0.58398	.	0.113303	0.64402	D	0.000019	T	0.17492	0.0420	N	0.10809	0.05	0.44798	D	0.997805	B	0.22746	0.074	B	0.21708	0.036	T	0.09079	-1.0691	10	0.35671	T	0.21	-24.5898	5.2272	0.15401	0.2355:0.0:0.7645:0.0	.	401	Q86V87	F16B2_HUMAN	H	401	ENSP00000289921:R401H	ENSP00000289921:R401H	R	+	2	0	FAM160B2	22013210	0.998000	0.40836	1.000000	0.80357	0.939000	0.58152	2.575000	0.46025	2.664000	0.90586	0.655000	0.94253	CGC	FAM160B2	-	pfam_RetinoicA-induced_16-like	ENSG00000158863		0.667	FAM160B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM160B2	HGNC	protein_coding	OTTHUMT00000375334.2	-	0.00	48	0	G			21957265	+1	tier1	-	no_errors	ENST00000289921	ensembl	human	known	74_37	missense	15.91	37	7	SNP	1.000	A
FAM46A	55603	genome.wustl.edu	37	6	82459847	82459847	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr6:82459847G>T	ENST00000320172.6	-	3	1208	c.894C>A	c.(892-894)aaC>aaA	p.N298K	FAM46A_ENST00000369754.3_Missense_Mutation_p.N317K|FAM46A_ENST00000369756.3_Missense_Mutation_p.N379K	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	298					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		TCACCAAGAGGTTGCAGTACT	0.493																																																	0													53.0	56.0	55.0					6																	82459847		2203	4300	6503	SO:0001583	missense	0			AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.894C>A	6.37:g.82459847G>T	ENSP00000318298:p.Asn298Lys		A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Missense_Mutation	SNP	pfam_DUF1693	p.N317K	ENST00000320172.6	37	c.951	CCDS34489.1	6	.	.	.	.	.	.	.	.	.	.	G	6.228	0.410266	0.11812	.	.	ENSG00000112773	ENST00000369754;ENST00000320172;ENST00000369756	T;T;T	0.23348	1.91;1.91;1.91	5.95	3.21	0.36854	Domain of unknown function DUF1693 (1);	0.123208	0.85682	D	0.000000	T	0.19005	0.0456	M	0.71871	2.18	0.58432	D	0.999999	P;P	0.44139	0.77;0.827	B;B	0.44133	0.422;0.442	T	0.02004	-1.1231	10	0.66056	D	0.02	-3.158	10.6499	0.45642	0.2589:0.0:0.7411:0.0	.	298;317	Q96IP4;Q96IP4-2	FA46A_HUMAN;.	K	317;298;379	ENSP00000358769:N317K;ENSP00000318298:N298K;ENSP00000358771:N379K	ENSP00000318298:N298K	N	-	3	2	FAM46A	82516566	1.000000	0.71417	1.000000	0.80357	0.111000	0.19643	1.831000	0.39141	0.407000	0.25591	-0.140000	0.14226	AAC	FAM46A	-	pfam_DUF1693	ENSG00000112773		0.493	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM46A	HGNC	protein_coding	OTTHUMT00000041331.1	-	0.00	59	0	G			82459847	-1	tier1	-	no_errors	ENST00000369754	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
FANCM	57697	genome.wustl.edu	37	14	45658089	45658089	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr14:45658089G>T	ENST00000267430.5	+	20	4949	c.4864G>T	c.(4864-4866)Gaa>Taa	p.E1622*	FANCM_ENST00000542564.2_Nonsense_Mutation_p.E1596*	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1622					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)	p.E1622*(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						AAGTGAAGAAGAAGTTTGTGT	0.323								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								1	Substitution - Nonsense(1)	lung(1)											86.0	88.0	88.0					14																	45658089		2203	4298	6501	SO:0001587	stop_gained	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.4864G>T	14.37:g.45658089G>T	ENSP00000267430:p.Glu1622*		B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Nonsense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_ERCC4_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E1622*	ENST00000267430.5	37	c.4864	CCDS32070.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	6.668864|6.668864	0.97747|0.97747	.|.	.|.	ENSG00000187790|ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250|ENST00000554809	.|.	.|.	.|.	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	0.317296|.	0.32785|.	N|.	0.005654|.	.|T	.|0.75110	.|0.3805	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72367	.|-0.4315	.|3	0.62326|.	D|.	0.03|.	.|.	18.6901|18.6901	0.91580|0.91580	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	1622;1596;1138|554	.|.	ENSP00000267430:E1622X|.	E|R	+|+	1|2	0|0	FANCM|FANCM	44727839|44727839	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	6.849000|6.849000	0.75414|0.75414	2.834000|2.834000	0.97654|0.97654	0.650000|0.650000	0.86243|0.86243	GAA|AGA	FANCM	-	NULL	ENSG00000187790		0.323	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCM	HGNC	protein_coding	OTTHUMT00000410474.1		0.00	60	0	G	XM_048128		45658089	+1			no_errors	ENST00000267430	ensembl	human	known	74_37	nonsense	6.12	46	3	SNP	1.000	T
FAP	2191	genome.wustl.edu	37	2	163083065	163083065	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:163083065G>T	ENST00000188790.4	-	3	365	c.158C>A	c.(157-159)tCt>tAt	p.S53Y	FAP_ENST00000443424.1_Missense_Mutation_p.S53Y	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha									p.S53F(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						TGTTTTATAAGAAAATGTTCC	0.289																																																	1	Substitution - Missense(1)	prostate(1)											48.0	52.0	50.0					2																	163083065		2202	4291	6493	SO:0001583	missense	0			U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.158C>A	2.37:g.163083065G>T	ENSP00000188790:p.Ser53Tyr			Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.S53Y	ENST00000188790.4	37	c.158	CCDS33311.1	2	.	.	.	.	.	.	.	.	.	.	G	10.58	1.389594	0.25118	.	.	ENSG00000078098	ENST00000188790;ENST00000443424;ENST00000447386	D;T	0.96073	-3.9;1.48	5.14	1.85	0.25348	.	0.744663	0.13191	N	0.406734	D	0.87787	0.6265	L	0.35723	1.085	0.09310	N	1	B;B	0.12630	0.0;0.006	B;B	0.14023	0.0;0.01	T	0.72944	-0.4138	10	0.02654	T	1	-3.0E-4	1.2991	0.02076	0.1867:0.1306:0.4376:0.2451	.	53;53	B4DLR2;Q12884	.;SEPR_HUMAN	Y	53;53;32	ENSP00000188790:S53Y;ENSP00000411391:S53Y	ENSP00000188790:S53Y	S	-	2	0	FAP	162791311	0.970000	0.33590	0.970000	0.41538	0.992000	0.81027	1.477000	0.35431	0.684000	0.31448	0.585000	0.79938	TCT	FAP	-	NULL	ENSG00000078098		0.289	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAP	HGNC	protein_coding	OTTHUMT00000332852.2		0.00	39	0	G			163083065	-1			no_errors	ENST00000188790	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.122	T
FCHO1	23149	genome.wustl.edu	37	19	17865939	17865939	+	5'UTR	SNP	C	C	T	rs374696612		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr19:17865939C>T	ENST00000596536.1	+	0	249				FCHO1_ENST00000594202.1_5'UTR|FCHO1_ENST00000252771.7_5'UTR|FCHO1_ENST00000595033.1_Intron|FCHO1_ENST00000389133.4_5'UTR|FCHO1_ENST00000600676.1_5'UTR|FCHO1_ENST00000596951.1_5'UTR|FCHO1_ENST00000599236.1_3'UTR|FCHO1_ENST00000539407.1_5'UTR	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1						clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						AGGCACTGGACGGGGCCTGCA	0.557																																																	0								C	,,,	1,4405	2.1+/-5.4	0,1,2202	103.0	117.0	113.0		,,,	0.1	0.0	19		113	0,8600		0,0,4300	no	utr-5,utr-5,intron,utr-5	FCHO1	NM_001161357.1,NM_001161358.1,NM_001161359.1,NM_015122.2	,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,	,,,	17865939	1,13005	2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.-35C>T	19.37:g.17865939C>T			A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	RNA	SNP	-	NULL	ENST00000596536.1	37	NULL	CCDS32955.1	19																																																																																			FCHO1	-	-	ENSG00000130475		0.557	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FCHO1	HGNC	protein_coding	OTTHUMT00000466946.2	-	0.00	44	0	C	NM_015122		17865939	+1	tier1	-	no_errors	ENST00000599236	ensembl	human	known	74_37	rna	15.79	48	9	SNP	0.006	T
FCRL3	115352	genome.wustl.edu	37	1	157665150	157665150	+	Silent	SNP	C	C	T	rs559835615		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:157665150C>T	ENST00000368184.3	-	8	1671	c.1380G>A	c.(1378-1380)caG>caA	p.Q460Q	RP11-367J7.3_ENST00000453692.1_RNA|FCRL3_ENST00000368186.5_Silent_p.Q460Q|FCRL3_ENST00000473231.1_5'UTR	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	460	Ig-like C2-type 5.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					CATGACTGTGCTGGGCCCCCA	0.517																																																	0													168.0	165.0	166.0					1																	157665150		2203	4300	6503	SO:0001819	synonymous_variant	0			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.1380G>A	1.37:g.157665150C>T			A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Silent	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Q466	ENST00000368184.3	37	c.1398	CCDS1167.1	1																																																																																			FCRL3	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000160856		0.517	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	FCRL3	HGNC	protein_coding	OTTHUMT00000051419.2	-	0.00	53	0	C	NM_052939		157665150	-1	tier1	-	no_errors	ENST00000492769	ensembl	human	known	74_37	silent	6.35	59	4	SNP	0.028	T
FKBP6	8468	genome.wustl.edu	37	7	72742619	72742619	+	Silent	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr7:72742619G>A	ENST00000252037.4	+	2	168	c.99G>A	c.(97-99)tcG>tcA	p.S33S	FKBP6_ENST00000413573.2_Silent_p.S33S|FKBP6_ENST00000431982.2_Silent_p.S28S|TRIM50_ENST00000333149.2_5'Flank|TRIM50_ENST00000493498.1_5'Flank	NM_003602.3	NP_003593.3	O75344	FKBP6_HUMAN	FK506 binding protein 6, 36kDa	33					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|piRNA metabolic process (GO:0034587)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|synaptonemal complex (GO:0000795)	FK506 binding (GO:0005528)|Hsp90 protein binding (GO:0051879)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	16		Lung NSC(55;0.0908)|all_lung(88;0.198)				TGGACATCTCGGGGGACCGGG	0.632																																																	0													6.0	6.0	6.0					7																	72742619		1867	3900	5767	SO:0001819	synonymous_variant	0			AF038847	CCDS43595.1, CCDS47604.1, CCDS64670.1	7q11.23	2009-01-05	2002-08-29		ENSG00000077800	ENSG00000077800			3722	protein-coding gene	gene with protein product	"""FK506 binding protein 6 (36kD)"", ""peptidylprolyl cis-trans isomerase"", ""rotamase"", ""immunophilin FKBP36"""	604839	"""FK506-binding protein 6 (36kD)"""			9782077, 19001379	Standard	NM_003602		Approved	PPIase, FKBP36	uc003tya.2	O75344	OTTHUMG00000150520	ENST00000252037.4:c.99G>A	7.37:g.72742619G>A			B4DXT7|G3V0I2|Q7Z4T4|Q9UDS0	Silent	SNP	pfam_PPIase_FKBP_dom,smart_TPR_repeat,pfscan_TPR-contain_dom,pfscan_PPIase_FKBP_dom	p.S33	ENST00000252037.4	37	c.99	CCDS43595.1	7																																																																																			FKBP6	-	NULL	ENSG00000077800		0.632	FKBP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FKBP6	HGNC	protein_coding	OTTHUMT00000318723.1	-	0.00	33	0	G	NM_003602		72742619	+1	tier1	-	no_errors	ENST00000252037	ensembl	human	known	74_37	silent	13.46	45	7	SNP	0.013	A
FMN2	56776	genome.wustl.edu	37	1	240371521	240371521	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:240371521G>A	ENST00000319653.9	+	5	3639	c.3409G>A	c.(3409-3411)Gga>Aga	p.G1137R		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1137	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CCCTCTTCCCGGAGCGGGCAT	0.716																																																	0													6.0	8.0	7.0					1																	240371521		2069	4066	6135	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3409G>A	1.37:g.240371521G>A	ENSP00000318884:p.Gly1137Arg		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_Formin_homology_1,smart_FH2_Formin,pfscan_DEP_dom	p.G1137R	ENST00000319653.9	37	c.3409	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	g	5.766	0.325803	0.10900	.	.	ENSG00000155816	ENST00000319653	T	0.67865	-0.29	3.28	1.35	0.21983	Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (2);	0.398052	0.18116	U	0.151198	T	0.69196	0.3084	M	0.80332	2.49	0.09310	N	1	D	0.59357	0.985	P	0.49683	0.619	T	0.61123	-0.7126	9	.	.	.	.	5.6701	0.17717	0.2633:0.0:0.7367:0.0	.	1137	Q9NZ56	FMN2_HUMAN	R	1137	ENSP00000318884:G1137R	.	G	+	1	0	FMN2	238438144	0.049000	0.20398	0.001000	0.08648	0.002000	0.02628	1.607000	0.36836	0.225000	0.20959	0.471000	0.43371	GGA	FMN2	-	pfam_Formin_homology_1,smart_FH2_Formin	ENSG00000155816		0.716	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2		0.00	56	0	G	XM_371352		240371521	+1			no_errors	ENST00000319653	ensembl	human	known	74_37	missense	6.45	57	4	SNP	0.001	A
FRYL	285527	genome.wustl.edu	37	4	48636316	48636316	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr4:48636316C>A	ENST00000503238.1	-	1	111	c.112G>T	c.(112-114)Gaa>Taa	p.E38*	FRYL_ENST00000358350.4_Nonsense_Mutation_p.E38*|FRYL_ENST00000514783.1_5'Flank|FRYL_ENST00000537810.1_Nonsense_Mutation_p.E38*|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000507711.1_Nonsense_Mutation_p.E38*			O94915	FRYL_HUMAN	FRY-like	38					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						ACCAAGGGTTCGGCCATTACA	0.353																																																	0													104.0	95.0	98.0					4																	48636316		1848	4096	5944	SO:0001587	stop_gained	0			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.112G>T	4.37:g.48636316C>A	ENSP00000426064:p.Glu38*		O95640|Q8WTZ5|Q9NT40	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.E38*	ENST00000503238.1	37	c.112	CCDS43227.1	4	.	.	.	.	.	.	.	.	.	.	C	41	9.014492	0.99037	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711;ENST00000505759	.	.	.	5.0	5.0	0.66597	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	18.659	0.91465	0.0:1.0:0.0:0.0	.	.	.	.	X	38;38;38;38;130	.	ENSP00000351113:E38X	E	-	1	0	FRYL	48331073	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.445000	0.80570	2.475000	0.83589	0.650000	0.86243	GAA	FRYL	-	NULL	ENSG00000075539		0.353	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2		0.00	61	0	C			48636316	-1			no_errors	ENST00000358350	ensembl	human	known	74_37	nonsense	8.16	45	4	SNP	1.000	A
FREM3	166752	genome.wustl.edu	37	4	144618303	144618303	+	Missense_Mutation	SNP	A	A	C			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr4:144618303A>C	ENST00000329798.5	-	1	3525	c.3526T>G	c.(3526-3528)Ttc>Gtc	p.F1176V		NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	1176					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						TTTGGGGAGAAGTTGATGCCA	0.428																																																	0													119.0	108.0	111.0					4																	144618303		692	1591	2283	SO:0001583	missense	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.3526T>G	4.37:g.144618303A>C	ENSP00000332886:p.Phe1176Val			Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.F1176V	ENST00000329798.5	37	c.3526	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	A	0.684	-0.797014	0.02862	.	.	ENSG00000183090	ENST00000329798	T	0.40756	1.02	4.23	0.225	0.15325	.	0.282632	0.34133	N	0.004226	T	0.34600	0.0903	L	0.45285	1.41	0.37833	D	0.928804	.	.	.	.	.	.	T	0.12682	-1.0538	8	0.25751	T	0.34	-1.111	5.6345	0.17528	0.4367:0.1441:0.0:0.4192	.	.	.	.	V	1176	ENSP00000332886:F1176V	ENSP00000332886:F1176V	F	-	1	0	FREM3	144837753	1.000000	0.71417	0.887000	0.34795	0.156000	0.22039	2.307000	0.43682	-0.099000	0.12263	-1.139000	0.01908	TTC	FREM3	-	NULL	ENSG00000183090		0.428	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	-	0.00	59	0	A	XM_094074		144618303	-1	tier1	-	no_errors	ENST00000329798	ensembl	human	putative	74_37	missense	9.38	58	6	SNP	1.000	C
FRZB	2487	genome.wustl.edu	37	2	183731088	183731088	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:183731088C>T	ENST00000295113.4	-	1	802	c.193G>A	c.(193-195)Gcc>Acc	p.A65T		NM_001463.3	NP_001454.2	Q92765	SFRP3_HUMAN	frizzled-related protein	65	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				brain development (GO:0007420)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell development (GO:0010721)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of hepatocyte differentiation (GO:0070367)|negative regulation of Wnt signaling pathway (GO:0030178)|neural crest cell differentiation (GO:0014033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fat cell differentiation (GO:0045600)|skeletal system development (GO:0001501)|somite development (GO:0061053)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)			GCCAGGATGGCGTTGGCCTGA	0.622																																																	0													110.0	89.0	96.0					2																	183731088		2203	4300	6503	SO:0001583	missense	0			U24163	CCDS2286.1	2q32.1	2013-09-19			ENSG00000162998	ENSG00000162998		"""Secreted frizzled-related proteins"""	3959	protein-coding gene	gene with protein product		605083				8824257, 9118218	Standard	NM_001463		Approved	FRZB-PEN, FRZB1, SRFP3, FRP-3, SFRP3, FRE, FRITZ, FRZB-1, FZRB, hFIZ	uc002upa.2	Q92765	OTTHUMG00000132597	ENST00000295113.4:c.193G>A	2.37:g.183731088C>T	ENSP00000295113:p.Ala65Thr		O00181|Q99686	Missense_Mutation	SNP	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.A65T	ENST00000295113.4	37	c.193	CCDS2286.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.348430	0.95807	.	.	ENSG00000162998	ENST00000295113	T	0.81415	-1.49	4.91	4.91	0.64330	Frizzled domain (5);	0.000000	0.85682	D	0.000000	D	0.91382	0.7281	M	0.89030	3	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92746	0.6212	10	0.66056	D	0.02	.	18.2762	0.90084	0.0:1.0:0.0:0.0	.	65	Q92765	SFRP3_HUMAN	T	65	ENSP00000295113:A65T	ENSP00000295113:A65T	A	-	1	0	FRZB	183439333	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.564000	0.82326	2.530000	0.85305	0.561000	0.74099	GCC	FRZB	-	pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom	ENSG00000162998		0.622	FRZB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRZB	HGNC	protein_coding	OTTHUMT00000255808.1	-	0.00	61	0	C	NM_001463		183731088	-1	tier1	-	no_errors	ENST00000295113	ensembl	human	known	74_37	missense	8.96	61	6	SNP	1.000	T
GABRR2	2570	genome.wustl.edu	37	6	89977400	89977400	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr6:89977400G>T	ENST00000402938.3	-	6	867	c.734C>A	c.(733-735)aCt>aAt	p.T245N	GABRR2_ENST00000602808.1_5'Flank|GABRR2_ENST00000602399.1_Missense_Mutation_p.T270N	NM_002043.3	NP_002034.3	P28476	GBRR2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 2	245					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(10)|prostate(2)|urinary_tract(1)	21		all_cancers(76;1.67e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.77e-07)|all_epithelial(107;2.51e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0158)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	ATAGCTACCAGTGCTGCTGTA	0.403																																																	0													98.0	100.0	100.0					6																	89977400		2203	4300	6503	SO:0001583	missense	0				CCDS5020.2, CCDS5020.3	6q15	2012-06-22	2012-02-03		ENSG00000111886	ENSG00000111886		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4091	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 2"""	137162	"""gamma-aminobutyric acid (GABA) receptor, rho 2"""			1315307	Standard	NM_002043		Approved		uc003pnb.3	P28476	OTTHUMG00000015198	ENST00000402938.3:c.734C>A	6.37:g.89977400G>T	ENSP00000386029:p.Thr245Asn		A2BDE4|Q9H153	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAa_rho2_rcpt,prints_GABAAa_rho_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.T270N	ENST00000402938.3	37	c.809	CCDS5020.3	6	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327243	0.81690	.	.	ENSG00000111886	ENST00000402938	.	.	.	5.75	5.75	0.90469	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.85212	0.5645	M	0.92738	3.34	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.87521	0.2446	8	.	.	.	.	19.9417	0.97165	0.0:0.0:1.0:0.0	.	270	P28476	GBRR2_HUMAN	N	270	.	.	T	-	2	0	GABRR2	90034119	1.000000	0.71417	0.969000	0.41365	0.692000	0.40212	9.476000	0.97823	2.720000	0.93068	0.655000	0.94253	ACT	GABRR2	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000111886		0.403	GABRR2-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	GABRR2	HGNC	protein_coding	OTTHUMT00000041482.3		0.00	99	0	G			89977400	-1			no_errors	ENST00000602399	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
GALNT12	79695	genome.wustl.edu	37	9	101589033	101589033	+	Splice_Site	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr9:101589033G>T	ENST00000375011.3	+	3	541		c.e3-1			NM_024642.4	NP_078918.3	Q8IXK2	GLT12_HUMAN	polypeptide N-acetylgalactosaminyltransferase 12						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(62;0.0559)				TGCCTCCCTAGAGCACCTGAA	0.627																																																	0													35.0	33.0	34.0					9																	101589033		2203	4300	6503	SO:0001630	splice_region_variant	0			AB078146	CCDS6737.1	9q22.33	2014-03-13	2014-03-13		ENSG00000119514	ENSG00000119514	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19877	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 12"""	610290	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)"""			12135769	Standard	NM_024642		Approved	GalNAc-T12	uc004ayz.3	Q8IXK2	OTTHUMG00000020348	ENST00000375011.3:c.542-1G>T	9.37:g.101589033G>T			Q5TCF7|Q8NG54|Q96CT9|Q9H771	Splice_Site	SNP	-	e3-1	ENST00000375011.3	37	c.542-1	CCDS6737.1	9	.	.	.	.	.	.	.	.	.	.	G	16.67	3.188803	0.57909	.	.	ENSG00000119514	ENST00000375011	.	.	.	5.96	5.96	0.96718	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.902	0.88907	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GALNT12	100628854	1.000000	0.71417	0.992000	0.48379	0.345000	0.29048	9.864000	0.99589	2.814000	0.96858	0.655000	0.94253	.	GALNT12	-	-	ENSG00000119514		0.627	GALNT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT12	HGNC	protein_coding	OTTHUMT00000053382.1	-	0.00	36	0	G	NM_024642	Intron	101589033	+1	tier1	-	no_errors	ENST00000375011	ensembl	human	known	74_37	splice_site	10.00	36	4	SNP	1.000	T
GCFC2	6936	genome.wustl.edu	37	2	75915055	75915055	+	Missense_Mutation	SNP	C	C	T	rs370757430		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:75915055C>T	ENST00000321027.3	-	11	1721	c.1588G>A	c.(1588-1590)Gaa>Aaa	p.E530K	MRPL19_ENST00000358788.6_Intron|GCFC2_ENST00000541687.1_3'UTR|GCFC2_ENST00000409857.3_Missense_Mutation_p.E492K	NM_001201334.1|NM_003203.4	NP_001188263.1|NP_003194.3	P16383	GCFC2_HUMAN	GC-rich sequence DNA-binding factor 2	530					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)										TCCATAAATTCTTCTACAGAT	0.318																																																	0													61.0	64.0	63.0					2																	75915055		2203	4298	6501	SO:0001583	missense	0			AB026911	CCDS1961.1, CCDS62943.1	2p12	2014-01-17	2011-11-24	2011-11-24	ENSG00000005436	ENSG00000005436			1317	protein-coding gene	gene with protein product	"""GC binding factor"""	189901	"""transcription factor 9 (binds GC-rich sequences)"", ""chromosome 2 open reading frame 3"""	TCF9, C2orf3		1370479, 2556218, 17309879, 24304693	Standard	NM_003203		Approved	DNABF, GCF	uc002sno.3	P16383	OTTHUMG00000129989	ENST00000321027.3:c.1588G>A	2.37:g.75915055C>T	ENSP00000318690:p.Glu530Lys		A4UHQ8|O95032|Q53TY0|Q6P2F2	Missense_Mutation	SNP	pfam_GCFC_dom	p.E530K	ENST00000321027.3	37	c.1588	CCDS1961.1	2	.	.	.	.	.	.	.	.	.	.	C	11.65	1.701131	0.30142	.	.	ENSG00000005436	ENST00000321027;ENST00000409857	T;T	0.41400	1.0;1.0	5.7	2.92	0.33932	GC-rich sequence DNA-binding factor domain (1);	0.272266	0.42548	N	0.000695	T	0.28632	0.0709	L	0.41824	1.3	0.80722	D	1	B	0.18013	0.025	B	0.20184	0.028	T	0.07888	-1.0749	10	0.06757	T	0.87	-10.4182	10.0096	0.41979	0.0:0.7748:0.0:0.2252	.	530	P16383	GCF_HUMAN	K	530;492	ENSP00000318690:E530K;ENSP00000386552:E492K	ENSP00000318690:E530K	E	-	1	0	C2orf3	75768563	1.000000	0.71417	0.998000	0.56505	0.932000	0.56968	1.121000	0.31283	0.430000	0.26230	0.655000	0.94253	GAA	GCFC2	-	pfam_GCFC_dom	ENSG00000005436		0.318	GCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCFC2	HGNC	protein_coding	OTTHUMT00000252255.2	-	0.00	83	0	C	NM_003203		75915055	-1	tier1	-	no_errors	ENST00000321027	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
GCK	2645	genome.wustl.edu	37	7	44189585	44189585	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr7:44189585C>T	ENST00000403799.3	-	5	1031	c.562G>A	c.(562-564)Gct>Act	p.A188T	GCK_ENST00000437084.1_Missense_Mutation_p.A171T|GCK_ENST00000345378.2_Missense_Mutation_p.A189T|GCK_ENST00000395796.3_Missense_Mutation_p.A187T	NM_000162.3	NP_000153.1	P35557	HXK4_HUMAN	glucokinase (hexokinase 4)	188	Hexokinase type-1.		A -> T (in MODY2; large increase in Km for glucose). {ECO:0000269|PubMed:8325892}.		calcium ion import (GO:0070509)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|cellular response to glucose starvation (GO:0042149)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|detection of glucose (GO:0051594)|endocrine pancreas development (GO:0031018)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|NADP metabolic process (GO:0006739)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gluconeogenesis (GO:0045721)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphorylation (GO:0042327)|regulation of glucose transport (GO:0010827)|regulation of glycolytic process (GO:0006110)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transport (GO:0043266)|second-messenger-mediated signaling (GO:0019932)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|secretory granule (GO:0030141)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|magnesium ion binding (GO:0000287)			central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	37						CGTTTGATAGCGTCTCGCAGA	0.637																																																	0			GRCh37	CM930299	GCK	M							105.0	94.0	97.0					7																	44189585		2203	4300	6503	SO:0001583	missense	0			AF041014	CCDS5479.1, CCDS5480.1, CCDS5481.1	7p15.3-p15.1	2008-02-07	2008-02-07		ENSG00000106633	ENSG00000106633	2.7.1.2, 2.7.1.1		4195	protein-coding gene	gene with protein product		138079	"""maturity onset diabetes of the young 2"""	MODY2		1740341, 1502186	Standard	NM_033507		Approved	HK4	uc003tkk.1	P35557	OTTHUMG00000022903	ENST00000403799.3:c.562G>A	7.37:g.44189585C>T	ENSP00000384247:p.Ala188Thr		A4D2J2|A4D2J3|Q05810	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.A189T	ENST00000403799.3	37	c.565	CCDS5479.1	7	.	.	.	.	.	.	.	.	.	.	C	35	5.560669	0.96527	.	.	ENSG00000106633	ENST00000403799;ENST00000395796;ENST00000345378;ENST00000437084	D;D;D;D	0.98633	-5.04;-5.04;-5.04;-5.04	5.83	5.83	0.93111	Hexokinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99333	0.9766	M	0.90595	3.13	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.988;0.996	D	0.99194	1.0871	10	0.72032	D	0.01	-41.4636	19.7478	0.96258	0.0:1.0:0.0:0.0	.	188;189;187	P35557;P35557-2;P35557-3	HXK4_HUMAN;.;.	T	188;187;189;171	ENSP00000384247:A188T;ENSP00000379142:A187T;ENSP00000223366:A189T;ENSP00000402840:A171T	ENSP00000223366:A189T	A	-	1	0	GCK	44156110	1.000000	0.71417	0.992000	0.48379	0.952000	0.60782	4.970000	0.63742	2.763000	0.94921	0.563000	0.77884	GCT	GCK	-	pfam_Hexokinase_N	ENSG00000106633		0.637	GCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCK	HGNC	protein_coding	OTTHUMT00000251069.2		0.00	23	0	C			44189585	-1			no_errors	ENST00000345378	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	T
GJA5	2702	genome.wustl.edu	37	1	147230638	147230638	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:147230638G>A	ENST00000271348.2	-	2	870	c.709C>T	c.(709-711)Cga>Tga	p.R237*	GJA5_ENST00000369237.1_Nonsense_Mutation_p.R237*|RP11-433J22.2_ENST00000428911.1_RNA	NM_005266.5	NP_005257.2	P36382	CXA5_HUMAN	gap junction protein, alpha 5, 40kDa	237					angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|atrial cardiac muscle cell action potential (GO:0086014)|atrial septum development (GO:0003283)|AV node cell to bundle of His cell communication by electrical coupling (GO:0086053)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|gap junction assembly (GO:0016264)|mitral valve development (GO:0003174)|outflow tract morphogenesis (GO:0003151)|pulmonary valve formation (GO:0003193)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|transmembrane transport (GO:0055085)|ventricular septum development (GO:0003281)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)	gap junction channel activity involved in AV node cell-bundle of His cell electrical coupling (GO:0086077)|gap junction channel activity involved in cardiac conduction electrical coupling (GO:0086075)|gap junction hemi-channel activity (GO:0055077)	p.R237*(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	20	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			TTGACAAATCGCTGTCTGATC	0.547																																																	1	Substitution - Nonsense(1)	lung(1)											55.0	57.0	57.0					1																	147230638		2203	4300	6503	SO:0001587	stop_gained	0				CCDS929.1	1q21.1	2008-02-05	2007-01-16		ENSG00000143140	ENSG00000265107		"""Ion channels / Gap junction proteins (connexins)"""	4279	protein-coding gene	gene with protein product	"""connexin 40"""	121013	"""gap junction protein, alpha 5, 40kD (connexin 40)"", ""gap junction protein, alpha 5, 40kDa (connexin 40)"""				Standard	NM_005266		Approved	CX40	uc001eps.1	P36382	OTTHUMG00000014020	ENST00000271348.2:c.709C>T	1.37:g.147230638G>A	ENSP00000271348:p.Arg237*		Q5T3B6|Q5U0N6	Nonsense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin40	p.R237*	ENST00000271348.2	37	c.709	CCDS929.1	1	.	.	.	.	.	.	.	.	.	.	G	14.52	2.561105	0.45590	.	.	ENSG00000143140	ENST00000271348;ENST00000369237;ENST00000430508	.	.	.	5.68	2.66	0.31614	.	0.786143	0.12208	N	0.489624	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	10.3699	0.44046	0.0:0.1089:0.3456:0.5455	.	.	.	.	X	237	.	ENSP00000271348:R237X	R	-	1	2	GJA5	145697262	0.001000	0.12720	0.001000	0.08648	0.155000	0.21991	1.316000	0.33620	0.285000	0.22329	-0.309000	0.09137	CGA	GJA5	-	NULL	ENSG00000143140		0.547	GJA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GJA5	HGNC	protein_coding	OTTHUMT00000039422.2		0.00	30	0	G	NM_181703		147230638	-1			no_errors	ENST00000271348	ensembl	human	known	74_37	nonsense	5.17	55	3	SNP	0.000	A
GOSR1	9527	genome.wustl.edu	37	17	28837905	28837905	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr17:28837905C>T	ENST00000225724.5	+	7	595	c.523C>T	c.(523-525)Cgt>Tgt	p.R175C	GOSR1_ENST00000581721.1_Intron|GOSR1_ENST00000451249.2_Missense_Mutation_p.R173C|GOSR1_ENST00000467337.2_Missense_Mutation_p.R110C	NM_001007024.1|NM_001007025.1|NM_004871.2	NP_001007025.1|NP_001007026.1|NP_004862.1	O95249	GOSR1_HUMAN	golgi SNAP receptor complex member 1	175					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			endometrium(2)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	12						CAGCTCAGATCGTCTGATAGA	0.284																																																	0													84.0	91.0	89.0					17																	28837905		2203	4294	6497	SO:0001583	missense	0			AF047438	CCDS11258.1, CCDS45643.1, CCDS45644.1	17q11	2011-04-15			ENSG00000108587	ENSG00000108587			4430	protein-coding gene	gene with protein product	"""golgi integral membrane protein 2"""	604026				8638159, 9653160, 15004235	Standard	XM_005258072		Approved	GOS28, P28, GS28, GOS-28, GOLIM2	uc002hfe.3	O95249	OTTHUMG00000132796	ENST00000225724.5:c.523C>T	17.37:g.28837905C>T	ENSP00000225724:p.Arg175Cys		J3KST5|O75392	Missense_Mutation	SNP	NULL	p.R175C	ENST00000225724.5	37	c.523	CCDS11258.1	17	.	.	.	.	.	.	.	.	.	.	C	27.7	4.856206	0.91355	.	.	ENSG00000108587	ENST00000225724;ENST00000451249;ENST00000414833	D;D	0.81908	-1.55;-1.55	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.91932	0.7445	M	0.83603	2.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.988	D	0.92404	0.5932	10	0.66056	D	0.02	-10.4013	18.7644	0.91866	0.0:1.0:0.0:0.0	.	175;173	O95249;E9PCW1	GOSR1_HUMAN;.	C	175;173;110	ENSP00000225724:R175C;ENSP00000414441:R173C	ENSP00000225724:R175C	R	+	1	0	GOSR1	25862031	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.103000	0.71492	2.664000	0.90586	0.557000	0.71058	CGT	GOSR1	-	NULL	ENSG00000108587		0.284	GOSR1-001	KNOWN	basic|CCDS	protein_coding	GOSR1	HGNC	protein_coding	OTTHUMT00000256208.2	-	0.00	102	0	C			28837905	+1	tier1	-	no_errors	ENST00000225724	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
GPD2	2820	genome.wustl.edu	37	2	157436298	157436298	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:157436298C>T	ENST00000310454.6	+	16	2428	c.2056C>T	c.(2056-2058)Cag>Tag	p.Q686*	GPD2_ENST00000409125.4_Nonsense_Mutation_p.Q459*|GPD2_ENST00000496190.1_3'UTR|GPD2_ENST00000409674.1_Nonsense_Mutation_p.Q686*|GPD2_ENST00000540309.1_3'UTR|GPD2_ENST00000438166.2_Nonsense_Mutation_p.Q686*	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	686	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						TGAATTTTTGCAGGTGAGTTG	0.313																																																	0													58.0	60.0	59.0					2																	157436298		2202	4300	6502	SO:0001587	stop_gained	0				CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.2056C>T	2.37:g.157436298C>T	ENSP00000308610:p.Gln686*		A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Nonsense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_FAD_bind_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_G3P_DH_FAD-dep	p.Q686*	ENST00000310454.6	37	c.2056	CCDS2202.1	2	.	.	.	.	.	.	.	.	.	.	C	44	10.746995	0.99460	.	.	ENSG00000115159	ENST00000310454;ENST00000409125;ENST00000438166;ENST00000409674	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	20.6525	0.99598	0.0:1.0:0.0:0.0	.	.	.	.	X	686;459;686;686	.	ENSP00000308610:Q686X	Q	+	1	0	GPD2	157144544	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.900000	0.69853	2.890000	0.99128	0.585000	0.79938	CAG	GPD2	-	smart_EF_hand_dom,pfscan_EF_hand_dom	ENSG00000115159		0.313	GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPD2	HGNC	protein_coding	OTTHUMT00000254910.3	-	0.00	69	0	C			157436298	+1	tier1	-	no_errors	ENST00000310454	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	1.000	T
GPR116	221395	genome.wustl.edu	37	6	46839653	46839653	+	Silent	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr6:46839653G>T	ENST00000283296.7	-	11	1626	c.1338C>A	c.(1336-1338)atC>atA	p.I446I	GPR116_ENST00000456426.2_Silent_p.I304I|GPR116_ENST00000362015.4_Silent_p.I446I|GPR116_ENST00000545669.1_5'Flank|GPR116_ENST00000265417.7_Silent_p.I446I	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	446	Ig-like 2.				energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			CACAAGTGTAGATGACTGTTG	0.493																																					NSCLC(59;410 1274 8751 36715 50546)												0													180.0	156.0	164.0					6																	46839653		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.1338C>A	6.37:g.46839653G>T			O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_SEA_dom,pfam_GPS_dom,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom,prints_GPCR_2_Ig-hepta_rcpt,prints_GPCR_2_secretin-like	p.I446	ENST00000283296.7	37	c.1338	CCDS4919.1	6																																																																																			GPR116	-	pfscan_Ig-like_dom,prints_GPCR_2_Ig-hepta_rcpt	ENSG00000069122		0.493	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR116	HGNC	protein_coding	OTTHUMT00000040806.2	-	0.00	74	0	G	NM_015234		46839653	-1	tier1	-	no_errors	ENST00000265417	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.079	T
GPR20	2843	genome.wustl.edu	37	8	142367889	142367889	+	Silent	SNP	C	C	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr8:142367889C>A	ENST00000377741.3	-	2	225	c.135G>T	c.(133-135)ctG>ctT	p.L45L	CTD-3064M3.3_ENST00000562459.1_RNA	NM_005293.2	NP_005284.2	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	45					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(3)|lung(4)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	15	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0415)			AGGTGCCATGCAGCTCCTCGT	0.662																																																	0													48.0	47.0	48.0					8																	142367889		2203	4300	6503	SO:0001819	synonymous_variant	0			U66579	CCDS34949.1	8q24.3	2012-08-21				ENSG00000204882		"""GPCR / Class A : Orphans"""	4475	protein-coding gene	gene with protein product		601908				18347022	Standard	NM_005293		Approved		uc003ywf.3	Q99678		ENST00000377741.3:c.135G>T	8.37:g.142367889C>A			Q17R96	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.L45	ENST00000377741.3	37	c.135	CCDS34949.1	8																																																																																			GPR20	-	NULL	ENSG00000204882		0.662	GPR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR20	HGNC	protein_coding	OTTHUMT00000378968.1	-	0.00	107	0	C	NM_005293		142367889	-1	tier1	-	no_errors	ENST00000377741	ensembl	human	known	74_37	silent	11.76	104	14	SNP	0.657	A
GPR98	84059	genome.wustl.edu	37	5	89938579	89938579	+	Splice_Site	SNP	A	A	C			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr5:89938579A>C	ENST00000405460.2	+	12	2463	c.2367A>C	c.(2365-2367)aaA>aaC	p.K789N		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	789	Calx-beta 6. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ATGTTATAAAAGTAAGTACGA	0.358																																																	0													81.0	86.0	85.0					5																	89938579		1796	4065	5861	SO:0001630	splice_region_variant	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.2367+1A>C	5.37:g.89938579A>C			O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.K789N	ENST00000405460.2	37	c.2367	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	A	4.378	0.069659	0.08436	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.26518	1.73	5.09	-3.28	0.05033	Na-Ca exchanger/integrin-beta4 (1);	0.253642	0.46758	N	0.000271	T	0.08980	0.0222	N	0.12471	0.22	0.80722	D	1	B	0.11235	0.004	B	0.11329	0.006	T	0.13388	-1.0511	10	0.34782	T	0.22	.	1.2194	0.01921	0.4406:0.1111:0.1432:0.3051	.	789	Q8WXG9	GPR98_HUMAN	N	789	ENSP00000384582:K789N	ENSP00000296619:K789N	K	+	3	2	GPR98	89974335	0.005000	0.15991	0.992000	0.48379	0.049000	0.14656	-1.095000	0.03356	-0.271000	0.09272	-0.545000	0.04230	AAA	GPR98	-	smart_Calx_beta	ENSG00000164199		0.358	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	-	0.00	84	0	A	NM_032119	Missense_Mutation	89938579	+1	tier1	-	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	9.23	59	6	SNP	0.944	C
GPSM2	29899	genome.wustl.edu	37	1	109465107	109465107	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:109465107G>T	ENST00000406462.2	+	14	2282	c.1509G>T	c.(1507-1509)agG>agT	p.R503S	GPSM2_ENST00000264126.3_Missense_Mutation_p.R503S|AKNAD1_ENST00000357393.4_Intron			P81274	GPSM2_HUMAN	G-protein signaling modulator 2	503	GoLoco 1. {ECO:0000255|PROSITE- ProRule:PRU00097}.				establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		AAAGCAATAGGATGGATGATC	0.358																																																	0													147.0	146.0	146.0					1																	109465107		2203	4300	6503	SO:0001583	missense	0			AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	ENST00000406462.2:c.1509G>T	1.37:g.109465107G>T	ENSP00000385510:p.Arg503Ser		Q5T1N8|Q6IBL7|Q8N0Z5	Missense_Mutation	SNP	pfam_GoLoco_motif,pfam_TPR_1,pfam_TPR-4,smart_TPR_repeat,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R503S	ENST00000406462.2	37	c.1509	CCDS792.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.11|19.11	3.764206|3.764206	0.69878|0.69878	.|.	.|.	ENSG00000121957|ENSG00000121957	ENST00000441735|ENST00000406462;ENST00000264126	.|D;D	.|0.99304	.|-5.72;-5.72	6.17|6.17	5.27|5.27	0.74061|0.74061	.|GoLoco motif (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99254|0.99254	0.9740|0.9740	M|M	0.81341|0.81341	2.54|2.54	0.51767|0.51767	D|D	0.999931|0.999931	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	D|D	0.99274|0.99274	1.0894|1.0894	5|10	.|0.87932	.|D	.|0	-20.0539|-20.0539	12.482|12.482	0.55850|0.55850	0.133:0.0:0.867:0.0|0.133:0.0:0.867:0.0	.|.	.|503	.|P81274	.|GPSM2_HUMAN	V|S	93|503	.|ENSP00000385510:R503S;ENSP00000264126:R503S	.|ENSP00000264126:R503S	G|R	+|+	2|3	0|2	GPSM2|GPSM2	109266630|109266630	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.798000|0.798000	0.45092|0.45092	2.997000|2.997000	0.49457|0.49457	1.636000|1.636000	0.50526|0.50526	-0.136000|-0.136000	0.14681|0.14681	GGA|AGG	GPSM2	-	pfam_GoLoco_motif,smart_GoLoco_motif,pfscan_GoLoco_motif	ENSG00000121957		0.358	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPSM2	HGNC	protein_coding	OTTHUMT00000032400.3	-	0.00	101	0	G	NM_013296		109465107	+1	tier1	-	no_errors	ENST00000264126	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
GTPBP4	23560	genome.wustl.edu	37	10	1052988	1052988	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr10:1052988G>T	ENST00000360803.4	+	10	1115	c.1033G>T	c.(1033-1035)Gaa>Taa	p.E345*	GTPBP4_ENST00000538293.1_Nonsense_Mutation_p.E229*|GTPBP4_ENST00000545048.1_Nonsense_Mutation_p.E298*|GTPBP4_ENST00000491635.1_3'UTR	NM_012341.2	NP_036473.2	Q9BZE4	NOG1_HUMAN	GTP binding protein 4	345					GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of collagen binding (GO:0033342)|negative regulation of DNA replication (GO:0008156)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein stabilization (GO:0050821)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(1)	21		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		TCATCGAGTGGAAACCAAAAT	0.498																																																	0													143.0	117.0	126.0					10																	1052988		2203	4300	6503	SO:0001587	stop_gained	0			AK001548	CCDS31132.1	10p15-p14	2007-07-27			ENSG00000107937	ENSG00000107937			21535	protein-coding gene	gene with protein product	"""G protein-binding protein CRFG"", "" GTP-binding protein"""					11316846	Standard	NM_012341		Approved	CRFG, NGB, FLJ10690, FLJ10686, NOG1	uc001ift.3	Q9BZE4	OTTHUMG00000017538	ENST00000360803.4:c.1033G>T	10.37:g.1052988G>T	ENSP00000354040:p.Glu345*		B3KMC5|B4DY13|B7Z7A3|O95446|Q5T3R8|Q9NVJ8	Nonsense_Mutation	SNP	pfam_NOG1_Rossman_fold_dom,pfam_NOG_C,pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,pfam_MIRO-like,superfamily_P-loop_NTPase,prints_GTP_binding_domain,tigrfam_Small_GTP-bd_dom	p.E345*	ENST00000360803.4	37	c.1033	CCDS31132.1	10	.	.	.	.	.	.	.	.	.	.	G	40	8.215092	0.98709	.	.	ENSG00000107937	ENST00000360803;ENST00000538293;ENST00000545048	.	.	.	5.47	5.47	0.80525	.	0.355410	0.35151	N	0.003417	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-22.3461	19.7377	0.96214	0.0:0.0:1.0:0.0	.	.	.	.	X	345;229;298	.	ENSP00000354040:E345X	E	+	1	0	GTPBP4	1042988	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	5.934000	0.70138	2.733000	0.93635	0.650000	0.86243	GAA	GTPBP4	-	pfam_Fe2_transport_prot_B_N	ENSG00000107937		0.498	GTPBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP4	HGNC	protein_coding	OTTHUMT00000046412.1	-	0.00	58	0	G	NM_012341		1052988	+1	tier1	-	no_errors	ENST00000360803	ensembl	human	known	74_37	nonsense	5.88	64	4	SNP	1.000	T
HCAR2	338442	genome.wustl.edu	37	12	123187714	123187714	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:123187714G>C	ENST00000328880.5	-	1	176	c.117C>G	c.(115-117)atC>atG	p.I39M	HCAR1_ENST00000356987.2_Intron|RP11-324E6.6_ENST00000543611.1_lincRNA	NM_177551.3	NP_808219.1	Q8TDS4	HCAR2_HUMAN	hydroxycarboxylic acid receptor 2	39					negative regulation of lipid catabolic process (GO:0050995)|neutrophil apoptotic process (GO:0001781)|positive regulation of adiponectin secretion (GO:0070165)|positive regulation of neutrophil apoptotic process (GO:0033031)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nicotinic acid receptor activity (GO:0070553)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	15					Niacin(DB00627)	GAAGCCCGAAGATAAACTCCA	0.512																																																	0													76.0	73.0	74.0					12																	123187714		2203	4300	6503	SO:0001583	missense	0			AY148884	CCDS9235.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000182782	ENSG00000182782		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	24827	protein-coding gene	gene with protein product	"""niacin receptor 1"""	609163	"""G protein-coupled receptor 109A"""	GPR109A		21167710, 12522134, 12646212, 19141678, 18983141, 21454438	Standard	NM_177551		Approved	HCA2, HM74A, PUMAG, Puma-g, NIACR1	uc001ucx.1	Q8TDS4	OTTHUMG00000162722	ENST00000328880.5:c.117C>G	12.37:g.123187714G>C	ENSP00000375066:p.Ile39Met		A0PJL5|A7LGG3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.I39M	ENST00000328880.5	37	c.117	CCDS9235.1	12	.	.	.	.	.	.	.	.	.	.	G	2.480	-0.319929	0.05386	.	.	ENSG00000182782	ENST00000328880;ENST00000536970	T	0.40756	1.02	5.49	-1.03	0.10102	.	0.394981	0.22640	N	0.057473	T	0.31765	0.0807	L	0.49126	1.545	0.09310	N	1	B	0.20164	0.042	B	0.26094	0.066	T	0.30679	-0.9970	10	0.72032	D	0.01	-15.3083	4.981	0.14164	0.2166:0.3486:0.3632:0.0717	.	39	Q8TDS4	HCAR2_HUMAN	M	39	ENSP00000375066:I39M	ENSP00000375066:I39M	I	-	3	3	HCAR2	121753667	0.000000	0.05858	0.184000	0.23157	0.023000	0.10783	-1.290000	0.02777	0.115000	0.18071	-1.291000	0.01355	ATC	HCAR2	-	prints_GPCR_Rhodpsn	ENSG00000182782		0.512	HCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCAR2	HGNC	protein_coding	OTTHUMT00000370202.1	-	0.00	75	0	G	NM_177551		123187714	-1	tier1	-	no_errors	ENST00000328880	ensembl	human	known	74_37	missense	6.25	90	6	SNP	0.189	C
HCCS	3052	genome.wustl.edu	37	X	11139818	11139818	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chrX:11139818G>A	ENST00000321143.4	+	7	897	c.695G>A	c.(694-696)gGt>gAt	p.G232D	ARHGAP6_ENST00000534860.1_Intron|HCCS_ENST00000380763.3_Missense_Mutation_p.G232D|HCCS_ENST00000380762.4_Missense_Mutation_p.G232D	NM_001122608.2|NM_001171991.2|NM_005333.4	NP_001116080.1|NP_001165462.1|NP_005324.3	P53701	CCHL_HUMAN	holocytochrome c synthase	232					organ morphogenesis (GO:0009887)|oxidation-reduction process (GO:0055114)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	holocytochrome-c synthase activity (GO:0004408)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(3)	7						TATGATGGTGGTGAAGTCAAC	0.448																																					Ovarian(86;1338 1347 1462 10340 37882)												0													192.0	156.0	168.0					X																	11139818		2203	4300	6503	SO:0001583	missense	0				CCDS14139.1	Xp22	2014-01-31	2010-05-11		ENSG00000004961	ENSG00000004961	4.4.1.17		4837	protein-coding gene	gene with protein product	"""cytochrome c heme-lyase"""	300056	"""holocytochrome c synthase (cytochrome c heme-lyase)"", ""microphthalamia with linear skin defects"""	MLS		8364577, 12444108	Standard	NM_001122608		Approved	CCHL	uc004cuj.3	P53701	OTTHUMG00000021128	ENST00000321143.4:c.695G>A	X.37:g.11139818G>A	ENSP00000326579:p.Gly232Asp		B3KUS1|Q502X8	Missense_Mutation	SNP	pfam_Cyt_C/C1_haem_lyase	p.G232D	ENST00000321143.4	37	c.695	CCDS14139.1	X	.	.	.	.	.	.	.	.	.	.	G	15.77	2.931523	0.52866	.	.	ENSG00000004961	ENST00000321143;ENST00000380763;ENST00000380762	D;D;D	0.82081	-1.57;-1.57;-1.57	6.05	6.05	0.98169	.	0.150930	0.64402	D	0.000017	T	0.78470	0.4288	L	0.31664	0.95	0.80722	D	1	B	0.31730	0.337	B	0.41036	0.346	T	0.72537	-0.4263	10	0.08599	T	0.76	-25.0457	16.7492	0.85481	0.0:0.0:1.0:0.0	.	232	P53701	CCHL_HUMAN	D	232	ENSP00000326579:G232D;ENSP00000370140:G232D;ENSP00000370139:G232D	ENSP00000326579:G232D	G	+	2	0	HCCS	11049739	1.000000	0.71417	0.017000	0.16124	0.938000	0.57974	9.239000	0.95389	2.565000	0.86533	0.594000	0.82650	GGT	HCCS	-	pfam_Cyt_C/C1_haem_lyase	ENSG00000004961		0.448	HCCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCCS	HGNC	protein_coding	OTTHUMT00000055742.1	-	0.00	32	0	G			11139818	+1	tier1	-	no_errors	ENST00000321143	ensembl	human	known	74_37	missense	14.29	18	3	SNP	0.870	A
HLA-DPB2	3116	genome.wustl.edu	37	6	33080318	33080318	+	RNA	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr6:33080318G>T	ENST00000435074.1	+	0	91									major histocompatibility complex, class II, DP beta 2 (pseudogene)																		GTTTCAGGGGGCCCCTGGACA	0.522																																																	0																																												0			M23911		6p21.3	2012-10-02			ENSG00000224557	ENSG00000224557		"""Histocompatibility complex"""	4941	pseudogene	pseudogene				HLA-DP2B		3036829	Standard	NR_001435		Approved	DP2B, DPB2	uc003ocv.1		OTTHUMG00000031080		6.37:g.33080318G>T				RNA	SNP	-	NULL	ENST00000435074.1	37	NULL		6																																																																																			HLA-DPB2	-	-	ENSG00000224557		0.522	HLA-DPB2-002	KNOWN	basic	processed_transcript	HLA-DPB2	HGNC	pseudogene	OTTHUMT00000276666.1	-	0.00	55	0	G	NR_001435		33080318	+1	tier1	-	no_errors	ENST00000435074	ensembl	human	known	74_37	rna	6.06	62	4	SNP	0.000	T
HMCN1	83872	genome.wustl.edu	37	1	185972897	185972897	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:185972897G>T	ENST00000271588.4	+	29	4625	c.4396G>T	c.(4396-4398)Gtc>Ttc	p.V1466F	HMCN1_ENST00000367492.2_Missense_Mutation_p.V1466F	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1466	Ig-like C2-type 12.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGTCTCAGTTGTCCTCAACCG	0.428																																																	0													170.0	146.0	154.0					1																	185972897		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.4396G>T	1.37:g.185972897G>T	ENSP00000271588:p.Val1466Phe		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.V1466F	ENST00000271588.4	37	c.4396	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.321094	0.60634	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.67345	-0.26;-0.26	5.86	-1.37	0.09056	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.578415	0.18826	N	0.130127	T	0.64735	0.2625	L	0.46885	1.475	0.40632	D	0.981861	D	0.62365	0.991	P	0.58172	0.834	T	0.62015	-0.6943	10	0.42905	T	0.14	.	5.5198	0.16925	0.591:0.1667:0.2423:0.0	.	1466	Q96RW7	HMCN1_HUMAN	F	1466	ENSP00000271588:V1466F;ENSP00000356462:V1466F	ENSP00000271588:V1466F	V	+	1	0	HMCN1	184239520	0.678000	0.27586	0.707000	0.30419	0.685000	0.39939	0.897000	0.28390	-0.100000	0.12241	-0.145000	0.13849	GTC	HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000143341		0.428	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1		0.00	71	0	G	NM_031935		185972897	+1			no_errors	ENST00000271588	ensembl	human	known	74_37	missense	7.94	58	5	SNP	0.970	T
HSPH1	10808	genome.wustl.edu	37	13	31713165	31713165	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr13:31713165G>T	ENST00000320027.5	-	15	2404	c.2060C>A	c.(2059-2061)gCa>gAa	p.A687E	HSPH1_ENST00000380405.4_Missense_Mutation_p.A643E|HSPH1_ENST00000429785.2_Missense_Mutation_p.A506E|HSPH1_ENST00000380406.5_Missense_Mutation_p.A646E|HSPH1_ENST00000445273.2_Missense_Mutation_p.A689E	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	687					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		GTCAACATATGCTTGTTTAGC	0.338																																																	0													124.0	111.0	115.0					13																	31713165		2203	4300	6503	SO:0001583	missense	0			AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.2060C>A	13.37:g.31713165G>T	ENSP00000318687:p.Ala687Glu		B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.A689E	ENST00000320027.5	37	c.2066	CCDS9340.1	13	.	.	.	.	.	.	.	.	.	.	G	20.3	3.969017	0.74131	.	.	ENSG00000120694	ENST00000320027;ENST00000380405;ENST00000380406;ENST00000445273;ENST00000429785	T;T;T;T;T	0.09350	2.99;2.99;2.99;2.99;2.99	5.7	5.7	0.88788	.	0.196429	0.44483	D	0.000454	T	0.05914	0.0154	N	0.01817	-0.705	0.36866	D	0.88864	P;B;P;P;P	0.45212	0.853;0.013;0.853;0.714;0.758	B;B;P;B;P	0.47626	0.425;0.026;0.53;0.306;0.552	T	0.34229	-0.9837	10	0.51188	T	0.08	-12.0227	7.4506	0.27235	0.1969:0.0:0.8031:0.0	.	506;646;689;643;687	B4DY72;Q92598-3;B4DYH1;Q92598-2;Q92598	.;.;.;.;HS105_HUMAN	E	687;643;646;689;506	ENSP00000318687:A687E;ENSP00000369768:A643E;ENSP00000369769:A646E;ENSP00000396090:A689E;ENSP00000388778:A506E	ENSP00000318687:A687E	A	-	2	0	HSPH1	30611165	1.000000	0.71417	0.746000	0.31095	0.872000	0.50106	6.009000	0.70745	2.705000	0.92388	0.650000	0.86243	GCA	HSPH1	-	pfam_Hsp_70_fam	ENSG00000120694		0.338	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPH1	HGNC	protein_coding	OTTHUMT00000044384.1	-	0.00	78	0	G			31713165	-1	tier1	-	no_errors	ENST00000445273	ensembl	human	known	74_37	missense	5.48	68	4	SNP	0.993	T
INADL	10207	genome.wustl.edu	37	1	62614014	62614014	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:62614014G>T	ENST00000371158.2	+	42	5444	c.5330G>T	c.(5329-5331)gGc>gTc	p.G1777V		NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1777					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						ATGTCTACAGGCTACCACCTT	0.448																																																	0													145.0	138.0	141.0					1																	62614014		1910	4132	6042	SO:0001583	missense	0			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.5330G>T	1.37:g.62614014G>T	ENSP00000360200:p.Gly1777Val		O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_L27,smart_PDZ,pfscan_L27,pfscan_PDZ	p.G1777V	ENST00000371158.2	37	c.5330	CCDS617.2	1	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349893	0.61183	.	.	ENSG00000132849	ENST00000371158	T	0.11712	2.75	5.22	5.22	0.72569	.	0.071589	0.53938	D	0.000059	T	0.11239	0.0274	L	0.27053	0.805	0.80722	D	1	B	0.32573	0.376	B	0.34991	0.193	T	0.14282	-1.0478	10	0.41790	T	0.15	.	18.7837	0.91946	0.0:0.0:1.0:0.0	.	1777	Q8NI35	INADL_HUMAN	V	1777	ENSP00000360200:G1777V	ENSP00000360200:G1777V	G	+	2	0	INADL	62386602	1.000000	0.71417	0.960000	0.40013	0.867000	0.49689	8.255000	0.89846	2.432000	0.82394	0.561000	0.74099	GGC	INADL	-	NULL	ENSG00000132849		0.448	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INADL	HGNC	protein_coding	OTTHUMT00000023639.2		0.00	57	0	G	NM_170605		62614014	+1			no_errors	ENST00000371158	ensembl	human	known	74_37	missense	6.25	45	3	SNP	0.604	T
INCENP	3619	genome.wustl.edu	37	11	61914190	61914190	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr11:61914190C>T	ENST00000394818.3	+	15	2222	c.2020C>T	c.(2020-2022)Cgg>Tgg	p.R674W	INCENP_ENST00000278849.4_Missense_Mutation_p.R670W	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	674					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						ggagcaggagcggctgcggaa	0.692																																																	0													9.0	11.0	10.0					11																	61914190		1809	3388	5197	SO:0001583	missense	0			AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.2020C>T	11.37:g.61914190C>T	ENSP00000378295:p.Arg674Trp		A8MQD2|Q5Y192	Missense_Mutation	SNP	pfam_INCENP_N,pfam_Inner_centromere_prot_ARK-bd	p.R674W	ENST00000394818.3	37	c.2020	CCDS44624.1	11	.	.	.	.	.	.	.	.	.	.	C	14.72	2.619725	0.46736	.	.	ENSG00000149503	ENST00000394818;ENST00000278849	T;T	0.18960	2.18;2.18	3.06	2.13	0.27403	.	0.329273	0.20914	N	0.083401	T	0.37732	0.1014	M	0.64997	1.995	0.45066	D	0.998084	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.985;0.994;0.985	T	0.13469	-1.0508	10	0.87932	D	0	.	7.5163	0.27602	0.2556:0.7444:0.0:0.0	.	670;670;674	B3KPD3;Q9NQS7-2;Q9NQS7	.;.;INCE_HUMAN	W	674;670	ENSP00000378295:R674W;ENSP00000278849:R670W	ENSP00000278849:R670W	R	+	1	2	INCENP	61670766	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.608000	0.24223	0.840000	0.34995	0.637000	0.83480	CGG	INCENP	-	NULL	ENSG00000149503		0.692	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INCENP	HGNC	protein_coding	OTTHUMT00000394723.2		0.00	82	0	C	NM_020238		61914190	+1			no_errors	ENST00000394818	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
INPP4A	3631	genome.wustl.edu	37	2	99154342	99154342	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:99154342C>T	ENST00000523221.1	+	6	484	c.484C>T	c.(484-486)Cgt>Tgt	p.R162C	INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000074304.5_Missense_Mutation_p.R162C|INPP4A_ENST00000409851.3_Missense_Mutation_p.R162C|INPP4A_ENST00000545415.1_Missense_Mutation_p.R162C|INPP4A_ENST00000409016.4_Missense_Mutation_p.R162C|INPP4A_ENST00000409540.3_Missense_Mutation_p.R162C			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	162					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)	p.R162C(3)		breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						AGAGAGTGACCGTGTAGGTAA	0.532																																																	3	Substitution - Missense(3)	endometrium(3)											72.0	79.0	77.0					2																	99154342		2090	4225	6315	SO:0001583	missense	0			U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.484C>T	2.37:g.99154342C>T	ENSP00000427722:p.Arg162Cys		O15326|Q13187|Q53TD8|Q8TC02	Missense_Mutation	SNP	superfamily_C2_dom	p.R162C	ENST00000523221.1	37	c.484	CCDS46369.1	2	.	.	.	.	.	.	.	.	.	.	C	25.2	4.609179	0.87258	.	.	ENSG00000040933	ENST00000409016;ENST00000409851;ENST00000074304;ENST00000545415;ENST00000409540;ENST00000523221	T;T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41;1.41	5.59	4.71	0.59529	.	0.053537	0.85682	D	0.000000	T	0.40322	0.1112	L	0.36672	1.1	0.58432	D	0.999999	D;D;D;D	0.71674	0.994;0.998;0.998;0.998	P;P;P;P	0.56474	0.629;0.795;0.799;0.799	T	0.29150	-1.0021	10	0.59425	D	0.04	-15.2901	15.5476	0.76118	0.0:0.8616:0.1384:0.0	.	162;162;162;162	Q96PE3-2;Q96PE3-4;Q96PE3;Q96PE3-3	.;.;INP4A_HUMAN;.	C	162	ENSP00000386704:R162C;ENSP00000386777:R162C;ENSP00000074304:R162C;ENSP00000442149:R162C;ENSP00000387294:R162C;ENSP00000427722:R162C	ENSP00000074304:R162C	R	+	1	0	INPP4A	98520774	1.000000	0.71417	0.988000	0.46212	0.986000	0.74619	3.812000	0.55628	1.324000	0.45282	0.655000	0.94253	CGT	INPP4A	-	NULL	ENSG00000040933		0.532	INPP4A-009	KNOWN	basic|CCDS	protein_coding	INPP4A	HGNC	protein_coding	OTTHUMT00000376095.1		0.00	53	0	C	NM_001566		99154342	+1			no_errors	ENST00000074304	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	T
ITGBL1	9358	genome.wustl.edu	37	13	102227889	102227889	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr13:102227889T>C	ENST00000376180.3	+	4	797	c.578T>C	c.(577-579)aTa>aCa	p.I193T	ITGBL1_ENST00000545560.2_Missense_Mutation_p.I52T|ITGBL1_ENST00000376162.3_Missense_Mutation_p.I100T	NM_001271756.1|NM_004791.1	NP_001258685.1|NP_004782.1	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat domains)	193	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)				breast(1)|large_intestine(6)|lung(16)|ovary(1)|prostate(4)|skin(3)	31	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ACAGAAGAAATATGTGGAGGT	0.343																																																	0													190.0	182.0	185.0					13																	102227889		2203	4300	6503	SO:0001583	missense	0			AF072752	CCDS9499.1, CCDS61361.1, CCDS61362.1, CCDS73594.1	13q33	2008-07-18			ENSG00000198542	ENSG00000198542			6164	protein-coding gene	gene with protein product	"""ten integrin EGF-like repeat domains protein"", ""ITGBL1, integrin beta-like 1"""	604234				10051402	Standard	NM_004791		Approved	TIED, OSCP	uc001vpb.4	O95965	OTTHUMG00000017296	ENST00000376180.3:c.578T>C	13.37:g.102227889T>C	ENSP00000365351:p.Ile193Thr		A8K5M5|B3KTP1|B4DQ02|Q8N172|Q9NPR0	Missense_Mutation	SNP	pfam_EGF_extracell,smart_EG-like_dom	p.I193T	ENST00000376180.3	37	c.578	CCDS9499.1	13	.	.	.	.	.	.	.	.	.	.	T	16.22	3.061448	0.55432	.	.	ENSG00000198542	ENST00000376180;ENST00000537118;ENST00000539955;ENST00000545560;ENST00000376162	D;D;D	0.93019	-3.15;-3.15;-3.15	6.17	4.93	0.64822	EGF, extracellular (1);	0.219650	0.51477	D	0.000094	D	0.95271	0.8466	M	0.63843	1.955	0.44036	D	0.996768	P;B	0.46912	0.886;0.17	D;B	0.64410	0.925;0.297	D	0.94056	0.7322	10	0.34782	T	0.22	.	13.2634	0.60120	0.0:0.0:0.132:0.868	.	52;193	B3KTP1;O95965	.;ITGBL_HUMAN	T	193;101;52;52;100	ENSP00000365351:I193T;ENSP00000439903:I52T;ENSP00000365332:I100T	ENSP00000365332:I100T	I	+	2	0	ITGBL1	101025890	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.919000	0.70005	2.371000	0.80710	0.533000	0.62120	ATA	ITGBL1	-	pfam_EGF_extracell,smart_EG-like_dom	ENSG00000198542		0.343	ITGBL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGBL1	HGNC	protein_coding	OTTHUMT00000045669.2	-	0.00	95	0	T	NM_004791		102227889	+1	tier1	-	no_errors	ENST00000376180	ensembl	human	known	74_37	missense	6.36	103	7	SNP	1.000	C
KCNQ4	9132	genome.wustl.edu	37	1	41284640	41284640	+	Intron	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:41284640G>T	ENST00000347132.5	+	4	790				KCNQ4_ENST00000506017.1_3'UTR|KCNQ4_ENST00000509682.2_Intron	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4						inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	GGGACCACTCGTACCACAAAG	0.677																																																	0																																										SO:0001627	intron_variant	0			AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.708+288G>T	1.37:g.41284640G>T			O96025	RNA	SNP	-	NULL	ENST00000347132.5	37	NULL	CCDS456.1	1																																																																																			KCNQ4	-	-	ENSG00000117013		0.677	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KCNQ4	HGNC	protein_coding	OTTHUMT00000020812.1	-	0.00	23	0	G	NM_004700		41284640	+1	tier1	-	no_errors	ENST00000506017	ensembl	human	known	74_37	rna	16.67	20	4	SNP	0.000	T
KDR	3791	genome.wustl.edu	37	4	55956188	55956188	+	Nonsense_Mutation	SNP	T	T	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr4:55956188T>A	ENST00000263923.4	-	23	3422	c.3127A>T	c.(3127-3129)Aaa>Taa	p.K1043*	RP11-530I17.1_ENST00000511222.1_RNA	NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	1043	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCACAGATTTTAACCACGTTC	0.438			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																														Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	0													95.0	93.0	94.0					4																	55956188		2203	4300	6503	SO:0001587	stop_gained	0			AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.3127A>T	4.37:g.55956188T>A	ENSP00000263923:p.Lys1043*		A2RRS0|B5A925|C5IFA0|O60723|Q14178	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR2_rcpt	p.K1043*	ENST00000263923.4	37	c.3127	CCDS3497.1	4	.	.	.	.	.	.	.	.	.	.	T	44	11.166958	0.99525	.	.	ENSG00000128052	ENST00000263923	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.1634	0.81734	0.0:0.0:0.0:1.0	.	.	.	.	X	1043	.	ENSP00000263923:K1043X	K	-	1	0	KDR	55650945	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.997000	0.88414	2.276000	0.75962	0.460000	0.39030	AAA	KDR	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000128052		0.438	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDR	HGNC	protein_coding	OTTHUMT00000250645.1		0.00	57	0	T			55956188	-1			no_errors	ENST00000263923	ensembl	human	known	74_37	nonsense	13.33	39	6	SNP	1.000	A
KHNYN	23351	genome.wustl.edu	37	14	24900980	24900980	+	Frame_Shift_Del	DEL	G	G	-	rs201288250		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr14:24900980delG	ENST00000251343.5	+	3	652	c.513delG	c.(511-513)ccgfs	p.P171fs	CBLN3_ENST00000267406.6_5'Flank|KHNYN_ENST00000554268.1_5'Flank|CBLN3_ENST00000555436.1_5'Flank|KHNYN_ENST00000556842.1_Frame_Shift_Del_p.P171fs|KHNYN_ENST00000553935.1_Frame_Shift_Del_p.P171fs			O15037	KHNYN_HUMAN	KH and NYN domain containing	171							RNA binding (GO:0003723)			kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						TGCAGTCCCCGGGGGATGCCC	0.637											OREG0022627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													54.0	62.0	59.0					14																	24900980		2203	4300	6503	SO:0001589	frameshift_variant	0			AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037		ENST00000251343.5:c.513delG	14.37:g.24900980delG	ENSP00000251343:p.Pro171fs	774	Q86TZ6|Q8IUQ2|Q96BA9	Frame_Shift_Del	DEL	pfam_RNase_Zc3h12	p.D173fs	ENST00000251343.5	37	c.513	CCDS32058.1	14																																																																																			KHNYN	-	NULL	ENSG00000100441		0.637	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KHNYN	HGNC	protein_coding	OTTHUMT00000412928.1		0.00	30	0	G			24900980	+1	tier1		no_errors	ENST00000251343	ensembl	human	known	74_37	frame_shift_del	8.33	22	2	DEL	0.000	-
KIAA1324	57535	genome.wustl.edu	37	1	109743447	109743447	+	Silent	SNP	C	C	A	rs529832723		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:109743447C>A	ENST00000369939.3	+	21	3081	c.2898C>A	c.(2896-2898)ggC>ggA	p.G966G	KIAA1324_ENST00000369938.1_3'UTR|KIAA1324_ENST00000529753.1_Silent_p.G879G	NM_020775.4	NP_065826	Q6UXG2	K1324_HUMAN	KIAA1324	966					cellular response to starvation (GO:0009267)|macroautophagy (GO:0016236)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of autophagic vacuole assembly (GO:2000786)|positive regulation of vacuole organization (GO:0044090)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	poly(A) RNA binding (GO:0044822)	p.G966G(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		TCATGGAAGGCGAGGATGTAG	0.493											OREG0013630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - coding silent(1)	large_intestine(1)											110.0	97.0	101.0					1																	109743447		2203	4300	6503	SO:0001819	synonymous_variant	0			AK057647	CCDS794.1, CCDS58015.1	1p13.3	2008-09-18			ENSG00000116299	ENSG00000116299			29618	protein-coding gene	gene with protein product	"""estrogen induced gene 121"""	611298				10718198, 16322283	Standard	NM_020775		Approved	maba1, EIG121	uc021orb.1	Q6UXG2	OTTHUMG00000011725	ENST00000369939.3:c.2898C>A	1.37:g.109743447C>A		1422	Q08AE6|Q5T5C9|Q5T5D0|Q5T5D1|Q9P2M2	Silent	SNP	superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Growth_fac_rcpt_N_dom	p.G966	ENST00000369939.3	37	c.2898	CCDS794.1	1																																																																																			KIAA1324	-	NULL	ENSG00000116299		0.493	KIAA1324-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1324	HGNC	protein_coding	OTTHUMT00000032389.2		0.00	17	0	C	NM_020775		109743447	+1			no_errors	ENST00000369939	ensembl	human	known	74_37	silent	10.53	17	2	SNP	0.986	A
KIF13A	63971	genome.wustl.edu	37	6	17764594	17764594	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr6:17764594G>A	ENST00000259711.6	-	39	5270	c.5165C>T	c.(5164-5166)aCg>aTg	p.T1722M	KIF13A_ENST00000378814.5_Missense_Mutation_p.T1674M|KIF13A_ENST00000378816.5_Missense_Mutation_p.T1687M|KIF13A_ENST00000378826.2_Missense_Mutation_p.T1687M|KIF13A_ENST00000378843.2_Missense_Mutation_p.T1674M	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1722					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GTGTTCTACCGTCACCTCCCT	0.483																																																	0													81.0	75.0	77.0					6																	17764594		1901	4118	6019	SO:0001583	missense	0			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.5165C>T	6.37:g.17764594G>A	ENSP00000259711:p.Thr1722Met		A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.T1722M	ENST00000259711.6	37	c.5165	CCDS47381.1	6	.	.	.	.	.	.	.	.	.	.	G	21.8	4.207900	0.79240	.	.	ENSG00000137177	ENST00000378814;ENST00000502297;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	T;T;T;T;T;T	0.76060	-0.96;1.54;-0.91;-0.99;-0.97;-0.99	5.78	5.78	0.91487	.	0.206219	0.42682	D	0.000669	T	0.76321	0.3971	L	0.34521	1.04	0.37870	D	0.930022	D;D;D;D	0.89917	0.999;1.0;0.998;0.997	P;D;P;P	0.63703	0.897;0.917;0.791;0.855	T	0.76011	-0.3115	10	0.49607	T	0.09	.	20.3754	0.98918	0.0:0.0:1.0:0.0	.	1674;1687;1722;1674	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;KI13A_HUMAN;.	M	1674;726;1722;1687;1674;1687	ENSP00000368091:T1674M;ENSP00000425616:T726M;ENSP00000259711:T1722M;ENSP00000368103:T1687M;ENSP00000368120:T1674M;ENSP00000368093:T1687M	ENSP00000259711:T1722M	T	-	2	0	KIF13A	17872573	1.000000	0.71417	0.972000	0.41901	0.973000	0.67179	6.417000	0.73337	2.894000	0.99253	0.591000	0.81541	ACG	KIF13A	-	NULL	ENSG00000137177		0.483	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	HGNC	protein_coding	OTTHUMT00000039954.4	-	0.00	149	0	G			17764594	-1	tier1	-	no_errors	ENST00000259711	ensembl	human	known	74_37	missense	13.10	126	19	SNP	0.997	A
KLHDC7B	113730	genome.wustl.edu	37	22	50987858	50987858	+	Silent	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr22:50987858C>T	ENST00000395676.2	+	1	1397	c.1263C>T	c.(1261-1263)taC>taT	p.Y421Y	CTA-384D8.31_ENST00000434237.1_RNA	NM_138433.3	NP_612442.2	Q96G42	KLD7B_HUMAN	kelch domain containing 7B	421										central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	14		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGGAGTGCTACGACCCGCGAA	0.677																																																	0													79.0	78.0	79.0					22																	50987858		2203	4299	6502	SO:0001819	synonymous_variant	0			BC009980	CCDS14097.2	22q13.33	2006-11-29		2005-12-13	ENSG00000130487	ENSG00000130487			25145	protein-coding gene	gene with protein product							Standard	NM_138433		Approved	MGC16635	uc003bmi.3	Q96G42	OTTHUMG00000150250	ENST00000395676.2:c.1263C>T	22.37:g.50987858C>T				Silent	SNP	pfam_Kelch_1,smart_Kelch_1	p.Y421	ENST00000395676.2	37	c.1263	CCDS14097.2	22																																																																																			KLHDC7B	-	pfam_Kelch_1,smart_Kelch_1	ENSG00000130487		0.677	KLHDC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC7B	HGNC	protein_coding	OTTHUMT00000317089.2		0.00	50	0	C	NM_138433		50987858	+1			no_errors	ENST00000395676	ensembl	human	known	74_37	silent	8.57	32	3	SNP	0.994	T
KLHL7	55975	genome.wustl.edu	37	7	23164708	23164708	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr7:23164708C>T	ENST00000339077.5	+	4	602	c.359C>T	c.(358-360)gCa>gTa	p.A120V	KLHL7_ENST00000322275.5_Missense_Mutation_p.A120V|KLHL7_ENST00000545443.1_Missense_Mutation_p.A98V|KLHL7_ENST00000542558.1_Intron|KLHL7_ENST00000409689.1_Missense_Mutation_p.A72V|KLHL7_ENST00000410047.1_Missense_Mutation_p.A98V|KLHL7_ENST00000545771.1_Missense_Mutation_p.A98V|KLHL7_ENST00000479288.1_Intron|KLHL7_ENST00000539124.1_Missense_Mutation_p.A44V|KLHL7_ENST00000322231.7_Missense_Mutation_p.A98V	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	120					protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TTGCTGGATGCAGCAAACCAA	0.313																																																	0													96.0	98.0	97.0					7																	23164708		2202	4299	6501	SO:0001583	missense	0				CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.359C>T	7.37:g.23164708C>T	ENSP00000343273:p.Ala120Val		A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.A120V	ENST00000339077.5	37	c.359	CCDS34609.1	7	.	.	.	.	.	.	.	.	.	.	C	25.0	4.596653	0.86953	.	.	ENSG00000122550	ENST00000322231;ENST00000339077;ENST00000322275;ENST00000539124;ENST00000409689;ENST00000410047;ENST00000545771;ENST00000545443	T;T;T;T;T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77;-0.77;-0.77;-0.77;-0.77	5.78	5.78	0.91487	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.86867	0.6036	M	0.76170	2.325	0.80722	D	1	D;P;P;D;D	0.71674	0.998;0.757;0.518;0.998;0.998	D;B;B;D;D	0.80764	0.994;0.333;0.103;0.994;0.994	D	0.86688	0.1921	10	0.66056	D	0.02	.	20.3668	0.98882	0.0:1.0:0.0:0.0	.	98;120;98;120;98	F5GYE2;Q8IXQ5;Q8IXQ5-2;Q8IXQ5-3;Q8IXQ5-4	.;KLHL7_HUMAN;.;.;.	V	98;120;120;44;72;98;98;98	ENSP00000322958:A98V;ENSP00000343273:A120V;ENSP00000323270:A120V;ENSP00000441136:A44V;ENSP00000386263:A72V;ENSP00000386999:A98V;ENSP00000446445:A98V;ENSP00000442366:A98V	ENSP00000322958:A98V	A	+	2	0	KLHL7	23131233	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.228000	0.78079	2.894000	0.99253	0.655000	0.94253	GCA	KLHL7	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin	ENSG00000122550		0.313	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL7	HGNC	protein_coding	OTTHUMT00000326860.3	-	0.00	56	0	C	NM_018846		23164708	+1	tier1	-	no_errors	ENST00000339077	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
KSR2	283455	genome.wustl.edu	37	12	117977585	117977585	+	Silent	SNP	C	C	T	rs377054023		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:117977585C>T	ENST00000339824.5	-	10	2353	c.1626G>A	c.(1624-1626)ccG>ccA	p.P542P	KSR2_ENST00000302438.5_Silent_p.P239P|KSR2_ENST00000545002.1_5'UTR|KSR2_ENST00000425217.1_Silent_p.P513P			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	542	Pro-rich.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGGGAGAAGGCGGCGTGGCAC	0.642																																																	0								C		0,4228		0,0,2114	68.0	80.0	76.0		1539	0.9	1.0	12		76	1,8429		0,1,4214	no	coding-synonymous	KSR2	NM_173598.4		0,1,6328	TT,TC,CC		0.0119,0.0,0.0079		513/922	117977585	1,12657	2114	4215	6329	SO:0001819	synonymous_variant	0			AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.1626G>A	12.37:g.117977585C>T			A0PJT2|Q3B828|Q8N775	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.P542	ENST00000339824.5	37	c.1626		12																																																																																			KSR2	-	NULL	ENSG00000171435		0.642	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	KSR2	HGNC	protein_coding	OTTHUMT00000401987.2	-	0.00	33	0	C	NM_173598		117977585	-1	tier1	-	no_errors	ENST00000339824	ensembl	human	known	74_37	silent	15.79	32	6	SNP	0.980	T
LAT2	7462	genome.wustl.edu	37	7	73638368	73638368	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr7:73638368G>A	ENST00000460943.1	+	12	1358	c.469G>A	c.(469-471)Ggt>Agt	p.G157S	LAT2_ENST00000344995.5_Missense_Mutation_p.G157S|LAT2_ENST00000398475.1_Missense_Mutation_p.G157S|LAT2_ENST00000275635.7_Missense_Mutation_p.G157S	NM_032464.2	NP_115853.2	Q9UHI5	LAT2_HUMAN	linker for activation of T cells family, member 2	0					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6					L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	GGAGGGCATAGGTGGCCTCTG	0.622																																																	0													41.0	49.0	46.0					7																	73638368		1979	4165	6144	SO:0001583	missense	0			AF257135	CCDS5566.2	7q11.23	2011-11-01	2005-04-26	2005-04-26	ENSG00000086730	ENSG00000086730			12749	protein-coding gene	gene with protein product	"""linker for activation of B cells"", ""non-T cell activation linker"", ""linker for activation of T cells, transmembrane adaptor 2"""	605719	"""Williams-Beuren syndrome chromosome region 5"""	WBSCR15, WBSCR5		8812460, 12514734	Standard	NM_032464		Approved	WSCR5, HSPC046, LAB, NTAL	uc003uai.3	Q9GZY6	OTTHUMG00000130151	ENST00000460943.1:c.469G>A	7.37:g.73638368G>A	ENSP00000420494:p.Gly157Ser		B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Missense_Mutation	SNP	NULL	p.G157S	ENST00000460943.1	37	c.469	CCDS5566.2	7	.	.	.	.	.	.	.	.	.	.	G	7.564	0.665394	0.14710	.	.	ENSG00000086730	ENST00000344995;ENST00000460943;ENST00000398475;ENST00000275635	T;T;T;T	0.03580	3.88;3.88;3.88;3.88	2.75	1.81	0.25067	.	.	.	.	.	T	0.03783	0.0107	N	0.14661	0.345	0.09310	N	1	P	0.48694	0.914	P	0.47744	0.556	T	0.45585	-0.9251	9	0.87932	D	0	.	7.8631	0.29522	0.0:0.2595:0.7404:0.0	.	157	Q9GZY6	NTAL_HUMAN	S	157	ENSP00000344881:G157S;ENSP00000420494:G157S;ENSP00000381492:G157S;ENSP00000275635:G157S	ENSP00000275635:G157S	G	+	1	0	LAT2	73276304	0.000000	0.05858	0.004000	0.12327	0.019000	0.09904	-0.199000	0.09491	0.414000	0.25790	0.491000	0.48974	GGT	LAT2	-	NULL	ENSG00000086730		0.622	LAT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LAT2	HGNC	protein_coding	OTTHUMT00000277062.1	-	0.00	65	0	G			73638368	+1	tier1	-	no_errors	ENST00000275635	ensembl	human	known	74_37	missense	9.80	45	5	SNP	0.004	A
LINC00599	157627	genome.wustl.edu	37	8	9760811	9760811	+	lincRNA	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr8:9760811G>A	ENST00000385275.1	-	0	170					NR_029668.1				long intergenic non-protein coding RNA 599																		TCGCGCCCGCGGCCGCTGCGC	0.741																																																	0																																												0			AF052108		8p23.1	2012-10-19			ENSG00000253230	ENSG00000253230		"""Long non-coding RNAs"", ""-"""	27231	non-coding RNA	RNA, long non-coding	"""retinal non-coding RNA 3"""					8619474, 9110174	Standard	NR_024281		Approved	Rncr3			OTTHUMG00000163734		8.37:g.9760811G>A				RNA	SNP	-	NULL	ENST00000385275.1	37	NULL		8																																																																																			LINC00599	-	-	ENSG00000253230		0.741	LINC00599-201	KNOWN	basic	miRNA	LINC00599	HGNC	lincRNA		-	0.00	44	0	G	NR_024281		9760811	-1	tier1	-	no_errors	ENST00000517675	ensembl	human	known	74_37	rna	26.67	44	16	SNP	0.000	A
LMLN	89782	genome.wustl.edu	37	3	197762815	197762815	+	Missense_Mutation	SNP	G	G	T	rs147639153		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr3:197762815G>T	ENST00000330198.4	+	15	1790	c.1768G>T	c.(1768-1770)Gat>Tat	p.D590Y	LMLN_ENST00000482695.1_Missense_Mutation_p.D575Y|LMLN_ENST00000420910.2_Missense_Mutation_p.D627Y|LMLN-AS1_ENST00000423460.1_RNA|LMLN_ENST00000332636.5_Missense_Mutation_p.D538Y	NM_033029.3	NP_149018.2	Q96KR4	LMLN_HUMAN	leishmanolysin-like (metallopeptidase M8 family)	590					cell adhesion (GO:0007155)|mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		CTGGATTCACGATGGAAACCT	0.522																																																	0													128.0	120.0	122.0					3																	197762815		2203	4300	6503	SO:0001583	missense	0			AJ312398	CCDS3332.1, CCDS46988.1	3q29	2008-02-04			ENSG00000185621	ENSG00000185621	3.4.24.36		15991	protein-coding gene	gene with protein product		609380					Standard	NM_033029		Approved	Gp63, Msp	uc010iar.3	Q96KR4	OTTHUMG00000155375	ENST00000330198.4:c.1768G>T	3.37:g.197762815G>T	ENSP00000328829:p.Asp590Tyr		B3LDG9|B3LDH0|C9J796|F8WB28|Q96KR5	Missense_Mutation	SNP	pfam_Peptidase_M8	p.D590Y	ENST00000330198.4	37	c.1768	CCDS3332.1	3	.	.	.	.	.	.	.	.	.	.	G	11.11	1.541091	0.27563	.	.	ENSG00000185621	ENST00000482695;ENST00000330198;ENST00000420910;ENST00000332636	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.28	3.38	0.38709	.	0.732861	0.13326	N	0.396278	T	0.42494	0.1205	N	0.22421	0.69	0.09310	N	1	D;P;D;B;B	0.59357	0.965;0.773;0.985;0.04;0.018	P;P;P;B;B	0.57911	0.829;0.465;0.679;0.078;0.047	T	0.19031	-1.0318	10	0.56958	D	0.05	-1.5213	8.1992	0.31415	0.2056:0.0:0.7944:0.0	.	590;538;627;619;575	Q96KR4;F8WCE5;F8WB28;B4DR62;Q96KR4-2	LMLN_HUMAN;.;.;.;.	Y	575;590;627;538	ENSP00000418324:D575Y;ENSP00000328829:D590Y;ENSP00000410926:D627Y;ENSP00000328611:D538Y	ENSP00000328829:D590Y	D	+	1	0	LMLN	199247212	0.099000	0.21834	0.007000	0.13788	0.952000	0.60782	2.344000	0.44010	0.519000	0.28406	0.650000	0.86243	GAT	LMLN	-	pfam_Peptidase_M8	ENSG00000185621		0.522	LMLN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LMLN	HGNC	protein_coding	OTTHUMT00000339701.1		0.00	85	0	G	NM_033029		197762815	+1			no_errors	ENST00000330198	ensembl	human	known	74_37	missense	6.06	61	4	SNP	0.016	T
MAML3	55534	genome.wustl.edu	37	4	141055470	141055470	+	Intron	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr4:141055470G>T	ENST00000509479.2	-	1	1325				RP11-392B6.1_ENST00000509184.1_RNA	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					CAAGGAACTTGTACAACCAAG	0.443																																																	0																																										SO:0001627	intron_variant	0			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.468+18543C>A	4.37:g.141055470G>T				RNA	SNP	-	NULL	ENST00000509479.2	37	NULL	CCDS54805.1	4																																																																																			RP11-392B6.1	-	-	ENSG00000250698		0.443	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927516	Clone_based_vega_gene	protein_coding	OTTHUMT00000364934.2	-	0.00	44	0	G			141055470	+1	tier1	-	no_errors	ENST00000509184	ensembl	human	known	74_37	rna	10.26	35	4	SNP	0.000	T
TMC3	342125	genome.wustl.edu	37	15	81633902	81633902	+	Intron	SNP	G	G	T	rs536229335		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr15:81633902G>T	ENST00000359440.5	-	16	1851				RP11-761I4.3_ENST00000559277.1_RNA|RP11-761I4.3_ENST00000560851.1_RNA|TMC3_ENST00000558726.1_Intron|RP11-761I4.3_ENST00000559781.1_RNA|RP11-761I4.3_ENST00000560973.1_RNA	NM_001080532.1	NP_001074001.1			transmembrane channel-like 3											autonomic_ganglia(2)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	34						TTCTCTTTCAGCCTATCTCCC	0.507																																																	0													24.0	25.0	24.0					15																	81633902		1939	4143	6082	SO:0001627	intron_variant	0			AY263163	CCDS45324.1	15q24.3	2006-11-24				ENSG00000188869			22995	protein-coding gene	gene with protein product						12906855, 12812529	Standard	NM_001080532		Approved		uc021ssk.1	Q7Z5M5		ENST00000359440.5:c.1716-43C>A	15.37:g.81633902G>T				Splice_Site	SNP	-	NULL	ENST00000359440.5	37	c.NULL	CCDS45324.1	15																																																																																			RP11-761I4.3	-	-	ENSG00000259343		0.507	TMC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC101929655	Clone_based_vega_gene	protein_coding	OTTHUMT00000417795.3	-	0.00	63	0	G	NM_181841		81633902	+1	tier1	-	no_errors	ENST00000559781	ensembl	human	known	74_37	splice_site	7.55	49	4	SNP	0.010	T
LOC644669	644669	genome.wustl.edu	37	18	15316542	15316542	+	RNA	SNP	G	G	T	rs12953331		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr18:15316542G>T	ENST00000455308.2	-	0	881					NR_027417.1																						gaacagagaagctgaacatac	0.378																																																	0																																												0																															18.37:g.15316542G>T				RNA	SNP	-	NULL	ENST00000455308.2	37	NULL		18																																																																																			AP005901.1	-	-	ENSG00000215512		0.378	AP005901.1-001	KNOWN	basic	processed_transcript	LOC644669	Clone_based_vega_gene	pseudogene	OTTHUMT00000373635.1	-	0.00	41	0	G			15316542	-1	tier1	rs12953331	no_errors	ENST00000455308	ensembl	human	known	74_37	rna	16.00	42	8	SNP	0.181	T
LOXHD1	125336	genome.wustl.edu	37	18	44102122	44102122	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr18:44102122C>T	ENST00000398722.4	-	25	4192	c.4193G>A	c.(4192-4194)gGc>gAc	p.G1398D	LOXHD1_ENST00000579038.1_Missense_Mutation_p.G469D|LOXHD1_ENST00000441893.2_Missense_Mutation_p.G609D|LOXHD1_ENST00000582408.1_Missense_Mutation_p.G565D|LOXHD1_ENST00000536736.1_Missense_Mutation_p.G1676D|LOXHD1_ENST00000441551.2_Missense_Mutation_p.G1470D|LOXHD1_ENST00000300591.6_Missense_Mutation_p.G565D			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1398	PLAT 10. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						CTCCACAGAGCCACGGCTGAA	0.567																																																	0													107.0	100.0	102.0					18																	44102122		692	1591	2283	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.4193G>A	18.37:g.44102122C>T	ENSP00000381707:p.Gly1398Asp		B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.G1676D	ENST00000398722.4	37	c.5027		18	.	.	.	.	.	.	.	.	.	.	C	10.26	1.301548	0.23736	.	.	ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000536736;ENST00000441893;ENST00000335730	T;T;T;T	0.80653	-0.34;-0.34;-1.4;1.14	5.01	5.01	0.66863	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.000000	0.85682	D	0.000000	D	0.89921	0.6855	M	0.84156	2.68	0.52501	D	0.999952	D;P;P;D	0.89917	1.0;0.539;0.859;0.999	D;B;B;D	0.97110	1.0;0.17;0.36;0.979	D	0.91056	0.4882	10	0.66056	D	0.02	.	15.1075	0.72332	0.0:0.8581:0.1419:0.0	.	1676;609;1398;1398	F5GZB4;F8WA52;Q8IVV2-2;Q8IVV2	.;.;.;LOXH1_HUMAN	D	565;1398;1676;609;1398	ENSP00000300591:G565D;ENSP00000381707:G1398D;ENSP00000444586:G1676D;ENSP00000409062:G609D	ENSP00000300591:G565D	G	-	2	0	LOXHD1	42356120	1.000000	0.71417	0.998000	0.56505	0.286000	0.27126	2.519000	0.45546	2.497000	0.84241	0.555000	0.69702	GGC	LOXHD1	-	superfamily_Lipase_LipOase	ENSG00000167210		0.567	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		-	0.00	72	0	C	NM_144612		44102122	-1	tier1	-	no_errors	ENST00000536736	ensembl	human	known	74_37	missense	10.00	54	6	SNP	1.000	T
LPCAT4	254531	genome.wustl.edu	37	15	34651938	34651938	+	Silent	SNP	A	A	G			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr15:34651938A>G	ENST00000314891.6	-	13	1428	c.1251T>C	c.(1249-1251)gcT>gcC	p.A417A		NM_153613.2	NP_705841.2	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4	417					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphoethanolamine O-acyltransferase activity (GO:0047166)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)|lysophospholipid acyltransferase activity (GO:0071617)			NS(1)|breast(1)|large_intestine(2)|lung(5)|prostate(1)	10						CTTGCTCTTCAGCAAAGAGCT	0.587																																																	0													42.0	39.0	40.0					15																	34651938		2201	4298	6499	SO:0001819	synonymous_variant	0			AF542964	CCDS32191.1	15q14	2008-07-02	2008-06-24	2008-06-24		ENSG00000176454			30059	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 2"""	612039	"""acyltransferase like 3"", ""1-acylglycerol-3-phosphate O-acyltransferase 7 (lysophosphatidic acid acyltransferase, eta)"""	AYTL3, AGPAT7		8619474, 9110174, 16243729, 18458083	Standard	XR_243087		Approved	FLJ10257, LPAAT-eta, LPEAT2	uc001zig.3	Q643R3		ENST00000314891.6:c.1251T>C	15.37:g.34651938A>G			A8K2K8|O43412|Q7Z4P4|Q8IUL7|Q8TB38	Silent	SNP	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.A417	ENST00000314891.6	37	c.1251	CCDS32191.1	15																																																																																			LPCAT4	-	NULL	ENSG00000176454		0.587	LPCAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT4	HGNC	protein_coding	OTTHUMT00000418028.2		0.00	58	0	A	NM_153613		34651938	-1			no_errors	ENST00000314891	ensembl	human	known	74_37	silent	5.56	68	4	SNP	0.887	G
PLPPR2	64748	genome.wustl.edu	37	19	11470601	11470601	+	Silent	SNP	C	C	T	rs201978882		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr19:11470601C>T	ENST00000251473.5	+	5	736	c.360C>T	c.(358-360)agC>agT	p.S120S	DKFZP761J1410_ENST00000591608.1_Silent_p.S95S	NM_001170635.1|NM_022737.2	NP_001164106.1|NP_073574.2																					GCCGCTTCAGCCCCCCAGTGC	0.627																																																	0													34.0	35.0	35.0					19																	11470601		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000251473.5:c.360C>T	19.37:g.11470601C>T				Silent	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.S95	ENST00000251473.5	37	c.285	CCDS12258.1	19																																																																																			DKFZP761J1410	-	superfamily_P_Acid_Pase_2/haloperoxidase	ENSG00000105520		0.627	DKFZP761J1410-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR2	Uniprot_gn	protein_coding	OTTHUMT00000458779.1	-	0.00	63	0	C			11470601	+1	tier1	rs201978882	no_errors	ENST00000591608	ensembl	human	known	74_37	silent	8.70	63	6	SNP	0.998	T
LY75	4065	genome.wustl.edu	37	2	160706507	160706507	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:160706507A>G	ENST00000263636.4	-	23	3161	c.3134T>C	c.(3133-3135)cTg>cCg	p.L1045P	LY75_ENST00000554112.1_Missense_Mutation_p.L1045P|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.L1045P|LY75_ENST00000553424.1_Missense_Mutation_p.L1045P|LY75-CD302_ENST00000505052.1_Missense_Mutation_p.L1045P	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1045	C-type lectin 6. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		TGGTATTCTCAGCCTCCCACT	0.373																																																	0													151.0	146.0	148.0					2																	160706507		2203	4300	6503	SO:0001583	missense	0			AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.3134T>C	2.37:g.160706507A>G	ENSP00000263636:p.Leu1045Pro		O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.L1045P	ENST00000263636.4	37	c.3134	CCDS2211.1	2	.	.	.	.	.	.	.	.	.	.	A	0.997	-0.692279	0.03303	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.09817	2.96;2.96;2.94;2.96;2.96	5.11	2.49	0.30216	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.933360	0.08580	U	0.924626	T	0.17365	0.0417	M	0.62723	1.935	0.21147	N	0.999775	B;B;D	0.53151	0.134;0.03;0.958	B;B;P	0.51229	0.027;0.033;0.663	T	0.17258	-1.0375	10	0.34782	T	0.22	-0.4599	4.6088	0.12391	0.4652:0.3058:0.0:0.229	.	1045;1045;1045	O60449-3;O60449;O60449-2	.;LY75_HUMAN;.	P	1045	ENSP00000451511:L1045P;ENSP00000451446:L1045P;ENSP00000263636:L1045P;ENSP00000423463:L1045P;ENSP00000421035:L1045P	ENSP00000423463:L1045P	L	-	2	0	LY75;LY75-CD302	160414753	0.005000	0.15991	0.004000	0.12327	0.274000	0.26718	1.794000	0.38774	0.771000	0.33359	0.482000	0.46254	CTG	LY75	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000054219		0.373	LY75-001	KNOWN	basic|CCDS	protein_coding	LY75	HGNC	protein_coding	OTTHUMT00000255035.1	-	0.00	62	0	A			160706507	-1	tier1	-	no_errors	ENST00000554112	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.000	G
MACF1	23499	genome.wustl.edu	37	1	39906714	39906714	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:39906714G>T	ENST00000372915.3	+	72	18271	c.18184G>T	c.(18184-18186)Gag>Tag	p.E6062*	MACF1_ENST00000317713.7_Nonsense_Mutation_p.E4104*|MACF1_ENST00000567887.1_Nonsense_Mutation_p.E6200*|MACF1_ENST00000289893.4_Nonsense_Mutation_p.E4606*|MACF1_ENST00000564288.1_Nonsense_Mutation_p.E6163*|MACF1_ENST00000539005.1_Nonsense_Mutation_p.E3974*|MACF1_ENST00000361689.2_Nonsense_Mutation_p.E4104*|MACF1_ENST00000545844.1_Nonsense_Mutation_p.E4104*			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	6062					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGAAGAGCTGGAGTTTATTCG	0.398																																																	0													110.0	112.0	111.0					1																	39906714		2203	4300	6503	SO:0001587	stop_gained	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.18184G>T	1.37:g.39906714G>T	ENSP00000362006:p.Glu6062*		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.E4104*	ENST00000372915.3	37	c.12310		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	51|51	17.515589|17.515589	0.99888|0.99888	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	.|.	.|.	.|.	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	0.000000|.	0.64402|.	D|.	0.000013|.	.|T	.|0.76976	.|0.4063	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74210	.|-0.3739	.|4	0.72032|.	D|.	0.01|.	.|.	20.2191|20.2191	0.98319|0.98319	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|V	4104;6062;4104;4104;3974;4606|3107	.|.	ENSP00000289893:E4606X|.	E|G	+|+	1|2	0|0	MACF1|MACF1	39679301|39679301	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.869000|9.869000	0.99810|0.99810	2.780000|2.780000	0.95670|0.95670	0.655000|0.655000	0.94253|0.94253	GAG|GGA	MACF1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000127603		0.398	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	-	0.00	76	0	G	NM_033044		39906714	+1	tier1	-	no_errors	ENST00000317713	ensembl	human	known	74_37	nonsense	6.15	61	4	SNP	1.000	T
MAP4K4	9448	genome.wustl.edu	37	2	102483020	102483020	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:102483020G>T	ENST00000347699.4	+	18	2101	c.2101G>T	c.(2101-2103)Ggg>Tgg	p.G701W	MAP4K4_ENST00000350198.4_Missense_Mutation_p.G617W|MAP4K4_ENST00000350878.4_Missense_Mutation_p.G674W|MAP4K4_ENST00000425019.1_Missense_Mutation_p.G670W|MAP4K4_ENST00000324219.4_Missense_Mutation_p.G779W|MAP4K4_ENST00000456652.1_Missense_Mutation_p.G500W|MAP4K4_ENST00000413150.2_Missense_Mutation_p.G616W|MAP4K4_ENST00000302217.5_Missense_Mutation_p.G501W	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	701					intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GAGTGGCTCCGGGGAACGCTT	0.537																																																	0													63.0	70.0	68.0					2																	102483020		1937	4142	6079	SO:0001583	missense	0			AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.2101G>T	2.37:g.102483020G>T	ENSP00000314363:p.Gly701Trp		O75172|Q9NST7	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.G779W	ENST00000347699.4	37	c.2335	CCDS56130.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.9|23.9	4.471275|4.471275	0.84533|0.84533	.|.	.|.	ENSG00000071054|ENSG00000071054	ENST00000425019;ENST00000324219;ENST00000350198;ENST00000302217;ENST00000413150;ENST00000456652;ENST00000347699;ENST00000417294;ENST00000350878|ENST00000421882	T;T;T;T;T;T;T;T;T|.	0.12774|.	2.65;2.65;2.65;2.65;2.65;2.65;2.65;2.65;2.65|.	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	0.116455|.	0.56097|.	D|.	0.000022|.	T|T	0.73791|0.73791	0.3632|0.3632	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D;D;D;D|.	0.97110|.	0.993;0.981;0.99;0.981;0.992;1.0;0.999;0.992;0.997;1.0|.	T|T	0.69621|0.69621	-0.5096|-0.5096	10|5	0.37606|.	T|.	0.19|.	.|.	20.063|20.063	0.97692|0.97692	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	674;694;500;501;616;701;670;617;670;779|.	B7Z388;B7Z3V5;E7EX83;C9J840;O95819-4;O95819;E7EN19;G3XAA2;O95819-2;G5E948|.	.;.;.;.;.;M4K4_HUMAN;.;.;.;.|.	W|L	670;779;617;501;616;500;701;632;674|517	ENSP00000392830:G670W;ENSP00000313644:G779W;ENSP00000281111:G617W;ENSP00000303600:G501W;ENSP00000389752:G616W;ENSP00000387370:G500W;ENSP00000314363:G701W;ENSP00000409720:G632W;ENSP00000343658:G674W|.	ENSP00000303600:G501W|.	G|R	+|+	1|2	0|0	MAP4K4|MAP4K4	101849452|101849452	1.000000|1.000000	0.71417|0.71417	0.980000|0.980000	0.43619|0.43619	0.992000|0.992000	0.81027|0.81027	6.318000|6.318000	0.72866|0.72866	2.735000|2.735000	0.93741|0.93741	0.655000|0.655000	0.94253|0.94253	GGG|CGG	MAP4K4	-	NULL	ENSG00000071054		0.537	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	MAP4K4	HGNC	protein_coding	OTTHUMT00000339839.1	-	0.00	40	0	G	NM_004834		102483020	+1	tier1	-	no_errors	ENST00000324219	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
MAP2	4133	genome.wustl.edu	37	2	210557512	210557512	+	Silent	SNP	T	T	G			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:210557512T>G	ENST00000360351.4	+	7	1124	c.618T>G	c.(616-618)acT>acG	p.T206T	MAP2_ENST00000361559.4_Intron|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000447185.1_Silent_p.T202T|MAP2_ENST00000392194.1_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	206					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	CAACTAAAACTTACCCTGATA	0.458																																					Pancreas(27;423 979 28787 29963)												0													85.0	83.0	84.0					2																	210557512		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.618T>G	2.37:g.210557512T>G			Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	pfam_MAP2_projctn,pfam_MAP_tubulin-bd_rpt	p.T206	ENST00000360351.4	37	c.618	CCDS2384.1	2																																																																																			MAP2	-	NULL	ENSG00000078018		0.458	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	-	0.00	58	0	T	NM_001039538		210557512	+1	tier1	-	no_errors	ENST00000360351	ensembl	human	known	74_37	silent	11.11	48	6	SNP	0.000	G
MAST2	23139	genome.wustl.edu	37	1	46496277	46496277	+	Splice_Site	SNP	A	A	G			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:46496277A>G	ENST00000361297.2	+	22	2836		c.e22-1		MAST2_ENST00000372009.2_Splice_Site	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					CTGTGCCCACAGGTGTACAGC	0.602																																																	0													12.0	14.0	14.0					1																	46496277		2068	4208	6276	SO:0001630	splice_region_variant	0			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.2554-1A>G	1.37:g.46496277A>G				Splice_Site	SNP	-	e22-2	ENST00000361297.2	37	c.2554-2	CCDS41326.1	1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.147053	0.77888	.	.	ENSG00000086015	ENST00000361297;ENST00000372009;ENST00000432341;ENST00000372008	.	.	.	4.86	4.86	0.63082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7905	0.63138	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAST2	46268864	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.009000	0.93606	2.037000	0.60232	0.459000	0.35465	.	MAST2	-	-	ENSG00000086015		0.602	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST2	HGNC	protein_coding	OTTHUMT00000021977.1	-	0.00	80	0	A	NM_015112	Intron	46496277	+1	tier1	-	no_errors	ENST00000361297	ensembl	human	known	74_37	splice_site	5.48	69	4	SNP	1.000	G
MAST2	23139	genome.wustl.edu	37	1	46501457	46501457	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:46501457C>T	ENST00000361297.2	+	29	5399	c.5116C>T	c.(5116-5118)Cag>Tag	p.Q1706*	MAST2_ENST00000372009.2_Nonsense_Mutation_p.Q1516*	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					GGGGAAGACACAGCCACCTAG	0.572																																																	0													59.0	68.0	65.0					1																	46501457		1968	4162	6130	SO:0001587	stop_gained	0			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.5116C>T	1.37:g.46501457C>T	ENSP00000354671:p.Gln1706*			Nonsense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_dom	p.Q1706*	ENST00000361297.2	37	c.5116	CCDS41326.1	1	.	.	.	.	.	.	.	.	.	.	c	42	9.624801	0.99223	.	.	ENSG00000086015	ENST00000361297;ENST00000372009	.	.	.	5.8	1.46	0.22682	.	2.068350	0.02044	N	0.049541	.	.	.	.	.	.	0.52099	D	0.999944	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-1.4142	3.3675	0.07208	0.5211:0.2462:0.0:0.2327	.	.	.	.	X	1706;1516	.	ENSP00000354671:Q1706X	Q	+	1	0	MAST2	46274044	0.001000	0.12720	0.351000	0.25721	0.747000	0.42532	-0.208000	0.09371	0.233000	0.21120	0.651000	0.88453	CAG	MAST2	-	NULL	ENSG00000086015		0.572	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST2	HGNC	protein_coding	OTTHUMT00000021977.1	-	0.00	44	0	C	NM_015112		46501457	+1	tier1	-	no_errors	ENST00000361297	ensembl	human	known	74_37	nonsense	9.52	38	4	SNP	0.107	T
MCC	4163	genome.wustl.edu	37	5	112379231	112379231	+	Missense_Mutation	SNP	G	G	A	rs372422505		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr5:112379231G>A	ENST00000302475.4	-	15	2745	c.2182C>T	c.(2182-2184)Cgt>Tgt	p.R728C	MCC_ENST00000515367.2_Missense_Mutation_p.R665C|MCC_ENST00000408903.3_Missense_Mutation_p.R918C|MCC_ENST00000514701.3_5'UTR	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	728					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		GCTTACCGACGAATGGCGTTG	0.562											OREG0016728	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								G	CYS/ARG,CYS/ARG	0,4404		0,0,2202	109.0	69.0	83.0		2752,2182	5.2	1.0	5		83	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	MCC	NM_001085377.1,NM_002387.2	180,180	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	918/1020,728/830	112379231	1,13003	2202	4300	6502	SO:0001583	missense	0				CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.2182C>T	5.37:g.112379231G>A	ENSP00000305617:p.Arg728Cys	1442	D3DT05|Q6ZR04	Missense_Mutation	SNP	pfam_USH1C-bd_PDZ_domain,superfamily_tRNA-bd_arm	p.R728C	ENST00000302475.4	37	c.2182	CCDS4111.1	5	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208457	0.58343	0.0	1.16E-4	ENSG00000171444	ENST00000302475;ENST00000515367;ENST00000408903	T;T;T	0.36520	2.42;2.42;1.25	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.43853	0.1266	N	0.19112	0.55	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.79108	0.992;0.973	T	0.42816	-0.9429	10	0.59425	D	0.04	.	12.8849	0.58038	0.0:0.0:0.8269:0.173	.	918;728	P23508-2;P23508	.;CRCM_HUMAN	C	728;665;918	ENSP00000305617:R728C;ENSP00000421615:R665C;ENSP00000386227:R918C	ENSP00000305617:R728C	R	-	1	0	MCC	112407130	1.000000	0.71417	0.992000	0.48379	0.258000	0.26162	2.581000	0.46077	2.409000	0.81822	0.561000	0.74099	CGT	MCC	-	NULL	ENSG00000171444		0.562	MCC-001	KNOWN	basic|CCDS	protein_coding	MCC	HGNC	protein_coding	OTTHUMT00000250736.3	-	0.00	54	0	G	NM_001085377		112379231	-1	tier1	-	no_errors	ENST00000302475	ensembl	human	known	74_37	missense	9.30	39	4	SNP	0.996	A
MED13L	23389	genome.wustl.edu	37	12	116401223	116401223	+	Silent	SNP	C	C	T	rs140228421		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:116401223C>T	ENST00000281928.3	-	30	6695	c.6489G>A	c.(6487-6489)tcG>tcA	p.S2163S	RP11-493P1.2_ENST00000549725.1_RNA	NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	2163						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TTAAAACATCCGACGTGGTTT	0.448																																																	0								A		0,4406		0,0,2203	123.0	107.0	112.0		6489	1.5	1.0	12	dbSNP_134	112	1,8599		0,1,4299	no	coding-synonymous	MED13L	NM_015335.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		2163/2211	116401223	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.6489G>A	12.37:g.116401223C>T			A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Silent	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.S2163	ENST00000281928.3	37	c.6489	CCDS9177.1	12																																																																																			MED13L	-	pfam_Mediator_Med13	ENSG00000123066		0.448	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13L	HGNC	protein_coding	OTTHUMT00000403879.3	-	0.00	51	0	C			116401223	-1	tier1	rs140228421	no_errors	ENST00000281928	ensembl	human	known	74_37	silent	8.70	42	4	SNP	0.962	T
MEF2C	4208	genome.wustl.edu	37	5	88100421	88100421	+	Silent	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr5:88100421G>A	ENST00000437473.2	-	3	669	c.252C>T	c.(250-252)atC>atT	p.I84I	MEF2C_ENST00000514028.1_Silent_p.I84I|MEF2C_ENST00000506554.1_Silent_p.I84I|MEF2C_ENST00000514015.1_Silent_p.I84I|MEF2C_ENST00000424173.2_Silent_p.I84I|MEF2C_ENST00000510942.1_Silent_p.I84I|MEF2C_ENST00000340208.5_Silent_p.I84I|MEF2C_ENST00000539796.1_Silent_p.I84I|MEF2C_ENST00000508569.1_Silent_p.I84I|MEF2C_ENST00000504921.2_Silent_p.I84I	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	84					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		TCACCTCCACGATGTCTGAGT	0.547										HNSCC(66;0.2)																																							0													117.0	108.0	111.0					5																	88100421		2203	4300	6503	SO:0001819	synonymous_variant	0			AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.252C>T	5.37:g.88100421G>A			C9JMZ0|D7F7N5|F8W7V7	Silent	SNP	pfam_TF_MADSbox,pfam_HJURP_C,superfamily_TF_MADSbox,smart_TF_MADSbox,prints_TF_MADSbox,pfscan_TF_MADSbox	p.I84	ENST00000437473.2	37	c.252	CCDS47245.1	5																																																																																			MEF2C	-	superfamily_TF_MADSbox	ENSG00000081189		0.547	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	MEF2C	HGNC	protein_coding	OTTHUMT00000369817.1	-	0.00	63	0	G	NM_002397		88100421	-1	tier1	-	no_errors	ENST00000437473	ensembl	human	known	74_37	silent	10.45	60	7	SNP	0.999	A
METTL2A	339175	genome.wustl.edu	37	17	60518003	60518003	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr17:60518003G>A	ENST00000311506.5	+	6	731	c.695G>A	c.(694-696)cGg>cAg	p.R232Q		NM_181725.3	NP_859076.3	Q96IZ6	MET2A_HUMAN	methyltransferase like 2A	232					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(2)|central_nervous_system(1)|endometrium(1)|upper_aerodigestive_tract(2)	6			BRCA - Breast invasive adenocarcinoma(2;1.08e-10)			GATCCTTCTCGGTGTTTTGCC	0.368																																																	0													190.0	180.0	183.0					17																	60518003		2203	4300	6503	SO:0001583	missense	0			AK000991	CCDS45752.1	17q23.3	2012-12-20		2006-02-10	ENSG00000087995	ENSG00000087995			25755	protein-coding gene	gene with protein product						12477932	Standard	NM_181725		Approved	FLJ12760, METTL2	uc002izv.2	Q96IZ6	OTTHUMG00000164527	ENST00000311506.5:c.695G>A	17.37:g.60518003G>A	ENSP00000309610:p.Arg232Gln		A6NNC4|Q9H9G9|Q9NUI8|Q9P0B5	Missense_Mutation	SNP	pfam_Methyltransf_12,pfam_Methyltransf_11,pfam_UbiE/COQ5_MeTrFase,pirsf_MeTrfase	p.R232Q	ENST00000311506.5	37	c.695	CCDS45752.1	17	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843154	0.71488	.	.	ENSG00000087995	ENST00000311506	T	0.04603	3.59	4.73	4.73	0.59995	Methyltransferase type 12 (1);	0.000000	0.85682	D	0.000000	T	0.14184	0.0343	M	0.63428	1.95	0.80722	D	1	P	0.52577	0.954	P	0.55713	0.782	T	0.03202	-1.1061	10	0.30078	T	0.28	-0.0107	16.7058	0.85371	0.0:0.0:1.0:0.0	.	232	Q96IZ6	MTL2A_HUMAN	Q	232	ENSP00000309610:R232Q	ENSP00000309610:R232Q	R	+	2	0	METTL2A	57871735	1.000000	0.71417	0.983000	0.44433	0.538000	0.34931	9.401000	0.97294	2.348000	0.79779	0.586000	0.80456	CGG	METTL2A	-	pfam_Methyltransf_12,pfam_Methyltransf_11,pfam_UbiE/COQ5_MeTrFase,pirsf_MeTrfase	ENSG00000087995		0.368	METTL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL2A	HGNC	protein_coding	OTTHUMT00000445130.1	-	0.00	65	0	G	NM_181725		60518003	+1	tier1	-	no_errors	ENST00000311506	ensembl	human	known	74_37	missense	13.58	70	11	SNP	1.000	A
MEX3A	92312	genome.wustl.edu	37	1	156051653	156051653	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:156051653C>A	ENST00000532414.2	-	1	136	c.137G>T	c.(136-138)tGc>tTc	p.C46F	LMNA_ENST00000368301.2_5'Flank|MEX3A_ENST00000442784.1_5'Flank	NM_001093725.1	NP_001087194.1	A1L020	MEX3A_HUMAN	mex-3 RNA binding family member A	46						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9	Hepatocellular(266;0.158)|all_neural(408;0.195)					ACCCAGGAGGCAGAGTTGATC	0.731																																																	0													13.0	14.0	14.0					1																	156051653		1316	2646	3962	SO:0001583	missense	0			AK024097	CCDS53377.1	1q22	2013-09-24	2013-08-21	2007-07-18	ENSG00000254726	ENSG00000254726		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	33482	protein-coding gene	gene with protein product		611007	"""ring finger and KH domain containing 4"", ""mex-3 homolog A (C. elegans)"""	RKHD4		17267406	Standard	NM_001093725		Approved		uc001fnd.4	A1L020	OTTHUMG00000017465	ENST00000532414.2:c.137G>T	1.37:g.156051653C>A	ENSP00000432845:p.Cys46Phe			Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,smart_Znf_RING,pfscan_Znf_RING,pfscan_KH_dom_type_1	p.C46F	ENST00000532414.2	37	c.137	CCDS53377.1	1	.	.	.	.	.	.	.	.	.	.	c	12.40	1.927124	0.34002	.	.	ENSG00000254726	ENST00000532414	T	0.46819	0.86	2.2	2.2	0.27929	.	0.230379	0.19497	U	0.112840	T	0.08358	0.0208	N	0.08118	0	0.29487	N	0.855902	P	0.39940	0.696	B	0.22753	0.041	T	0.10177	-1.0641	10	0.62326	D	0.03	.	7.9291	0.29891	0.0:1.0:0.0:0.0	.	46	A1L020	MEX3A_HUMAN	F	46	ENSP00000432845:C46F	ENSP00000432845:C46F	C	-	2	0	MEX3A	154318277	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.905000	0.39878	1.232000	0.43678	0.403000	0.27427	TGC	MEX3A	-	NULL	ENSG00000254726		0.731	MEX3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEX3A	HGNC	protein_coding	OTTHUMT00000046218.3		0.00	43	0	C	NM_001093725		156051653	-1			no_errors	ENST00000532414	ensembl	human	known	74_37	missense	9.30	38	4	SNP	1.000	A
MIR487A	619555	genome.wustl.edu	37	14	101521775	101521775	+	RNA	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr14:101521775G>A	ENST00000384827.1	+	0	80				MIR323B_ENST00000385269.2_RNA|MIR485_ENST00000385292.2_RNA|MIR134_ENST00000385258.2_RNA|MIR382_ENST00000385009.2_RNA	NR_030162.1				microRNA 487a																		GAGGCTGGCCGTGATGAATTC	0.532																																																	0													123.0	116.0	118.0					14																	101521775		1568	3582	5150			0					14q32.31	2011-09-12	2006-02-23	2008-12-18	ENSG00000207558	ENSG00000207558		"""ncRNAs / Micro RNAs"""	32343	non-coding RNA	RNA, micro			"""microRNA 487"""	MIRN487, MIRN487A			Standard	NR_030162		Approved	hsa-mir-487, hsa-mir-487a	uc021sdk.1				14.37:g.101521775G>A				RNA	SNP	-	NULL	ENST00000384827.1	37	NULL		14																																																																																			MIR485	-	-	ENSG00000208027		0.532	MIR487A-201	KNOWN	basic	miRNA	MIR485	HGNC	miRNA			0.00	21	0	G	NR_030162		101521775	+1			no_errors	ENST00000385292	ensembl	human	known	74_37	rna	9.09	40	4	SNP	1.000	A
MKI67	4288	genome.wustl.edu	37	10	129913974	129913974	+	Frame_Shift_Del	DEL	T	T	-			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr10:129913974delT	ENST00000368654.3	-	7	1073	c.698delA	c.(697-699)aatfs	p.N233fs	MKI67_ENST00000368653.3_Intron	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	233					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GGGAGATTCATTTTTTTTGCT	0.343																																																	0													77.0	75.0	76.0					10																	129913974		2203	4300	6503	SO:0001589	frameshift_variant	0			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.698delA	10.37:g.129913974delT	ENSP00000357643:p.Asn233fs		Q5VWH2	Frame_Shift_Del	DEL	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.N233fs	ENST00000368654.3	37	c.698	CCDS7659.1	10																																																																																			MKI67	-	NULL	ENSG00000148773		0.343	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1		0.00	53	0	T	NM_002417		129913974	-1	tier1		no_errors	ENST00000368654	ensembl	human	known	74_37	frame_shift_del	10.42	43	5	DEL	0.003	-
DPM1	8813	genome.wustl.edu	37	20	49576475	49576475	+	5'Flank	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr20:49576475C>T	ENST00000371588.5	-	0	0				DPM1_ENST00000371582.4_5'Flank|MOCS3_ENST00000244051.1_Missense_Mutation_p.R366C|DPM1_ENST00000371583.5_5'Flank|DPM1_ENST00000466152.1_5'Flank	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						GGACATTTGTCGTTTGCCTCA	0.527																																																	0													210.0	209.0	209.0					20																	49576475		2203	4300	6503	SO:0001631	upstream_gene_variant	0			AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742		20.37:g.49576475C>T	Exception_encountered		O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,pfam_MoeZ_MoeB,pfam_Rhodanese-like_dom,superfamily_Molybdenum_cofac_synth_MoeB,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	p.R366C	ENST00000371588.5	37	c.1096	CCDS13434.1	20	.	.	.	.	.	.	.	.	.	.	C	15.26	2.781913	0.49891	.	.	ENSG00000124217	ENST00000244051	T	0.27402	1.67	5.14	3.18	0.36537	Rhodanese-like (4);Molybdenum cofactor biosynthesis, MoeB (1);	0.369961	0.31648	N	0.007294	T	0.30070	0.0753	M	0.73372	2.23	0.58432	D	0.999999	B	0.27351	0.176	B	0.23716	0.048	T	0.10268	-1.0637	9	.	.	.	-2.7197	10.3133	0.43721	0.0:0.8446:0.0:0.1554	.	366	O95396	MOCS3_HUMAN	C	366	ENSP00000244051:R366C	.	R	+	1	0	MOCS3	49009882	0.049000	0.20398	0.987000	0.45799	0.987000	0.75469	1.009000	0.29886	1.407000	0.46875	-0.140000	0.14226	CGT	MOCS3	-	pfam_Rhodanese-like_dom,superfamily_Molybdenum_cofac_synth_MoeB,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	ENSG00000124217		0.527	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOCS3	HGNC	protein_coding	OTTHUMT00000079716.1		0.00	36	0	C	NM_003859		49576475	+1			no_errors	ENST00000244051	ensembl	human	known	74_37	missense	8.11	32	3	SNP	1.000	T
MRPS2	51116	genome.wustl.edu	37	9	138392962	138392962	+	Silent	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr9:138392962C>T	ENST00000371785.1	+	3	371	c.162C>T	c.(160-162)gaC>gaT	p.D54D	MRPS2_ENST00000488610.1_3'UTR|C9orf116_ENST00000371791.1_Intron|MRPS2_ENST00000241600.5_Silent_p.D54D|C9orf116_ENST00000429260.2_5'Flank|C9orf116_ENST00000371789.3_5'Flank|RP11-426A6.5_ENST00000415062.1_RNA			Q9Y399	RT02_HUMAN	mitochondrial ribosomal protein S2	54					translation (GO:0006412)	mitochondrion (GO:0005739)|small ribosomal subunit (GO:0015935)	structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(1)|prostate(2)|urinary_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.46e-53)|Epithelial(140;2.04e-47)|all cancers(34;1.23e-42)		AGTCGGAGGACAGCACCGGTA	0.711																																																	0													7.0	9.0	8.0					9																	138392962		2151	4239	6390	SO:0001819	synonymous_variant	0			AB051627	CCDS6990.1	9q34	2012-09-13			ENSG00000122140	ENSG00000122140		"""Mitochondrial ribosomal proteins / small subunits"""	14495	protein-coding gene	gene with protein product		611971					Standard	NM_016034		Approved	CGI-91	uc004cfv.5	Q9Y399	OTTHUMG00000020910	ENST00000371785.1:c.162C>T	9.37:g.138392962C>T			Q5T899|Q9BSQ4	Silent	SNP	pfam_Ribosomal_S2,superfamily_Ribosomal_S2_flav_dom,prints_Ribosomal_S2	p.D54	ENST00000371785.1	37	c.162	CCDS6990.1	9																																																																																			MRPS2	-	NULL	ENSG00000122140		0.711	MRPS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPS2	HGNC	protein_coding	OTTHUMT00000054998.1	-	0.00	32	0	C			138392962	+1	tier1	-	no_errors	ENST00000241600	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.000	T
MTHFSD	64779	genome.wustl.edu	37	16	86575392	86575392	+	Missense_Mutation	SNP	C	C	T	rs200301012		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr16:86575392C>T	ENST00000360900.6	-	7	617	c.592G>A	c.(592-594)Gac>Aac	p.D198N	MTHFSD_ENST00000543303.2_Missense_Mutation_p.D197N|MTHFSD_ENST00000546093.1_Missense_Mutation_p.D35N|MTHFSD_ENST00000381214.5_Missense_Mutation_p.D198N|MTHFSD_ENST00000322911.6_Missense_Mutation_p.D197N	NM_001159380.1	NP_001152852.1	Q2M296	MTHSD_HUMAN	methenyltetrahydrofolate synthetase domain containing	198							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(3)|lung(6)|skin(1)	11						ACAGTGATGTCGTGCTCCTCA	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		20314	0.001		0.0	False		,,,				2504	0.0																0													90.0	98.0	96.0					16																	86575392		2137	4255	6392	SO:0001583	missense	0			AK023060	CCDS54047.1, CCDS54048.1, CCDS58490.1	16q24.1	2013-02-12				ENSG00000103248		"""RNA binding motif (RRM) containing"""	25778	protein-coding gene	gene with protein product						12477932	Standard	NM_022764		Approved	FLJ12998	uc010vor.2	Q2M296		ENST00000360900.6:c.592G>A	16.37:g.86575392C>T	ENSP00000354152:p.Asp198Asn		A8MQ77|B7ZLC0|B7ZLC2|D3DUM9|E9PAM1|Q9H878|Q9H954	Missense_Mutation	SNP	pfam_FTHF_cligase,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D198N	ENST00000360900.6	37	c.592	CCDS54047.1	16	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	20.6	4.014509	0.75161	.	.	ENSG00000103248	ENST00000543303;ENST00000381214;ENST00000360900;ENST00000322911;ENST00000546093	D;D;D;D	0.95980	-3.87;-3.87;-3.87;-3.87	5.57	5.57	0.84162	5-formyltetrahydrofolate cyclo-ligase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.98648	0.9547	H	0.96720	3.87	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.99605	1.0979	10	0.87932	D	0	-8.267	18.5465	0.91048	0.0:1.0:0.0:0.0	.	198;197;35;198;197	E9PAM1;B7ZLC0;B3KUB0;Q2M296;Q2M296-2	.;.;.;MTHSD_HUMAN;.	N	196;198;198;197;35	ENSP00000370612:D198N;ENSP00000354152:D198N;ENSP00000326777:D197N;ENSP00000438761:D35N	ENSP00000326777:D197N	D	-	1	0	MTHFSD	85132893	1.000000	0.71417	0.755000	0.31263	0.006000	0.05464	7.171000	0.77595	2.626000	0.88956	0.655000	0.94253	GAC	MTHFSD	-	pfam_FTHF_cligase	ENSG00000103248		0.582	MTHFSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTHFSD	HGNC	protein_coding	OTTHUMT00000432182.1		0.00	20	0	C	NM_022764		86575392	-1			no_errors	ENST00000360900	ensembl	human	known	74_37	missense	12.00	22	3	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9057288	9057288	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr19:9057288A>G	ENST00000397910.4	-	3	30361	c.30158T>C	c.(30157-30159)cTc>cCc	p.L10053P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10055	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGGGTGAGGAGTGAAGTCAC	0.483																																																	0													79.0	73.0	75.0					19																	9057288		1961	4156	6117	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.30158T>C	19.37:g.9057288A>G	ENSP00000381008:p.Leu10053Pro		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.L10053P	ENST00000397910.4	37	c.30158	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	a	3.641	-0.073533	0.07184	.	.	ENSG00000181143	ENST00000397910	T	0.28255	1.62	2.39	0.232	0.15381	.	.	.	.	.	T	0.18215	0.0437	N	0.24115	0.695	.	.	.	B	0.15141	0.012	B	0.18871	0.023	T	0.18999	-1.0319	8	0.87932	D	0	.	4.4942	0.11828	0.6728:0.0:0.3272:0.0	.	10053	B5ME49	.	P	10053	ENSP00000381008:L10053P	ENSP00000381008:L10053P	L	-	2	0	MUC16	8918288	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.997000	0.03705	-0.020000	0.14032	0.383000	0.25322	CTC	MUC16	-	NULL	ENSG00000181143		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	42	0	A	NM_024690		9057288	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	14.71	29	5	SNP	0.000	G
MYH7	4625	genome.wustl.edu	37	14	23888490	23888490	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr14:23888490G>T	ENST00000355349.3	-	29	4030	c.3868C>A	c.(3868-3870)Cag>Aag	p.Q1290K	MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1290					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TCATCCAGCTGCCGGGACAGC	0.597																																																	0													87.0	84.0	85.0					14																	23888490		2203	4300	6503	SO:0001583	missense	0			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.3868C>A	14.37:g.23888490G>T	ENSP00000347507:p.Gln1290Lys		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q1290K	ENST00000355349.3	37	c.3868	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	G	16.93	3.258000	0.59321	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	T	0.79352	-1.26	4.99	4.99	0.66335	Myosin tail (1);	.	.	.	.	T	0.81987	0.4939	M	0.79926	2.475	0.46131	D	0.998889	B	0.22983	0.078	B	0.32149	0.141	T	0.80874	-0.1187	9	0.54805	T	0.06	.	18.4795	0.90806	0.0:0.0:1.0:0.0	.	1290	P12883	MYH7_HUMAN	K	1290;1295	ENSP00000347507:Q1290K	ENSP00000347507:Q1290K	Q	-	1	0	MYH7	22958330	1.000000	0.71417	0.993000	0.49108	0.992000	0.81027	7.415000	0.80131	2.602000	0.87976	0.655000	0.94253	CAG	MYH7	-	pfam_Myosin_tail	ENSG00000092054		0.597	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3		0.00	58	0	G	NM_000257		23888490	-1			no_errors	ENST00000355349	ensembl	human	known	74_37	missense	5.88	48	3	SNP	0.999	T
MYO5C	55930	genome.wustl.edu	37	15	52545602	52545602	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr15:52545602G>T	ENST00000261839.7	-	12	1609	c.1448C>A	c.(1447-1449)aCg>aAg	p.T483K	MYO5C_ENST00000443683.2_3'UTR	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	483	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		ATCTATCAGCGTCCAAGGTAT	0.333																																																	0													108.0	101.0	103.0					15																	52545602		1824	4080	5904	SO:0001583	missense	0			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.1448C>A	15.37:g.52545602G>T	ENSP00000261839:p.Thr483Lys		Q6P1W8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.T483K	ENST00000261839.7	37	c.1448	CCDS42036.1	15	.	.	.	.	.	.	.	.	.	.	G	19.38	3.816973	0.70912	.	.	ENSG00000128833	ENST00000261839	D	0.95307	-3.67	5.57	4.66	0.58398	Myosin head, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.92642	0.7662	L	0.50333	1.59	0.80722	D	1	P	0.42556	0.783	B	0.41946	0.371	D	0.92397	0.5926	10	0.51188	T	0.08	.	14.7397	0.69445	0.0696:0.0:0.9304:0.0	.	483	Q9NQX4	MYO5C_HUMAN	K	483	ENSP00000261839:T483K	ENSP00000261839:T483K	T	-	2	0	MYO5C	50332894	1.000000	0.71417	0.996000	0.52242	0.646000	0.38490	9.813000	0.99286	1.489000	0.48450	-0.142000	0.14014	ACG	MYO5C	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000128833		0.333	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5C	HGNC	protein_coding	OTTHUMT00000419562.1		0.00	54	0	G	NM_018728		52545602	-1			no_errors	ENST00000261839	ensembl	human	known	74_37	missense	6.52	42	3	SNP	1.000	T
MYO9B	4650	genome.wustl.edu	37	19	17212666	17212666	+	Missense_Mutation	SNP	G	G	A	rs570386608		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr19:17212666G>A	ENST00000594824.1	+	2	286	c.139G>A	c.(139-141)Gtc>Atc	p.V47I	MYO9B_ENST00000397274.2_Missense_Mutation_p.V47I|CTD-2528A14.5_ENST00000597045.1_RNA|MYO9B_ENST00000595618.1_Missense_Mutation_p.V47I			Q13459	MYO9B_HUMAN	myosin IXB	47	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						CACCTCGGACGTCATCAAGGA	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		18251	0.001		0.0	False		,,,				2504	0.0																0													46.0	51.0	49.0					19																	17212666		2150	4250	6400	SO:0001583	missense	0				CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.139G>A	19.37:g.17212666G>A	ENSP00000471367:p.Val47Ile		O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.V47I	ENST00000594824.1	37	c.139		19	.	.	.	.	.	.	.	.	.	.	G	16.54	3.151997	0.57151	.	.	ENSG00000099331	ENST00000397274	T	0.35789	1.29	4.93	4.93	0.64822	Ras-association (3);	0.000000	0.43416	D	0.000573	T	0.51584	0.1683	L	0.52266	1.64	0.51233	D	0.999915	D;D;D	0.89917	0.969;0.969;1.0	P;P;D	0.74023	0.771;0.771;0.982	T	0.39583	-0.9607	10	0.13470	T	0.59	.	17.1436	0.86760	0.0:0.0:1.0:0.0	.	47;47;53	Q13459;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.	I	47	ENSP00000380444:V47I	ENSP00000380444:V47I	V	+	1	0	MYO9B	17073666	1.000000	0.71417	0.976000	0.42696	0.070000	0.16714	9.459000	0.97638	2.264000	0.75181	0.655000	0.94253	GTC	MYO9B	-	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	ENSG00000099331		0.642	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	MYO9B	HGNC	protein_coding	OTTHUMT00000463236.1	-	0.00	44	0	G			17212666	+1	tier1	-	no_errors	ENST00000594824	ensembl	human	known	74_37	missense	25.64	29	10	SNP	1.000	A
NCDN	23154	genome.wustl.edu	37	1	36028217	36028217	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:36028217G>A	ENST00000373243.2	+	4	1751	c.1368G>A	c.(1366-1368)tgG>tgA	p.W456*	NCDN_ENST00000356090.4_Nonsense_Mutation_p.W456*|NCDN_ENST00000373253.3_Nonsense_Mutation_p.W439*	NM_014284.2	NP_055099.1	Q9UBB6	NCDN_HUMAN	neurochondrin	456					bone resorption (GO:0045453)|neuron projection development (GO:0031175)|regulation of neuronal synaptic plasticity (GO:0048168)	cytosol (GO:0005829)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|pancreas(1)|skin(2)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GGCCCACCTGGCCAGGAGACG	0.592																																																	0													30.0	31.0	30.0					1																	36028217		2203	4300	6503	SO:0001587	stop_gained	0			AB011179	CCDS392.1, CCDS30672.1	1p34.3	2008-02-05			ENSG00000020129	ENSG00000020129			17597	protein-coding gene	gene with protein product		608458				15007648	Standard	NM_014284		Approved	NCDN-1, NCDN-2	uc001bza.3	Q9UBB6	OTTHUMG00000059204	ENST00000373243.2:c.1368G>A	1.37:g.36028217G>A	ENSP00000362340:p.Trp456*		D3DPR9|Q9UBY2|Q9Y4A6|Q9Y4D9	Nonsense_Mutation	SNP	NULL	p.W456*	ENST00000373243.2	37	c.1368	CCDS392.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.4|23.4	4.409176|4.409176	0.83340|0.83340	.|.	.|.	ENSG00000020129|ENSG00000020129	ENST00000423723|ENST00000373253;ENST00000356090;ENST00000373243	.|.	.|.	.|.	4.67|4.67	4.67|4.67	0.58626|0.58626	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.36441|.	0.0967|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.43782|.	-0.9370|.	3|.	.|0.16896	.|T	.|0.51	.|.	7.9697|7.9697	0.30119|0.30119	0.1129:0.0:0.8871:0.0|0.1129:0.0:0.8871:0.0	.|.	.|.	.|.	.|.	D|X	50|439;456;456	.|.	.|ENSP00000348394:W456X	G|W	+|+	2|3	0|0	NCDN|NCDN	35800804|35800804	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	2.986000|2.986000	0.49370|0.49370	2.434000|2.434000	0.82447|0.82447	0.462000|0.462000	0.41574|0.41574	GGC|TGG	NCDN	-	NULL	ENSG00000020129		0.592	NCDN-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NCDN	HGNC	protein_coding	OTTHUMT00000131298.1		0.00	31	0	G	NM_014284		36028217	+1			no_errors	ENST00000356090	ensembl	human	known	74_37	nonsense	6.45	29	2	SNP	1.000	A
NEUROD1	4760	genome.wustl.edu	37	2	182543465	182543465	+	Silent	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:182543465G>A	ENST00000295108.3	-	2	580	c.123C>T	c.(121-123)gaC>gaT	p.D41D	NEUROD1_ENST00000496876.1_Intron|CERKL_ENST00000479558.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	41					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			TTTCGAGGTCGTCCTCCTTCT	0.592																																																	0													123.0	95.0	105.0					2																	182543465		2203	4300	6503	SO:0001819	synonymous_variant	0			U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.123C>T	2.37:g.182543465G>A			B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Silent	SNP	pfam_Neurogenic_DUF,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pirsf_TF_bHLH_NeuroD,pfscan_bHLH_dom	p.D41	ENST00000295108.3	37	c.123	CCDS2283.1	2																																																																																			NEUROD1	-	pirsf_TF_bHLH_NeuroD	ENSG00000162992		0.592	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROD1	HGNC	protein_coding	OTTHUMT00000255792.2	-	0.00	83	0	G	NM_002500		182543465	-1	tier1	-	no_errors	ENST00000295108	ensembl	human	known	74_37	silent	5.49	86	5	SNP	0.996	A
NFE2L1	4779	genome.wustl.edu	37	17	46136806	46136806	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr17:46136806C>T	ENST00000362042.3	+	6	2738	c.2122C>T	c.(2122-2124)Cga>Tga	p.R708*	NFE2L1_ENST00000582155.1_Nonsense_Mutation_p.R520*|RP5-890E16.4_ENST00000583349.1_RNA|NFE2L1_ENST00000585291.1_Nonsense_Mutation_p.R678*|NFE2L1_ENST00000361665.3_Nonsense_Mutation_p.R697*|NFE2L1_ENST00000583378.1_Nonsense_Mutation_p.R509*|NFE2L1_ENST00000536222.1_Nonsense_Mutation_p.R552*|NFE2L1_ENST00000357480.5_Nonsense_Mutation_p.R678*	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1	708	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GCGCTCCCTGCGACAGATGAA	0.602																																																	0													80.0	82.0	81.0					17																	46136806		2203	4300	6503	SO:0001587	stop_gained	0			AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.2122C>T	17.37:g.46136806C>T	ENSP00000354855:p.Arg708*		D3DTU3|D3DTU5|Q12877|Q96FN6	Nonsense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.R708*	ENST00000362042.3	37	c.2122	CCDS11524.1	17	.	.	.	.	.	.	.	.	.	.	C	39	7.661839	0.98419	.	.	ENSG00000082641	ENST00000362042;ENST00000361665;ENST00000357480;ENST00000536222	.	.	.	5.89	5.89	0.94794	.	0.175668	0.51477	D	0.000092	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-8.0756	19.0276	0.92939	0.0:1.0:0.0:0.0	.	.	.	.	X	727;708;678;552	.	ENSP00000350072:R678X	R	+	1	2	NFE2L1	43491805	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.829000	0.69316	2.797000	0.96272	0.563000	0.77884	CGA	NFE2L1	-	pfam_bZIP,smart_bZIP,pfscan_bZIP	ENSG00000082641		0.602	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L1	HGNC	protein_coding	OTTHUMT00000443019.1	-	0.00	37	0	C	NM_003204		46136806	+1	tier1	-	no_errors	ENST00000362042	ensembl	human	known	74_37	nonsense	14.71	29	5	SNP	1.000	T
NFX1	4799	genome.wustl.edu	37	9	33295406	33295406	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr9:33295406G>T	ENST00000379540.3	+	2	1076	c.1014G>T	c.(1012-1014)aaG>aaT	p.K338N	NFX1_ENST00000318524.6_Missense_Mutation_p.K338N|NFX1_ENST00000379521.4_Missense_Mutation_p.K338N	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	338					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.K338N(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		ATGTGCTAAAGAATGTGGAAA	0.373																																																	1	Substitution - Missense(1)	large_intestine(1)											64.0	62.0	63.0					9																	33295406		2203	4300	6503	SO:0001583	missense	0			U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.1014G>T	9.37:g.33295406G>T	ENSP00000368856:p.Lys338Asn		A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	pfam_Znf_NFX1,pfam_R3H_ss-bd,smart_Znf_RING,smart_Znf_NFX1,smart_R3H_ss-bd,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_R3H_ss-bd	p.K338N	ENST00000379540.3	37	c.1014	CCDS6538.1	9	.	.	.	.	.	.	.	.	.	.	G	14.85	2.657214	0.47467	.	.	ENSG00000086102	ENST00000379540;ENST00000379521;ENST00000536210;ENST00000318524	T;T;T	0.51574	0.7;0.7;0.7	5.91	3.66	0.41972	.	0.106915	0.64402	D	0.000010	T	0.62392	0.2424	M	0.72118	2.19	0.45284	D	0.998284	D;D;P;D;P	0.71674	0.998;0.99;0.572;0.998;0.858	D;P;B;D;P	0.68621	0.959;0.697;0.122;0.959;0.491	T	0.62158	-0.6913	10	0.40728	T	0.16	.	10.1027	0.42515	0.1953:0.0:0.8047:0.0	.	338;222;338;338;338	F5GXD0;A0JLR2;Q12986;Q12986-2;Q12986-3	.;.;NFX1_HUMAN;.;.	N	338	ENSP00000368856:K338N;ENSP00000368836:K338N;ENSP00000317695:K338N	ENSP00000317695:K338N	K	+	3	2	NFX1	33285406	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.374000	0.44274	1.413000	0.46997	0.643000	0.83706	AAG	NFX1	-	NULL	ENSG00000086102		0.373	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFX1	HGNC	protein_coding	OTTHUMT00000052069.1		0.00	43	0	G			33295406	+1			no_errors	ENST00000379540	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
NIPSNAP3A	25934	genome.wustl.edu	37	9	107516796	107516796	+	Intron	SNP	A	A	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr9:107516796A>T	ENST00000374767.4	+	4	535				NIPSNAP3A_ENST00000471001.1_3'UTR	NM_015469.1	NP_056284.1	Q9UFN0	NPS3A_HUMAN	nipsnap homolog 3A (C. elegans)							cytoplasm (GO:0005737)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	8						TATTGCTTGAATGTTTTCTGA	0.398																																																	0													38.0	37.0	37.0					9																	107516796		2203	4300	6503	SO:0001627	intron_variant	0			BC005935	CCDS6760.1	9q31.3	2003-11-27			ENSG00000136783	ENSG00000136783			23619	protein-coding gene	gene with protein product		608871				12477932	Standard	NM_015469		Approved	DKFZp564D177, FLJ13953, HSPC299, MGC14553		Q9UFN0	OTTHUMG00000020413	ENST00000374767.4:c.431-36A>T	9.37:g.107516796A>T			A6NM55|Q5VX32|Q9BRV7|Q9H843|Q9P083	RNA	SNP	-	NULL	ENST00000374767.4	37	NULL	CCDS6760.1	9																																																																																			NIPSNAP3A	-	-	ENSG00000136783		0.398	NIPSNAP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPSNAP3A	HGNC	protein_coding	OTTHUMT00000053484.1	-	0.00	35	0	A	NM_015469		107516796	+1	tier1	-	no_errors	ENST00000471001	ensembl	human	known	74_37	rna	7.27	51	4	SNP	0.000	T
NOD1	10392	genome.wustl.edu	37	7	30492172	30492172	+	Silent	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr7:30492172G>A	ENST00000222823.4	-	6	1386	c.861C>T	c.(859-861)gaC>gaT	p.D287D	NOD1_ENST00000423334.2_Missense_Mutation_p.T242M	NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	287	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						AGTGCAGCTCGTCCAGGCCAT	0.652																																																	0													45.0	45.0	45.0					7																	30492172		2203	4300	6503	SO:0001819	synonymous_variant	0			AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.861C>T	7.37:g.30492172G>A			B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,pfscan_CARD	p.T242M	ENST00000222823.4	37	c.725	CCDS5427.1	7	.	.	.	.	.	.	.	.	.	.	G	7.020	0.558505	0.13436	.	.	ENSG00000106100	ENST00000423334	.	.	.	5.65	0.553	0.17235	.	.	.	.	.	T	0.36468	0.0968	.	.	.	0.26245	N	0.978804	B	0.21753	0.06	B	0.10450	0.005	T	0.29305	-1.0016	7	0.87932	D	0	.	9.9931	0.41883	0.5768:0.0:0.4232:0.0	.	242	B4DTU3	.	M	242	.	ENSP00000409416:T242M	T	-	2	0	NOD1	30458697	1.000000	0.71417	0.996000	0.52242	0.981000	0.71138	0.840000	0.27600	-0.184000	0.10567	-0.244000	0.11960	ACG	NOD1	-	NULL	ENSG00000106100		0.652	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOD1	HGNC	protein_coding	OTTHUMT00000250443.2	-	0.00	79	0	G			30492172	-1	tier1	-	no_errors	ENST00000423334	ensembl	human	known	74_37	missense	7.35	63	5	SNP	0.982	A
NOP9	161424	genome.wustl.edu	37	14	24770856	24770856	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr14:24770856G>T	ENST00000267425.3	+	3	829	c.736G>T	c.(736-738)Gat>Tat	p.D246Y	DHRS1_ENST00000288111.7_5'Flank|NOP9_ENST00000396802.3_Missense_Mutation_p.D246Y|DHRS1_ENST00000396813.1_5'Flank	NM_174913.1	NP_777573.1	Q86U38	NOP9_HUMAN	NOP9 nucleolar protein	246							poly(A) RNA binding (GO:0044822)										TAAGCCAGCTGATTTTGAAGT	0.483																																																	0													125.0	106.0	113.0					14																	24770856		2203	4300	6503	SO:0001583	missense	0				CCDS9624.1, CCDS66616.1	14q12	2012-12-10	2012-12-10	2012-06-06	ENSG00000196943	ENSG00000196943			19826	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 21"", ""NOP9 nucleolar protein homolog (yeast)"""	C14orf21		21653694	Standard	XM_005267385		Approved		uc001wol.1	Q86U38	OTTHUMG00000029342	ENST00000267425.3:c.736G>T	14.37:g.24770856G>T	ENSP00000267425:p.Asp246Tyr		A8MY76|Q8IVF0|Q8TBS6	Missense_Mutation	SNP	superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt	p.D246Y	ENST00000267425.3	37	c.736	CCDS9624.1	14	.	.	.	.	.	.	.	.	.	.	G	17.76	3.468616	0.63625	.	.	ENSG00000196943	ENST00000267425;ENST00000396802	T;T	0.14893	2.47;2.47	5.46	4.5	0.54988	Armadillo-like helical (1);Armadillo-type fold (1);	0.237569	0.41605	D	0.000843	T	0.24851	0.0603	L	0.47716	1.5	0.47994	D	0.99956	P	0.46142	0.873	P	0.52267	0.694	T	0.00146	-1.1992	10	0.59425	D	0.04	-0.6444	10.9813	0.47497	0.096:0.0:0.904:0.0	.	246	Q86U38	CN021_HUMAN	Y	246	ENSP00000267425:D246Y;ENSP00000380020:D246Y	ENSP00000267425:D246Y	D	+	1	0	C14orf21	23840696	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	3.220000	0.51207	2.840000	0.97914	0.655000	0.94253	GAT	NOP9	-	superfamily_ARM-type_fold	ENSG00000196943		0.483	NOP9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP9	HGNC	protein_coding	OTTHUMT00000073186.2	-	0.00	77	0	G			24770856	+1	tier1	-	no_errors	ENST00000267425	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.998	T
NOTCH4	4855	genome.wustl.edu	37	6	32188007	32188007	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr6:32188007G>T	ENST00000375023.3	-	7	1352	c.1214C>A	c.(1213-1215)gCc>gAc	p.A405D		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	405	EGF-like 10. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						GCTGCATTGGGCATCCCCATG	0.612																																																	0													71.0	72.0	71.0					6																	32188007		2203	4300	6503	SO:0001583	missense	0				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1214C>A	6.37:g.32188007G>T	ENSP00000364163:p.Ala405Asp		B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd_dom,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_4,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.A405D	ENST00000375023.3	37	c.1214	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	G	18.59	3.657033	0.67586	.	.	ENSG00000204301	ENST00000375023	D	0.87809	-2.3	4.16	4.16	0.48862	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.40222	N	0.001149	D	0.92603	0.7650	M	0.84585	2.705	0.80722	D	1	D;P	0.89917	1.0;0.685	D;B	0.97110	1.0;0.216	D	0.93728	0.7039	10	0.87932	D	0	.	13.9929	0.64378	0.0:0.0:1.0:0.0	.	405;405	Q6P3V5;Q99466	.;NOTC4_HUMAN	D	405	ENSP00000364163:A405D	ENSP00000364163:A405D	A	-	2	0	NOTCH4	32295985	1.000000	0.71417	0.997000	0.53966	0.561000	0.35649	9.151000	0.94674	2.133000	0.65898	0.305000	0.20034	GCC	NOTCH4	-	pirsf_Notch,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000204301		0.612	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	HGNC	protein_coding	OTTHUMT00000076045.2	-	0.00	44	0	G			32188007	-1	tier1	-	no_errors	ENST00000375023	ensembl	human	known	74_37	missense	10.00	45	5	SNP	1.000	T
NRXN1	9378	genome.wustl.edu	37	2	51149818	51149818	+	Silent	SNP	C	C	T	rs201027928		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:51149818C>T	ENST00000406316.2	-	4	2274	c.798G>A	c.(796-798)gcG>gcA	p.A266A	NRXN1_ENST00000401669.2_Silent_p.A266A|NRXN1_ENST00000402717.3_Silent_p.A266A|NRXN1_ENST00000404971.1_Silent_p.A299A|NRXN1_ENST00000405472.3_Silent_p.A266A|NRXN1_ENST00000405581.1_Silent_p.A266A|NRXN1_ENST00000406859.3_Silent_p.A266A	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	266					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.A300A(1)|p.A299A(1)|p.A266A(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TCATCAGGTGCGCCAGACCTT	0.483																																																	3	Substitution - coding silent(3)	endometrium(3)						C	,	2,4106		0,2,2052	79.0	78.0	78.0		897,798	4.3	1.0	2		78	0,8352		0,0,4176	no	coding-synonymous,coding-synonymous	NRXN1	NM_001135659.1,NM_004801.4	,	0,2,6228	TT,TC,CC		0.0,0.0487,0.0161	,	299/1548,266/1478	51149818	2,12458	2054	4176	6230	SO:0001819	synonymous_variant	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.798G>A	2.37:g.51149818C>T			A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.A266	ENST00000406316.2	37	c.798	CCDS54360.1	2																																																																																			NRXN1	-	NULL	ENSG00000179915		0.483	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2		0.00	42	0	C			51149818	-1			no_errors	ENST00000402717	ensembl	human	known	74_37	silent	7.14	26	2	SNP	1.000	T
NTRK3	4916	genome.wustl.edu	37	15	88472495	88472495	+	Missense_Mutation	SNP	A	A	C			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr15:88472495A>C	ENST00000360948.2	-	16	2221	c.2060T>G	c.(2059-2061)gTt>gGt	p.V687G	NTRK3_ENST00000394480.2_Missense_Mutation_p.V687G|NTRK3_ENST00000357724.2_Missense_Mutation_p.V679G|NTRK3_ENST00000557856.1_Missense_Mutation_p.V679G|NTRK3_ENST00000542733.2_Missense_Mutation_p.V589G|NTRK3_ENST00000558676.1_Missense_Mutation_p.V679G|NTRK3_ENST00000355254.2_Missense_Mutation_p.V687G	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	687	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			ATTCGCTCCAACCAGGCAGTT	0.547			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																														Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	0													100.0	91.0	94.0					15																	88472495		2201	4299	6500	SO:0001583	missense	0			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.2060T>G	15.37:g.88472495A>C	ENSP00000354207:p.Val687Gly		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_3,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V687G	ENST00000360948.2	37	c.2060	CCDS32322.1	15	.	.	.	.	.	.	.	.	.	.	A	23.9	4.466957	0.84425	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733	D;D;D;D;D	0.86097	-2.07;-2.07;-2.07;-2.07;-2.07	5.16	5.16	0.70880	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95053	0.8398	H	0.97635	4.045	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.998;0.998;0.996;0.998	D	0.96622	0.9460	10	0.87932	D	0	.	14.1992	0.65690	1.0:0.0:0.0:0.0	.	589;679;679;687;687	B7Z7U4;E9PG56;B7Z4C5;Q16288-3;Q16288	.;.;.;.;NTRK3_HUMAN	G	687;687;679;687;589	ENSP00000377990:V687G;ENSP00000354207:V687G;ENSP00000350356:V679G;ENSP00000347397:V687G;ENSP00000437773:V589G	ENSP00000347397:V687G	V	-	2	0	NTRK3	86273499	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	9.118000	0.94355	1.952000	0.56665	0.533000	0.62120	GTT	NTRK3	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000140538		0.547	NTRK3-204	KNOWN	basic|CCDS	protein_coding	NTRK3	HGNC	protein_coding		-	0.00	60	0	A			88472495	-1	tier1	-	no_errors	ENST00000360948	ensembl	human	known	74_37	missense	7.41	49	4	SNP	1.000	C
NTSR1	4923	genome.wustl.edu	37	20	61340826	61340826	+	Silent	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr20:61340826G>A	ENST00000370501.3	+	1	638	c.267G>A	c.(265-267)gcG>gcA	p.A89A		NM_002531.2	NP_002522.2	P30989	NTR1_HUMAN	neurotensin receptor 1 (high affinity)	89					adult locomotory behavior (GO:0008344)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(16)|prostate(1)|skin(3)	27	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			TCACGCTGGCGCGGAAGAAGT	0.657																																					GBM(37;400 780 6403 19663 35669)												0													76.0	58.0	64.0					20																	61340826		2202	4299	6501	SO:0001819	synonymous_variant	0				CCDS13502.1	20q13	2012-08-08			ENSG00000101188	ENSG00000101188		"""GPCR / Class A : Neurotensin receptors"""	8039	protein-coding gene	gene with protein product		162651				8075503	Standard	NM_002531		Approved	NTR	uc002ydf.3	P30989	OTTHUMG00000032932	ENST00000370501.3:c.267G>A	20.37:g.61340826G>A			Q9H4H1|Q9H4T5	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_NT1_rcpt,prints_GPCR_Rhodpsn,prints_NT_rcpt	p.A89	ENST00000370501.3	37	c.267	CCDS13502.1	20																																																																																			NTSR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_NT1_rcpt,prints_GPCR_Rhodpsn	ENSG00000101188		0.657	NTSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTSR1	HGNC	protein_coding	OTTHUMT00000080061.1	-	0.00	19	0	G			61340826	+1	tier1	-	no_errors	ENST00000370501	ensembl	human	known	74_37	silent	22.22	21	6	SNP	0.987	A
NXPH4	11247	genome.wustl.edu	37	12	57619118	57619118	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:57619118T>C	ENST00000349394.5	+	2	690	c.515T>C	c.(514-516)gTc>gCc	p.V172A	NXPH4_ENST00000555154.1_3'UTR|Y_RNA_ENST00000365197.1_RNA	NM_007224.3	NP_009155.1	O95158	NXPH4_HUMAN	neurexophilin 4	172	IV (linker domain).				neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)	10						CCCGGGCCTGTCCCCCACCCT	0.701																																																	0													55.0	60.0	58.0					12																	57619118		2203	4300	6503	SO:0001583	missense	0			AF043469	CCDS8933.1	12q13.3	2014-09-04			ENSG00000182379	ENSG00000182379			8078	protein-coding gene	gene with protein product		604637				9570794	Standard	NM_007224		Approved	NPH4	uc009zpj.4	O95158	OTTHUMG00000171241	ENST00000349394.5:c.515T>C	12.37:g.57619118T>C	ENSP00000333593:p.Val172Ala		A8K4I4|Q7Z6L3|Q8N462	Missense_Mutation	SNP	pfam_NXPH/NXPE,pirsf_Neurexophilin	p.V172A	ENST00000349394.5	37	c.515	CCDS8933.1	12	.	.	.	.	.	.	.	.	.	.	T	0.043	-1.277567	0.01410	.	.	ENSG00000182379	ENST00000349394	.	.	.	4.27	-0.101	0.13618	.	1.023130	0.07861	N	0.966323	T	0.12987	0.0315	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26292	-1.0107	9	0.05959	T	0.93	-19.6367	0.9059	0.01284	0.1611:0.3909:0.1576:0.2905	.	172	O95158	NXPH4_HUMAN	A	172	.	ENSP00000333593:V172A	V	+	2	0	NXPH4	55905385	0.015000	0.18098	0.924000	0.36721	0.597000	0.36814	-0.055000	0.11807	-0.160000	0.11002	-0.624000	0.04008	GTC	NXPH4	-	pirsf_Neurexophilin	ENSG00000182379		0.701	NXPH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXPH4	HGNC	protein_coding	OTTHUMT00000412474.1		0.00	57	0	T	NM_007224		57619118	+1			no_errors	ENST00000349394	ensembl	human	known	74_37	missense	5.45	52	3	SNP	0.113	C
OAS3	4940	genome.wustl.edu	37	12	113379474	113379474	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:113379474C>G	ENST00000228928.7	+	2	456	c.277C>G	c.(277-279)Cgc>Ggc	p.R93G	OAS3_ENST00000548514.1_Missense_Mutation_p.R93G|RP1-71H24.1_ENST00000552784.1_RNA|OAS3_ENST00000551007.1_Missense_Mutation_p.R93G|OAS3_ENST00000546638.1_Intron	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	93	OAS domain 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						CCAGAGGGCCCGCCGTGCAGA	0.607																																																	0													71.0	76.0	75.0					12																	113379474		1971	4157	6128	SO:0001583	missense	0			AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.277C>G	12.37:g.113379474C>G	ENSP00000228928:p.Arg93Gly		Q2HJ14|Q9H3P5	Missense_Mutation	SNP	pfam_2-5-oligoAdlate_synth_1_dom2/C,pfam_Nucleotidyltransferase,pfscan_2-5-oligoadenylate_synth_N	p.R93G	ENST00000228928.7	37	c.277	CCDS44981.1	12	.	.	.	.	.	.	.	.	.	.	C	7.292	0.611251	0.14066	.	.	ENSG00000111331	ENST00000228928;ENST00000551007;ENST00000548514;ENST00000323881	T;T;T	0.21543	2.0;2.0;2.0	3.69	-3.35	0.04928	2-5-oligoadenylate synthetase, N-terminal (1);	.	.	.	.	T	0.16385	0.0394	L	0.61036	1.89	0.09310	N	1	B;B;B	0.11235	0.0;0.002;0.004	B;B;B	0.14023	0.0;0.003;0.01	T	0.40098	-0.9581	9	0.51188	T	0.08	.	0.8445	0.01158	0.1518:0.249:0.2984:0.3008	.	93;93;93	Q9Y6K5;F8VS35;F8VWK9	OAS3_HUMAN;.;.	G	93	ENSP00000228928:R93G;ENSP00000449299:R93G;ENSP00000448388:R93G	ENSP00000228928:R93G	R	+	1	0	OAS3	111863857	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.721000	0.04963	-0.605000	0.05753	-0.291000	0.09656	CGC	OAS3	-	pfscan_2-5-oligoadenylate_synth_N	ENSG00000111331		0.607	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OAS3	HGNC	protein_coding	OTTHUMT00000405920.1	-	0.00	46	0	C			113379474	+1	tier1	-	no_errors	ENST00000228928	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.000	G
ODF3L2	284451	genome.wustl.edu	37	19	464029	464029	+	Frame_Shift_Del	DEL	G	G	-			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr19:464029delG	ENST00000315489.4	-	4	920	c.685delC	c.(685-687)cggfs	p.R229fs	ODF3L2_ENST00000382696.3_Frame_Shift_Del_p.R193fs	NM_182577.2	NP_872383.1	Q3SX64	OD3L2_HUMAN	outer dense fiber of sperm tails 3-like 2	229	Pro-rich.					cytoplasmic microtubule (GO:0005881)				large_intestine(1)|lung(2)	3						cgcggggcccggggccgcccc	0.697																																																	0													8.0	11.0	10.0					19																	464029		2156	4242	6398	SO:0001589	frameshift_variant	0			AK097378	CCDS12027.1	19p13.3	2010-04-23	2008-07-04	2008-07-04		ENSG00000181781			26841	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 19"""	C19orf19		14702039	Standard	NM_182577		Approved	FLJ40059	uc002lor.3	Q3SX64		ENST00000315489.4:c.685delC	19.37:g.464029delG	ENSP00000318029:p.Arg229fs		Q3SX65|Q8N1L2	Frame_Shift_Del	DEL	pfam_SHIPPO-rpt	p.R229fs	ENST00000315489.4	37	c.685	CCDS12027.1	19																																																																																			ODF3L2	-	NULL	ENSG00000181781		0.697	ODF3L2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ODF3L2	HGNC	protein_coding	OTTHUMT00000451849.2		0.00	42	0	G	NM_182577		464029	-1	tier1		no_errors	ENST00000315489	ensembl	human	known	74_37	frame_shift_del	8.57	32	3	DEL	0.010	-
OLFM3	118427	genome.wustl.edu	37	1	102269856	102269856	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:102269856C>T	ENST00000338858.5	-	6	1374	c.1375G>A	c.(1375-1377)Ggc>Agc	p.G459S	OLFM3_ENST00000462354.1_5'UTR|OLFM3_ENST00000370103.4_Missense_Mutation_p.G439S|OLFM3_ENST00000536598.1_3'UTR			Q96PB7	NOE3_HUMAN	olfactomedin 3	459	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		ACCTGGTGGCCATTGTTCCAG	0.413																																																	0													169.0	160.0	163.0					1																	102269856		2203	4300	6503	SO:0001583	missense	0			AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.1375G>A	1.37:g.102269856C>T	ENSP00000345192:p.Gly459Ser		Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	pfam_Olfac-like,pfam_Noelin-1,superfamily_Quino_amine_DH_bsu,smart_Olfac-like,pfscan_Olfac-like	p.G459S	ENST00000338858.5	37	c.1375		1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.689100	0.88735	.	.	ENSG00000118733	ENST00000370103;ENST00000338858	D;D	0.90385	-2.66;-2.66	5.77	5.77	0.91146	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.95490	0.8535	M	0.86028	2.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.93925	0.7209	10	0.39692	T	0.17	.	19.9831	0.97336	0.0:1.0:0.0:0.0	.	439;459	Q5T3V6;Q96PB7	.;NOE3_HUMAN	S	439;459	ENSP00000359121:G439S;ENSP00000345192:G459S	ENSP00000345192:G459S	G	-	1	0	OLFM3	102042444	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.487000	0.81328	2.728000	0.93425	0.650000	0.86243	GGC	OLFM3	-	pfam_Olfac-like,superfamily_Quino_amine_DH_bsu,smart_Olfac-like,pfscan_Olfac-like	ENSG00000118733		0.413	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	OLFM3	HGNC	protein_coding	OTTHUMT00000030142.1	-	0.00	57	0	C			102269856	-1	tier1	-	no_errors	ENST00000338858	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
OR5B17	219965	genome.wustl.edu	37	11	58126193	58126193	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr11:58126193G>T	ENST00000357377.3	-	1	349	c.350C>A	c.(349-351)gCc>gAc	p.A117D		NM_001005489.1	NP_001005489.1	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B, member 17	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GCGGTCATAGGCCATTGAGGA	0.473																																																	0													122.0	109.0	114.0					11																	58126193		2201	4295	6496	SO:0001583	missense	0			AB065849	CCDS31548.1	11q12.1	2012-08-09			ENSG00000197786	ENSG00000197786		"""GPCR / Class A : Olfactory receptors"""	15267	protein-coding gene	gene with protein product				OR5B20P			Standard	NM_001005489		Approved		uc010rke.2	Q8NGF7	OTTHUMG00000167465	ENST00000357377.3:c.350C>A	11.37:g.58126193G>T	ENSP00000349945:p.Ala117Asp		Q6IEX1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A117D	ENST00000357377.3	37	c.350	CCDS31548.1	11	.	.	.	.	.	.	.	.	.	.	g	17.91	3.503501	0.64298	.	.	ENSG00000197786	ENST00000357377	T	0.56103	0.48	3.6	2.68	0.31781	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36893	U	0.002355	T	0.81138	0.4760	H	0.98866	4.355	0.31112	N	0.709867	D	0.89917	1.0	D	0.83275	0.996	T	0.82390	-0.0481	10	0.87932	D	0	-12.0866	9.5671	0.39405	0.1077:0.0:0.8923:0.0	.	117	Q8NGF7	OR5BH_HUMAN	D	117	ENSP00000349945:A117D	ENSP00000349945:A117D	A	-	2	0	OR5B17	57882769	1.000000	0.71417	0.998000	0.56505	0.651000	0.38670	6.396000	0.73234	0.723000	0.32274	0.461000	0.40582	GCC	OR5B17	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000197786		0.473	OR5B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B17	HGNC	protein_coding	OTTHUMT00000394708.2		0.00	74	0	G	NM_001005489		58126193	-1			no_errors	ENST00000357377	ensembl	human	known	74_37	missense	5.26	54	3	SNP	1.000	T
OTOF	9381	genome.wustl.edu	37	2	26741909	26741909	+	Missense_Mutation	SNP	G	G	T	rs555829802		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:26741909G>T	ENST00000272371.2	-	4	422	c.296C>A	c.(295-297)aCg>aAg	p.T99K	OTOF_ENST00000403946.3_Missense_Mutation_p.T99K	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	99					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.T99M(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCAATCAGCGTGTCAGTCAC	0.577																																					GBM(102;732 1451 20652 24062 31372)												1	Substitution - Missense(1)	lung(1)											148.0	108.0	121.0					2																	26741909		2203	4300	6503	SO:0001583	missense	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.296C>A	2.37:g.26741909G>T	ENSP00000272371:p.Thr99Lys		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.T99K	ENST00000272371.2	37	c.296	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266430	0.80358	.	.	ENSG00000115155	ENST00000272371;ENST00000403946	T;T	0.71341	-0.56;-0.56	5.05	4.18	0.49190	C2 calcium/lipid-binding domain, CaLB (1);	0.050741	0.85682	D	0.000000	T	0.64778	0.2629	M	0.62723	1.935	0.53005	D	0.99996	B	0.32653	0.379	B	0.26202	0.067	T	0.66093	-0.6009	10	0.52906	T	0.07	-12.4287	11.8556	0.52435	0.0861:0.0:0.9139:0.0	.	99	Q9HC10	OTOF_HUMAN	K	99	ENSP00000272371:T99K;ENSP00000385255:T99K	ENSP00000272371:T99K	T	-	2	0	OTOF	26595413	1.000000	0.71417	0.973000	0.42090	0.985000	0.73830	6.844000	0.75390	1.262000	0.44165	0.563000	0.77884	ACG	OTOF	-	superfamily_C2_dom	ENSG00000115155		0.577	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3		0.00	24	0	G			26741909	-1			no_errors	ENST00000272371	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.998	T
OXSR1	9943	genome.wustl.edu	37	3	38234783	38234783	+	Intron	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr3:38234783G>T	ENST00000446845.1	+	3	664				OXSR1_ENST00000311806.3_Intron					oxidative stress responsive 1											skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TGACACACTGGAGAAACTGGA	0.383																																																	0																																										SO:0001627	intron_variant	0			AB017642	CCDS2675.1	3p22.2	2013-05-17	2013-05-17	2004-11-26	ENSG00000172939	ENSG00000172939			8508	protein-coding gene	gene with protein product		604046	"""oxidative-stress responsive 1"""	OSR1		10083736	Standard	XM_005265638		Approved	KIAA1101	uc003chy.3	O95747	OTTHUMG00000131084	ENST00000446845.1:c.292+2453G>T	3.37:g.38234783G>T				Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,pfscan_Prot_kinase_dom	p.W101C	ENST00000446845.1	37	c.303		3																																																																																			OXSR1	-	pfscan_Prot_kinase_dom	ENSG00000172939		0.383	OXSR1-004	NOVEL	basic|exp_conf	protein_coding	OXSR1	HGNC	protein_coding	OTTHUMT00000342708.1	-	0.00	79	0	G	NM_005109		38234783	+1	tier1	-	no_errors	ENST00000426620	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
PAPOLA	10914	genome.wustl.edu	37	14	96986549	96986549	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr14:96986549G>T	ENST00000216277.8	+	2	386	c.166G>T	c.(166-168)Gag>Tag	p.E56*	PAPOLA_ENST00000554130.1_3'UTR|PAPOLA_ENST00000557320.1_Nonsense_Mutation_p.E56*|PAPOLA_ENST00000557471.1_Nonsense_Mutation_p.E56*|PAPOLA_ENST00000392990.2_Nonsense_Mutation_p.E56*	NM_032632.4	NP_116021.2	P51003	PAPOA_HUMAN	poly(A) polymerase alpha	56	Poly-Glu.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|RNA polyadenylation (GO:0043631)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		TGAAGAGGAAGAGGAACTGCA	0.373																																					NSCLC(19;254 734 11908 35501 39234)												0													66.0	65.0	65.0					14																	96986549		2203	4300	6503	SO:0001587	stop_gained	0			X76770	CCDS9946.1, CCDS58334.1, CCDS58335.1	14q32.1-q32.2	2008-02-08				ENSG00000090060	2.7.7.19		14981	protein-coding gene	gene with protein product		605553				8302877, 10429366	Standard	NM_032632		Approved	PAP	uc001yfq.3	P51003		ENST00000216277.8:c.166G>T	14.37:g.96986549G>T	ENSP00000216277:p.Glu56*		Q86SX4|Q86TV0|Q8IYF5|Q9BVU2	Nonsense_Mutation	SNP	pfam_PolA_pol_cen_dom,pfam_PolA_pol_RNA-bd_dom,pfam_Nucleotidyltransferase,superfamily_NuclTrfase_I_C,pirsf_PolyA_polymerase	p.E56*	ENST00000216277.8	37	c.166	CCDS9946.1	14	.	.	.	.	.	.	.	.	.	.	G	32	5.188002	0.94923	.	.	ENSG00000090060	ENST00000216277;ENST00000557320;ENST00000546064;ENST00000557471;ENST00000556619;ENST00000392990	.	.	.	4.94	4.94	0.65067	.	0.192413	0.44483	D	0.000459	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	18.5341	0.91002	0.0:0.0:1.0:0.0	.	.	.	.	X	56;56;72;56;56;56	.	ENSP00000216277:E56X	E	+	1	0	PAPOLA	96056302	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.081000	0.71309	2.455000	0.83008	0.650000	0.86243	GAG	PAPOLA	-	pfam_PolA_pol_cen_dom,pirsf_PolyA_polymerase	ENSG00000090060		0.373	PAPOLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPOLA	HGNC	protein_coding	OTTHUMT00000413411.2	-	0.00	79	0	G			96986549	+1	tier1	-	no_errors	ENST00000216277	ensembl	human	known	74_37	nonsense	5.63	67	4	SNP	1.000	T
PCDHAC2	56134	genome.wustl.edu	37	5	140348787	140348787	+	Silent	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr5:140348787G>A	ENST00000289269.5	+	1	2968	c.2436G>A	c.(2434-2436)ggG>ggA	p.G812G	PCDHA11_ENST00000398640.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	812					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAATACAGGGGCCCAGACAG	0.537																																					Melanoma(190;638 2083 3390 11909 52360)												0													69.0	70.0	70.0					5																	140348787		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.2436G>A	5.37:g.140348787G>A			Q2M3V1|Q9Y5F4	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G812	ENST00000289269.5	37	c.2436	CCDS4242.1	5																																																																																			PCDHAC2	-	NULL	ENSG00000243232		0.537	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHAC2	HGNC	protein_coding	OTTHUMT00000251802.2	-	0.00	36	0	G	NM_018899		140348787	+1	tier1	-	no_errors	ENST00000289269	ensembl	human	known	74_37	silent	17.65	27	6	SNP	0.996	A
PDE4A	5141	genome.wustl.edu	37	19	10543166	10543166	+	Intron	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr19:10543166C>T	ENST00000352831.6	+	1	430				PDE4A_ENST00000592685.1_Intron|PDE4A_ENST00000380702.2_Intron|PDE4A_ENST00000293683.5_Intron|PDE4A_ENST00000440014.2_Missense_Mutation_p.P19L	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific						cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	CTGGCACTGCCCCCCACGGGC	0.766																																																	0													5.0	7.0	6.0					19																	10543166		662	1543	2205	SO:0001627	intron_variant	0				CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.320+11406C>T	19.37:g.10543166C>T			O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.P19L	ENST00000352831.6	37	c.56	CCDS45961.1	19	.	.	.	.	.	.	.	.	.	.	C	19.72	3.880353	0.72294	.	.	ENSG00000065989	ENST00000440014	T	0.66280	-0.2	3.39	3.39	0.38822	.	.	.	.	.	T	0.64951	0.2645	.	.	.	0.80722	D	1	P	0.51351	0.944	P	0.49853	0.624	T	0.69427	-0.5148	8	0.87932	D	0	.	10.2013	0.43084	0.0:1.0:0.0:0.0	.	19	P27815-6	.	L	19	ENSP00000394754:P19L	ENSP00000394754:P19L	P	+	2	0	PDE4A	10404166	0.981000	0.34729	0.988000	0.46212	0.869000	0.49853	2.416000	0.44644	1.727000	0.51537	0.449000	0.29647	CCC	PDE4A	-	NULL	ENSG00000065989		0.766	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE4A	HGNC	protein_coding	OTTHUMT00000451244.1	-	0.00	30	0	C			10543166	+1	tier1	-	no_errors	ENST00000440014	ensembl	human	known	74_37	missense	12.82	33	5	SNP	1.000	T
PIP4K2B	8396	genome.wustl.edu	37	17	36936743	36936743	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr17:36936743C>T	ENST00000269554.3	-	4	949	c.469G>A	c.(469-471)Gtg>Atg	p.V157M	PIP4K2B_ENST00000311500.6_5'UTR	NM_003559.4	NP_003550.1	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, beta	157	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cell surface receptor signaling pathway (GO:0007166)|intracellular signal transduction (GO:0035556)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|receptor signaling protein activity (GO:0005057)	p.V157L(1)		endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)	19						ATCTCCGCCACGTCCTCGCTG	0.582																																																	1	Substitution - Missense(1)	ovary(1)											100.0	89.0	93.0					17																	36936743		2203	4300	6503	SO:0001583	missense	0			U85245	CCDS11329.1	17q21.2	2007-08-14	2007-08-14	2007-08-14		ENSG00000276293	2.7.1.149		8998	protein-coding gene	gene with protein product		603261	"""phosphatidylinositol-4-phosphate 5-kinase, type II, beta"""	PIP5K2B		9038203, 14691457, 9367159	Standard	NM_003559		Approved	PIP5KIIB, PIP5KIIbeta	uc002hqs.3	P78356		ENST00000269554.3:c.469G>A	17.37:g.36936743C>T	ENSP00000269554:p.Val157Met		Q5U0E8|Q8TBP2	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.V157M	ENST00000269554.3	37	c.469	CCDS11329.1	17	.	.	.	.	.	.	.	.	.	.	C	25.9	4.684665	0.88639	.	.	ENSG00000141720	ENST00000269554;ENST00000311500	T	0.37235	1.21	5.21	5.21	0.72293	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.056354	0.64402	D	0.000001	T	0.58722	0.2142	M	0.67700	2.07	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.986	D;D;P	0.71870	0.975;0.968;0.853	T	0.58358	-0.7650	10	0.52906	T	0.07	-20.3191	17.4822	0.87675	0.0:1.0:0.0:0.0	.	157;157;157	C9JMM2;P78356-2;P78356	.;.;PI42B_HUMAN	M	157	ENSP00000269554:V157M	ENSP00000269554:V157M	V	-	1	0	PIP4K2B	34190269	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.360000	0.59455	2.716000	0.92895	0.561000	0.74099	GTG	PIP4K2B	-	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	ENSG00000141720		0.582	PIP4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP4K2B	HGNC	protein_coding	OTTHUMT00000256791.1		0.00	66	0	C	NM_003559		36936743	-1			no_errors	ENST00000269554	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	T
POTEE	445582	genome.wustl.edu	37	2	132010593	132010593	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:132010593G>T	ENST00000356920.5	+	13	1793	c.1699G>T	c.(1699-1701)Gat>Tat	p.D567Y	POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	567					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											CAATGGTGATGATGGATTAAT	0.433																																																	0													8.0	10.0	10.0					2																	132010593		1459	3052	4511	SO:0001583	missense	0			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.1699G>T	2.37:g.132010593G>T	ENSP00000439189:p.Asp567Tyr		Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.D567Y	ENST00000356920.5	37	c.1699	CCDS46414.1	2	.	.	.	.	.	.	.	.	.	.	.	9.428	1.084743	0.20309	.	.	ENSG00000188219	ENST00000356920	D	0.83506	-1.73	0.714	-0.315	0.12746	.	.	.	.	.	T	0.77519	0.4142	N	0.17082	0.46	0.09310	N	1	D	0.59357	0.985	P	0.56823	0.807	T	0.66712	-0.5854	8	0.87932	D	0	.	.	.	.	.	567	Q6S8J3	POTEE_HUMAN	Y	567	ENSP00000439189:D567Y	ENSP00000439189:D567Y	D	+	1	0	AC131180.1	131727063	0.022000	0.18835	0.006000	0.13384	0.103000	0.19146	-0.683000	0.05179	-0.147000	0.11254	0.184000	0.17185	GAT	POTEE	-	NULL	ENSG00000188219		0.433	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	HGNC	protein_coding			0.00	266	0	G	NM_001083538		132010593	+1			no_errors	ENST00000356920	ensembl	human	known	74_37	missense	5.39	281	16	SNP	0.008	T
PRAM1	84106	genome.wustl.edu	37	19	8563310	8563310	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr19:8563310G>A	ENST00000423345.4	-	2	1902	c.1382C>T	c.(1381-1383)cCg>cTg	p.P461L	PRAM1_ENST00000255612.3_Missense_Mutation_p.P461L			Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	509	Pro-rich.				integrin-mediated signaling pathway (GO:0007229)|regulation of neutrophil degranulation (GO:0043313)		lipid binding (GO:0008289)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)	19						CACGGGCCCCGGGGGCAGCGG	0.736																																																	0													6.0	7.0	7.0					19																	8563310		1791	3895	5686	SO:0001583	missense	0			BC028012	CCDS45954.1, CCDS45954.2	19p13.2	2009-01-21				ENSG00000133246			30091	protein-coding gene	gene with protein product		606466				11301322, 15572693	Standard	NM_032152		Approved	PML-RAR	uc002mkd.3	Q96QH2		ENST00000423345.4:c.1382C>T	19.37:g.8563310G>A	ENSP00000408342:p.Pro461Leu		Q8N6W7	Missense_Mutation	SNP	superfamily_SH3_domain	p.P461L	ENST00000423345.4	37	c.1382	CCDS45954.2	19	.	.	.	.	.	.	.	.	.	.	G	13.72	2.321318	0.41096	.	.	ENSG00000133246	ENST00000255612;ENST00000423345	T;T	0.64803	-0.12;-0.05	4.4	0.778	0.18543	.	0.184721	0.26824	N	0.022302	T	0.70552	0.3237	L	0.60455	1.87	0.39970	D	0.974785	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.69476	-0.5135	10	0.72032	D	0.01	.	8.026	0.30438	0.0:0.1564:0.5203:0.3233	.	461;509	Q96QH2-2;Q96QH2	.;PRAM_HUMAN	L	461	ENSP00000255612:P461L;ENSP00000408342:P461L	ENSP00000255612:P461L	P	-	2	0	PRAM1	8469310	1.000000	0.71417	0.894000	0.35097	0.145000	0.21501	3.984000	0.56923	0.143000	0.18926	0.462000	0.41574	CCG	PRAM1	-	NULL	ENSG00000133246		0.736	PRAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRAM1	HGNC	protein_coding	OTTHUMT00000397040.3	-	0.00	50	0	G	NM_032152		8563310	-1	tier1	-	no_errors	ENST00000423345	ensembl	human	known	74_37	missense	18.00	40	9	SNP	0.869	A
PPP2R1A	5518	genome.wustl.edu	37	19	52723017	52723017	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr19:52723017C>T	ENST00000322088.6	+	10	1260	c.1202C>T	c.(1201-1203)tCc>tTc	p.S401F	PPP2R1A_ENST00000462990.1_Missense_Mutation_p.S222F|PPP2R1A_ENST00000444322.2_Missense_Mutation_p.S346F|CTD-2525I3.3_ENST00000593857.1_RNA	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	401	PP2A subunit C binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CGGCAGCTGTCCCAGTCCCTG	0.592			Mis		clear cell ovarian carcinoma																																			Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	0													82.0	73.0	76.0					19																	52723017		2203	4300	6503	SO:0001583	missense	0				CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.1202C>T	19.37:g.52723017C>T	ENSP00000324804:p.Ser401Phe		Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.S401F	ENST00000322088.6	37	c.1202	CCDS12849.1	19	.	.	.	.	.	.	.	.	.	.	C	27.2	4.807120	0.90623	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000444322	T;T	0.20332	2.08;2.08	4.68	4.68	0.58851	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000013	T	0.45135	0.1327	M	0.90252	3.1	0.80722	D	1	D;P	0.54601	0.967;0.945	P;B	0.51974	0.686;0.269	T	0.58244	-0.7670	10	0.87932	D	0	-30.3958	15.5205	0.75862	0.0:1.0:0.0:0.0	.	346;401	F5H3X9;P30153	.;2AAA_HUMAN	F	391;321;401;346	ENSP00000324804:S401F;ENSP00000415067:S346F	ENSP00000324804:S401F	S	+	2	0	PPP2R1A	57414829	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.907000	0.75724	2.605000	0.88082	0.655000	0.94253	TCC	PPP2R1A	-	superfamily_ARM-type_fold,pfscan_HEAT_type_2	ENSG00000105568		0.592	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R1A	HGNC	protein_coding	OTTHUMT00000267967.2	-	0.00	44	0	C	NM_014225		52723017	+1	tier1	-	no_errors	ENST00000322088	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	T
PRAMEF11	440560	genome.wustl.edu	37	1	12887301	12887301	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:12887301G>A	ENST00000535591.1	-	3	751	c.556C>T	c.(556-558)Cca>Tca	p.P186S		NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	186					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						CCCAGGTATGGGGTAAACTGT	0.493																																																	0																																										SO:0001583	missense	0			AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.556C>T	1.37:g.12887301G>A	ENSP00000439551:p.Pro186Ser			Missense_Mutation	SNP	NULL	p.P186S	ENST00000535591.1	37	c.556	CCDS53268.1	1	.	.	.	.	.	.	.	.	.	.	.	9.468	1.094937	0.20471	.	.	ENSG00000204513	ENST00000535591;ENST00000331684;ENST00000437584	T;T	0.15372	2.43;2.43	1.48	0.538	0.17150	.	0.208506	0.40469	N	0.001097	T	0.31638	0.0803	M	0.71871	2.18	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.05784	-1.0864	10	0.56958	D	0.05	.	3.8996	0.09155	0.2384:0.0:0.7616:0.0	.	186	O60813	PRA11_HUMAN	S	186;227;186	ENSP00000439551:P186S;ENSP00000391839:P186S	ENSP00000328783:P227S	P	-	1	0	PRAMEF11	12809888	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.132000	0.10467	0.196000	0.20367	-0.498000	0.04607	CCA	PRAMEF11	-	NULL	ENSG00000204513		0.493	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF11	HGNC	protein_coding		-	0.00	315	0	G	XM_496341		12887301	-1	tier1	-	no_errors	ENST00000535591	ensembl	human	known	74_37	missense	5.74	279	17	SNP	0.002	A
PRB4	5545	genome.wustl.edu	37	12	11461742	11461742	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:11461742C>T	ENST00000535904.1	-	3	208	c.175G>A	c.(175-177)Gga>Aga	p.G59R	PRB4_ENST00000445719.2_Missense_Mutation_p.G59R|PRB4_ENST00000279575.1_Missense_Mutation_p.G59R			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	80	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.					extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						GGGGGTGGTCCTTGTGGCTTT	0.627										HNSCC(22;0.051)																																							0													205.0	222.0	216.0					12																	11461742		2201	4293	6494	SO:0001583	missense	0				CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.175G>A	12.37:g.11461742C>T	ENSP00000442834:p.Gly59Arg		A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	NULL	p.G59R	ENST00000535904.1	37	c.175	CCDS8641.1	12	.	.	.	.	.	.	.	.	.	.	.	1.855	-0.464114	0.04476	.	.	ENSG00000230657	ENST00000279575;ENST00000535904;ENST00000445719	T;T;T	0.04862	3.54;3.54;3.54	0.956	-1.91	0.07641	.	.	.	.	.	T	0.06554	0.0168	M	0.66297	2.02	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.40079	-0.9582	9	0.31617	T	0.26	.	2.5673	0.04786	0.0:0.3453:0.2742:0.3805	.	59	E9PAL0	.	R	59	ENSP00000279575:G59R;ENSP00000442834:G59R;ENSP00000412740:G59R	ENSP00000279575:G59R	G	-	1	0	PRB4	11353009	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-2.693000	0.00829	-1.187000	0.02709	0.196000	0.17591	GGA	PRB4	-	NULL	ENSG00000230657		0.627	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRB4	HGNC	protein_coding	OTTHUMT00000402308.1	-	0.00	134	0	C	NM_002723		11461742	-1	tier1	-	no_errors	ENST00000279575	ensembl	human	known	74_37	missense	5.85	177	11	SNP	0.012	T
PRDX6	9588	genome.wustl.edu	37	1	173450517	173450517	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:173450517G>T	ENST00000340385.5	+	2	280	c.148G>T	c.(148-150)Gag>Tag	p.E50*	PRDX6_ENST00000470017.1_3'UTR	NM_004905.2	NP_004896.1	P30041	PRDX6_HUMAN	peroxiredoxin 6	50	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				hydrogen peroxide catabolic process (GO:0042744)|phospholipid catabolic process (GO:0009395)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|membrane (GO:0016020)	antioxidant activity (GO:0016209)|glutathione peroxidase activity (GO:0004602)|peroxiredoxin activity (GO:0051920)|phospholipase A2 activity (GO:0004623)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	12						GTGCACCACAGAGCTTGGCAG	0.473																																																	0													125.0	121.0	123.0					1																	173450517		2203	4300	6503	SO:0001587	stop_gained	0			D14662	CCDS1307.1	1q24.1	2008-02-05			ENSG00000117592	ENSG00000117592			16753	protein-coding gene	gene with protein product		602316				11233154	Standard	NM_004905		Approved	AOP2, KIAA0106, 1-Cys, NSGPx, PRX, aiPLA2, MGC46173, p29	uc001giy.1	P30041	OTTHUMG00000034804	ENST00000340385.5:c.148G>T	1.37:g.173450517G>T	ENSP00000342026:p.Glu50*		A8JZY7|P32077|Q5TAH4|Q5ZEZ8	Nonsense_Mutation	SNP	pfam_AhpC/TSA,pfam_Peroxiredoxin_C,pfam_Redoxin,superfamily_Thioredoxin-like_fold	p.E50*	ENST00000340385.5	37	c.148	CCDS1307.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.637539	0.97726	.	.	ENSG00000117592	ENST00000340385	.	.	.	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-28.74	18.9171	0.92510	0.0:0.0:1.0:0.0	.	.	.	.	X	50	.	ENSP00000342026:E50X	E	+	1	0	PRDX6	171717140	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	9.015000	0.93640	2.838000	0.97847	0.655000	0.94253	GAG	PRDX6	-	pfam_AhpC/TSA,pfam_Redoxin,superfamily_Thioredoxin-like_fold	ENSG00000117592		0.473	PRDX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDX6	HGNC	protein_coding	OTTHUMT00000084222.1		0.00	66	0	G	NM_004905		173450517	+1			no_errors	ENST00000340385	ensembl	human	known	74_37	nonsense	7.35	63	5	SNP	1.000	T
PRSS58	136541	genome.wustl.edu	37	7	141952333	141952333	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr7:141952333G>T	ENST00000552471.1	-	4	854	c.535C>A	c.(535-537)Ctg>Atg	p.L179M	PRSS58_ENST00000547058.2_Missense_Mutation_p.L179M			Q8IYP2	PRS58_HUMAN	protease, serine, 58	179	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	19						CCCACACACAGCATATTTTCC	0.448																																																	0													177.0	160.0	166.0					7																	141952333		2203	4300	6503	SO:0001583	missense	0				CCDS5871.1	7q34	2012-10-03			ENSG00000258223	ENSG00000258223	3.4.21.4	"""Serine peptidases / Serine peptidases"""	39125	protein-coding gene	gene with protein product	"""trypsin X3"""						Standard	NM_001001317		Approved	TRYX3	uc003vxc.4	Q8IYP2	OTTHUMG00000158565	ENST00000552471.1:c.535C>A	7.37:g.141952333G>T	ENSP00000446916:p.Leu179Met		B3KVJ6|D3DXD2	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.L179M	ENST00000552471.1	37	c.535	CCDS5871.1	7	.	.	.	.	.	.	.	.	.	.	G	10.31	1.315109	0.23908	.	.	ENSG00000258223	ENST00000547058;ENST00000552471	D;D	0.90385	-2.66;-2.66	4.35	-4.89	0.03103	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.83207	0.5204	L	0.46614	1.455	0.25967	N	0.982548	B	0.26635	0.155	B	0.26310	0.068	T	0.69525	-0.5122	9	0.44086	T	0.13	.	4.5561	0.12136	0.3522:0.0:0.1907:0.457	.	179	Q8IYP2	PRS58_HUMAN	M	179	ENSP00000447588:L179M;ENSP00000446916:L179M	ENSP00000307206:L179M	L	-	1	2	PRSS58	141598811	0.401000	0.25303	0.674000	0.29902	0.665000	0.39181	-1.084000	0.03393	-1.010000	0.03396	0.655000	0.94253	CTG	PRSS58	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000258223		0.448	PRSS58-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRSS58	HGNC	protein_coding	OTTHUMT00000351328.2		0.00	47	0	G	NM_001001317		141952333	-1			no_errors	ENST00000547058	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.803	T
PTPRD	5789	genome.wustl.edu	37	9	8500858	8500858	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr9:8500858T>C	ENST00000381196.4	-	21	2567	c.2024A>G	c.(2023-2025)gAa>gGa	p.E675G	PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000360074.4_Missense_Mutation_p.E662G|PTPRD_ENST00000486161.1_Intron|PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000540109.1_Missense_Mutation_p.E675G|PTPRD_ENST00000356435.5_Missense_Mutation_p.E675G|PTPRD_ENST00000471274.1_5'UTR|PTPRD_ENST00000397606.3_Intron|PTPRD_ENST00000358503.5_Missense_Mutation_p.E662G|PTPRD_ENST00000397617.3_Intron	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	675	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TTCCAGCTGTTCCAAAAGGTA	0.478										TSP Lung(15;0.13)																																							0													233.0	218.0	223.0					9																	8500858		2203	4300	6503	SO:0001583	missense	0			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.2024A>G	9.37:g.8500858T>C	ENSP00000370593:p.Glu675Gly		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt	p.E675G	ENST00000381196.4	37	c.2024	CCDS43786.1	9	.	.	.	.	.	.	.	.	.	.	T	16.39	3.108681	0.56291	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000540109	T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.33	5.64	5.64	0.86602	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.68888	0.3050	L	0.42686	1.345	0.80722	D	1	P;D;B	0.76494	0.749;0.999;0.01	B;D;B	0.81914	0.288;0.995;0.071	T	0.67373	-0.5687	9	.	.	.	.	15.8599	0.79014	0.0:0.0:0.0:1.0	.	662;675;675	G3XAE2;Q2HXI4;P23468	.;.;PTPRD_HUMAN	G	675;675;662;662;675	ENSP00000370593:E675G;ENSP00000348812:E675G;ENSP00000353187:E662G;ENSP00000351293:E662G;ENSP00000438164:E675G	.	E	-	2	0	PTPRD	8490858	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.694000	0.84235	2.136000	0.66102	0.459000	0.35465	GAA	PTPRD	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000153707		0.478	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	-	0.00	132	0	T			8500858	-1	tier1	-	no_errors	ENST00000356435	ensembl	human	known	74_37	missense	8.70	105	10	SNP	1.000	C
RAD21L1	642636	genome.wustl.edu	37	20	1214736	1214736	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr20:1214736G>T	ENST00000409241.1	+	5	469	c.376G>T	c.(376-378)Gat>Tat	p.D126Y	RAD21L1_ENST00000477283.1_3'UTR|RAD21L1_ENST00000402452.1_Missense_Mutation_p.D126Y|RAD21L1_ENST00000381882.2_Missense_Mutation_p.D126Y	NM_001136566.2	NP_001130038.2	Q9H4I0	RD21L_HUMAN	RAD21-like 1 (S. pombe)	126					attachment of telomeric heterochromatin to nuclear envelope (GO:0070197)|chromosome segregation (GO:0007059)|double-strand break repair via homologous recombination (GO:0000724)|fertilization (GO:0009566)|linear element assembly (GO:0030999)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleus (GO:0005634)				NS(1)|breast(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	7						TAGTGCTATTGATGTTTCAGA	0.323																																																	0													79.0	64.0	69.0					20																	1214736		692	1587	2279	SO:0001583	missense	0			AL031665	CCDS46568.1	20p13	2011-08-12			ENSG00000244588	ENSG00000244588			16271	protein-coding gene	gene with protein product							Standard	NM_001136566		Approved	dJ545L17.2, RAD21L	uc010gab.1	Q9H4I0	OTTHUMG00000031664	ENST00000409241.1:c.376G>T	20.37:g.1214736G>T	ENSP00000386414:p.Asp126Tyr		B2RXL0|B7ZBB1|B7ZW76|Q5W0X5	Missense_Mutation	SNP	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu	p.D126Y	ENST00000409241.1	37	c.376	CCDS46568.1	20	.	.	.	.	.	.	.	.	.	.	G	18.87	3.714730	0.68730	.	.	ENSG00000244588	ENST00000402452;ENST00000409241;ENST00000381882	T;T;T	0.59083	0.55;0.29;0.55	4.69	3.75	0.43078	.	0.202696	0.34338	N	0.004051	T	0.75302	0.3831	M	0.84585	2.705	0.58432	D	0.999997	D	0.71674	0.998	D	0.64687	0.928	T	0.80151	-0.1502	10	0.87932	D	0	.	12.7422	0.57259	0.0807:0.0:0.9193:0.0	.	126	Q9H4I0	RD21L_HUMAN	Y	126	ENSP00000385925:D126Y;ENSP00000386414:D126Y;ENSP00000371306:D126Y	ENSP00000371306:D126Y	D	+	1	0	RAD21L1	1162736	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.971000	0.70440	1.328000	0.45358	0.591000	0.81541	GAT	RAD21L1	-	NULL	ENSG00000244588		0.323	RAD21L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21L1	HGNC	protein_coding	OTTHUMT00000334022.1	-	0.00	47	0	G			1214736	+1	tier1	-	no_errors	ENST00000409241	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
RD3	343035	genome.wustl.edu	37	1	211652558	211652558	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:211652558G>T	ENST00000367002.4	-	3	1571	c.408C>A	c.(406-408)caC>caA	p.H136Q	RD3_ENST00000484910.1_5'UTR	NM_001164688.1|NM_183059.2	NP_001158160.1|NP_898882.1	Q7Z3Z2	RD3_HUMAN	retinal degeneration 3	136					response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)					central_nervous_system(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10				OV - Ovarian serous cystadenocarcinoma(81;0.00284)|all cancers(67;0.0279)|Epithelial(68;0.0689)		GCGTCAGCTTGTGGGCCTCCT	0.682																																																	0													23.0	22.0	23.0					1																	211652558		2201	4299	6500	SO:0001583	missense	0			AY191519	CCDS1498.1	1q32.3	2008-02-05	2006-11-13	2006-11-13	ENSG00000198570	ENSG00000198570			19689	protein-coding gene	gene with protein product		180040	"""chromosome 1 open reading frame 36"""	C1orf36		12914764	Standard	NM_183059		Approved	LCA12	uc001hin.2	Q7Z3Z2	OTTHUMG00000037002	ENST00000367002.4:c.408C>A	1.37:g.211652558G>T	ENSP00000355969:p.His136Gln		A8K595	Missense_Mutation	SNP	NULL	p.H136Q	ENST00000367002.4	37	c.408	CCDS1498.1	1	.	.	.	.	.	.	.	.	.	.	G	2.243	-0.373257	0.05034	.	.	ENSG00000198570	ENST00000367002	T	0.08282	3.11	4.33	-4.31	0.03698	.	0.489617	0.23369	N	0.048933	T	0.01387	0.0045	N	0.01188	-0.97	0.24988	N	0.991554	B	0.02656	0.0	B	0.04013	0.001	T	0.36672	-0.9738	10	0.05620	T	0.96	-16.4574	0.6897	0.00889	0.2871:0.2758:0.2593:0.1778	.	136	Q7Z3Z2	RD3_HUMAN	Q	136	ENSP00000355969:H136Q	ENSP00000355969:H136Q	H	-	3	2	RD3	209719181	0.994000	0.37717	0.607000	0.28956	0.740000	0.42216	0.225000	0.17757	-0.486000	0.06744	-0.263000	0.10527	CAC	RD3	-	NULL	ENSG00000198570		0.682	RD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RD3	HGNC	protein_coding	OTTHUMT00000089837.1		0.00	58	0	G	NM_183059		211652558	-1			no_errors	ENST00000367002	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.995	T
RNF19B	127544	genome.wustl.edu	37	1	33402751	33402751	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:33402751C>T	ENST00000373456.7	-	9	1854	c.1855G>A	c.(1855-1857)Gca>Aca	p.A619T	RNF19B_ENST00000235150.4_Missense_Mutation_p.A618T|RNF19B_ENST00000356990.5_3'UTR	NM_153341.2	NP_699172.2	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B	619					interferon-gamma secretion (GO:0072643)|natural killer cell mediated cytotoxicity (GO:0042267)|protein ubiquitination (GO:0016567)	cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TCATTCTCTGCCATCTGAGCA	0.527																																																	0													148.0	134.0	139.0					1																	33402751		2203	4300	6503	SO:0001583	missense	0			AK074486	CCDS372.2, CCDS44107.1, CCDS72754.1	1p35.1	2010-05-11	2007-08-20	2007-08-20	ENSG00000116514	ENSG00000116514		"""RING-type (C3HC4) zinc fingers"""	26886	protein-coding gene	gene with protein product		610872	"""IBR domain containing 3"""	IBRDC3		12477932	Standard	XM_006710356		Approved	FLJ90005	uc010oho.2	Q6ZMZ0	OTTHUMG00000004013	ENST00000373456.7:c.1855G>A	1.37:g.33402751C>T	ENSP00000362555:p.Ala619Thr		B7ZLB2|E9PAW6|G3XA82|Q0VG77|Q5TH44|Q5TH45|Q6P6A4|Q8N2S8|Q8WUF3	Missense_Mutation	SNP	pfam_Znf_C6HC,smart_Znf_RING,smart_Znf_C6HC,pfscan_Znf_RING	p.A619T	ENST00000373456.7	37	c.1855	CCDS372.2	1	.	.	.	.	.	.	.	.	.	.	C	14.60	2.582815	0.46006	.	.	ENSG00000116514	ENST00000373456;ENST00000235150	T;T	0.35236	1.32;1.32	4.59	3.66	0.41972	.	0.332419	0.30969	N	0.008508	T	0.20577	0.0495	N	0.08118	0	0.38911	D	0.957522	P;B	0.35272	0.493;0.361	B;B	0.34242	0.178;0.086	T	0.09997	-1.0649	10	0.34782	T	0.22	.	14.725	0.69339	0.0:0.8542:0.1457:0.0	.	618;619	G3XA82;Q6ZMZ0	.;RN19B_HUMAN	T	619;618	ENSP00000362555:A619T;ENSP00000235150:A618T	ENSP00000235150:A618T	A	-	1	0	RNF19B	33175338	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	2.662000	0.46766	1.051000	0.40369	0.537000	0.68136	GCA	RNF19B	-	NULL	ENSG00000116514		0.527	RNF19B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF19B	HGNC	protein_coding	OTTHUMT00000011465.3		0.00	75	0	C	NM_153341		33402751	-1			no_errors	ENST00000373456	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
RGS8	85397	genome.wustl.edu	37	1	182636065	182636065	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:182636065A>G	ENST00000483095.2	-	4	327	c.70T>C	c.(70-72)Tca>Cca	p.S24P	RGS8_ENST00000367557.4_Missense_Mutation_p.S24P|RGS8_ENST00000258302.4_Missense_Mutation_p.S42P|RGS8_ENST00000367556.1_Missense_Mutation_p.S24P|RGS8_ENST00000491420.2_5'UTR			P57771	RGS8_HUMAN	regulator of G-protein signaling 8	24					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			haematopoietic_and_lymphoid_tissue(1)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	5						CACGAGTCTGACTTGTGAGAC	0.527																																					Ovarian(189;1262 3804 41973)												0													201.0	168.0	179.0					1																	182636065		2203	4300	6503	SO:0001583	missense	0			AF297015	CCDS1349.1, CCDS41443.1	1q25	2008-07-18	2007-08-14		ENSG00000135824	ENSG00000135824		"""Regulators of G-protein signaling"""	16810	protein-coding gene	gene with protein product		607189	"""regulator of G-protein signalling 8"""			11318611	Standard	NM_001102450		Approved	MGC119067, MGC119068, MGC119069	uc001gpm.1	P57771	OTTHUMG00000035219	ENST00000483095.2:c.70T>C	1.37:g.182636065A>G	ENSP00000426289:p.Ser24Pro		B4DGL9|Q3SYD2	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.S42P	ENST00000483095.2	37	c.124	CCDS41443.1	1	.	.	.	.	.	.	.	.	.	.	A	12.51	1.960821	0.34565	.	.	ENSG00000135824	ENST00000483095;ENST00000258302;ENST00000367557;ENST00000367556;ENST00000508450	T;T;T;T	0.48522	0.81;0.83;0.81;0.81	5.45	5.45	0.79879	.	0.000000	0.20904	U	0.083581	T	0.34279	0.0892	L	0.31371	0.925	0.42644	D	0.993422	B;B	0.23735	0.09;0.037	B;B	0.25614	0.021;0.062	T	0.13124	-1.0521	10	0.08837	T	0.75	.	13.0432	0.58913	1.0:0.0:0.0:0.0	.	24;42	P57771;P57771-2	RGS8_HUMAN;.	P	24;42;24;24;24	ENSP00000426289:S24P;ENSP00000258302:S42P;ENSP00000356528:S24P;ENSP00000356527:S24P	ENSP00000258302:S42P	S	-	1	0	RGS8	180902688	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.505000	0.66981	2.074000	0.62210	0.533000	0.62120	TCA	RGS8	-	NULL	ENSG00000135824		0.527	RGS8-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RGS8	HGNC	protein_coding	OTTHUMT00000358979.1	-	0.00	29	0	A	NM_033345		182636065	-1	tier1	-	no_errors	ENST00000258302	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	G
RGS7	6000	genome.wustl.edu	37	1	240939498	240939498	+	Missense_Mutation	SNP	A	A	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:240939498A>T	ENST00000366565.1	-	18	1810	c.1429T>A	c.(1429-1431)Tcc>Acc	p.S477T	RGS7_ENST00000331110.7_Intron|RGS7_ENST00000446183.2_3'UTR|RGS7_ENST00000366563.1_3'UTR|RGS7_ENST00000366564.1_Missense_Mutation_p.S459T|RGS7_ENST00000348120.2_3'UTR|RGS7_ENST00000366562.4_Missense_Mutation_p.S459T	NM_002924.4	NP_002915.3	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	0					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			AACCTCTTGGACGTGAGAGAT	0.388																																																	0													114.0	103.0	107.0					1																	240939498		2203	4300	6503	SO:0001583	missense	0			BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000366565.1:c.1429T>A	1.37:g.240939498A>T	ENSP00000355523:p.Ser477Thr		Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	pfam_RGS_dom,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal_superfam,prints_RGS_dom,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal_superfam	p.S477T	ENST00000366565.1	37	c.1429	CCDS31071.1	1	.	.	.	.	.	.	.	.	.	.	A	9.029	0.986903	0.18889	.	.	ENSG00000182901	ENST00000366565;ENST00000366564;ENST00000366562	T;T;T	0.32515	1.45;1.55;1.55	5.35	5.35	0.76521	.	1.243150	0.05228	N	0.509856	T	0.22126	0.0533	.	.	.	0.80722	D	1	B;B	0.32467	0.001;0.372	B;B	0.30316	0.005;0.114	T	0.02837	-1.1104	9	0.11182	T	0.66	.	13.0756	0.59085	1.0:0.0:0.0:0.0	.	459;477	P49802-2;P49802-5	.;.	T	477;459;459	ENSP00000355523:S477T;ENSP00000355522:S459T;ENSP00000355520:S459T	ENSP00000355520:S459T	S	-	1	0	RGS7	239006121	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	6.046000	0.71029	2.039000	0.60335	0.397000	0.26171	TCC	RGS7	-	NULL	ENSG00000182901		0.388	RGS7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS7	HGNC	protein_coding	OTTHUMT00000096719.3	-	0.00	39	0	A	NM_002924		240939498	-1	tier1	-	no_errors	ENST00000366565	ensembl	human	known	74_37	missense	12.20	36	5	SNP	1.000	T
RNF6	6049	genome.wustl.edu	37	13	26788999	26788999	+	Silent	SNP	A	A	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr13:26788999A>T	ENST00000381588.4	-	5	1772	c.1020T>A	c.(1018-1020)tcT>tcA	p.S340S	RNF6_ENST00000468480.1_Intron|RNF6_ENST00000346166.3_Silent_p.S340S|RNF6_ENST00000399762.2_Intron|RNF6_ENST00000381570.3_Silent_p.S340S	NM_005977.3	NP_005968.1	Q9Y252	RNF6_HUMAN	ring finger protein (C3H2C3 type) 6	340	Arg-rich.				negative regulation of axon extension (GO:0030517)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K27-linked ubiquitination (GO:0044314)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	axon (GO:0030424)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(3)|ovary(2)|prostate(2)|skin(2)	23	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)		TCCTCCTAACAGATCTTCTAG	0.438																																																	0													135.0	126.0	129.0					13																	26788999		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ010346	CCDS9316.1	13q12.2	2013-01-09			ENSG00000127870	ENSG00000127870		"""RING-type (C3HC4) zinc fingers"""	10069	protein-coding gene	gene with protein product	"""RING-H2 protein RNF-6"""	604242				10331950	Standard	NM_005977		Approved	DKFZp686P0776	uc001uqq.3	Q9Y252	OTTHUMG00000016614	ENST00000381588.4:c.1020T>A	13.37:g.26788999A>T			B4DDP0|Q5W0H0|Q9BZP5|Q9UF41	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.S340	ENST00000381588.4	37	c.1020	CCDS9316.1	13																																																																																			RNF6	-	NULL	ENSG00000127870		0.438	RNF6-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF6	HGNC	protein_coding	OTTHUMT00000044246.2	-	0.00	68	0	A	NM_005977		26788999	-1	tier1	-	no_errors	ENST00000346166	ensembl	human	known	74_37	silent	5.56	68	4	SNP	0.998	T
RNPEPL1	57140	genome.wustl.edu	37	2	241513968	241513968	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:241513968T>C	ENST00000270357.4	+	6	1111	c.518T>C	c.(517-519)cTg>cCg	p.L173P		NM_018226.4	NP_060696.4	Q9HAU8	RNPL1_HUMAN	arginyl aminopeptidase (aminopeptidase B)-like 1	173					leukotriene biosynthetic process (GO:0019370)		aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	13		all_epithelial(40;1.13e-11)|Breast(86;0.000169)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.204)|Melanoma(123;0.238)		Epithelial(32;3.05e-31)|all cancers(36;8.2e-29)|OV - Ovarian serous cystadenocarcinoma(60;8.55e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.12e-06)|Lung(119;0.00168)|Colorectal(34;0.005)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.0322)		GCCTTCCGCCTGGACGCCCTG	0.652																																																	0													41.0	40.0	40.0					2																	241513968		2202	4300	6502	SO:0001583	missense	0					2q37.3	2012-03-06			ENSG00000142327	ENSG00000142327			10079	protein-coding gene	gene with protein product		605287				19508204	Standard	NM_018226		Approved		uc002vzi.4	Q9HAU8	OTTHUMG00000133357	ENST00000270357.4:c.518T>C	2.37:g.241513968T>C	ENSP00000270357:p.Leu173Pro		Q5XKC3|Q6NX56|Q96AC9|Q9H033|Q9NVD0	Missense_Mutation	SNP	pfam_Peptidase_M1_C,pfam_Peptidase_M1_N,superfamily_ARM-type_fold,prints_Peptidase_M1_N	p.L173P	ENST00000270357.4	37	c.518		2	.	.	.	.	.	.	.	.	.	.	T	17.65	3.441819	0.63067	.	.	ENSG00000142327	ENST00000270357	T	0.03272	3.99	4.64	3.43	0.39272	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.088582	0.46758	D	0.000266	T	0.15089	0.0364	M	0.78344	2.41	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.85130	0.997;0.986	T	0.00475	-1.1717	10	0.39692	T	0.17	-19.2717	9.556	0.39339	0.0:0.0:0.1778:0.8222	.	79;173	A4FTX9;Q9HAU8	.;RNPL1_HUMAN	P	173	ENSP00000270357:L173P	ENSP00000270357:L173P	L	+	2	0	RNPEPL1	241162641	1.000000	0.71417	0.986000	0.45419	0.968000	0.65278	4.473000	0.60196	0.684000	0.31448	0.482000	0.46254	CTG	RNPEPL1	-	pfam_Peptidase_M1_N	ENSG00000142327		0.652	RNPEPL1-001	KNOWN	basic|appris_principal	protein_coding	RNPEPL1	HGNC	protein_coding	OTTHUMT00000257190.4	-	0.00	60	0	T	NM_018226		241513968	+1	tier1	-	no_errors	ENST00000270357	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	C
RPAIN	84268	genome.wustl.edu	37	17	5329555	5329555	+	Splice_Site	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr17:5329555G>T	ENST00000381209.3	+	5	995		c.e5-1		CTC-524C5.2_ENST00000575890.1_RNA|RPAIN_ENST00000327154.6_Intron|RPAIN_ENST00000381208.5_Splice_Site|RPAIN_ENST00000405578.4_Splice_Site|RPAIN_ENST00000574003.1_Intron|RPAIN_ENST00000536255.2_Intron	NM_001033002.3	NP_001028174.2	Q86UA6	RIP_HUMAN	RPA interacting protein						DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|protein import into nucleus (GO:0006606)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)	metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)	6						TCTGCTTCTAGGTACAACCTG	0.488																																																	0													297.0	216.0	243.0					17																	5329555		2203	4300	6503	SO:0001630	splice_region_variant	0			AY775314	CCDS32536.1, CCDS54075.1, CCDS54076.1, CCDS54077.1, CCDS54079.1	17p13.2	2014-02-12	2006-05-08			ENSG00000129197			28641	protein-coding gene	gene with protein product						16135809, 16008515	Standard	NM_001033002		Approved	MGC4189, RIP, hRIP	uc010vsz.1	Q86UA6		ENST00000381209.3:c.426-1G>T	17.37:g.5329555G>T			B4DI36|B4DTX7|E9PES3|J3KNH8|Q4G2Y0|Q4G2Y5|Q4G2Y8|Q6B4V9|Q6B4W0|Q6B4W1|Q6B4W4|Q86X49|Q9BT00	Splice_Site	SNP	-	e5-1	ENST00000381209.3	37	c.426-1	CCDS32536.1	17	.	.	.	.	.	.	.	.	.	.	G	20.3	3.964951	0.74131	.	.	ENSG00000129197	ENST00000381209;ENST00000381208;ENST00000405578	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7198	0.88348	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RPAIN	5270279	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.285000	0.72658	2.769000	0.95229	0.563000	0.77884	.	RPAIN	-	-	ENSG00000129197		0.488	RPAIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAIN	HGNC	protein_coding	OTTHUMT00000439373.1	-	0.00	98	0	G	NM_001033002	Intron	5329555	+1	tier1	-	no_errors	ENST00000405578	ensembl	human	known	74_37	splice_site	5.05	94	5	SNP	1.000	T
RPTOR	57521	genome.wustl.edu	37	17	78797005	78797005	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr17:78797005C>T	ENST00000306801.3	+	9	1480	c.1118C>T	c.(1117-1119)aCg>aTg	p.T373M	RPTOR_ENST00000570891.1_Missense_Mutation_p.T373M|RPTOR_ENST00000537330.1_Missense_Mutation_p.T188M|RPTOR_ENST00000544334.2_Missense_Mutation_p.T373M|RPTOR_ENST00000575542.1_3'UTR	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	373					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						CTGCCGCCCACGTACATGCAC	0.567																																																	0													85.0	89.0	88.0					17																	78797005		2203	4300	6503	SO:0001583	missense	0				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.1118C>T	17.37:g.78797005C>T	ENSP00000307272:p.Thr373Met		B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	pfam_HEAT,pfam_WD40_repeat,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Raptor	p.T373M	ENST00000306801.3	37	c.1118	CCDS11773.1	17	.	.	.	.	.	.	.	.	.	.	C	16.91	3.252334	0.59212	.	.	ENSG00000141564	ENST00000537330;ENST00000306801;ENST00000544334	T;T	0.52754	0.65;0.7	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.64649	0.2617	L	0.51853	1.615	0.80722	D	1	D;P;D	0.89917	1.0;0.468;0.999	D;B;P	0.83275	0.996;0.035;0.73	T	0.60622	-0.7227	10	0.35671	T	0.21	.	19.1163	0.93343	0.0:1.0:0.0:0.0	.	373;188;373	F5H7J5;F5GXV9;Q8N122	.;.;RPTOR_HUMAN	M	188;373;373	ENSP00000307272:T373M;ENSP00000442479:T373M	ENSP00000307272:T373M	T	+	2	0	RPTOR	76411600	1.000000	0.71417	0.156000	0.22583	0.116000	0.19942	7.418000	0.80167	2.513000	0.84729	0.650000	0.86243	ACG	RPTOR	-	NULL	ENSG00000141564		0.567	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTOR	HGNC	protein_coding	OTTHUMT00000438125.1		0.00	45	0	C	NM_020761		78797005	+1			no_errors	ENST00000306801	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.996	T
RRBP1	6238	genome.wustl.edu	37	20	17640489	17640489	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr20:17640489C>A	ENST00000377813.1	-	3	967	c.664G>T	c.(664-666)Gca>Tca	p.A222S	RRBP1_ENST00000246043.4_Missense_Mutation_p.A222S|RRBP1_ENST00000455029.2_Intron|RRBP1_ENST00000377807.2_Intron|RRBP1_ENST00000360807.4_Intron			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	222	41 X 10 AA approximate tandem repeats of [TN]-Q-[GSA]-[KRQT]-K-[ATGSV]-[ED]- [GTAS]-[ATIS]-[PQTAS].				osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						GTTCCCTCTGCCTTTCTGCCC	0.547																																																	0																																										SO:0001583	missense	0			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.664G>T	20.37:g.17640489C>A	ENSP00000367044:p.Ala222Ser		A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	pfam_Rib_rcpt_KP,superfamily_Ribosome_recyc_fac_dom	p.A222S	ENST00000377813.1	37	c.664		20	.	.	.	.	.	.	.	.	.	.	C	11.91	1.781046	0.31502	.	.	ENSG00000125844	ENST00000377813;ENST00000246043;ENST00000398782	T;T;T	0.54279	0.58;0.58;0.86	4.6	1.45	0.22620	.	.	.	.	.	T	0.26738	0.0654	.	.	.	0.22719	N	0.998812	.	.	.	.	.	.	T	0.19451	-1.0305	6	0.10902	T	0.67	1.1421	4.0075	0.09608	0.2952:0.4827:0.1428:0.0793	.	.	.	.	S	222	ENSP00000367044:A222S;ENSP00000246043:A222S;ENSP00000381762:A222S	ENSP00000246043:A222S	A	-	1	0	RRBP1	17588489	0.258000	0.24033	0.000000	0.03702	0.002000	0.02628	1.320000	0.33666	0.219000	0.20840	0.655000	0.94253	GCA	RRBP1	-	NULL	ENSG00000125844		0.547	RRBP1-002	NOVEL	basic	protein_coding	RRBP1	HGNC	protein_coding	OTTHUMT00000078125.1	-	0.00	125	0	C	NM_001042576		17640489	-1	tier1	-	no_errors	ENST00000246043	ensembl	human	known	74_37	missense	8.26	111	10	SNP	0.027	A
RYR2	6262	genome.wustl.edu	37	1	237758827	237758827	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:237758827G>A	ENST00000366574.2	+	34	4783	c.4466G>A	c.(4465-4467)tGt>tAt	p.C1489Y	RYR2_ENST00000542537.1_Missense_Mutation_p.C1473Y|RYR2_ENST00000360064.6_Missense_Mutation_p.C1487Y	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1489	4 X approximate repeats.|B30.2/SPRY 3. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TATATGGTATGTGCGGGTGAG	0.463																																																	0													86.0	90.0	89.0					1																	237758827		2059	4189	6248	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.4466G>A	1.37:g.237758827G>A	ENSP00000355533:p.Cys1489Tyr		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.C1487Y	ENST00000366574.2	37	c.4460	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	20.0	3.930870	0.73327	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.68479	-0.33;-0.33;-0.33	5.52	5.52	0.82312	SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.074252	0.56097	D	0.000031	T	0.65228	0.2671	L	0.50333	1.59	0.80722	D	1	B	0.33198	0.401	B	0.33846	0.171	T	0.65619	-0.6124	10	0.51188	T	0.08	.	19.4398	0.94813	0.0:0.0:1.0:0.0	.	1489	Q92736	RYR2_HUMAN	Y	1489;1487;1473	ENSP00000355533:C1489Y;ENSP00000353174:C1487Y;ENSP00000443798:C1473Y	ENSP00000353174:C1487Y	C	+	2	0	RYR2	235825450	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.858000	0.99539	2.598000	0.87819	0.655000	0.94253	TGT	RYR2	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000198626		0.463	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	62	0	G	NM_001035		237758827	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	12.70	55	8	SNP	1.000	A
SALL1	6299	genome.wustl.edu	37	16	51173577	51173577	+	Silent	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr16:51173577G>T	ENST00000251020.4	-	2	2589	c.2556C>A	c.(2554-2556)tcC>tcA	p.S852S	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Silent_p.S755S|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	852					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			AAGGCGAAGAGGATAAGCTGT	0.517																																					GBM(103;1352 1446 1855 4775 8890)												0													110.0	109.0	110.0					16																	51173577		2198	4300	6498	SO:0001819	synonymous_variant	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2556C>A	16.37:g.51173577G>T			Q99881|Q9NSC3|Q9P1R0	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S852	ENST00000251020.4	37	c.2556	CCDS10747.1	16																																																																																			SALL1	-	NULL	ENSG00000103449		0.517	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	-	0.00	47	0	G	NM_002968		51173577	-1	tier1	-	no_errors	ENST00000251020	ensembl	human	known	74_37	silent	7.69	48	4	SNP	0.121	T
SAMD9L	219285	genome.wustl.edu	37	7	92763145	92763145	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr7:92763145T>C	ENST00000318238.4	-	5	3356	c.2140A>G	c.(2140-2142)Agt>Ggt	p.S714G	SAMD9L_ENST00000411955.1_Missense_Mutation_p.S714G|SAMD9L_ENST00000437805.1_Missense_Mutation_p.S714G	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	714					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TTTTCATAACTGTCCCTTTTA	0.353																																																	0													59.0	61.0	60.0					7																	92763145		2203	4297	6500	SO:0001583	missense	0			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.2140A>G	7.37:g.92763145T>C	ENSP00000326247:p.Ser714Gly		A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	superfamily_SAM/pointed,superfamily_P-loop_NTPase,pfscan_SAM	p.S714G	ENST00000318238.4	37	c.2140	CCDS34681.1	7	.	.	.	.	.	.	.	.	.	.	T	3.488	-0.104536	0.06967	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.22134	1.97;1.97;1.97	4.73	2.1	0.27182	.	1.079380	0.07096	N	0.839575	T	0.16257	0.0391	L	0.44542	1.39	0.09310	N	1	B	0.28933	0.228	B	0.27796	0.083	T	0.33033	-0.9884	10	0.30854	T	0.27	0.2933	2.7676	0.05324	0.135:0.0795:0.2789:0.5066	.	714	Q8IVG5	SAM9L_HUMAN	G	714	ENSP00000326247:S714G;ENSP00000405760:S714G;ENSP00000408796:S714G	ENSP00000326247:S714G	S	-	1	0	SAMD9L	92601081	0.000000	0.05858	0.045000	0.18777	0.509000	0.34042	-0.124000	0.10595	0.810000	0.34279	0.378000	0.23410	AGT	SAMD9L	-	NULL	ENSG00000177409		0.353	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9L	HGNC	protein_coding	OTTHUMT00000341730.1	-	0.00	53	0	T	NM_152703		92763145	-1	tier1	-	no_errors	ENST00000318238	ensembl	human	known	74_37	missense	11.36	39	5	SNP	0.001	C
SCAPER	49855	genome.wustl.edu	37	15	76797222	76797222	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr15:76797222T>C	ENST00000563290.1	-	24	3027	c.2932A>G	c.(2932-2934)Aca>Gca	p.T978A	SCAPER_ENST00000538941.2_Missense_Mutation_p.T732A|SCAPER_ENST00000324767.7_Missense_Mutation_p.T978A			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	978						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						CTTAAAACTGTGTTCACATTT	0.393																																																	0													88.0	83.0	85.0					15																	76797222		1847	4090	5937	SO:0001583	missense	0			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.2932A>G	15.37:g.76797222T>C	ENSP00000454973:p.Thr978Ala		F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	smart_Znf_U1	p.T978A	ENST00000563290.1	37	c.2932	CCDS53962.1	15	.	.	.	.	.	.	.	.	.	.	T	7.731	0.699234	0.15106	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.22336	1.97;1.96	6.07	2.41	0.29592	.	0.428761	0.27402	N	0.019521	T	0.04907	0.0132	N	0.01267	-0.92	0.25508	N	0.987485	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.38585	-0.9654	10	0.07325	T	0.83	.	4.2294	0.10596	0.0:0.2375:0.178:0.5845	.	977;732	Q9BY12;F5H7X8	SCAPE_HUMAN;.	A	978;732;1000	ENSP00000326924:T978A;ENSP00000442190:T732A	ENSP00000303560:T1000A	T	-	1	0	SCAPER	74584277	0.999000	0.42202	1.000000	0.80357	0.797000	0.45037	0.377000	0.20552	0.508000	0.28173	-0.256000	0.11100	ACA	SCAPER	-	NULL	ENSG00000140386		0.393	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAPER	HGNC	protein_coding	OTTHUMT00000419698.1	-	0.00	77	0	T	NM_020843		76797222	-1	tier1	-	no_errors	ENST00000324767	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	C
SDSL	113675	genome.wustl.edu	37	12	113873214	113873214	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:113873214G>A	ENST00000403593.4	+	6	786	c.524G>A	c.(523-525)gGt>gAt	p.G175D	SDSL_ENST00000345635.4_Missense_Mutation_p.G175D			Q96GA7	SDSL_HUMAN	serine dehydratase-like	175					cellular amino acid metabolic process (GO:0006520)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	L-serine ammonia-lyase activity (GO:0003941)|L-threonine ammonia-lyase activity (GO:0004794)|pyridoxal phosphate binding (GO:0030170)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	15						GCAGTTGGGGGTGGGGGTCTC	0.662																																																	0													17.0	20.0	19.0					12																	113873214		2198	4294	6492	SO:0001583	missense	0			AF134473	CCDS9170.1	12q24.21	2014-06-24				ENSG00000139410			30404	protein-coding gene	gene with protein product						16580895	Standard	NM_138432		Approved	SDS-RS1, cSDH	uc001tvi.3	Q96GA7		ENST00000403593.4:c.524G>A	12.37:g.113873214G>A	ENSP00000385790:p.Gly175Asp			Missense_Mutation	SNP	pfam_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_Trp_syn_b_sub_like_PLP_eny_SF	p.G175D	ENST00000403593.4	37	c.524	CCDS9170.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.49|16.49	3.137537|3.137537	0.56936|0.56936	.|.	.|.	ENSG00000139410|ENSG00000139410	ENST00000403593;ENST00000553248;ENST00000345635|ENST00000546672	D;D;D|.	0.97352|.	-4.35;-4.35;-4.35|.	4.49|4.49	4.49|4.49	0.54785|0.54785	Pyridoxal phosphate-dependent enzyme, beta subunit (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.90442|0.90442	0.7007|0.7007	H|H	0.98507|0.98507	4.25|4.25	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.94496|0.94496	0.7705|0.7705	10|5	0.87932|.	D|.	0|.	-14.1173|-14.1173	17.133|17.133	0.86730|0.86730	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	175|.	Q96GA7|.	SDSL_HUMAN|.	D|M	175;117;175|71	ENSP00000385790:G175D;ENSP00000448868:G117D;ENSP00000341117:G175D|.	ENSP00000341117:G175D|.	G|V	+|+	2|1	0|0	SDSL|SDSL	112357597|112357597	1.000000|1.000000	0.71417|0.71417	0.825000|0.825000	0.32803|0.32803	0.017000|0.017000	0.09413|0.09413	9.570000|9.570000	0.98174|0.98174	2.209000|2.209000	0.71365|0.71365	0.462000|0.462000	0.41574|0.41574	GGT|GTG	SDSL	-	pfam_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_Trp_syn_b_sub_like_PLP_eny_SF	ENSG00000139410		0.662	SDSL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SDSL	HGNC	protein_coding	OTTHUMT00000404782.1	-	0.00	167	0	G	NM_138432		113873214	+1	tier1	-	no_errors	ENST00000345635	ensembl	human	known	74_37	missense	19.21	121	29	SNP	1.000	A
SEMA5B	54437	genome.wustl.edu	37	3	122631065	122631065	+	Silent	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr3:122631065G>T	ENST00000357599.3	-	19	3236	c.2850C>A	c.(2848-2850)ctC>ctA	p.L950L	SEMA5B_ENST00000451055.2_Silent_p.L1004L|SEMA5B_ENST00000195173.4_Silent_p.L949L	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	950	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		TGTGCAGCCCGAGACAGATGT	0.642																																																	0													60.0	50.0	53.0					3																	122631065		2203	4300	6503	SO:0001819	synonymous_variant	0			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2850C>A	3.37:g.122631065G>T			A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Silent	SNP	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.L1004	ENST00000357599.3	37	c.3012	CCDS35491.1	3																																																																																			SEMA5B	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000082684		0.642	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	SEMA5B	HGNC	protein_coding	OTTHUMT00000277165.1		0.00	42	0	G	NM_001031702		122631065	-1			no_errors	ENST00000451055	ensembl	human	known	74_37	silent	8.00	23	2	SNP	0.685	T
SFT2D2	375035	genome.wustl.edu	37	1	168205836	168205836	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:168205836G>A	ENST00000271375.4	+	5	400	c.328G>A	c.(328-330)Gca>Aca	p.A110T	SFT2D2_ENST00000367829.1_Silent_p.L82L|SFT2D2_ENST00000367825.3_Silent_p.L82L|SFT2D2_ENST00000471981.1_3'UTR	NM_199344.2	NP_955376.1			SFT2 domain containing 2											lung(3)|skin(1)	4	all_hematologic(923;0.215)					GTTGTGTTTTGCACTTACCCT	0.323																																																	0													179.0	165.0	170.0					1																	168205836		2203	4300	6503	SO:0001583	missense	0			AL035297	CCDS1271.1	1q24.2	2008-02-05			ENSG00000213064	ENSG00000213064			25140	protein-coding gene	gene with protein product							Standard	NM_199344		Approved	UNQ512, dJ747L4.C1.2	uc001gfi.4	O95562	OTTHUMG00000034650	ENST00000271375.4:c.328G>A	1.37:g.168205836G>A	ENSP00000271375:p.Ala110Thr			Missense_Mutation	SNP	pfam_Vesicle_transpt_Got1/SFT2	p.A110T	ENST00000271375.4	37	c.328	CCDS1271.1	1	.	.	.	.	.	.	.	.	.	.	G	18.57	3.652708	0.67472	.	.	ENSG00000213064	ENST00000271375	T	0.43294	0.95	5.35	-1.24	0.09435	.	0.573596	0.17018	N	0.190227	T	0.13415	0.0325	L	0.46741	1.465	0.24171	N	0.995626	B	0.02656	0.0	B	0.08055	0.003	T	0.10870	-1.0611	9	0.39692	T	0.17	-14.3117	6.2188	0.20669	0.4527:0.1254:0.4219:0.0	.	110	O95562	SFT2B_HUMAN	T	110	ENSP00000271375:A110T	ENSP00000271375:A110T	A	+	1	0	SFT2D2	166472460	0.041000	0.20044	0.006000	0.13384	0.980000	0.70556	0.671000	0.25172	-0.232000	0.09811	0.650000	0.86243	GCA	SFT2D2	-	pfam_Vesicle_transpt_Got1/SFT2	ENSG00000213064		0.323	SFT2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFT2D2	HGNC	protein_coding	OTTHUMT00000083827.2		0.00	75	0	G	NM_199344		168205836	+1			no_errors	ENST00000271375	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.005	A
SIPA1L1	26037	genome.wustl.edu	37	14	72202017	72202017	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr14:72202017G>T	ENST00000555818.1	+	20	5443	c.5095G>T	c.(5095-5097)Gct>Tct	p.A1699S	SIPA1L1_ENST00000358550.2_Missense_Mutation_p.A1678S|SIPA1L1_ENST00000381232.3_Missense_Mutation_p.A1678S|SIPA1L1_ENST00000537413.1_Missense_Mutation_p.A1153S|SIPA1L1_ENST00000554874.1_3'UTR	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1699					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		ATTTTTTGCTGCTAGTGATGA	0.498																																																	0													165.0	173.0	170.0					14																	72202017		2203	4300	6503	SO:0001583	missense	0			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.5095G>T	14.37:g.72202017G>T	ENSP00000450832:p.Ala1699Ser		J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP_dom,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.A1699S	ENST00000555818.1	37	c.5095	CCDS9807.1	14	.	.	.	.	.	.	.	.	.	.	G	8.647	0.897309	0.17686	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550;ENST00000537413	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	5.39	5.39	0.77823	.	0.288637	0.39687	N	0.001290	T	0.14917	0.0360	N	0.12182	0.205	0.38317	D	0.943403	B;B;B;B;B	0.13594	0.001;0.002;0.0;0.0;0.008	B;B;B;B;B	0.14578	0.001;0.003;0.004;0.001;0.011	T	0.11567	-1.0582	10	0.29301	T	0.29	-16.2937	12.082	0.53675	0.0794:0.0:0.9206:0.0	.	1153;1699;1153;1678;1699	F5GYF8;A6H8W6;B4DYX7;O43166-2;O43166	.;.;.;.;SI1L1_HUMAN	S	1678;1699;1678;1153	ENSP00000370630:A1678S;ENSP00000450832:A1699S;ENSP00000351352:A1678S;ENSP00000440682:A1153S	ENSP00000351352:A1699S	A	+	1	0	SIPA1L1	71271770	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.781000	0.62389	2.677000	0.91161	0.655000	0.94253	GCT	SIPA1L1	-	pfam_DUF3401	ENSG00000197555		0.498	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIPA1L1	HGNC	protein_coding	OTTHUMT00000412806.1	-	0.00	74	0	G	NM_015556		72202017	+1	tier1	-	no_errors	ENST00000555818	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
SLC10A6	345274	genome.wustl.edu	37	4	87769942	87769943	+	Frame_Shift_Ins	INS	-	-	C			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr4:87769942_87769943insC	ENST00000273905.6	-	1	473_474	c.326_327insG	c.(325-327)ggcfs	p.G109fs	SLC10A6_ENST00000505535.1_5'UTR	NM_197965.2	NP_932069.1	Q3KNW5	SOAT_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 6	109					sodium-dependent organic anion transport (GO:0043251)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)|sodium-dependent organic anion transmembrane transporter activity (GO:0043250)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	9		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.00099)		TAGAGATGGTGCCCCCCGGGCA	0.505																																																	0																																										SO:0001589	frameshift_variant	0			AJ583502	CCDS3614.1	4q22.1	2013-07-18	2013-07-18		ENSG00000145283	ENSG00000145283		"""Solute carriers"""	30603	protein-coding gene	gene with protein product		613366				15020217, 17491011	Standard	NM_197965		Approved	SOAT	uc003hqd.2	Q3KNW5	OTTHUMG00000130596	ENST00000273905.6:c.327dupG	4.37:g.87769948_87769948dupC	ENSP00000273905:p.Gly109fs		Q70EX7	Frame_Shift_Ins	INS	pfam_BilAc/Na_symport,tigrfam_Bil_ac_transpt	p.T110fs	ENST00000273905.6	37	c.327_326	CCDS3614.1	4																																																																																			SLC10A6	-	pfam_BilAc/Na_symport,tigrfam_Bil_ac_transpt	ENSG00000145283		0.505	SLC10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A6	HGNC	protein_coding	OTTHUMT00000253043.2		0.00	54	0	-	NM_197965		87769943	-1	tier1		no_errors	ENST00000273905	ensembl	human	known	74_37	frame_shift_ins	9.38	29	3	INS	0.221:1.000	C
SLC12A7	10723	genome.wustl.edu	37	5	1078124	1078125	+	Splice_Site	INS	-	-	GCAG	rs369273236|rs369196468|rs200032397	byFrequency	TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr5:1078124_1078125insGCAG	ENST00000264930.5	-	12	1498		c.e12-2			NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7						cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	TCCCCGAACCTgcaggcaggcg	0.673														58	0.0115815	0.0159	0.0144	5008	,	,		15824	0.0		0.0209	False		,,,				2504	0.0061																0										94,3970		14,66,1952						3.5	1.0			11	265,7685		24,217,3734	no	splice-3	SLC12A7	NM_006598.2		38,283,5686	A1A1,A1R,RR		3.3333,2.313,2.9882				359,11655				SO:0001630	splice_region_variant	0			AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1455-2->CTGC	5.37:g.1078129_1078132dupGCAG			A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Splice_Site	INS	-	e12-2	ENST00000264930.5	37	c.1455-3_1455-2	CCDS34129.1	5																																																																																			SLC12A7	-	-	ENSG00000113504		0.673	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SLC12A7	HGNC	protein_coding	OTTHUMT00000366446.2		0.00	15	0	-	NM_006598	Intron	1078125	-1	tier1		no_errors	ENST00000264930	ensembl	human	known	74_37	splice_site_ins	38.46	8	5	INS	1.000:0.971	GCAG
SLC26A3	1811	genome.wustl.edu	37	7	107408329	107408329	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr7:107408329C>T	ENST00000340010.5	-	19	2271	c.2087G>A	c.(2086-2088)cGg>cAg	p.R696Q	SLC26A3_ENST00000422236.2_Missense_Mutation_p.R583Q	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	696	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						AAATTCATACCGGTTAAGCTT	0.333																																																	0													76.0	78.0	77.0					7																	107408329		2202	4300	6502	SO:0001583	missense	0			L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.2087G>A	7.37:g.107408329C>T	ENSP00000345873:p.Arg696Gln			Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.R696Q	ENST00000340010.5	37	c.2087	CCDS5748.1	7	.	.	.	.	.	.	.	.	.	.	C	5.478	0.273270	0.10403	.	.	ENSG00000091138	ENST00000422236;ENST00000340010	D;D	0.87809	-2.3;-2.3	5.1	2.34	0.29019	Sulphate transporter/antisigma-factor antagonist STAS (4);	0.376804	0.29830	N	0.011098	T	0.80144	0.4569	L	0.43923	1.385	0.09310	N	0.999997	B;B	0.24823	0.098;0.112	B;B	0.16289	0.008;0.015	T	0.66858	-0.5817	10	0.38643	T	0.18	.	10.28	0.43534	0.0:0.7868:0.0:0.2132	.	583;696	G5E9U3;P40879	.;S26A3_HUMAN	Q	583;696	ENSP00000415817:R583Q;ENSP00000345873:R696Q	ENSP00000345873:R696Q	R	-	2	0	SLC26A3	107195565	0.440000	0.25618	0.381000	0.26106	0.063000	0.16089	0.856000	0.27818	0.325000	0.23359	0.467000	0.42956	CGG	SLC26A3	-	pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	ENSG00000091138		0.333	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A3	HGNC	protein_coding	OTTHUMT00000337190.1		0.00	26	0	C	NM_000111		107408329	-1			no_errors	ENST00000340010	ensembl	human	known	74_37	missense	7.69	24	2	SNP	0.425	T
SLC4A4	8671	genome.wustl.edu	37	4	72338536	72338536	+	Silent	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr4:72338536G>T	ENST00000264485.5	+	14	1869	c.1752G>T	c.(1750-1752)acG>acT	p.T584T	SLC4A4_ENST00000514331.1_3'UTR|SLC4A4_ENST00000512686.1_Silent_p.T540T|SLC4A4_ENST00000340595.3_Silent_p.T540T|SLC4A4_ENST00000425175.1_Silent_p.T584T|SLC4A4_ENST00000351898.6_Silent_p.T584T	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	584					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	CACGTTTCACGGAGGAGGGCT	0.453																																																	0													175.0	167.0	170.0					4																	72338536		2203	4300	6503	SO:0001819	synonymous_variant	0			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.1752G>T	4.37:g.72338536G>T			C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Silent	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.T584	ENST00000264485.5	37	c.1752	CCDS43236.1	4																																																																																			SLC4A4	-	pfam_HCO3_transpt_C,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk	ENSG00000080493		0.453	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A4	HGNC	protein_coding	OTTHUMT00000362090.1	-	0.00	82	0	G	NM_003759		72338536	+1	tier1	-	no_errors	ENST00000425175	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.001	T
SLC5A5	6528	genome.wustl.edu	37	19	17988836	17988836	+	Silent	SNP	C	C	T	rs550545031		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr19:17988836C>T	ENST00000222248.3	+	7	1250	c.903C>T	c.(901-903)atC>atT	p.I301I		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	301					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						GCTGTGGCATCGTCATGTTTG	0.627																																					Melanoma(65;1008 1708 7910 46650)												0													118.0	84.0	95.0					19																	17988836		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.903C>T	19.37:g.17988836C>T			O43702|Q2M335|Q9NYB6	Silent	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.I301	ENST00000222248.3	37	c.903	CCDS12368.1	19																																																																																			SLC5A5	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000105641		0.627	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A5	HGNC	protein_coding	OTTHUMT00000466690.1	-	0.00	47	0	C			17988836	+1	tier1	-	no_errors	ENST00000222248	ensembl	human	known	74_37	silent	17.39	38	8	SNP	0.295	T
SLC9A7P1	121456	genome.wustl.edu	37	12	98849257	98849257	+	RNA	SNP	C	C	T	rs547163132		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:98849257C>T	ENST00000554295.1	-	0	1666					NR_033801.1				solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7 pseudogene 1									p.R214Q(1)									GAAGTACTGTCGGTGGTGTTC	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		21404	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	endometrium(1)																																										0					12q23.1	2013-05-22	2012-03-22		ENSG00000227825	ENSG00000227825		"""Solute carriers"""	32679	pseudogene	pseudogene			"""solute carrier family 9 (sodium/hydrogen exchanger), member 7 pseudogene 1"""				Standard	NR_033801		Approved		uc009ztm.2		OTTHUMG00000170629		12.37:g.98849257C>T				RNA	SNP	-	NULL	ENST00000554295.1	37	NULL		12																																																																																			SLC9A7P1	-	-	ENSG00000227825		0.498	SLC9A7P1-002	PUTATIVE	basic	processed_transcript	SLC9A7P1	HGNC	pseudogene	OTTHUMT00000409869.1		0.00	64	0	C			98849257	-1			no_errors	ENST00000554295	ensembl	human	putative	74_37	rna	6.00	47	3	SNP	0.702	T
SMIM11	54065	genome.wustl.edu	37	21	35757784	35757784	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr21:35757784G>T	ENST00000399295.2	+	3	391	c.21G>T	c.(19-21)gaG>gaT	p.E7D	SMIM11_ENST00000399292.3_Missense_Mutation_p.E7D|SMIM11_ENST00000481710.1_3'UTR|SMIM11_ENST00000399299.1_Intron			P58511	SIM11_HUMAN	small integral membrane protein 11	7						integral component of membrane (GO:0016021)											AGGTTCTTGAGCACGTGCCCC	0.398																																																	0													106.0	88.0	94.0					21																	35757784		2203	4300	6503	SO:0001583	missense	0			BC015596	CCDS33550.1	21q22.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000205670	ENSG00000205670			1293	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 51"", ""family with sequence similarity 165, member B"""	C21orf51, FAM165B			Standard	NM_058182		Approved		uc002ytu.4	P58511	OTTHUMG00000086193	ENST00000399295.2:c.21G>T	21.37:g.35757784G>T	ENSP00000382234:p.Glu7Asp			Missense_Mutation	SNP	NULL	p.E7D	ENST00000399295.2	37	c.21	CCDS33550.1	21	.	.	.	.	.	.	.	.	.	.	G	9.152	1.016530	0.19355	.	.	ENSG00000205670	ENST00000399292;ENST00000399295	T;T	0.42513	0.97;0.97	5.49	-11.0	0.00169	.	.	.	.	.	T	0.18551	0.0445	.	.	.	0.18873	N	0.999989	B	0.06786	0.001	B	0.12156	0.007	T	0.07829	-1.0752	8	0.21540	T	0.41	.	5.1357	0.14934	0.2038:0.0766:0.4851:0.2346	.	7	P58511	F165B_HUMAN	D	7	ENSP00000382231:E7D;ENSP00000382234:E7D	ENSP00000382231:E7D	E	+	3	2	FAM165B	34679654	0.072000	0.21174	0.006000	0.13384	0.551000	0.35334	-1.212000	0.02994	-3.652000	0.00126	-0.440000	0.05779	GAG	SMIM11	-	NULL	ENSG00000205670		0.398	SMIM11-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SMIM11	HGNC	protein_coding	OTTHUMT00000194078.1		0.00	42	0	G	NM_058182		35757784	+1			no_errors	ENST00000399292	ensembl	human	known	74_37	missense	9.30	39	4	SNP	0.037	T
SMIM7	79086	genome.wustl.edu	37	19	16757446	16757446	+	3'UTR	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr19:16757446C>T	ENST00000487416.2	-	0	885				CTC-429P9.1_ENST00000601040.1_RNA|SMIM7_ENST00000597711.1_3'UTR|SMIM7_ENST00000397349.2_5'UTR|CTC-429P9.4_ENST00000593962.1_Intron|CTC-429P9.4_ENST00000600705.1_Intron	NM_024104.3	NP_077009.2	Q9BQ49	SMIM7_HUMAN	small integral membrane protein 7							integral component of membrane (GO:0016021)											AATATCCCCACAACTGCTCCA	0.423																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK025602	CCDS12348.2, CCDS74307.1	19p13.11	2012-10-26	2012-10-26	2012-10-26	ENSG00000214046	ENSG00000214046			28419	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 42"""	C19orf42		12477932	Standard	NM_024104		Approved	MGC2747	uc002ner.3	Q9BQ49	OTTHUMG00000149895	ENST00000487416.2:c.*611G>A	19.37:g.16757446C>T			A8MX44	RNA	SNP	-	NULL	ENST00000487416.2	37	NULL	CCDS12348.2	19																																																																																			SMIM7	-	-	ENSG00000214046		0.423	SMIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMIM7	HGNC	protein_coding	OTTHUMT00000313801.2	-	0.00	25	0	C	NM_024104		16757446	-1	tier1	-	no_errors	ENST00000397349	ensembl	human	known	74_37	rna	33.33	14	7	SNP	0.000	T
SNTG2	54221	genome.wustl.edu	37	2	1079214	1079214	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:1079214C>A	ENST00000308624.5	+	2	212	c.83C>A	c.(82-84)aCt>aAt	p.T28N	SNTG2_ENST00000407292.1_Missense_Mutation_p.T28N	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	28					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		ACGAAAACCACTATTGCTCTG	0.483																																																	0													120.0	120.0	120.0					2																	1079214		2025	4177	6202	SO:0001583	missense	0			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.83C>A	2.37:g.1079214C>A	ENSP00000311837:p.Thr28Asn		Q05AH5	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.T28N	ENST00000308624.5	37	c.83	CCDS46220.1	2	.	.	.	.	.	.	.	.	.	.	C	12.27	1.887986	0.33348	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.69926	1.17;-0.44	3.78	2.89	0.33648	.	0.247105	0.40302	N	0.001129	T	0.45637	0.1352	N	0.08118	0	0.21652	N	0.9996	B;B	0.19817	0.039;0.023	B;B	0.18561	0.022;0.014	T	0.45512	-0.9256	10	0.87932	D	0	.	11.6898	0.51508	0.0:0.2451:0.7549:0.0	.	28;28	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	N	28	ENSP00000311837:T28N;ENSP00000385020:T28N	ENSP00000311837:T28N	T	+	2	0	SNTG2	1069214	1.000000	0.71417	0.001000	0.08648	0.001000	0.01503	5.933000	0.70130	0.556000	0.29098	0.591000	0.81541	ACT	SNTG2	-	NULL	ENSG00000172554		0.483	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG2	HGNC	protein_coding	OTTHUMT00000322454.1	-	0.00	76	0	C	NM_018968		1079214	+1	tier1	-	no_errors	ENST00000308624	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.711	A
SPEG	10290	genome.wustl.edu	37	2	220348119	220348119	+	Silent	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:220348119G>A	ENST00000312358.7	+	30	6066	c.5934G>A	c.(5932-5934)agG>agA	p.R1978R	SPEG_ENST00000485813.1_3'UTR|AC053503.11_ENST00000429882.1_RNA	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1978					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		AGCAGGGAAGGGCTCCCTCTC	0.711																																																	0													7.0	9.0	9.0					2																	220348119		1813	4018	5831	SO:0001819	synonymous_variant	0			BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.5934G>A	2.37:g.220348119G>A			A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Silent	SNP	pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R1978	ENST00000312358.7	37	c.5934	CCDS42824.1	2																																																																																			SPEG	-	NULL	ENSG00000072195		0.711	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2	-	0.00	48	0	G	NM_005876		220348119	+1	tier1	-	no_errors	ENST00000312358	ensembl	human	novel	74_37	silent	14.29	36	6	SNP	0.993	A
SULF2	55959	genome.wustl.edu	37	20	46365616	46365616	+	Missense_Mutation	SNP	G	G	T	rs368302336		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr20:46365616G>T	ENST00000359930.4	-	3	1097	c.246C>A	c.(244-246)ttC>ttA	p.F82L	SULF2_ENST00000478766.1_5'UTR|SULF2_ENST00000361612.4_Missense_Mutation_p.F82L|SULF2_ENST00000467815.1_Missense_Mutation_p.F82L|SULF2_ENST00000484875.1_Missense_Mutation_p.F82L	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	82					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						GTGTGGTCACGAAGGCGTTGA	0.582																																																	0													243.0	186.0	205.0					20																	46365616		2203	4300	6503	SO:0001583	missense	0			AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.246C>A	20.37:g.46365616G>T	ENSP00000353007:p.Phe82Leu		E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Missense_Mutation	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.F82L	ENST00000359930.4	37	c.246	CCDS13408.1	20	.	.	.	.	.	.	.	.	.	.	G	22.6	4.314713	0.81358	.	.	ENSG00000196562	ENST00000359930;ENST00000484875;ENST00000361612;ENST00000467815;ENST00000437955	D;D;D;D;D	0.96716	-4.1;-4.1;-4.1;-4.1;-3.33	5.44	4.29	0.51040	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.045113	0.85682	D	0.000000	D	0.96873	0.8979	M	0.74647	2.275	0.48288	D	0.999627	D;D;D	0.63046	0.985;0.992;0.982	D;P;P	0.63113	0.911;0.842;0.79	D	0.96138	0.9098	10	0.87932	D	0	-17.1625	6.3063	0.21141	0.2685:0.0:0.7315:0.0	.	82;82;82	G3XAE6;Q8IWU5-2;Q8IWU5	.;.;SULF2_HUMAN	L	82	ENSP00000353007:F82L;ENSP00000418290:F82L;ENSP00000354662:F82L;ENSP00000418442:F82L;ENSP00000410026:F82L	ENSP00000353007:F82L	F	-	3	2	SULF2	45799023	0.998000	0.40836	1.000000	0.80357	0.964000	0.63967	0.679000	0.25291	2.559000	0.86315	0.561000	0.74099	TTC	SULF2	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	ENSG00000196562		0.582	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SULF2	HGNC	protein_coding	OTTHUMT00000079606.1		0.00	41	0	G	NM_018837		46365616	-1			no_errors	ENST00000359930	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	T
SWAP70	23075	genome.wustl.edu	37	11	9761755	9761755	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr11:9761755G>T	ENST00000318950.6	+	9	1319	c.1216G>T	c.(1216-1218)Gct>Tct	p.A406S	SWAP70_ENST00000447399.2_Missense_Mutation_p.A348S	NM_015055.2	NP_055870.2	Q9UH65	SWP70_HUMAN	SWAP switching B-cell complex 70kDa subunit	406					isotype switching (GO:0045190)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	11				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		AGAACAGGTTGCTCAAAAGTC	0.473																																																	0													85.0	79.0	81.0					11																	9761755		2201	4294	6495	SO:0001583	missense	0			AB014540	CCDS31426.1, CCDS73257.1	11p15	2013-01-10			ENSG00000133789	ENSG00000133789		"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	17070	protein-coding gene	gene with protein product		604762				9734811, 10681448	Standard	XM_005252829		Approved	KIAA0640, SWAP-70	uc001mhw.3	Q9UH65	OTTHUMG00000165865	ENST00000318950.6:c.1216G>T	11.37:g.9761755G>T	ENSP00000315630:p.Ala406Ser		D3DQV1|O75135|Q7LCY6|Q9P061|Q9P0Z8	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_EF_hand_dom,pfscan_Pleckstrin_homology	p.A406S	ENST00000318950.6	37	c.1216	CCDS31426.1	11	.	.	.	.	.	.	.	.	.	.	G	21.8	4.205845	0.79127	.	.	ENSG00000133789	ENST00000447399;ENST00000318950	T;T	0.18016	2.24;2.24	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.28896	0.0717	L	0.29908	0.895	0.53005	D	0.999964	D;D;D	0.69078	0.996;0.997;0.997	P;P;P	0.62813	0.907;0.885;0.802	T	0.01583	-1.1319	10	0.30078	T	0.28	-9.9337	18.8651	0.92289	0.0:0.0:1.0:0.0	.	348;406;348	E7EMB1;Q9UH65;B3KUB9	.;SWP70_HUMAN;.	S	348;406	ENSP00000399056:A348S;ENSP00000315630:A406S	ENSP00000315630:A406S	A	+	1	0	SWAP70	9718331	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	9.476000	0.97823	2.445000	0.82738	0.591000	0.81541	GCT	SWAP70	-	NULL	ENSG00000133789		0.473	SWAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SWAP70	HGNC	protein_coding	OTTHUMT00000386766.2		0.00	45	0	G	NM_015055		9761755	+1			no_errors	ENST00000318950	ensembl	human	known	74_37	missense	5.77	49	3	SNP	1.000	T
SYMPK	8189	genome.wustl.edu	37	19	46326035	46326035	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr19:46326035G>T	ENST00000245934.7	-	21	3014	c.2770C>A	c.(2770-2772)Cgc>Agc	p.R924S	SYMPK_ENST00000598155.1_5'UTR	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	924					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		CCCAGCAGGCGGTTGAAGACT	0.607																																																	0													95.0	84.0	87.0					19																	46326035		2203	4300	6503	SO:0001583	missense	0			U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.2770C>A	19.37:g.46326035G>T	ENSP00000245934:p.Arg924Ser		O00521|O00689|O00733|Q59GT5|Q8N2U5	Missense_Mutation	SNP	pfam_DUF3453,pfam_Symplekin_C,superfamily_ARM-type_fold	p.R924S	ENST00000245934.7	37	c.2770	CCDS12676.2	19	.	.	.	.	.	.	.	.	.	.	G	18.31	3.596840	0.66332	.	.	ENSG00000125755	ENST00000245934	T	0.66280	-0.2	4.37	4.37	0.52481	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72890	0.3517	L	0.60845	1.875	0.58432	D	0.999994	D;P	0.89917	1.0;0.88	D;P	0.97110	1.0;0.897	T	0.74965	-0.3484	10	0.87932	D	0	.	9.6845	0.40089	0.0:0.0:0.7928:0.2072	.	939;924	Q4LE61;Q92797	.;SYMPK_HUMAN	S	924	ENSP00000245934:R924S	ENSP00000245934:R924S	R	-	1	0	SYMPK	51017875	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.787000	0.55439	2.275000	0.75901	0.555000	0.69702	CGC	SYMPK	-	pfam_Symplekin_C,superfamily_ARM-type_fold	ENSG00000125755		0.607	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYMPK	HGNC	protein_coding	OTTHUMT00000316581.1		0.00	39	0	G	NM_004819		46326035	-1			no_errors	ENST00000245934	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
SYT6	148281	genome.wustl.edu	37	1	114682356	114682356	+	Silent	SNP	G	G	T	rs576443917		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:114682356G>T	ENST00000610222.1	-	2	539	c.393C>A	c.(391-393)gcC>gcA	p.A131A	SYT6_ENST00000369547.1_Silent_p.A46A|SYT6_ENST00000393296.1_Silent_p.A131A|SYT6_ENST00000609117.1_Silent_p.A46A|SYT6_ENST00000607941.1_Silent_p.A46A			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	131					acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)	p.A46A(1)		central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGATCTTCACGGCCGCCTCCA	0.617																																																	1	Substitution - coding silent(1)	lung(1)											88.0	82.0	84.0					1																	114682356		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.393C>A	1.37:g.114682356G>T			B1AMB8|B3KPK1	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_dom	p.A131	ENST00000610222.1	37	c.393		1																																																																																			SYT6	-	NULL	ENSG00000134207		0.617	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SYT6	HGNC	protein_coding	OTTHUMT00000314819.2		0.00	43	0	G	NM_205848		114682356	-1			no_errors	ENST00000393296	ensembl	human	known	74_37	silent	5.13	37	2	SNP	0.001	T
NPFF	8620	genome.wustl.edu	37	12	53898476	53898476	+	IGR	SNP	T	T	C			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:53898476T>C	ENST00000267017.3	-	0	592				TARBP2_ENST00000266987.2_Intron|TARBP2_ENST00000552857.1_Intron|TARBP2_ENST00000394357.2_Intron|TARBP2_ENST00000456234.2_Intron	NM_003717.2	NP_003708.1	O15130	NPFF_HUMAN	neuropeptide FF-amide peptide precursor						acute inflammatory response to antigenic stimulus (GO:0002438)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of appetite (GO:0032099)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane depolarization (GO:0003254)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|response to morphine (GO:0043278)|somatostatin secretion (GO:0070253)|spinal cord development (GO:0021510)|synaptic transmission (GO:0007268)|vasopressin secretion (GO:0030103)	axon terminus (GO:0043679)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|vesicle (GO:0031982)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(1)|prostate(1)|urinary_tract(1)	3						GTGTCTCCCTTCCAAGGAGCT	0.592																																																	0													72.0	71.0	71.0					12																	53898476		2203	4300	6503	SO:0001628	intergenic_variant	0			AF005271	CCDS8862.1	12q13.13	2013-02-26			ENSG00000139574	ENSG00000139574		"""Endogenous ligands"""	7901	protein-coding gene	gene with protein product		604643				9224703	Standard	NM_003717		Approved	FMRFAL	uc001sdw.1	O15130	OTTHUMG00000169856		12.37:g.53898476T>C			Q3SXL4	Silent	SNP	pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom	p.L171	ENST00000267017.3	37	c.513	CCDS8862.1	12																																																																																			TARBP2	-	NULL	ENSG00000139546		0.592	NPFF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARBP2	HGNC	protein_coding	OTTHUMT00000406301.1	-	0.00	50	0	T	NM_003717		53898476	+1	tier1	-	no_errors	ENST00000549572	ensembl	human	known	74_37	silent	10.81	33	4	SNP	0.000	C
TDRD9	122402	genome.wustl.edu	37	14	104457534	104457534	+	Nonsense_Mutation	SNP	C	C	T	rs377183290		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr14:104457534C>T	ENST00000409874.4	+	9	1201	c.1153C>T	c.(1153-1155)Cga>Tga	p.R385*	TDRD9_ENST00000339063.5_Nonsense_Mutation_p.R385*	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	385	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.R100*(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				TGTGTTGGAGCGAAGCAGTGT	0.408																																																	1	Substitution - Nonsense(1)	ovary(1)											193.0	173.0	180.0					14																	104457534		2203	4300	6503	SO:0001587	stop_gained	0			AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.1153C>T	14.37:g.104457534C>T	ENSP00000387303:p.Arg385*		A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Nonsense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_Tudor,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,smart_Tudor,pfscan_Tudor,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R385*	ENST00000409874.4	37	c.1153	CCDS9987.2	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.442261|5.442261	0.96187|0.96187	.|.	.|.	ENSG00000156414|ENSG00000156414	ENST00000557332|ENST00000409874;ENST00000339063	.|.	.|.	.|.	5.63|5.63	4.72|4.72	0.59763|0.59763	.|.	.|0.224693	.|0.31145	.|N	.|0.008165	T|.	0.34308|.	0.0893|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.35276|.	-0.9795|.	3|.	.|0.02654	.|T	.|1	.|.	13.7168|13.7168	0.62702|0.62702	0.1545:0.8455:0.0:0.0|0.1545:0.8455:0.0:0.0	.|.	.|.	.|.	.|.	V|X	111|385	.|.	.|ENSP00000343545:R385X	A|R	+|+	2|1	0|2	TDRD9|TDRD9	103527287|103527287	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.933000|0.933000	0.57130|0.57130	0.920000|0.920000	0.28705|0.28705	1.323000|1.323000	0.45263|0.45263	0.655000|0.655000	0.94253|0.94253	GCG|CGA	TDRD9	-	superfamily_P-loop_NTPase,pfscan_Helicase_C	ENSG00000156414		0.408	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD9	HGNC	protein_coding	OTTHUMT00000328325.3	-	0.00	130	0	C	NM_153046		104457534	+1	tier1	-	no_errors	ENST00000409874	ensembl	human	known	74_37	nonsense	7.03	119	9	SNP	1.000	T
TEKT2	27285	genome.wustl.edu	37	1	36551545	36551545	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:36551545G>T	ENST00000207457.3	+	4	518	c.391G>T	c.(391-393)Gac>Tac	p.D131Y	ADPRHL2_ENST00000373178.4_5'Flank	NM_014466.2	NP_055281.2	Q9UIF3	TEKT2_HUMAN	tektin 2 (testicular)	131					cell projection organization (GO:0030030)|inner dynein arm assembly (GO:0036159)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|pancreas(1)|skin(2)	13		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TGTGGTGAAGGACCCTGTGGA	0.577																																																	0													90.0	70.0	77.0					1																	36551545		2203	4300	6503	SO:0001583	missense	0			AB033823	CCDS401.1	1p34.3	2008-02-05			ENSG00000092850	ENSG00000092850			11725	protein-coding gene	gene with protein product		608953				12029069, 11751288	Standard	NM_014466		Approved	TEKTB1	uc001bzr.3	Q9UIF3	OTTHUMG00000007629	ENST00000207457.3:c.391G>T	1.37:g.36551545G>T	ENSP00000207457:p.Asp131Tyr		A6NIS6|O60638	Missense_Mutation	SNP	pfam_Tektin,superfamily_Prefoldin,prints_Tektin	p.D131Y	ENST00000207457.3	37	c.391	CCDS401.1	1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438482	0.83885	.	.	ENSG00000092850	ENST00000207457	T	0.26957	1.7	5.51	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.60117	0.2244	M	0.92367	3.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.71407	-0.4602	10	0.87932	D	0	.	14.1813	0.65577	0.0714:0.0:0.9286:0.0	.	131	Q9UIF3	TEKT2_HUMAN	Y	131	ENSP00000207457:D131Y	ENSP00000207457:D131Y	D	+	1	0	TEKT2	36324132	1.000000	0.71417	0.770000	0.31555	0.995000	0.86356	9.706000	0.98722	1.337000	0.45525	0.655000	0.94253	GAC	TEKT2	-	pfam_Tektin	ENSG00000092850		0.577	TEKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT2	HGNC	protein_coding	OTTHUMT00000020200.1		0.00	32	0	G	NM_014466		36551545	+1			no_errors	ENST00000207457	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	T
TMEM101	84336	genome.wustl.edu	37	17	42089360	42089360	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr17:42089360A>G	ENST00000589334.1	-	5	1025	c.710T>C	c.(709-711)aTg>aCg	p.M237T	TMEM101_ENST00000206380.3_Missense_Mutation_p.M237T|TMEM101_ENST00000542039.1_Missense_Mutation_p.M179T			Q96IK0	TM101_HUMAN	transmembrane protein 101	237					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		Breast(137;0.0264)|Prostate(33;0.0861)		BRCA - Breast invasive adenocarcinoma(366;0.113)		AAGGAGCTTCATCTGGTTCCA	0.557																																																	0													103.0	88.0	93.0					17																	42089360		2203	4300	6503	SO:0001583	missense	0			AK172826	CCDS11474.1	17q21.31	2005-12-16							28653	protein-coding gene	gene with protein product						12761501	Standard	NM_032376		Approved	MGC4251, FLJ23987	uc002ieu.3	Q96IK0		ENST00000589334.1:c.710T>C	17.37:g.42089360A>G	ENSP00000468025:p.Met237Thr		B2R9N6	Missense_Mutation	SNP	NULL	p.M237T	ENST00000589334.1	37	c.710	CCDS11474.1	17	.	.	.	.	.	.	.	.	.	.	A	17.37	3.372318	0.61624	.	.	ENSG00000091947	ENST00000206380;ENST00000542039	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.46502	0.1396	L	0.29908	0.895	0.80722	D	1	B	0.31290	0.318	B	0.29176	0.099	T	0.49818	-0.8899	9	0.62326	D	0.03	-12.6751	13.6738	0.62440	1.0:0.0:0.0:0.0	.	237	Q96IK0	TM101_HUMAN	T	237;179	.	ENSP00000206380:M237T	M	-	2	0	TMEM101	39444886	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.202000	0.95026	2.113000	0.64589	0.397000	0.26171	ATG	TMEM101	-	NULL	ENSG00000091947		0.557	TMEM101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM101	HGNC	protein_coding	OTTHUMT00000457665.1		0.00	41	0	A	NM_032376		42089360	-1			no_errors	ENST00000206380	ensembl	human	known	74_37	missense	8.33	33	3	SNP	1.000	G
TMEM14B	81853	genome.wustl.edu	37	6	10751375	10751375	+	Missense_Mutation	SNP	C	C	T	rs554783546		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr6:10751375C>T	ENST00000379542.5	+	4	277	c.110C>T	c.(109-111)cCg>cTg	p.P37L	TMEM14B_ENST00000473276.1_Intron|TMEM14B_ENST00000491103.1_3'UTR|SYCP2L_ENST00000543878.1_Intron|TMEM14B_ENST00000481240.1_Intron|RNA5SP203_ENST00000410451.1_RNA|TMEM14B_ENST00000461342.1_Intron|RP11-637O19.3_ENST00000480294.1_Intron|TMEM14B_ENST00000467317.1_Missense_Mutation_p.P37L|TMEM14B_ENST00000379530.3_Intron|TMEM14B_ENST00000475942.1_Missense_Mutation_p.P37L	NM_030969.3	NP_112231.3	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B	37				P -> S (in Ref. 3; AAH07080). {ECO:0000305}.		integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(2)|skin(2)	11	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				GGCAGCGTGCCGTCCCTGGCT	0.547																																																	0													125.0	109.0	114.0					6																	10751375		2202	4300	6502	SO:0001583	missense	0			AL024498	CCDS4515.1, CCDS47372.1, CCDS75395.1, CCDS75396.1, CCDS75397.1	6p25.1-p23	2008-08-12			ENSG00000137210	ENSG00000137210			21384	protein-coding gene	gene with protein product							Standard	NM_030969		Approved	MGC1223	uc003mzk.4	Q9NUH8	OTTHUMG00000014246	ENST00000379542.5:c.110C>T	6.37:g.10751375C>T	ENSP00000368858:p.Pro37Leu		Q5THN7|Q5THN8|Q96IX7|Q9BVN8	Missense_Mutation	SNP	pfam_UPF0136_TM	p.P37L	ENST00000379542.5	37	c.110	CCDS4515.1	6	.	.	.	.	.	.	.	.	.	.	C	9.583	1.124200	0.20959	.	.	ENSG00000137210	ENST00000472062;ENST00000379542;ENST00000475942;ENST00000467317	T;T;T	0.14391	2.51;2.51;2.51	4.01	4.01	0.46588	.	0.000000	0.85682	D	0.000000	T	0.12433	0.0302	M	0.83384	2.64	0.80722	D	1	B	0.15930	0.015	B	0.23275	0.045	T	0.04579	-1.0941	10	0.32370	T	0.25	.	16.2553	0.82515	0.0:1.0:0.0:0.0	.	37	Q9NUH8	TM14B_HUMAN	L	37	ENSP00000368858:P37L;ENSP00000418730:P37L;ENSP00000420658:P37L	ENSP00000368858:P37L	P	+	2	0	TMEM14B	10859361	1.000000	0.71417	0.770000	0.31555	0.003000	0.03518	5.770000	0.68873	2.236000	0.73375	0.484000	0.47621	CCG	TMEM14B	-	pfam_UPF0136_TM	ENSG00000137210		0.547	TMEM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM14B	HGNC	protein_coding	OTTHUMT00000039836.1	-	0.00	99	0	C	NM_030969		10751375	+1	tier1	-	no_errors	ENST00000379542	ensembl	human	known	74_37	missense	10.17	106	12	SNP	0.997	T
TMEM52B	120939	genome.wustl.edu	37	12	10342518	10342518	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr12:10342518G>T	ENST00000381923.2	+	6	735	c.331G>T	c.(331-333)Gca>Tca	p.A111S	TMEM52B_ENST00000298530.3_Missense_Mutation_p.A91S|TMEM52B_ENST00000536952.1_Missense_Mutation_p.A111S			Q4KMG9	TM52B_HUMAN	transmembrane protein 52B	111						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GTTTGGCCCTGCAGCTCGGAG	0.552																																																	0													98.0	85.0	89.0					12																	10342518		2203	4300	6503	SO:0001583	missense	0			AY358845	CCDS8619.1, CCDS66314.1	12p13.2	2012-08-15	2012-08-15	2012-08-15	ENSG00000165685	ENSG00000165685			26438	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 59"""	C12orf59		12975309	Standard	XM_005253299		Approved	FLJ31166	uc001qxq.3	Q4KMG9	OTTHUMG00000168410	ENST00000381923.2:c.331G>T	12.37:g.10342518G>T	ENSP00000371348:p.Ala111Ser		Q96NA7	Missense_Mutation	SNP	NULL	p.A111S	ENST00000381923.2	37	c.331		12	.	.	.	.	.	.	.	.	.	.	G	12.68	2.010029	0.35415	.	.	ENSG00000165685	ENST00000381923;ENST00000298530;ENST00000536952	T;T;T	0.32515	1.45;1.45;1.45	4.39	3.49	0.39957	.	0.082651	0.50627	N	0.000105	T	0.24160	0.0585	L	0.38531	1.155	0.39020	D	0.959726	B;B	0.30709	0.15;0.291	B;B	0.28991	0.044;0.097	T	0.12451	-1.0547	10	0.51188	T	0.08	-16.1825	11.6732	0.51415	0.0:0.0:0.8212:0.1787	.	111;91	Q4KMG9;Q4KMG9-2	CL059_HUMAN;.	S	111;91;111	ENSP00000371348:A111S;ENSP00000298530:A91S;ENSP00000446102:A111S	ENSP00000298530:A91S	A	+	1	0	C12orf59	10233785	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	4.370000	0.59517	1.179000	0.42884	0.585000	0.79938	GCA	TMEM52B	-	NULL	ENSG00000165685		0.552	TMEM52B-002	KNOWN	basic|appris_candidate_longest	protein_coding	TMEM52B	HGNC	protein_coding	OTTHUMT00000399645.1	-	0.00	39	0	G	NM_153022		10342518	+1	tier1	-	no_errors	ENST00000381923	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
TNFRSF10A	8797	genome.wustl.edu	37	8	23049386	23049386	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr8:23049386C>T	ENST00000221132.3	-	10	1292	c.1228G>A	c.(1228-1230)Gca>Aca	p.A410T	RP11-1149O23.2_ENST00000518308.1_RNA	NM_003844.3	NP_003835.3	O00220	TR10A_HUMAN	tumor necrosis factor receptor superfamily, member 10a	410	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|signal transduction (GO:0007165)|TRAIL-activated apoptotic signaling pathway (GO:0036462)	integral component of membrane (GO:0016021)	death receptor activity (GO:0005035)|protease binding (GO:0002020)|receptor activity (GO:0004872)|TRAIL binding (GO:0045569)|transcription factor binding (GO:0008134)			NS(2)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|skin(1)	16		Prostate(55;0.0421)|Breast(100;0.14)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)		ATCAGCATTGCATACAAGGCA	0.532																																																	0													235.0	194.0	208.0					8																	23049386		2203	4300	6503	SO:0001583	missense	0			U90875	CCDS6039.1	8p21	2006-02-22			ENSG00000104689	ENSG00000104689		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11904	protein-coding gene	gene with protein product		603611				9311998, 9082980	Standard	NM_003844		Approved	DR4, Apo2, TRAILR-1, CD261	uc003xda.3	O00220	OTTHUMG00000097843	ENST00000221132.3:c.1228G>A	8.37:g.23049386C>T	ENSP00000221132:p.Ala410Thr		A8K5I4|Q53Y72|Q96E62	Missense_Mutation	SNP	pirsf_TNFR_10,pfam_Death_domain,pfam_TNFR/NGFR_Cys_rich_reg,superfamily_DEATH-like_dom,smart_TNFR/NGFR_Cys_rich_reg,smart_Death_domain,prints_TNFR_10,pfscan_Death_domain,pfscan_TNFR/NGFR_Cys_rich_reg	p.A410T	ENST00000221132.3	37	c.1228	CCDS6039.1	8	.	.	.	.	.	.	.	.	.	.	C	8.778	0.927442	0.18056	.	.	ENSG00000104689	ENST00000221132	T	0.46451	0.87	3.43	1.12	0.20585	Death (3);DEATH-like (2);	1.754830	0.04155	N	0.321933	T	0.21062	0.0507	N	0.08118	0	0.09310	N	1	B	0.26258	0.145	B	0.20955	0.032	T	0.13388	-1.0511	10	0.27785	T	0.31	.	2.4007	0.04400	0.0:0.3197:0.3346:0.3457	.	410	O00220	TR10A_HUMAN	T	410	ENSP00000221132:A410T	ENSP00000221132:A410T	A	-	1	0	TNFRSF10A	23105331	0.000000	0.05858	0.002000	0.10522	0.094000	0.18550	-0.733000	0.04898	0.030000	0.15379	0.462000	0.41574	GCA	TNFRSF10A	-	pirsf_TNFR_10,pfam_Death_domain,superfamily_DEATH-like_dom,smart_Death_domain,pfscan_Death_domain	ENSG00000104689		0.532	TNFRSF10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF10A	HGNC	protein_coding	OTTHUMT00000215133.2		0.00	74	0	C	NM_003844		23049386	-1			no_errors	ENST00000221132	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.001	T
TNN	63923	genome.wustl.edu	37	1	175049324	175049324	+	Silent	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:175049324G>A	ENST00000239462.4	+	4	923	c.810G>A	c.(808-810)ctG>ctA	p.L270L		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	270	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GCCTGCAGCTGCTCAAGAACA	0.612																																																	0													49.0	52.0	51.0					1																	175049324		2203	4300	6503	SO:0001819	synonymous_variant	0			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.810G>A	1.37:g.175049324G>A			B9EGP3|Q5R360	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.L270	ENST00000239462.4	37	c.810	CCDS30943.1	1																																																																																			TNN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000120332		0.612	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNN	HGNC	protein_coding	OTTHUMT00000084422.1	-	0.00	42	0	G	XM_040527		175049324	+1	tier1	-	no_errors	ENST00000239462	ensembl	human	known	74_37	silent	12.00	22	3	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577498	7577498	+	Splice_Site	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr17:7577498C>T	ENST00000269305.4	-	7	972		c.e7+1		TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000455263.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(29)|p.0?(8)|p.E258fs*71(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGCTCCTGACCTGGAGTCTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	38	Unknown(29)|Whole gene deletion(8)|Deletion - Frameshift(1)	breast(5)|ovary(5)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|upper_aerodigestive_tract(2)|stomach(2)|central_nervous_system(2)|large_intestine(2)|oesophagus(2)|peritoneum(1)|biliary_tract(1)|liver(1)|urinary_tract(1)|salivary_gland(1)|lung(1)|skin(1)|pancreas(1)											121.0	85.0	97.0					17																	7577498		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.782+1G>A	17.37:g.7577498C>T			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e6+1	ENST00000269305.4	37	c.782+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	12.61	1.989137	0.35131	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.31	4.31	0.51392	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.688	0.69062	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7518223	1.000000	0.71417	0.987000	0.45799	0.147000	0.21601	3.111000	0.50360	2.406000	0.81754	0.462000	0.41574	.	TP53	-	-	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	75	0	C	NM_000546	Intron	7577498	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	11.11	48	6	SNP	1.000	T
TRDN	10345	genome.wustl.edu	37	6	123786032	123786033	+	Intron	INS	-	-	A	rs201431159		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr6:123786032_123786033insA	ENST00000398178.3	-	10	953				RP11-532N4.2_ENST00000587106.2_RNA|TRDN_ENST00000334268.4_Intron|TRDN_ENST00000546248.1_Frame_Shift_Ins_p.S297fs|RP11-532N4.2_ENST00000587049.1_RNA|RP11-532N4.2_ENST00000427828.1_RNA|RP11-532N4.2_ENST00000589182.1_RNA|RP11-532N4.2_ENST00000434768.1_RNA|RP11-532N4.2_ENST00000418467.2_RNA	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin						cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		AGATCTTTAAGAAAAAAAAAAG	0.386																																																	0																																										SO:0001627	intron_variant	0			U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.931+17->T	6.37:g.123786042_123786042dupA			A5D6W5|F5H2W7|Q6NSB8	Frame_Shift_Ins	INS	pfam_Asp-B-hydro/Triadin_dom	p.S297fs	ENST00000398178.3	37	c.890_889	CCDS55053.1	6																																																																																			TRDN	-	NULL	ENSG00000186439		0.386	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRDN	HGNC	protein_coding			0.00	37	0	-			123786033	-1	tier1		no_errors	ENST00000546248	ensembl	human	known	74_37	frame_shift_ins	19.35	25	6	INS	0.000:0.000	A
TRDN	10345	genome.wustl.edu	37	6	123714810	123714810	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr6:123714810G>T	ENST00000398178.3	-	13	1085	c.1064C>A	c.(1063-1065)gCt>gAt	p.A355D	TRDN_ENST00000334268.4_Missense_Mutation_p.A355D	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	355					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		GGTTTCAGAAGCTTTTCCCGG	0.318																																																	0													96.0	85.0	88.0					6																	123714810		1793	4057	5850	SO:0001583	missense	0			U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.1064C>A	6.37:g.123714810G>T	ENSP00000381240:p.Ala355Asp		A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	pfam_Asp-B-hydro/Triadin_dom	p.A355D	ENST00000398178.3	37	c.1064	CCDS55053.1	6	.	.	.	.	.	.	.	.	.	.	G	12.73	2.026293	0.35701	.	.	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268	T;T	0.63096	-0.02;-0.02	5.24	2.42	0.29668	.	1.234480	0.05796	N	0.611292	T	0.19927	0.0479	N	0.14661	0.345	0.21416	N	0.999696	B;B;B	0.32245	0.361;0.361;0.361	B;B;B	0.27500	0.08;0.08;0.08	T	0.15521	-1.0434	10	0.23891	T	0.37	1.9892	7.1218	0.25448	0.1518:0.14:0.7081:0.0	.	355;356;355	Q5SWK9;Q8IVK2;Q13061	.;.;TRDN_HUMAN	D	355;357;355	ENSP00000381240:A355D;ENSP00000333984:A355D	ENSP00000333984:A355D	A	-	2	0	TRDN	123756509	0.906000	0.30813	0.025000	0.17156	0.699000	0.40488	1.022000	0.30052	0.277000	0.22141	0.563000	0.77884	GCT	TRDN	-	NULL	ENSG00000186439		0.318	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRDN	HGNC	protein_coding			0.00	56	0	G			123714810	-1			no_errors	ENST00000398178	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.310	T
TRMT6	51605	genome.wustl.edu	37	20	5923415	5923415	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr20:5923415G>T	ENST00000203001.2	-	7	815	c.685C>A	c.(685-687)Cag>Aag	p.Q229K	TRMT6_ENST00000453074.2_Missense_Mutation_p.Q59K|TRMT6_ENST00000473131.1_5'UTR	NM_015939.3	NP_057023.2	Q9UJA5	TRM6_HUMAN	tRNA methyltransferase 6 homolog (S. cerevisiae)	229					regulation of translational initiation (GO:0006446)|tRNA processing (GO:0008033)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)	15						GGGTATAGCTGAATAATGGAG	0.443																																																	0													108.0	117.0	114.0					20																	5923415		2203	4300	6503	SO:0001583	missense	0			AK000613	CCDS13093.1, CCDS63225.1	20p12.3	2009-01-12			ENSG00000089195	ENSG00000089195			20900	protein-coding gene	gene with protein product						16043508	Standard	NM_001281467		Approved	GCD10, MGC5029, Gcd10p, CGI-09	uc002wmh.1	Q9UJA5	OTTHUMG00000031816	ENST00000203001.2:c.685C>A	20.37:g.5923415G>T	ENSP00000203001:p.Gln229Lys		B4DUV6|Q76P92|Q9BQV5|Q9ULR7|Q9Y2Z8	Missense_Mutation	SNP	pfam_EIF3_gamma,pirsf_tRNA_m1A_mtfrase	p.Q229K	ENST00000203001.2	37	c.685	CCDS13093.1	20	.	.	.	.	.	.	.	.	.	.	G	26.9	4.784383	0.90282	.	.	ENSG00000089195	ENST00000203001;ENST00000453074	T;T	0.23552	1.9;1.9	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.49525	0.1562	M	0.82323	2.585	0.80722	D	1	D;D	0.69078	0.997;0.992	D;P	0.68621	0.959;0.908	T	0.48614	-0.9020	10	0.06494	T	0.89	-15.6713	16.376	0.83392	0.0:0.0:0.8677:0.1323	.	59;229	B4DUV6;Q9UJA5	.;TRM6_HUMAN	K	229;59	ENSP00000203001:Q229K;ENSP00000392070:Q59K	ENSP00000203001:Q229K	Q	-	1	0	TRMT6	5871415	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.708000	0.74660	2.941000	0.99782	0.655000	0.94253	CAG	TRMT6	-	pfam_EIF3_gamma,pirsf_tRNA_m1A_mtfrase	ENSG00000089195		0.443	TRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT6	HGNC	protein_coding	OTTHUMT00000077889.2		0.00	37	0	G			5923415	-1			no_errors	ENST00000203001	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
TUBB1	81027	genome.wustl.edu	37	20	57599479	57599479	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr20:57599479G>A	ENST00000217133.1	+	4	1266	c.997G>A	c.(997-999)Gtg>Atg	p.V333M		NM_030773.3	NP_110400.1	Q9H4B7	TBB1_HUMAN	tubulin, beta 1 class VI	333					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|skin(2)	16	all_lung(29;0.00711)		Colorectal(105;0.109)		Cabazitaxel(DB06772)|Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	ACTGCTCTCCGTGCAGACCAG	0.627																																																	0													62.0	56.0	58.0					20																	57599479		2203	4300	6503	SO:0001583	missense	0			AJ292757	CCDS13475.1	20q13.32	2014-09-17	2011-10-10		ENSG00000101162	ENSG00000101162		"""Tubulins"""	16257	protein-coding gene	gene with protein product	"""class VI beta-tubulin"""	612901	"""tubulin, beta 1"""				Standard	NM_030773		Approved	dJ543J19.4	uc002yak.3	Q9H4B7	OTTHUMG00000032860	ENST00000217133.1:c.997G>A	20.37:g.57599479G>A	ENSP00000217133:p.Val333Met			Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Gamma_tubulin,prints_Alpha_tubulin	p.V333M	ENST00000217133.1	37	c.997	CCDS13475.1	20	.	.	.	.	.	.	.	.	.	.	G	16.38	3.105961	0.56291	.	.	ENSG00000101162	ENST00000217133	D	0.83075	-1.68	5.41	3.43	0.39272	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.231105	0.46145	D	0.000309	T	0.76162	0.3949	L	0.41710	1.295	0.37057	D	0.897861	B	0.23128	0.08	B	0.26693	0.072	T	0.77534	-0.2552	10	0.87932	D	0	.	10.5732	0.45212	0.2187:0.0:0.7813:0.0	.	333	Q9H4B7	TBB1_HUMAN	M	333	ENSP00000217133:V333M	ENSP00000217133:V333M	V	+	1	0	TUBB1	57032874	0.966000	0.33281	0.835000	0.33067	0.941000	0.58515	1.478000	0.35442	1.286000	0.44565	0.561000	0.74099	GTG	TUBB1	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Gamma_tubulin,prints_Alpha_tubulin	ENSG00000101162		0.627	TUBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB1	HGNC	protein_coding	OTTHUMT00000079903.1	-	0.00	76	0	G	NM_030773		57599479	+1	tier1	-	no_errors	ENST00000217133	ensembl	human	known	74_37	missense	8.97	71	7	SNP	0.938	A
TYMS	7298	genome.wustl.edu	37	18	657939	657939	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr18:657939G>T	ENST00000323274.10	+	1	336	c.197G>T	c.(196-198)aGc>aTc	p.S66I	TYMS_ENST00000323250.5_Missense_Mutation_p.S66I|TYMS_ENST00000323224.7_Missense_Mutation_p.S66I|C18orf56_ENST00000323813.3_Silent_p.G103G|RP11-806L2.5_ENST00000584679.1_RNA|C18orf56_ENST00000585033.1_Silent_p.G103G	NM_001071.2	NP_001062.1	P04818	TYSY_HUMAN	thymidylate synthetase	66					aging (GO:0007568)|cartilage development (GO:0051216)|circadian rhythm (GO:0007623)|deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|developmental growth (GO:0048589)|dTMP biosynthetic process (GO:0006231)|dTTP biosynthetic process (GO:0006235)|dUMP metabolic process (GO:0046078)|G1/S transition of mitotic cell cycle (GO:0000082)|immortalization of host cell by virus (GO:0019088)|intestinal epithelial cell maturation (GO:0060574)|mitotic cell cycle (GO:0000278)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|organ regeneration (GO:0031100)|polysaccharide metabolic process (GO:0005976)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to organophosphorus (GO:0046683)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|response to vitamin A (GO:0033189)|small molecule metabolic process (GO:0044281)|tetrahydrofolate metabolic process (GO:0046653)|uracil metabolic process (GO:0019860)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cofactor binding (GO:0048037)|drug binding (GO:0008144)|folic acid binding (GO:0005542)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|thymidylate synthase activity (GO:0004799)			endometrium(1)|large_intestine(3)|lung(2)|urinary_tract(2)	8					Capecitabine(DB01101)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Leucovorin(DB00650)|Methotrexate(DB00563)|Pemetrexed(DB00642)|Pralatrexate(DB06813)|Raltitrexed(DB00293)|Trifluridine(DB00432)|Trimethoprim(DB00440)	GCGCGCTACAGCCTGAGAGGT	0.731																																																	0													7.0	7.0	7.0					18																	657939		2155	4208	6363	SO:0001583	missense	0			X02308	CCDS11821.1	18p11.31-p11.21	2014-09-17			ENSG00000176890	ENSG00000176890	2.1.1.45		12441	protein-coding gene	gene with protein product		188350		TS			Standard	NM_001071		Approved	Tsase, TMS, HsT422	uc010dka.1	P04818	OTTHUMG00000131473	ENST00000323274.10:c.197G>T	18.37:g.657939G>T	ENSP00000315644:p.Ser66Ile		Q8WYK3|Q8WYK4	Missense_Mutation	SNP	pfam_Thymidylate_synthase,superfamily_Thymidate_synth/dCMP_Mease,prints_Thymidylate_synthase,tigrfam_Thymidylate_synthase	p.S66I	ENST00000323274.10	37	c.197	CCDS11821.1	18	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021028	0.54576	.	.	ENSG00000176890	ENST00000323274;ENST00000323224;ENST00000323250	.	.	.	4.39	-0.743	0.11105	Thymidylate synthase/dCMP hydroxymethylase domain (2);	0.200671	0.64402	D	0.000009	T	0.71626	0.3362	.	.	.	0.58432	D	0.999997	B;P;P	0.52463	0.007;0.848;0.953	B;P;P	0.61397	0.026;0.85;0.888	T	0.71735	-0.4503	8	0.87932	D	0	-14.1687	9.9339	0.41539	0.3819:0.0:0.6181:0.0	.	66;66;66	Q8WYK4;Q8WYK3;P04818	.;.;TYSY_HUMAN	I	66	.	ENSP00000314727:S66I	S	+	2	0	TYMS	647939	1.000000	0.71417	0.982000	0.44146	0.645000	0.38454	2.193000	0.42658	-0.142000	0.11354	-0.259000	0.10710	AGC	TYMS	-	pfam_Thymidylate_synthase,superfamily_Thymidate_synth/dCMP_Mease	ENSG00000176890		0.731	TYMS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYMS	HGNC	protein_coding	OTTHUMT00000254316.1		0.00	45	0	G	NM_001071		657939	+1			no_errors	ENST00000323274	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.999	T
UGT3A2	167127	genome.wustl.edu	37	5	36037942	36037942	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr5:36037942C>T	ENST00000282507.3	-	6	1353	c.1252G>A	c.(1252-1254)Gag>Aag	p.E418K	UGT3A2_ENST00000504954.1_5'Flank|UGT3A2_ENST00000513300.1_Missense_Mutation_p.E384K|UGT3A2_ENST00000545528.1_Missense_Mutation_p.E116K	NM_174914.3	NP_777574.2	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	418					cellular response to genistein (GO:0071412)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)	p.E418*(1)		NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	43	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GCCAATGTCTCTGCCTTGAGC	0.443																																																	1	Substitution - Nonsense(1)	lung(1)											177.0	164.0	168.0					5																	36037942		2203	4300	6503	SO:0001583	missense	0				CCDS3914.1, CCDS54842.1	5p13.2	2014-05-20			ENSG00000168671	ENSG00000168671		"""UDP glucuronosyltransferases"""	27266	protein-coding gene	gene with protein product						12975309	Standard	NM_174914		Approved		uc003jjz.2	Q3SY77	OTTHUMG00000131108	ENST00000282507.3:c.1252G>A	5.37:g.36037942C>T	ENSP00000282507:p.Glu418Lys		B4DUQ7|E9PFK7|Q6UXC4|Q8NBP2	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.E418K	ENST00000282507.3	37	c.1252	CCDS3914.1	5	.	.	.	.	.	.	.	.	.	.	C	15.08	2.727663	0.48833	.	.	ENSG00000168671	ENST00000282507;ENST00000513300;ENST00000545528	T;T;T	0.66995	-0.24;-0.24;3.0	3.18	2.3	0.28687	.	0.000000	0.64402	U	0.000004	T	0.75265	0.3826	M	0.76328	2.33	0.44447	D	0.997376	D;P	0.63046	0.992;0.955	D;P	0.63113	0.911;0.676	T	0.72437	-0.4294	10	0.26408	T	0.33	.	10.257	0.43403	0.0:0.8937:0.0:0.1063	.	384;418	E9PFK7;Q3SY77	.;UD3A2_HUMAN	K	418;384;116	ENSP00000282507:E418K;ENSP00000427404:E384K;ENSP00000445367:E116K	ENSP00000282507:E418K	E	-	1	0	UGT3A2	36073699	0.505000	0.26131	0.905000	0.35620	0.569000	0.35902	1.304000	0.33482	0.888000	0.36160	0.563000	0.77884	GAG	UGT3A2	-	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	ENSG00000168671		0.443	UGT3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT3A2	HGNC	protein_coding	OTTHUMT00000253771.2	-	0.00	78	0	C	NM_174914		36037942	-1	tier1	-	no_errors	ENST00000282507	ensembl	human	known	74_37	missense	14.49	59	10	SNP	0.947	T
USP9X	8239	genome.wustl.edu	37	X	41084051	41084051	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chrX:41084051C>T	ENST00000324545.8	+	40	7441	c.6808C>T	c.(6808-6810)Cca>Tca	p.P2270S	USP9X_ENST00000378308.2_Missense_Mutation_p.P2270S	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	2270					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						ACCTATAATGCCAATTCAGCA	0.348																																					Ovarian(172;1807 2695 35459 49286)												0													106.0	106.0	106.0					X																	41084051		2203	4299	6502	SO:0001583	missense	0			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.6808C>T	X.37:g.41084051C>T	ENSP00000316357:p.Pro2270Ser		O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_ARM-type_fold,pfscan_Peptidase_C19/C67	p.P2270S	ENST00000324545.8	37	c.6808	CCDS43930.1	X	.	.	.	.	.	.	.	.	.	.	C	15.19	2.761096	0.49468	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.03358	3.97;3.96	5.9	5.02	0.67125	.	0.159668	0.56097	D	0.000029	T	0.08223	0.0205	M	0.77103	2.36	0.52099	D	0.999947	B;B	0.21225	0.025;0.053	B;B	0.25614	0.062;0.029	T	0.03175	-1.1064	10	0.46703	T	0.11	.	13.8804	0.63678	0.0:0.7357:0.2643:0.0	.	2270;2270	Q93008-1;Q93008	.;USP9X_HUMAN	S	2270	ENSP00000367558:P2270S;ENSP00000316357:P2270S	ENSP00000316357:P2270S	P	+	1	0	USP9X	40968995	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.889000	0.56212	2.495000	0.84180	0.544000	0.68410	CCA	USP9X	-	NULL	ENSG00000124486		0.348	USP9X-003	KNOWN	basic|CCDS	protein_coding	USP9X	HGNC	protein_coding	OTTHUMT00000056250.4	-	0.00	35	0	C	NM_004652		41084051	+1	tier1	-	no_errors	ENST00000324545	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
WASL	8976	genome.wustl.edu	37	7	123332839	123332841	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	AGG	AGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr7:123332839_123332841delAGG	ENST00000223023.4	-	9	1239_1241	c.907_909delCCT	c.(907-909)cctdel	p.P303del		NM_003941.2	NP_003932.3	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome-like	303	Pro-rich.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cellular protein complex localization (GO:0034629)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane budding (GO:0006900)|mitotic nuclear division (GO:0007067)|nitric oxide metabolic process (GO:0046209)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of filopodium assembly (GO:0051491)|protein complex assembly (GO:0006461)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|response to bacterium (GO:0009617)|small molecule metabolic process (GO:0044281)|spindle localization (GO:0051653)|transcription, DNA-templated (GO:0006351)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	small GTPase regulator activity (GO:0005083)	p.P303A(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TTCCCCTagcaggaggaggagga	0.616																																																	1	Substitution - Missense(1)	kidney(1)																																								SO:0001651	inframe_deletion	0			D88460	CCDS34743.1	7q31.3	2008-02-01			ENSG00000106299	ENSG00000106299			12735	protein-coding gene	gene with protein product		605056				9422512, 9322739	Standard	NM_003941		Approved	N-WASP, NWASP	uc003vkz.3	O00401	OTTHUMG00000157346	ENST00000223023.4:c.907_909delCCT	7.37:g.123332848_123332850delAGG	ENSP00000223023:p.Pro303del		A1JUI9|Q7Z746	In_Frame_Del	DEL	pfam_WH1/EVH1,pfam_CRIB_dom,pfam_WH2_dom,superfamily_WASP_C,smart_WH1/EVH1,smart_CRIB_dom,smart_WH2_dom,pfscan_CRIB_dom,pfscan_WH1/EVH1,pfscan_WH2_dom	p.P303in_frame_del	ENST00000223023.4	37	c.909_907	CCDS34743.1	7																																																																																			WASL	-	superfamily_WASP_C	ENSG00000106299		0.616	WASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WASL	HGNC	protein_coding	OTTHUMT00000348522.1		0.00	52	0	AGG	NM_003941		123332841	-1	tier1		no_errors	ENST00000223023	ensembl	human	known	74_37	in_frame_del	11.36	39	5	DEL	0.996:1.000:1.000	-
WDR27	253769	genome.wustl.edu	37	6	170043854	170043854	+	Silent	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr6:170043854C>T	ENST00000448612.1	-	17	1795	c.1686G>A	c.(1684-1686)ttG>ttA	p.L562L	WDR27_ENST00000423258.1_Silent_p.L435L|WDR27_ENST00000333572.6_Silent_p.L562L|WDR27_ENST00000546525.1_5'UTR	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27	532						nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		GATGGTTGGCCAACCCACAGG	0.418																																																	0													49.0	54.0	52.0					6																	170043854		1873	4093	5966	SO:0001819	synonymous_variant	0			AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.1686G>A	6.37:g.170043854C>T			A5PLM8|C9JGV0|Q5T066	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L562	ENST00000448612.1	37	c.1686	CCDS47520.2	6																																																																																			WDR27	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000184465		0.418	WDR27-010	KNOWN	basic|CCDS	protein_coding	WDR27	HGNC	protein_coding	OTTHUMT00000407334.1	-	0.00	34	0	C	NM_182552		170043854	-1	tier1	-	no_errors	ENST00000448612	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.867	T
CFAP57	149465	genome.wustl.edu	37	1	43675420	43675420	+	Nonsense_Mutation	SNP	C	C	T	rs369556067		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:43675420C>T	ENST00000372492.4	+	11	2086	c.1762C>T	c.(1762-1764)Cga>Tga	p.R588*	WDR65_ENST00000528956.1_Nonsense_Mutation_p.R588*	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		588										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				tcagatCCTTCGAGAGATATC	0.567																																																	0								C	stop/ARG,stop/ARG,stop/ARG	0,4406		0,0,2203	96.0	81.0	86.0		1762,1762,1762	5.9	1.0	1		86	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained,stop-gained,stop-gained	WDR65	NM_001167965.1,NM_001167966.1,NM_152498.3	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	588/699,588/699,588/699	43675420	1,13005	2203	4300	6503	SO:0001587	stop_gained	0																														ENST00000372492.4:c.1762C>T	1.37:g.43675420C>T	ENSP00000361570:p.Arg588*		A6NKQ3|Q17RI9|Q5TAI0	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R588*	ENST00000372492.4	37	c.1762		1	.	.	.	.	.	.	.	.	.	.	c	37	6.121468	0.97300	0.0	1.16E-4	ENSG00000243710	ENST00000372492;ENST00000528956	.	.	.	5.89	5.89	0.94794	.	0.073040	0.52532	D	0.000068	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.265	0.98459	0.0:1.0:0.0:0.0	.	.	.	.	X	588	.	ENSP00000361570:R588X	R	+	1	2	WDR65	43448007	1.000000	0.71417	1.000000	0.80357	0.438000	0.31896	2.293000	0.43558	2.801000	0.96364	0.543000	0.68304	CGA	WDR65	-	superfamily_Quinonprotein_ADH-like_supfam	ENSG00000243710		0.567	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	WDR65	HGNC	protein_coding	OTTHUMT00000384325.1		0.00	39	0	C			43675420	+1			no_errors	ENST00000528956	ensembl	human	known	74_37	nonsense	5.88	32	2	SNP	1.000	T
TSIX	9383	genome.wustl.edu	37	X	73042914	73042914	+	lincRNA	SNP	C	C	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chrX:73042914C>A	ENST00000604411.1	+	0	30875				XIST_ENST00000429829.1_lincRNA	NR_003255.2				TSIX transcript, XIST antisense RNA																		CATATGTCTTCCTGTCTCTAA	0.284																																																	0													56.0	59.0	58.0					X																	73042914		874	1990	2864			0					Xq13.2	2012-10-19	2012-08-15			ENSG00000270641		"""Long non-coding RNAs"", ""-"""	12377	non-coding RNA	RNA, long non-coding	"""XIST antisense RNA (non-protein coding)"", ""long intergenic non-protein coding RNA 13"""	300181	"""X (inactive)-specific transcript, antisense"", ""TSIX transcript, XIST antisense RNA (non-protein coding)"""			10192391	Standard	NR_003255		Approved	NCRNA00013, XIST-AS1, LINC00013	uc004ebn.2				X.37:g.73042914C>A				RNA	SNP	-	NULL	ENST00000604411.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.284	TSIX-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000469120.1	-	0.00	83	0	C	NR_003255		73042914	-1	tier1	-	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	16.22	62	12	SNP	0.012	A
XIST	7503	genome.wustl.edu	37	X	73062049	73062049	+	lincRNA	SNP	C	C	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chrX:73062049C>A	ENST00000429829.1	-	0	10539					NR_001564.2				X inactive specific transcript (non-protein coding)																		TGGCTGTATCCTGGCATTTGG	0.348																																																	0													5.0	5.0	5.0					X																	73062049		830	1891	2721			0			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73062049C>A				RNA	SNP	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.348	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1	-	0.00	34	0	C	NR_001564		73062049	-1	tier1	-	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	22.22	21	6	SNP	0.005	A
YES1	7525	genome.wustl.edu	37	18	745953	745953	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr18:745953G>T	ENST00000584307.1	-	5	739	c.569C>A	c.(568-570)aCt>aAt	p.T190N	YES1_ENST00000314574.4_Missense_Mutation_p.T190N|YES1_ENST00000577961.1_Missense_Mutation_p.T195N			P07947	YES_HUMAN	YES proto-oncogene 1, Src family tyrosine kinase	190	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glucose transport (GO:0015758)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|regulation of vascular permeability (GO:0043114)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)	17					Dasatinib(DB01254)	CATACCTTTAGTTGTTTCACT	0.313																																																	0													38.0	39.0	39.0					18																	745953		2198	4293	6491	SO:0001583	missense	0			M15990	CCDS11824.1	18p11.31-p11.21	2014-06-26	2014-06-26		ENSG00000176105	ENSG00000176105		"""SH2 domain containing"""	12841	protein-coding gene	gene with protein product		164880	"""v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1"""			2983418	Standard	NM_005433		Approved	Yes, c-yes, HsT441	uc002kky.3	P07947	OTTHUMG00000131472	ENST00000584307.1:c.569C>A	18.37:g.745953G>T	ENSP00000462468:p.Thr190Asn		A6NLB3|D3DUH1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.T190N	ENST00000584307.1	37	c.569	CCDS11824.1	18	.	.	.	.	.	.	.	.	.	.	G	22.9	4.347768	0.82022	.	.	ENSG00000176105	ENST00000359834;ENST00000314574	D	0.88741	-2.42	5.7	5.7	0.88788	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.84383	0.5460	N	0.21545	0.675	0.80722	D	1	B	0.13145	0.007	B	0.23716	0.048	T	0.77955	-0.2393	10	0.38643	T	0.18	.	19.8338	0.96646	0.0:0.0:1.0:0.0	.	190	P07947	YES_HUMAN	N	190	ENSP00000324740:T190N	ENSP00000324740:T190N	T	-	2	0	YES1	735953	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.737000	0.98831	2.692000	0.91855	0.591000	0.81541	ACT	YES1	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000176105		0.313	YES1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	YES1	HGNC	protein_coding	OTTHUMT00000440827.2	-	0.00	94	0	G	NM_005433		745953	-1	tier1	-	no_errors	ENST00000314574	ensembl	human	known	74_37	missense	5.95	79	5	SNP	1.000	T
ZC3H11A	9877	genome.wustl.edu	37	1	203799261	203799261	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr1:203799261G>T	ENST00000545588.1	+	7	4457	c.630G>T	c.(628-630)ttG>ttT	p.L210F	ZC3H11A_ENST00000367210.1_Missense_Mutation_p.L210F|ZC3H11A_ENST00000367212.3_Missense_Mutation_p.L210F|ZC3H11A_ENST00000367214.1_Missense_Mutation_p.L210F|ZC3H11A_ENST00000332127.4_Missense_Mutation_p.L210F	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	210					poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GTGAATGTTTGAATTTTGGAA	0.308																																																	0													41.0	48.0	46.0					1																	203799261		2202	4297	6499	SO:0001583	missense	0				CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.630G>T	1.37:g.203799261G>T	ENSP00000438527:p.Leu210Phe		Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Missense_Mutation	SNP	smart_Znf_CCCH	p.L210F	ENST00000545588.1	37	c.630	CCDS30978.1	1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.780709	0.70222	.	.	ENSG00000058673	ENST00000453771;ENST00000367214;ENST00000537080;ENST00000367212;ENST00000332127;ENST00000545588;ENST00000367210	T;T;T;T;T	0.60040	0.22;0.22;0.22;0.22;0.22	5.59	3.73	0.42828	.	0.067185	0.64402	D	0.000008	T	0.69115	0.3075	M	0.72894	2.215	0.53688	D	0.999971	D	0.64830	0.994	P	0.62435	0.902	T	0.68318	-0.5440	10	0.45353	T	0.12	-8.3771	10.1638	0.42868	0.1437:0.0:0.8563:0.0	.	210	O75152	ZC11A_HUMAN	F	210;210;156;210;210;210;210	ENSP00000356183:L210F;ENSP00000356181:L210F;ENSP00000333253:L210F;ENSP00000438527:L210F;ENSP00000356179:L210F	ENSP00000333253:L210F	L	+	3	2	ZC3H11A	202065884	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.803000	0.47924	0.840000	0.34995	0.585000	0.79938	TTG	ZC3H11A	-	NULL	ENSG00000058673		0.308	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H11A	HGNC	protein_coding	OTTHUMT00000087471.3	-	0.00	84	0	G	NM_014827		203799261	+1	tier1	-	no_errors	ENST00000332127	ensembl	human	known	74_37	missense	7.14	78	6	SNP	1.000	T
ZFPM2	23414	genome.wustl.edu	37	8	106811081	106811081	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr8:106811081G>A	ENST00000407775.2	+	7	1119	c.869G>A	c.(868-870)aGt>aAt	p.S290N	ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000509144.2_RNA|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.S158N|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000524045.2_RNA|ZFPM2_ENST00000378472.4_Missense_Mutation_p.S21N|ZFPM2_ENST00000517361.1_Missense_Mutation_p.S158N|RP11-152P17.2_ENST00000520594.1_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	290					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AATGAAGACAGTGCCCATCAG	0.502																																																	0													126.0	131.0	129.0					8																	106811081		2085	4236	6321	SO:0001583	missense	0			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.869G>A	8.37:g.106811081G>A	ENSP00000384179:p.Ser290Asn		Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S290N	ENST00000407775.2	37	c.869	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	G	9.395	1.076464	0.20227	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.19394	2.15;2.62;2.62;3.84	6.06	-0.663	0.11410	.	0.561397	0.21029	N	0.081363	T	0.08802	0.0218	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36163	-0.9759	10	0.16420	T	0.52	.	7.5953	0.28044	0.2979:0.2019:0.5002:0.0	.	290	Q8WW38	FOG2_HUMAN	N	290;158;158;21	ENSP00000384179:S290N;ENSP00000430757:S158N;ENSP00000428720:S158N;ENSP00000367733:S21N	ENSP00000367733:S21N	S	+	2	0	ZFPM2	106880257	0.009000	0.17119	0.059000	0.19551	0.979000	0.70002	0.628000	0.24522	-0.061000	0.13110	0.650000	0.86243	AGT	ZFPM2	-	NULL	ENSG00000169946		0.502	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1		0.00	63	0	G			106811081	+1			no_errors	ENST00000407775	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.001	A
ZFP41	286128	genome.wustl.edu	37	8	144332324	144332324	+	Missense_Mutation	SNP	G	G	T	rs562354410		TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr8:144332324G>T	ENST00000330701.4	+	2	680	c.311G>T	c.(310-312)cGc>cTc	p.R104L	ZFP41_ENST00000520584.1_Missense_Mutation_p.R104L|ZFP41_ENST00000522452.1_Missense_Mutation_p.R104L	NM_173832.4	NP_776193.1	Q8N8Y5	ZFP41_HUMAN	ZFP41 zinc finger protein	104					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|lung(4)|ovary(1)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.6e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GACCACATTCGCCATCAGAGG	0.547																																																	0													87.0	86.0	87.0					8																	144332324		2203	4300	6503	SO:0001583	missense	0				CCDS6397.1	8q24.3	2013-01-08	2012-11-27		ENSG00000181638	ENSG00000181638		"""Zinc fingers, C2H2-type"""	26786	protein-coding gene	gene with protein product			"""zinc finger protein 41 homolog (mouse)"""			11214971	Standard	NM_173832		Approved	FLJ38705, FLJ00028, ZNF753	uc003yxw.4	Q8N8Y5	OTTHUMG00000164951	ENST00000330701.4:c.311G>T	8.37:g.144332324G>T	ENSP00000327427:p.Arg104Leu		D3DWJ5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R104L	ENST00000330701.4	37	c.311	CCDS6397.1	8	.	.	.	.	.	.	.	.	.	.	G	11.87	1.766784	0.31320	.	.	ENSG00000181638	ENST00000520584;ENST00000330701;ENST00000522452	T;T;T	0.13778	2.56;2.56;2.56	3.68	-0.13	0.13498	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05181	0.0138	N	0.16307	0.4	0.09310	N	1	P	0.42827	0.791	B	0.29862	0.108	T	0.39272	-0.9622	9	0.16896	T	0.51	-27.8292	6.4267	0.21773	0.5682:0.0:0.4318:0.0	.	104	Q8N8Y5	ZFP41_HUMAN	L	104	ENSP00000430465:R104L;ENSP00000327427:R104L;ENSP00000428966:R104L	ENSP00000327427:R104L	R	+	2	0	ZFP41	144403699	0.000000	0.05858	0.010000	0.14722	0.815000	0.46073	-1.671000	0.01954	-0.031000	0.13781	0.467000	0.42956	CGC	ZFP41	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181638		0.547	ZFP41-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	ZFP41	HGNC	protein_coding	OTTHUMT00000381114.2		0.00	40	0	G	NM_173832		144332324	+1			no_errors	ENST00000330701	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.023	T
ZMAT5	55954	genome.wustl.edu	37	22	30144477	30144477	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr22:30144477G>T	ENST00000344318.3	-	2	173	c.57C>A	c.(55-57)caC>caA	p.H19Q	ZMAT5_ENST00000397781.3_Missense_Mutation_p.H19Q	NM_001003692.1	NP_001003692.1	Q9UDW3	ZMAT5_HUMAN	zinc finger, matrin-type 5	19					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(5;0.000597)|all cancers(5;0.0534)|Epithelial(10;0.0574)			TCTTGCGGTTGTGGAGGTTGT	0.607																																																	0													147.0	121.0	130.0					22																	30144477		2203	4300	6503	SO:0001583	missense	0				CCDS13868.1	22q12.2	2013-09-20	2010-09-15		ENSG00000100319	ENSG00000100319		"""Zinc fingers, matrin-type"""	28046	protein-coding gene	gene with protein product	"""U11/U12 snRNP 20K"""					9847074	Standard	NM_019103		Approved	SNRNP20	uc003agn.3	Q9UDW3	OTTHUMG00000151292	ENST00000344318.3:c.57C>A	22.37:g.30144477G>T	ENSP00000344241:p.His19Gln		A8K9F6	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_Znf_U1-C,smart_Znf_CCCH	p.H19Q	ENST00000344318.3	37	c.57	CCDS13868.1	22	.	.	.	.	.	.	.	.	.	.	G	17.84	3.489011	0.64074	.	.	ENSG00000100319	ENST00000344318;ENST00000397781	.	.	.	5.36	4.35	0.52113	Zinc finger, U1-C type (1);	0.000000	0.85682	D	0.000000	T	0.62853	0.2462	L	0.35723	1.085	0.58432	D	0.999995	D	0.76494	0.999	D	0.72338	0.977	T	0.57648	-0.7775	9	0.21540	T	0.41	-37.1746	11.4869	0.50358	0.0834:0.0:0.9166:0.0	.	19	Q9UDW3	ZMAT5_HUMAN	Q	19	.	ENSP00000344241:H19Q	H	-	3	2	ZMAT5	28474477	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	3.750000	0.55157	1.270000	0.44297	-0.350000	0.07774	CAC	ZMAT5	-	pfam_Znf_U1-C	ENSG00000100319		0.607	ZMAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMAT5	HGNC	protein_coding	OTTHUMT00000322114.1	-	0.00	53	0	G	NM_019103		30144477	-1	tier1	-	no_errors	ENST00000344318	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
ZNF192P1	651302	genome.wustl.edu	37	6	28134339	28134339	+	RNA	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr6:28134339G>T	ENST00000440790.2	+	0	442					NR_103448.1				zinc finger protein 192 pseudogene 1																		TTCTAAGGATGGACCCACACC	0.413																																																	0													33.0	31.0	31.0					6																	28134339		692	1591	2283			0					6p22.1	2012-10-05	2011-08-31	2011-08-31	ENSG00000226314	ENSG00000226314			18777	pseudogene	pseudogene	"""zinc finger protein 389, pseudogene"""		"""zinc finger protein 389"""	ZNF389			Standard	NR_103448		Approved	dJ265C24.4, ZNF389P	uc021yrq.2		OTTHUMG00000014513		6.37:g.28134339G>T				RNA	SNP	-	NULL	ENST00000440790.2	37	NULL		6																																																																																			ZNF192P1	-	-	ENSG00000226314		0.413	ZNF192P1-001	KNOWN	basic	processed_transcript	ZNF192P1	HGNC	pseudogene	OTTHUMT00000040181.1	-	0.00	35	0	G			28134339	+1	tier1	-	no_errors	ENST00000440790	ensembl	human	known	74_37	rna	11.11	32	4	SNP	0.021	T
ZNF287	57336	genome.wustl.edu	37	17	16456419	16456419	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr17:16456419C>T	ENST00000395824.1	-	6	1654	c.1037G>A	c.(1036-1038)aGg>aAg	p.R346K	ZNF287_ENST00000395825.3_Missense_Mutation_p.R346K			Q9HBT7	ZN287_HUMAN	zinc finger protein 287	339					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|prostate(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (92;0.083)		GAAGGTTGCCCTGCCTTCATT	0.308																																																	0													72.0	69.0	70.0					17																	16456419		2203	4300	6503	SO:0001583	missense	0			AF217227	CCDS11179.2	17p11.2	2013-01-09			ENSG00000141040	ENSG00000141040		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13502	protein-coding gene	gene with protein product							Standard	NM_020653		Approved	ZKSCAN13, ZSCAN45	uc002gqi.2	Q9HBT7	OTTHUMG00000058993	ENST00000395824.1:c.1037G>A	17.37:g.16456419C>T	ENSP00000379168:p.Arg346Lys		Q6IAG1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.R346K	ENST00000395824.1	37	c.1037	CCDS11179.2	17	.	.	.	.	.	.	.	.	.	.	C	1.772	-0.484178	0.04383	.	.	ENSG00000141040	ENST00000395825;ENST00000395824	T;T	0.04758	3.56;3.56	5.31	0.388	0.16264	.	0.556823	0.17630	N	0.167434	T	0.01835	0.0058	N	0.03608	-0.345	0.21147	N	0.999779	B	0.02656	0.0	B	0.01281	0.0	T	0.43442	-0.9391	10	0.37606	T	0.19	.	2.717	0.05190	0.3464:0.2528:0.0:0.4008	.	339	Q9HBT7	ZN287_HUMAN	K	346	ENSP00000379169:R346K;ENSP00000379168:R346K	ENSP00000379168:R346K	R	-	2	0	ZNF287	16397144	0.001000	0.12720	0.006000	0.13384	0.003000	0.03518	0.200000	0.17257	-0.001000	0.14495	0.650000	0.86243	AGG	ZNF287	-	NULL	ENSG00000141040		0.308	ZNF287-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF287	HGNC	protein_coding	OTTHUMT00000130504.1	-	0.00	50	0	C			16456419	-1	tier1	-	no_errors	ENST00000395824	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.798	T
ZNF397	84307	genome.wustl.edu	37	18	32822582	32822582	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr18:32822582C>G	ENST00000330501.7	+	2	301	c.148C>G	c.(148-150)Cgt>Ggt	p.R50G	ZNF397_ENST00000591206.1_Missense_Mutation_p.R50G|ZNF397_ENST00000261333.6_Missense_Mutation_p.R50G|ZNF397_ENST00000589420.1_Intron|ZNF397_ENST00000585800.1_Missense_Mutation_p.R50G|ZNF397_ENST00000355632.4_Missense_Mutation_p.R50G|ZNF397_ENST00000592264.1_Missense_Mutation_p.R50G	NM_001135178.2	NP_001128650.1	Q8NF99	ZN397_HUMAN	zinc finger protein 397	50	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)	12						AGAATTGTTTCGTCAGCAATT	0.453																																																	0													53.0	59.0	57.0					18																	32822582		2203	4300	6503	SO:0001583	missense	0			BC006172	CCDS32814.1, CCDS45852.1	18p12	2013-01-09	2003-07-22			ENSG00000186812		"""-"", ""Zinc fingers, C2H2-type"""	18818	protein-coding gene	gene with protein product		609601	"""zinc finger protein 47"""	ZNF47			Standard	NM_032347		Approved	ZSCAN15, MGC13250	uc010dmp.3	Q8NF99		ENST00000330501.7:c.148C>G	18.37:g.32822582C>G	ENSP00000331577:p.Arg50Gly		Q9BRM2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R50G	ENST00000330501.7	37	c.148	CCDS45852.1	18	.	.	.	.	.	.	.	.	.	.	C	18.11	3.550495	0.65311	.	.	ENSG00000186812	ENST00000261333;ENST00000330501;ENST00000355632	T;T;T	0.07688	3.17;3.17;3.17	4.19	4.19	0.49359	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.34460	N	0.003941	T	0.43612	0.1255	H	0.98629	4.285	0.34323	D	0.686859	D;D;D;D	0.71674	0.997;0.997;0.996;0.998	D;D;D;D	0.81914	0.995;0.961;0.992;0.95	T	0.70439	-0.4871	10	0.87932	D	0	.	12.2995	0.54866	0.0:1.0:0.0:0.0	.	50;50;50;50	Q96K65;Q8NF99;Q8NF99-2;Q8NF99-3	.;ZN397_HUMAN;.;.	G	50	ENSP00000261333:R50G;ENSP00000331577:R50G;ENSP00000347850:R50G	ENSP00000261333:R50G	R	+	1	0	ZNF397	31076580	0.999000	0.42202	0.999000	0.59377	0.948000	0.59901	0.848000	0.27710	2.620000	0.88729	0.591000	0.81541	CGT	ZNF397	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000186812		0.453	ZNF397-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF397	HGNC	protein_coding	OTTHUMT00000442398.1	-	0.00	61	0	C	NM_032347		32822582	+1	tier1	-	no_errors	ENST00000330501	ensembl	human	known	74_37	missense	9.26	49	5	SNP	1.000	G
ZNF547	284306	genome.wustl.edu	37	19	57888904	57888904	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr19:57888904G>T	ENST00000282282.3	+	4	710	c.560G>T	c.(559-561)aGc>aTc	p.S187I	AC003002.4_ENST00000597658.1_Intron	NM_173631.2	NP_775902.2	Q8IVP9	ZN547_HUMAN	zinc finger protein 547	187					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TATAAGTGCAGCAAATGTGGG	0.418																																																	0													77.0	75.0	76.0					19																	57888904		2203	4300	6503	SO:0001583	missense	0			AK055662	CCDS33131.1	19q13.43	2013-01-08				ENSG00000152433		"""Zinc fingers, C2H2-type"", ""-"""	26432	protein-coding gene	gene with protein product							Standard	NM_173631		Approved	FLJ31100	uc002qol.3	Q8IVP9		ENST00000282282.3:c.560G>T	19.37:g.57888904G>T	ENSP00000282282:p.Ser187Ile		A8K5Z9|Q96NC4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S187I	ENST00000282282.3	37	c.560	CCDS33131.1	19	.	.	.	.	.	.	.	.	.	.	G	14.15	2.448673	0.43531	.	.	ENSG00000152433	ENST00000391704;ENST00000282282	T	0.19105	2.17	1.87	-2.95	0.05564	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32255	0.0823	L	0.54323	1.7	0.09310	N	1	D;D;D	0.76494	0.994;0.999;0.995	P;D;P	0.69824	0.899;0.966;0.892	T	0.17684	-1.0361	9	0.49607	T	0.09	.	5.9155	0.19052	0.2535:0.5079:0.2386:0.0	.	187;187;187	Q8IVP9-2;C9JTQ3;Q8IVP9	.;.;ZN547_HUMAN	I	187	ENSP00000282282:S187I	ENSP00000282282:S187I	S	+	2	0	ZNF547	62580716	0.000000	0.05858	0.000000	0.03702	0.572000	0.35998	-5.996000	0.00086	-0.537000	0.06290	0.491000	0.48974	AGC	ZNF547	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000152433		0.418	ZNF547-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF547	HGNC	protein_coding	OTTHUMT00000465787.1		0.00	64	0	G	NM_173631		57888904	+1			no_errors	ENST00000282282	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.000	T
ZNF736	728927	genome.wustl.edu	37	7	63808652	63808652	+	Silent	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr7:63808652G>A	ENST00000423484.2	+	4	533	c.411G>A	c.(409-411)ttG>ttA	p.L137L	ZNF736_ENST00000355095.4_Silent_p.L137L			B4DX44	ZN736_HUMAN	zinc finger protein 736	137					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|stomach(1)|urinary_tract(1)	9						ATCAATGTTTGTCAGCTACCC	0.373																																																	0													151.0	124.0	132.0					7																	63808652		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS55114.1	7q11.21	2013-01-08			ENSG00000234444	ENSG00000234444		"""Zinc fingers, C2H2-type"", ""-"""	32467	protein-coding gene	gene with protein product							Standard	XM_006716104		Approved		uc011kdo.2	B4DX44	OTTHUMG00000156537	ENST00000423484.2:c.411G>A	7.37:g.63808652G>A				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L137	ENST00000423484.2	37	c.411	CCDS55114.1	7																																																																																			ZNF736	-	NULL	ENSG00000234444		0.373	ZNF736-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF736	HGNC	protein_coding	OTTHUMT00000344559.2	-	0.00	69	0	G	NM_001170905		63808652	+1	tier1	-	no_errors	ENST00000355095	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.002	A
ZNF775	285971	genome.wustl.edu	37	7	150093717	150093717	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr7:150093717G>A	ENST00000329630.5	+	3	255	c.148G>A	c.(148-150)Ggc>Agc	p.G50S		NM_173680.3	NP_775951.2	Q96BV0	ZN775_HUMAN	zinc finger protein 775	50					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(7)|skin(1)	11	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.0173)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCAGCACCGGGGCCTCCCGCC	0.672																																																	0													11.0	15.0	14.0					7																	150093717		1978	4136	6114	SO:0001583	missense	0			BC038111	CCDS43678.1	7q36.1	2013-01-08			ENSG00000196456	ENSG00000196456		"""Zinc fingers, C2H2-type"""	28501	protein-coding gene	gene with protein product						12477932	Standard	NM_173680		Approved	MGC33584	uc003whf.1	Q96BV0	OTTHUMG00000158324	ENST00000329630.5:c.148G>A	7.37:g.150093717G>A	ENSP00000330838:p.Gly50Ser		Q8IY24	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G50S	ENST00000329630.5	37	c.148	CCDS43678.1	7	.	.	.	.	.	.	.	.	.	.	G	6.386	0.439286	0.12104	.	.	ENSG00000196456	ENST00000478789;ENST00000329630;ENST00000490973	T;T;T	0.08720	3.94;3.06;3.26	4.74	-1.49	0.08718	.	.	.	.	.	T	0.05823	0.0152	N	0.19112	0.55	0.09310	N	1	B	0.15473	0.013	B	0.10450	0.005	T	0.37798	-0.9690	9	0.66056	D	0.02	.	9.7292	0.40350	0.4898:0.0:0.5102:0.0	.	50	Q96BV0	ZN775_HUMAN	S	50	ENSP00000419336:G50S;ENSP00000330838:G50S;ENSP00000417483:G50S	ENSP00000330838:G50S	G	+	1	0	ZNF775	149724650	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.083000	0.14871	-0.229000	0.09854	0.561000	0.74099	GGC	ZNF775	-	NULL	ENSG00000196456		0.672	ZNF775-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF775	HGNC	protein_coding	OTTHUMT00000350679.1		0.00	39	0	G	NM_173680		150093717	+1			no_errors	ENST00000329630	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.000	A
ZNF804A	91752	genome.wustl.edu	37	2	185802855	185802855	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr2:185802855C>A	ENST00000302277.6	+	4	3326	c.2732C>A	c.(2731-2733)tCc>tAc	p.S911Y		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	911							metal ion binding (GO:0046872)	p.S911Y(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TCAGATGTTTCCAATGATCCC	0.403																																																	1	Substitution - Missense(1)	prostate(1)											91.0	87.0	88.0					2																	185802855		2203	4300	6503	SO:0001583	missense	0			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2732C>A	2.37:g.185802855C>A	ENSP00000303252:p.Ser911Tyr		A7E253|Q6ZN26	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.S911Y	ENST00000302277.6	37	c.2732	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	C	9.027	0.986376	0.18889	.	.	ENSG00000170396	ENST00000302277	T	0.06687	3.27	5.57	4.5	0.54988	.	0.348482	0.25047	N	0.033542	T	0.06645	0.0170	L	0.29908	0.895	0.09310	N	1	P	0.41947	0.766	B	0.37047	0.24	T	0.28427	-1.0044	10	0.87932	D	0	-1.96	9.9012	0.41348	0.0:0.79:0.0:0.21	.	911	Q7Z570	Z804A_HUMAN	Y	911	ENSP00000303252:S911Y	ENSP00000303252:S911Y	S	+	2	0	ZNF804A	185511100	0.002000	0.14202	0.036000	0.18154	0.017000	0.09413	1.132000	0.31418	2.613000	0.88420	0.591000	0.81541	TCC	ZNF804A	-	NULL	ENSG00000170396		0.403	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	HGNC	protein_coding	OTTHUMT00000255871.1		0.00	45	0	C	NM_194250		185802855	+1			no_errors	ENST00000302277	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.001	A
ZNF829	374899	genome.wustl.edu	37	19	37382574	37382574	+	Silent	SNP	G	G	T			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr19:37382574G>T	ENST00000391711.3	-	6	1483	c.1119C>A	c.(1117-1119)atC>atA	p.I373I	ZNF345_ENST00000526123.1_Intron|ZNF829_ENST00000520965.1_Silent_p.I454I|ZNF345_ENST00000432005.2_Intron	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	373					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CATCTGTATGGATTCTCTGAT	0.378																																																	0																																										SO:0001819	synonymous_variant	0			BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.1119C>A	19.37:g.37382574G>T			Q3KNS7|Q6ZNN0|Q7Z657	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I454	ENST00000391711.3	37	c.1362	CCDS42557.1	19																																																																																			ZNF829	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000185869		0.378	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF829	HGNC	protein_coding	OTTHUMT00000109575.3	-	0.00	68	0	G	NM_001037232		37382574	-1	tier1	-	no_errors	ENST00000520965	ensembl	human	known	74_37	silent	5.00	76	4	SNP	1.000	T
ZSCAN9	7746	genome.wustl.edu	37	6	28200447	28200447	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A939-01A-12D-A37C-09	TCGA-JY-A939-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e215fdc7-0015-459e-915c-b51c6b2106e4	7efc7e5e-31ae-45cd-a03a-936dd92b52ef	g.chr6:28200447C>A	ENST00000252207.5	+	4	824	c.676C>A	c.(676-678)Cag>Aag	p.Q226K	ZSCAN9_ENST00000425468.2_Missense_Mutation_p.Q277K|ZSCAN9_ENST00000531979.1_Missense_Mutation_p.Q226K	NM_006299.4	NP_006290.1	O15535	ZSC9_HUMAN	zinc finger and SCAN domain containing 9	226					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GGAGGTATCACAGCAGGATCC	0.468																																																	0													78.0	67.0	71.0					6																	28200447		2203	4300	6503	SO:0001583	missense	0			U62392	CCDS4646.1, CCDS56407.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000137185	ENSG00000137185		"""-"", ""Zinc fingers, C2H2-type"""	12984	protein-coding gene	gene with protein product		602246	"""zinc finger protein 193"""	ZNF193			Standard	NM_001199479		Approved	PRD51	uc003nkq.2	O15535	OTTHUMG00000014515	ENST00000252207.5:c.676C>A	6.37:g.28200447C>A	ENSP00000252207:p.Gln226Lys		B4E1W6|E7EVQ2|Q2TTR1	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.Q226K	ENST00000252207.5	37	c.676	CCDS4646.1	6	.	.	.	.	.	.	.	.	.	.	C	10.10	1.256981	0.22965	.	.	ENSG00000137185	ENST00000425468;ENST00000252207;ENST00000531979;ENST00000527844	T;T;T;T	0.06218	3.33;3.38;3.38;3.46	4.36	2.34	0.29019	.	.	.	.	.	T	0.00784	0.0026	N	0.08118	0	0.09310	N	0.999999	B;B	0.14438	0.005;0.01	B;B	0.12156	0.007;0.003	T	0.46992	-0.9151	9	0.07644	T	0.81	.	7.1322	0.25508	0.0:0.6511:0.0:0.3489	.	277;226	E7EVQ2;O15535	.;ZN193_HUMAN	K	277;226;226;255	ENSP00000404074:Q277K;ENSP00000252207:Q226K;ENSP00000433402:Q226K;ENSP00000436166:Q255K	ENSP00000252207:Q226K	Q	+	1	0	ZNF193	28308426	0.000000	0.05858	0.001000	0.08648	0.941000	0.58515	-0.147000	0.10234	0.443000	0.26582	0.655000	0.94253	CAG	ZSCAN9	-	NULL	ENSG00000137185		0.468	ZSCAN9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZSCAN9	HGNC	protein_coding	OTTHUMT00000040183.2	-	0.00	43	0	C	NM_006299		28200447	+1	tier1	-	no_errors	ENST00000252207	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.001	A
