#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AAK1	22848	genome.wustl.edu	37	2	69732760	69732760	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr2:69732760G>T	ENST00000409085.4	-	16	2586	c.2210C>A	c.(2209-2211)cCa>cAa	p.P737Q	AAK1_ENST00000409068.1_Intron|AAK1_ENST00000406297.3_Missense_Mutation_p.P737Q	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	737					endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						TTGAAAGCCTGGGATCAAACT	0.483																																																	0													86.0	84.0	85.0					2																	69732760		1898	4114	6012	SO:0001583	missense	0			AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.2210C>A	2.37:g.69732760G>T	ENSP00000386456:p.Pro737Gln		Q4ZFZ3|Q53RX6|Q9UPV4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P737Q	ENST00000409085.4	37	c.2210	CCDS1893.2	2	.	.	.	.	.	.	.	.	.	.	G	18.89	3.718681	0.68844	.	.	ENSG00000115977	ENST00000409085;ENST00000406297	T;T	0.30182	1.54;1.54	5.67	5.67	0.87782	.	0.055628	0.64402	D	0.000001	T	0.47040	0.1424	L	0.32530	0.975	0.47862	D	0.999537	D;D;D	0.89917	0.983;0.99;1.0	P;P;D	0.80764	0.799;0.901;0.994	T	0.39440	-0.9614	10	0.59425	D	0.04	-10.121	18.3583	0.90365	0.0:0.0:1.0:0.0	.	737;737;737	B7ZLC4;Q2M2I8-2;Q2M2I8	.;.;AAK1_HUMAN	Q	737	ENSP00000386456:P737Q;ENSP00000385181:P737Q	ENSP00000385181:P737Q	P	-	2	0	AAK1	69586264	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.845000	0.55880	2.675000	0.91044	0.655000	0.94253	CCA	AAK1	-	NULL	ENSG00000115977		0.483	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AAK1	HGNC	protein_coding	OTTHUMT00000251847.4	-	0.00	75	0	G	NM_014911		69732760	-1	tier1	-	no_errors	ENST00000409085	ensembl	human	known	74_37	missense	20.41	39	10	SNP	1.000	T
ACTL6A	86	genome.wustl.edu	37	3	179305771	179305771	+	Silent	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:179305771G>A	ENST00000429709.2	+	14	1476	c.1263G>A	c.(1261-1263)aaG>aaA	p.K421K	ACTL6A_ENST00000450518.2_Silent_p.K379K|ACTL6A_ENST00000392662.1_Silent_p.K379K	NM_004301.3	NP_004292.1	O96019	ACL6A_HUMAN	actin-like 6A	421					ATP-dependent chromatin remodeling (GO:0043044)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|nervous system development (GO:0007399)|neural retina development (GO:0003407)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|npBAF complex (GO:0071564)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	21	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			AAGGAGGGAAGCAGTGTGTAG	0.363																																																	0													87.0	105.0	99.0					3																	179305771		2203	4300	6503	SO:0001819	synonymous_variant	0			AK098691	CCDS3231.1, CCDS43174.1	3q26.33	2011-07-06			ENSG00000136518	ENSG00000136518		"""INO80 complex subunits"""	24124	protein-coding gene	gene with protein product	"""BAF complex 53 kDa subunit"", ""BRG1-associated factor"", ""actin-related protein 4"", ""INO80 complex subunit K"""	604958				9845365, 10380635	Standard	NM_004301		Approved	Actl6, BAF53A, Arp4, Baf53a, INO80K	uc003fjw.3	O96019	OTTHUMG00000157782	ENST00000429709.2:c.1263G>A	3.37:g.179305771G>A			B3KMN1|D3DNR9|Q8TAE5|Q9BVS8|Q9H0W6	Silent	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.K421	ENST00000429709.2	37	c.1263	CCDS3231.1	3																																																																																			ACTL6A	-	pfam_Actin-related,smart_Actin-related	ENSG00000136518		0.363	ACTL6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL6A	HGNC	protein_coding	OTTHUMT00000349599.1	-	0.00	39	0	G	NM_004301		179305771	+1	tier1	-	no_errors	ENST00000429709	ensembl	human	known	74_37	silent	46.67	16	14	SNP	1.000	A
ADAM6	8755	genome.wustl.edu	37	14	106436793	106436793	+	lincRNA	SNP	C	C	T	rs541434788		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr14:106436793C>T	ENST00000452053.1	-	0	867					NR_002224.2				ADAM metallopeptidase domain 6, pseudogene																		TAAACGTTTGCGGGACATGTC	0.512													.|||	1	0.000199681	0.0008	0.0	5008	,	,		10345	0.0		0.0	False		,,,				2504	0.0																0																																												0			AI024595		14q32.33	2013-09-05	2012-08-22		ENSG00000233988	ENSG00000271968		"""ADAM metallopeptidase domain containing"""	213	pseudogene	pseudogene			"""chromosome 14 open reading frame 96"", ""a disintegrin and metalloproteinase domain 6"", ""ADAM metallopeptidase domain 6"""	C14orf96			Standard	NR_002224		Approved	tMDCIV	uc001ysu.1		OTTHUMG00000152319		14.37:g.106436793C>T				RNA	SNP	-	NULL	ENST00000452053.1	37	NULL		14																																																																																			ADAM6	-	-	ENSG00000233988		0.512	ADAM6-001	KNOWN	basic	lincRNA	ADAM6	HGNC	lincRNA	OTTHUMT00000325881.1	-	0.00	20	0	C	NR_002224		106436793	-1	tier1	-	no_errors	ENST00000452053	ensembl	human	known	74_37	rna	41.67	7	5	SNP	0.000	T
ADGB	79747	genome.wustl.edu	37	6	147042619	147042619	+	Missense_Mutation	SNP	G	G	T	rs201252634		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr6:147042619G>T	ENST00000397944.3	+	17	2149	c.2073G>T	c.(2071-2073)ttG>ttT	p.L691F	ADGB_ENST00000367493.3_Missense_Mutation_p.L110F	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	691					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						TTTCTGCATTGGTACGCTGGG	0.448																																																	0													213.0	199.0	203.0					6																	147042619		692	1591	2283	SO:0001583	missense	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.2073G>T	6.37:g.147042619G>T	ENSP00000381036:p.Leu691Phe		Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,superfamily_Globin-like,smart_Peptidase_C2_calpain_cat,pfscan_IQ_motif_EF-hand-BS,pfscan_Peptidase_C2_calpain_cat	p.L691F	ENST00000397944.3	37	c.2073		6	.	.	.	.	.	.	.	.	.	.	G	19.02	3.746156	0.69418	.	.	ENSG00000118492	ENST00000397944;ENST00000367493	T	0.54866	0.55	5.69	3.89	0.44902	.	0.000000	0.64402	D	0.000017	T	0.46502	0.1396	M	0.73962	2.25	0.36993	D	0.894881	D	0.58268	0.982	P	0.51945	0.685	T	0.54774	-0.8243	10	0.72032	D	0.01	-3.1311	6.0824	0.19948	0.165:0.1567:0.6783:0.0	.	691	Q8N7X0	CAN7L_HUMAN	F	691;110	ENSP00000381036:L691F	ENSP00000356463:L110F	L	+	3	2	C6orf103	147084312	1.000000	0.71417	0.992000	0.48379	0.992000	0.81027	2.833000	0.48159	0.741000	0.32674	0.655000	0.94253	TTG	ADGB	-	NULL	ENSG00000118492		0.448	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	HGNC	protein_coding	OTTHUMT00000376350.2	-	0.00	66	0	G	NM_024694		147042619	+1	tier1	-	no_errors	ENST00000397944	ensembl	human	known	74_37	missense	40.38	31	21	SNP	1.000	T
AFF2	2334	genome.wustl.edu	37	X	147891443	147891443	+	Splice_Site	SNP	G	G	A	rs368578550		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chrX:147891443G>A	ENST00000370460.2	+	4	1564	c.1085G>A	c.(1084-1086)cGg>cAg	p.R362Q	AFF2_ENST00000370458.1_Splice_Site_p.R358Q|AFF2_ENST00000370457.5_Splice_Site_p.R358Q|AFF2_ENST00000342251.3_Splice_Site_p.R358Q|AFF2_ENST00000286437.5_Splice_Site_p.R32Q	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	362					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.R362Q(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					GAAATCTTGCGGGTGAGTTTA	0.338																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)						G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	1,3834		0,0,1,1632,570	202.0	173.0	183.0		1073,1073,1085,1073,95,1085	5.0	1.0	X		183	0,6728		0,0,0,2428,1872	no	missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice	AFF2	NM_001169122.1,NM_001169123.1,NM_001169124.1,NM_001169125.1,NM_001170628.1,NM_002025.3	43,43,43,43,43,43	0,0,1,4060,2442	AA,AG,A,GG,G		0.0,0.0261,0.0095	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	358/1277,358/1302,362/1277,358/1273,32/953,362/1312	147891443	1,10562	2203	4300	6503	SO:0001630	splice_region_variant	0			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1086+1G>A	X.37:g.147891443G>A			A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.R362Q	ENST00000370460.2	37	c.1085	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	G	25.2	4.616088	0.87359	2.61E-4	0.0	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458;ENST00000286437	T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;0.02	5.87	5.01	0.66863	.	0.141084	0.45606	D	0.000353	T	0.74966	0.3786	L	0.39245	1.2	0.42575	D	0.993197	B;B;B;B;B;B;D	0.89917	0.04;0.032;0.032;0.032;0.032;0.04;1.0	B;B;B;B;B;B;D	0.81914	0.028;0.016;0.016;0.016;0.016;0.028;0.995	T	0.77351	-0.2620	10	0.66056	D	0.02	.	14.2101	0.65759	0.0731:0.0:0.9269:0.0	.	32;362;358;358;358;362;358	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;.;AFF2_HUMAN;.	Q	362;358;358;358;32	ENSP00000359489:R362Q;ENSP00000359486:R358Q;ENSP00000345459:R358Q;ENSP00000359487:R358Q;ENSP00000286437:R32Q	ENSP00000286437:R32Q	R	+	2	0	AFF2	147699135	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.877000	0.75562	1.247000	0.43917	-0.191000	0.12829	CGG	AFF2	-	pfam_TF_AF4/FMR2	ENSG00000155966		0.338	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	HGNC	protein_coding	OTTHUMT00000058673.2	-	0.00	63	0	G	NM_002025	Missense_Mutation	147891443	+1	tier1	-	no_errors	ENST00000370460	ensembl	human	known	74_37	missense	82.46	10	47	SNP	1.000	A
AGRN	375790	genome.wustl.edu	37	1	981861	981861	+	Frame_Shift_Del	DEL	C	C	-			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:981861delC	ENST00000379370.2	+	18	3046	c.2996delC	c.(2995-2997)gccfs	p.A999fs		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	999	Ser/Thr-rich.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		GCACTGCCGGCCCCCCCCGGC	0.701																																																	0										75,129,3992		3,0,69,2,125,1899	13.0	16.0	15.0			-4.9	0.0	1		15	87,176,7897		1,0,85,1,174,3819	no	codingComplex	AGRN	NM_198576.3		4,0,154,3,299,5718	A1A1,A1A2,A1R,A2A2,A2R,RR		3.223,4.8618,3.7795			981861	162,305,11889	2192	4284	6476	SO:0001589	frameshift_variant	0			XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.2996delC	1.37:g.981861delC	ENSP00000368678:p.Ala999fs		Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Frame_Shift_Del	DEL	pfam_Laminin_G,pfam_Agrin_NtA,pfam_Kazal_dom,pfam_EGF_laminin,pfam_SEA_dom,pfam_EG-like_dom,superfamily_TIMP-like_OB-fold,superfamily_ConA-like_lec_gl_sf,smart_FacI_MAC,smart_Fol_N,smart_Kazal_dom,smart_EG-like_dom,smart_EGF_laminin,smart_SEA_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Agrin_NtA,pfscan_SEA_dom	p.G1002fs	ENST00000379370.2	37	c.2996	CCDS30551.1	1																																																																																			AGRN	-	NULL	ENSG00000188157		0.701	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGRN	HGNC	protein_coding	OTTHUMT00000097990.2		0.00	68	0	C	NM_198576		981861	+1	tier1		no_errors	ENST00000379370	ensembl	human	known	74_37	frame_shift_del	6.90	27	2	DEL	0.000	-
AHDC1	27245	genome.wustl.edu	37	1	27877292	27877292	+	Silent	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:27877292C>T	ENST00000247087.5	-	5	1931	c.1335G>A	c.(1333-1335)ccG>ccA	p.P445P	AHDC1_ENST00000374011.2_Silent_p.P445P			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	445	Pro-rich.						DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GGACTGAGACCGGGCCTGGGC	0.692																																																	0													6.0	7.0	7.0					1																	27877292		2148	4205	6353	SO:0001819	synonymous_variant	0			AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.1335G>A	1.37:g.27877292C>T			Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Silent	SNP	NULL	p.P445	ENST00000247087.5	37	c.1335	CCDS30652.1	1																																																																																			AHDC1	-	NULL	ENSG00000126705		0.692	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHDC1	HGNC	protein_coding	OTTHUMT00000009523.3	-	0.00	12	0	C			27877292	-1	tier1	-	no_errors	ENST00000247087	ensembl	human	known	74_37	silent	36.36	7	4	SNP	0.819	T
AK2	204	genome.wustl.edu	37	1	33476313	33476313	+	3'UTR	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:33476313C>T	ENST00000373449.2	-	0	857				AK2_ENST00000491241.1_5'UTR|RP1-117O3.2_ENST00000427524.1_RNA|AK2_ENST00000548033.1_3'UTR	NM_001199199.1|NM_013411.4	NP_001186128.1|NP_037543.1			adenylate kinase 2											kidney(1)|large_intestine(2)|lung(4)|skin(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				GAGCCCCTCACCAGCCCTCCC	0.512																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U84371	CCDS373.1, CCDS374.1	1p35.1	2014-09-17			ENSG00000004455	ENSG00000004455	2.7.4.3	"""Adenylate kinases"""	362	protein-coding gene	gene with protein product		103020				8843353, 6961883	Standard	NM_013411		Approved		uc001bwp.2	P54819	OTTHUMG00000004131	ENST00000373449.2:c.*117G>A	1.37:g.33476313C>T				RNA	SNP	-	NULL	ENST00000373449.2	37	NULL	CCDS373.1	1																																																																																			AK2	-	-	ENSG00000004455		0.512	AK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AK2	HGNC	protein_coding	OTTHUMT00000011884.1	-	0.00	112	0	C	NM_001625		33476313	-1	tier1	-	no_errors	ENST00000491241	ensembl	human	known	74_37	rna	19.40	54	13	SNP	0.095	T
AKR1A1	10327	genome.wustl.edu	37	1	46034257	46034257	+	Missense_Mutation	SNP	G	G	A	rs572719037		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:46034257G>A	ENST00000372070.3	+	7	1400	c.653G>A	c.(652-654)cGt>cAt	p.R218H	AKR1A1_ENST00000473038.1_Intron|AKR1A1_ENST00000351829.4_Missense_Mutation_p.R218H	NM_001202413.1|NM_001202414.1|NM_006066.3	NP_001189342.1|NP_001189343.1|NP_006057.1	P14550	AK1A1_HUMAN	aldo-keto reductase family 1, member A1 (aldehyde reductase)	218					aldehyde catabolic process (GO:0046185)|cellular aldehyde metabolic process (GO:0006081)|D-glucuronate catabolic process (GO:0042840)|glucose metabolic process (GO:0006006)|L-ascorbic acid biosynthetic process (GO:0019853)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|L-glucuronate reductase activity (GO:0047939)			lung(3)|prostate(1)|urinary_tract(1)	5	Acute lymphoblastic leukemia(166;0.155)				Doxorubicin(DB00997)	TCCTCTGATCGTGCATGGCGT	0.542																																																	0													108.0	87.0	94.0					1																	46034257		2203	4300	6503	SO:0001583	missense	0			J04794	CCDS523.1	1p33-p32	2010-04-08			ENSG00000117448	ENSG00000117448	1.1.1.2	"""Aldo-keto reductases"""	380	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 3"""	103830				2498333, 10393438	Standard	NM_001202414		Approved	ALR, DD3	uc001coe.3	P14550	OTTHUMG00000007740	ENST00000372070.3:c.653G>A	1.37:g.46034257G>A	ENSP00000361140:p.Arg218His		A8KAL8|D3DQ04|Q6IAZ4	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.R218H	ENST00000372070.3	37	c.653	CCDS523.1	1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.887525	0.91814	.	.	ENSG00000117448	ENST00000372070;ENST00000351829	T;T	0.30182	1.54;1.54	6.02	4.17	0.49024	NADP-dependent oxidoreductase domain (3);	0.046204	0.85682	N	0.000000	T	0.55417	0.1919	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.59467	-0.7449	10	0.72032	D	0.01	.	12.7004	0.57029	0.1321:0.0:0.8679:0.0	.	218	P14550	AK1A1_HUMAN	H	218	ENSP00000361140:R218H;ENSP00000312606:R218H	ENSP00000312606:R218H	R	+	2	0	AKR1A1	45806844	1.000000	0.71417	0.971000	0.41717	0.983000	0.72400	9.773000	0.98989	0.909000	0.36697	0.650000	0.86243	CGT	AKR1A1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	ENSG00000117448		0.542	AKR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1A1	HGNC	protein_coding	OTTHUMT00000020851.1		0.00	69	0	G	NM_006066		46034257	+1			no_errors	ENST00000351829	ensembl	human	known	74_37	missense	5.13	36	2	SNP	0.999	A
ARHGAP32	9743	genome.wustl.edu	37	11	128839636	128839636	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:128839636C>G	ENST00000310343.9	-	22	5429	c.5430G>C	c.(5428-5430)aaG>aaC	p.K1810N	ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.K1461N|ARHGAP32_ENST00000527272.1_Missense_Mutation_p.K1461N	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1810	Interaction with FYN.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						GGCGGCTCTCCTTTCCTTCTG	0.582																																																	0													87.0	84.0	85.0					11																	128839636		2201	4297	6498	SO:0001583	missense	0			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.5430G>C	11.37:g.128839636C>G	ENSP00000310561:p.Lys1810Asn		I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,pfam_Phox,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Phox,smart_SH3_domain,smart_RhoGAP_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.K1810N	ENST00000310343.9	37	c.5430	CCDS44769.1	11	.	.	.	.	.	.	.	.	.	.	C	15.08	2.727953	0.48833	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000527272	T;T;T	0.13196	2.64;2.61;2.61	6.07	4.19	0.49359	.	0.102638	0.64402	D	0.000005	T	0.21801	0.0525	M	0.66939	2.045	0.43953	D	0.996627	D	0.57899	0.981	P	0.49637	0.617	T	0.00995	-1.1487	10	0.56958	D	0.05	.	9.2544	0.37575	0.0:0.7293:0.0:0.2707	.	1810	A7KAX9	RHG32_HUMAN	N	1810;1461;1461	ENSP00000310561:K1810N;ENSP00000376425:K1461N;ENSP00000432862:K1461N	ENSP00000310561:K1810N	K	-	3	2	ARHGAP32	128344846	0.994000	0.37717	0.981000	0.43875	0.780000	0.44128	0.330000	0.19715	0.879000	0.35944	0.655000	0.94253	AAG	ARHGAP32	-	NULL	ENSG00000134909		0.582	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP32	HGNC	protein_coding	OTTHUMT00000386151.3	-	0.00	68	0	C	NM_014715		128839636	-1	tier1	-	no_errors	ENST00000310343	ensembl	human	known	74_37	missense	51.06	23	24	SNP	1.000	G
ARHGAP32	9743	genome.wustl.edu	37	11	128843257	128843257	+	Silent	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:128843257C>T	ENST00000310343.9	-	21	3101	c.3102G>A	c.(3100-3102)ccG>ccA	p.P1034P	ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000392657.3_Silent_p.P685P|ARHGAP32_ENST00000527272.1_Silent_p.P685P	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1034	Poly-Pro.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						TTTTCGGAGGCGGTGGTGGTG	0.522																																																	0													105.0	115.0	111.0					11																	128843257		2198	4297	6495	SO:0001819	synonymous_variant	0			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.3102G>A	11.37:g.128843257C>T			I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Silent	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,pfam_Phox,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Phox,smart_SH3_domain,smart_RhoGAP_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.P1034	ENST00000310343.9	37	c.3102	CCDS44769.1	11																																																																																			ARHGAP32	-	NULL	ENSG00000134909		0.522	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP32	HGNC	protein_coding	OTTHUMT00000386151.3	-	0.00	75	0	C	NM_014715		128843257	-1	tier1	-	no_errors	ENST00000310343	ensembl	human	known	74_37	silent	31.67	41	19	SNP	1.000	T
ARHGAP32	9743	genome.wustl.edu	37	11	128910853	128910853	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:128910853G>A	ENST00000310343.9	-	10	972	c.973C>T	c.(973-975)Cag>Tag	p.Q325*	ARHGAP32_ENST00000524655.1_Nonsense_Mutation_p.Q251*	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	325					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						GTCACTGACTGGGGAACTTTT	0.403																																																	0													85.0	74.0	77.0					11																	128910853		1566	3579	5145	SO:0001587	stop_gained	0			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.973C>T	11.37:g.128910853G>A	ENSP00000310561:p.Gln325*		I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,pfam_Phox,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Phox,smart_SH3_domain,smart_RhoGAP_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.Q325*	ENST00000310343.9	37	c.973	CCDS44769.1	11	.	.	.	.	.	.	.	.	.	.	G	36	5.637262	0.96693	.	.	ENSG00000134909	ENST00000310343;ENST00000524655;ENST00000457677;ENST00000356092	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	15.6837	0.77393	0.0:0.0:1.0:0.0	.	.	.	.	X	325;251;259;35	.	ENSP00000310561:Q325X	Q	-	1	0	ARHGAP32	128416063	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.752000	0.85141	2.448000	0.82819	0.591000	0.81541	CAG	ARHGAP32	-	superfamily_SH3_domain	ENSG00000134909		0.403	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP32	HGNC	protein_coding	OTTHUMT00000386151.3	-	0.00	58	0	G	NM_014715		128910853	-1	tier1	-	no_errors	ENST00000310343	ensembl	human	known	74_37	nonsense	24.44	34	11	SNP	1.000	A
ARHGAP39	80728	genome.wustl.edu	37	8	145773258	145773258	+	Silent	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr8:145773258C>T	ENST00000276826.5	-	4	1413	c.1212G>A	c.(1210-1212)gcG>gcA	p.A404A	ARHGAP39_ENST00000377307.2_Silent_p.A404A|ARHGAP39_ENST00000540274.1_Silent_p.A404A|ARHGAP39_ENST00000528810.1_5'Flank			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	404					axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						GGCTGGAGCCCGCCTGCTCCA	0.692																																																	0													15.0	12.0	13.0					8																	145773258		2153	4210	6363	SO:0001819	synonymous_variant	0				CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.1212G>A	8.37:g.145773258C>T			B4E1I1	Silent	SNP	pfam_RhoGAP_dom,pfam_MyTH4_dom,superfamily_Rho_GTPase_activation_prot,superfamily_WW_dom,smart_WW_dom,smart_MyTH4_dom,smart_RhoGAP_dom,pfscan_MyTH4_dom,pfscan_WW_dom,pfscan_RhoGAP_dom	p.A404	ENST00000276826.5	37	c.1212		8																																																																																			ARHGAP39	-	NULL	ENSG00000147799		0.692	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	ARHGAP39	HGNC	protein_coding	OTTHUMT00000382509.1		0.00	10	0	C			145773258	-1			no_errors	ENST00000377307	ensembl	human	known	74_37	silent	29.41	12	5	SNP	0.029	T
ARHGEF19	128272	genome.wustl.edu	37	1	16534232	16534232	+	Silent	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:16534232G>A	ENST00000270747.3	-	4	871	c.735C>T	c.(733-735)agC>agT	p.S245S	ARHGEF19_ENST00000478117.1_5'Flank	NM_153213.3	NP_694945.2	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19	245					regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)		GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(1)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		CCCGGTCCCCGCTCATCTCTA	0.667																																																	0													50.0	53.0	52.0					1																	16534232		2203	4299	6502	SO:0001819	synonymous_variant	0			BC012982	CCDS170.1	1p36.13	2011-11-16			ENSG00000142632	ENSG00000142632		"""Rho guanine nucleotide exchange factors"""	26604	protein-coding gene	gene with protein product		612496				12477932	Standard	NM_153213		Approved	FLJ33962, WGEF	uc001ayc.1	Q8IW93	OTTHUMG00000002219	ENST00000270747.3:c.735C>T	1.37:g.16534232G>A			A6NJ04|Q5TEV2|Q6PJQ4|Q8N244	Silent	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.S245	ENST00000270747.3	37	c.735	CCDS170.1	1																																																																																			ARHGEF19	-	NULL	ENSG00000142632		0.667	ARHGEF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF19	HGNC	protein_coding	OTTHUMT00000006289.1	-	0.00	74	0	G	NM_153213		16534232	-1	tier1	-	no_errors	ENST00000270747	ensembl	human	known	74_37	silent	10.26	35	4	SNP	0.004	A
ARHGEF10L	55160	genome.wustl.edu	37	1	17975067	17975067	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:17975067G>A	ENST00000361221.3	+	22	2450	c.2291G>A	c.(2290-2292)gGc>gAc	p.G764D	ARHGEF10L_ENST00000375415.1_Missense_Mutation_p.G725D|ARHGEF10L_ENST00000469726.1_3'UTR|ARHGEF10L_ENST00000167825.4_Missense_Mutation_p.G467D|ARHGEF10L_ENST00000434513.1_Missense_Mutation_p.G759D|ARHGEF10L_ENST00000452522.1_Missense_Mutation_p.G725D|ARHGEF10L_ENST00000375408.3_Missense_Mutation_p.G537D	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	764						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		AACCAGCCAGGCTGGCTATGC	0.627																																																	0													66.0	65.0	65.0					1																	17975067		2203	4300	6503	SO:0001583	missense	0			AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.2291G>A	1.37:g.17975067G>A	ENSP00000355060:p.Gly764Asp		B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,smart_DH-domain,pfscan_DH-domain	p.G764D	ENST00000361221.3	37	c.2291	CCDS182.1	1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438873	0.83885	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415;ENST00000375408;ENST00000457829;ENST00000167825	T;T;T;T;T;T	0.17213	2.29;2.29;2.29;2.29;2.29;2.29	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.45418	0.1341	M	0.82716	2.605	0.58432	D	0.999997	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.996;1.0;1.0;0.996;0.998;1.0;1.0	T	0.50734	-0.8793	10	0.72032	D	0.01	-25.1601	14.8497	0.70286	0.0:0.0:1.0:0.0	.	537;759;467;525;720;725;764	Q5VXI4;Q9HCE6-5;Q9HCE6-4;B3KX74;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;.;.;.;ARGAL_HUMAN	D	764;725;759;725;537;537;467	ENSP00000355060:G764D;ENSP00000399401:G725D;ENSP00000394621:G759D;ENSP00000364564:G725D;ENSP00000364557:G537D;ENSP00000167825:G467D	ENSP00000167825:G467D	G	+	2	0	ARHGEF10L	17847654	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.891000	0.87319	2.340000	0.79590	0.591000	0.81541	GGC	ARHGEF10L	-	NULL	ENSG00000074964		0.627	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	ARHGEF10L	HGNC	protein_coding	OTTHUMT00000007147.1	-	0.00	54	0	G	NM_018125		17975067	+1	tier1	-	no_errors	ENST00000361221	ensembl	human	known	74_37	missense	12.90	27	4	SNP	1.000	A
ARID4B	51742	genome.wustl.edu	37	1	235424033	235424033	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:235424033G>C	ENST00000264183.3	-	3	538	c.41C>G	c.(40-42)aCt>aGt	p.T14S	ARID4B_ENST00000366603.2_Missense_Mutation_p.T14S|ARID4B_ENST00000349213.3_Missense_Mutation_p.T14S	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	14					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			ACTCACATCAGTGCCCACTGT	0.368																																																	0													96.0	91.0	93.0					1																	235424033		2203	4300	6503	SO:0001583	missense	0			AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.41C>G	1.37:g.235424033G>C	ENSP00000264183:p.Thr14Ser		A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Missense_Mutation	SNP	pfam_RBB1NT,pfam_ARID/BRIGHT_DNA-bd,pfam_Tudor-knot,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Chromodomain-like,smart_Tudor,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.T14S	ENST00000264183.3	37	c.41	CCDS31061.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.300427	0.95601	.	.	ENSG00000054267	ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183;ENST00000439834;ENST00000418304	T;T;T;T	0.52295	0.82;0.67;0.67;1.15	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.71074	0.3297	M	0.75615	2.305	0.80722	D	1	D;D;D;D	0.89917	0.996;1.0;0.998;0.997	D;D;D;D	0.83275	0.971;0.996;0.994;0.985	T	0.72969	-0.4130	10	0.87932	D	0	-16.5971	19.6077	0.95587	0.0:0.0:1.0:0.0	.	14;14;14;14	F8WB31;Q4LE39-3;Q4LE39-2;Q4LE39	.;.;.;ARI4B_HUMAN	S	14	ENSP00000264184:T14S;ENSP00000355562:T14S;ENSP00000264183:T14S;ENSP00000391497:T14S	ENSP00000264183:T14S	T	-	2	0	ARID4B	233490656	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.869000	0.99810	2.728000	0.93425	0.549000	0.68633	ACT	ARID4B	-	NULL	ENSG00000054267		0.368	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID4B	HGNC	protein_coding	OTTHUMT00000095566.3	-	0.00	86	0	G	NM_016374		235424033	-1	tier1	-	no_errors	ENST00000264183	ensembl	human	known	74_37	missense	33.93	37	19	SNP	1.000	C
ARPP21	10777	genome.wustl.edu	37	3	35770848	35770848	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:35770848C>T	ENST00000187397.4	+	15	1735	c.1279C>T	c.(1279-1281)Cca>Tca	p.P427S	ARPP21_ENST00000444190.1_Missense_Mutation_p.P373S|ARPP21_ENST00000337271.5_Missense_Mutation_p.P373S|ARPP21_ENST00000417925.1_Missense_Mutation_p.P393S|ARPP21_ENST00000458225.1_Missense_Mutation_p.P393S	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	427					cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						CCGCACCCATCCACCTCTCCA	0.562																																																	0													65.0	66.0	66.0					3																	35770848		2203	4300	6503	SO:0001583	missense	0			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.1279C>T	3.37:g.35770848C>T	ENSP00000187397:p.Pro427Ser		B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.P393S	ENST00000187397.4	37	c.1177	CCDS2661.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.223|8.223	0.802903|0.802903	0.16397|0.16397	.|.	.|.	ENSG00000172995|ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925|ENST00000425289	T;T;T;T;T|.	0.47528|.	0.84;0.84;0.84;0.84;0.84|.	6.06|6.06	4.23|4.23	0.50019|0.50019	.|.	0.812665|.	0.11631|.	N|.	0.544752|.	T|T	0.34745|0.34745	0.0908|0.0908	N|N	0.03209|0.03209	-0.39|-0.39	0.46011|0.46011	D|D	0.998819|0.998819	B;B;B|.	0.15930|.	0.015;0.015;0.015|.	B;B;B|.	0.23419|.	0.046;0.021;0.029|.	T|T	0.13124|0.13124	-1.0521|-1.0521	10|5	0.27785|.	T|.	0.31|.	-1.3753|-1.3753	16.7724|16.7724	0.85542|0.85542	0.0:0.7564:0.2436:0.0|0.0:0.7564:0.2436:0.0	.|.	393;427;373|.	Q9UBL0-3;Q9UBL0;Q9UBL0-4|.	.;ARP21_HUMAN;.|.	S|F	393;373;373;427;393|199	ENSP00000414351:P393S;ENSP00000337792:P373S;ENSP00000405276:P373S;ENSP00000187397:P427S;ENSP00000412326:P393S|.	ENSP00000187397:P427S|.	P|S	+|+	1|2	0|0	ARPP21|ARPP21	35745852|35745852	0.984000|0.984000	0.35163|0.35163	0.023000|0.023000	0.16930|0.16930	0.820000|0.820000	0.46376|0.46376	3.982000|3.982000	0.56909|0.56909	0.845000|0.845000	0.35118|0.35118	0.650000|0.650000	0.86243|0.86243	CCA|TCC	ARPP21	-	NULL	ENSG00000172995		0.562	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPP21	HGNC	protein_coding	OTTHUMT00000253334.2		0.00	43	0	C	NM_198399		35770848	+1			no_errors	ENST00000417925	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.943	T
ASPRV1	151516	genome.wustl.edu	37	2	70187813	70187813	+	Silent	SNP	T	T	C			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr2:70187813T>C	ENST00000320256.4	-	1	1584	c.1008A>G	c.(1006-1008)gaA>gaG	p.E336E	PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000419542.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000596259.1_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1											endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						CCTGCCGCCCTTCTTCTGAGG	0.552																																																	0													73.0	77.0	76.0					2																	70187813		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647	ENST00000320256.4:c.1008A>G	2.37:g.70187813T>C				Silent	SNP	pfam_Peptidase_aspartic_DDI1-type,pfam_Pept_A2A_retrovirus_sg,superfamily_Peptidase_aspartic_dom,pfscan_Peptidase_A2_cat	p.E336	ENST00000320256.4	37	c.1008	CCDS1897.1	2																																																																																			ASPRV1	-	NULL	ENSG00000244617		0.552	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPRV1	HGNC	protein_coding	OTTHUMT00000334161.1	-	0.00	73	0	T	NM_152792		70187813	-1	tier1	-	no_errors	ENST00000320256	ensembl	human	known	74_37	silent	5.13	74	4	SNP	0.000	C
ATG4B	23192	genome.wustl.edu	37	2	242590455	242590455	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr2:242590455C>G	ENST00000404914.3	+	2	144	c.41C>G	c.(40-42)gCt>gGt	p.A14G	ATG4B_ENST00000491867.1_3'UTR|ATG4B_ENST00000405546.3_Missense_Mutation_p.A14G|ATG4B_ENST00000396411.3_5'UTR|ATG4B_ENST00000474739.2_5'UTR|ATG4B_ENST00000402096.1_5'UTR	NM_013325.4|NM_178326.2	NP_037457.3|NP_847896.1	Q9Y4P1	ATG4B_HUMAN	autophagy related 4B, cysteine peptidase	14					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|positive regulation of autophagy (GO:0010508)|positive regulation of protein catabolic process (GO:0045732)|protein transport (GO:0015031)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	cysteine-type peptidase activity (GO:0008234)|endopeptidase activity (GO:0004175)			breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.44e-33)|all cancers(36;5.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.75e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0848)		CTCCGGTTTGCTGAGTTTGAA	0.448																																					Melanoma(78;458 1323 6342 12171 39523)												0													74.0	68.0	70.0					2																	242590455		1890	4119	6009	SO:0001583	missense	0			AB023160	CCDS46564.1, CCDS46565.1	2q37.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000168397	ENSG00000168397			20790	protein-coding gene	gene with protein product		611338	"""APG4 autophagy 4 homolog B (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog B (S. cerevisiae)"""	APG4B		12446702	Standard	NM_013325		Approved	Apg4B, KIAA0943, DKFZp586D1822, AUTL1	uc002wbv.3	Q9Y4P1	OTTHUMG00000151514	ENST00000404914.3:c.41C>G	2.37:g.242590455C>G	ENSP00000384259:p.Ala14Gly		B7WNK2|Q53NU4|Q6ZUV8|Q8WYM9|Q96K07|Q96K96|Q96SZ1|Q9Y2F2	Missense_Mutation	SNP	pfam_Peptidase_C54	p.A14G	ENST00000404914.3	37	c.41	CCDS46564.1	2	.	.	.	.	.	.	.	.	.	.	C	13.05	2.122245	0.37436	.	.	ENSG00000168397	ENST00000405546;ENST00000337606;ENST00000404914;ENST00000425239;ENST00000400771	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.36	5.36	0.76844	.	0.056069	0.64402	D	0.000001	T	0.26593	0.0650	N	0.10972	0.075	0.80722	D	1	B;B;B	0.12013	0.003;0.005;0.001	B;B;B	0.15052	0.005;0.012;0.001	T	0.06267	-1.0836	10	0.23891	T	0.37	-17.562	16.5673	0.84602	0.0:1.0:0.0:0.0	.	131;102;14	B4DZK0;Q9Y4P1-2;Q9Y4P1	.;.;ATG4B_HUMAN	G	14;131;14;14;14	ENSP00000383964:A14G;ENSP00000384259:A14G;ENSP00000409895:A14G;ENSP00000383582:A14G	ENSP00000336547:A131G	A	+	2	0	ATG4B	242239128	0.997000	0.39634	0.983000	0.44433	0.847000	0.48162	3.154000	0.50693	2.523000	0.85059	0.561000	0.74099	GCT	ATG4B	-	NULL	ENSG00000168397		0.448	ATG4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG4B	HGNC	protein_coding	OTTHUMT00000322967.3	-	0.00	54	0	C	NM_013325		242590455	+1	tier1	-	no_errors	ENST00000404914	ensembl	human	known	74_37	missense	52.00	12	13	SNP	0.997	G
ATP10D	57205	genome.wustl.edu	37	4	47525174	47525174	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr4:47525174G>T	ENST00000273859.3	+	4	900	c.631G>T	c.(631-633)Ggt>Tgt	p.G211C	ATP10D_ENST00000504445.1_Missense_Mutation_p.G211C	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	211					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						TGAGACTTCTGGTCTTGATGG	0.443																																																	0													117.0	105.0	109.0					4																	47525174		2203	4300	6503	SO:0001583	missense	0			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.631G>T	4.37:g.47525174G>T	ENSP00000273859:p.Gly211Cys		A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.G211C	ENST00000273859.3	37	c.631	CCDS3476.1	4	.	.	.	.	.	.	.	.	.	.	G	18.94	3.729046	0.69074	.	.	ENSG00000145246	ENST00000273859;ENST00000504445	T;T	0.77489	-1.1;-1.1	5.74	4.02	0.46733	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.184142	0.48767	D	0.000177	T	0.80088	0.4559	L	0.38838	1.175	0.30865	N	0.733104	D;P	0.69078	0.997;0.886	D;P	0.68353	0.957;0.762	T	0.78610	-0.2137	10	0.72032	D	0.01	-11.3384	8.8601	0.35251	0.2883:0.0:0.7117:0.0	.	211;211	Q9P241;Q6PEW3	AT10D_HUMAN;.	C	211	ENSP00000273859:G211C;ENSP00000420909:G211C	ENSP00000273859:G211C	G	+	1	0	ATP10D	47219931	0.942000	0.31987	0.962000	0.40283	0.990000	0.78478	1.789000	0.38724	0.785000	0.33685	0.484000	0.47621	GGT	ATP10D	-	pfam_ATPase_P-typ_transduc_dom_A,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000145246		0.443	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	HGNC	protein_coding	OTTHUMT00000216900.1		0.00	117	0	G	NM_020453		47525174	+1			no_errors	ENST00000273859	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.998	T
BHLHE22	27319	genome.wustl.edu	37	8	65493930	65493930	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr8:65493930G>A	ENST00000321870.1	+	1	1117	c.583G>A	c.(583-585)Gtc>Atc	p.V195I	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	195	Gly-rich.				anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						cggcgccagcgtccccccggg	0.796																																					Colon(113;104 1586 2865 9855 18065)												0													1.0	1.0	1.0					8																	65493930		589	1498	2087	SO:0001583	missense	0			U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.583G>A	8.37:g.65493930G>A	ENSP00000318799:p.Val195Ile			Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.V195I	ENST00000321870.1	37	c.583	CCDS6179.1	8	.	.	.	.	.	.	.	.	.	.	G	5.400	0.259039	0.10239	.	.	ENSG00000180828	ENST00000321870	T	0.81415	-1.49	3.73	2.82	0.32997	.	0.501802	0.16512	U	0.211197	T	0.59985	0.2234	N	0.08118	0	0.09310	N	1	B	0.16802	0.019	B	0.06405	0.002	T	0.47100	-0.9143	10	0.27785	T	0.31	-11.1079	8.66	0.34086	0.0:0.2494:0.7506:0.0	.	195	Q8NFJ8	BHE22_HUMAN	I	195	ENSP00000318799:V195I	ENSP00000318799:V195I	V	+	1	0	BHLHE22	65656484	0.946000	0.32159	0.004000	0.12327	0.546000	0.35178	4.410000	0.59774	0.726000	0.32339	0.455000	0.32223	GTC	BHLHE22	-	NULL	ENSG00000180828		0.796	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BHLHE22	HGNC	protein_coding	OTTHUMT00000378549.1		0.00	10	0	G	NM_152414		65493930	+1			no_errors	ENST00000321870	ensembl	human	known	74_37	missense	37.50	10	6	SNP	0.103	A
BMP8B	656	genome.wustl.edu	37	1	40230448	40230448	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:40230448G>A	ENST00000372827.3	-	4	1090	c.715C>T	c.(715-717)Cgg>Tgg	p.R239W	BMP8B_ENST00000397360.2_Intron	NM_001720.3	NP_001711.2	P34820	BMP8B_HUMAN	bone morphogenetic protein 8b	239					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|growth (GO:0040007)|ossification (GO:0001503)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)				endometrium(1)|liver(1)|ovary(1)|urinary_tract(1)	4	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CGTGGGGCCCGTTGACCCAGC	0.657																																																	0																																										SO:0001583	missense	0			BC023526	CCDS444.1	1p35-p32	2014-01-30	2008-05-22	2003-10-22	ENSG00000116985	ENSG00000116985		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1075	protein-coding gene	gene with protein product	"""osteogenic protein 2"""	602284	"""bone morphogenetic protein 8 (osteogenic protein 2)"""	BMP8		1460021, 9070944	Standard	NM_001720		Approved	OP-2	uc001cdz.1	P34820	OTTHUMG00000009247	ENST00000372827.3:c.715C>T	1.37:g.40230448G>A	ENSP00000361915:p.Arg239Trp		E7EMY8|Q32NE5|Q53ZM7|Q9NUF0	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu	p.R239W	ENST00000372827.3	37	c.715	CCDS444.1	1	.	.	.	.	.	.	.	.	.	.	G	12.93	2.085980	0.36758	.	.	ENSG00000116985	ENST00000372827	T	0.69306	-0.39	4.37	3.44	0.39384	Transforming growth factor-beta, N-terminal (1);	0.515644	0.18927	U	0.127313	T	0.76637	0.4015	M	0.68593	2.085	0.32377	N	0.555066	D	0.76494	0.999	P	0.60345	0.873	T	0.82192	-0.0579	10	0.72032	D	0.01	.	13.5303	0.61617	0.0:0.0:0.8433:0.1567	.	239	P34820	BMP8B_HUMAN	W	239	ENSP00000361915:R239W	ENSP00000361915:R239W	R	-	1	2	BMP8B	40003035	0.013000	0.17824	0.001000	0.08648	0.137000	0.21094	1.883000	0.39658	1.030000	0.39839	0.558000	0.71614	CGG	BMP8B	-	pfam_TGF-b_N	ENSG00000116985		0.657	BMP8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP8B	HGNC	protein_coding	OTTHUMT00000025641.1	-	0.00	199	0	G	NM_001720		40230448	-1	tier1	-	no_errors	ENST00000372827	ensembl	human	known	74_37	missense	10.87	82	10	SNP	0.008	A
BTBD7	55727	genome.wustl.edu	37	14	93754909	93754909	+	Intron	DEL	T	T	-			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr14:93754909delT	ENST00000334746.5	-	3	1470				BTBD7_ENST00000554565.1_Intron|BTBD7_ENST00000555525.1_Frame_Shift_Del_p.R444fs|BTBD7_ENST00000298896.3_3'UTR|BTBD7_ENST00000393170.2_Intron	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7						multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		gactttgttctttttgctctg	0.368																																																	0																																										SO:0001627	intron_variant	0			AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.1162+5294A>-	14.37:g.93754909delT			A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Frame_Shift_Del	DEL	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.R444fs	ENST00000334746.5	37	c.1330	CCDS32146.1	14																																																																																			BTBD7	-	NULL	ENSG00000011114		0.368	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD7	HGNC	protein_coding	OTTHUMT00000412701.1		0.00	15	0	T	NM_001002860		93754909	-1	tier1		no_errors	ENST00000555525	ensembl	human	putative	74_37	frame_shift_del	15.38	11	2	DEL	0.538	-
C10orf11	83938	genome.wustl.edu	37	10	77542758	77542758	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr10:77542758G>T	ENST00000372499.1	+	1	240	c.25G>T	c.(25-27)Ggc>Tgc	p.G9C	C10orf11_ENST00000593699.1_Intron	NM_032024.3	NP_114413.1	Q9H2I8	CJ011_HUMAN	chromosome 10 open reading frame 11	9					melanocyte differentiation (GO:0030318)			p.G9C(1)		endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	10	Prostate(51;0.0095)|all_epithelial(25;0.0221)					GTCACTCAGCGGCAATCATTC	0.408																																																	1	Substitution - Missense(1)	lung(1)											98.0	87.0	91.0					10																	77542758		2203	4300	6503	SO:0001583	missense	0			AF267860	CCDS7351.1	10q22.3	2013-08-22			ENSG00000148655	ENSG00000148655			23405	protein-coding gene	gene with protein product	"""oculocutaneous albinism 7, autosomal recessive"""	614537				23395477	Standard	NM_032024		Approved	CDA017, OCA7	uc001jxi.3	Q9H2I8	OTTHUMG00000018532	ENST00000372499.1:c.25G>T	10.37:g.77542758G>T	ENSP00000361577:p.Gly9Cys		B1AVW6	Missense_Mutation	SNP	NULL	p.G9C	ENST00000372499.1	37	c.25	CCDS7351.1	10	.	.	.	.	.	.	.	.	.	.	G	13.32	2.203282	0.38905	.	.	ENSG00000148655	ENST00000372499	T	0.26373	1.74	5.69	0.742	0.18341	.	.	.	.	.	T	0.25754	0.0627	N	0.24115	0.695	0.25506	N	0.987504	D	0.53885	0.963	P	0.54460	0.753	T	0.18840	-1.0324	9	0.38643	T	0.18	.	9.6943	0.40147	0.5888:0.0:0.4112:0.0	.	9	Q9H2I8	CJ011_HUMAN	C	9	ENSP00000361577:G9C	ENSP00000361577:G9C	G	+	1	0	C10orf11	77212764	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	0.936000	0.28938	-0.110000	0.12022	-0.136000	0.14681	GGC	C10orf11	-	NULL	ENSG00000148655		0.408	C10orf11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf11	HGNC	protein_coding	OTTHUMT00000048839.1		0.00	25	0	G	NM_032024		77542758	+1			no_errors	ENST00000372499	ensembl	human	known	74_37	missense	10.53	17	2	SNP	0.998	T
C3orf62	375341	genome.wustl.edu	37	3	49308821	49308821	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:49308821T>C	ENST00000343010.3	-	3	1632	c.596A>G	c.(595-597)gAa>gGa	p.E199G	MIR4271_ENST00000582451.1_RNA|Y_RNA_ENST00000362676.1_RNA	NM_198562.2	NP_940964.1	Q6ZUJ4	CC062_HUMAN	chromosome 3 open reading frame 62	199										breast(1)|kidney(1)|large_intestine(1)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GTGGTTCAATTCGTTTTCAAA	0.433																																																	0													70.0	73.0	72.0					3																	49308821		2203	4300	6503	SO:0001583	missense	0			AK125642	CCDS2792.1	3p21.31	2006-02-11			ENSG00000188315	ENSG00000188315			24771	protein-coding gene	gene with protein product						12477932	Standard	NM_198562		Approved	FLJ43654	uc003cwn.2	Q6ZUJ4	OTTHUMG00000156819	ENST00000343010.3:c.596A>G	3.37:g.49308821T>C	ENSP00000341139:p.Glu199Gly		Q6P7E9|Q7Z3X6	Missense_Mutation	SNP	NULL	p.E199G	ENST00000343010.3	37	c.596	CCDS2792.1	3	.	.	.	.	.	.	.	.	.	.	T	14.13	2.444621	0.43429	.	.	ENSG00000188315	ENST00000343010	T	0.60424	0.19	5.3	4.13	0.48395	.	0.131007	0.34507	N	0.003916	T	0.51550	0.1681	L	0.34521	1.04	0.29343	N	0.865903	P	0.49635	0.926	P	0.48654	0.585	T	0.53394	-0.8445	10	0.87932	D	0	-17.8214	9.2452	0.37520	0.0:0.0:0.182:0.8179	.	199	Q6ZUJ4	CC062_HUMAN	G	199	ENSP00000341139:E199G	ENSP00000341139:E199G	E	-	2	0	C3orf62	49283825	0.875000	0.30112	0.370000	0.25965	0.030000	0.12068	2.729000	0.47327	1.004000	0.39156	0.477000	0.44152	GAA	C3orf62	-	NULL	ENSG00000188315		0.433	C3orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf62	HGNC	protein_coding	OTTHUMT00000345990.1	-	0.00	56	0	T	NM_198562		49308821	-1	tier1	-	no_errors	ENST00000343010	ensembl	human	known	74_37	missense	59.09	18	26	SNP	0.831	C
CYSRT1	375791	genome.wustl.edu	37	9	140120094	140120094	+	Silent	SNP	C	C	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr9:140120094C>A	ENST00000359069.2	+	2	71	c.21C>A	c.(19-21)gtC>gtA	p.V7V	RNF224_ENST00000445101.2_5'Flank|C9orf169_ENST00000409414.1_Silent_p.V47V	NM_199001.2	NP_945352.2	A8MQ03	CRTP1_HUMAN		7						extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)	1						AAGAGATGGTCGTCAAGAACC	0.627																																																	0													24.0	26.0	26.0					9																	140120094		692	1589	2281	SO:0001819	synonymous_variant	0																														ENST00000359069.2:c.21C>A	9.37:g.140120094C>A			Q86UY7	Silent	SNP	pfam_UPF0574	p.V7	ENST00000359069.2	37	c.21	CCDS48064.1	9																																																																																			C9orf169	-	pfam_UPF0574	ENSG00000197191		0.627	C9orf169-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf169	HGNC	protein_coding		-	0.00	42	0	C			140120094	+1	tier1	-	no_errors	ENST00000359069	ensembl	human	known	74_37	silent	35.29	44	24	SNP	0.125	A
CD248	57124	genome.wustl.edu	37	11	66082734	66082734	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:66082734G>A	ENST00000311330.3	-	1	1781	c.1765C>T	c.(1765-1767)Cag>Tag	p.Q589*	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	589	Pro-rich.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						AGAGAGGGCTGGGCAGTTGGG	0.657																																																	0													125.0	141.0	136.0					11																	66082734		2200	4295	6495	SO:0001587	stop_gained	0			AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.1765C>T	11.37:g.66082734G>A	ENSP00000308117:p.Gln589*		Q2M2V5|Q3SX55|Q96KB6	Nonsense_Mutation	SNP	pfam_C-type_lectin,pfam_EGF-like_Ca-bd_dom,superfamily_C-type_lectin_fold,smart_C-type_lectin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_C-type_lectin	p.Q589*	ENST00000311330.3	37	c.1765	CCDS8134.1	11	.	.	.	.	.	.	.	.	.	.	G	16.13	3.034652	0.54896	.	.	ENSG00000174807	ENST00000311330	.	.	.	4.32	4.32	0.51571	.	16.400100	0.00757	U	0.001117	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-12.5322	12.1732	0.54169	0.0:0.0:1.0:0.0	.	.	.	.	X	589	.	ENSP00000308117:Q589X	Q	-	1	0	CD248	65839310	0.966000	0.33281	0.756000	0.31282	0.058000	0.15608	4.965000	0.63708	2.222000	0.72286	0.460000	0.39030	CAG	CD248	-	NULL	ENSG00000174807		0.657	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD248	HGNC	protein_coding	OTTHUMT00000392922.2	-	0.00	46	0	G	NM_020404		66082734	-1	tier1	-	no_errors	ENST00000311330	ensembl	human	known	74_37	nonsense	24.00	19	6	SNP	0.738	A
CD38	952	genome.wustl.edu	37	4	15818189	15818189	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr4:15818189C>A	ENST00000226279.3	+	2	426	c.289C>A	c.(289-291)Cat>Aat	p.H97N		NM_001775.2	NP_001766.2	P28907	CD38_HUMAN	CD38 molecule	97					apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|female pregnancy (GO:0007565)|long term synaptic depression (GO:0060292)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone resorption (GO:0045779)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell growth (GO:0030307)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hydroperoxide (GO:0033194)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|phosphorus-oxygen lyase activity (GO:0016849)|transferase activity (GO:0016740)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|stomach(1)	14						TATTTCAAAACATCCTTGCAA	0.363																																																	0													89.0	84.0	86.0					4																	15818189		2203	4300	6503	SO:0001583	missense	0			D84276	CCDS3417.1	4p15.32	2010-05-04	2006-03-28		ENSG00000004468	ENSG00000004468	3.2.2.5	"""CD molecules"""	1667	protein-coding gene	gene with protein product	"""ADP-ribosyl cyclase 1"", ""NAD(+) nucleosidase"""	107270	"""CD38 antigen (p45)"""			9074508, 2319135	Standard	NM_001775		Approved		uc003gol.1	P28907	OTTHUMG00000048206	ENST00000226279.3:c.289C>A	4.37:g.15818189C>A	ENSP00000226279:p.His97Asn		O00121|O00122|Q96HY4	Missense_Mutation	SNP	pfam_ADP-ribosyl_cyclase	p.H97N	ENST00000226279.3	37	c.289	CCDS3417.1	4	.	.	.	.	.	.	.	.	.	.	C	0.033	-1.324265	0.01309	.	.	ENSG00000004468	ENST00000226279;ENST00000540195	T	0.12569	2.67	5.57	-5.78	0.02362	.	0.594522	0.18043	N	0.153545	T	0.02571	0.0078	N	0.01209	-0.955	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.29761	-1.0001	10	0.15952	T	0.53	-9.0675	3.2534	0.06823	0.5791:0.2131:0.1173:0.0905	.	97;97	P28907;B2R880	CD38_HUMAN;.	N	97	ENSP00000226279:H97N	ENSP00000226279:H97N	H	+	1	0	CD38	15427287	0.757000	0.28394	0.000000	0.03702	0.043000	0.13939	0.020000	0.13466	-1.789000	0.01264	-2.631000	0.00153	CAT	CD38	-	pfam_ADP-ribosyl_cyclase	ENSG00000004468		0.363	CD38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD38	HGNC	protein_coding	OTTHUMT00000250322.2	-	0.00	84	0	C	NM_001775		15818189	+1	tier1	-	no_errors	ENST00000226279	ensembl	human	known	74_37	missense	30.77	44	20	SNP	0.336	A
CDON	50937	genome.wustl.edu	37	11	125889553	125889553	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:125889553G>T	ENST00000392693.3	-	4	584	c.457C>A	c.(457-459)Cgc>Agc	p.R153S	CDON_ENST00000263577.7_Missense_Mutation_p.R153S	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	153	Ig-like C2-type 2.				anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R153C(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		ATTTTATAGCGCACCTCAGCT	0.448																																																	1	Substitution - Missense(1)	large_intestine(1)											132.0	136.0	135.0					11																	125889553		2201	4299	6500	SO:0001583	missense	0			AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.457C>A	11.37:g.125889553G>T	ENSP00000376458:p.Arg153Ser		O14631	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R153S	ENST00000392693.3	37	c.457	CCDS58192.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.1|23.1	4.377756|4.377756	0.82682|0.82682	.|.	.|.	ENSG00000064309|ENSG00000064309	ENST00000534661|ENST00000392693;ENST00000263577;ENST00000531586	.|T;T;T	.|0.59772	.|2.76;2.76;0.24	5.33|5.33	4.42|4.42	0.53409|0.53409	.|Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.000000	.|0.53938	.|D	.|0.000041	T|T	0.60728|0.60728	0.2291|0.2291	L|L	0.28649|0.28649	0.875|0.875	0.42091|0.42091	D|D	0.991298|0.991298	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.87578	.|0.998;0.996;0.993	T|T	0.55811|0.55811	-0.8082|-0.8082	5|10	.|0.06757	.|T	.|0.87	-18.783|-18.783	14.5518|14.5518	0.68073|0.68073	0.0706:0.0:0.9294:0.0|0.0706:0.0:0.9294:0.0	.|.	.|153;153;153	.|E9PRD8;Q4KMG0;Q4KMG0-2	.|.;CDON_HUMAN;.	E|S	128|153	.|ENSP00000376458:R153S;ENSP00000263577:R153S;ENSP00000434212:R153S	.|ENSP00000263577:R153S	A|R	-|-	2|1	0|0	CDON|CDON	125394763|125394763	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.884000|0.884000	0.51177|0.51177	6.387000|6.387000	0.73191|0.73191	1.384000|1.384000	0.46424|0.46424	-0.215000|-0.215000	0.12644|0.12644	GCG|CGC	CDON	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000064309		0.448	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDON	HGNC	protein_coding	OTTHUMT00000386749.2		0.00	78	0	G	NM_016952		125889553	-1			no_errors	ENST00000392693	ensembl	human	known	74_37	missense	5.88	47	3	SNP	1.000	T
CEBPA	1050	genome.wustl.edu	37	19	33792456	33792456	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr19:33792456G>A	ENST00000498907.2	-	1	1014	c.865C>T	c.(865-867)Cgc>Tgc	p.R289C	CEBPA-AS1_ENST00000592982.2_RNA|CTD-2540B15.7_ENST00000587312.1_RNA|CTD-2540B15.11_ENST00000589932.1_RNA	NM_004364.3	NP_004355.2	P49715	CEBPA_HUMAN	CCAAT/enhancer binding protein (C/EBP), alpha	289	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				acute-phase response (GO:0006953)|brown fat cell differentiation (GO:0050873)|cell maturation (GO:0048469)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|cholesterol metabolic process (GO:0008203)|cytokine-mediated signaling pathway (GO:0019221)|embryonic placenta development (GO:0001892)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|liver development (GO:0001889)|lung development (GO:0030324)|macrophage differentiation (GO:0030225)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to glucocorticoid (GO:0051384)|response to vitamin B2 (GO:0033274)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|urea cycle (GO:0000050)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.H200_K352>Q(1)|p.?(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(912)|lung(5)|prostate(1)|stomach(1)	920	Esophageal squamous(110;0.137)					TTGCGCTCGCGCCGCACCCGG	0.677			"""Mis, N, F"""		"""AML, MDS"""				Acute Myeloid Leukemia, Familial, associated with CEBPA germline mutation																															Dom	yes		19	19q13.1	1050	"""CCAAT/enhancer binding protein (C/EBP), alpha"""		L	2	Unknown(1)|Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(2)											40.0	41.0	40.0					19																	33792456		2203	4299	6502	SO:0001583	missense	0	Familial Cancer Database	Familial AML	M37197	CCDS54243.1	19q13.1	2014-09-17				ENSG00000245848		"""basic leucine zipper proteins"""	1833	protein-coding gene	gene with protein product		116897		CEBP		1535333, 1840554	Standard	NM_004364		Approved	C/EBP-alpha	uc002nun.3	P49715		ENST00000498907.2:c.865C>T	19.37:g.33792456G>A	ENSP00000427514:p.Arg289Cys		A7LNP2|P78319|Q05CA4	Missense_Mutation	SNP	pfam_bZIP,smart_bZIP,pirsf_CCAAT/enhancer-binding,pfscan_bZIP	p.R289C	ENST00000498907.2	37	c.865	CCDS54243.1	19	.	.	.	.	.	.	.	.	.	.	G	20.6	4.022251	0.75275	.	.	ENSG00000245848	ENST00000498907	T	0.71934	-0.61	4.7	4.7	0.59300	Basic-leucine zipper (bZIP) transcription factor (2);Basic leucine zipper (1);	.	.	.	.	D	0.88089	0.6343	H	0.96142	3.775	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90975	0.4823	9	0.87932	D	0	.	11.8248	0.52261	0.0:0.0:0.8248:0.1752	.	289	P49715	CEBPA_HUMAN	C	289	ENSP00000427514:R289C	ENSP00000427514:R289C	R	-	1	0	CEBPA	38484296	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	3.078000	0.50096	2.133000	0.65898	0.462000	0.41574	CGC	CEBPA	-	pfam_bZIP,smart_bZIP,pirsf_CCAAT/enhancer-binding,pfscan_bZIP	ENSG00000245848		0.677	CEBPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEBPA	HGNC	protein_coding	OTTHUMT00000365012.1		0.00	87	0	G	NM_004364		33792456	-1			no_errors	ENST00000498907	ensembl	human	known	74_37	missense	5.26	54	3	SNP	1.000	A
CEL	1056	genome.wustl.edu	37	9	135946427	135946427	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr9:135946427C>T	ENST00000372080.4	+	11	1563	c.1547C>T	c.(1546-1548)aCg>aTg	p.T516M	CEL_ENST00000351304.7_Missense_Mutation_p.T447M	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	513					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		CCCTACACTACGGAAAACAGC	0.607																																																	0													36.0	46.0	43.0					9																	135946427		2021	4192	6213	SO:0001583	missense	0			M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.1547C>T	9.37:g.135946427C>T	ENSP00000361151:p.Thr516Met		Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.T516M	ENST00000372080.4	37	c.1547	CCDS43896.1	9	.	.	.	.	.	.	.	.	.	.	C	5.976	0.363985	0.11296	.	.	ENSG00000170835	ENST00000372080;ENST00000351304;ENST00000303626	T;T	0.59083	0.29;0.29	5.04	-3.94	0.04130	Carboxylesterase, type B (1);	4.726440	0.00931	N	0.002706	T	0.50956	0.1646	M	0.67569	2.06	0.09310	N	1	B	0.27140	0.169	B	0.15484	0.013	T	0.38308	-0.9667	10	0.44086	T	0.13	.	5.6204	0.17453	0.3482:0.4416:0.0:0.2102	.	513	P19835	CEL_HUMAN	M	516;447;515	ENSP00000361151:T516M;ENSP00000342217:T447M	ENSP00000304021:T515M	T	+	2	0	CEL	134936248	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.042000	0.00307	-0.310000	0.08766	0.297000	0.19635	ACG	CEL	-	pfam_CarbesteraseB	ENSG00000170835		0.607	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	HGNC	protein_coding	OTTHUMT00000054823.1	-	0.00	64	0	C			135946427	+1	tier1	-	no_errors	ENST00000372080	ensembl	human	known	74_37	missense	16.98	44	9	SNP	0.000	T
CEP57L1	285753	genome.wustl.edu	37	6	109468002	109468002	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr6:109468002C>T	ENST00000517392.1	+	3	628	c.202C>T	c.(202-204)Cgt>Tgt	p.R68C	CEP57L1_ENST00000359793.3_Missense_Mutation_p.R68C|CEP57L1_ENST00000368968.2_Missense_Mutation_p.R68C|CEP57L1_ENST00000520883.1_Intron|CEP57L1_ENST00000368970.2_Missense_Mutation_p.R68C|CEP57L1_ENST00000519095.1_Missense_Mutation_p.R68C|CEP57L1_ENST00000523787.1_Missense_Mutation_p.R71C|CEP57L1_ENST00000336977.4_Intron|CEP57L1_ENST00000407272.1_Missense_Mutation_p.R68C|CEP57L1_ENST00000521277.1_Missense_Mutation_p.R68C|CEP57L1_ENST00000521522.1_Missense_Mutation_p.R68C	NM_001271852.1|NM_001271853.1	NP_001258781.1|NP_001258782.1	Q8IYX8	CE57L_HUMAN	centrosomal protein 57kDa-like 1	68					microtubule anchoring (GO:0034453)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)	11						AAAAATTCATCGTTTAGAGCT	0.333																																																	0																																										SO:0001583	missense	0			AK092723	CCDS5071.1, CCDS64491.1	6q21	2014-01-28	2010-09-30	2010-09-30	ENSG00000183137	ENSG00000183137			21561	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 182"""	C6orf182			Standard	NM_001083535		Approved	bA487F23.2, MGC21731	uc003psy.4	Q8IYX8	OTTHUMG00000015336	ENST00000517392.1:c.202C>T	6.37:g.109468002C>T	ENSP00000427844:p.Arg68Cys		G5E992	Missense_Mutation	SNP	pfam_Cep57_MT-bd_dom	p.R68C	ENST00000517392.1	37	c.202	CCDS5071.1	6	.	.	.	.	.	.	.	.	.	.	C	15.64	2.892139	0.52014	.	.	ENSG00000183137	ENST00000521277;ENST00000517392;ENST00000407272;ENST00000540778;ENST00000519286;ENST00000518853;ENST00000521522;ENST00000524064;ENST00000522608;ENST00000521503;ENST00000519095;ENST00000368968;ENST00000368970;ENST00000523787;ENST00000359793	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58;0.58	5.05	5.05	0.67936	.	0.227351	0.45126	D	0.000397	T	0.61615	0.2361	L	0.54323	1.7	0.52501	D	0.999953	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	P;D;D;D	0.74348	0.888;0.935;0.983;0.98	T	0.64571	-0.6376	10	0.59425	D	0.04	-6.3167	16.5933	0.84781	0.0:1.0:0.0:0.0	.	68;68;68;68	Q8IYX8;G5E992;Q6P2R3;E5RJH1	CE57L_HUMAN;.;.;.	C	68;68;68;68;68;68;68;68;68;68;68;68;68;71;68	ENSP00000430558:R68C;ENSP00000427844:R68C;ENSP00000383936:R68C;ENSP00000429812:R68C;ENSP00000430265:R68C;ENSP00000428344:R68C;ENSP00000427771:R68C;ENSP00000428464:R68C;ENSP00000431113:R68C;ENSP00000430911:R68C;ENSP00000357964:R68C;ENSP00000357966:R68C;ENSP00000430529:R71C;ENSP00000352841:R68C	ENSP00000352841:R68C	R	+	1	0	CEP57L1	109574695	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	2.224000	0.42945	2.340000	0.79590	0.467000	0.42956	CGT	CEP57L1	-	NULL	ENSG00000183137		0.333	CEP57L1-001	KNOWN	basic|CCDS	protein_coding	CEP57L1	HGNC	protein_coding	OTTHUMT00000041734.4	-	0.00	71	0	C	NM_173830		109468002	+1	tier1	-	no_errors	ENST00000359793	ensembl	human	known	74_37	missense	18.52	44	10	SNP	0.998	T
CLDND1	56650	genome.wustl.edu	37	3	98240278	98240278	+	5'UTR	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:98240278C>T	ENST00000503004.1	-	0	870				CLDND1_ENST00000437922.1_Silent_p.L20L|CLDND1_ENST00000394181.2_5'UTR|CLDND1_ENST00000513287.1_5'UTR|CLDND1_ENST00000502288.1_Intron|CLDND1_ENST00000507874.1_5'UTR|CLDND1_ENST00000394180.2_5'UTR|CLDND1_ENST00000394185.2_5'UTR|CLDND1_ENST00000511081.1_Intron|CLDND1_ENST00000341181.6_5'UTR|RP11-227H4.5_ENST00000502999.1_RNA|CLDND1_ENST00000508503.1_5'UTR|CLDND1_ENST00000510545.1_5'UTR			Q9NY35	CLDN1_HUMAN	claudin domain containing 1							apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	9						TTCTGGCATTCAGACTGCTCT	0.388																																																	0													77.0	77.0	77.0					3																	98240278		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AF116664	CCDS2930.1, CCDS43116.1	3q12.1	2005-12-23	2005-12-23	2005-12-23		ENSG00000080822			1322	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 4"""	C3orf4			Standard	NM_001040181		Approved		uc003dst.3	Q9NY35		ENST00000503004.1:c.-10G>A	3.37:g.98240278C>T			B3KQR1|D3DN36|F2Z2D9|Q502Y8|Q6UVX2|Q9BUZ9|Q9NZZ5|Q9Y4S9	Silent	SNP	pfam_PMP22/EMP/MP20/Claudin	p.L20	ENST00000503004.1	37	c.60	CCDS2930.1	3																																																																																			CLDND1	-	NULL	ENSG00000080822		0.388	CLDND1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CLDND1	HGNC	protein_coding	OTTHUMT00000359071.1		0.00	15	0	C	NM_019895		98240278	-1			no_errors	ENST00000437922	ensembl	human	known	74_37	silent	27.78	13	5	SNP	1.000	T
CRLF2	64109	genome.wustl.edu	37	X	1327703	1327704	+	Missense_Mutation	DNP	AG	AG	GT			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	A|G	A|G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chrX:1327703_1327704AG>GT	ENST00000381567.3	-	2	176_177	c.177_178CT>AC	c.(175-180)caCTac>caACac	p.59_60HY>QH	CRLF2_ENST00000467626.1_5'UTR|CRLF2_ENST00000381566.1_Missense_Mutation_p.59_60HY>QH	NM_022148.2	NP_071431.2	Q9HC73	CRLF2_HUMAN	cytokine receptor-like factor 2	59					immunoglobulin secretion involved in immune response (GO:0002380)|inflammatory response (GO:0006954)|T-helper 2 cell cytokine production (GO:0035745)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(10)|lung(9)	20		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				ACTTACCTGTAGTGGAAAGTCA	0.495			"""Mis, T"""	"""P2RY8, IGH@"""	"""B-ALL, Downs associated ALL"""																																			Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	64109	cytokine receptor-like factor 2		L	0																																										SO:0001583	missense	0			AF142570	CCDS75944.1, CCDS75945.1	Xp22.3 and Yp11.3	2011-10-07			ENSG00000205755	ENSG00000205755		"""Pseudoautosomal regions / PAR1"""	14281	protein-coding gene	gene with protein product		300357, 400023				11237741, 11474172	Standard	NM_022148		Approved	CRL2, TSLPR	uc004cpk.2	Q9HC73	OTTHUMG00000067432	ENST00000381567.3:c.177_178delinsGT	X.37:g.1327703_1327704delinsGT	ENSP00000370979:p.H59_Y60delinsQH		Q9H5R3	Missense_Mutation	SNP	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.Y60H|p.H59Q	ENST00000381567.3	37	c.178|c.177		X																																																																																			CRLF2	-	superfamily_Fibronectin_type3	ENSG00000205755		0.495	CRLF2-202	KNOWN	basic|appris_principal	protein_coding	CRLF2	HGNC	protein_coding		-	0.00	255|253	0	A|G	NM_022148		1327703|1327704	-1	tier1	-	no_errors	ENST00000381567	ensembl	human	known	74_37	missense	12.55|12.50	223|224	32	SNP	0.030|0.029	G|T
CTNNA2	1496	genome.wustl.edu	37	2	80782891	80782891	+	Silent	SNP	G	G	T	rs374667703		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr2:80782891G>T	ENST00000402739.4	+	11	1619	c.1614G>T	c.(1612-1614)cgG>cgT	p.R538R	CTNNA2_ENST00000540488.1_Silent_p.R538R|CTNNA2_ENST00000361291.4_Silent_p.R572R|CTNNA2_ENST00000541047.1_Silent_p.R538R|CTNNA2_ENST00000466387.1_Silent_p.R538R|CTNNA2_ENST00000343114.3_Silent_p.R217R|CTNNA2_ENST00000496558.1_Silent_p.R538R	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	538					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)	p.R538R(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						CTCTGGACCGGACTGCAGGGG	0.507																																																	1	Substitution - coding silent(1)	kidney(1)											84.0	83.0	84.0					2																	80782891		1877	4111	5988	SO:0001819	synonymous_variant	0				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1614G>T	2.37:g.80782891G>T			B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Silent	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.R572	ENST00000402739.4	37	c.1716		2																																																																																			CTNNA2	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000066032		0.507	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	CTNNA2	HGNC	protein_coding	OTTHUMT00000328511.4		0.00	57	0	G	NM_004389		80782891	+1			no_errors	ENST00000361291	ensembl	human	known	74_37	silent	5.13	36	2	SNP	0.998	T
CTNNA3	29119	genome.wustl.edu	37	10	68280417	68280417	+	Missense_Mutation	SNP	C	C	T	rs368067642		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr10:68280417C>T	ENST00000433211.2	-	11	1663	c.1489G>A	c.(1489-1491)Gta>Ata	p.V497I	CTNNA3_ENST00000373744.4_Missense_Mutation_p.V497I	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						ATGTCATCTACGGCTTCAGTG	0.353																																																	0								C	ILE/VAL,ILE/VAL	0,4406		0,0,2203	193.0	168.0	176.0		1489,1489	4.5	1.0	10		176	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CTNNA3	NM_013266.2,NM_001127384.1	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	497/896,497/896	68280417	1,13005	2203	4300	6503	SO:0001583	missense	0			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.1489G>A	10.37:g.68280417C>T	ENSP00000389714:p.Val497Ile			Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.V497I	ENST00000433211.2	37	c.1489	CCDS7269.1	10	.	.	.	.	.	.	.	.	.	.	C	23.3	4.404533	0.83230	0.0	1.16E-4	ENSG00000183230	ENST00000433211;ENST00000373744	T;T	0.50001	0.76;0.76	5.43	4.53	0.55603	.	0.124076	0.35466	N	0.003197	T	0.67961	0.2949	M	0.84433	2.695	0.80722	D	1	P;B	0.51791	0.948;0.003	P;B	0.61592	0.891;0.014	T	0.73626	-0.3923	10	0.87932	D	0	-14.0514	12.1414	0.54000	0.0:0.9164:0.0:0.0836	.	497;497	Q9UI47-2;Q9UI47	.;CTNA3_HUMAN	I	497	ENSP00000389714:V497I;ENSP00000362849:V497I	ENSP00000362849:V497I	V	-	1	0	CTNNA3	67950423	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.969000	0.70422	1.442000	0.47568	0.650000	0.86243	GTA	CTNNA3	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin	ENSG00000183230		0.353	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA3	HGNC	protein_coding	OTTHUMT00000048282.2	-	0.00	65	0	C	NM_013266		68280417	-1	tier1	-	no_errors	ENST00000373744	ensembl	human	known	74_37	missense	38.10	39	24	SNP	1.000	T
CUX1	1523	genome.wustl.edu	37	7	101916646	101916646	+	Missense_Mutation	SNP	C	C	T	rs62001055	byFrequency	TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr7:101916646C>T	ENST00000437600.4	+	15	1611	c.1259C>T	c.(1258-1260)gCa>gTa	p.A420V	CUX1_ENST00000393824.3_Missense_Mutation_p.A383V|CUX1_ENST00000547394.2_Missense_Mutation_p.A406V|CUX1_ENST00000560541.1_3'UTR|CUX1_ENST00000425244.2_Missense_Mutation_p.A376V|CUX1_ENST00000292538.4_Missense_Mutation_p.A422V	NM_181500.2	NP_852477.1	P39880	CUX1_HUMAN	cut-like homeobox 1	0					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						GGACGCTGTGCAGAGCTGCAA	0.622																																																	0													42.0	36.0	38.0					7																	101916646		2203	4300	6503	SO:0001583	missense	0			M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000437600.4:c.1259C>T	7.37:g.101916646C>T	ENSP00000414091:p.Ala420Val		B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	pfam_CASP_C,superfamily_LemA-like_dom	p.A422V	ENST00000437600.4	37	c.1265	CCDS47672.1	7	.	.	.	.	.	.	.	.	.	.	C	15.68	2.905288	0.52333	.	.	ENSG00000257923	ENST00000292538;ENST00000547394;ENST00000425244;ENST00000437600	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	4.75	4.75	0.60458	CASP, C-terminal (1);	.	.	.	.	T	0.50326	0.1609	M	0.78637	2.42	0.23809	N	0.996781	P;D;B;P;P	0.54964	0.473;0.969;0.317;0.617;0.533	B;P;B;B;B	0.55667	0.138;0.781;0.108;0.242;0.25	T	0.45687	-0.9244	9	0.30078	T	0.28	.	15.921	0.79575	0.0:1.0:0.0:0.0	.	383;376;406;420;422	B4DZZ2;B3KV79;G3V1Z6;Q13948-2;Q13948	.;.;.;.;CASP_HUMAN	V	422;406;376;420	ENSP00000292538:A422V;ENSP00000449371:A406V;ENSP00000409745:A376V;ENSP00000414091:A420V	ENSP00000292538:A422V	A	+	2	0	CUX1	101703366	0.997000	0.39634	0.945000	0.38365	0.791000	0.44710	5.063000	0.64332	2.190000	0.69967	0.561000	0.74099	GCA	CUX1	-	pfam_CASP_C	ENSG00000257923		0.622	CUX1-003	KNOWN	basic|CCDS	protein_coding	CUX1	HGNC	protein_coding	OTTHUMT00000347534.3	-	0.00	71	0	C	NM_001913		101916646	+1	tier1	-	no_errors	ENST00000292538	ensembl	human	known	74_37	missense	18.42	62	14	SNP	0.963	T
CXorf31	724087	genome.wustl.edu	37	X	46753976	46753976	+	Silent	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chrX:46753976G>T	ENST00000377879.3	-	2	140	c.33C>A	c.(31-33)acC>acA	p.T11T						chromosome X open reading frame 31																		TCCTGATTGGGGTCCTCACTT	0.453																																																	0																																										SO:0001819	synonymous_variant	0			BC038573		Xp11.3	2013-01-16			ENSG00000204904	ENSG00000204904			17986	other	unknown							Standard	NR_046101		Approved	OTTHUMG00000021429	uc031tji.1	Q5VT33	OTTHUMG00000021429	ENST00000377879.3:c.33C>A	X.37:g.46753976G>T				Silent	SNP	NULL	p.T11	ENST00000377879.3	37	c.33		X																																																																																			CXorf31	-	NULL	ENSG00000204904		0.453	CXorf31-001	KNOWN	basic|appris_principal	protein_coding	CXorf31	HGNC	protein_coding	OTTHUMT00000056374.1	-	0.00	49	0	G	NR_046101		46753976	-1	tier1	-	no_errors	ENST00000377879	ensembl	human	known	74_37	silent	13.33	26	4	SNP	0.000	T
CYFIP1	23191	genome.wustl.edu	37	15	22940818	22940818	+	Silent	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr15:22940818G>A	ENST00000313077.7	+	11	1208	c.1083G>A	c.(1081-1083)tcG>tcA	p.S361S	CYFIP1_ENST00000560848.1_Silent_p.S361S	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		GCTTCATTTCGGAGCTGGCGC	0.607																																																	0													50.0	38.0	42.0					15																	22940818		2203	4300	6503	SO:0001819	synonymous_variant	0			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.1083G>A	15.37:g.22940818G>A				Silent	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.S361	ENST00000313077.7	37	c.1083	CCDS10009.1	15																																																																																			CYFIP1	-	pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000068793		0.607	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYFIP1	HGNC	protein_coding	OTTHUMT00000251136.2		0.00	36	0	G	NM_014608		22940818	+1			no_errors	ENST00000313077	ensembl	human	known	74_37	silent	9.52	19	2	SNP	0.006	A
CYP4F2	8529	genome.wustl.edu	37	19	15990223	15990223	+	Missense_Mutation	SNP	G	G	T	rs142113670	byFrequency	TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr19:15990223G>T	ENST00000221700.6	-	12	1425	c.1330C>A	c.(1330-1332)Cgc>Agc	p.R444S		NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2											NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GGGTCAAAGCGAAAGGGGTCG	0.577																																																	0													117.0	121.0	120.0					19																	15990223		2203	4300	6503	SO:0001583	missense	0			U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.1330C>A	19.37:g.15990223G>T	ENSP00000221700:p.Arg444Ser			Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.R444S	ENST00000221700.6	37	c.1330	CCDS12336.1	19	.	.	.	.	.	.	.	.	.	.	g	14.43	2.532414	0.45073	.	.	ENSG00000186115	ENST00000221700;ENST00000392846	D	0.90504	-2.68	3.05	1.97	0.26223	.	0.000000	0.64402	U	0.000006	D	0.96231	0.8771	H	0.96833	3.89	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95136	0.8259	10	0.87932	D	0	.	9.1712	0.37083	0.0:0.0:0.7805:0.2195	.	444	P78329	CP4F2_HUMAN	S	444;295	ENSP00000221700:R444S	ENSP00000221700:R444S	R	-	1	0	CYP4F2	15851223	1.000000	0.71417	0.981000	0.43875	0.328000	0.28507	3.392000	0.52537	0.571000	0.29365	0.491000	0.48974	CGC	CYP4F2	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	ENSG00000186115		0.577	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F2	HGNC	protein_coding	OTTHUMT00000460372.3	-	0.00	87	0	G	NM_001082		15990223	-1	tier1	-	no_errors	ENST00000221700	ensembl	human	known	74_37	missense	54.63	49	59	SNP	0.994	T
DCAF12L2	340578	genome.wustl.edu	37	X	125298846	125298846	+	Silent	SNP	C	C	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chrX:125298846C>A	ENST00000360028.2	-	1	1088	c.1062G>T	c.(1060-1062)cgG>cgT	p.R354R	DCAF12L2_ENST00000538699.1_Silent_p.R354R			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	354										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						AGCTCAGCGACCGCACGCCTG	0.637																																																	0													48.0	52.0	50.0					X																	125298846		2203	4300	6503	SO:0001819	synonymous_variant	0			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.1062G>T	X.37:g.125298846C>A			B2RN42	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R354	ENST00000360028.2	37	c.1062	CCDS43991.1	X																																																																																			DCAF12L2	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000198354		0.637	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L2	HGNC	protein_coding	OTTHUMT00000058181.1	-	0.00	37	0	C	NM_001013628		125298846	-1	tier1	-	no_errors	ENST00000360028	ensembl	human	known	74_37	silent	82.35	3	14	SNP	0.999	A
DCBLD1	285761	genome.wustl.edu	37	6	117859866	117859866	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr6:117859866C>T	ENST00000338728.5	+	8	964	c.844C>T	c.(844-846)Caa>Taa	p.Q282*	DCBLD1_ENST00000296955.8_Nonsense_Mutation_p.Q282*|DCBLD1_ENST00000368503.4_Intron|GOPC_ENST00000467125.1_Intron			Q8N8Z6	DCBD1_HUMAN	discoidin, CUB and LCCL domain containing 1	282	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)		GAGTGGAGACCAAGTTCACTG	0.537																																																	0													74.0	73.0	73.0					6																	117859866		2203	4300	6503	SO:0001587	stop_gained	0			AK055462	CCDS34522.1	6q22.31	2003-06-20			ENSG00000164465	ENSG00000164465			21479	protein-coding gene	gene with protein product							Standard	NM_173674		Approved	MGC46341, dJ94G16.1	uc003pxs.3	Q8N8Z6	OTTHUMG00000015455	ENST00000338728.5:c.844C>T	6.37:g.117859866C>T	ENSP00000342422:p.Gln282*		Q5H992|Q8IYK5|Q8N7L9|Q96NH2	Nonsense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_LCCL,pfam_CUB_dom,superfamily_Galactose-bd-like,superfamily_LCCL,superfamily_CUB_dom,smart_CUB_dom,smart_LCCL,smart_Coagulation_fac_5/8-C_type_dom,pfscan_CUB_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_LCCL	p.Q282*	ENST00000338728.5	37	c.844		6	.	.	.	.	.	.	.	.	.	.	C	36	5.903296	0.97087	.	.	ENSG00000164465	ENST00000296955;ENST00000338728	.	.	.	4.06	3.15	0.36227	.	0.785305	0.11513	N	0.556505	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-5.6245	8.3176	0.32111	0.0:0.6613:0.2416:0.0971	.	.	.	.	X	282	.	ENSP00000296955:Q282X	Q	+	1	0	DCBLD1	117966559	0.000000	0.05858	0.004000	0.12327	0.941000	0.58515	0.154000	0.16343	2.102000	0.63906	0.462000	0.41574	CAA	DCBLD1	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000164465		0.537	DCBLD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	DCBLD1	HGNC	protein_coding	OTTHUMT00000041979.2	-	0.00	58	0	C	NM_173674		117859866	+1	tier1	-	no_errors	ENST00000338728	ensembl	human	known	74_37	nonsense	41.03	23	16	SNP	0.001	T
DERL3	91319	genome.wustl.edu	37	22	24180922	24180922	+	Silent	SNP	C	C	G			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr22:24180922C>G	ENST00000318109.7	-	2	151	c.135G>C	c.(133-135)ccG>ccC	p.P45P	DERL3_ENST00000464023.1_5'Flank|DERL3_ENST00000404056.1_Intron|DERL3_ENST00000476077.1_Silent_p.P45P|DERL3_ENST00000406855.3_Silent_p.P45P			Q96Q80	DERL3_HUMAN	derlin 3	45					endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of endoplasmic reticulum membrane (GO:0030176)				ovary(1)|prostate(1)|skin(1)	3						ACACAAGGTGCGGGTTGAAGT	0.687																																																	0													21.0	25.0	24.0					22																	24180922		1938	3806	5744	SO:0001819	synonymous_variant	0			AB049213	CCDS33615.1, CCDS42986.1, CCDS46672.1	22q11.23	2012-02-01	2012-02-01	2004-11-02	ENSG00000099958	ENSG00000099958			14236	protein-coding gene	gene with protein product		610305	"""chromosome 22 open reading frame 14"", ""Der1-like domain family, member 3"""	C22orf14		15215855	Standard	NM_198440		Approved	FLJ43842, MGC71803, derlin-3, IZP6	uc002zyk.4	Q96Q80	OTTHUMG00000150743	ENST00000318109.7:c.135G>C	22.37:g.24180922C>G			F2Z3B6|Q6ICJ6|Q6PEX0|Q6ZUB5	Silent	SNP	pfam_DER1	p.P45	ENST00000318109.7	37	c.135	CCDS33615.1	22																																																																																			DERL3	-	pfam_DER1	ENSG00000099958		0.687	DERL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DERL3	HGNC	protein_coding	OTTHUMT00000319905.1	-	0.00	124	0	C	NM_198440		24180922	-1	tier1	-	no_errors	ENST00000318109	ensembl	human	known	74_37	silent	16.36	46	9	SNP	0.994	G
DGKH	160851	genome.wustl.edu	37	13	42784739	42784739	+	Splice_Site	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr13:42784739C>T	ENST00000337343.4	+	24	2873	c.2852C>T	c.(2851-2853)gCc>gTc	p.A951V	DGKH_ENST00000540693.1_Splice_Site_p.A951V|DGKH_ENST00000261491.5_Splice_Site_p.A951V|DGKH_ENST00000538674.1_Splice_Site_p.A706V|DGKH_ENST00000379274.2_Splice_Site_p.A815V|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000536612.1_Splice_Site_p.A815V	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	951					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		TTTAAATAGGCCTTTGAGAGC	0.368																																																	0													89.0	83.0	85.0					13																	42784739		2203	4300	6503	SO:0001630	splice_region_variant	0			AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.2851-1C>T	13.37:g.42784739C>T			A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SAM_type1,superfamily_SAM/pointed,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_SAM,pfscan_Pleckstrin_homology,pfscan_SAM,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.A951V	ENST00000337343.4	37	c.2852	CCDS9381.1	13	.	.	.	.	.	.	.	.	.	.	C	20.4	3.981585	0.74474	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	D;T;D;T;T;T	0.81579	-1.51;-1.34;-1.51;-1.49;-1.49;1.73	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.84397	0.5463	M	0.83118	2.625	0.80722	D	1	B;B;B;B	0.21147	0.047;0.039;0.052;0.005	B;B;B;B	0.29942	0.109;0.068;0.081;0.037	T	0.82430	-0.0461	10	0.48119	T	0.1	.	18.9347	0.92580	0.0:1.0:0.0:0.0	.	706;815;951;951	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	V	951;951;951;815;815;706	ENSP00000440823:A951V;ENSP00000337572:A951V;ENSP00000261491:A951V;ENSP00000368576:A815V;ENSP00000445114:A815V;ENSP00000441308:A706V	ENSP00000261491:A951V	A	+	2	0	DGKH	41682739	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.641000	0.83368	2.554000	0.86153	0.563000	0.77884	GCC	DGKH	-	NULL	ENSG00000102780		0.368	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKH	HGNC	protein_coding	OTTHUMT00000044699.2	-	0.00	72	0	C	NM_178009	Missense_Mutation	42784739	+1	tier1	-	no_errors	ENST00000337343	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
DLX2	1746	genome.wustl.edu	37	2	172967148	172967148	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr2:172967148T>C	ENST00000234198.4	-	1	480	c.119A>G	c.(118-120)aAc>aGc	p.N40S	DLX2_ENST00000466293.2_Missense_Mutation_p.N40S|AC104801.1_ENST00000448117.1_lincRNA	NM_004405.3	NP_004396.1	Q07687	DLX2_HUMAN	distal-less homeobox 2	40					brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|cartilage development (GO:0051216)|cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic cranial skeleton morphogenesis (GO:0048701)|hippocampus development (GO:0021766)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb development (GO:0021772)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded RNA binding (GO:0003727)			endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.216)			gctgctgctgttgcCAcccgg	0.687																																					GBM(188;775 2993 11256 23072)												0													13.0	14.0	13.0					2																	172967148		1938	3807	5745	SO:0001583	missense	0			U51003	CCDS2248.1	2q31.1	2011-06-20	2005-12-22		ENSG00000115844	ENSG00000115844		"""Homeoboxes / ANTP class : NKL subclass"""	2915	protein-coding gene	gene with protein product		126255	"""distal-less homeo box 2"""			1354641	Standard	NM_004405		Approved	TES-1	uc002uhn.3	Q07687	OTTHUMG00000132276	ENST00000234198.4:c.119A>G	2.37:g.172967148T>C	ENSP00000234198:p.Asn40Ser		B4DMK4|B7ZA14	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_Distal-less_N,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.N40S	ENST00000234198.4	37	c.119	CCDS2248.1	2	.	.	.	.	.	.	.	.	.	.	T	1.828	-0.470589	0.04445	.	.	ENSG00000115844	ENST00000234198;ENST00000466293	D;D	0.91686	-2.45;-2.89	3.78	0.793	0.18632	.	0.372870	0.19791	N	0.105987	T	0.76688	0.4022	N	0.08118	0	0.29494	N	0.855433	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.63734	-0.6570	10	0.05959	T	0.93	-3.1839	6.4359	0.21823	0.0:0.6322:0.0:0.3678	.	40;40	B7ZA14;Q07687	.;DLX2_HUMAN	S	40	ENSP00000234198:N40S;ENSP00000446904:N40S	ENSP00000234198:N40S	N	-	2	0	DLX2	172675394	.	.	0.959000	0.39883	0.451000	0.32288	.	.	0.011000	0.14865	-0.366000	0.07423	AAC	DLX2	-	NULL	ENSG00000115844		0.687	DLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX2	HGNC	protein_coding	OTTHUMT00000255368.3		0.00	60	0	T			172967148	-1			no_errors	ENST00000234198	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.992	C
DMD	1756	genome.wustl.edu	37	X	32862923	32862923	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chrX:32862923G>T	ENST00000357033.4	-	4	447	c.241C>A	c.(241-243)Ctg>Atg	p.L81M	DMD_ENST00000288447.4_Missense_Mutation_p.L73M|DMD_ENST00000378677.2_Missense_Mutation_p.L77M	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	81	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AAAACCCGCAGTGCCTTGTTG	0.463																																																	0													194.0	138.0	157.0					X																	32862923		2202	4300	6502	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.241C>A	X.37:g.32862923G>T	ENSP00000354923:p.Leu81Met		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.L81M	ENST00000357033.4	37	c.241	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633495	0.67015	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000288447;ENST00000447523	D;D;D;D	0.98192	-4.78;-4.78;-4.78;-4.78	5.74	4.88	0.63580	Calponin homology domain (5);	0.000000	0.27754	U	0.017996	D	0.98814	0.9600	M	0.82923	2.615	0.80722	D	1	D;D;D;D	0.76494	0.996;0.999;0.984;0.999	D;D;D;D	0.91635	0.969;0.999;0.933;0.999	D	0.99116	1.0848	10	0.59425	D	0.04	.	12.7298	0.57191	0.0825:0.0:0.9175:0.0	.	73;73;81;77	Q4G0X0;P11532-4;P11532;E9PDN5	.;.;DMD_HUMAN;.	M	73;77;81;81;73;44	ENSP00000367948:L77M;ENSP00000354923:L81M;ENSP00000288447:L73M;ENSP00000395904:L44M	ENSP00000288447:L73M	L	-	1	2	DMD	32772844	1.000000	0.71417	0.964000	0.40570	0.981000	0.71138	4.603000	0.61105	1.167000	0.42706	0.600000	0.82982	CTG	DMD	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pirsf_Dystrophin/utrophin,pfscan_CH-domain	ENSG00000198947		0.463	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	-	0.00	54	0	G	NM_004006		32862923	-1	tier1	-	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	20.00	12	3	SNP	0.998	T
DNMT1	1786	genome.wustl.edu	37	19	10257175	10257175	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr19:10257175C>T	ENST00000340748.4	-	27	2933	c.2698G>A	c.(2698-2700)Gct>Act	p.A900T	DNMT1_ENST00000589538.1_5'Flank|DNMT1_ENST00000540357.1_Missense_Mutation_p.A900T|DNMT1_ENST00000359526.4_Missense_Mutation_p.A916T			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	900					cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	CTCATCTCAGCCAGACGGGCA	0.567																																																	0													57.0	57.0	57.0					19																	10257175		2203	4300	6503	SO:0001583	missense	0			X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.2698G>A	19.37:g.10257175C>T	ENSP00000345739:p.Ala900Thr		A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	pirsf_DNA_C5-MeTrfase_1_euk,pfam_C5_MeTfrase,pfam_BAH_dom,pfam_Cytosine_MeTrfase1_RFD,pfam_DMAP1-bd,pfam_Znf_CXXC,smart_BAH_dom,prints_C5_MeTfrase,pfscan_BAH_dom,pfscan_Znf_CXXC	p.A916T	ENST00000340748.4	37	c.2746	CCDS12228.1	19	.	.	.	.	.	.	.	.	.	.	C	12.68	2.010121	0.35415	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748;ENST00000541266	T;T;T	0.23147	1.92;1.92;1.92	5.52	5.52	0.82312	.	0.447213	0.24871	N	0.034932	T	0.26340	0.0643	L	0.48362	1.52	0.35765	D	0.820443	B;B;B	0.09022	0.002;0.002;0.001	B;B;B	0.11329	0.006;0.006;0.002	T	0.15809	-1.0424	10	0.21540	T	0.41	.	18.2103	0.89868	0.0:1.0:0.0:0.0	.	900;916;900	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	T	916;900;900;768	ENSP00000352516:A916T;ENSP00000440457:A900T;ENSP00000345739:A900T	ENSP00000345739:A900T	A	-	1	0	DNMT1	10118175	0.999000	0.42202	0.965000	0.40720	0.993000	0.82548	3.740000	0.55082	2.590000	0.87494	0.655000	0.94253	GCT	DNMT1	-	pirsf_DNA_C5-MeTrfase_1_euk	ENSG00000130816		0.567	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	DNMT1	HGNC	protein_coding	OTTHUMT00000451166.1		0.00	93	0	C	NM_001379		10257175	-1			no_errors	ENST00000359526	ensembl	human	known	74_37	missense	5.45	52	3	SNP	0.894	T
DOCK11	139818	genome.wustl.edu	37	X	117700054	117700054	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chrX:117700054G>A	ENST00000276202.7	+	8	843	c.780G>A	c.(778-780)atG>atA	p.M260I	DOCK11_ENST00000276204.6_Missense_Mutation_p.M260I	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	260	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						AGCAGGAAATGGAGGAATGGT	0.398																																																	0													136.0	135.0	135.0					X																	117700054		2203	4300	6503	SO:0001583	missense	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.780G>A	X.37:g.117700054G>A	ENSP00000276202:p.Met260Ile		A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.M260I	ENST00000276202.7	37	c.780	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	G	25.5	4.642039	0.87859	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.76316	-1.01;-1.01	5.48	5.48	0.80851	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.90755	0.7098	M	0.91561	3.22	0.80722	D	1	D;D	0.65815	0.994;0.995	D;D	0.91635	0.999;0.988	D	0.92249	0.5807	10	0.56958	D	0.05	-11.0256	18.041	0.89319	0.0:0.0:1.0:0.0	.	260;260	A6NIW2;Q5JSL3	.;DOC11_HUMAN	I	260	ENSP00000276204:M260I;ENSP00000276202:M260I	ENSP00000276202:M260I	M	+	3	0	DOCK11	117584082	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.296000	0.77279	0.422000	0.28245	ATG	DOCK11	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000147251		0.398	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	-	0.00	63	0	G	NM_144658		117700054	+1	tier1	-	no_errors	ENST00000276202	ensembl	human	known	74_37	missense	75.47	13	40	SNP	1.000	A
DPY19L2	283417	genome.wustl.edu	37	12	64055262	64055263	+	Splice_Site	INS	-	-	T	rs565018|rs202064990		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr12:64055262_64055263insT	ENST00000324472.4	-	4	634		c.e4-1		RP11-415I12.3_ENST00000509615.2_RNA	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)						multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		AATAAAGTCCCTTTTTTTAAAA	0.257																																																	0																																										SO:0001630	splice_region_variant	0				CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.451-1->A	12.37:g.64055269_64055269dupT			A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Splice_Site	INS	-	e4-1	ENST00000324472.4	37	c.451-2_451-1	CCDS31851.1	12																																																																																			DPY19L2	-	-	ENSG00000177990		0.257	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L2	HGNC	protein_coding	OTTHUMT00000400689.2		0.00	84	0	-	NM_173812	Intron	64055263	-1	tier1		no_errors	ENST00000324472	ensembl	human	known	74_37	splice_site_ins	33.33	58	29	INS	1.000:0.999	T
DSTYK	25778	genome.wustl.edu	37	1	205117394	205117394	+	Silent	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:205117394C>T	ENST00000367162.3	-	12	2571	c.2541G>A	c.(2539-2541)aaG>aaA	p.K847K	DSTYK_ENST00000367161.3_Intron|DSTYK_ENST00000367160.4_Silent_p.K506K	NM_015375.2	NP_056190.1	Q6XUX3	DUSTY_HUMAN	dual serine/threonine and tyrosine protein kinase	847	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to fibroblast growth factor stimulus (GO:0044344)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of kinase activity (GO:0033674)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.K308N(1)|p.K847N(1)		breast(2)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)	14						CCTCAGGGAGCTTGACAGAGC	0.478																																																	2	Substitution - Missense(2)	lung(2)											151.0	138.0	143.0					1																	205117394		2203	4300	6503	SO:0001819	synonymous_variant	0			AF068286	CCDS1451.1, CCDS1452.1	1q32	2008-12-18	2008-12-18	2008-12-18	ENSG00000133059	ENSG00000133059			29043	protein-coding gene	gene with protein product		612666	"""receptor interacting protein kinase 5"""	RIPK5		15178406	Standard	NM_015375		Approved	KIAA0472, DustyPK, RIP5	uc001hbw.3	Q6XUX3	OTTHUMG00000037102	ENST00000367162.3:c.2541G>A	1.37:g.205117394C>T			B7ZL64|O75060|Q17R94|Q5RKT0|Q6IN87|Q6P997|Q86Y03|Q9P1S5	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K847	ENST00000367162.3	37	c.2541	CCDS1451.1	1																																																																																			DSTYK	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000133059		0.478	DSTYK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSTYK	HGNC	protein_coding	OTTHUMT00000090345.1		0.00	46	0	C	NM_015375		205117394	-1			no_errors	ENST00000367162	ensembl	human	known	74_37	silent	6.45	29	2	SNP	1.000	T
ECE2	9718	genome.wustl.edu	37	3	183995996	183995996	+	Silent	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:183995996C>T	ENST00000402825.3	+	6	999	c.999C>T	c.(997-999)aaC>aaT	p.N333N	EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000404464.3_Silent_p.N215N|ECE2_ENST00000359140.4_Silent_p.N186N|ECE2_ENST00000357474.5_Silent_p.N261N	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	333	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ACCAGGACAACTTTATGGAGG	0.517																																																	0													88.0	86.0	86.0					3																	183995996		2203	4300	6503	SO:0001819	synonymous_variant	0			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.999C>T	3.37:g.183995996C>T			A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Silent	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,pfam_Methyltransf_11,prints_Peptidase_M13_C	p.N333	ENST00000402825.3	37	c.999	CCDS3256.2	3																																																																																			ECE2	-	pfam_Peptidase_M13_N	ENSG00000145194		0.517	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	HGNC	protein_coding	OTTHUMT00000318874.3	-	0.00	61	0	C	NM_014693		183995996	+1	tier1	-	no_errors	ENST00000402825	ensembl	human	known	74_37	silent	38.64	27	17	SNP	1.000	T
ENKD1	84080	genome.wustl.edu	37	16	67697103	67697103	+	Silent	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr16:67697103G>A	ENST00000243878.4	-	7	1323	c.1002C>T	c.(1000-1002)atC>atT	p.I334I	ENKD1_ENST00000602409.1_5'Flank|ACD_ENST00000393919.4_5'Flank|ENKD1_ENST00000602644.1_3'UTR|ACD_ENST00000219251.8_5'Flank	NM_032140.1	NP_115516.1	Q9H0I2	ENKD1_HUMAN	enkurin domain containing 1	334	Enkurin. {ECO:0000255|PROSITE- ProRule:PRU01000}.					cytoplasmic microtubule (GO:0005881)|microtubule cytoskeleton (GO:0015630)											GCCGAGAAAAGATCTTGATGG	0.597																																																	0													96.0	79.0	85.0					16																	67697103		2198	4300	6498	SO:0001819	synonymous_variant	0			BC008284	CCDS10844.1	16q22.1	2012-10-09	2012-10-09	2012-10-09	ENSG00000124074	ENSG00000124074			25246	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 48"""	C16orf48		11230166	Standard	NM_032140		Approved	DKFZP434A1319	uc002etw.1	Q9H0I2	OTTHUMG00000137550	ENST00000243878.4:c.1002C>T	16.37:g.67697103G>A			Q6UWD7	Silent	SNP	NULL	p.I334	ENST00000243878.4	37	c.1002	CCDS10844.1	16																																																																																			ENKD1	-	NULL	ENSG00000124074		0.597	ENKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENKD1	HGNC	protein_coding	OTTHUMT00000268884.1	-	0.00	68	0	G	NM_032140		67697103	-1	tier1	-	no_errors	ENST00000243878	ensembl	human	known	74_37	silent	54.55	20	24	SNP	0.999	A
CDH13	1012	genome.wustl.edu	37	16	82875766	82875766	+	Intron	SNP	T	T	C	rs199719992		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr16:82875766T>C	ENST00000566620.1	+	2	335				RN7SL134P_ENST00000579756.1_RNA|CDH13_ENST00000567445.1_Intron|CDH13_ENST00000446376.2_Intron|CDH13_ENST00000565636.1_Intron|CDH13_ENST00000268613.10_Intron|CDH13_ENST00000428848.3_Intron|CDH13_ENST00000431540.3_Intron|AC099506.1_ENST00000408468.1_RNA	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13						adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		tatatatatatatacacacac	0.229																																																	0																																										SO:0001627	intron_variant	0			U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.46-16201T>C	16.37:g.82875766T>C			A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	RNA	SNP	-	NULL	ENST00000566620.1	37	NULL	CCDS58486.1	16																																																																																			AC099506.1	-	-	ENSG00000221395		0.229	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221395	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000432917.1	-	0.00	29	0	T	NM_001257		82875766	+1	tier1	-	no_errors	ENST00000408468	ensembl	human	novel	74_37	rna	75.00	2	6	SNP	0.000	C
MNT	4335	genome.wustl.edu	37	17	2288155	2288155	+	3'UTR	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr17:2288155C>T	ENST00000174618.4	-	0	4194				RP1-59D14.1_ENST00000571775.1_RNA|MNT_ENST00000575374.1_5'Flank	NM_020310.2	NP_064706.1	Q99583	MNT_HUMAN	MAX network transcriptional repressor						cell aging (GO:0007569)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cell cycle (GO:0051726)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			endometrium(4)|large_intestine(5)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	12				Colorectal(2;1.37e-05)|READ - Rectum adenocarcinoma(2;8.68e-05)		TGCTGGGGGACAGGGACGGGG	0.612																																																	0																																										SO:0001624	3_prime_UTR_variant	0			Y13444	CCDS11018.1	17p13.3	2013-11-15	2013-11-15		ENSG00000070444	ENSG00000070444		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7188	protein-coding gene	gene with protein product	"""myc antagonist"", ""Max-interacting protein"""	603039	"""MAX binding protein"", ""MNT, MAX dimerization protein"""			9598315	Standard	NM_020310		Approved	ROX, MXD6, MAD6, bHLHd3	uc002fur.3	Q99583	OTTHUMG00000090603	ENST00000174618.4:c.*2040G>A	17.37:g.2288155C>T			A8K6D1|D3DTI7|Q1ED38	RNA	SNP	-	NULL	ENST00000174618.4	37	NULL	CCDS11018.1	17																																																																																			RP1-59D14.1	-	-	ENSG00000262456		0.612	MNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000262456	Clone_based_vega_gene	protein_coding	OTTHUMT00000207158.1	-	0.00	25	0	C	NM_020310		2288155	+1	tier1	-	no_errors	ENST00000571775	ensembl	human	known	74_37	rna	40.00	27	18	SNP	0.000	T
TTN	7273	genome.wustl.edu	37	2	179442292	179442292	+	Intron	SNP	T	T	A	rs148238009	byFrequency	TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr2:179442292T>A	ENST00000591111.1	-	273	64126				TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000456053.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000589042.1_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAATTTGCTTTAAAAAAAAAA	0.353																																																	0													49.0	44.0	46.0					2																	179442292		1808	4064	5872	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.63901+36A>T	2.37:g.179442292T>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	RNA	SNP	-	NULL	ENST00000591111.1	37	NULL		2																																																																																			RP11-171I2.5	-	-	ENSG00000271011		0.353	TTN-019	PUTATIVE	basic	protein_coding	ENSG00000271011	Clone_based_vega_gene	protein_coding	OTTHUMT00000460310.1	-	0.00	57	0	T	NM_133378		179442292	+1	tier1	-	no_errors	ENST00000604215	ensembl	human	known	74_37	rna	7.41	50	4	SNP	0.663	A
BMS1P4	729096	genome.wustl.edu	37	10	75463858	75463858	+	RNA	SNP	A	A	C			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr10:75463858A>C	ENST00000399449.3	-	0	1480				RNA5SP320_ENST00000516263.1_RNA|RP11-574K11.29_ENST00000415917.2_lincRNA|RP11-574K11.28_ENST00000580790.1_RNA																							GTCTCTCATGATCCCAGGCAG	0.428																																																	0																																												0																															10.37:g.75463858A>C				RNA	SNP	-	NULL	ENST00000399449.3	37	NULL		10																																																																																			RP11-574K11.29	-	-	ENSG00000272140		0.428	RP11-464F9.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000272140	Clone_based_vega_gene	processed_transcript	OTTHUMT00000048674.2	-	0.00	110	0	A			75463858	-1	tier1	-	no_errors	ENST00000415917	ensembl	human	known	74_37	rna	27.87	44	17	SNP	0.174	C
ENTHD1	150350	genome.wustl.edu	37	22	40283492	40283492	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr22:40283492C>A	ENST00000325157.6	-	2	511	c.261G>T	c.(259-261)aaG>aaT	p.K87N		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	87	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.									breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					GAATAACTTTCTTTGATCCAT	0.403																																																	0													153.0	156.0	155.0					22																	40283492		2203	4300	6503	SO:0001583	missense	0			AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.261G>T	22.37:g.40283492C>A	ENSP00000317431:p.Lys87Asn		B0QYD5|Q5H9F7|Q96LK3	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_VHS,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.K87N	ENST00000325157.6	37	c.261	CCDS13998.1	22	.	.	.	.	.	.	.	.	.	.	C	12.37	1.919047	0.33908	.	.	ENSG00000176177	ENST00000325157	T	0.43294	0.95	5.42	0.761	0.18448	Epsin domain, N-terminal (1);ENTH/VHS (2);Epsin-like, N-terminal (2);	0.329918	0.28349	N	0.015677	T	0.19967	0.0480	N	0.10874	0.06	0.28867	N	0.895178	B	0.14805	0.011	B	0.18561	0.022	T	0.10567	-1.0624	10	0.62326	D	0.03	-5.7057	4.9004	0.13771	0.1083:0.6047:0.1057:0.1813	.	87	Q8IYW4	ENTD1_HUMAN	N	87	ENSP00000317431:K87N	ENSP00000317431:K87N	K	-	3	2	ENTHD1	38613438	1.000000	0.71417	0.919000	0.36401	0.851000	0.48451	1.289000	0.33307	0.316000	0.23135	-0.872000	0.02987	AAG	ENTHD1	-	pfam_Epsin_dom_N,pfam_VHS,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	ENSG00000176177		0.403	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTHD1	HGNC	protein_coding	OTTHUMT00000321302.1	-	0.00	44	0	C	NM_152512		40283492	-1	tier1	-	no_errors	ENST00000325157	ensembl	human	known	74_37	missense	32.35	23	11	SNP	0.887	A
ETNK2	55224	genome.wustl.edu	37	1	204101362	204101362	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:204101362G>T	ENST00000367202.4	-	8	1261	c.1111C>A	c.(1111-1113)Cag>Aag	p.Q371K	RP11-74C13.4_ENST00000565388.1_RNA|ETNK2_ENST00000367198.2_Missense_Mutation_p.Q193K|ETNK2_ENST00000367201.3_3'UTR|ETNK2_ENST00000367197.1_Missense_Mutation_p.Q53K|ETNK2_ENST00000367199.2_Missense_Mutation_p.Q302K	NM_018208.2	NP_060678.2	Q9NVF9	EKI2_HUMAN	ethanolamine kinase 2	371					glycerophospholipid biosynthetic process (GO:0046474)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|placenta development (GO:0001890)|post-embryonic development (GO:0009791)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)			breast(1)|central_nervous_system(1)|large_intestine(4)|ovary(1)	7	all_cancers(21;0.032)|Breast(84;0.116)|all_epithelial(62;0.196)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			TTGAAGTACTGGTTGAATCGG	0.572																																																	0													68.0	66.0	67.0					1																	204101362		1564	3578	5142	SO:0001583	missense	0			AK001623	CCDS1442.2, CCDS73006.1	1q32.1	2008-02-05			ENSG00000143845	ENSG00000143845			25575	protein-coding gene	gene with protein product		609859				12477932	Standard	XM_005245302		Approved	FLJ10761, EKI2	uc001hao.4	Q9NVF9	OTTHUMG00000036061	ENST00000367202.4:c.1111C>A	1.37:g.204101362G>T	ENSP00000356170:p.Gln371Lys		B7Z7K1|Q5SXX5|Q68CK3|Q96G05	Missense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom	p.Q371K	ENST00000367202.4	37	c.1111	CCDS1442.2	1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.202896	0.79127	.	.	ENSG00000143845	ENST00000367202;ENST00000367199;ENST00000455266;ENST00000367198;ENST00000367197	T;T;T;T	0.62364	0.03;0.03;0.03;0.03	5.11	5.11	0.69529	Protein kinase-like domain (1);	.	.	.	.	T	0.73567	0.3603	M	0.86028	2.79	0.44247	D	0.997091	P;P	0.42483	0.732;0.781	P;B	0.47915	0.561;0.358	T	0.77723	-0.2481	9	0.52906	T	0.07	.	15.4511	0.75274	0.0:0.0:1.0:0.0	.	330;371	Q9NVF9-3;Q9NVF9	.;EKI2_HUMAN	K	371;302;237;193;53	ENSP00000356170:Q371K;ENSP00000356167:Q302K;ENSP00000356166:Q193K;ENSP00000356165:Q53K	ENSP00000356165:Q53K	Q	-	1	0	ETNK2	202367985	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.704000	0.68347	2.378000	0.81104	0.655000	0.94253	CAG	ETNK2	-	superfamily_Kinase-like_dom	ENSG00000143845		0.572	ETNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETNK2	HGNC	protein_coding	OTTHUMT00000087893.1	-	0.00	38	0	G	NM_018208		204101362	-1	tier1	-	no_errors	ENST00000367202	ensembl	human	known	74_37	missense	15.00	17	3	SNP	1.000	T
FAM120A	23196	genome.wustl.edu	37	9	96294581	96294581	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr9:96294581G>T	ENST00000277165.6	+	10	2073	c.1879G>T	c.(1879-1881)Gct>Tct	p.A627S	FAM120A_ENST00000475933.1_3'UTR|FAM120A_ENST00000340893.4_Missense_Mutation_p.A627S|FAM120A_ENST00000333936.5_Missense_Mutation_p.A655S	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	627						cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TGAGAGACTTGCTTTTAGAAA	0.443																																																	0													111.0	108.0	109.0					9																	96294581		2203	4300	6503	SO:0001583	missense	0			AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.1879G>T	9.37:g.96294581G>T	ENSP00000277165:p.Ala627Ser		A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Missense_Mutation	SNP	NULL	p.A655S	ENST00000277165.6	37	c.1963	CCDS6706.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.8|29.8	5.040770|5.040770	0.93685|0.93685	.|.	.|.	ENSG00000048828|ENSG00000048828	ENST00000277165;ENST00000333936;ENST00000340893;ENST00000427765|ENST00000446420	T;T;T;T|.	0.53423|.	0.62;0.62;0.62;0.62|.	5.99|5.99	5.99|5.99	0.97316|0.97316	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.69333|0.69333	0.3099|0.3099	L|L	0.44542|0.44542	1.39|1.39	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D;B|.	0.71674|.	0.998;0.979;0.996;0.188|.	D;P;D;B|.	0.80764|.	0.994;0.889;0.99;0.232|.	T|T	0.62253|0.62253	-0.6893|-0.6893	10|6	0.48119|0.31617	T|T	0.1|0.26	-10.8167|-10.8167	20.4777|20.4777	0.99188|0.99188	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	627;655;627;627|.	Q9NZB2-4;Q9NZB2-6;Q9NZB2-5;Q9NZB2|.	.;.;.;F120A_HUMAN|.	S|F	627;655;627;49|469	ENSP00000277165:A627S;ENSP00000334918:A655S;ENSP00000344698:A627S;ENSP00000412440:A49S|.	ENSP00000277165:A627S|ENSP00000396534:L469F	A|L	+|+	1|3	0|2	FAM120A|FAM120A	95334402|95334402	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	8.517000|8.517000	0.90555|0.90555	2.840000|2.840000	0.97914|0.97914	0.655000|0.655000	0.94253|0.94253	GCT|TTG	FAM120A	-	NULL	ENSG00000048828		0.443	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM120A	HGNC	protein_coding	OTTHUMT00000053160.2	-	0.00	78	0	G	NM_014612		96294581	+1	tier1	-	no_errors	ENST00000333936	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
FAM131C	348487	genome.wustl.edu	37	1	16385063	16385064	+	Frame_Shift_Ins	INS	-	-	G			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:16385063_16385064insG	ENST00000375662.4	-	7	894_895	c.711_712insC	c.(709-714)cccagcfs	p.S238fs	FAM131C_ENST00000494078.1_5'UTR	NM_182623.2	NP_872429.2	Q96AQ9	F131C_HUMAN	family with sequence similarity 131, member C	238	Pro-rich.									large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		AGCTCTGGGCTGGGGGGCTGCG	0.733																																																	0																																										SO:0001589	frameshift_variant	0				CCDS41270.1	1p36.13	2008-02-05	2007-03-20	2007-03-20	ENSG00000185519	ENSG00000185519			26717	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 117"""	C1orf117		12477932	Standard	NM_182623		Approved	FLJ36766	uc001axz.4	Q96AQ9	OTTHUMG00000009525	ENST00000375662.4:c.712dupC	1.37:g.16385069_16385069dupG	ENSP00000364814:p.Ser238fs		Q5T5Q5|Q8N3X3|Q8N9P9	Frame_Shift_Ins	INS	superfamily_Chromodomain-like	p.S237fs	ENST00000375662.4	37	c.712_711	CCDS41270.1	1																																																																																			FAM131C	-	NULL	ENSG00000185519		0.733	FAM131C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM131C	HGNC	protein_coding	OTTHUMT00000026319.1		0.00	66	0	-	NM_182623		16385064	-1	tier1		no_errors	ENST00000375662	ensembl	human	known	74_37	frame_shift_ins	22.86	27	8	INS	0.458:0.335	G
FAM172A	83989	genome.wustl.edu	37	5	93410402	93410402	+	Missense_Mutation	SNP	G	G	T	rs143516571		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr5:93410402G>T	ENST00000395965.3	-	2	197	c.55C>A	c.(55-57)Caa>Aaa	p.Q19K	FAM172A_ENST00000509163.1_Intron|FAM172A_ENST00000505869.1_Intron|FAM172A_ENST00000504768.2_5'UTR|FAM172A_ENST00000509739.1_5'UTR	NM_032042.5	NP_114431.2	Q8WUF8	F172A_HUMAN	family with sequence similarity 172, member A	19						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)		p.Q19E(1)		endometrium(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	9						TGCTGGATTTGTGCCATGTTT	0.343																																																	1	Substitution - Missense(1)	lung(1)						G	,,LYS/GLN	1,4405	2.1+/-5.4	0,1,2202	129.0	118.0	122.0		,,55	5.9	1.0	5	dbSNP_134	122	0,8600		0,0,4300	no	intron,intron,missense	FAM172A	NM_001163417.1,NM_001163418.1,NM_032042.5	,,53	0,1,6502	TT,TG,GG		0.0,0.0227,0.0077	,,possibly-damaging	,,19/417	93410402	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS4069.1, CCDS54879.1, CCDS54880.1	5q15	2008-06-16	2008-06-16	2008-06-16	ENSG00000113391	ENSG00000113391			25365	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 21"""	C5orf21		11230166	Standard	NM_032042		Approved	DKFZP564D172	uc010jbd.3	Q8WUF8	OTTHUMG00000131329	ENST00000395965.3:c.55C>A	5.37:g.93410402G>T	ENSP00000379294:p.Gln19Lys		B2R7C6|B4DJ14|B4DLG5|Q9H0U8	Missense_Mutation	SNP	pfam_Arb2_domain	p.Q19K	ENST00000395965.3	37	c.55	CCDS4069.1	5	.	.	.	.	.	.	.	.	.	.	G	23.5	4.425971	0.83667	2.27E-4	0.0	ENSG00000113391	ENST00000395965	T	0.45276	0.9	5.87	5.87	0.94306	.	0.283030	0.39985	N	0.001202	T	0.38957	0.1060	L	0.54323	1.7	0.80722	D	1	B;B	0.29037	0.231;0.058	B;B	0.24701	0.054;0.055	T	0.15407	-1.0438	10	0.15952	T	0.53	-1.5904	17.1159	0.86688	0.0:0.0:1.0:0.0	.	19;19	Q8WUF8;Q8WUF8-2	F172A_HUMAN;.	K	19	ENSP00000379294:Q19K	ENSP00000379294:Q19K	Q	-	1	0	FAM172A	93436158	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.177000	0.58276	2.775000	0.95449	0.650000	0.86243	CAA	FAM172A	-	NULL	ENSG00000113391		0.343	FAM172A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM172A	HGNC	protein_coding	OTTHUMT00000254100.3		0.00	69	0	G	NM_032042		93410402	-1			no_errors	ENST00000395965	ensembl	human	known	74_37	missense	5.13	36	2	SNP	1.000	T
FAM175B	23172	genome.wustl.edu	37	10	126517363	126517363	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr10:126517363G>T	ENST00000298492.5	+	6	542	c.497G>T	c.(496-498)gGa>gTa	p.G166V		NM_032182.3	NP_115558.3	Q15018	F175B_HUMAN	family with sequence similarity 175, member B	166					cellular response to freezing (GO:0071497)	BRISC complex (GO:0070552)|cytoplasm (GO:0005737)	polyubiquitin binding (GO:0031593)			NS(1)	1						CCCAATCTAGGAAATACTAGC	0.363																																																	0													103.0	97.0	99.0					10																	126517363		2203	4300	6503	SO:0001583	missense	0			D63877	CCDS31308.2	10q26.2	2013-01-24	2008-07-02	2008-07-02	ENSG00000165660	ENSG00000165660			28975	protein-coding gene	gene with protein product	"""Abraxas brother"""	611144	"""KIAA0157"""	KIAA0157		8590280	Standard	NM_032182		Approved	Em:AC068896.4, ABRO1	uc001lib.4	Q15018	OTTHUMG00000019218	ENST00000298492.5:c.497G>T	10.37:g.126517363G>T	ENSP00000298492:p.Gly166Val		B4DKR2|Q96H11	Missense_Mutation	SNP	prints_FAM175_BRISC_cplx_Abro1_su,prints_FAM175	p.G166V	ENST00000298492.5	37	c.497	CCDS31308.2	10	.	.	.	.	.	.	.	.	.	.	G	29.2	4.985861	0.93044	.	.	ENSG00000165660	ENST00000298492	T	0.46451	0.87	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.68906	0.3052	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69803	-0.5046	10	0.87932	D	0	-15.3879	20.5948	0.99439	0.0:0.0:1.0:0.0	.	166	Q15018	F175B_HUMAN	V	166	ENSP00000298492:G166V	ENSP00000298492:G166V	G	+	2	0	FAM175B	126507353	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.399000	0.97285	2.873000	0.98535	0.563000	0.77884	GGA	FAM175B	-	prints_FAM175	ENSG00000165660		0.363	FAM175B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM175B	HGNC	protein_coding	OTTHUMT00000050891.2	-	0.00	88	0	G	NM_032182		126517363	+1	tier1	-	no_errors	ENST00000298492	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
FAM181A	90050	genome.wustl.edu	37	14	94394682	94394682	+	Silent	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr14:94394682G>A	ENST00000267594.5	+	3	544	c.237G>A	c.(235-237)gcG>gcA	p.A79A	FAM181A-AS1_ENST00000554742.1_RNA|FAM181A_ENST00000556222.1_Silent_p.A17A|FAM181A_ENST00000557000.2_Silent_p.A17A|FAM181A_ENST00000557719.1_Silent_p.A17A	NM_001207073.1|NM_001207074.1|NM_138344.4	NP_001194002.1|NP_001194003.1|NP_612353.3	Q8N9Y4	F181A_HUMAN	family with sequence similarity 181, member A	79										cervix(1)|endometrium(2)|large_intestine(8)|lung(4)|prostate(1)|skin(2)	18						TGAACCTGGCGTCCAGCGACA	0.597																																																	0													80.0	70.0	74.0					14																	94394682		2203	4300	6503	SO:0001819	synonymous_variant	0			BC009073	CCDS9914.1, CCDS55939.1	14q32.12	2011-11-30	2008-07-22	2008-07-22	ENSG00000140067	ENSG00000140067			20491	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 152"""	C14orf152			Standard	NM_138344		Approved		uc021saz.1	Q8N9Y4	OTTHUMG00000171297	ENST00000267594.5:c.237G>A	14.37:g.94394682G>A			B2RD39|Q96GY1	Silent	SNP	NULL	p.A79	ENST00000267594.5	37	c.237	CCDS9914.1	14																																																																																			FAM181A	-	NULL	ENSG00000140067		0.597	FAM181A-001	KNOWN	basic|CCDS	protein_coding	FAM181A	HGNC	protein_coding	OTTHUMT00000412840.1	-	0.00	65	0	G	NM_138344		94394682	+1	tier1	-	no_errors	ENST00000267594	ensembl	human	known	74_37	silent	33.33	26	13	SNP	0.071	A
FAM184B	27146	genome.wustl.edu	37	4	17661603	17661603	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr4:17661603T>G	ENST00000265018.3	-	9	2014	c.1802A>C	c.(1801-1803)cAg>cCg	p.Q601P		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	601										NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						TTTGGCCTTCTGGCTTTGCCA	0.527																																																	0													112.0	100.0	104.0					4																	17661603		692	1591	2283	SO:0001583	missense	0				CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.1802A>C	4.37:g.17661603T>G	ENSP00000265018:p.Gln601Pro			Missense_Mutation	SNP	NULL	p.Q601P	ENST00000265018.3	37	c.1802	CCDS47033.1	4	.	.	.	.	.	.	.	.	.	.	T	20.0	3.929940	0.73327	.	.	ENSG00000047662	ENST00000265018	T	0.33654	1.4	5.36	5.36	0.76844	.	0.341131	0.26879	N	0.022030	T	0.50718	0.1632	L	0.60455	1.87	0.29908	N	0.823792	D	0.57899	0.981	P	0.58970	0.849	T	0.54323	-0.8311	10	0.51188	T	0.08	-31.3722	12.8747	0.57984	0.0:0.0:0.0:1.0	.	601	Q9ULE4	F184B_HUMAN	P	601	ENSP00000265018:Q601P	ENSP00000265018:Q601P	Q	-	2	0	FAM184B	17270701	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.850000	0.55918	2.013000	0.59113	0.460000	0.39030	CAG	FAM184B	-	NULL	ENSG00000047662		0.527	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM184B	HGNC	protein_coding	OTTHUMT00000360137.1	-	0.00	71	0	T	NM_015688		17661603	-1	tier1	-	no_errors	ENST00000265018	ensembl	human	known	74_37	missense	12.50	49	7	SNP	1.000	G
FAM84A	151354	genome.wustl.edu	37	2	14789551	14789551	+	3'UTR	SNP	C	C	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr2:14789551C>A	ENST00000497769.1	+	0	666				AC011897.1_ENST00000581929.1_3'UTR			Q96KN4	FA84A_HUMAN	family with sequence similarity 84, member A											endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(1;0.00969)			CTCTTTTCAGCAACCATATCC	0.507																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ417080, BC026346	CCDS1684.1	2p24.3	2005-08-09			ENSG00000162981	ENSG00000162981			20743	protein-coding gene	gene with protein product	"""neurological/sensory 1"""	611234				14702039	Standard	NM_145175		Approved	NSE1, FLJ35392	uc002rbz.2	Q96KN4	OTTHUMG00000119093	ENST00000497769.1:c.*663C>A	2.37:g.14789551C>A			A6NP76|Q86UZ2|Q8NAH7|Q8TAM5	RNA	SNP	-	NULL	ENST00000497769.1	37	NULL		2																																																																																			FAM84A	-	-	ENSG00000162981		0.507	FAM84A-003	KNOWN	basic	processed_transcript	FAM84A	HGNC	protein_coding	OTTHUMT00000323612.1	-	0.00	96	0	C	NM_145175		14789551	+1	tier1	-	no_errors	ENST00000464947	ensembl	human	known	74_37	rna	40.00	36	24	SNP	0.002	A
FBXO31	79791	genome.wustl.edu	37	16	87380786	87380786	+	Silent	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr16:87380786G>A	ENST00000311635.7	-	3	495	c.483C>T	c.(481-483)aaC>aaT	p.N161N		NM_001282683.1|NM_024735.3	NP_001269612.1|NP_079011.3	Q5XUX0	FBX31_HUMAN	F-box protein 31	161					cellular response to DNA damage stimulus (GO:0006974)|cyclin catabolic process (GO:0008054)|mitotic G1 DNA damage checkpoint (GO:0031571)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0272)		TTACCACCACGTTCAGCAGTC	0.557																																																	0													193.0	171.0	179.0					16																	87380786		2198	4300	6498	SO:0001819	synonymous_variant	0			BC002985	CCDS32501.1, CCDS73922.1	16q24	2008-12-18	2004-05-27			ENSG00000103264		"""F-boxes /  ""other"""""	16510	protein-coding gene	gene with protein product		609102	"""F-box only protein 31"""				Standard	NM_024735		Approved	FBX14, FBXO14, Fbx31, MGC15419	uc002fjw.3	Q5XUX0		ENST00000311635.7:c.483C>T	16.37:g.87380786G>A			Q5K680|Q8WYV1|Q96D73|Q9UFV4	Silent	SNP	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.N161	ENST00000311635.7	37	c.483	CCDS32501.1	16																																																																																			FBXO31	-	NULL	ENSG00000103264		0.557	FBXO31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO31	HGNC	protein_coding	OTTHUMT00000430799.2	-	0.00	39	0	G	NM_024735		87380786	-1	tier1	-	no_errors	ENST00000311635	ensembl	human	known	74_37	silent	76.47	4	13	SNP	0.998	A
FCRL1	115350	genome.wustl.edu	37	1	157773875	157773875	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:157773875G>T	ENST00000368176.3	-	3	146	c.79C>A	c.(79-81)Cat>Aat	p.H27N	FCRL1_ENST00000358292.3_Missense_Mutation_p.H27N|FCRL1_ENST00000489998.1_5'UTR|FCRL1_ENST00000491942.1_Missense_Mutation_p.H27N	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	27	Ig-like C2-type 1.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TCTGTGGGATGGGAGGGGCTG	0.498																																					GBM(54;482 1003 11223 30131 35730)												0													67.0	74.0	71.0					1																	157773875		2203	4300	6503	SO:0001583	missense	0			BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.79C>A	1.37:g.157773875G>T	ENSP00000357158:p.His27Asn		B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.H27N	ENST00000368176.3	37	c.79	CCDS1170.1	1	.	.	.	.	.	.	.	.	.	.	G	8.211	0.800429	0.16397	.	.	ENSG00000163534	ENST00000358292;ENST00000368176;ENST00000491942	T;T;T	0.11604	2.76;2.76;2.76	4.55	0.356	0.16074	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.191250	0.02035	N	0.048830	T	0.03564	0.0102	L	0.39898	1.24	0.09310	N	1	B;B;B	0.25272	0.122;0.032;0.0	B;B;B	0.34536	0.185;0.066;0.001	T	0.41538	-0.9503	10	0.33940	T	0.23	.	3.6705	0.08272	0.19:0.0:0.4759:0.3342	.	27;27;27	Q96LA6-3;Q96LA6-2;Q96LA6	.;.;FCRL1_HUMAN	N	27	ENSP00000351039:H27N;ENSP00000357158:H27N;ENSP00000418130:H27N	ENSP00000351039:H27N	H	-	1	0	FCRL1	156040499	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.127000	0.10547	-0.008000	0.14320	0.655000	0.94253	CAT	FCRL1	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000163534		0.498	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL1	HGNC	protein_coding	OTTHUMT00000051401.1		0.00	86	0	G	NM_052938		157773875	-1			no_errors	ENST00000368176	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.000	T
FGF5	2250	genome.wustl.edu	37	4	81196110	81196110	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr4:81196110G>T	ENST00000312465.7	+	2	629	c.403G>T	c.(403-405)Gga>Tga	p.G135*	FGF5_ENST00000503413.1_3'UTR|FGF5_ENST00000456523.3_Intron	NM_004464.3	NP_004455.2	P12034	FGF5_HUMAN	fibroblast growth factor 5	135					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell differentiation (GO:0010001)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction involved in regulation of gene expression (GO:0023019)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	fibroblast growth factor receptor binding (GO:0005104)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22						AGGAATACGAGGAGTTTTCAG	0.338																																																	0													94.0	96.0	96.0					4																	81196110		2203	4300	6503	SO:0001587	stop_gained	0			M23534	CCDS3586.1, CCDS34021.1	4q21	2014-01-30			ENSG00000138675	ENSG00000138675		"""Endogenous ligands"""	3683	protein-coding gene	gene with protein product		165190				3211147, 2577873	Standard	NM_001291812		Approved		uc003hmd.3	P12034	OTTHUMG00000130288	ENST00000312465.7:c.403G>T	4.37:g.81196110G>T	ENSP00000311697:p.Gly135*		B2R554|O75846|Q3Y8M3|Q8NF90	Nonsense_Mutation	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	p.G135*	ENST00000312465.7	37	c.403	CCDS34021.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.533899	0.96460	.	.	ENSG00000138675	ENST00000312465	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.7147	0.96110	0.0:0.0:1.0:0.0	.	.	.	.	X	135	.	ENSP00000311697:G135X	G	+	1	0	FGF5	81415134	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.049000	0.93837	2.732000	0.93576	0.591000	0.81541	GGA	FGF5	-	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	ENSG00000138675		0.338	FGF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF5	HGNC	protein_coding	OTTHUMT00000252627.2	-	0.00	129	0	G			81196110	+1	tier1	-	no_errors	ENST00000312465	ensembl	human	known	74_37	nonsense	7.02	53	4	SNP	1.000	T
DMBT1P1	375940	genome.wustl.edu	37	10	124558447	124558447	+	RNA	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr10:124558447G>T	ENST00000439464.2	+	0	3743					NR_003570.1																						CACGTGGTCTGCAGGCAGCTG	0.627																																																	0																																												0																															10.37:g.124558447G>T				RNA	SNP	-	NULL	ENST00000439464.2	37	NULL		10																																																																																			RP11-318C4.2	-	-	ENSG00000176584		0.627	RP11-318C4.2-001	KNOWN	basic	processed_transcript	FLJ46361	Clone_based_vega_gene	pseudogene	OTTHUMT00000471298.1	-	0.00	103	0	G			124558447	+1	tier1	-	no_errors	ENST00000605982	ensembl	human	known	74_37	rna	21.67	47	13	SNP	1.000	T
FLNB	2317	genome.wustl.edu	37	3	58092574	58092574	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:58092574G>T	ENST00000295956.4	+	12	2080	c.1915G>T	c.(1915-1917)Gcc>Tcc	p.A639S	FLNB_ENST00000493452.1_Missense_Mutation_p.A470S|FLNB_ENST00000357272.4_Missense_Mutation_p.A639S|FLNB_ENST00000490882.1_Missense_Mutation_p.A639S|FLNB_ENST00000348383.5_Missense_Mutation_p.A639S|FLNB_ENST00000419752.2_Missense_Mutation_p.A470S|FLNB_ENST00000429972.2_Missense_Mutation_p.A639S|FLNB_ENST00000358537.3_Missense_Mutation_p.A639S	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	639					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		CATCCACCCAGCCACGGGAGG	0.557																																																	0													119.0	87.0	98.0					3																	58092574		2203	4300	6503	SO:0001583	missense	0			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.1915G>T	3.37:g.58092574G>T	ENSP00000295956:p.Ala639Ser		B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.A639S	ENST00000295956.4	37	c.1915	CCDS2885.1	3	.	.	.	.	.	.	.	.	.	.	G	16.82	3.227956	0.58777	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.91011	-2.77;-2.77;-2.77;-2.77;-2.77;-2.77;-2.77;-2.77	5.92	4.12	0.48240	Immunoglobulin E-set (1);	0.095222	0.64402	D	0.000001	D	0.89019	0.6596	L	0.61218	1.895	0.46298	D	0.998975	B;P;B;B;B;B	0.41450	0.364;0.75;0.249;0.399;0.249;0.249	B;B;B;B;B;B	0.43155	0.209;0.41;0.103;0.287;0.103;0.103	D	0.87179	0.2226	10	0.35671	T	0.21	.	10.8486	0.46757	0.0669:0.0:0.8012:0.1319	.	639;639;470;470;639;639	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	S	639;639;639;639;639;639;470;470	ENSP00000295956:A639S;ENSP00000420213:A639S;ENSP00000351339:A639S;ENSP00000415599:A639S;ENSP00000232447:A639S;ENSP00000349819:A639S;ENSP00000418510:A470S;ENSP00000414532:A470S	ENSP00000295956:A639S	A	+	1	0	FLNB	58067614	1.000000	0.71417	0.411000	0.26484	0.915000	0.54546	5.518000	0.67068	1.513000	0.48852	0.650000	0.86243	GCC	FLNB	-	superfamily_Ig_E-set,smart_Filamin	ENSG00000136068		0.557	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLNB	HGNC	protein_coding	OTTHUMT00000353569.1		0.00	31	0	G	NM_001457		58092574	+1			no_errors	ENST00000295956	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.923	T
FRMD3	257019	genome.wustl.edu	37	9	86153075	86153075	+	Silent	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr9:86153075G>A	ENST00000304195.3	-	1	278	c.72C>T	c.(70-72)agC>agT	p.S24S	FRMD3_ENST00000376438.1_Silent_p.S24S	NM_001244960.1|NM_174938.5	NP_001231889.1|NP_777598.3	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	24						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	30						GCGATTTGACGCTGGAGCTCC	0.642																																																	0													27.0	32.0	30.0					9																	86153075		2085	4216	6301	SO:0001819	synonymous_variant	0			AK094281	CCDS43840.1, CCDS59131.1, CCDS59132.1, CCDS59133.1, CCDS75852.1	9q21.33	2008-02-05			ENSG00000172159	ENSG00000172159			24125	protein-coding gene	gene with protein product		607619				12601556	Standard	NM_174938		Approved	EPB41L4O, MGC20553	uc004ams.2	A2A2Y4	OTTHUMG00000020103	ENST00000304195.3:c.72C>T	9.37:g.86153075G>A			A8MQB0|B4DN14|Q53EP2|Q5JV59|Q5VZA1|Q86WP8|Q8IZ44|Q8N3Y5|Q8N9L2	Silent	SNP	pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.S24	ENST00000304195.3	37	c.72	CCDS43840.1	9																																																																																			FRMD3	-	NULL	ENSG00000172159		0.642	FRMD3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD3	HGNC	protein_coding	OTTHUMT00000157355.1	-	0.00	145	0	G	NM_174938		86153075	-1	tier1	-	no_errors	ENST00000304195	ensembl	human	known	74_37	silent	40.59	60	41	SNP	1.000	A
FSIP2	401024	genome.wustl.edu	37	2	186664503	186664503	+	Nonsense_Mutation	SNP	C	C	G	rs200741240		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr2:186664503C>G	ENST00000424728.1	+	17	10470	c.10470C>G	c.(10468-10470)taC>taG	p.Y3490*	AC008174.3_ENST00000429929.1_RNA|FSIP2_ENST00000343098.5_Nonsense_Mutation_p.Y3579*|AC008174.3_ENST00000436557.1_RNA			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	3490										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						GAAACATATACGATGATTCTT	0.323																																																	0																																										SO:0001587	stop_gained	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.10470C>G	2.37:g.186664503C>G	ENSP00000401306:p.Tyr3490*		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Nonsense_Mutation	SNP	NULL	p.Y3579*	ENST00000424728.1	37	c.10737		2	.	.	.	.	.	.	.	.	.	.	C	49	15.525647	0.99836	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	.	.	.	5.32	-1.73	0.08081	.	0.634070	0.14781	N	0.298804	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	4.6093	0.12395	0.1659:0.3248:0.0:0.5094	.	.	.	.	X	3579;3490	.	ENSP00000344403:Y3579X	Y	+	3	2	FSIP2	186372748	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.461000	0.02366	-0.147000	0.11254	-0.252000	0.11476	TAC	FSIP2	-	NULL	ENSG00000188738		0.323	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	-	0.00	113	0	C	NM_173651		186664503	+1	tier1	-	no_errors	ENST00000343098	ensembl	human	known	74_37	nonsense	39.34	74	48	SNP	0.000	G
GAS1	2619	genome.wustl.edu	37	9	89561664	89561664	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr9:89561664C>A	ENST00000298743.7	-	1	440	c.31G>T	c.(31-33)Gag>Tag	p.E11*	RP11-276H19.1_ENST00000415801.1_lincRNA	NM_002048.2	NP_002039.2	P54826	GAS1_HUMAN	growth arrest-specific 1	11					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cerebellum morphogenesis (GO:0021587)|developmental growth (GO:0048589)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|eye morphogenesis (GO:0048592)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein processing (GO:0010955)|negative regulation of smoothened signaling pathway (GO:0045879)|odontogenesis (GO:0042476)|outer ear morphogenesis (GO:0042473)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|programmed cell death (GO:0012501)|regulation of apoptotic process (GO:0042981)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|regulation of smoothened signaling pathway (GO:0008589)	anchored component of plasma membrane (GO:0046658)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|lung(2)|skin(1)	4						ccgcgggcctcgccgccgccg	0.811																																																	0													1.0	1.0	1.0					9																	89561664		115	246	361	SO:0001587	stop_gained	0				CCDS6674.1	9q21.3-q22	2008-07-21			ENSG00000180447	ENSG00000180447			4165	protein-coding gene	gene with protein product	"""Growth arrest-specific gene-1"""	139185				8307588	Standard	NM_002048		Approved		uc004aox.4	P54826	OTTHUMG00000020141	ENST00000298743.7:c.31G>T	9.37:g.89561664C>A	ENSP00000298743:p.Glu11*		B9EGM4|Q6B086	Nonsense_Mutation	SNP	pfam_GDNF/GAS1,smart_GDNF/GAS1	p.E11*	ENST00000298743.7	37	c.31	CCDS6674.1	9	.	.	.	.	.	.	.	.	.	.	C	38	7.229391	0.98150	.	.	ENSG00000180447	ENST00000298743	.	.	.	3.04	3.04	0.35103	.	1.296010	0.06471	U	0.731136	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	7.1285	0.25486	0.0:0.8659:0.0:0.1341	.	.	.	.	X	11	.	ENSP00000298743:E11X	E	-	1	0	GAS1	88751484	0.129000	0.22400	1.000000	0.80357	0.933000	0.57130	1.062000	0.30555	1.239000	0.43787	0.298000	0.19748	GAG	GAS1	-	NULL	ENSG00000180447		0.811	GAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS1	HGNC	protein_coding	OTTHUMT00000052928.1		0.00	47	0	C	NM_002048		89561664	-1			no_errors	ENST00000298743	ensembl	human	known	74_37	nonsense	23.53	26	8	SNP	0.997	A
GCH1	2643	genome.wustl.edu	37	14	55312530	55312530	+	Silent	SNP	C	C	T	rs199836777	byFrequency	TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr14:55312530C>T	ENST00000491895.2	-	5	770	c.582G>A	c.(580-582)acG>acA	p.T194T	GCH1_ENST00000395514.1_Silent_p.T194T|GCH1_ENST00000543643.2_Silent_p.T194T|GCH1_ENST00000536224.2_Silent_p.T194T|GCH1_ENST00000254299.4_5'UTR	NM_000161.2	NP_000152.1	P30793	GCH1_HUMAN	GTP cyclohydrolase 1	194					7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|dopamine biosynthetic process (GO:0042416)|GTP catabolic process (GO:0006184)|metabolic process (GO:0008152)|negative regulation of blood pressure (GO:0045776)|neuromuscular process controlling posture (GO:0050884)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric-oxide synthase activity (GO:0051000)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|pteridine-containing compound biosynthetic process (GO:0042559)|regulation of blood pressure (GO:0008217)|regulation of lung blood pressure (GO:0014916)|regulation of nitric-oxide synthase activity (GO:0050999)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|response to pain (GO:0048265)|response to tumor necrosis factor (GO:0034612)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|tetrahydrofolate biosynthetic process (GO:0046654)|vasodilation (GO:0042311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|coenzyme binding (GO:0050662)|GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(2)|lung(7)|skin(2)	11						GCAAGGCTTCCGTGATTGCTA	0.478													C|||	2	0.000399361	0.0	0.0014	5008	,	,		20572	0.0		0.0	False		,,,				2504	0.001				Pancreas(198;1245 2204 4807 21567 38372)												0								C	,,,	0,4406		0,0,2203	126.0	116.0	120.0		582,582,582,582	-0.6	1.0	14		120	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	GCH1	NM_000161.2,NM_001024024.1,NM_001024070.1,NM_001024071.1	,,,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,,,	194/251,194/251,194/234,194/214	55312530	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			U19523	CCDS9720.1, CCDS41954.1, CCDS45110.1	14q22.1-q22.2	2014-04-01	2008-08-01		ENSG00000131979	ENSG00000131979	3.5.4.16		4193	protein-coding gene	gene with protein product	"""dopa-responsive dystonia"""	600225	"""dystonia 14"""	GCH, DYT5, DYT14		7874165, 8695054	Standard	XM_005267530		Approved	GTPCH1, DYT5a	uc001xbi.1	P30793	OTTHUMG00000029754	ENST00000491895.2:c.582G>A	14.37:g.55312530C>T			Q6FHY7|Q9Y4I8	Silent	SNP	pfam_GTP_CycHdrlase_I_dom,tigrfam_GTP_CycHdrlase_I	p.T194	ENST00000491895.2	37	c.582	CCDS9720.1	14																																																																																			GCH1	-	pfam_GTP_CycHdrlase_I_dom,tigrfam_GTP_CycHdrlase_I	ENSG00000131979		0.478	GCH1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	GCH1	HGNC	protein_coding	OTTHUMT00000276895.3		0.00	46	0	C			55312530	-1			no_errors	ENST00000395514	ensembl	human	known	74_37	silent	5.26	54	3	SNP	0.997	T
GNAZ	2781	genome.wustl.edu	37	22	23465296	23465296	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr22:23465296G>A	ENST00000248996.4	+	3	1412	c.746G>A	c.(745-747)cGc>cAc	p.R249H	RTDR1_ENST00000216036.4_Intron	NM_002073.2	NP_002064.1	P19086	GNAZ_HUMAN	guanine nucleotide binding protein (G protein), alpha z polypeptide	249					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(5)|urinary_tract(1)	19	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		GAGAGCTTGCGCCTCTTTGAC	0.557																																																	0													86.0	87.0	87.0					22																	23465296		2203	4300	6503	SO:0001583	missense	0				CCDS13804.1	22q11.1-q11.2	2008-06-10			ENSG00000128266	ENSG00000128266			4395	protein-coding gene	gene with protein product		139160				2115889	Standard	NM_002073		Approved		uc002zwu.1	P19086	OTTHUMG00000150611	ENST00000248996.4:c.746G>A	22.37:g.23465296G>A	ENSP00000248996:p.Arg249His		B2R6C1|Q4QRJ6	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I	p.R249H	ENST00000248996.4	37	c.746	CCDS13804.1	22	.	.	.	.	.	.	.	.	.	.	G	18.29	3.592053	0.66219	.	.	ENSG00000128266	ENST00000248996;ENST00000456059	D	0.88431	-2.38	5.14	4.1	0.47936	.	0.128983	0.53938	D	0.000041	D	0.85248	0.5653	L	0.31420	0.93	0.51012	D	0.999906	P	0.35944	0.529	B	0.42798	0.398	T	0.82673	-0.0341	10	0.30078	T	0.28	.	14.2605	0.66083	0.0:0.0:0.8498:0.1502	.	249	P19086	GNAZ_HUMAN	H	249;197	ENSP00000248996:R249H	ENSP00000248996:R249H	R	+	2	0	GNAZ	21795296	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	3.976000	0.56867	1.282000	0.44496	0.655000	0.94253	CGC	GNAZ	-	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Gprotein_alpha_su	ENSG00000128266		0.557	GNAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAZ	HGNC	protein_coding	OTTHUMT00000319073.1	-	0.00	80	0	G	NM_002073		23465296	+1	tier1	-	no_errors	ENST00000248996	ensembl	human	known	74_37	missense	52.38	20	22	SNP	0.998	A
GPR31	2853	genome.wustl.edu	37	6	167570380	167570380	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr6:167570380G>T	ENST00000366834.1	-	1	1437	c.940C>A	c.(940-942)Ccc>Acc	p.P314T		NM_005299.2	NP_005290.2	O00270	GPR31_HUMAN	G protein-coupled receptor 31	314					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(4)|large_intestine(4)|lung(7)|prostate(1)	17		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)		GAGTCTCTGGGGTTGAAATCT	0.537																																																	0													51.0	56.0	54.0					6																	167570380		2203	4300	6503	SO:0001583	missense	0			U65402	CCDS5299.1	6q27	2012-08-21				ENSG00000120436		"""GPCR / Class A : Orphans"""	4486	protein-coding gene	gene with protein product	"""hydroxyeicosatetraenoic (HETE) acid receptor 1"", ""12-(S)-HETE acid receptor"""	602043				9205127, 21712392	Standard	NM_005299		Approved	HETER1, 12-HETER	uc011egq.2	O00270		ENST00000366834.1:c.940C>A	6.37:g.167570380G>T	ENSP00000355799:p.Pro314Thr		B0M0K2|Q4VBL3|Q9NQ20	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.P314T	ENST00000366834.1	37	c.940	CCDS5299.1	6	.	.	.	.	.	.	.	.	.	.	G	7.535	0.659485	0.14645	.	.	ENSG00000120436	ENST00000366834	T	0.60299	0.2	3.31	1.44	0.22558	.	0.595988	0.12710	U	0.445586	T	0.12347	0.0300	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.25779	-1.0122	10	0.31617	T	0.26	-8.7701	3.7756	0.08659	0.1342:0.0:0.607:0.2588	.	314	O00270	GPR31_HUMAN	T	314	ENSP00000355799:P314T	ENSP00000355799:P314T	P	-	1	0	GPR31	167490370	0.005000	0.15991	0.002000	0.10522	0.033000	0.12548	1.411000	0.34702	0.108000	0.17862	0.313000	0.20887	CCC	GPR31	-	NULL	ENSG00000120436		0.537	GPR31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR31	HGNC	protein_coding	OTTHUMT00000043111.1		0.00	62	0	G	NM_005299		167570380	-1			no_errors	ENST00000366834	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.006	T
GREB1	9687	genome.wustl.edu	37	2	11780510	11780510	+	Missense_Mutation	SNP	G	G	A	rs376907059		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr2:11780510G>A	ENST00000381486.2	+	33	6080	c.5780G>A	c.(5779-5781)cGc>cAc	p.R1927H	GREB1_ENST00000396123.1_Missense_Mutation_p.R925H|GREB1_ENST00000234142.5_Missense_Mutation_p.R1927H	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1927						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TTCCGGCTGCGCGATGAGTTC	0.607																																					Ovarian(39;850 945 2785 23371 33093)												0													50.0	60.0	57.0					2																	11780510		2018	4161	6179	SO:0001583	missense	0				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.5780G>A	2.37:g.11780510G>A	ENSP00000370896:p.Arg1927His		A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.R1927H	ENST00000381486.2	37	c.5780	CCDS42655.1	2	.	.	.	.	.	.	.	.	.	.	G	28.0	4.884564	0.91814	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.27557	2.99;2.99;1.66	5.04	4.16	0.48862	.	0.104397	0.64402	D	0.000007	T	0.53738	0.1815	M	0.71036	2.16	0.45161	D	0.998173	D	0.89917	1.0	D	0.83275	0.996	T	0.58137	-0.7689	10	0.87932	D	0	-14.6584	13.3282	0.60471	0.0774:0.0:0.9226:0.0	.	1927	Q4ZG55	GREB1_HUMAN	H	1927;1927;925	ENSP00000370896:R1927H;ENSP00000234142:R1927H;ENSP00000379429:R925H	ENSP00000234142:R1927H	R	+	2	0	GREB1	11697961	1.000000	0.71417	0.815000	0.32552	0.970000	0.65996	7.403000	0.79983	1.090000	0.41315	0.563000	0.77884	CGC	GREB1	-	NULL	ENSG00000196208		0.607	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREB1	HGNC	protein_coding	OTTHUMT00000280490.1	-	0.00	31	0	G	NM_014668		11780510	+1	tier1	-	no_errors	ENST00000234142	ensembl	human	known	74_37	missense	25.81	23	8	SNP	0.996	A
GPR55	9290	genome.wustl.edu	37	2	231775309	231775309	+	Silent	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr2:231775309G>A	ENST00000392040.1	-	2	561	c.369C>T	c.(367-369)atC>atT	p.I123I	AC012507.4_ENST00000454890.1_RNA|GPR55_ENST00000392039.2_Silent_p.I123I	NM_005683.3	NP_005674.2	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	123					activation of phospholipase C activity (GO:0007202)|bone resorption (GO:0045453)|cannabinoid signaling pathway (GO:0038171)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho protein signal transduction (GO:0035025)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		GCGGGTAACGGATGGCCAAGA	0.582																																																	0													58.0	45.0	50.0					2																	231775309		2203	4300	6503	SO:0001819	synonymous_variant	0			AF096786	CCDS2480.1	2q37	2012-08-21			ENSG00000135898	ENSG00000135898		"""GPCR / Class A : Orphans"""	4511	protein-coding gene	gene with protein product		604107				9931487	Standard	NM_005683		Approved		uc002vrg.3	Q9Y2T6	OTTHUMG00000133224	ENST00000392040.1:c.369C>T	2.37:g.231775309G>A			Q8N580	Silent	SNP	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.I123	ENST00000392040.1	37	c.369	CCDS2480.1	2																																																																																			GPR55	-	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000135898		0.582	GPR55-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR55	HGNC	protein_coding	OTTHUMT00000332618.1	-	0.00	48	0	G	NM_005683		231775309	-1	tier1	-	no_errors	ENST00000392039	ensembl	human	known	74_37	silent	44.44	20	16	SNP	0.964	A
GRIP2	80852	genome.wustl.edu	37	3	14549126	14549126	+	RNA	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:14549126G>A	ENST00000273083.3	-	0	2225							Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				endometrium(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	25						TGCAGGAGGTGGATGGCCTCG	0.602																																																	0													63.0	70.0	68.0					3																	14549126		2046	4190	6236			0			AB051506		3p24-p23	2012-02-08			ENSG00000144596	ENSG00000144596			23841	protein-coding gene	gene with protein product							Standard	NM_001080423		Approved	KIAA1719	uc021wtn.1	Q9C0E4	OTTHUMG00000155544		3.37:g.14549126G>A			Q8TEH9|Q9H7H3	RNA	SNP	-	NULL	ENST00000273083.3	37	NULL		3																																																																																			GRIP2	-	-	ENSG00000144596		0.602	GRIP2-001	KNOWN	basic	processed_transcript	GRIP2	HGNC	processed_transcript	OTTHUMT00000340582.2	-	0.00	64	0	G	NM_001080423		14549126	-1	tier1	-	no_errors	ENST00000273083	ensembl	human	known	74_37	rna	39.58	29	19	SNP	1.000	A
GRM8	2918	genome.wustl.edu	37	7	126173519	126173519	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr7:126173519C>T	ENST00000339582.2	-	9	2725	c.1917G>A	c.(1915-1917)atG>atA	p.M639I	GRM8_ENST00000480995.1_5'UTR|GRM8_ENST00000444921.2_Missense_Mutation_p.M639I|GRM8_ENST00000358373.3_Missense_Mutation_p.M639I			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	639					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				GTGCTGCAATCATTAAAAACG	0.458										HNSCC(24;0.065)																																							0													92.0	92.0	92.0					7																	126173519		2203	4300	6503	SO:0001583	missense	0				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1917G>A	7.37:g.126173519C>T	ENSP00000344173:p.Met639Ile		A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_8,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4,pfscan_GPCR_3_C	p.M639I	ENST00000339582.2	37	c.1917	CCDS5794.1	7	.	.	.	.	.	.	.	.	.	.	C	16.83	3.231690	0.58777	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373	D;D;D	0.87729	-2.29;-2.29;-2.29	5.75	5.75	0.90469	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.81297	0.4793	L	0.28274	0.84	0.80722	D	1	P;B	0.38335	0.627;0.05	B;B	0.36030	0.216;0.055	T	0.80032	-0.1552	10	0.33141	T	0.24	.	18.9383	0.92595	0.0:1.0:0.0:0.0	.	639;639	O00222-2;O00222	.;GRM8_HUMAN	I	639	ENSP00000344173:M639I;ENSP00000409790:M639I;ENSP00000351142:M639I	ENSP00000344173:M639I	M	-	3	0	GRM8	125960755	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.732000	0.93576	0.655000	0.94253	ATG	GRM8	-	pfam_GPCR_3_C,pfscan_GPCR_3_C	ENSG00000179603		0.458	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	HGNC	protein_coding	OTTHUMT00000059209.4	-	0.00	41	0	C			126173519	-1	tier1	-	no_errors	ENST00000339582	ensembl	human	known	74_37	missense	14.29	30	5	SNP	1.000	T
GSDMC	56169	genome.wustl.edu	37	8	130762320	130762320	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr8:130762320T>G	ENST00000276708.4	-	12	2010	c.1129A>C	c.(1129-1131)Atc>Ctc	p.I377L		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	377						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						TTCTTTAGGATGGCACCACCA	0.373																																																	0													37.0	37.0	37.0					8																	130762320		2203	4300	6503	SO:0001583	missense	0			AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.1129A>C	8.37:g.130762320T>G	ENSP00000276708:p.Ile377Leu		Q5XKF3|Q6P494	Missense_Mutation	SNP	pfam_Gasdermin	p.I377L	ENST00000276708.4	37	c.1129	CCDS6360.1	8	.	.	.	.	.	.	.	.	.	.	T	16.87	3.243064	0.58995	.	.	ENSG00000147697	ENST00000276708	T	0.22743	1.94	4.76	0.837	0.18896	.	0.343618	0.25189	N	0.032472	T	0.22437	0.0541	M	0.72118	2.19	0.19300	N	0.999975	P	0.48089	0.905	P	0.47786	0.557	T	0.10154	-1.0642	10	0.32370	T	0.25	.	1.6357	0.02741	0.1709:0.095:0.1779:0.5561	.	377	Q9BYG8	GSDMC_HUMAN	L	377	ENSP00000276708:I377L	ENSP00000276708:I377L	I	-	1	0	GSDMC	130831502	0.294000	0.24380	0.054000	0.19295	0.086000	0.17979	0.211000	0.17474	0.061000	0.16311	0.482000	0.46254	ATC	GSDMC	-	pfam_Gasdermin	ENSG00000147697		0.373	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSDMC	HGNC	protein_coding	OTTHUMT00000380586.1	-	0.00	97	0	T			130762320	-1	tier1	-	no_errors	ENST00000276708	ensembl	human	known	74_37	missense	19.27	87	21	SNP	0.200	G
H2AFB1	474382	genome.wustl.edu	37	X	154113573	154113573	+	Silent	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chrX:154113573C>T	ENST00000354461.2	+	1	257	c.249C>T	c.(247-249)atC>atT	p.I83I	F8_ENST00000330287.6_Intron|MIR1184-1_ENST00000408606.1_RNA|F8A1_ENST00000369446.2_5'Flank|F8_ENST00000360256.4_Intron	NM_001017990.1	NP_001017990.1	P0C5Y9	H2AB1_HUMAN	H2A histone family, member B1	83					mRNA processing (GO:0006397)|nucleosome assembly (GO:0006334)	nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)	2	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AGCGGAACATCACTCCCCTGC	0.622																																																	0													23.0	43.0	40.0					X																	154113573		815	3527	4342	SO:0001819	synonymous_variant	0				CCDS35458.1	Xq28	2011-01-27			ENSG00000198082	ENSG00000274183		"""Histones / Replication-independent"""	22516	protein-coding gene	gene with protein product							Standard	NM_001017990		Approved			P0C5Y9	OTTHUMG00000034291	ENST00000354461.2:c.249C>T	X.37:g.154113573C>T			A0PK90|P98176|Q5TZB2|Q6FG78|Q96PR7	Silent	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.I83	ENST00000354461.2	37	c.249	CCDS35458.1	X																																																																																			H2AFB1	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2A	ENSG00000198082		0.622	H2AFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H2AFB1	HGNC	protein_coding	OTTHUMT00000082835.2	-	0.00	182	0	C	NM_001017990		154113573	+1	tier1	-	no_errors	ENST00000354461	ensembl	human	known	74_37	silent	43.06	82	62	SNP	1.000	T
HBG2	3048	genome.wustl.edu	37	11	5275677	5275677	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:5275677C>T	ENST00000380259.2	-	7	1400	c.160G>A	c.(160-162)Gcc>Acc	p.A54T	HBG2_ENST00000380252.1_Missense_Mutation_p.A44T|HBG2_ENST00000336906.4_Missense_Mutation_p.A54T			P69892	HBG2_HUMAN	hemoglobin, gamma G	54					blood coagulation (GO:0007596)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	13		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCCATGATGGCAGAGGCAGAG	0.522																																																	0													96.0	77.0	83.0					11																	5275677		2201	4295	6496	SO:0001583	missense	0			BC029387	CCDS7755.1	11p15.5	2014-05-19			ENSG00000196565	ENSG00000196565			4832	protein-coding gene	gene with protein product		142250				2649166	Standard	NM_000184		Approved	HBG-T1		P69892	OTTHUMG00000066673	ENST00000380259.2:c.160G>A	11.37:g.5275677C>T	ENSP00000369609:p.Ala54Thr		A8MZE0|P02096|P62027|Q14491|Q68NH9|Q96FH6|Q96FH7	Missense_Mutation	SNP	pfam_Globin,superfamily_Globin-like,pfscan_Globin,prints_Haemoglobin_b,prints_Myoglobin	p.A54T	ENST00000380259.2	37	c.160	CCDS7755.1	11	.	.	.	.	.	.	.	.	.	.	C	21.4	4.136276	0.77662	.	.	ENSG00000196565	ENST00000380252;ENST00000380259;ENST00000336906;ENST00000380247	D;D;D	0.93547	-3.24;-3.24;-3.24	3.88	3.88	0.44766	Globin-like (2);Globin, structural domain (2);	.	.	.	.	D	0.96953	0.9005	M	0.90309	3.105	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.97595	1.0119	9	0.87932	D	0	.	13.719	0.62714	0.0:1.0:0.0:0.0	.	54;54	P69892;P69891	HBG2_HUMAN;HBG1_HUMAN	T	44;54;54;54	ENSP00000369602:A44T;ENSP00000369609:A54T;ENSP00000338082:A54T	ENSP00000338082:A54T	A	-	1	0	HBG2	5232253	0.988000	0.35896	0.922000	0.36590	0.960000	0.62799	2.774000	0.47694	2.128000	0.65567	0.650000	0.86243	GCC	HBG2	-	pfam_Globin,superfamily_Globin-like,pfscan_Globin,prints_Haemoglobin_b	ENSG00000196565		0.522	HBG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBG2	HGNC	protein_coding	OTTHUMT00000142967.2	-	0.00	280	0	C	NM_000184		5275677	-1	tier1	-	no_errors	ENST00000336906	ensembl	human	known	74_37	missense	25.60	124	43	SNP	0.948	T
HGFAC	3083	genome.wustl.edu	37	4	3443784	3443786	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr4:3443784_3443786delTCC	ENST00000382774.3	+	1	171_173	c.56_58delTCC	c.(55-60)ttcctc>ttc	p.L29del	HGFAC_ENST00000511533.1_In_Frame_Del_p.L29del	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	29					proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CTGGGCCCCTTCCTCCTCCTCCT	0.729																																																	0										28,2978		6,16,1481						-2.5	0.0			13	48,6296		6,36,3130	no	coding	HGFAC	NM_001528.2		12,52,4611	A1A1,A1R,RR		0.7566,0.9315,0.8128				76,9274				SO:0001651	inframe_deletion	0			D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.56_58delTCC	4.37:g.3443793_3443795delTCC	ENSP00000372224:p.Leu29del		Q14726|Q2M1W7|Q53X47	In_Frame_Del	DEL	pirsf_Coagulation_fac_XIIa/HGFA,pfam_Peptidase_S1,pfam_Kringle,pfam_FN_type2_col-bd,pfam_Fibronectin_type1,pfam_EG-like_dom,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,smart_EG-like_dom,smart_Fibronectin_type1,smart_Kringle,smart_Peptidase_S1,pfscan_EG-like_dom,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Kringle,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.L23in_frame_del	ENST00000382774.3	37	c.56_58	CCDS3369.1	4																																																																																			HGFAC	-	pirsf_Coagulation_fac_XIIa/HGFA	ENSG00000109758		0.729	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGFAC	HGNC	protein_coding	OTTHUMT00000206607.3		0.00	44	0	TCC			3443786	+1	tier1		no_errors	ENST00000382774	ensembl	human	known	74_37	in_frame_del	9.68	28	3	DEL	0.728:0.710:0.712	-
HIST2H2BF	440689	genome.wustl.edu	37	1	149783548	149783548	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:149783548C>T	ENST00000369167.1	-	1	366	c.331G>A	c.(331-333)Gcc>Acc	p.A111T	RP11-196G18.21_ENST00000420462.1_RNA|HIST2H2BF_ENST00000545683.1_Missense_Mutation_p.A111T|HIST2H2BF_ENST00000469483.1_5'UTR|HIST2H2BF_ENST00000427880.2_Missense_Mutation_p.A111T	NM_001024599.4	NP_001019770.1	Q5QNW6	H2B2F_HUMAN	histone cluster 2, H2bf	111					chromatin organization (GO:0006325)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Breast(34;0.0124)|all_hematologic(923;0.127)					TCGGACACGGCGTGCTTGGCC	0.627																																																	0													5.0	6.0	5.0					1																	149783548		1742	3601	5343	SO:0001583	missense	0			BC110793	CCDS30846.1, CCDS53359.1	1q21.2	2013-06-03	2006-10-11		ENSG00000203814	ENSG00000203814		"""Histones / Replication-dependent"""	24700	protein-coding gene	gene with protein product			"""histone 2, H2bf"""				Standard	NM_001161334		Approved		uc010pbj.2	Q5QNW6	OTTHUMG00000183159	ENST00000369167.1:c.331G>A	1.37:g.149783548C>T	ENSP00000358164:p.Ala111Thr		A8K0U9|B4DLA9	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.A111T	ENST00000369167.1	37	c.331	CCDS30846.1	1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.421579	0.83559	.	.	ENSG00000203814	ENST00000545683;ENST00000427880;ENST00000369167	T;T;T	0.36340	1.26;1.26;1.26	3.57	3.57	0.40892	Histone-fold (2);	0.000000	0.64402	D	0.000015	T	0.36635	0.0974	M	0.86420	2.815	0.49687	D	0.999813	D;D;P	0.65815	0.995;0.987;0.685	B;B;B	0.43445	0.42;0.339;0.1	T	0.54925	-0.8220	10	0.59425	D	0.04	.	14.9566	0.71120	0.0:1.0:0.0:0.0	.	111;111;111	B4DR52;B4DLA9;Q5QNW6	.;.;H2B2F_HUMAN	T	111	ENSP00000445831:A111T;ENSP00000407461:A111T;ENSP00000358164:A111T	ENSP00000358164:A111T	A	-	1	0	HIST2H2BF	148050172	1.000000	0.71417	1.000000	0.80357	0.480000	0.33159	6.976000	0.76135	2.292000	0.77174	0.205000	0.17691	GCC	HIST2H2BF	-	superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000203814		0.627	HIST2H2BF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H2BF	HGNC	protein_coding	OTTHUMT00000033453.2	-	0.00	45	0	C	NM_001024599		149783548	-1	tier1	-	no_errors	ENST00000427880	ensembl	human	known	74_37	missense	31.58	26	12	SNP	1.000	T
HIVEP2	3097	genome.wustl.edu	37	6	143095613	143095613	+	Missense_Mutation	SNP	C	C	T	rs569905766	byFrequency	TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr6:143095613C>T	ENST00000367604.1	-	4	902	c.263G>A	c.(262-264)cGt>cAt	p.R88H	HIVEP2_ENST00000367603.2_Missense_Mutation_p.R88H|HIVEP2_ENST00000012134.2_Missense_Mutation_p.R88H			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	88					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		AGGACTCGGACGATGCGGTGG	0.537													C|||	3	0.000599042	0.0	0.0014	5008	,	,		21291	0.0		0.0	False		,,,				2504	0.002				Esophageal Squamous(107;843 1510 13293 16805 42198)												0													163.0	171.0	168.0					6																	143095613		2157	4261	6418	SO:0001583	missense	0			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.263G>A	6.37:g.143095613C>T	ENSP00000356576:p.Arg88His		Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R88H	ENST00000367604.1	37	c.263	CCDS43510.1	6	.	.	.	.	.	.	.	.	.	.	C	15.11	2.735156	0.48939	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02631	4.22;4.22;4.22	5.53	3.75	0.43078	.	0.332847	0.36972	N	0.002316	T	0.01387	0.0045	M	0.62723	1.935	0.31251	N	0.694022	B	0.09022	0.002	B	0.04013	0.001	T	0.40384	-0.9566	10	0.44086	T	0.13	-0.1773	7.5081	0.27558	0.1352:0.7219:0.0:0.1429	.	88	P31629	ZEP2_HUMAN	H	88	ENSP00000356576:R88H;ENSP00000356575:R88H;ENSP00000012134:R88H	ENSP00000012134:R88H	R	-	2	0	HIVEP2	143137306	0.889000	0.30405	0.830000	0.32933	0.994000	0.84299	1.167000	0.31847	0.697000	0.31718	0.650000	0.86243	CGT	HIVEP2	-	NULL	ENSG00000010818		0.537	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1	-	0.00	71	0	C			143095613	-1	tier1	-	no_errors	ENST00000012134	ensembl	human	known	74_37	missense	20.90	53	14	SNP	0.993	T
HIVEP3	59269	genome.wustl.edu	37	1	42048742	42048742	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:42048742C>T	ENST00000372583.1	-	4	2612	c.1727G>A	c.(1726-1728)aGc>aAc	p.S576N	HIVEP3_ENST00000247584.5_Missense_Mutation_p.S576N|HIVEP3_ENST00000429157.2_Missense_Mutation_p.S576N|HIVEP3_ENST00000372584.1_Missense_Mutation_p.S576N	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	576	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CACGTGACTGCTGTGGCTCAG	0.597																																																	0													50.0	52.0	51.0					1																	42048742		2203	4300	6503	SO:0001583	missense	0			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.1727G>A	1.37:g.42048742C>T	ENSP00000361664:p.Ser576Asn		A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S576N	ENST00000372583.1	37	c.1727	CCDS463.1	1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.151486	0.38021	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.06768	3.27;3.26;3.26;3.27	4.64	3.71	0.42584	.	0.094546	0.47093	N	0.000254	T	0.07098	0.0180	L	0.28014	0.82	0.30409	N	0.779303	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.06092	-1.0846	10	0.42905	T	0.14	-6.9895	12.8889	0.58058	0.0:0.919:0.0:0.081	.	576;576	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	N	576	ENSP00000361665:S576N;ENSP00000361664:S576N;ENSP00000247584:S576N;ENSP00000410828:S576N	ENSP00000247584:S576N	S	-	2	0	HIVEP3	41821329	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.872000	0.56085	1.144000	0.42321	0.561000	0.74099	AGC	HIVEP3	-	NULL	ENSG00000127124		0.597	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIVEP3	HGNC	protein_coding	OTTHUMT00000016978.1		0.00	69	0	C	NM_024503		42048742	-1			no_errors	ENST00000247584	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
HPS5	11234	genome.wustl.edu	37	11	18303559	18303559	+	Silent	SNP	A	A	G			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:18303559A>G	ENST00000349215.3	-	22	3544	c.3267T>C	c.(3265-3267)ctT>ctC	p.L1089L	HPS5_ENST00000537258.1_Silent_p.L196L|HPS5_ENST00000438420.2_Silent_p.L975L|HPS5_ENST00000396253.3_Silent_p.L975L|HPS5_ENST00000352460.3_5'UTR	NM_181507.1	NP_852608.1	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5	1089					blood coagulation (GO:0007596)|organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						CTGACAACTCAAGGGCCAGAC	0.512									Hermansky-Pudlak syndrome																																								0													129.0	121.0	124.0					11																	18303559		2199	4293	6492	SO:0001819	synonymous_variant	0	Familial Cancer Database	HPS, HPS1-8	AB023234	CCDS7836.1, CCDS7837.1	11p14	2014-06-18			ENSG00000110756	ENSG00000110756			17022	protein-coding gene	gene with protein product		607521				10231032, 10094488	Standard	NM_181507		Approved		uc001mod.1	Q9UPZ3	OTTHUMG00000166612	ENST00000349215.3:c.3267T>C	11.37:g.18303559A>G			A8K6J8|A8K8S1|D3DQX9|D3DQY0|O95942|Q8N4U0	Silent	SNP	superfamily_WD40_repeat_dom,pirsf_BLOC-2_complex_Hps5_subunit	p.L1089	ENST00000349215.3	37	c.3267	CCDS7836.1	11																																																																																			HPS5	-	pirsf_BLOC-2_complex_Hps5_subunit	ENSG00000110756		0.512	HPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS5	HGNC	protein_coding	OTTHUMT00000390808.1	-	0.00	70	0	A	NM_181507		18303559	-1	tier1	-	no_errors	ENST00000349215	ensembl	human	known	74_37	silent	11.76	30	4	SNP	0.158	G
HS3ST1	9957	genome.wustl.edu	37	4	11400771	11400771	+	Missense_Mutation	SNP	C	C	T	rs370389171		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr4:11400771C>T	ENST00000002596.5	-	2	2033	c.859G>A	c.(859-861)Gaa>Aaa	p.E287K		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	287					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)	p.E287K(2)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						TGAAAATATTCGTGCAGTTTA	0.488																																																	2	Substitution - Missense(2)	large_intestine(2)						C	LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	81.0	84.0	83.0		859	5.5	0.9	4		83	0,8600		0,0,4300	no	missense	HS3ST1	NM_005114.2	56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	287/308	11400771	1,13005	2203	4300	6503	SO:0001583	missense	0			AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.859G>A	4.37:g.11400771C>T	ENSP00000002596:p.Glu287Lys		B3KUA6|Q6PEY8	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.E287K	ENST00000002596.5	37	c.859	CCDS3408.1	4	.	.	.	.	.	.	.	.	.	.	C	5.030	0.191182	0.09547	2.27E-4	0.0	ENSG00000002587	ENST00000002596	T	0.55930	0.49	5.49	5.49	0.81192	Sulfotransferase domain (1);	0.350601	0.29653	N	0.011541	T	0.31606	0.0802	N	0.03177	-0.4	0.43708	D	0.99617	B	0.14438	0.01	B	0.10450	0.005	T	0.15607	-1.0431	10	0.16896	T	0.51	.	18.3674	0.90396	0.0:1.0:0.0:0.0	.	287	O14792	HS3S1_HUMAN	K	287	ENSP00000002596:E287K	ENSP00000002596:E287K	E	-	1	0	HS3ST1	11009869	0.996000	0.38824	0.918000	0.36340	0.411000	0.31082	2.461000	0.45040	2.571000	0.86741	0.655000	0.94253	GAA	HS3ST1	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	ENSG00000002587		0.488	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST1	HGNC	protein_coding	OTTHUMT00000207073.3	-	0.00	76	0	C	NM_005114		11400771	-1	tier1	-	no_errors	ENST00000002596	ensembl	human	known	74_37	missense	11.11	40	5	SNP	0.979	T
HTT	3064	genome.wustl.edu	37	4	3240679	3240679	+	Frame_Shift_Del	DEL	G	G	-			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr4:3240679delG	ENST00000355072.5	+	66	9334	c.9189delG	c.(9187-9189)gcgfs	p.A3063fs		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	3063					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TTGTCAGCGCGTCCACCAGCC	0.622																																																	0													21.0	24.0	23.0					4																	3240679		2124	4214	6338	SO:0001589	frameshift_variant	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.9189delG	4.37:g.3240679delG	ENSP00000347184:p.Ala3063fs		Q9UQB7	Frame_Shift_Del	DEL	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.S3064fs	ENST00000355072.5	37	c.9189	CCDS43206.1	4																																																																																			HTT	-	NULL	ENSG00000197386		0.622	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2		0.00	73	0	G	NM_002111		3240679	+1	tier1		no_errors	ENST00000355072	ensembl	human	known	74_37	frame_shift_del	50.94	26	27	DEL	0.030	-
HS3ST1	9957	genome.wustl.edu	37	4	11400857	11400857	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr4:11400857C>A	ENST00000002596.5	-	2	1947	c.773G>T	c.(772-774)cGg>cTg	p.R258L		NM_005114.2	NP_005105.1	O14792	HS3S1_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 1	258					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|sulfotransferase activity (GO:0008146)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|skin(3)	15						GCCGCTGTCCCGCAGGCAGTA	0.512																																																	0													45.0	48.0	47.0					4																	11400857		2203	4300	6503	SO:0001583	missense	0			AF019386	CCDS3408.1	4p16	2008-02-05			ENSG00000002587	ENSG00000002587	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5194	protein-coding gene	gene with protein product		603244				9988767	Standard	NM_005114		Approved	3OST1	uc003gmq.3	O14792	OTTHUMG00000090547	ENST00000002596.5:c.773G>T	4.37:g.11400857C>A	ENSP00000002596:p.Arg258Leu		B3KUA6|Q6PEY8	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.R258L	ENST00000002596.5	37	c.773	CCDS3408.1	4	.	.	.	.	.	.	.	.	.	.	C	19.54	3.846423	0.71603	.	.	ENSG00000002587	ENST00000002596	D	0.82255	-1.59	5.59	5.59	0.84812	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.72598	0.3480	N	0.25332	0.735	0.80722	D	1	B	0.27700	0.186	B	0.22601	0.04	T	0.69003	-0.5260	10	0.07990	T	0.79	.	18.5875	0.91196	0.0:1.0:0.0:0.0	.	258	O14792	HS3S1_HUMAN	L	258	ENSP00000002596:R258L	ENSP00000002596:R258L	R	-	2	0	HS3ST1	11009955	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.628000	0.89032	0.655000	0.94253	CGG	HS3ST1	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	ENSG00000002587		0.512	HS3ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST1	HGNC	protein_coding	OTTHUMT00000207073.3	-	0.00	62	0	C	NM_005114		11400857	-1	tier1	-	no_errors	ENST00000002596	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	A
INSRR	3645	genome.wustl.edu	37	1	156816460	156816460	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:156816460C>T	ENST00000368195.3	-	8	2057	c.1661G>A	c.(1660-1662)cGc>cAc	p.R554H	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	554	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.		R -> C (in dbSNP:rs56068937). {ECO:0000269|PubMed:17344846}.		actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTCCTGGGTGCGGCTTAGGGG	0.612																																																	0													83.0	73.0	77.0					1																	156816460		2203	4300	6503	SO:0001583	missense	0			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.1661G>A	1.37:g.156816460C>T	ENSP00000357178:p.Arg554His		O60724|Q5VZS3	Missense_Mutation	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom	p.R554H	ENST00000368195.3	37	c.1661	CCDS1160.1	1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.152426	0.78001	.	.	ENSG00000027644	ENST00000368195	T	0.68624	-0.34	4.85	4.85	0.62838	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.43110	D	0.000609	T	0.37348	0.1000	.	.	.	0.31465	N	0.669049	B	0.26547	0.152	B	0.15870	0.014	T	0.41215	-0.9521	9	0.62326	D	0.03	.	8.9775	0.35944	0.0:0.9014:0.0:0.0986	.	554	P14616	INSRR_HUMAN	H	554	ENSP00000357178:R554H	ENSP00000357178:R554H	R	-	2	0	INSRR	155083084	0.340000	0.24792	1.000000	0.80357	0.991000	0.79684	0.742000	0.26216	2.492000	0.84095	0.655000	0.94253	CGC	INSRR	-	pirsf_Tyr_kinase_insulin-like_rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000027644		0.612	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSRR	HGNC	protein_coding	OTTHUMT00000098929.1	-	0.00	35	0	C	NM_014215		156816460	-1	tier1	-	no_errors	ENST00000368195	ensembl	human	known	74_37	missense	20.00	16	4	SNP	0.997	T
IKBKE	9641	genome.wustl.edu	37	1	206652386	206652386	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:206652386G>A	ENST00000367120.3	+	10	1466	c.1093G>A	c.(1093-1095)Gtc>Atc	p.V365I	IKBKE_ENST00000537984.1_Missense_Mutation_p.V280I	NM_001193322.1|NM_014002.3	NP_001180251.1|NP_054721.1	Q14164	IKKE_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon	365					immune response (GO:0006955)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of type I interferon production (GO:0032480)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein phosphorylation (GO:0006468)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|NF-kappaB-inducing kinase activity (GO:0004704)	p.V365I(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|skin(2)	32	Breast(84;0.137)					CGAGCCCAGCGTCTCAGCACA	0.622																																																	1	Substitution - Missense(1)	central_nervous_system(1)											104.0	94.0	97.0					1																	206652386		2203	4300	6503	SO:0001583	missense	0			AB016590	CCDS30996.1, CCDS53464.1, CCDS73019.1	1q31	2014-05-06			ENSG00000143466				14552	protein-coding gene	gene with protein product		605048				10421793, 10882136	Standard	NM_001193321		Approved	IKKE, IKK-i, KIAA0151	uc001hdz.2	Q14164	OTTHUMG00000184613	ENST00000367120.3:c.1093G>A	1.37:g.206652386G>A	ENSP00000356087:p.Val365Ile		D3DT78|Q3B754|Q3KR43|Q5JTS6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V365I	ENST00000367120.3	37	c.1093	CCDS30996.1	1	.	.	.	.	.	.	.	.	.	.	G	5.483	0.274112	0.10403	.	.	ENSG00000143466	ENST00000367120;ENST00000537984	T;T	0.63096	-0.02;0.13	5.97	0.714	0.18180	.	0.458448	0.25616	N	0.029459	T	0.34600	0.0903	N	0.08118	0	0.09310	N	0.999998	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.16129	-1.0413	10	0.21014	T	0.42	0.0532	8.0358	0.30491	0.1123:0.5114:0.3171:0.0592	.	280;365	Q3B754;Q14164	.;IKKE_HUMAN	I	365;280	ENSP00000356087:V365I;ENSP00000444529:V280I	ENSP00000356087:V365I	V	+	1	0	IKBKE	204719009	0.001000	0.12720	0.020000	0.16555	0.243000	0.25628	-0.017000	0.12590	-0.084000	0.12595	-0.911000	0.02809	GTC	IKBKE	-	NULL	ENSG00000143466		0.622	IKBKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKE	HGNC	protein_coding	OTTHUMT00000088484.1	-	0.00	44	0	G			206652386	+1	tier1	-	no_errors	ENST00000367120	ensembl	human	known	74_37	missense	47.06	9	8	SNP	0.985	A
ITPKB	3707	genome.wustl.edu	37	1	226923581	226923581	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:226923581G>A	ENST00000272117.3	-	1	1578	c.1579C>T	c.(1579-1581)Caa>Taa	p.Q527*	ITPKB_ENST00000429204.1_Nonsense_Mutation_p.Q527*|ITPKB_ENST00000366784.1_Nonsense_Mutation_p.Q527*			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	527					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				CCCTCTGATTGCACCCCTGTG	0.632																																					Colon(84;110 1851 5306 33547)												0													50.0	47.0	48.0					1																	226923581		2203	4300	6503	SO:0001587	stop_gained	0			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.1579C>T	1.37:g.226923581G>A	ENSP00000272117:p.Gln527*		Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Nonsense_Mutation	SNP	pfam_IPK	p.Q527*	ENST00000272117.3	37	c.1579	CCDS1555.1	1	.	.	.	.	.	.	.	.	.	.	G	42	9.376227	0.99153	.	.	ENSG00000143772	ENST00000272117;ENST00000429204;ENST00000366784	.	.	.	5.44	3.54	0.40534	.	0.883252	0.09697	N	0.767507	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-4.0E-4	4.8431	0.13500	0.183:0.0:0.6447:0.1723	.	.	.	.	X	527	.	ENSP00000272117:Q527X	Q	-	1	0	ITPKB	224990204	0.011000	0.17503	0.001000	0.08648	0.313000	0.28021	1.953000	0.40352	0.749000	0.32854	0.491000	0.48974	CAA	ITPKB	-	NULL	ENSG00000143772		0.632	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	HGNC	protein_coding	OTTHUMT00000091632.1		0.00	54	0	G	NM_002221		226923581	-1			no_errors	ENST00000272117	ensembl	human	known	74_37	nonsense	7.32	37	3	SNP	0.000	A
KCNJ12	3768	genome.wustl.edu	37	17	21319388	21319388	+	Missense_Mutation	SNP	C	C	T	rs140875968	byFrequency	TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr17:21319388C>T	ENST00000583088.1	+	3	1629	c.734C>T	c.(733-735)cCg>cTg	p.P245L	KCNJ12_ENST00000331718.5_Missense_Mutation_p.P245L	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	245					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	GAGTACATCCCGCTGGACCAG	0.612										Prostate(3;0.18)																																							0								C	LEU/PRO	0,4406		0,0,2203	122.0	89.0	100.0		734	5.3	1.0	17	dbSNP_134	100	7,8593	2.2+/-6.3	0,7,4293	yes	missense	KCNJ12	NM_021012.4	98	0,7,6496	TT,TC,CC		0.0814,0.0,0.0538	probably-damaging	245/434	21319388	7,12999	2203	4300	6503	SO:0001583	missense	0			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.734C>T	17.37:g.21319388C>T	ENSP00000463778:p.Pro245Leu		O43401|Q15756|Q8NG63	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.2	p.P245L	ENST00000583088.1	37	c.734	CCDS11219.1	17	.	.	.	.	.	.	.	.	.	.	C	26.3	4.720594	0.89205	0.0	8.14E-4	ENSG00000184185	ENST00000331718	D	0.91521	-2.86	5.32	5.32	0.75619	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.95620	0.8576	M	0.81179	2.53	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95974	0.8972	10	0.87932	D	0	.	18.9979	0.92821	0.0:1.0:0.0:0.0	.	245	Q14500	IRK12_HUMAN	L	245	ENSP00000328150:P245L	ENSP00000328150:P245L	P	+	2	0	KCNJ12	21259981	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	7.680000	0.84062	2.496000	0.84212	0.655000	0.94253	CCG	KCNJ12	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000184185		0.612	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ12	HGNC	protein_coding	OTTHUMT00000255060.2	-	0.00	126	0	C	NM_021012		21319388	+1	tier1	rs140875968	no_errors	ENST00000331718	ensembl	human	known	74_37	missense	10.81	99	12	SNP	1.000	T
KCNH4	23415	genome.wustl.edu	37	17	40331008	40331008	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr17:40331008C>A	ENST00000264661.3	-	2	445	c.113G>T	c.(112-114)cGg>cTg	p.R38L	KCNH4_ENST00000607371.1_Missense_Mutation_p.R38L	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	38	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GGGAAAGCCCCGTGTGCCCTG	0.612																																					NSCLC(117;707 1703 2300 21308 31858)												0													69.0	60.0	63.0					17																	40331008		2203	4300	6503	SO:0001583	missense	0			AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.113G>T	17.37:g.40331008C>A	ENSP00000264661:p.Arg38Leu			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,pfam_PAS_fold,pfam_PAS_4,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.R38L	ENST00000264661.3	37	c.113	CCDS11420.1	17	.	.	.	.	.	.	.	.	.	.	C	14.69	2.609362	0.46527	.	.	ENSG00000089558	ENST00000264661	D	0.98684	-5.07	4.52	2.54	0.30619	PAS (2);	0.000000	0.37178	N	0.002209	D	0.96166	0.8750	N	0.13235	0.315	0.09310	N	0.999998	P	0.44380	0.834	P	0.50231	0.635	D	0.92087	0.5677	10	0.41790	T	0.15	.	8.9423	0.35738	0.0:0.8283:0.0:0.1717	.	38	Q9UQ05	KCNH4_HUMAN	L	38	ENSP00000264661:R38L	ENSP00000264661:R38L	R	-	2	0	KCNH4	37584534	0.003000	0.15002	0.996000	0.52242	0.692000	0.40212	1.079000	0.30766	0.546000	0.28920	-0.373000	0.07131	CGG	KCNH4	-	superfamily_PAS,pfscan_PAS	ENSG00000089558		0.612	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	KCNH4	HGNC	protein_coding	OTTHUMT00000449791.2	-	0.00	60	0	C	NM_012285		40331008	-1	tier1	-	no_errors	ENST00000264661	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.068	A
RIMS4	140730	genome.wustl.edu	37	20	43379101	43379101	+	IGR	SNP	C	C	T	rs575724831		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr20:43379101C>T	ENST00000372851.3	-	0	5203				KCNK15_ENST00000372861.3_Silent_p.F205F	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4						exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)				central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				TCGGCGACTTCGTGGCACTGC	0.637																																																	0													73.0	67.0	69.0					20																	43379101		2203	4300	6503	SO:0001628	intergenic_variant	0				CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546		20.37:g.43379101C>T			A4FU94|E1P613|Q3MI44|Q5JWT7	Silent	SNP	pfam_2pore_dom_K_chnl_dom,pirsf_2pore_dom_K_chnl_TASK,prints_TASK5,prints_2pore_dom_K_chnl_TASK,prints_2pore_dom_K_chnl	p.F205	ENST00000372851.3	37	c.615	CCDS13338.1	20																																																																																			KCNK15	-	pfam_2pore_dom_K_chnl_dom,pirsf_2pore_dom_K_chnl_TASK,prints_2pore_dom_K_chnl	ENSG00000124249		0.637	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KCNK15	HGNC	protein_coding	OTTHUMT00000101027.2		0.00	46	0	C	NM_182970		43379101	+1			no_errors	ENST00000372861	ensembl	human	known	74_37	silent	5.88	48	3	SNP	0.998	T
KHSRP	8570	genome.wustl.edu	37	19	6416853	6416853	+	Frame_Shift_Del	DEL	G	G	-			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr19:6416853delG	ENST00000398148.3	-	13	1315	c.1223delC	c.(1222-1224)ccgfs	p.P408fs	MIR3940_ENST00000579148.1_RNA	NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein	408	Gly-rich.				gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)	p.P408L(1)		breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						TCGGCCCCCCGGGGGCATGCC	0.652																																					Colon(55;593 1006 2067 9135 22980)												1	Substitution - Missense(1)	large_intestine(1)											15.0	18.0	17.0					19																	6416853		1895	4104	5999	SO:0001589	frameshift_variant	0			U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945		ENST00000398148.3:c.1223delC	19.37:g.6416853delG	ENSP00000381216:p.Pro408fs		O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Frame_Shift_Del	DEL	pfam_KH_dom_type_1,pfam_KH_dom_type_2,pfam_DUF1897,smart_KH_dom,pfscan_KH_dom_type_1	p.P408fs	ENST00000398148.3	37	c.1223	CCDS45936.1	19																																																																																			KHSRP	-	NULL	ENSG00000088247		0.652	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHSRP	HGNC	protein_coding	OTTHUMT00000453305.1		0.00	127	0	G			6416853	-1	tier1		no_errors	ENST00000398148	ensembl	human	known	74_37	frame_shift_del	5.00	38	2	DEL	0.998	-
KIAA0141	9812	genome.wustl.edu	37	5	141309193	141309193	+	Silent	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr5:141309193G>A	ENST00000432126.2	+	5	593	c.459G>A	c.(457-459)agG>agA	p.R153R	KIAA0141_ENST00000194118.4_Silent_p.R153R	NM_001142603.1|NM_014773.3	NP_001136075.1|NP_055588.3	Q14154	DELE_HUMAN	KIAA0141	153					extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	mitochondrion (GO:0005739)				endometrium(3)|large_intestine(4)|lung(5)|skin(1)|urinary_tract(3)	16		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCTCCCAGGCACACTGGCC	0.622																																																	0													66.0	67.0	67.0					5																	141309193		2203	4300	6503	SO:0001819	synonymous_variant	0			BC011269	CCDS4268.1	5q31	2011-05-05			ENSG00000081791	ENSG00000081791			28969	protein-coding gene	gene with protein product	"""death ligand signal enhancer"""	615741				20563667	Standard	XM_005268549		Approved	DELE	uc003llt.3	Q14154	OTTHUMG00000129662	ENST00000432126.2:c.459G>A	5.37:g.141309193G>A			Q969R4|Q96EU9	Silent	SNP	pfam_Sel1-like,smart_Sel1-like	p.R153	ENST00000432126.2	37	c.459	CCDS4268.1	5																																																																																			KIAA0141	-	NULL	ENSG00000081791		0.622	KIAA0141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0141	HGNC	protein_coding	OTTHUMT00000251863.2		0.00	47	0	G	NM_014773		141309193	+1			no_errors	ENST00000194118	ensembl	human	known	74_37	silent	9.09	40	4	SNP	0.034	A
KIAA2022	340533	genome.wustl.edu	37	X	73961539	73961539	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chrX:73961539G>T	ENST00000055682.6	-	3	3464	c.2853C>A	c.(2851-2853)gaC>gaA	p.D951E		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	951					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						CTTGCATGGAGTCATACAGGA	0.433																																																	0													177.0	152.0	160.0					X																	73961539		2203	4300	6503	SO:0001583	missense	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.2853C>A	X.37:g.73961539G>T	ENSP00000055682:p.Asp951Glu		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.D951E	ENST00000055682.6	37	c.2853	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	G	0	-2.864744	0.00064	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.26957	1.7;1.7	5.05	-0.508	0.11980	.	0.935815	0.09120	N	0.845914	T	0.06462	0.0166	N	0.02539	-0.55	0.21020	N	0.999803	B	0.19200	0.034	B	0.15870	0.014	T	0.34403	-0.9830	10	0.02654	T	1	-0.2623	0.8205	0.01111	0.3959:0.1088:0.2348:0.2604	.	951	Q5QGS0	K2022_HUMAN	E	951	ENSP00000362567:D951E;ENSP00000055682:D951E	ENSP00000055682:D951E	D	-	3	2	KIAA2022	73878264	0.998000	0.40836	0.393000	0.26258	0.019000	0.09904	0.451000	0.21779	-0.080000	0.12685	-1.158000	0.01797	GAC	KIAA2022	-	NULL	ENSG00000050030		0.433	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	-	0.00	48	0	G	NM_001008537		73961539	-1	tier1	-	no_errors	ENST00000055682	ensembl	human	known	74_37	missense	11.11	24	3	SNP	0.967	T
KLF12	11278	genome.wustl.edu	37	13	74420344	74420344	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr13:74420344G>A	ENST00000377669.2	-	3	316	c.290C>T	c.(289-291)tCa>tTa	p.S97L	KLF12_ENST00000377666.4_Missense_Mutation_p.S97L|KLF12_ENST00000472022.1_5'UTR	NM_007249.4	NP_009180.3	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12	97					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	16		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		TGGGGAGGATGAAACGGCAGT	0.502																																																	0													180.0	132.0	148.0					13																	74420344		2203	4300	6503	SO:0001583	missense	0			AJ243274	CCDS9449.1	13q22	2013-01-08			ENSG00000118922	ENSG00000118922		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6346	protein-coding gene	gene with protein product	"""KLF12 zinc finger transcriptional repressor"", ""AP-2rep transcription factor"", ""AP-2 repressor"""	607531				10704285	Standard	NM_007249		Approved	AP-2rep, HSPC122, AP2REP	uc001vjf.3	Q9Y4X4	OTTHUMG00000017078	ENST00000377669.2:c.290C>T	13.37:g.74420344G>A	ENSP00000366897:p.Ser97Leu		A8K5T2|L0R3J4|Q5VZM7|Q9UHZ0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S97L	ENST00000377669.2	37	c.290	CCDS9449.1	13	.	.	.	.	.	.	.	.	.	.	G	15.63	2.890140	0.52014	.	.	ENSG00000118922	ENST00000377669;ENST00000342812;ENST00000377666	T;T	0.01464	4.86;4.86	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.03390	0.0098	L	0.61218	1.895	0.58432	D	0.999999	B	0.06786	0.001	B	0.06405	0.002	T	0.52351	-0.8587	10	0.11182	T	0.66	.	19.5289	0.95219	0.0:0.0:1.0:0.0	.	97	Q9Y4X4	KLF12_HUMAN	L	97	ENSP00000366897:S97L;ENSP00000366894:S97L	ENSP00000344057:S97L	S	-	2	0	KLF12	73318345	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	6.275000	0.72594	2.865000	0.98341	0.655000	0.94253	TCA	KLF12	-	NULL	ENSG00000118922		0.502	KLF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF12	HGNC	protein_coding	OTTHUMT00000045271.2	-	0.00	125	0	G	NM_007249		74420344	-1	tier1	-	no_errors	ENST00000377666	ensembl	human	known	74_37	missense	45.45	54	45	SNP	1.000	A
KPNB1	3837	genome.wustl.edu	37	17	45738512	45738512	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr17:45738512G>A	ENST00000290158.4	+	6	1071	c.664G>A	c.(664-666)Gtc>Atc	p.V222I	KPNB1_ENST00000577918.1_3'UTR|KPNB1_ENST00000535458.2_Missense_Mutation_p.V77I|KPNB1_ENST00000540627.1_Missense_Mutation_p.V77I|KPNB1_ENST00000537679.1_Missense_Mutation_p.V77I	NM_001276453.1|NM_002265.4	NP_001263382.1|NP_002256.2	Q14974	IMB1_HUMAN	karyopherin (importin) beta 1	222					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|protein import into nucleus (GO:0006606)|protein import into nucleus, translocation (GO:0000060)|ribosomal protein import into nucleus (GO:0006610)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|ovary(1)|pancreas(1)|skin(1)	4						TATGCAGGTGGTCTGTGAAGC	0.383																																																	0													122.0	114.0	117.0					17																	45738512		2203	4300	6503	SO:0001583	missense	0			L39793	CCDS11513.1, CCDS62228.1	17q21.32	2013-02-14			ENSG00000108424	ENSG00000108424		"""Importins"", ""Armadillo repeat containing"""	6400	protein-coding gene	gene with protein product	"""importin 1"""	602738				7615630, 7627554	Standard	NM_002265		Approved	NTF97, IPOB, MGC2155, MGC2156, MGC2157, IMB1, Impnb, IPO1	uc002ilt.2	Q14974	OTTHUMG00000036957	ENST00000290158.4:c.664G>A	17.37:g.45738512G>A	ENSP00000290158:p.Val222Ile		B7ZAV6|D3DTT3|Q14637|Q53XN2|Q96J27	Missense_Mutation	SNP	pfam_HEAT,pfam_Importin-beta_N,pfam_Armadillo,superfamily_ARM-type_fold,smart_Importin-beta_N,smart_Armadillo,pfscan_HEAT_type_2,pfscan_Importin-beta_N	p.V222I	ENST00000290158.4	37	c.664	CCDS11513.1	17	.	.	.	.	.	.	.	.	.	.	G	19.36	3.813152	0.70912	.	.	ENSG00000108424	ENST00000535458;ENST00000290158;ENST00000540627;ENST00000537679	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	5.91	5.91	0.95273	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.77671	0.4165	M	0.62723	1.935	0.39478	D	0.967836	P;P	0.42123	0.771;0.5	P;B	0.54372	0.75;0.05	T	0.71735	-0.4503	9	0.30854	T	0.27	-4.6913	20.2983	0.98569	0.0:0.0:1.0:0.0	.	77;222	F5H4R7;Q14974	.;IMB1_HUMAN	I	77;222;77;77	ENSP00000438253:V77I;ENSP00000290158:V222I;ENSP00000438964:V77I;ENSP00000445006:V77I	ENSP00000290158:V222I	V	+	1	0	KPNB1	43093511	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.575000	0.98187	2.802000	0.96397	0.655000	0.94253	GTC	KPNB1	-	superfamily_ARM-type_fold	ENSG00000108424		0.383	KPNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNB1	HGNC	protein_coding	OTTHUMT00000089755.2	-	0.00	81	0	G	NM_002265		45738512	+1	tier1	-	no_errors	ENST00000290158	ensembl	human	known	74_37	missense	38.18	34	21	SNP	1.000	A
KRTAP10-7	386675	genome.wustl.edu	37	21	46020564	46020564	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr21:46020564T>A	ENST00000380102.2	+	1	68	c.43T>A	c.(43-45)Tac>Aac	p.Y15N	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	15						keratin filament (GO:0045095)				breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						CGACCTGAGCTACGGCAGCCG	0.627																																																	0													46.0	56.0	53.0					21																	46020564		2097	4217	6314	SO:0001583	missense	0			AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.43T>A	21.37:g.46020564T>A	ENSP00000369445:p.Tyr15Asn		Q0VDJ8|Q70LJ2	Missense_Mutation	SNP	NULL	p.Y15N	ENST00000380102.2	37	c.43		21	.	.	.	.	.	.	.	.	.	.	t	10.43	1.349456	0.24426	.	.	ENSG00000205441	ENST00000380102	T	0.00669	5.9	3.94	1.33	0.21861	.	.	.	.	.	T	0.01254	0.0041	M	0.79926	2.475	0.09310	N	1	P	0.38020	0.615	B	0.37304	0.246	T	0.41680	-0.9495	9	0.29301	T	0.29	.	4.0929	0.09978	0.0:0.1203:0.2081:0.6716	.	15	P60409-2	.	N	15	ENSP00000369445:Y15N	ENSP00000369445:Y15N	Y	+	1	0	KRTAP10-7	44844992	0.250000	0.23951	0.001000	0.08648	0.013000	0.08279	0.938000	0.28965	0.372000	0.24591	0.383000	0.25322	TAC	KRTAP10-7	-	NULL	ENSG00000205441		0.627	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	KRTAP10-7	HGNC	protein_coding	OTTHUMT00000128038.1	-	0.00	184	0	T	NM_198689		46020564	+1	tier1	-	no_errors	ENST00000380102	ensembl	human	known	74_37	missense	66.67	32	64	SNP	0.002	A
LINC01531	100128682	genome.wustl.edu	37	19	35899445	35899445	+	lincRNA	SNP	C	C	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr19:35899445C>A	ENST00000536898.1	+	0	2034					NR_040046.1																						AGATGTGGATCTTAGGGACGG	0.557																																																	0																																												0																															19.37:g.35899445C>A				RNA	SNP	-	NULL	ENST00000536898.1	37	NULL		19	.	.	.	.	.	.	.	.	.	.	C	5.817	0.334948	0.11013	.	.	ENSG00000205786	ENST00000536898	.	.	.	2.91	-0.684	0.11331	.	.	.	.	.	T	0.20981	0.0505	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24584	-1.0156	4	.	.	.	.	2.5866	0.04832	0.2282:0.5007:0.0:0.271	.	.	.	.	I	266	.	.	L	+	1	0	AC002511.1	40591285	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.297000	0.08276	-0.038000	0.13624	-0.324000	0.08512	CTT	AC002511.1	-	-	ENSG00000205786		0.557	AC002511.1-002	KNOWN	basic	lincRNA	LOC100128682	Clone_based_vega_gene	lincRNA	OTTHUMT00000466118.1	-	0.00	59	0	C			35899445	+1	tier1	-	no_errors	ENST00000536898	ensembl	human	known	74_37	rna	34.21	25	13	SNP	0.001	A
LMTK3	114783	genome.wustl.edu	37	19	49003083	49003083	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr19:49003083G>A	ENST00000600059.1	-	11	1470	c.1243C>T	c.(1243-1245)Cgg>Tgg	p.R415W	LMTK3_ENST00000270238.3_Missense_Mutation_p.R444W			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	415					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		CGGGGAGGCCGCTCGGAGAGC	0.701																																																	0													4.0	5.0	4.0					19																	49003083		1780	3952	5732	SO:0001583	missense	0			AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.1243C>T	19.37:g.49003083G>A	ENSP00000472020:p.Arg415Trp		Q4G0U1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R444W	ENST00000600059.1	37	c.1330		19	.	.	.	.	.	.	.	.	.	.	G	17.20	3.329061	0.60743	.	.	ENSG00000142235	ENST00000270238	T	0.77489	-1.1	3.42	3.42	0.39159	Protein kinase-like domain (1);	0.131912	0.28088	N	0.016658	T	0.68403	0.2997	N	0.08118	0	0.28884	N	0.894253	D	0.89917	1.0	P	0.60012	0.867	T	0.61347	-0.7081	10	0.37606	T	0.19	.	6.8129	0.23814	0.1301:0.0:0.8699:0.0	.	415	Q96Q04	LMTK3_HUMAN	W	444	ENSP00000270238:R444W	ENSP00000270238:R444W	R	-	1	2	LMTK3	53694895	1.000000	0.71417	0.998000	0.56505	0.722000	0.41435	0.815000	0.27253	1.944000	0.56390	0.400000	0.26472	CGG	LMTK3	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom	ENSG00000142235		0.701	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	LMTK3	HGNC	protein_coding	OTTHUMT00000466137.1	-	0.00	75	0	G	NM_052895		49003083	-1	tier1	-	no_errors	ENST00000270238	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	A
PLXDC1	57125	genome.wustl.edu	37	17	37263851	37263851	+	Intron	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr17:37263851G>A	ENST00000315392.4	-	6	804				PLXDC1_ENST00000444911.2_Intron|PLXDC1_ENST00000539608.1_Intron|PLXDC1_ENST00000493200.1_Intron|PLXDC1_ENST00000394316.2_Intron	NM_020405.4	NP_065138.2	Q8IUK5	PLDX1_HUMAN	plexin domain containing 1						angiogenesis (GO:0001525)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)	receptor activity (GO:0004872)			kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						AATGCCAGTCGGAGGGCAGCG	0.602																																																	0																																										SO:0001627	intron_variant	0			AF279144	CCDS11333.1	17q21.1	2006-04-12			ENSG00000161381	ENSG00000161381			20945	protein-coding gene	gene with protein product	"""tumor endothelial marker 7 precursor"""	606826				10947988, 11559528	Standard	NM_020405		Approved	TEM3, TEM7	uc002hrg.2	Q8IUK5	OTTHUMG00000133183	ENST00000315392.4:c.593-73C>T	17.37:g.37263851G>A			B2R7I8|Q5QCZ7|Q5QCZ8|Q5QCZ9|Q9HCT9	RNA	SNP	-	NULL	ENST00000315392.4	37	NULL	CCDS11333.1	17																																																																																			CTD-2206N4.4	-	-	ENSG00000263818		0.602	PLXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100131347	Clone_based_vega_gene	protein_coding	OTTHUMT00000256892.2	-	0.00	85	0	G	NM_020405		37263851	+1	tier1	-	no_errors	ENST00000578423	ensembl	human	known	74_37	rna	29.69	45	19	SNP	0.000	A
RNU1-5P	107105261	genome.wustl.edu	37	1	17198381	17198381	+	lincRNA	SNP	T	T	G	rs199674141	byFrequency	TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:17198381T>G	ENST00000362684.1	+	0	0																											GGAGAGACTCTCGTGTAGCTC	0.547													.|||	1641	0.327676	0.1218	0.3573	5008	,	,		20970	0.6736		0.3181	False		,,,				2504	0.2382																0																																												0																															1.37:g.17198381T>G				RNA	SNP	-	NULL	ENST00000362684.1	37	NULL		1	.	.	.	.	.	.	.	.	.	.	.	3.367	-0.129342	0.06753	.	.	ENSG00000196690	ENST00000356370	.	.	.	0.646	-1.29	0.09288	.	.	.	.	.	T	0.08313	0.0207	.	.	.	.	.	.	.	.	.	.	.	.	T	0.25606	-1.0127	3	0.02654	T	1	.	.	.	.	.	.	.	.	A	88	.	ENSP00000348731:E88A	E	-	2	0	BX284668.1	17070968	0.029000	0.19370	0.001000	0.08648	0.007000	0.05969	-0.524000	0.06222	-1.683000	0.01444	-1.044000	0.02363	GAG	U1	-	-	ENSG00000228549		0.547	U1.1-201	KNOWN	basic	snRNA	LOC101927806	RFAM	lincRNA		-	0.00	45	0	T			17198381	+1	tier1	rs199674141	no_errors	ENST00000438002	ensembl	human	known	74_37	rna	14.29	24	4	SNP	0.001	G
PDE4DIP	9659	genome.wustl.edu	37	1	145018788	145018788	+	Intron	SNP	T	T	C	rs1052063	byFrequency	TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:145018788T>C	ENST00000530740.1	-	2	328				PDE4DIP_ENST00000369359.4_Intron|PDE4DIP_ENST00000313382.9_Intron|PDE4DIP_ENST00000369348.3_Intron|RP11-326G21.1_ENST00000610119.1_RNA|PDE4DIP_ENST00000493130.2_Intron|PDE4DIP_ENST00000478649.2_Intron			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GAACAGAAATTTAAGGCAGGC	0.343			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0																																										SO:0001627	intron_variant	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000530740.1:c.289+2323A>G	1.37:g.145018788T>C			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	RNA	SNP	-	NULL	ENST00000530740.1	37	NULL		1																																																																																			RP11-326G21.1	-	-	ENSG00000272755		0.343	PDE4DIP-036	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	LOC101929787	Clone_based_vega_gene	protein_coding	OTTHUMT00000384663.2	-	0.00	8	0	T	NM_022359		145018788	+1	tier1	rs1052063	no_errors	ENST00000610119	ensembl	human	known	74_37	rna	71.43	2	5	SNP	0.998	C
LOC440040	440040	genome.wustl.edu	37	11	49831501	49831501	+	RNA	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:49831501G>A	ENST00000527477.1	+	0	1726																											TGGGCTTTCGGTGTTTGTAAT	0.453																																																	0																																												0																															11.37:g.49831501G>A				RNA	SNP	-	NULL	ENST00000527477.1	37	NULL		11																																																																																			RP11-707M1.1	-	-	ENSG00000205035		0.453	RP11-707M1.1-003	KNOWN	basic	processed_transcript	LOC440040	Clone_based_vega_gene	pseudogene	OTTHUMT00000391378.2	-	0.00	302	0	G			49831501	+1	tier1	-	no_errors	ENST00000527477	ensembl	human	known	74_37	rna	51.05	92	97	SNP	0.555	A
LRRCC1	85444	genome.wustl.edu	37	8	86044118	86044118	+	Silent	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr8:86044118C>T	ENST00000360375.3	+	12	2039	c.1890C>T	c.(1888-1890)gaC>gaT	p.D630D	LRRCC1_ENST00000414626.2_Silent_p.D610D	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	630					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						AGAAAATTGACGTGTTAAGCC	0.358																																																	0													117.0	109.0	112.0					8																	86044118		1837	4078	5915	SO:0001819	synonymous_variant	0			BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.1890C>T	8.37:g.86044118C>T			B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Silent	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin	p.D630	ENST00000360375.3	37	c.1890	CCDS43750.1	8																																																																																			LRRCC1	-	NULL	ENSG00000133739		0.358	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRCC1	HGNC	protein_coding	OTTHUMT00000380267.1	-	0.00	75	0	C	NM_033402		86044118	+1	tier1	-	no_errors	ENST00000360375	ensembl	human	known	74_37	silent	8.70	105	10	SNP	0.000	T
ME2	4200	genome.wustl.edu	37	18	48466002	48466002	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr18:48466002G>T	ENST00000321341.5	+	14	1752	c.1480G>T	c.(1480-1482)Gct>Tct	p.A494S	ME2_ENST00000382927.3_Intron|ME2_ENST00000585680.1_Intron	NM_002396.4	NP_002387.1	P23368	MAOM_HUMAN	malic enzyme 2, NAD(+)-dependent, mitochondrial	494					malate metabolic process (GO:0006108)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(3)	23		Colorectal(6;0.0273)|all_epithelial(6;0.118)		Colorectal(21;0.0313)|READ - Rectum adenocarcinoma(32;0.105)|STAD - Stomach adenocarcinoma(97;0.184)		TTTCCTAGAAGCTGCAAAGGT	0.323																																																	0													101.0	100.0	100.0					18																	48466002		2203	4300	6503	SO:0001583	missense	0			M55905	CCDS11948.1, CCDS54187.1	18q21	2012-10-02			ENSG00000082212	ENSG00000082212	1.1.1.40		6984	protein-coding gene	gene with protein product		154270				1993674	Standard	NM_002396		Approved		uc002ley.3	P23368	OTTHUMG00000132694	ENST00000321341.5:c.1480G>T	18.37:g.48466002G>T	ENSP00000321070:p.Ala494Ser		B2R8J2|Q9BWL6|Q9BYG1|Q9H4B2	Missense_Mutation	SNP	pfam_Malic_NAD-bd,pfam_Malic_N,smart_Malic_NAD-bd,prints_Malic_OxRdtase	p.A494S	ENST00000321341.5	37	c.1480	CCDS11948.1	18	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124975	0.56613	.	.	ENSG00000082212	ENST00000321341	T	0.61274	0.12	5.22	5.22	0.72569	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.60051	0.2239	L	0.51853	1.615	0.80722	D	1	B	0.10296	0.003	B	0.35240	0.198	T	0.56372	-0.7990	10	0.35671	T	0.21	-11.5192	17.5378	0.87837	0.0:0.0:1.0:0.0	.	494	P23368	MAOM_HUMAN	S	494	ENSP00000321070:A494S	ENSP00000321070:A494S	A	+	1	0	ME2	46720000	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.195000	0.72088	2.440000	0.82611	0.467000	0.42956	GCT	ME2	-	pfam_Malic_NAD-bd,smart_Malic_NAD-bd	ENSG00000082212		0.323	ME2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ME2	HGNC	protein_coding	OTTHUMT00000255991.1	-	0.00	113	0	G	NM_002396		48466002	+1	tier1	-	no_errors	ENST00000321341	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
MFRP	83552	genome.wustl.edu	37	11	119213351	119213351	+	Missense_Mutation	SNP	C	C	T	rs142846614		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:119213351C>T	ENST00000530681.1	-	11	1486	c.1342G>A	c.(1342-1344)Gat>Aat	p.D448N	C1QTNF5_ENST00000525657.1_5'Flank|C1QTNF5_ENST00000445041.2_5'UTR|MFRP_ENST00000555262.1_Missense_Mutation_p.D448N|MFRP_ENST00000360167.4_Silent_p.P372P|MFRP_ENST00000529147.1_5'Flank|C1QTNF5_ENST00000528368.1_5'Flank|MFRP_ENST00000449574.2_Missense_Mutation_p.D448N	NM_001278431.1	NP_001265360.1	Q9BY79	MFRP_HUMAN	membrane frizzled-related protein	448	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				embryo development (GO:0009790)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|urinary_tract(1)	18		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		TCGCTGCCATCGGTGCAGTCT	0.642																																																	0								C	,ASN/ASP	0,4398		0,0,2199	119.0	108.0	112.0		,1342	1.1	0.0	11	dbSNP_134	112	2,8588	2.2+/-6.3	0,2,4293	no	utr-5,missense	MFRP,C1QTNF5	NM_015645.3,NM_031433.2	,23	0,2,6492	TT,TC,CC		0.0233,0.0,0.0154	,benign	,448/580	119213351	2,12986	2199	4295	6494	SO:0001583	missense	0			AB055505	CCDS8421.1	11q23.3	2014-01-28			ENSG00000235718	ENSG00000235718			18121	protein-coding gene	gene with protein product	"""membrane-type frizzled-related protein"", ""complement C1q tumor necrosis factor-related protein 5 precursor variant 1"""	606227				11263980	Standard	NM_031433		Approved	FLJ30570, rd6, NNO2, C1QTNF5	uc001pwj.2	Q9BY79		ENST00000530681.1:c.1342G>A	11.37:g.119213351C>T	ENSP00000456533:p.Asp448Asn		B0YJ36|B0YJ37|B4DHN8|Q335M3|Q96DQ9	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Frizzled_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_Frizzled_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,smart_Frizzled_dom,pfscan_CUB_dom,pfscan_Frizzled_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.D448N	ENST00000530681.1	37	c.1342	CCDS8421.1	11	.	.	.	.	.	.	.	.	.	.	C	10.17	1.276653	0.23307	0.0	2.33E-4	ENSG00000235718	ENST00000555262;ENST00000449574	D;D	0.96554	-4.05;-4.05	4.19	1.09	0.20402	.	0.176302	0.46758	N	0.000265	D	0.91895	0.7434	L	0.60957	1.885	0.09310	N	1	B	0.20671	0.047	B	0.13407	0.009	T	0.78054	-0.2354	10	0.10636	T	0.68	0.1577	6.0311	0.19681	0.0:0.6551:0.1566:0.1883	.	448	Q9BY79	MFRP_HUMAN	N	448	ENSP00000450509:D448N;ENSP00000391664:D448N	ENSP00000391664:D448N	D	-	1	0	MFRP	118718561	0.002000	0.14202	0.000000	0.03702	0.341000	0.28922	1.514000	0.35834	0.099000	0.17552	0.561000	0.74099	GAT	MFRP	-	superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	ENSG00000235718		0.642	MFRP-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	MFRP	HGNC	protein_coding	OTTHUMT00000415179.1	-	0.00	33	0	C	NM_031433		119213351	-1	tier1	rs142846614	no_errors	ENST00000449574	ensembl	human	known	74_37	missense	46.15	14	12	SNP	0.028	T
MFSD10	10227	genome.wustl.edu	37	4	2933849	2933849	+	Missense_Mutation	SNP	G	G	A	rs200375938	byFrequency	TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr4:2933849G>A	ENST00000329687.4	-	6	1259	c.725C>T	c.(724-726)gCg>gTg	p.A242V	NOP14-AS1_ENST00000505731.1_RNA|MFSD10_ENST00000514800.1_Missense_Mutation_p.A242V|NOP14-AS1_ENST00000507999.1_RNA|MFSD10_ENST00000507555.1_Missense_Mutation_p.A242V|MFSD10_ENST00000508221.1_Missense_Mutation_p.A242V|MFSD10_ENST00000355443.4_Missense_Mutation_p.A242V	NM_001120.4	NP_001111.3	Q14728	MFS10_HUMAN	major facilitator superfamily domain containing 10	242					apoptotic process (GO:0006915)|tetracycline transport (GO:0015904)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)	tetracycline transporter activity (GO:0008493)			breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CAGATCAGCCGCATCACGGAA	0.667													G|||	7	0.00139776	0.0	0.0	5008	,	,		17280	0.005		0.001	False		,,,				2504	0.001																0								G	VAL/ALA,VAL/ALA	0,4400		0,0,2200	24.0	24.0	24.0		725,725	4.7	0.0	4		24	3,8589		0,3,4293	yes	missense,missense	MFSD10	NM_001120.4,NM_001146069.1	64,64	0,3,6493	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging,probably-damaging	242/456,242/456	2933849	3,12989	2200	4296	6496	SO:0001583	missense	0			L11669	CCDS3365.1	4p16.3	2008-03-03			ENSG00000109736	ENSG00000109736			16894	protein-coding gene	gene with protein product	"""tetracycline transporter like protein"""	610977				8353488, 17362938	Standard	NM_001120		Approved	TETRAN, IT10C3	uc003gfz.3	Q14728	OTTHUMG00000122081	ENST00000329687.4:c.725C>T	4.37:g.2933849G>A	ENSP00000332646:p.Ala242Val		Q07706	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A242V	ENST00000329687.4	37	c.725	CCDS3365.1	4	6	0.0027472527472527475	0	0.0	0	0.0	4	0.006993006993006993	2	0.002638522427440633	G	21.0	4.077615	0.76528	0.0	3.49E-4	ENSG00000109736	ENST00000514800;ENST00000355443;ENST00000329687;ENST00000508221;ENST00000507555	T;T;T;T;T	0.81330	-1.48;-1.48;-1.48;-1.48;-1.48	4.69	4.69	0.59074	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.167381	0.53938	D	0.000060	T	0.81941	0.4929	M	0.79123	2.44	0.09310	N	0.999996	P;D;P;P	0.54207	0.907;0.965;0.935;0.907	P;P;P;P	0.52066	0.558;0.689;0.449;0.638	T	0.78099	-0.2336	10	0.46703	T	0.11	-25.3775	16.194	0.82011	0.0:0.0:1.0:0.0	.	242;242;242;242	D6RIZ4;D6RE79;D6RA47;Q14728	.;.;.;MFS10_HUMAN	V	242	ENSP00000426907:A242V;ENSP00000347619:A242V;ENSP00000332646:A242V;ENSP00000425757:A242V;ENSP00000423402:A242V	ENSP00000332646:A242V	A	-	2	0	MFSD10	2903647	0.661000	0.27430	0.005000	0.12908	0.004000	0.04260	3.978000	0.56881	2.156000	0.67533	0.637000	0.83480	GCG	MFSD10	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000109736		0.667	MFSD10-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MFSD10	HGNC	protein_coding	OTTHUMT00000358072.2		0.00	33	0	G	NM_001120		2933849	-1			no_errors	ENST00000329687	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.058	A
MN1	4330	genome.wustl.edu	37	22	28194933	28194933	+	Silent	SNP	T	T	C	rs572936881|rs373314940|rs71194738	byFrequency	TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr22:28194933T>C	ENST00000302326.4	-	1	2553	c.1599A>G	c.(1597-1599)caA>caG	p.Q533Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	533	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgttgctgctgct	0.652			T	ETV6	"""AML, meningioma"""								T|||	98	0.0195687	0.0613	0.0086	5008	,	,		12327	0.002		0.005	False		,,,				2504	0.0041							Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	0								C		9,3561		0,9,1776	4.0	5.0	5.0		1599	-0.4	1.0	22		5	5,7341		0,5,3668	no	coding-synonymous	MN1	NM_002430.2		0,14,5444	CC,CT,TT		0.0681,0.2521,0.1283		533/1321	28194933	14,10902	1785	3673	5458	SO:0001819	synonymous_variant	0			X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1599A>G	22.37:g.28194933T>C			A9Z1V9	Silent	SNP	NULL	p.Q533	ENST00000302326.4	37	c.1599	CCDS42998.1	22																																																																																			MN1	-	NULL	ENSG00000169184		0.652	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MN1	HGNC	protein_coding	OTTHUMT00000320737.1	-	0.00	45	0	T	NM_002430		28194933	-1	tier1	-	no_errors	ENST00000302326	ensembl	human	known	74_37	silent	17.39	19	4	SNP	0.993	C
MRGPRF	116535	genome.wustl.edu	37	11	68773432	68773432	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:68773432G>A	ENST00000309099.6	-	3	728	c.346C>T	c.(346-348)Cgc>Tgc	p.R116C	MRGPRF_ENST00000441623.1_Missense_Mutation_p.R116C|RP11-554A11.5_ENST00000562506.1_RNA	NM_145015.4	NP_659452.3	Q96AM1	MRGRF_HUMAN	MAS-related GPR, member F	116						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(4)	7			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CACACGCTGCGGATGTAGTCG	0.677																																																	0													26.0	24.0	25.0					11																	68773432		2173	4261	6434	SO:0001583	missense	0			AK075492	CCDS8188.1	11q13.1	2014-03-13	2004-03-25		ENSG00000172935	ENSG00000172935		"""GPCR / Class A : Orphans"""	24828	protein-coding gene	gene with protein product		607233	"""G protein-coupled receptor 168"", ""G protein-coupled receptor 140"""	GPR168, GPR140		12477932	Standard	NM_001098515		Approved	MGC21621, mrgF	uc001oop.4	Q96AM1	OTTHUMG00000167897	ENST00000309099.6:c.346C>T	11.37:g.68773432G>A	ENSP00000309782:p.Arg116Cys		B3KV43|Q8NBK8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.R116C	ENST00000309099.6	37	c.346	CCDS8188.1	11	.	.	.	.	.	.	.	.	.	.	G	12.00	1.805649	0.31961	.	.	ENSG00000172935	ENST00000441623;ENST00000309099;ENST00000421543	T;T	0.15487	2.42;2.42	4.71	4.71	0.59529	GPCR, rhodopsin-like superfamily (1);	0.162245	0.29565	N	0.011788	T	0.08980	0.0222	N	0.11064	0.09	0.40228	D	0.97781	B	0.25441	0.126	B	0.19148	0.024	T	0.27706	-1.0066	10	0.17369	T	0.5	-38.8931	13.1873	0.59688	0.0:0.0:1.0:0.0	.	116	Q96AM1	MRGRF_HUMAN	C	116;116;88	ENSP00000403660:R116C;ENSP00000309782:R116C	ENSP00000309782:R116C	R	-	1	0	MRGPRF	68530008	0.004000	0.15560	0.390000	0.26220	0.126000	0.20510	1.204000	0.32296	2.177000	0.69029	0.561000	0.74099	CGC	MRGPRF	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000172935		0.677	MRGPRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRF	HGNC	protein_coding	OTTHUMT00000396875.1	-	0.00	99	0	G	NM_145015		68773432	-1	tier1	-	no_errors	ENST00000309099	ensembl	human	known	74_37	missense	23.08	50	15	SNP	0.835	A
MT-ND5	4540	genome.wustl.edu	37	M	12417	12418	+	Frame_Shift_Ins	INS	-	-	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chrM:12417_12418insA	ENST00000361567.2	+	1	81_82	c.81_82insA	c.(82-84)aaafs	p.K28fs	MT-CYB_ENST00000361789.2_5'Flank|MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	28					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						GTTAACCCTAACAAAAAAAACT	0.416																																																	0																																										SO:0001589	frameshift_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.89dupA	M.37:g.12417_12417dupA	ENSP00000354813:p.Lys28fs		Q34773|Q8WCY3	Frame_Shift_Ins	INS	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.N29fs	ENST00000361567.2	37	c.81_82		MT																																																																																			MT-ND5	-	tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.416	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding			0.00	14	0	-	YP_003024036		12418	+1	tier1		no_errors	ENST00000361567	ensembl	human	known	74_37	frame_shift_ins	75.00	2	6	INS	NULL	A
MTMR10	54893	genome.wustl.edu	37	15	31235188	31235188	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr15:31235188C>T	ENST00000435680.1	-	15	1733	c.1636G>A	c.(1636-1638)Gca>Aca	p.A546T	MTMR10_ENST00000314404.8_Intron|MTMR10_ENST00000425768.1_3'UTR|FAN1_ENST00000362065.4_3'UTR	NM_017762.2	NP_060232.2	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10	546	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.						phosphatase activity (GO:0016791)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		CGATCCTTTGCTGTAAACTGG	0.413																																																	0													77.0	79.0	79.0					15																	31235188		1864	4077	5941	SO:0001583	missense	0			AK000320	CCDS45204.1	15q13.3	2011-06-09				ENSG00000166912		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	25999	protein-coding gene	gene with protein product						12495846	Standard	NM_017762		Approved	FLJ20313	uc001zfh.1	Q9NXD2		ENST00000435680.1:c.1636G>A	15.37:g.31235188C>T	ENSP00000402537:p.Ala546Thr		Q6P4Q6	Missense_Mutation	SNP	pfam_Myotubularin_assoc,pfam_Myotubularin-like_Pase_dom	p.A546T	ENST00000435680.1	37	c.1636	CCDS45204.1	15	.	.	.	.	.	.	.	.	.	.	C	12.70	2.016556	0.35606	.	.	ENSG00000166912	ENST00000435680	D	0.89939	-2.59	6.06	5.14	0.70334	Myotubularin phosphatase domain (1);	.	.	.	.	D	0.83473	0.5262	L	0.47716	1.5	0.36202	D	0.850823	B	0.13594	0.008	B	0.06405	0.002	T	0.79836	-0.1635	9	0.15952	T	0.53	.	11.1357	0.48373	0.0:0.796:0.1307:0.0733	.	546	Q9NXD2	MTMRA_HUMAN	T	546	ENSP00000402537:A546T	ENSP00000402537:A546T	A	-	1	0	MTMR10	29022480	0.895000	0.30542	0.537000	0.28052	0.966000	0.64601	1.137000	0.31479	1.556000	0.49512	0.655000	0.94253	GCA	MTMR10	-	NULL	ENSG00000166912		0.413	MTMR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR10	HGNC	protein_coding	OTTHUMT00000430747.1	-	0.00	97	0	C	NM_017762		31235188	-1	tier1	-	no_errors	ENST00000435680	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.387	T
MUC6	4588	genome.wustl.edu	37	11	1013970	1013972	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:1013970_1013972delCTC	ENST00000421673.2	-	32	7119_7121	c.7069_7071delGAG	c.(7069-7071)gagdel	p.E2357del		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2357	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGAACGTGATCTCCTCCTGCTGC	0.66																																																	0																																										SO:0001651	inframe_deletion	0			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.7069_7071delGAG	11.37:g.1013973_1013975delCTC	ENSP00000406861:p.Glu2357del		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	In_Frame_Del	DEL	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.E2357in_frame_del	ENST00000421673.2	37	c.7071_7069	CCDS44513.1	11																																																																																			MUC6	-	smart_Cys_knot_C,pfscan_Cys_knot_C	ENSG00000184956		0.660	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	HGNC	protein_coding	OTTHUMT00000382120.2		0.00	115	0	CTC	XM_290540		1013972	-1	tier1		no_errors	ENST00000421673	ensembl	human	known	74_37	in_frame_del	21.84	68	19	DEL	0.081:0.065:0.053	-
MUC5B	727897	genome.wustl.edu	37	11	1278831	1278831	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:1278831G>T	ENST00000529681.1	+	41	16399	c.16341G>T	c.(16339-16341)aaG>aaT	p.K5447N	MUC5B_ENST00000447027.1_Missense_Mutation_p.K5450N	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	5447	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TGCAGTGCAAGCCCCTGCCCT	0.692																																																	0													42.0	57.0	52.0					11																	1278831		2139	4239	6378	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.16341G>T	11.37:g.1278831G>T	ENSP00000436812:p.Lys5447Asn		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.K5450N	ENST00000529681.1	37	c.16350	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	G	10.12	1.263521	0.23136	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000546052;ENST00000406844	T;T	0.42900	0.96;0.96	4.43	-2.96	0.05547	.	.	.	.	.	T	0.23532	0.0569	L	0.34521	1.04	0.09310	N	1	B;P	0.39809	0.312;0.689	B;B	0.28305	0.053;0.088	T	0.13255	-1.0516	9	0.87932	D	0	.	7.5556	0.27822	0.1941:0.5773:0.2286:0.0	.	5784;5450	A7Y9J9;E9PBJ0	.;.	N	5447;5450;5391;346;5159	ENSP00000436812:K5447N;ENSP00000415793:K5450N	ENSP00000343037:K5391N	K	+	3	2	MUC5B	1235407	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-4.784000	0.00186	-0.397000	0.07691	0.549000	0.68633	AAG	MUC5B	-	smart_VWC_out,smart_VWF_C,pfscan_VWF_C	ENSG00000117983		0.692	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2		0.00	138	0	G	XM_001126093		1278831	+1			no_errors	ENST00000447027	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.000	T
MYH8	4626	genome.wustl.edu	37	17	10298754	10298754	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr17:10298754G>C	ENST00000403437.2	-	34	4752	c.4658C>G	c.(4657-4659)tCt>tGt	p.S1553C	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1553					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						ATGTTCAAGAGATGCCTTAAC	0.368									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																								0													60.0	54.0	56.0					17																	10298754		2203	4299	6502	SO:0001583	missense	0	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.4658C>G	17.37:g.10298754G>C	ENSP00000384330:p.Ser1553Cys		Q14910	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.S1553C	ENST00000403437.2	37	c.4658	CCDS11153.1	17	.	.	.	.	.	.	.	.	.	.	G	23.6	4.435459	0.83885	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.78816	-1.21	4.66	4.66	0.58398	Myosin tail (1);	0.000000	0.40728	U	0.001040	D	0.85588	0.5731	M	0.82630	2.6	0.53688	D	0.999977	P	0.47677	0.899	P	0.51657	0.676	D	0.88560	0.3122	10	0.87932	D	0	.	17.7273	0.88369	0.0:0.0:1.0:0.0	.	1553	P13535	MYH8_HUMAN	C	1553	ENSP00000384330:S1553C	ENSP00000252173:S1553C	S	-	2	0	MYH8	10239479	0.999000	0.42202	1.000000	0.80357	0.988000	0.76386	9.231000	0.95317	2.414000	0.81942	0.650000	0.86243	TCT	MYH8	-	pfam_Myosin_tail,superfamily_t-SNARE	ENSG00000133020		0.368	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	HGNC	protein_coding	OTTHUMT00000252724.2	-	0.00	60	0	G	NM_002472		10298754	-1	tier1	-	no_errors	ENST00000403437	ensembl	human	known	74_37	missense	20.25	63	16	SNP	1.000	C
MYO15A	51168	genome.wustl.edu	37	17	18034622	18034622	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr17:18034622C>T	ENST00000205890.5	+	9	4446	c.4108C>T	c.(4108-4110)Cgc>Tgc	p.R1370C		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	1370	Myosin motor.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CAACTCCAGCCGCTTTGGGAA	0.547																																																	0													68.0	72.0	70.0					17																	18034622		1969	4192	6161	SO:0001583	missense	0			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.4108C>T	17.37:g.18034622C>T	ENSP00000205890:p.Arg1370Cys		B4DFC7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.R1370C	ENST00000205890.5	37	c.4108	CCDS42271.1	17	.	.	.	.	.	.	.	.	.	.	C	16.97	3.269633	0.59540	.	.	ENSG00000091536	ENST00000205890	D	0.98280	-4.84	5.22	5.22	0.72569	Myosin head, motor domain (3);	.	.	.	.	D	0.99293	0.9753	H	0.97516	4.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98730	1.0712	9	0.87932	D	0	.	12.5453	0.56195	0.2768:0.7232:0.0:0.0	.	1370	Q9UKN7	MYO15_HUMAN	C	1370	ENSP00000205890:R1370C	ENSP00000205890:R1370C	R	+	1	0	MYO15A	17975347	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	2.455000	0.44988	2.445000	0.82738	0.491000	0.48974	CGC	MYO15A	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000091536		0.547	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1	-	0.00	105	0	C	NM_016239		18034622	+1	tier1	-	no_errors	ENST00000205890	ensembl	human	known	74_37	missense	37.65	53	32	SNP	1.000	T
MZB1	51237	genome.wustl.edu	37	5	138725510	138725512	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr5:138725510_138725512delCAG	ENST00000302125.8	-	1	91_93	c.34_36delCTG	c.(34-36)ctgdel	p.L12del	MZB1_ENST00000457570.2_In_Frame_Del_p.L12del|MZB1_ENST00000412103.2_5'UTR	NM_016459.3	NP_057543.2	Q8WU39	MZB1_HUMAN	marginal zone B and B1 cell-specific protein	12					apoptotic process (GO:0006915)|integrin activation (GO:0033622)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immunoglobulin biosynthetic process (GO:0002642)|regulation of B cell proliferation (GO:0030888)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)											CCCAGGCTCCcagcagcagcagc	0.626																																																	0										3,22,3657		0,0,3,3,16,1819						1.3	0.7			37	1,48,7121		0,0,1,6,36,3542	no	codingComplex	MZB1	NM_016459.3		0,0,4,9,52,5361	A1A1,A1A2,A1R,A2A2,A2R,RR		0.6834,0.679,0.6819				4,70,10778				SO:0001651	inframe_deletion	0			AF151024	CCDS47273.1	5q31.2	2012-09-27	2012-09-19		ENSG00000170476	ENSG00000170476			30125	protein-coding gene	gene with protein product	"""plasma cell-induced ER protein 1"", ""proapoptotic caspase adaptor protein"", ""mesenteric oestrogen-dependent adipose gene- 7"""	609447				22573353, 12573802, 11350957, 21093319, 21688198	Standard	NM_016459		Approved	PACAP, MGC29506, HSPC190, pERp1, MEDA-7	uc003lei.3	Q8WU39	OTTHUMG00000163390	ENST00000302125.8:c.34_36delCTG	5.37:g.138725519_138725521delCAG	ENSP00000303920:p.Leu12del		D2IYS0|Q7Z6N2|Q96RL5|Q9P0T3	In_Frame_Del	DEL	NULL	p.L12in_frame_del	ENST00000302125.8	37	c.36_34	CCDS47273.1	5																																																																																			MZB1	-	NULL	ENSG00000170476		0.626	MZB1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MZB1	HGNC	protein_coding	OTTHUMT00000373055.1		0.00	26	0	CAG	NM_016459		138725512	-1	tier1		no_errors	ENST00000503481	ensembl	human	known	74_37	in_frame_del	9.68	28	3	DEL	0.366:0.352:0.265	-
NFKBIZ	64332	genome.wustl.edu	37	3	101572494	101572494	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:101572494G>T	ENST00000326172.5	+	5	1239	c.1124G>T	c.(1123-1125)aGc>aTc	p.S375I	NFKBIZ_ENST00000326151.5_Missense_Mutation_p.S253I|NFKBIZ_ENST00000394054.2_Missense_Mutation_p.S275I	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	375	Required for transcriptional activity. {ECO:0000250}.				inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						CACAGCTTCAGCATGATGCCC	0.498																																																	0													104.0	108.0	107.0					3																	101572494		2203	4300	6503	SO:0001583	missense	0			AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.1124G>T	3.37:g.101572494G>T	ENSP00000325663:p.Ser375Ile		B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.S375I	ENST00000326172.5	37	c.1124	CCDS2946.1	3	.	.	.	.	.	.	.	.	.	.	G	10.42	1.346070	0.24426	.	.	ENSG00000144802	ENST00000483180;ENST00000394054;ENST00000326151;ENST00000326172	T;T;T;T	0.58506	0.35;0.33;0.58;0.36	5.65	-0.796	0.10912	.	0.505775	0.22410	N	0.060423	T	0.47525	0.1450	L	0.47716	1.5	0.09310	N	1	D;P	0.53151	0.958;0.558	P;B	0.47981	0.563;0.107	T	0.42292	-0.9460	10	0.54805	T	0.06	-17.1799	3.3623	0.07192	0.2745:0.1003:0.5228:0.1023	.	253;375	Q9BYH8-3;Q9BYH8	.;IKBZ_HUMAN	I	275;275;253;375	ENSP00000419800:S275I;ENSP00000377618:S275I;ENSP00000325593:S253I;ENSP00000325663:S375I	ENSP00000325593:S253I	S	+	2	0	NFKBIZ	103055184	0.002000	0.14202	0.006000	0.13384	0.058000	0.15608	0.050000	0.14120	-0.117000	0.11872	0.563000	0.77884	AGC	NFKBIZ	-	NULL	ENSG00000144802		0.498	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFKBIZ	HGNC	protein_coding	OTTHUMT00000353793.1	-	0.00	57	0	G	NM_031419		101572494	+1	tier1	-	no_errors	ENST00000326172	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.006	T
NFX1	4799	genome.wustl.edu	37	9	33311168	33311168	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr9:33311168C>T	ENST00000379540.3	+	6	1503	c.1441C>T	c.(1441-1443)Cga>Tga	p.R481*	NFX1_ENST00000318524.6_Nonsense_Mutation_p.R481*|NFX1_ENST00000379521.4_Nonsense_Mutation_p.R481*	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	481					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		TGAATGTGGACGAACCAGGTA	0.413																																																	0													146.0	142.0	143.0					9																	33311168		2203	4300	6503	SO:0001587	stop_gained	0			U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.1441C>T	9.37:g.33311168C>T	ENSP00000368856:p.Arg481*		A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Nonsense_Mutation	SNP	pfam_Znf_NFX1,pfam_R3H_ss-bd,smart_Znf_RING,smart_Znf_NFX1,smart_R3H_ss-bd,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_R3H_ss-bd	p.R481*	ENST00000379540.3	37	c.1441	CCDS6538.1	9	.	.	.	.	.	.	.	.	.	.	C	37	5.991872	0.97179	.	.	ENSG00000086102	ENST00000379540;ENST00000379521;ENST00000536210;ENST00000318524	.	.	.	5.56	5.56	0.83823	.	0.203246	0.42964	D	0.000635	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.0929	0.53737	0.1716:0.8284:0.0:0.0	.	.	.	.	X	481	.	ENSP00000317695:R481X	R	+	1	2	NFX1	33301168	1.000000	0.71417	1.000000	0.80357	0.529000	0.34654	3.877000	0.56123	2.629000	0.89072	0.644000	0.83932	CGA	NFX1	-	NULL	ENSG00000086102		0.413	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFX1	HGNC	protein_coding	OTTHUMT00000052069.1	-	0.00	75	0	C			33311168	+1	tier1	-	no_errors	ENST00000379540	ensembl	human	known	74_37	nonsense	48.89	23	22	SNP	1.000	T
NLGN1	22871	genome.wustl.edu	37	3	173322858	173322858	+	Missense_Mutation	SNP	A	A	C			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:173322858A>C	ENST00000457714.1	+	3	899	c.470A>C	c.(469-471)aAt>aCt	p.N157T	NLGN1_ENST00000401917.3_Missense_Mutation_p.N157T|NLGN1_ENST00000545397.1_Missense_Mutation_p.N157T|NLGN1_ENST00000361589.4_Missense_Mutation_p.N157T	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	157					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			CTATATTTAAATATATATGTC	0.348																																																	0													76.0	81.0	79.0					3																	173322858		2203	4300	6503	SO:0001583	missense	0			AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.470A>C	3.37:g.173322858A>C	ENSP00000392500:p.Asn157Thr		Q9UPT2	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.N157T	ENST00000457714.1	37	c.470	CCDS3222.1	3	.	.	.	.	.	.	.	.	.	.	A	16.95	3.263226	0.59431	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000415045;ENST00000545397;ENST00000401917	D;D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73;-1.73	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.93377	0.7888	M	0.93241	3.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94948	0.8097	10	0.87932	D	0	.	16.1135	0.81278	1.0:0.0:0.0:0.0	.	157;157	D2X2H5;Q8N2Q7-2	.;.	T	157	ENSP00000392500:N157T;ENSP00000354541:N157T;ENSP00000410374:N157T;ENSP00000441108:N157T;ENSP00000385750:N157T	ENSP00000354541:N157T	N	+	2	0	NLGN1	174805552	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	8.910000	0.92685	2.267000	0.75376	0.383000	0.25322	AAT	NLGN1	-	pfam_CarbesteraseB	ENSG00000169760		0.348	NLGN1-001	KNOWN	basic|CCDS	protein_coding	NLGN1	HGNC	protein_coding	OTTHUMT00000347054.3	-	0.00	32	0	A	NM_014932		173322858	+1	tier1	-	no_errors	ENST00000401917	ensembl	human	known	74_37	missense	35.48	20	11	SNP	1.000	C
NPEPPS	9520	genome.wustl.edu	37	17	45695743	45695743	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr17:45695743G>T	ENST00000322157.4	+	20	2560	c.2323G>T	c.(2323-2325)Gag>Tag	p.E775*	NPEPPS_ENST00000530173.1_Nonsense_Mutation_p.E771*|NPEPPS_ENST00000544660.1_Nonsense_Mutation_p.E695*|RP11-580I16.2_ENST00000582066.1_RNA|RP11-580I16.2_ENST00000582389.1_RNA	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	775					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						TATGCAAGAAGAGAAAAACCG	0.388																																																	0													95.0	92.0	93.0					17																	45695743		1831	4090	5921	SO:0001587	stop_gained	0			Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.2323G>T	17.37:g.45695743G>T	ENSP00000320324:p.Glu775*		B7Z463|Q6P145|Q9NP16|Q9UEM2	Nonsense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.E775*	ENST00000322157.4	37	c.2323	CCDS45721.1	17	.	.	.	.	.	.	.	.	.	.	G	40	8.252522	0.98727	.	.	ENSG00000141279	ENST00000530173;ENST00000322157;ENST00000544660;ENST00000528565	.	.	.	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.7774	0.96400	0.0:0.0:1.0:0.0	.	.	.	.	X	771;775;695;10	.	ENSP00000320324:E775X	E	+	1	0	NPEPPS	43050742	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.841000	0.99482	2.771000	0.95319	0.650000	0.86243	GAG	NPEPPS	-	NULL	ENSG00000141279		0.388	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPEPPS	HGNC	protein_coding	OTTHUMT00000384269.1	-	0.00	97	0	G	NM_006310		45695743	+1	tier1	-	no_errors	ENST00000322157	ensembl	human	known	74_37	nonsense	48.00	26	24	SNP	1.000	T
NSUN3	63899	genome.wustl.edu	37	3	93795412	93795412	+	Intron	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:93795412G>T	ENST00000314622.4	+	3	333				NSUN3_ENST00000485793.1_Intron	NM_022072.3	NP_071355.1	Q9H649	NSUN3_HUMAN	NOP2/Sun domain family, member 3								methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	18						GATGTCCCACGGGTAGATGGT	0.473																																																	0																																										SO:0001627	intron_variant	0			BC020602	CCDS2927.1	3q11.2	2009-11-23	2009-11-23		ENSG00000178694	ENSG00000178694		"""NOP2/Sun domain containing"""	26208	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 3"", ""NOL1/NOP2/Sun domain family, member 3"""			12477932	Standard	NM_022072		Approved	FLJ22609	uc003drl.1	Q9H649	OTTHUMG00000159025	ENST00000314622.4:c.123-7539G>T	3.37:g.93795412G>T			Q6PG41|Q8IXG9|Q9H6M2	RNA	SNP	-	NULL	ENST00000314622.4	37	NULL	CCDS2927.1	3																																																																																			NSUN3	-	-	ENSG00000178694		0.473	NSUN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN3	HGNC	protein_coding	OTTHUMT00000352934.1	-	0.00	21	0	G	NM_022072		93795412	+1	tier1	-	no_errors	ENST00000494128	ensembl	human	putative	74_37	rna	20.00	16	4	SNP	0.998	T
NYAP1	222950	genome.wustl.edu	37	7	100084522	100084522	+	Silent	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr7:100084522C>T	ENST00000300179.2	+	3	306	c.147C>T	c.(145-147)atC>atT	p.I49I	NYAP1_ENST00000454988.1_5'Flank|NYAP1_ENST00000423930.1_Silent_p.I49I	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	49					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												TGCGGGACATCGCCTCGCTGC	0.741																																																	0													5.0	6.0	6.0					7																	100084522		2062	4108	6170	SO:0001819	synonymous_variant	0			AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.147C>T	7.37:g.100084522C>T			Q6U9Y3|Q8N1V0	Silent	SNP	NULL	p.I49	ENST00000300179.2	37	c.147	CCDS5696.1	7																																																																																			NYAP1	-	NULL	ENSG00000166924		0.741	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NYAP1	HGNC	protein_coding	OTTHUMT00000339335.2	-	0.00	23	0	C	NM_173564		100084522	+1	tier1	-	no_errors	ENST00000423930	ensembl	human	known	74_37	silent	16.67	20	4	SNP	0.997	T
OR6A2	8590	genome.wustl.edu	37	11	6816472	6816472	+	Silent	SNP	T	T	C			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:6816472T>C	ENST00000332601.3	-	1	656	c.468A>G	c.(466-468)ggA>ggG	p.G156G		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	156					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TGCCAAAACCTCCAGCCCAAG	0.502																																																	0													81.0	79.0	79.0					11																	6816472		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.468A>G	11.37:g.6816472T>C			Q3MJC7|Q6IF35|Q9H206	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G156	ENST00000332601.3	37	c.468	CCDS7772.1	11																																																																																			OR6A2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000184933		0.502	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6A2	HGNC	protein_coding	OTTHUMT00000385981.1		0.00	61	0	T	NM_003696		6816472	-1			no_errors	ENST00000332601	ensembl	human	known	74_37	silent	9.09	40	4	SNP	0.132	C
OR4D11	219986	genome.wustl.edu	37	11	59271520	59271520	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:59271520G>A	ENST00000313253.1	+	1	472	c.472G>A	c.(472-474)Gtg>Atg	p.V158M		NM_001004706.1	NP_001004706.1	Q8NGI4	OR4DB_HUMAN	olfactory receptor, family 4, subfamily D, member 11	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29						CCACTCCATCGTGCAGATCTC	0.547																																																	0													220.0	189.0	200.0					11																	59271520		2201	4295	6496	SO:0001583	missense	0			AB065810	CCDS31563.1	11q12.1	2012-08-09		2004-03-10	ENSG00000176200	ENSG00000176200		"""GPCR / Class A : Olfactory receptors"""	15174	protein-coding gene	gene with protein product				OR4D11P			Standard	NM_001004706		Approved		uc001noa.1	Q8NGI4	OTTHUMG00000167342	ENST00000313253.1:c.472G>A	11.37:g.59271520G>A	ENSP00000320077:p.Val158Met			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V158M	ENST00000313253.1	37	c.472	CCDS31563.1	11	.	.	.	.	.	.	.	.	.	.	g	13.23	2.174588	0.38413	.	.	ENSG00000176200	ENST00000313253	T	0.38560	1.13	5.29	3.43	0.39272	GPCR, rhodopsin-like superfamily (1);	0.314786	0.22480	N	0.059503	T	0.43656	0.1257	M	0.64260	1.97	0.34329	D	0.687431	P	0.37176	0.586	B	0.43123	0.409	T	0.56926	-0.7898	10	0.72032	D	0.01	-22.5887	7.2255	0.26012	0.159:0.1405:0.7005:0.0	.	158	Q8NGI4	OR4DB_HUMAN	M	158	ENSP00000320077:V158M	ENSP00000320077:V158M	V	+	1	0	OR4D11	59028096	0.007000	0.16637	0.943000	0.38184	0.920000	0.55202	0.798000	0.27014	0.632000	0.30432	0.557000	0.71058	GTG	OR4D11	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176200		0.547	OR4D11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D11	HGNC	protein_coding	OTTHUMT00000394236.1	-	0.00	98	0	G	NM_001004706		59271520	+1	tier1	-	no_errors	ENST00000313253	ensembl	human	known	74_37	missense	32.14	57	27	SNP	0.800	A
OTOP3	347741	genome.wustl.edu	37	17	72943349	72943349	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr17:72943349T>C	ENST00000328801.4	+	6	1399	c.1399T>C	c.(1399-1401)Ttc>Ctc	p.F467L		NM_178233.1	NP_839947.1	Q7RTS5	OTOP3_HUMAN	otopetrin 3	467						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_lung(278;0.151)|Lung NSC(278;0.185)					TCAGAACCTCTTCATCATCGA	0.642																																																	0													46.0	43.0	44.0					17																	72943349		2203	4300	6503	SO:0001583	missense	0			BK000568	CCDS11709.1	17q25	2004-01-19				ENSG00000182938			19658	protein-coding gene	gene with protein product		607828				12651873	Standard	NM_178233		Approved		uc010wrr.3	Q7RTS5		ENST00000328801.4:c.1399T>C	17.37:g.72943349T>C	ENSP00000328090:p.Phe467Leu			Missense_Mutation	SNP	pfam_Otopetrin	p.F467L	ENST00000328801.4	37	c.1399	CCDS11709.1	17	.	.	.	.	.	.	.	.	.	.	T	26.5	4.739826	0.89573	.	.	ENSG00000182938	ENST00000328801	T	0.34472	1.36	4.54	4.54	0.55810	.	0.000000	0.64402	D	0.000001	T	0.64416	0.2596	M	0.86651	2.83	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72211	-0.4359	10	0.87932	D	0	-20.0745	13.8706	0.63617	0.0:0.0:0.0:1.0	.	467	Q7RTS5	OTOP3_HUMAN	L	467	ENSP00000328090:F467L	ENSP00000328090:F467L	F	+	1	0	OTOP3	70454944	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.982000	0.88131	1.684000	0.51022	0.379000	0.24179	TTC	OTOP3	-	pfam_Otopetrin	ENSG00000182938		0.642	OTOP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP3	HGNC	protein_coding	OTTHUMT00000445308.1	-	0.00	40	0	T	NM_178233		72943349	+1	tier1	-	no_errors	ENST00000328801	ensembl	human	known	74_37	missense	54.55	15	18	SNP	1.000	C
PABPC3	5042	genome.wustl.edu	37	13	25670411	25670411	+	Silent	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr13:25670411G>A	ENST00000281589.3	+	1	112	c.75G>A	c.(73-75)gcG>gcA	p.A25A		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	25	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TGACTGAGGCGATGCTCTACG	0.637																																																	0													75.0	72.0	73.0					13																	25670411		2203	4300	6503	SO:0001819	synonymous_variant	0			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.75G>A	13.37:g.25670411G>A			Q8NHV0|Q9H086	Silent	SNP	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.A25	ENST00000281589.3	37	c.75	CCDS9311.1	13																																																																																			PABPC3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000151846		0.637	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC3	HGNC	protein_coding	OTTHUMT00000044220.2	-	0.00	108	0	G	NM_030979		25670411	+1	tier1	-	no_errors	ENST00000281589	ensembl	human	known	74_37	silent	14.29	66	11	SNP	0.997	A
PAPD5	64282	genome.wustl.edu	37	16	50263692	50263693	+	3'UTR	INS	-	-	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr16:50263692_50263693insT	ENST00000561678.1	+	0	2294_2295				PAPD5_ENST00000436909.3_3'UTR|PAPD5_ENST00000357464.3_3'UTR|PAPD5_ENST00000573002.1_3'UTR			Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5						histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		ATCTGTGCATGTTTTTTTTTTA	0.307																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000561678.1:c.*454->T	16.37:g.50263702_50263702dupT			B4DV38|Q9NW67|Q9Y6C0	RNA	INS	-	NULL	ENST00000561678.1	37	NULL		16																																																																																			PAPD5	-	-	ENSG00000121274		0.307	PAPD5-002	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	PAPD5	HGNC	protein_coding	OTTHUMT00000423150.1		0.00	51	0	-	NM_022447		50263693	+1	tier1		no_errors	ENST00000573002	ensembl	human	known	74_37	rna	15.38	33	6	INS	1.000:0.737	T
PAX7	5081	genome.wustl.edu	37	1	19071366	19071366	+	Silent	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:19071366C>T	ENST00000420770.2	+	9	1544	c.1461C>T	c.(1459-1461)ctC>ctT	p.L487L		NM_001135254.1	NP_001128726.1	P23759	PAX7_HUMAN	paired box 7	0					anatomical structure morphogenesis (GO:0009653)|cartilage development (GO:0051216)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic skeletal system development (GO:0048706)|muscle tissue morphogenesis (GO:0060415)|negative regulation of apoptotic process (GO:0043066)|neuron fate commitment (GO:0048663)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell fate commitment (GO:0010453)|regulation of protein binding (GO:0043393)|skeletal muscle satellite cell commitment (GO:0014813)|skeletal muscle tissue regeneration (GO:0043403)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)		PAX7/FOXO1(197)	breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)	31		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		GCATGAAGCTCGGGGAGCACT	0.562			T	FOXO1A	alveolar rhabdomyosarcoma																																			Dom	yes		1	1p36.2-p36.12	5081	paired box gene 7		M	0													24.0	25.0	25.0					1																	19071366		1559	3538	5097	SO:0001819	synonymous_variant	0			X96743	CCDS186.1, CCDS44074.1, CCDS44075.1	1p36.13	2011-06-20	2007-07-12		ENSG00000009709	ENSG00000009709		"""Paired boxes"", ""Homeoboxes / PRD class"""	8621	protein-coding gene	gene with protein product		167410	"""paired box gene 7"""			7981748, 8431641	Standard	NM_001135254		Approved	Hup1	uc001bay.3	P23759	OTTHUMG00000002433	ENST00000420770.2:c.1461C>T	1.37:g.19071366C>T			E9PFV9|Q0VA99|Q2PJS5	Silent	SNP	pfam_Paired_dom,pfam_Homeobox_dom,pfam_Pax7,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Paired_dom,prints_Paired_dom	p.L487	ENST00000420770.2	37	c.1461	CCDS44074.1	1																																																																																			PAX7	-	NULL	ENSG00000009709		0.562	PAX7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PAX7	HGNC	protein_coding	OTTHUMT00000372482.1	-	0.00	79	0	C	NM_002584		19071366	+1	tier1	-	no_errors	ENST00000420770	ensembl	human	known	74_37	silent	30.43	16	7	SNP	0.019	T
PCDH1	5097	genome.wustl.edu	37	5	141244972	141244972	+	Silent	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr5:141244972G>A	ENST00000394536.3	-	3	1063	c.924C>T	c.(922-924)gaC>gaT	p.D308D	PCDH1_ENST00000287008.3_Silent_p.D308D|PCDH1_ENST00000511044.1_5'UTR|PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000456271.1_Silent_p.D296D|PCDH1_ENST00000536585.1_Silent_p.D286D	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	308	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		TGGCACCTTGGTCTGAGTCAT	0.493																																					Ovarian(132;1609 1739 4190 14731 45037)												0													91.0	94.0	93.0					5																	141244972		2182	4279	6461	SO:0001819	synonymous_variant	0			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.924C>T	5.37:g.141244972G>A			Q8IUP2	Silent	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D308	ENST00000394536.3	37	c.924	CCDS43375.1	5																																																																																			PCDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000156453		0.493	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH1	HGNC	protein_coding	OTTHUMT00000251862.1	-	0.00	39	0	G	NM_032420		141244972	-1	tier1	-	no_errors	ENST00000287008	ensembl	human	known	74_37	silent	28.12	23	9	SNP	1.000	A
PDIA4	9601	genome.wustl.edu	37	7	148718188	148718190	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr7:148718188_148718190delTCC	ENST00000286091.4	-	2	370_372	c.138_140delGGA	c.(136-141)gaggaa>gaa	p.46_47EE>E		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	46	Asp/Glu-rich (acidic).|Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			atcatcatcttcctcctcctcct	0.424																																																	0										16,4248		0,16,2116						-8.9	0.0			143	53,8201		0,53,4074	no	coding	PDIA4	NM_004911.4		0,69,6190	A1A1,A1R,RR		0.6421,0.3752,0.5512				69,12449				SO:0001651	inframe_deletion	0			BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.138_140delGGA	7.37:g.148718197_148718199delTCC	ENSP00000286091:p.Glu47del		A8K4K6|Q549T6	In_Frame_Del	DEL	pirsf_Protein_diS-isomerase_A4,pfam_Thioredoxin_domain,pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,prints_Calsequestrin,tigrfam_Prot_disulphide_isomerase,tigrfam_Disulphide_isomerase	p.E47in_frame_del	ENST00000286091.4	37	c.140_138	CCDS5893.1	7																																																																																			PDIA4	-	pirsf_Protein_diS-isomerase_A4	ENSG00000155660		0.424	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIA4	HGNC	protein_coding	OTTHUMT00000317077.1		0.00	74	0	TCC	NM_004911		148718190	-1			no_errors	ENST00000286091	ensembl	human	known	74_37	in_frame_del	6.35	59	4	DEL	0.950:0.950:0.167	0
PIK3R1	5295	genome.wustl.edu	37	5	67591135	67591137	+	In_Frame_Del	DEL	GAG	GAG	-	rs149090706	byFrequency	TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr5:67591135_67591137delGAG	ENST00000521381.1	+	13	2344_2346	c.1728_1730delGAG	c.(1726-1731)acgaga>aca	p.R577del	PIK3R1_ENST00000521657.1_In_Frame_Del_p.R577del|PIK3R1_ENST00000523872.1_In_Frame_Del_p.R214del|PIK3R1_ENST00000320694.8_In_Frame_Del_p.R277del|PIK3R1_ENST00000274335.5_In_Frame_Del_p.R577del|PIK3R1_ENST00000396611.1_In_Frame_Del_p.R577del|PIK3R1_ENST00000336483.5_In_Frame_Del_p.R307del	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	577					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.T576del(3)|p.R307K(1)|p.L570_D578del(1)|p.0?(1)|p.?(1)|p.R277K(1)|p.R577_M582>K(1)|p.R577K(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	TGAGAAAGACGAGAGACCAATAC	0.374			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																														Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	10	Substitution - Missense(3)|Deletion - In frame(2)|Deletion - Frameshift(2)|Whole gene deletion(1)|Complex - deletion inframe(1)|Unknown(1)	endometrium(4)|central_nervous_system(3)|large_intestine(1)|lung(1)|ovary(1)																																								SO:0001651	inframe_deletion	0			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1728_1730delGAG	5.37:g.67591135_67591137delGAG	ENSP00000428056:p.Arg577del		B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	In_Frame_Del	DEL	pfam_SH2,pfam_RhoGAP_dom,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Guanylate-bd_C,smart_SH3_domain,smart_RhoGAP_dom,smart_SH2,pfscan_SH2,pfscan_SH3_domain,pfscan_RhoGAP_dom,prints_PI3kinase_P85,prints_SH2	p.R577in_frame_del	ENST00000521381.1	37	c.1728_1730	CCDS3993.1	5																																																																																			PIK3R1	-	prints_PI3kinase_P85	ENSG00000145675		0.374	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R1	HGNC	protein_coding	OTTHUMT00000254013.2		0.00	95	0	GAG	NM_181504		67591137	+1	tier1		no_errors	ENST00000396611	ensembl	human	known	74_37	in_frame_del	31.82	30	14	DEL	0.016:0.975:1.000	-
PPAP2B	8613	genome.wustl.edu	37	1	56990007	56990007	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:56990007C>T	ENST00000371250.3	-	3	1068	c.517G>A	c.(517-519)Gaa>Aaa	p.E173K		NM_003713.4	NP_003704.3	O14495	LPP3_HUMAN	phosphatidic acid phosphatase type 2B	173					Bergmann glial cell differentiation (GO:0060020)|blood vessel development (GO:0001568)|canonical Wnt signaling pathway involved in positive regulation of cell-cell adhesion (GO:0044329)|canonical Wnt signaling pathway involved in positive regulation of endothelial cell migration (GO:0044328)|canonical Wnt signaling pathway involved in positive regulation of wound healing (GO:0044330)|dephosphorylation (GO:0016311)|gastrulation with mouth forming second (GO:0001702)|germ cell migration (GO:0008354)|homotypic cell-cell adhesion (GO:0034109)|lipid metabolic process (GO:0006629)|negative regulation of protein phosphorylation (GO:0001933)|phospholipid metabolic process (GO:0006644)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of sphingolipid mediated signaling pathway (GO:1902068)|regulation of Wnt signaling pathway (GO:0030111)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)|sphingosine-1-phosphate phosphatase activity (GO:0042392)	p.E173K(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17						ATGTAGCCTTCAGAGCAGTTG	0.537																																																	1	Substitution - Missense(1)	urinary_tract(1)											145.0	142.0	143.0					1																	56990007		2203	4300	6503	SO:0001583	missense	0			AB000889	CCDS604.1	1p32.2	2009-05-27			ENSG00000162407	ENSG00000162407	3.1.3.4		9229	protein-coding gene	gene with protein product		607125				9305923	Standard	NM_003713		Approved	PAP-2b, LPP3	uc001cyj.2	O14495	OTTHUMG00000008160	ENST00000371250.3:c.517G>A	1.37:g.56990007C>T	ENSP00000360296:p.Glu173Lys		B2R651|D3DQ52|Q5U0F7|Q96GW0|Q99782	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.E173K	ENST00000371250.3	37	c.517	CCDS604.1	1	.	.	.	.	.	.	.	.	.	.	C	6.639	0.486380	0.12641	.	.	ENSG00000162407	ENST00000371250	T	0.74737	-0.87	5.7	2.82	0.32997	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.657749	0.15276	N	0.270980	T	0.47801	0.1465	N	0.16567	0.415	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.30060	-0.9991	10	0.06757	T	0.87	.	1.1	0.01682	0.1572:0.4144:0.1911:0.2374	.	173	O14495	LPP3_HUMAN	K	173	ENSP00000360296:E173K	ENSP00000360296:E173K	E	-	1	0	PPAP2B	56762595	0.037000	0.19845	0.975000	0.42487	0.973000	0.67179	0.461000	0.21940	0.748000	0.32831	0.655000	0.94253	GAA	PPAP2B	-	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	ENSG00000162407		0.537	PPAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAP2B	HGNC	protein_coding	OTTHUMT00000022334.2		0.00	60	0	C	NM_003713		56990007	-1			no_errors	ENST00000371250	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.069	T
PRRT3	285368	genome.wustl.edu	37	3	9990484	9990484	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:9990484C>T	ENST00000412055.1	-	3	1258	c.1129G>A	c.(1129-1131)Gct>Act	p.A377T	PRRT3_ENST00000411976.2_Missense_Mutation_p.A377T|PRRT3-AS1_ENST00000431558.1_RNA	NM_207351.3	NP_997234.3	Q5FWE3	PRRT3_HUMAN	proline-rich transmembrane protein 3	377	Pro-rich.					integral component of membrane (GO:0016021)				NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)|stomach(2)	13						CGGTTTACAGCTGGGCCAGGG	0.637																																																	0													91.0	97.0	95.0					3																	9990484		1856	4095	5951	SO:0001583	missense	0			AK090993	CCDS43049.1	3p25.3	2011-10-10			ENSG00000163704	ENSG00000163704		"""Proline-rich transmembrane proteins"""	26591	protein-coding gene	gene with protein product							Standard	NM_207351		Approved	FLJ33674	uc003bul.2	Q5FWE3	OTTHUMG00000155285	ENST00000412055.1:c.1129G>A	3.37:g.9990484C>T	ENSP00000392511:p.Ala377Thr		Q49AD0|Q6UXY6|Q8NBC9	Missense_Mutation	SNP	NULL	p.A377T	ENST00000412055.1	37	c.1129	CCDS43049.1	3	.	.	.	.	.	.	.	.	.	.	C	9.451	1.090573	0.20471	.	.	ENSG00000163704	ENST00000412055;ENST00000411976	T;T	0.20463	2.51;2.07	5.17	-2.41	0.06562	.	0.700875	0.12466	N	0.466423	T	0.07908	0.0198	N	0.16656	0.425	0.09310	N	1	B;B	0.30709	0.291;0.004	B;B	0.26693	0.072;0.01	T	0.28170	-1.0052	9	.	.	.	-0.7894	0.7949	0.01064	0.2555:0.3448:0.1261:0.2736	.	377;377	Q5FWE3-3;Q5FWE3	.;PRRT3_HUMAN	T	377	ENSP00000392511:A377T;ENSP00000404512:A377T	.	A	-	1	0	PRRT3	9965484	0.002000	0.14202	0.023000	0.16930	0.704000	0.40688	-0.034000	0.12225	-0.363000	0.08101	-0.182000	0.12963	GCT	PRRT3	-	NULL	ENSG00000163704		0.637	PRRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT3	HGNC	protein_coding	OTTHUMT00000339322.1	-	0.00	61	0	C	NM_207351		9990484	-1	tier1	-	no_errors	ENST00000295984	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.000	T
PRKCD	5580	genome.wustl.edu	37	3	53221364	53221364	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:53221364C>T	ENST00000394729.2	+	14	1689	c.1361C>T	c.(1360-1362)gCc>gTc	p.A454V	PRKCD_ENST00000330452.3_Missense_Mutation_p.A454V	NM_212539.1	NP_997704.1	Q05655	KPCD_HUMAN	protein kinase C, delta	454	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular senescence (GO:0090398)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-10 production (GO:0032613)|interleukin-12 production (GO:0032615)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|mRNA metabolic process (GO:0016071)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of filopodium assembly (GO:0051490)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil activation (GO:0042119)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of glucosylceramide catabolic process (GO:2000753)|positive regulation of phospholipid scramblase activity (GO:1900163)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of sphingomyelin catabolic process (GO:2000755)|positive regulation of superoxide anion generation (GO:0032930)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of receptor activity (GO:0010469)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|termination of signal transduction (GO:0023021)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|insulin receptor substrate binding (GO:0043560)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)	Ingenol Mebutate(DB05013)|Tamoxifen(DB00675)	AGGTTTTATGCCGCTGAGATA	0.587																																																	0													133.0	130.0	131.0					3																	53221364		2203	4300	6503	SO:0001583	missense	0				CCDS2870.1	3p21.31	2009-07-10			ENSG00000163932	ENSG00000163932	2.7.11.1		9399	protein-coding gene	gene with protein product		176977				8188219	Standard	NM_006254		Approved		uc003dgm.3	Q05655	OTTHUMG00000133659	ENST00000394729.2:c.1361C>T	3.37:g.53221364C>T	ENSP00000378217:p.Ala454Val		B0KZ81|B2R834|Q15144|Q86XJ6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,prints_DAG/PE-bd,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.A454V	ENST00000394729.2	37	c.1361	CCDS2870.1	3	.	.	.	.	.	.	.	.	.	.	C	23.9	4.466308	0.84425	.	.	ENSG00000163932	ENST00000394729;ENST00000330452	T;T	0.65732	-0.17;-0.17	5.47	4.58	0.56647	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.314985	0.33199	N	0.005174	T	0.49355	0.1552	L	0.28556	0.865	0.35936	D	0.832857	P	0.46457	0.878	B	0.39217	0.294	T	0.65096	-0.6251	10	0.62326	D	0.03	.	13.8927	0.63750	0.0:0.7762:0.2238:0.0	.	454	Q05655	KPCD_HUMAN	V	454	ENSP00000378217:A454V;ENSP00000331602:A454V	ENSP00000331602:A454V	A	+	2	0	PRKCD	53196404	0.894000	0.30519	0.952000	0.39060	0.896000	0.52359	1.727000	0.38095	2.572000	0.86782	0.591000	0.81541	GCC	PRKCD	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Prot_kin_PKC_delta,pfscan_Prot_kinase_dom	ENSG00000163932		0.587	PRKCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCD	HGNC	protein_coding	OTTHUMT00000257818.1		0.00	90	0	C			53221364	+1			no_errors	ENST00000330452	ensembl	human	known	74_37	missense	6.02	77	5	SNP	0.392	T
PSMA3	5684	genome.wustl.edu	37	14	58734209	58734209	+	Silent	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr14:58734209C>T	ENST00000216455.4	+	8	651	c.561C>T	c.(559-561)tgC>tgT	p.C187C	RP11-349A22.5_ENST00000554360.1_RNA|CTD-2002H8.2_ENST00000557322.1_RNA|RP11-349A22.5_ENST00000554378.1_RNA|PSMA3_ENST00000412908.2_Silent_p.C180C|PSMA3_ENST00000557508.1_Silent_p.C112C|RP11-349A22.5_ENST00000556002.1_RNA|RP11-349A22.5_ENST00000555162.1_RNA|RP11-349A22.5_ENST00000555275.1_RNA	NM_002788.3|NM_152132.2	NP_002779.1|NP_687033.1	P25788	PSA3_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 3	187					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(2)	12						AAATGACCTGCCGTGATATCG	0.264																																																	0													52.0	56.0	54.0					14																	58734209		2203	4290	6493	SO:0001819	synonymous_variant	0				CCDS9731.1, CCDS45113.1	14q23	2008-08-29			ENSG00000100567	ENSG00000100567		"""Proteasome (prosome, macropain) subunits"""	9532	protein-coding gene	gene with protein product		176843				2025653, 8811196	Standard	NM_002788		Approved	HC8	uc001xdj.2	P25788	OTTHUMG00000140319	ENST00000216455.4:c.561C>T	14.37:g.58734209C>T			B2RCK6|Q86U83|Q8N1D8|Q9BS70	Silent	SNP	pfam_Proteasome_sua/b,pfam_Proteasome_asu_N,smart_Proteasome_asu_N	p.C187	ENST00000216455.4	37	c.561	CCDS9731.1	14																																																																																			PSMA3	-	pfam_Proteasome_sua/b	ENSG00000100567		0.264	PSMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMA3	HGNC	protein_coding	OTTHUMT00000276923.1	-	0.00	129	0	C	NM_002788		58734209	+1	tier1	-	no_errors	ENST00000216455	ensembl	human	known	74_37	silent	36.52	73	42	SNP	1.000	T
PTENP1	11191	genome.wustl.edu	37	9	33674343	33674344	+	RNA	INS	-	-	T	rs373787988|rs200594180|rs76928302		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr9:33674343_33674344insT	ENST00000532280.1	-	0	3153_3154					NR_023917.1				phosphatase and tensin homolog pseudogene 1 (functional)																		CTTCTATGTTCTTTTTTTTTTT	0.272																																																	0																																												0			AF023139, BC038293, BY797336		9p13.3	2014-09-11	2014-01-16		ENSG00000237984	ENSG00000237984		"""-"""	9589	pseudogene	pseudogene		613531	"""phosphatase and tensin homolog pseudogene 1"""			9393738, 9620558	Standard	NR_023917		Approved	PTEN2, psiPTEN, PTH2, PTEN-rs, PTENpg1	uc003zth.4		OTTHUMG00000000410		9.37:g.33674354_33674354dupT				RNA	INS	-	NULL	ENST00000532280.1	37	NULL		9																																																																																			PTENP1	-	-	ENSG00000237984		0.272	PTENP1-002	KNOWN	basic	processed_transcript	PTENP1	HGNC	pseudogene	OTTHUMT00000395145.1		0.00	17	0	-	NR_023917		33674344	-1	tier1		no_errors	ENST00000532280	ensembl	human	known	74_37	rna	27.27	8	3	INS	0.829:0.837	T
PUS7	54517	genome.wustl.edu	37	7	105111289	105111289	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr7:105111289T>C	ENST00000356362.2	-	11	1458	c.1244A>G	c.(1243-1245)aAg>aGg	p.K415R	PUS7_ENST00000469408.1_Missense_Mutation_p.K415R	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	415	TRUD. {ECO:0000255|PROSITE- ProRule:PRU00342}.				pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						CAAGTAGCCCTTTTCAGCTGC	0.438																																					Colon(138;2387 3051 17860)												0													101.0	94.0	96.0					7																	105111289		2203	4300	6503	SO:0001583	missense	0			AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.1244A>G	7.37:g.105111289T>C	ENSP00000348722:p.Lys415Arg		Q75MG4|Q9NX19	Missense_Mutation	SNP	pfam_PsdUridine_synth_TruD,superfamily_PsdUridine_synth_cat_dom,pirsf_PsdUridine_synth_TruD_euk,pfscan_PsdUridine_synth_TruD_insert,tigrfam_PsdUridine_synth_TruD	p.K415R	ENST00000356362.2	37	c.1244	CCDS34725.1	7	.	.	.	.	.	.	.	.	.	.	T	21.3	4.136165	0.77662	.	.	ENSG00000091127	ENST00000356362;ENST00000544995;ENST00000469408	T;T	0.45276	0.9;0.9	5.62	5.62	0.85841	Pseudouridine synthase, catalytic domain (1);Pseudouridine synthase, TruD, insertion domain (1);	0.000000	0.85682	D	0.000000	T	0.51958	0.1705	L	0.37507	1.11	0.80722	D	1	D;D	0.67145	0.992;0.996	D;D	0.66847	0.912;0.947	T	0.43589	-0.9382	10	0.26408	T	0.33	-9.3234	14.9943	0.71418	0.0:0.0:0.0:1.0	.	415;415	B3KY42;Q96PZ0	.;PUS7_HUMAN	R	415	ENSP00000348722:K415R;ENSP00000417402:K415R	ENSP00000348722:K415R	K	-	2	0	PUS7	104898525	1.000000	0.71417	1.000000	0.80357	0.684000	0.39900	7.499000	0.81566	2.131000	0.65755	0.459000	0.35465	AAG	PUS7	-	pfam_PsdUridine_synth_TruD,superfamily_PsdUridine_synth_cat_dom,pirsf_PsdUridine_synth_TruD_euk,pfscan_PsdUridine_synth_TruD_insert,tigrfam_PsdUridine_synth_TruD	ENSG00000091127		0.438	PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PUS7	HGNC	protein_coding	OTTHUMT00000348681.1		0.00	69	0	T	NM_019042		105111289	-1			no_errors	ENST00000356362	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	C
PVRL2	5819	genome.wustl.edu	37	19	45381598	45381600	+	Intron	DEL	GAG	GAG	-	rs375813744		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr19:45381598_45381600delGAG	ENST00000252483.5	+	5	1042				PVRL2_ENST00000252485.4_In_Frame_Del_p.R391del	NM_001042724.1	NP_001036189.1	Q92692	PVRL2_HUMAN	poliovirus receptor-related 2 (herpesvirus entry mediator B)						acrosome assembly (GO:0001675)|adherens junction organization (GO:0034332)|adhesion of symbiont to host (GO:0044406)|cell junction assembly (GO:0034329)|cell part morphogenesis (GO:0032990)|cell-cell junction organization (GO:0045216)|cilium organization (GO:0044782)|coreceptor-mediated virion attachment to host cell (GO:0046814)|cytoskeleton organization (GO:0007010)|establishment of mitochondrion localization (GO:0051654)|fertilization (GO:0009566)|fusion of virus membrane with host plasma membrane (GO:0019064)|homophilic cell adhesion (GO:0007156)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|sperm mitochondrion organization (GO:0030382)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|large_intestine(6)|lung(5)	13	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		TGCTgagggtgaggaggaggagg	0.665																																																	0									,	4,172,3746		0,0,4,17,138,1802					,	-2.1	1.0			26	34,410,7168		2,1,29,23,363,3388	no	codingComplex,intron	PVRL2	NM_002856.2,NM_001042724.1	,	2,1,33,40,501,5190	A1A1,A1A2,A1R,A2A2,A2R,RR		5.8329,4.4875,5.3754	,	,		38,582,10914				SO:0001627	intron_variant	0			X80038	CCDS12645.1, CCDS42576.1	19q13.32	2013-01-29			ENSG00000130202	ENSG00000130202		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9707	protein-coding gene	gene with protein product		600798		HVEB		7622062, 10196354	Standard	NM_001042724		Approved	PVRR2, PRR2, CD112	uc002ozw.1	Q92692	OTTHUMG00000180839	ENST00000252483.5:c.1042+3863GAG>-	19.37:g.45381607_45381609delGAG			A8K5L5|O75455|Q6IBI6|Q96J29	In_Frame_Del	DEL	pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.R391in_frame_del	ENST00000252483.5	37	c.1161_1163	CCDS42576.1	19																																																																																			PVRL2	-	NULL	ENSG00000130202		0.665	PVRL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PVRL2	HGNC	protein_coding	OTTHUMT00000453231.1		0.00	38	0	GAG	NM_002856		45381600	+1	tier1		no_errors	ENST00000252485	ensembl	human	known	74_37	in_frame_del	10.00	27	3	DEL	0.999:1.000:1.000	-
RABEP2	79874	genome.wustl.edu	37	16	28919949	28919949	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr16:28919949G>A	ENST00000358201.4	-	8	1814	c.1226C>T	c.(1225-1227)tCa>tTa	p.S409L	RABEP2_ENST00000357573.6_Missense_Mutation_p.S377L|RABEP2_ENST00000544477.1_Missense_Mutation_p.S338L	NM_024816.2	NP_079092.2	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	409					endocytosis (GO:0006897)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	16						GCTGGGCAGTGATTCCTCCTC	0.642																																					Pancreas(66;639 1284 10093 31061 49099)												0													64.0	69.0	68.0					16																	28919949		2012	4184	6196	SO:0001583	missense	0			AK026935	CCDS42140.1	16p11.2	2014-09-11			ENSG00000177548	ENSG00000177548			24817	protein-coding gene	gene with protein product		611869				12477932	Standard	NM_024816		Approved	FRA, FLJ23282	uc002drq.3	Q9H5N1	OTTHUMG00000176593	ENST00000358201.4:c.1226C>T	16.37:g.28919949G>A	ENSP00000350934:p.Ser409Leu			Missense_Mutation	SNP	pfam_Rabaptin_coiled-coil,pfam_Rabaptin_Rab5-bd_dom,prints_Rabaptin	p.S409L	ENST00000358201.4	37	c.1226	CCDS42140.1	16	.	.	.	.	.	.	.	.	.	.	G	2.102	-0.405931	0.04832	.	.	ENSG00000177548	ENST00000358201;ENST00000357573;ENST00000544477	T;T;T	0.45668	0.89;0.89;0.89	4.78	1.56	0.23342	Rabaptin, GTPase-Rab5 binding (1);	1.807570	0.03956	N	0.289379	T	0.33789	0.0875	L	0.38175	1.15	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.001;0.002	T	0.28235	-1.0050	10	0.59425	D	0.04	-0.005	4.3743	0.11263	0.197:0.0:0.6265:0.1764	.	338;377;409	B4DHR0;Q9H5N1-2;Q9H5N1	.;.;RABE2_HUMAN	L	409;377;338	ENSP00000350934:S409L;ENSP00000350186:S377L;ENSP00000442798:S338L	ENSP00000350186:S377L	S	-	2	0	RABEP2	28827450	0.000000	0.05858	0.005000	0.12908	0.023000	0.10783	-0.089000	0.11180	0.445000	0.26639	0.462000	0.41574	TCA	RABEP2	-	pfam_Rabaptin_Rab5-bd_dom	ENSG00000177548		0.642	RABEP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RABEP2	HGNC	protein_coding	OTTHUMT00000432691.1	-	0.00	59	0	G	NM_024816		28919949	-1	tier1	-	no_errors	ENST00000358201	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.003	A
RABGAP1	23637	genome.wustl.edu	37	9	125838524	125838524	+	Splice_Site	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr9:125838524G>T	ENST00000373647.4	+	18	2388	c.2254G>T	c.(2254-2256)Gga>Tga	p.G752*	RABGAP1_ENST00000373643.5_Splice_Site_p.G91*	NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	752	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)			breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						TCTCTTTCAGGGAATAAGTGT	0.328																																																	0													146.0	139.0	141.0					9																	125838524		2202	4299	6501	SO:0001630	splice_region_variant	0			AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.2254-1G>T	9.37:g.125838524G>T			B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Nonsense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_Kinesin-like,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTB/PI_dom,pfscan_Rab-GTPase-TBC_dom	p.G752*	ENST00000373647.4	37	c.2254	CCDS6848.2	9	.	.	.	.	.	.	.	.	.	.	G	39	7.885679	0.98542	.	.	ENSG00000011454	ENST00000373647;ENST00000373643	.	.	.	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-21.6545	19.6889	0.95989	0.0:0.0:1.0:0.0	.	.	.	.	X	752;91	.	.	G	+	1	0	RABGAP1	124878345	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.144000	0.94629	2.650000	0.89964	0.650000	0.86243	GGA	RABGAP1	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000011454		0.328	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGAP1	HGNC	protein_coding	OTTHUMT00000053976.3		0.00	60	0	G	NM_012197	Nonsense_Mutation	125838524	+1			no_errors	ENST00000373647	ensembl	human	known	74_37	nonsense	5.19	73	4	SNP	1.000	T
RETSAT	54884	genome.wustl.edu	37	2	85577118	85577118	+	Intron	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr2:85577118C>T	ENST00000295802.4	-	4	912				RETSAT_ENST00000263854.6_Intron|RETSAT_ENST00000457495.2_Intron	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)						oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	AGAGGGCAGCCGTTCCTCCTC	0.587																																																	0													22.0	23.0	23.0					2																	85577118		2203	4300	6503	SO:0001627	intron_variant	0			AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.799+44G>A	2.37:g.85577118C>T			A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	RNA	SNP	-	NULL	ENST00000295802.4	37	NULL	CCDS1972.1	2																																																																																			RETSAT	-	-	ENSG00000042445		0.587	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RETSAT	HGNC	protein_coding	OTTHUMT00000252489.1	-	0.00	26	0	C	NM_017750		85577118	-1	tier1	-	no_errors	ENST00000482694	ensembl	human	putative	74_37	rna	19.05	17	4	SNP	0.000	T
RHBDD2	57414	genome.wustl.edu	37	7	75511280	75511280	+	Silent	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr7:75511280G>T	ENST00000006777.6	+	2	447	c.312G>T	c.(310-312)gtG>gtT	p.V104V	RHBDD2_ENST00000428119.1_5'Flank|RHBDD2_ENST00000468304.1_Intron|RHBDD2_ENST00000318622.4_5'UTR	NM_001040456.1	NP_001035546.1	Q6NTF9	RHBD2_HUMAN	rhomboid domain containing 2	104						Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|lung(4)|prostate(1)	6						TCTTCACCGTGATCTTCGCCA	0.557																																																	0													155.0	167.0	163.0					7																	75511280		2149	4254	6403	SO:0001819	synonymous_variant	0			AF226732	CCDS43602.1, CCDS43603.1	7q11	2008-09-04	2006-02-22	2006-02-22	ENSG00000005486	ENSG00000005486			23082	protein-coding gene	gene with protein product		615203	"""rhomboid, veinlet-like 7 (Drosophila)"""	RHBDL7		12838346	Standard	XM_005250511		Approved	NPD007	uc003udw.1	Q6NTF9	OTTHUMG00000156435	ENST00000006777.6:c.312G>T	7.37:g.75511280G>T			Q7L534|Q9H5W6|Q9HBK7|Q9UDT2	Silent	SNP	pfam_Peptidase_S54_rhomboid_dom	p.V104	ENST00000006777.6	37	c.312	CCDS43602.1	7																																																																																			RHBDD2	-	pfam_Peptidase_S54_rhomboid_dom	ENSG00000005486		0.557	RHBDD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHBDD2	HGNC	protein_coding	OTTHUMT00000344176.1		0.00	90	0	G	NM_020684		75511280	+1			no_errors	ENST00000006777	ensembl	human	known	74_37	silent	6.49	72	5	SNP	0.012	T
RHEBL1	121268	genome.wustl.edu	37	12	49459167	49459167	+	Missense_Mutation	SNP	G	G	A	rs201496596		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr12:49459167G>A	ENST00000301068.6	-	7	667	c.428C>T	c.(427-429)gCg>gTg	p.A143V		NM_144593.1	NP_653194.1	Q8TAI7	REBL1_HUMAN	Ras homolog enriched in brain like 1	143					GTP catabolic process (GO:0006184)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|small GTPase mediated signal transduction (GO:0007264)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(2)|large_intestine(2)|lung(5)	9						CATAAATGTCGCACCCCAGGA	0.478																																																	0								G	VAL/ALA	0,4406		0,0,2203	161.0	143.0	149.0		428	5.8	1.0	12		149	1,8599	1.2+/-3.3	0,1,4299	no	missense	RHEBL1	NM_144593.1	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	143/184	49459167	1,13005	2203	4300	6503	SO:0001583	missense	0			AK098663	CCDS8778.1	12q13.12	2014-05-09				ENSG00000167550			21166	protein-coding gene	gene with protein product						12477932	Standard	NM_144593		Approved	MGC34869, FLJ25797	uc001rtc.1	Q8TAI7	OTTHUMG00000170407	ENST00000301068.6:c.428C>T	12.37:g.49459167G>A	ENSP00000301068:p.Ala143Val		Q56VH8	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.A143V	ENST00000301068.6	37	c.428	CCDS8778.1	12	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206248	0.79127	0.0	1.16E-4	ENSG00000167550	ENST00000301068	T	0.80123	-1.34	5.82	5.82	0.92795	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.79828	0.4513	L	0.39397	1.21	0.48452	D	0.999652	D	0.76494	0.999	P	0.52554	0.702	T	0.80928	-0.1163	10	0.66056	D	0.02	.	11.0183	0.47703	0.0844:0.0:0.9156:0.0	.	143	Q8TAI7	REBL1_HUMAN	V	143	ENSP00000301068:A143V	ENSP00000301068:A143V	A	-	2	0	RHEBL1	47745434	0.965000	0.33210	0.960000	0.40013	0.929000	0.56500	2.469000	0.45110	2.757000	0.94681	0.655000	0.94253	GCG	RHEBL1	-	pfam_Small_GTPase,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,tigrfam_Small_GTP-bd_dom	ENSG00000167550		0.478	RHEBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHEBL1	HGNC	protein_coding	OTTHUMT00000408969.1	-	0.00	105	0	G	NM_144593		49459167	-1	tier1	rs201496596	no_errors	ENST00000301068	ensembl	human	known	74_37	missense	48.94	24	23	SNP	0.929	A
RIBC2	26150	genome.wustl.edu	37	22	45826894	45826894	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr22:45826894C>T	ENST00000342894.3	+	6	1213	c.799C>T	c.(799-801)Cgc>Tgc	p.R267C	RIBC2_ENST00000538017.1_Missense_Mutation_p.R335C|RIBC2_ENST00000466226.1_3'UTR			Q9H4K1	RIBC2_HUMAN	RIB43A domain with coiled-coils 2	267						nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|skin(2)|urinary_tract(1)	10		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		GCGCGACCTGCGCAGAGCTCT	0.687																																																	0													13.0	14.0	13.0					22																	45826894		2192	4286	6478	SO:0001583	missense	0			AK098586		22q13.3	2004-08-18	2004-08-18	2004-08-18	ENSG00000128408	ENSG00000128408			13241	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 11"""	C22orf11		12477932	Standard	NM_015653		Approved	DKFZp566F0546, FLJ25720	uc011aqs.3	Q9H4K1	OTTHUMG00000151332	ENST00000342894.3:c.799C>T	22.37:g.45826894C>T	ENSP00000342529:p.Arg267Cys		Q6ICD0|Q9Y413	Missense_Mutation	SNP	pfam_RIB43A	p.R335C	ENST00000342894.3	37	c.1003		22	.	.	.	.	.	.	.	.	.	.	C	11.80	1.745252	0.30955	.	.	ENSG00000128408	ENST00000342894;ENST00000538017	T;T	0.26660	1.72;1.72	3.9	2.89	0.33648	.	0.061980	0.64402	N	0.000009	T	0.44519	0.1297	.	.	.	0.38011	D	0.934524	D	0.89917	1.0	D	0.76575	0.988	T	0.46005	-0.9222	9	0.56958	D	0.05	-1.1145	6.1601	0.20360	0.1833:0.7171:0.0:0.0997	.	267	Q9H4K1	RIBC2_HUMAN	C	267;335	ENSP00000342529:R267C;ENSP00000444196:R335C	ENSP00000342529:R267C	R	+	1	0	RIBC2	44205558	0.971000	0.33674	0.699000	0.30290	0.020000	0.10135	2.261000	0.43276	0.869000	0.35703	-0.126000	0.14955	CGC	RIBC2	-	pfam_RIB43A	ENSG00000128408		0.687	RIBC2-001	KNOWN	basic	protein_coding	RIBC2	HGNC	protein_coding	OTTHUMT00000322250.1	-	0.00	29	0	C	NM_015653		45826894	+1	tier1	-	no_errors	ENST00000538017	ensembl	human	known	74_37	missense	51.85	13	14	SNP	0.322	T
RIMS1	22999	genome.wustl.edu	37	6	73110998	73110999	+	IGR	INS	-	-	A	rs200211207		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr6:73110998_73110999insA	ENST00000521978.1	+	0	5079				RIMS1_ENST00000348717.5_3'UTR|RIMS1_ENST00000414192.2_3'UTR|RIMS1_ENST00000431478.2_3'UTR|RIMS1_ENST00000264839.7_3'UTR	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1						calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CCAAAAGCACCAAAAAAAAGGG	0.391																																																	0																																										SO:0001628	intergenic_variant	0			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009		6.37:g.73111006_73111006dupA			A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	RNA	INS	-	NULL	ENST00000521978.1	37	NULL	CCDS47449.1	6																																																																																			RIMS1	-	-	ENSG00000079841		0.391	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	HGNC	protein_coding	OTTHUMT00000374968.1		0.00	44	0	-			73110999	+1	tier1		no_errors	ENST00000431478	ensembl	human	known	74_37	rna	26.67	33	12	INS	0.974:0.049	A
RNF10	9921	genome.wustl.edu	37	12	121001268	121001268	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr12:121001268C>A	ENST00000325954.4	+	9	1834	c.1373C>A	c.(1372-1374)cCa>cAa	p.P458Q	RNF10_ENST00000413266.2_Missense_Mutation_p.P463Q	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	458					negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P458R(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTGTCTGAACCAGAGCCTGAG	0.522																																																	1	Substitution - Missense(1)	lung(1)											77.0	79.0	78.0					12																	121001268		2203	4300	6503	SO:0001583	missense	0			AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.1373C>A	12.37:g.121001268C>A	ENSP00000322242:p.Pro458Gln		Q92550|Q9NPP8|Q9ULW4	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.P463Q	ENST00000325954.4	37	c.1388	CCDS9201.1	12	.	.	.	.	.	.	.	.	.	.	C	7.856	0.725095	0.15439	.	.	ENSG00000022840	ENST00000325954;ENST00000458409;ENST00000413266;ENST00000540046	T;T	0.45668	0.89;0.89	5.69	2.3	0.28687	.	1.056640	0.07279	N	0.870365	T	0.30448	0.0765	L	0.29908	0.895	0.09310	N	1	B;B	0.20671	0.047;0.047	B;B	0.21360	0.034;0.015	T	0.25916	-1.0118	10	0.15066	T	0.55	.	9.3483	0.38122	0.0:0.6999:0.0:0.3001	.	463;458	Q8N5U6-2;Q8N5U6	.;RNF10_HUMAN	Q	458;458;463;4	ENSP00000322242:P458Q;ENSP00000415682:P463Q	ENSP00000322242:P458Q	P	+	2	0	RNF10	119485651	0.276000	0.24211	0.789000	0.31954	0.800000	0.45204	0.236000	0.17967	0.695000	0.31675	0.650000	0.86243	CCA	RNF10	-	NULL	ENSG00000022840		0.522	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF10	HGNC	protein_coding	OTTHUMT00000401898.4		0.00	28	0	C			121001268	+1			no_errors	ENST00000413266	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.055	A
RNF180	285671	genome.wustl.edu	37	5	63626151	63626151	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr5:63626151G>T	ENST00000389100.4	+	7	1569	c.1497G>T	c.(1495-1497)ttG>ttT	p.L499F		NM_001113561.1	NP_001107033.1	Q86T96	RN180_HUMAN	ring finger protein 180	499					adult behavior (GO:0030534)|norepinephrine metabolic process (GO:0042415)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|regulation of catalytic activity (GO:0050790)|serotonin metabolic process (GO:0042428)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	20		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)		Lung(70;0.114)		AAGAATATTTGAAAATAAAAC	0.318																																																	0													50.0	44.0	46.0					5																	63626151		692	1591	2283	SO:0001583	missense	0			AK090756	CCDS34169.1, CCDS47219.1	5q12.3	2013-01-09			ENSG00000164197	ENSG00000164197		"""RING-type (C3HC4) zinc fingers"""	27752	protein-coding gene	gene with protein product							Standard	NM_178532		Approved		uc003jti.3	Q86T96	OTTHUMG00000162278	ENST00000389100.4:c.1497G>T	5.37:g.63626151G>T	ENSP00000373752:p.Leu499Phe		Q0JSU3|Q495A8|Q8NBD1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L499F	ENST00000389100.4	37	c.1497	CCDS47219.1	5	.	.	.	.	.	.	.	.	.	.	G	14.39	2.521954	0.44866	.	.	ENSG00000164197	ENST00000389100	T	0.50813	0.73	5.5	1.71	0.24356	.	0.341645	0.25117	N	0.033003	T	0.30479	0.0766	N	0.24115	0.695	0.80722	D	1	P	0.39216	0.664	B	0.37304	0.246	T	0.03576	-1.1023	10	0.38643	T	0.18	-6.8279	9.5064	0.39048	0.2833:0.0:0.7167:0.0	.	499	Q86T96	RN180_HUMAN	F	499	ENSP00000373752:L499F	ENSP00000373752:L499F	L	+	3	2	RNF180	63661907	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.256000	0.32921	0.291000	0.22468	0.643000	0.83706	TTG	RNF180	-	NULL	ENSG00000164197		0.318	RNF180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF180	HGNC	protein_coding	OTTHUMT00000368394.1	-	0.00	63	0	G	NM_178532		63626151	+1	tier1	-	no_errors	ENST00000389100	ensembl	human	known	74_37	missense	9.62	46	5	SNP	1.000	T
RP2	6102	genome.wustl.edu	37	X	46713483	46713483	+	Silent	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chrX:46713483G>T	ENST00000218340.3	+	2	836	c.675G>T	c.(673-675)cgG>cgT	p.R225R		NM_006915.2	NP_008846.2	O75695	XRP2_HUMAN	retinitis pigmentosa 2 (X-linked recessive)	225					cell morphogenesis (GO:0000902)|CTP biosynthetic process (GO:0006241)|cytoskeleton organization (GO:0007010)|GTP biosynthetic process (GO:0006183)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein transport (GO:0015031)|UTP biosynthetic process (GO:0006228)|visual perception (GO:0007601)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|periciliary membrane compartment (GO:1990075)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|nucleoside diphosphate kinase activity (GO:0004550)|unfolded protein binding (GO:0051082)			NS(1)|large_intestine(4)|lung(5)|stomach(1)	11						CAATATCCCGGGGTCAGAGAC	0.428																																																	0													64.0	51.0	55.0					X																	46713483		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ007590	CCDS14270.1	Xp11.3	2013-01-08			ENSG00000102218	ENSG00000102218			10274	protein-coding gene	gene with protein product		300757				6325945, 9697692, 19852809	Standard	NM_006915		Approved	TBCCD2, NME10, NM23-H10	uc004dgw.4	O75695	OTTHUMG00000021430	ENST00000218340.3:c.675G>T	X.37:g.46713483G>T			Q86XJ7|Q9NU67	Silent	SNP	pfam_Tubulin-bd_cofactor_C_dom,superfamily_Nucleoside_diP_kinase,superfamily_Adenylate_cyclase-assoc_CAP_C,smart_CARP_motif,pirsf_Protein_XRP2	p.R225	ENST00000218340.3	37	c.675	CCDS14270.1	X																																																																																			RP2	-	pirsf_Protein_XRP2	ENSG00000102218		0.428	RP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP2	HGNC	protein_coding	OTTHUMT00000056375.1	-	0.00	32	0	G	NM_006915		46713483	+1	tier1	-	no_errors	ENST00000218340	ensembl	human	known	74_37	silent	33.33	6	3	SNP	0.970	T
RPL8	6132	genome.wustl.edu	37	8	146017167	146017167	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr8:146017167C>T	ENST00000262584.3	-	3	503	c.271G>A	c.(271-273)Ggc>Agc	p.G91S	RPL8_ENST00000394920.2_Missense_Mutation_p.G91S|RPL8_ENST00000528957.1_Missense_Mutation_p.G91S|RPL8_ENST00000527914.1_Intron|RPL8_ENST00000529163.1_Intron	NM_000973.3	NP_000964.1	P62917	RL8_HUMAN	ribosomal protein L8	91					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			kidney(12)|lung(7)|prostate(1)	20	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.191)		CCCTTCTTGCCGCAATACACA	0.597																																																	0													79.0	76.0	77.0					8																	146017167		2203	4300	6503	SO:0001583	missense	0			Z28407	CCDS6433.1	8q24.3	2011-04-06			ENSG00000161016	ENSG00000161016		"""L ribosomal proteins"""	10368	protein-coding gene	gene with protein product		604177				7506540, 9582194	Standard	NM_033301		Approved	L8	uc003zec.3	P62917	OTTHUMG00000165249	ENST00000262584.3:c.271G>A	8.37:g.146017167C>T	ENSP00000262584:p.Gly91Ser		A8K094|D3DWN2|P25120|Q567Q7|Q969V7|Q9BWQ9	Missense_Mutation	SNP	pfam_Ribosomal_L2_C,pfam_Rbsml_prot_L2_RNA-bd_dom,superfamily_Translation_prot_SH3-like,superfamily_NA-bd_OB-fold,pirsf_Ribosomal_L2	p.G91S	ENST00000262584.3	37	c.271	CCDS6433.1	8	.	.	.	.	.	.	.	.	.	.	C	28.5	4.924226	0.92319	.	.	ENSG00000161016	ENST00000394920;ENST00000262584;ENST00000528957;ENST00000534813;ENST00000533397;ENST00000532702	T;T;T;T;T	0.52754	0.74;0.74;0.74;0.65;0.73	5.58	5.58	0.84498	Nucleic acid-binding, OB-fold-like (1);Translation protein SH3-like, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.74023	0.3662	M	0.90198	3.095	0.80722	D	1	D;D;P	0.63880	0.993;0.981;0.885	D;D;P	0.65684	0.937;0.922;0.5	T	0.79165	-0.1916	10	0.87932	D	0	-7.0225	17.5006	0.87730	0.0:1.0:0.0:0.0	.	91;91;55	B4DVG7;P62917;E9PIZ3	.;RL8_HUMAN;.	S	91;91;91;55;91;91	ENSP00000378378:G91S;ENSP00000262584:G91S;ENSP00000433464:G91S;ENSP00000435313:G91S;ENSP00000434535:G91S	ENSP00000262584:G91S	G	-	1	0	RPL8	145987971	1.000000	0.71417	1.000000	0.80357	0.075000	0.17131	4.888000	0.63164	2.821000	0.97095	0.555000	0.69702	GGC	RPL8	-	superfamily_NA-bd_OB-fold,pirsf_Ribosomal_L2	ENSG00000161016		0.597	RPL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL8	HGNC	protein_coding	OTTHUMT00000382948.1		0.00	75	0	C	NM_000973		146017167	-1			no_errors	ENST00000262584	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
RPRM	56475	genome.wustl.edu	37	2	154334954	154334954	+	Silent	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr2:154334954C>T	ENST00000325926.3	-	1	368	c.126G>A	c.(124-126)gcG>gcA	p.A42A	AC012501.2_ENST00000424322.1_RNA	NM_019845.2	NP_062819.1	Q9NS64	RPRM_HUMAN	reprimo, TP53 dependent G2 arrest mediator candidate	42					cell cycle arrest (GO:0007050)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				large_intestine(2)|lung(1)|prostate(1)	4						GGCCTCCCTCCGCGAAGCCGT	0.672																																																	0													84.0	58.0	67.0					2																	154334954		2203	4300	6503	SO:0001819	synonymous_variant	0			AK074808	CCDS2198.1	2q24.1	2011-01-26	2005-12-01		ENSG00000177519	ENSG00000177519			24201	protein-coding gene	gene with protein product	"""candidate mediator of the p53 dependent G2 arrest"", ""REPRIMO"""	612171	"""reprimo, TP53 dependant G2 arrest mediator candidate"""			10930422	Standard	NM_019845		Approved	FLJ90327, REPRIMO	uc002tyq.1	Q9NS64	OTTHUMG00000131905	ENST00000325926.3:c.126G>A	2.37:g.154334954C>T			B2R4V1	Silent	SNP	NULL	p.A42	ENST00000325926.3	37	c.126	CCDS2198.1	2																																																																																			RPRM	-	NULL	ENSG00000177519		0.672	RPRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPRM	HGNC	protein_coding	OTTHUMT00000254856.1	-	0.00	30	0	C	NM_019845		154334954	-1	tier1	-	no_errors	ENST00000325926	ensembl	human	known	74_37	silent	29.41	12	5	SNP	1.000	T
RRBP1	6238	genome.wustl.edu	37	20	17599256	17599256	+	Silent	SNP	G	G	A	rs371408403		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr20:17599256G>A	ENST00000377813.1	-	20	4047	c.3744C>T	c.(3742-3744)agC>agT	p.S1248S	RRBP1_ENST00000360807.4_Silent_p.S815S|RRBP1_ENST00000377807.2_Silent_p.S815S|RRBP1_ENST00000246043.4_Silent_p.S1248S|RRBP1_ENST00000455029.2_Silent_p.S589S|RRBP1_ENST00000470422.1_5'UTR			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	1248					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						CAAGCTCATCGCTCTGTTTCT	0.562																																																	0								G	,	0,4406		0,0,2203	94.0	84.0	87.0		2445,2445	-0.5	0.0	20		87	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	RRBP1	NM_001042576.1,NM_004587.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	815/978,815/978	17599256	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.3744C>T	20.37:g.17599256G>A			A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Silent	SNP	pfam_Rib_rcpt_KP,superfamily_Ribosome_recyc_fac_dom	p.S1248	ENST00000377813.1	37	c.3744		20																																																																																			RRBP1	-	NULL	ENSG00000125844		0.562	RRBP1-002	NOVEL	basic	protein_coding	RRBP1	HGNC	protein_coding	OTTHUMT00000078125.1	-	0.00	48	0	G	NM_001042576		17599256	-1	tier1	-	no_errors	ENST00000246043	ensembl	human	known	74_37	silent	13.95	37	6	SNP	0.052	A
RTP2	344892	genome.wustl.edu	37	3	187416574	187416574	+	Silent	SNP	G	G	A	rs376471256		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:187416574G>A	ENST00000358241.1	-	2	818	c.390C>T	c.(388-390)taC>taT	p.Y130Y		NM_001004312.2	NP_001004312.2	Q5QGT7	RTP2_HUMAN	receptor (chemosensory) transporter protein 2	130					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)			large_intestine(3)|lung(14)|skin(1)	18	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0515)		CATCCTCCTCGTAGCACTGCT	0.662																																																	0								G		0,4406		0,0,2203	36.0	31.0	33.0		390	2.2	1.0	3		33	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	RTP2	NM_001004312.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		130/226	187416574	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AY562236	CCDS33911.1	3q27.3	2014-02-20	2006-11-21		ENSG00000198471	ENSG00000198471		"""Receptor transporter proteins"""	32486	protein-coding gene	gene with protein product	"""receptor transporting protein 2"", ""zinc finger, 3CxxC-type 2"""	609138	"""receptor transporter protein 2"""			16271481, 15550249, 16720576	Standard	NM_001004312		Approved	MGC78665, Z3CXXC2	uc003fro.1	Q5QGT7	OTTHUMG00000156458	ENST00000358241.1:c.390C>T	3.37:g.187416574G>A			Q6NVH4	Silent	SNP	NULL	p.Y130	ENST00000358241.1	37	c.390	CCDS33911.1	3																																																																																			RTP2	-	NULL	ENSG00000198471		0.662	RTP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTP2	HGNC	protein_coding	OTTHUMT00000344259.1	-	0.00	38	0	G	NM_001004312		187416574	-1	tier1	-	no_errors	ENST00000358241	ensembl	human	known	74_37	silent	27.27	16	6	SNP	0.974	A
S100A11	6282	genome.wustl.edu	37	1	152005287	152005287	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:152005287G>T	ENST00000271638.2	-	3	288	c.169C>A	c.(169-171)Cct>Act	p.P57T	NBPF18P_ENST00000432386.1_RNA|S100A11_ENST00000478109.1_5'UTR	NM_005620.1	NP_005611.1	P31949	S10AB_HUMAN	S100 calcium binding protein A11	57	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)|S100 protein binding (GO:0044548)			large_intestine(1)|lung(1)|prostate(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			AGGACACCAGGGTCCTTCTGG	0.408																																					Colon(152;1751 1834 12462 21158 46902)												0													71.0	68.0	69.0					1																	152005287		2203	4300	6503	SO:0001583	missense	0			D38583	CCDS1009.1	1q21	2013-01-10	2006-09-11		ENSG00000163191	ENSG00000163191		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10488	protein-coding gene	gene with protein product		603114	"""S100 calcium-binding protein A11 (calgizzarin)"", ""S100 calcium binding protein A11 (calgizzarin)"""			8985590	Standard	NM_005620		Approved	S100C	uc001ezn.3	P31949	OTTHUMG00000013069	ENST00000271638.2:c.169C>A	1.37:g.152005287G>T	ENSP00000271638:p.Pro57Thr		Q5VTK0	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.P57T	ENST00000271638.2	37	c.169	CCDS1009.1	1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.049409	0.55218	.	.	ENSG00000163191	ENST00000271638	T	0.06768	3.26	5.09	5.09	0.68999	EF-hand-like domain (1);	0.000000	0.64402	D	0.000011	T	0.19005	0.0456	M	0.80616	2.505	0.52099	D	0.999941	P	0.49862	0.929	P	0.59487	0.858	T	0.00176	-1.1953	10	0.62326	D	0.03	.	14.3446	0.66651	0.0:0.0:1.0:0.0	.	57	P31949	S10AB_HUMAN	T	57	ENSP00000271638:P57T	ENSP00000271638:P57T	P	-	1	0	S100A11	150271911	1.000000	0.71417	0.997000	0.53966	0.357000	0.29423	4.215000	0.58534	2.529000	0.85273	0.491000	0.48974	CCT	S100A11	-	pfscan_EF_hand_dom	ENSG00000163191		0.408	S100A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A11	HGNC	protein_coding	OTTHUMT00000036676.1		0.00	50	0	G	NM_005620		152005287	-1			no_errors	ENST00000271638	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.999	T
SALL1	6299	genome.wustl.edu	37	16	51175536	51175536	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr16:51175536G>T	ENST00000251020.4	-	2	630	c.597C>A	c.(595-597)aaC>aaA	p.N199K	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.N102K|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000562674.1_5'Flank	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	199					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TGCTCTGGAGGTTCTCGATGA	0.607																																					GBM(103;1352 1446 1855 4775 8890)												0													93.0	90.0	91.0					16																	51175536		2198	4300	6498	SO:0001583	missense	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.597C>A	16.37:g.51175536G>T	ENSP00000251020:p.Asn199Lys		Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N199K	ENST00000251020.4	37	c.597	CCDS10747.1	16	.	.	.	.	.	.	.	.	.	.	G	15.95	2.983339	0.53827	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.06218	3.35;3.33	5.37	3.37	0.38596	.	0.000000	0.85682	D	0.000000	T	0.13756	0.0333	L	0.56769	1.78	0.54753	D	0.999985	D	0.67145	0.996	P	0.54815	0.761	T	0.01136	-1.1440	10	0.56958	D	0.05	.	10.6579	0.45686	0.2183:0.0:0.7817:0.0	.	199	Q9NSC2	SALL1_HUMAN	K	199;102;163	ENSP00000251020:N199K;ENSP00000407914:N102K	ENSP00000251020:N199K	N	-	3	2	SALL1	49733037	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.103000	0.41806	1.217000	0.43442	0.561000	0.74099	AAC	SALL1	-	NULL	ENSG00000103449		0.607	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	-	0.00	85	0	G	NM_002968		51175536	-1	tier1	-	no_errors	ENST00000251020	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
SDK1	221935	genome.wustl.edu	37	7	4218194	4218194	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr7:4218194G>A	ENST00000404826.2	+	35	5213	c.5074G>A	c.(5074-5076)Gtg>Atg	p.V1692M	SDK1_ENST00000389531.3_Missense_Mutation_p.V1672M	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1692	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.V1692M(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CAGCGCGCCCGTGGAGGTCTT	0.592																																																	1	Substitution - Missense(1)	kidney(1)											74.0	83.0	80.0					7																	4218194		2203	4300	6503	SO:0001583	missense	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.5074G>A	7.37:g.4218194G>A	ENSP00000385899:p.Val1692Met		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V1692M	ENST00000404826.2	37	c.5074	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	G	17.73	3.461279	0.63513	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.57752	0.38;0.38	5.09	5.09	0.68999	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000008	T	0.71476	0.3344	M	0.80183	2.485	0.38647	D	0.951745	D;D;D	0.76494	0.978;0.992;0.999	P;P;D	0.63113	0.738;0.557;0.911	T	0.74028	-0.3796	10	0.36615	T	0.2	.	17.0409	0.86489	0.0:0.0:1.0:0.0	.	1672;179;1692	F8W6X9;F2Z3E9;Q7Z5N4	.;.;SDK1_HUMAN	M	1692;1672	ENSP00000385899:V1692M;ENSP00000374182:V1672M	ENSP00000374182:V1672M	V	+	1	0	SDK1	4184720	1.000000	0.71417	0.901000	0.35422	0.370000	0.29829	5.763000	0.68818	2.525000	0.85131	0.655000	0.94253	GTG	SDK1	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000146555		0.592	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	-	0.00	53	0	G	NM_152744		4218194	+1	tier1	-	no_errors	ENST00000404826	ensembl	human	known	74_37	missense	30.00	35	15	SNP	0.986	A
SEMA5B	54437	genome.wustl.edu	37	3	122631054	122631054	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:122631054G>A	ENST00000357599.3	-	19	3247	c.2861C>T	c.(2860-2862)aCg>aTg	p.T954M	SEMA5B_ENST00000195173.4_Missense_Mutation_p.T953M|SEMA5B_ENST00000451055.2_Missense_Mutation_p.T1008M	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	954	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		TGCCTCCTCCGTGTGCAGCCC	0.652																																																	0													59.0	49.0	53.0					3																	122631054		2203	4300	6503	SO:0001583	missense	0			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2861C>T	3.37:g.122631054G>A	ENSP00000350215:p.Thr954Met		A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.T1008M	ENST00000357599.3	37	c.3023	CCDS35491.1	3	.	.	.	.	.	.	.	.	.	.	G	21.8	4.196653	0.79015	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	4.55	4.55	0.56014	.	0.055650	0.64402	D	0.000001	T	0.66479	0.2793	L	0.52206	1.635	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.989	T	0.64028	-0.6503	10	0.33940	T	0.23	.	16.4825	0.84161	0.0:0.0:1.0:0.0	.	860;954	D3YTI7;Q9P283	.;SEM5B_HUMAN	M	954;953;860;1008;954	ENSP00000350215:T954M;ENSP00000195173:T953M;ENSP00000389588:T1008M;ENSP00000377208:T954M	ENSP00000195173:T953M	T	-	2	0	SEMA5B	124113744	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.640000	0.98453	2.365000	0.80145	0.511000	0.50034	ACG	SEMA5B	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000082684		0.652	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	SEMA5B	HGNC	protein_coding	OTTHUMT00000277165.1	-	0.00	29	0	G	NM_001031702		122631054	-1	tier1	-	no_errors	ENST00000451055	ensembl	human	known	74_37	missense	28.57	10	4	SNP	1.000	A
SFXN4	119559	genome.wustl.edu	37	10	120900751	120900751	+	3'UTR	SNP	C	C	A	rs202015162	byFrequency	TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr10:120900751C>A	ENST00000355697.2	-	0	1036				SFXN4_ENST00000461438.1_5'Flank|SFXN4_ENST00000330036.6_3'UTR	NM_213649.1	NP_998814.1	Q6P4A7	SFXN4_HUMAN	sideroflexin 4						iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	11		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		CTAAAACTCACGCCTACACCC	0.423																																																	0													173.0	179.0	177.0					10																	120900751		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0				CCDS7610.1	10q26.11	2006-03-13			ENSG00000183605	ENSG00000183605		"""Sideroflexins"""	16088	protein-coding gene	gene with protein product		615564				14756423	Standard	NM_213649		Approved		uc001leb.3	Q6P4A7	OTTHUMG00000019147	ENST00000355697.2:c.*3G>T	10.37:g.120900751C>A			Q6WSU4|Q86TD9	RNA	SNP	-	NULL	ENST00000355697.2	37	NULL	CCDS7610.1	10																																																																																			SFXN4	-	-	ENSG00000183605		0.423	SFXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN4	HGNC	protein_coding	OTTHUMT00000050642.3	-	0.00	111	0	C	XM_058406		120900751	-1	tier1	-	no_errors	ENST00000484960	ensembl	human	known	74_37	rna	51.47	33	35	SNP	0.000	A
SH2D5	400745	genome.wustl.edu	37	1	21049287	21049287	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:21049287G>A	ENST00000444387.2	-	9	1427	c.1030C>T	c.(1030-1032)Cag>Tag	p.Q344*	SH2D5_ENST00000460804.1_5'UTR|SH2D5_ENST00000375031.1_Nonsense_Mutation_p.Q260*	NM_001103161.1	NP_001096631.1	Q6ZV89	SH2D5_HUMAN	SH2 domain containing 5	344	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.									lung(4)|prostate(1)|upper_aerodigestive_tract(1)	6		Colorectal(325;3.46e-05)|all_lung(284;5.32e-05)|Lung NSC(340;5.51e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|GBM - Glioblastoma multiforme(114;0.000465)|Kidney(64;0.000476)|STAD - Stomach adenocarcinoma(196;0.00303)|KIRC - Kidney renal clear cell carcinoma(64;0.00634)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CGGAAGACCTGGTGGGGCACC	0.692																																																	0													12.0	16.0	14.0					1																	21049287		2059	4177	6236	SO:0001587	stop_gained	0			AK124869, AK123236	CCDS41280.1, CCDS44080.1	1p36.12	2008-02-05			ENSG00000189410	ENSG00000189410			28819	protein-coding gene	gene with protein product							Standard	NM_001103161		Approved		uc009vpy.1	Q6ZV89	OTTHUMG00000002620	ENST00000444387.2:c.1030C>T	1.37:g.21049287G>A	ENSP00000406026:p.Gln344*		B7Z3W3|Q5SSJ2	Nonsense_Mutation	SNP	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom,pfscan_SH2	p.Q344*	ENST00000444387.2	37	c.1030	CCDS44080.1	1	.	.	.	.	.	.	.	.	.	.	G	42	9.172317	0.99089	.	.	ENSG00000189410	ENST00000375031;ENST00000444387	.	.	.	4.85	4.85	0.62838	.	0.573504	0.17351	N	0.177403	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	.	10.5243	0.44938	0.0:0.0:0.8068:0.1932	.	.	.	.	X	260;344	.	ENSP00000364171:Q260X	Q	-	1	0	SH2D5	20921874	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.476000	0.35420	2.523000	0.85059	0.563000	0.77884	CAG	SH2D5	-	pfscan_SH2	ENSG00000189410		0.692	SH2D5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SH2D5	HGNC	protein_coding	OTTHUMT00000007455.2	-	0.00	129	0	G	XM_375698		21049287	-1	tier1	-	no_errors	ENST00000444387	ensembl	human	known	74_37	nonsense	36.99	46	27	SNP	1.000	A
SHROOM3	57619	genome.wustl.edu	37	4	77476876	77476876	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr4:77476876G>T	ENST00000296043.6	+	2	1236	c.283G>T	c.(283-285)Gtg>Ttg	p.V95L		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	95	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			AGTTTCCCTGGTGAAAGGATC	0.587																																																	0													118.0	103.0	108.0					4																	77476876		2203	4300	6503	SO:0001583	missense	0			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.283G>T	4.37:g.77476876G>T	ENSP00000296043:p.Val95Leu		Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.V95L	ENST00000296043.6	37	c.283	CCDS3579.2	4	.	.	.	.	.	.	.	.	.	.	G	21.7	4.181984	0.78677	.	.	ENSG00000138771	ENST00000296043	T	0.22336	1.96	4.6	3.74	0.42951	PDZ/DHR/GLGF (4);	1.104210	0.06987	N	0.820867	T	0.18341	0.0440	N	0.13043	0.29	0.31762	N	0.633257	B	0.32467	0.372	B	0.35899	0.213	T	0.31779	-0.9931	10	0.87932	D	0	-16.1098	13.6609	0.62366	0.0:0.1556:0.8443:0.0	.	95	Q8TF72	SHRM3_HUMAN	L	95	ENSP00000296043:V95L	ENSP00000296043:V95L	V	+	1	0	SHROOM3	77695900	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	6.391000	0.73208	1.204000	0.43247	0.467000	0.42956	GTG	SHROOM3	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000138771		0.587	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	HGNC	protein_coding	OTTHUMT00000252408.2	-	0.00	87	0	G	NM_020859		77476876	+1	tier1	-	no_errors	ENST00000296043	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
SLC17A6	57084	genome.wustl.edu	37	11	22396359	22396359	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:22396359G>A	ENST00000263160.3	+	9	1537	c.1100G>A	c.(1099-1101)gGa>gAa	p.G367E		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	367					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						CCTATTGGGGGACAAATTGCA	0.388																																																	0													228.0	224.0	225.0					11																	22396359		2203	4300	6503	SO:0001583	missense	0			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1100G>A	11.37:g.22396359G>A	ENSP00000263160:p.Gly367Glu		A6NKS2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.G367E	ENST00000263160.3	37	c.1100	CCDS7856.1	11	.	.	.	.	.	.	.	.	.	.	G	29.9	5.047683	0.93740	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.70749	-0.51	5.74	5.74	0.90152	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.90577	0.7046	H	0.97516	4.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93199	0.6590	10	0.72032	D	0.01	.	19.9154	0.97058	0.0:0.0:1.0:0.0	.	367	Q9P2U8	VGLU2_HUMAN	E	367;255	ENSP00000263160:G367E	ENSP00000263160:G367E	G	+	2	0	SLC17A6	22352935	1.000000	0.71417	0.993000	0.49108	0.973000	0.67179	9.466000	0.97665	2.716000	0.92895	0.579000	0.79373	GGA	SLC17A6	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000091664		0.388	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	HGNC	protein_coding	OTTHUMT00000387671.1	-	0.00	73	0	G	NM_020346		22396359	+1	tier1	-	no_errors	ENST00000263160	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	A
SLC22A2	6582	genome.wustl.edu	37	6	160664750	160664750	+	Missense_Mutation	SNP	A	A	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr6:160664750A>T	ENST00000366953.3	-	7	1391	c.1133T>A	c.(1132-1134)cTg>cAg	p.L378Q	SLC22A2_ENST00000491092.1_5'UTR	NM_003058.3	NP_003049.2	O15244	S22A2_HUMAN	solute carrier family 22 (organic cation transporter), member 2	378					body fluid secretion (GO:0007589)|drug transmembrane transport (GO:0006855)|histamine transport (GO:0051608)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|organic cation transport (GO:0015695)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|steroid binding (GO:0005496)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(16)|prostate(2)|skin(1)	27		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)	Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Chlorphenamine(DB01114)|Choline(DB00122)|Cimetidine(DB00501)|Cisplatin(DB00515)|Cladribine(DB00242)|Cocaine(DB00907)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Desipramine(DB01151)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Famotidine(DB00927)|Flurazepam(DB00690)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Lamivudine(DB00709)|Levofloxacin(DB01137)|Memantine(DB01043)|Metformin(DB00331)|Metoprolol(DB00264)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Oxprenolol(DB01580)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Propranolol(DB00571)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Reserpine(DB00206)|Thiamine(DB00152)|Tubocurarine(DB01199)|Vinblastine(DB00570)|Zidovudine(DB00495)	GAAGAAATCCAGGTAGATATT	0.522																																																	0													108.0	98.0	101.0					6																	160664750		2203	4300	6503	SO:0001583	missense	0			X98333	CCDS5276.1	6q25.3	2013-05-22			ENSG00000112499	ENSG00000112499		"""Solute carriers"""	10966	protein-coding gene	gene with protein product		602608				9605850	Standard	NM_003058		Approved	OCT2	uc003qtf.3	O15244	OTTHUMG00000015950	ENST00000366953.3:c.1133T>A	6.37:g.160664750A>T	ENSP00000355920:p.Leu378Gln		Q5T7Q6|Q6PIQ8|Q8NG62|Q9NQB9	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.L378Q	ENST00000366953.3	37	c.1133	CCDS5276.1	6	.	.	.	.	.	.	.	.	.	.	A	26.8	4.769365	0.90020	.	.	ENSG00000112499	ENST00000366953	T	0.63913	-0.07	5.35	5.35	0.76521	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.169796	0.41396	D	0.000894	D	0.82935	0.5145	H	0.96208	3.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.993	D	0.87821	0.2638	10	0.56958	D	0.05	.	15.5001	0.75691	1.0:0.0:0.0:0.0	.	378;378	O15244;O15244-2	S22A2_HUMAN;.	Q	378	ENSP00000355920:L378Q	ENSP00000355920:L378Q	L	-	2	0	SLC22A2	160584740	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	9.028000	0.93712	2.250000	0.74265	0.533000	0.62120	CTG	SLC22A2	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000112499		0.522	SLC22A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A2	HGNC	protein_coding	OTTHUMT00000042943.1	-	0.00	65	0	A	NM_003058		160664750	-1	tier1	-	no_errors	ENST00000366953	ensembl	human	known	74_37	missense	61.22	19	30	SNP	0.992	T
SLC30A2	7780	genome.wustl.edu	37	1	26365728	26365728	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:26365728G>T	ENST00000374278.3	-	7	1111	c.895C>A	c.(895-897)Cac>Aac	p.H299N	SLC30A2_ENST00000374276.3_Missense_Mutation_p.H348N	NM_032513.3	NP_115902.1	Q9BRI3	ZNT2_HUMAN	solute carrier family 30 (zinc transporter), member 2	299					positive regulation of sequestering of zinc ion (GO:0061090)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)	cation transmembrane transporter activity (GO:0008324)			cervix(1)|endometrium(2)|kidney(1)|lung(8)|stomach(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.09e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00614)|READ - Rectum adenocarcinoma(331;0.0649)		GTCACGGTGTGGAAGTGGAAC	0.622																																																	0													89.0	77.0	81.0					1																	26365728		2203	4300	6503	SO:0001583	missense	0			AK023491	CCDS272.1, CCDS30644.1	1p35.3	2013-05-22			ENSG00000158014	ENSG00000158014		"""Solute carriers"""	11013	protein-coding gene	gene with protein product		609617		ZNT2			Standard	NM_001004434		Approved		uc001blg.1	Q9BRI3	OTTHUMG00000007508	ENST00000374278.3:c.895C>A	1.37:g.26365728G>T	ENSP00000363396:p.His299Asn		Q71RC8	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.H348N	ENST00000374278.3	37	c.1042	CCDS272.1	1	.	.	.	.	.	.	.	.	.	.	G	16.17	3.048137	0.55110	.	.	ENSG00000158014	ENST00000374278;ENST00000374276	T;T	0.63744	-0.06;-0.06	5.63	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.73697	0.3620	M	0.78637	2.42	0.42876	D	0.994157	P;P	0.48911	0.462;0.917	B;P	0.54544	0.356;0.755	T	0.76342	-0.2994	10	0.48119	T	0.1	-12.6021	13.5493	0.61723	0.0762:0.0:0.9237:0.0	.	299;348	Q9BRI3;Q9BRI3-2	ZNT2_HUMAN;.	N	299;348	ENSP00000363396:H299N;ENSP00000363394:H348N	ENSP00000363394:H348N	H	-	1	0	SLC30A2	26238315	1.000000	0.71417	1.000000	0.80357	0.620000	0.37586	2.723000	0.47277	1.391000	0.46566	0.462000	0.41574	CAC	SLC30A2	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000158014		0.622	SLC30A2-001	KNOWN	basic|CCDS	protein_coding	SLC30A2	HGNC	protein_coding	OTTHUMT00000019742.1		0.00	50	0	G	NM_032513		26365728	-1			no_errors	ENST00000374276	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
SLC35A2	7355	genome.wustl.edu	37	X	48760684	48760684	+	3'UTR	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chrX:48760684G>T	ENST00000247138.5	-	0	1225				SLC35A2_ENST00000376529.3_Nonsense_Mutation_p.S211*	NM_005660.1	NP_005651.1	P78381	S35A2_HUMAN	solute carrier family 35 (UDP-galactose transporter), member A2						galactose metabolic process (GO:0006012)|transmembrane transport (GO:0055085)|UDP-galactose transport (GO:0015785)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	sugar:proton symporter activity (GO:0005351)|UDP-galactose transmembrane transporter activity (GO:0005459)			breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(2)	15						AAGAGAGAACGAGGCCAGGCC	0.562																																																	0													112.0	70.0	84.0					X																	48760684		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			D88146	CCDS14311.1, CCDS35247.1, CCDS43937.1, CCDS65253.1, CCDS65254.1, CCDS75973.1, CCDS75974.1, CCDS75975.1	Xp11.23-p11.22	2013-05-22			ENSG00000102100	ENSG00000102100		"""Solute carriers"""	11022	protein-coding gene	gene with protein product		314375	"""solute carrier family 35 (UDP-galactose transporter), member 2"""	UGALT		8128316	Standard	NM_001042498		Approved	UGAT, UGT, UGT1, UGT2, UGTL	uc004dlo.1	P78381	OTTHUMG00000024129	ENST00000247138.5:c.*31C>A	X.37:g.48760684G>T			A8K2L9|A8K9V1|B4DE11|B4DPT2|E7EW45|Q8IV21|Q92553	Nonsense_Mutation	SNP	pfam_Nuc_sug_transpt	p.S211*	ENST00000247138.5	37	c.632	CCDS14311.1	X	.	.	.	.	.	.	.	.	.	.	G	16.77	3.216137	0.58452	.	.	ENSG00000102100	ENST00000376529	.	.	.	5.13	3.33	0.38152	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.738	0.28825	0.208:0.0:0.792:0.0	.	.	.	.	X	211	.	ENSP00000365712:S211X	S	-	2	0	SLC35A2	48645628	0.180000	0.23148	0.876000	0.34364	0.883000	0.51084	0.469000	0.22067	0.937000	0.37394	-0.208000	0.12717	TCG	SLC35A2	-	NULL	ENSG00000102100		0.562	SLC35A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC35A2	HGNC	protein_coding	OTTHUMT00000060790.1	-	0.00	52	0	G	NM_005660		48760684	-1	tier1	-	no_errors	ENST00000376529	ensembl	human	known	74_37	nonsense	16.67	20	4	SNP	0.030	T
SLC39A8	64116	genome.wustl.edu	37	4	103228745	103228745	+	Silent	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr4:103228745G>A	ENST00000394833.2	-	3	876	c.400C>T	c.(400-402)Ctg>Ttg	p.L134L	SLC39A8_ENST00000510255.1_5'UTR|SLC39A8_ENST00000356736.4_Silent_p.L134L|SLC39A8_ENST00000424970.2_Silent_p.L134L	NM_001135148.1|NM_022154.5	NP_001128620.1|NP_071437.3	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter), member 8	134					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)|plasma membrane (GO:0005886)	metal ion transmembrane transporter activity (GO:0046873)			large_intestine(1)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		GTCACTGACAGGAATCCATAT	0.378																																																	0													88.0	96.0	94.0					4																	103228745		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS3656.1, CCDS47117.1	4q22-q24	2013-05-22			ENSG00000138821	ENSG00000138821		"""Solute carriers"""	20862	protein-coding gene	gene with protein product		608732	"""solute carrier family 39 (metal ion transporter), member 8"""			12504855, 12659941	Standard	NM_001135146		Approved	BIGM103	uc003hwc.2	Q9C0K1	OTTHUMG00000131120	ENST00000394833.2:c.400C>T	4.37:g.103228745G>A			B4E2H3|Q96SM9|Q9BVC0|Q9NSA4	Silent	SNP	pfam_ZIP	p.L134	ENST00000394833.2	37	c.400	CCDS3656.1	4																																																																																			SLC39A8	-	pfam_ZIP	ENSG00000138821		0.378	SLC39A8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC39A8	HGNC	protein_coding	OTTHUMT00000253798.1	-	0.00	54	0	G	NM_022154		103228745	-1	tier1	-	no_errors	ENST00000356736	ensembl	human	known	74_37	silent	51.43	17	18	SNP	1.000	A
SLC5A12	159963	genome.wustl.edu	37	11	26743173	26743173	+	Missense_Mutation	SNP	A	A	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:26743173A>T	ENST00000396005.3	-	1	398	c.89T>A	c.(88-90)aTt>aAt	p.I30N	SLC5A12_ENST00000280467.6_Missense_Mutation_p.I30N	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	30					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						TCTCTCCTTAATGGCAAAGAA	0.458																																																	0													77.0	80.0	79.0					11																	26743173		2203	4299	6502	SO:0001583	missense	0			BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.89T>A	11.37:g.26743173A>T	ENSP00000379326:p.Ile30Asn		Q86UC7	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.I30N	ENST00000396005.3	37	c.89	CCDS7860.2	11	.	.	.	.	.	.	.	.	.	.	A	19.75	3.885225	0.72410	.	.	ENSG00000148942	ENST00000396005;ENST00000280467	D;D	0.85955	-2.05;-1.7	5.59	5.59	0.84812	.	0.186798	0.43110	D	0.000611	D	0.89026	0.6598	M	0.71581	2.175	0.47511	D	0.999441	P;D	0.54397	0.933;0.966	P;P	0.52554	0.689;0.702	D	0.90315	0.4340	10	0.72032	D	0.01	.	15.7638	0.78110	1.0:0.0:0.0:0.0	.	30;30	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	N	30	ENSP00000379326:I30N;ENSP00000280467:I30N	ENSP00000280467:I30N	I	-	2	0	SLC5A12	26699749	0.998000	0.40836	0.078000	0.20375	0.956000	0.61745	5.028000	0.64115	2.135000	0.66039	0.477000	0.44152	ATT	SLC5A12	-	pfscan_Na/solute_symporter	ENSG00000148942		0.458	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A12	HGNC	protein_coding	OTTHUMT00000319681.1	-	0.00	89	0	A	NM_178498		26743173	-1	tier1	-	no_errors	ENST00000396005	ensembl	human	known	74_37	missense	36.96	29	17	SNP	0.924	T
SLC7A13	157724	genome.wustl.edu	37	8	87235208	87235208	+	Silent	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr8:87235208G>A	ENST00000297524.3	-	2	913	c.810C>T	c.(808-810)ctC>ctT	p.L270L	SLC7A13_ENST00000419776.2_Silent_p.L261L|SLC7A13_ENST00000520624.1_5'UTR	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	270						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)	p.L270L(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						AACCTGAAGAGAGAATTTCCC	0.383																																																	1	Substitution - coding silent(1)	lung(1)											122.0	125.0	124.0					8																	87235208		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.810C>T	8.37:g.87235208G>A			Q05C37|Q08AH9|Q96N84	Silent	SNP	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1	p.L270	ENST00000297524.3	37	c.810	CCDS34917.1	8																																																																																			SLC7A13	-	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1	ENSG00000164893		0.383	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A13	HGNC	protein_coding	OTTHUMT00000374704.1	-	0.00	69	0	G	NM_138817		87235208	-1	tier1	-	no_errors	ENST00000297524	ensembl	human	known	74_37	silent	21.95	64	18	SNP	0.170	A
SLCO6A1	133482	genome.wustl.edu	37	5	101834432	101834432	+	Silent	SNP	C	C	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr5:101834432C>A	ENST00000506729.1	-	1	288	c.117G>T	c.(115-117)ccG>ccT	p.P39P	SLCO6A1_ENST00000514551.1_5'Flank|SLCO6A1_ENST00000513675.1_Silent_p.P39P|RP11-58B2.1_ENST00000502494.1_RNA|SLCO6A1_ENST00000379807.3_Silent_p.P39P|SLCO6A1_ENST00000389019.3_Silent_p.P39P|SLCO6A1_ENST00000379810.1_Silent_p.P39P			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	39						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		TCGAGGACTTCGGGGTTCCCT	0.592																																																	0													117.0	133.0	128.0					5																	101834432		2203	4300	6503	SO:0001819	synonymous_variant	0			AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.117G>T	5.37:g.101834432C>A			A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Silent	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.P39	ENST00000506729.1	37	c.117	CCDS34206.1	5																																																																																			SLCO6A1	-	NULL	ENSG00000205359		0.592	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO6A1	HGNC	protein_coding	OTTHUMT00000370335.1	-	0.00	66	0	C	NM_173488		101834432	-1	tier1	-	no_errors	ENST00000379807	ensembl	human	known	74_37	silent	30.00	28	12	SNP	0.000	A
SMAD4	4089	genome.wustl.edu	37	18	48591918	48591918	+	Missense_Mutation	SNP	C	C	T	rs80338963		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr18:48591918C>T	ENST00000342988.3	+	9	1619	c.1081C>T	c.(1081-1083)Cgc>Tgc	p.R361C	SMAD4_ENST00000398417.2_Missense_Mutation_p.R361C|SMAD4_ENST00000588745.1_Missense_Mutation_p.R265C	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	361	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		R -> C (in JPS; dbSNP:rs80338963). {ECO:0000269|PubMed:9811934}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.R361C(3)|p.R361S(2)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TGGAGGAGATCGCTTTTGTTT	0.413																																																	43	Whole gene deletion(36)|Substitution - Missense(5)|Unknown(2)	pancreas(26)|large_intestine(4)|lung(3)|breast(3)|stomach(2)|small_intestine(2)|upper_aerodigestive_tract(1)|biliary_tract(1)|oesophagus(1)	GRCh37	CM040450|CM041789|CM981228	SMAD4	M	rs80338963						179.0	149.0	159.0					18																	48591918		2203	4300	6503	SO:0001583	missense	0			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1081C>T	18.37:g.48591918C>T	ENSP00000341551:p.Arg361Cys		A8K405	Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.R361C	ENST00000342988.3	37	c.1081	CCDS11950.1	18	.	.	.	.	.	.	.	.	.	.	C	27.3	4.820743	0.90873	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.98164	-4.76;-4.76	5.86	5.86	0.93980	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.99275	0.9747	M	0.94021	3.485	0.80722	A	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99157	1.0860	9	0.87932	D	0	.	18.9646	0.92691	0.0:1.0:0.0:0.0	.	361	Q13485	SMAD4_HUMAN	C	361	ENSP00000341551:R361C;ENSP00000381452:R361C	ENSP00000341551:R361C	R	+	1	0	SMAD4	46845916	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.718000	0.61930	2.771000	0.95319	0.563000	0.77884	CGC	SMAD4	-	pfam_SMAD_dom_Dwarfin-type,superfamily_SMAD_FHA_domain,smart_SMAD_dom_Dwarfin-type,pfscan_SMAD_dom_Dwarfin-type	ENSG00000141646		0.413	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD4	HGNC	protein_coding	OTTHUMT00000255993.3	-	0.00	121	0	C	NM_005359		48591918	+1	tier1	rs80338963	no_errors	ENST00000342988	ensembl	human	known	74_37	missense	61.54	19	32	SNP	1.000	T
SMARCA1	6594	genome.wustl.edu	37	X	128645853	128645853	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chrX:128645853G>T	ENST00000371122.4	-	6	867	c.738C>A	c.(736-738)aaC>aaA	p.N246K	SMARCA1_ENST00000371121.3_Missense_Mutation_p.N246K|SMARCA1_ENST00000371123.1_Missense_Mutation_p.N246K|SMARCA1_ENST00000478420.1_5'UTR	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	246	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						CATTCATCCAGTTGTGTAAAG	0.398																																																	0													197.0	197.0	197.0					X																	128645853		2203	4300	6503	SO:0001583	missense	0			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.738C>A	X.37:g.128645853G>T	ENSP00000360163:p.Asn246Lys		Q5JV41|Q5JV42	Missense_Mutation	SNP	pfam_SNF2_N,pfam_SLIDE,pfam_ISWI_HAND-dom,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,superfamily_ISWI_HAND-dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_SANT/Myb,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.N246K	ENST00000371122.4	37	c.738	CCDS14612.1	X	.	.	.	.	.	.	.	.	.	.	G	22.1	4.240922	0.79912	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	D;D;D;D	0.93953	-3.32;-3.32;-3.32;-3.32	5.5	4.64	0.57946	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.64402	D	0.000001	D	0.97829	0.9287	H	0.98133	4.155	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;1.0	D	0.97862	1.0281	10	0.87932	D	0	-13.4736	11.5162	0.50522	0.1539:0.0:0.8461:0.0	.	225;246;246;246	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	K	246;246;246;225	ENSP00000360162:N246K;ENSP00000360164:N246K;ENSP00000360163:N246K;ENSP00000404275:N225K	ENSP00000360162:N246K	N	-	3	2	SMARCA1	128473534	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.070000	0.57548	1.070000	0.40811	0.600000	0.82982	AAC	SMARCA1	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000102038		0.398	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCA1	HGNC	protein_coding	OTTHUMT00000058206.1		0.00	92	0	G	NM_003069		128645853	-1			no_errors	ENST00000371122	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	T
SMCR8	140775	genome.wustl.edu	37	17	18219589	18219589	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr17:18219589G>T	ENST00000406438.3	+	1	966	c.486G>T	c.(484-486)caG>caT	p.Q162H	TOP3A_ENST00000582230.1_5'Flank|TOP3A_ENST00000542570.1_5'Flank|TOP3A_ENST00000321105.5_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	162						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						CTGCAGACCAGCATAAAATCA	0.527																																																	0													55.0	58.0	57.0					17																	18219589		2203	4300	6503	SO:0001583	missense	0			AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.486G>T	17.37:g.18219589G>T	ENSP00000385025:p.Gln162His		A5PKZ5|Q3ZCN0|Q6PJL3	Missense_Mutation	SNP	pfam_Folliculin	p.Q162H	ENST00000406438.3	37	c.486	CCDS11195.2	17	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141815	0.57044	.	.	ENSG00000176994	ENST00000406438	D	0.88818	-2.43	5.87	2.37	0.29283	.	0.054049	0.64402	D	0.000001	D	0.88709	0.6510	L	0.34521	1.04	0.38636	D	0.951495	D	0.54397	0.966	P	0.58331	0.837	D	0.89474	0.3745	10	0.66056	D	0.02	-35.4296	12.4591	0.55721	0.2129:0.0:0.7871:0.0	.	162	Q8TEV9	SMCR8_HUMAN	H	162	ENSP00000385025:Q162H	ENSP00000385025:Q162H	Q	+	3	2	SMCR8	18160314	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	3.765000	0.55272	0.824000	0.34613	0.655000	0.94253	CAG	SMCR8	-	pfam_Folliculin	ENSG00000176994		0.527	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR8	HGNC	protein_coding	OTTHUMT00000132065.2	-	0.00	71	0	G	NM_144775		18219589	+1	tier1	-	no_errors	ENST00000406438	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
SMOC2	64094	genome.wustl.edu	37	6	168999587	168999587	+	Missense_Mutation	SNP	G	G	A	rs551280549		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr6:168999587G>A	ENST00000356284.2	+	8	947	c.727G>A	c.(727-729)Ggc>Agc	p.G243S	SMOC2_ENST00000354536.5_Missense_Mutation_p.G254S	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	243	Thyroglobulin type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00500}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		GTGTGCGCACGGCGGCCTCTA	0.632													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14338	0.0		0.0	False		,,,				2504	0.0																0													105.0	75.0	85.0					6																	168999587		2203	4299	6502	SO:0001583	missense	0			AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.727G>A	6.37:g.168999587G>A	ENSP00000348630:p.Gly243Ser		B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_SPARC/Testican_Ca-bd-dom,pfam_Kazal_dom,superfamily_Thyroglobulin_1,smart_Kazal_dom,smart_Thyroglobulin_1,pfscan_EF_hand_dom,pfscan_Thyroglobulin_1	p.G254S	ENST00000356284.2	37	c.760	CCDS55076.1	6	.	.	.	.	.	.	.	.	.	.	G	29.3	4.996107	0.93167	.	.	ENSG00000112562	ENST00000356284;ENST00000354536;ENST00000366793	T;T	0.62364	0.03;0.03	4.89	4.89	0.63831	Thyroglobulin type-1 (5);EF-hand-like domain (1);	0.245514	0.35525	N	0.003145	T	0.53029	0.1771	N	0.12887	0.27	0.48830	D	0.999716	D;D	0.71674	0.998;0.998	P;P	0.61070	0.883;0.8	T	0.64330	-0.6433	10	0.59425	D	0.04	-6.6303	17.1175	0.86694	0.0:0.0:1.0:0.0	.	243;254	Q9H3U7;Q9H3U7-2	SMOC2_HUMAN;.	S	243;254;243	ENSP00000348630:G243S;ENSP00000346537:G254S	ENSP00000346537:G254S	G	+	1	0	SMOC2	168741512	1.000000	0.71417	0.188000	0.23233	0.919000	0.55068	8.993000	0.93524	2.268000	0.75426	0.386000	0.25728	GGC	SMOC2	-	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	ENSG00000112562		0.632	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMOC2	HGNC	protein_coding	OTTHUMT00000043201.1	-	0.00	52	0	G			168999587	+1	tier1	-	no_errors	ENST00000354536	ensembl	human	known	74_37	missense	20.00	28	7	SNP	0.980	A
SOWAHC	65124	genome.wustl.edu	37	2	110372640	110372640	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr2:110372640C>T	ENST00000356454.3	+	1	730	c.574C>T	c.(574-576)Ctt>Ttt	p.L192F	SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	192																	GGGCAGCTCCCTTGTGGGGGC	0.731																																																	0													5.0	7.0	6.0					2																	110372640		1598	2925	4523	SO:0001583	missense	0			AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.574C>T	2.37:g.110372640C>T	ENSP00000365830:p.Leu192Phe		Q8NE15|Q9H6U1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L192F	ENST00000356454.3	37	c.574	CCDS33270.1	2	.	.	.	.	.	.	.	.	.	.	C	13.50	2.256842	0.39896	.	.	ENSG00000198142	ENST00000356454	T	0.23147	1.92	4.02	1.93	0.25924	.	0.978510	0.08381	N	0.954608	T	0.18923	0.0454	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.28522	-1.0041	10	0.48119	T	0.1	1.081	7.0298	0.24960	0.0:0.6845:0.1371:0.1783	.	192	Q53LP3	ANR57_HUMAN	F	192	ENSP00000365830:L192F	ENSP00000365830:L192F	L	+	1	0	ANKRD57	109729929	0.017000	0.18338	0.001000	0.08648	0.090000	0.18270	2.523000	0.45580	0.173000	0.19788	0.462000	0.41574	CTT	SOWAHC	-	NULL	ENSG00000198142		0.731	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOWAHC	HGNC	protein_coding	OTTHUMT00000330168.1	-	0.00	15	0	C	NM_023016		110372640	+1	tier1	-	no_errors	ENST00000356454	ensembl	human	known	74_37	missense	80.00	2	8	SNP	0.005	T
SPPL2C	162540	genome.wustl.edu	37	17	43922723	43922723	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr17:43922723G>T	ENST00000329196.5	+	1	468	c.451G>T	c.(451-453)Gct>Tct	p.A151S	MAPT-AS1_ENST00000581125.1_RNA|MAPT-AS1_ENST00000579599.1_RNA|MAPT-AS1_ENST00000579244.1_RNA	NM_175882.2	NP_787078.2	Q8IUH8	SPP2C_HUMAN	signal peptide peptidase like 2C	151	PA.					endoplasmic reticulum membrane (GO:0005789)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)										CATCCCTGTGGCTATGCTCCA	0.642																																																	0													68.0	57.0	61.0					17																	43922723		2203	4300	6503	SO:0001583	missense	0				CCDS32673.1	17q21.31	2014-02-12			ENSG00000185294	ENSG00000185294			28902	protein-coding gene	gene with protein product	"""intramembrane protease 5"""	608284				12139484	Standard	NM_175882		Approved	IMP5	uc010wka.2	Q8IUH8		ENST00000329196.5:c.451G>T	17.37:g.43922723G>T	ENSP00000332488:p.Ala151Ser		Q8TC67|Q8WVZ6	Missense_Mutation	SNP	pfam_Peptidase_A22B_SPP,pfam_Protease-assoc_domain,smart_Preselin/SPP	p.A151S	ENST00000329196.5	37	c.451	CCDS32673.1	17	.	.	.	.	.	.	.	.	.	.	G	15.40	2.822273	0.50739	.	.	ENSG00000185294	ENST00000329196	T	0.08193	3.12	4.65	4.65	0.58169	Protease-associated domain, PA (1);	0.000000	0.43919	D	0.000518	T	0.30978	0.0782	M	0.85542	2.76	0.80722	D	1	D	0.71674	0.998	D	0.73380	0.98	T	0.07139	-1.0788	10	0.87932	D	0	-19.843	12.8955	0.58098	0.0:0.0:1.0:0.0	.	151	Q8IUH8	IMP5_HUMAN	S	151	ENSP00000332488:A151S	ENSP00000332488:A151S	A	+	1	0	AC217771.1	41278503	1.000000	0.71417	0.951000	0.38953	0.031000	0.12232	7.743000	0.85020	2.409000	0.81822	0.655000	0.94253	GCT	SPPL2C	-	pfam_Protease-assoc_domain	ENSG00000185294		0.642	SPPL2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPPL2C	HGNC	protein_coding	OTTHUMT00000441156.1		0.00	78	0	G	NM_175882		43922723	+1			no_errors	ENST00000329196	ensembl	human	known	74_37	missense	6.38	44	3	SNP	1.000	T
SPRTN	83932	genome.wustl.edu	37	1	231488755	231488755	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:231488755C>T	ENST00000295050.7	+	5	1454	c.1118C>T	c.(1117-1119)tCa>tTa	p.S373L	SPRTN_ENST00000391858.4_3'UTR	NM_001010984.2|NM_032018.5	NP_001010984.1|NP_114407.3	Q9H040	SPRTN_HUMAN	SprT-like N-terminal domain	373					cellular response to DNA damage stimulus (GO:0006974)|positive regulation of protein ubiquitination (GO:0031398)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|K63-linked polyubiquitin binding (GO:0070530)|metal ion binding (GO:0046872)|ubiquitin binding (GO:0043130)										AGAAGGGTTTCATCTTCTAAG	0.413																																																	0													81.0	82.0	82.0					1																	231488755		2203	4300	6503	SO:0001583	missense	0			AL512744	CCDS1594.1, CCDS31054.1, CCDS58066.1	1q42.12-q43	2013-01-30	2012-06-18	2012-06-18	ENSG00000010072	ENSG00000010072			25356	protein-coding gene	gene with protein product	"""SprT-like domain at the N terminus"", ""DNA damage-targeting VCP (p97) adaptor"""		"""chromosome 1 open reading frame 124"""	C1orf124		22681887	Standard	NM_032018		Approved	DKFZP547N043, Spartan, DVC1	uc001hur.4	Q9H040	OTTHUMG00000038022	ENST00000295050.7:c.1118C>T	1.37:g.231488755C>T	ENSP00000295050:p.Ser373Leu		B1AKT0|B5MEF7|Q5TE78|Q6UWW6|Q96BC5|Q96KA0	Missense_Mutation	SNP	pfam_SprT-like_domain,smart_SprT-like_domain,smart_Znf_Rad18_put	p.S373L	ENST00000295050.7	37	c.1118	CCDS1594.1	1	.	.	.	.	.	.	.	.	.	.	C	12.83	2.054787	0.36277	.	.	ENSG00000010072	ENST00000295050	T	0.44083	0.93	4.41	4.41	0.53225	.	1.251120	0.05428	N	0.545367	T	0.31104	0.0786	N	0.14661	0.345	0.37155	D	0.902351	B	0.20887	0.049	B	0.16722	0.016	T	0.01966	-1.1238	10	0.26408	T	0.33	-0.7204	13.3156	0.60405	0.1583:0.8417:0.0:0.0	.	373	Q9H040	CA124_HUMAN	L	373	ENSP00000295050:S373L	ENSP00000295050:S373L	S	+	2	0	C1orf124	229555378	0.029000	0.19370	0.007000	0.13788	0.054000	0.15201	3.258000	0.51507	2.758000	0.94735	0.643000	0.83706	TCA	SPRTN	-	NULL	ENSG00000010072		0.413	SPRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRTN	HGNC	protein_coding	OTTHUMT00000092858.1	-	0.00	47	0	C	NM_032018		231488755	+1	tier1	-	no_errors	ENST00000295050	ensembl	human	known	74_37	missense	44.44	15	12	SNP	0.009	T
SRRM4	84530	genome.wustl.edu	37	12	119588991	119588991	+	Missense_Mutation	SNP	T	T	G	rs550324165		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr12:119588991T>G	ENST00000267260.4	+	10	1634	c.1246T>G	c.(1246-1248)Tac>Gac	p.Y416D		NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	416	Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						TTCCCCCAGGTACACCCAAAG	0.532																																																	0													73.0	74.0	74.0					12																	119588991		1929	4125	6054	SO:0001583	missense	0			AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.1246T>G	12.37:g.119588991T>G	ENSP00000267260:p.Tyr416Asp		A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	NULL	p.Y416D	ENST00000267260.4	37	c.1246	CCDS44994.1	12	.	.	.	.	.	.	.	.	.	.	T	16.68	3.190744	0.58017	.	.	ENSG00000139767	ENST00000267260	T	0.24723	1.84	5.58	4.36	0.52297	.	0.352817	0.30667	N	0.009126	T	0.29716	0.0742	L	0.43152	1.355	0.34366	D	0.691496	P	0.49783	0.928	P	0.51135	0.66	T	0.36407	-0.9749	9	.	.	.	-12.2553	10.563	0.45156	0.1436:0.0:0.0:0.8564	.	416	A7MD48	SRRM4_HUMAN	D	416	ENSP00000267260:Y416D	.	Y	+	1	0	SRRM4	118073374	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	5.210000	0.65214	2.239000	0.73571	0.533000	0.62120	TAC	SRRM4	-	NULL	ENSG00000139767		0.532	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM4	HGNC	protein_coding	OTTHUMT00000401640.2	-	0.00	46	0	T	NM_194286		119588991	+1	tier1	-	no_errors	ENST00000267260	ensembl	human	known	74_37	missense	35.14	24	13	SNP	1.000	G
STAMBPL1	57559	genome.wustl.edu	37	10	90672881	90672882	+	Frame_Shift_Ins	INS	-	-	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr10:90672881_90672882insA	ENST00000371926.3	+	6	1402_1403	c.444_445insA	c.(445-447)aaafs	p.K149fs	STAMBPL1_ENST00000371922.1_5'UTR|STAMBPL1_ENST00000371927.3_Frame_Shift_Ins_p.K149fs|STAMBPL1_ENST00000371924.1_Frame_Shift_Ins_p.K149fs	NM_020799.3	NP_065850.1	Q96FJ0	STALP_HUMAN	STAM binding protein-like 1	149						membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(2)|endometrium(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(1)	11		Colorectal(252;0.0381)		Colorectal(12;6.38e-05)|COAD - Colon adenocarcinoma(12;7.75e-05)		CTGAAATTCTCAAAAAATTGGA	0.406																																																	0																																										SO:0001589	frameshift_variant	0			AB037794	CCDS7391.1	10q23.32	2006-11-08			ENSG00000138134	ENSG00000138134			24105	protein-coding gene	gene with protein product	"""associated molecule with the SH3 domain of STAM (AMSH) like protein"", ""associated molecule with the SH3 domain of STAM (AMSH) - Family Protein"""	612352				12810066, 12943674	Standard	NM_020799		Approved	AMSH-LP, KIAA1373, AMSH-FP, FLJ31524, ALMalpha, bA399O19.2	uc001kfk.4	Q96FJ0	OTTHUMG00000018702	ENST00000371926.3:c.450dupA	10.37:g.90672887_90672887dupA	ENSP00000360994:p.Lys149fs		B3KPA7|Q5T9N4|Q5T9N9|Q7Z420|Q9P2H4	Frame_Shift_Ins	INS	pfam_JAB_MPN_dom,smart_JAB_MPN_dom	p.L150fs	ENST00000371926.3	37	c.444_445	CCDS7391.1	10																																																																																			STAMBPL1	-	NULL	ENSG00000138134		0.406	STAMBPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAMBPL1	HGNC	protein_coding	OTTHUMT00000049283.1		0.00	66	0	-	NM_020799		90672882	+1	tier1		no_errors	ENST00000371927	ensembl	human	known	74_37	frame_shift_ins	5.71	33	2	INS	1.000:1.000	A
SUCLG2	8801	genome.wustl.edu	37	3	67426275	67426275	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:67426275C>T	ENST00000307227.5	-	11	1219	c.1192G>A	c.(1192-1194)Gtc>Atc	p.V398I	SUCLG2_ENST00000493112.1_Intron	NM_003848.3	NP_003839.2	Q96I99	SUCB2_HUMAN	succinate-CoA ligase, GDP-forming, beta subunit	398					cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|succinate-CoA ligase complex (GDP-forming) (GO:0045244)	ATP binding (GO:0005524)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|succinate-CoA ligase (GDP-forming) activity (GO:0004776)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	10		Renal(2;0.00294)|Lung NSC(201;0.012)|Hepatocellular(537;0.121)		BRCA - Breast invasive adenocarcinoma(55;3.53e-05)|Epithelial(33;0.000153)	Succinic acid(DB00139)	GCCTCTTGGACGTTGGTTCCT	0.517																																																	0													63.0	62.0	62.0					3																	67426275		1939	4133	6072	SO:0001583	missense	0			AF058954	CCDS43104.1, CCDS54605.1	3p14.3	2004-05-17			ENSG00000172340	ENSG00000172340	6.2.1.4		11450	protein-coding gene	gene with protein product		603922				9765291	Standard	NM_001177599		Approved		uc003dna.4	Q96I99	OTTHUMG00000158740	ENST00000307227.5:c.1192G>A	3.37:g.67426275C>T	ENSP00000307432:p.Val398Ile		C9JVT2|O95195|Q6NUH7|Q86VX8|Q8WUQ1	Missense_Mutation	SNP	pfam_ATP-grasp_succ-CoA_synth-type,pfam_CoA_ligase,superfamily_Succinyl-CoA_synth-like,tigrfam_Succ_CoA_synthase_bsu	p.V398I	ENST00000307227.5	37	c.1192	CCDS43104.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.00|16.00	2.998014|2.998014	0.54147|0.54147	.|.	.|.	ENSG00000172340|ENSG00000172340	ENST00000460567|ENST00000307227;ENST00000541608	.|T	.|0.74737	.|-0.87	5.38|5.38	5.38|5.38	0.77491|0.77491	.|Succinyl-CoA synthetase-like (2);ATP-citrate lyase/succinyl-CoA ligase (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80711|0.80711	0.4675|0.4675	M|M	0.69823|0.69823	2.125|2.125	0.80722|0.80722	D|D	1|1	.|P;B	.|0.46020	.|0.871;0.123	.|P;B	.|0.50082	.|0.63;0.027	T|T	0.82924|0.82924	-0.0216|-0.0216	5|10	.|0.72032	.|D	.|0.01	.|.	16.4035|16.4035	0.83650|0.83650	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|216;398	.|F5H4S7;Q96I99	.|.;SUCB2_HUMAN	H|I	155|398;216	.|ENSP00000307432:V398I	.|ENSP00000307432:V398I	R|V	-|-	2|1	0|0	SUCLG2|SUCLG2	67508965|67508965	1.000000|1.000000	0.71417|0.71417	0.894000|0.894000	0.35097|0.35097	0.201000|0.201000	0.24016|0.24016	6.739000|6.739000	0.74827|0.74827	2.676000|2.676000	0.91093|0.91093	0.563000|0.563000	0.77884|0.77884	CGT|GTC	SUCLG2	-	pfam_CoA_ligase,superfamily_Succinyl-CoA_synth-like,tigrfam_Succ_CoA_synthase_bsu	ENSG00000172340		0.517	SUCLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUCLG2	HGNC	protein_coding	OTTHUMT00000351993.1	-	0.00	93	0	C	NM_003848		67426275	-1	tier1	-	no_errors	ENST00000307227	ensembl	human	known	74_37	missense	33.75	53	27	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152712457	152712457	+	Silent	SNP	A	A	C			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr6:152712457A>C	ENST00000367255.5	-	52	8560	c.7959T>G	c.(7957-7959)acT>acG	p.T2653T	SYNE1_ENST00000448038.1_Silent_p.T2660T|SYNE1_ENST00000341594.5_Silent_p.T2692T|SYNE1_ENST00000265368.4_Silent_p.T2653T|SYNE1_ENST00000423061.1_Silent_p.T2660T	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2653					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGCTCCCAAGAGTGCTCTCTG	0.527										HNSCC(10;0.0054)																																							0													105.0	100.0	101.0					6																	152712457		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.7959T>G	6.37:g.152712457A>C			E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.T2653	ENST00000367255.5	37	c.7959	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.527	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	65	0	A	NM_182961		152712457	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	silent	10.17	53	6	SNP	0.000	C
SYNE2	23224	genome.wustl.edu	37	14	64608788	64608790	+	In_Frame_Del	DEL	TCT	TCT	-	rs368230785	byFrequency	TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	TCT	TCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr14:64608788_64608790delTCT	ENST00000344113.4	+	82	15500_15502	c.15288_15290delTCT	c.(15286-15291)catctt>cat	p.L5098del	SYNE2_ENST00000555002.1_In_Frame_Del_p.L1732del|SYNE2_ENST00000358025.3_In_Frame_Del_p.L5098del|SYNE2_ENST00000394768.2_In_Frame_Del_p.L1483del|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000554584.1_In_Frame_Del_p.L5015del|SYNE2_ENST00000357395.3_In_Frame_Del_p.L1483del	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5098					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAGTTAAACATCTTCTTCAGAAG	0.404														16	0.00319489	0.0113	0.0	5008	,	,		19858	0.0		0.001	False		,,,				2504	0.0																0									,	44,4220		0,44,2088					,	-4.5	0.0			87	1,8253		0,1,4126	no	coding,coding	SYNE2	NM_182914.2,NM_015180.4	,	0,45,6214	A1A1,A1R,RR		0.0121,1.0319,0.3595	,	,		45,12473				SO:0001651	inframe_deletion	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.15288_15290delTCT	14.37:g.64608791_64608793delTCT	ENSP00000341781:p.Leu5098del		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	In_Frame_Del	DEL	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L5098in_frame_del	ENST00000344113.4	37	c.15288_15290	CCDS41963.1	14																																																																																			SYNE2	-	smart_Spectrin/alpha-actinin	ENSG00000054654		0.404	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2		0.00	57	0	TCT	NM_182914		64608790	+1	tier1		no_errors	ENST00000358025	ensembl	human	known	74_37	in_frame_del	8.33	33	3	DEL	0.000:0.995:1.000	-
SYT11	23208	genome.wustl.edu	37	1	155837837	155837837	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:155837837G>A	ENST00000368324.4	+	2	369	c.116G>A	c.(115-117)tGc>tAc	p.C39Y	SYT11_ENST00000539162.1_Intron	NM_152280.4	NP_689493.3	Q9BT88	SYT11_HUMAN	synaptotagmin XI	39					negative regulation of neurotransmitter secretion (GO:0046929)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(1)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			GTCTGGTCATGCTGCCACCAG	0.552																																																	0													115.0	110.0	112.0					1																	155837837		2203	4300	6503	SO:0001583	missense	0			D38522	CCDS1122.1	1q22	2013-01-21			ENSG00000132718	ENSG00000132718		"""Synaptotagmins"""	19239	protein-coding gene	gene with protein product		608741				11543631	Standard	NM_152280		Approved	KIAA0080, MGC10881, MGC17226, DKFZp781D015	uc001fmg.3	Q9BT88	OTTHUMG00000014105	ENST00000368324.4:c.116G>A	1.37:g.155837837G>A	ENSP00000357307:p.Cys39Tyr		Q14998|Q5W0D4|Q68CT5|Q8IXU3|Q96SU2	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin	p.C39Y	ENST00000368324.4	37	c.116	CCDS1122.1	1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.031107	0.75504	.	.	ENSG00000132718	ENST00000368324	T	0.50548	0.74	5.52	5.52	0.82312	.	0.052900	0.85682	D	0.000000	T	0.43299	0.1241	M	0.62723	1.935	0.80722	D	1	P	0.52316	0.952	B	0.43990	0.438	T	0.52011	-0.8632	10	0.72032	D	0.01	.	19.036	0.92978	0.0:0.0:1.0:0.0	.	39	Q9BT88	SYT11_HUMAN	Y	39	ENSP00000357307:C39Y	ENSP00000357307:C39Y	C	+	2	0	SYT11	154104461	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.252000	0.72447	2.603000	0.88011	0.655000	0.94253	TGC	SYT11	-	NULL	ENSG00000132718		0.552	SYT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT11	HGNC	protein_coding	OTTHUMT00000039597.1	-	0.00	42	0	G	NM_152280		155837837	+1	tier1	-	no_errors	ENST00000368324	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	A
TBC1D27	96597	genome.wustl.edu	37	17	16826941	16826944	+	RNA	DEL	GCTG	GCTG	-			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	GCTG	GCTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr17:16826941_16826944delGCTG	ENST00000261651.2	-	0	4122_4125									TBC1 domain family, member 27																		AGGGCATGCTgctggctggctggc	0.632																																																	0																																												0			AK024458		17p11.2	2013-04-03			ENSG00000128438	ENSG00000128438			28104	other	unknown							Standard	XR_424798		Approved				OTTHUMG00000059260		17.37:g.16826949_16826952delGCTG				RNA	DEL	-	NULL	ENST00000261651.2	37	NULL		17																																																																																			TBC1D27	-	-	ENSG00000128438		0.632	TBC1D27-001	KNOWN	basic	processed_transcript	TBC1D27	HGNC	pseudogene	OTTHUMT00000131472.1		0.00	8	0	GCTG	XM_002343481		16826944	-1	tier1		no_errors	ENST00000261651	ensembl	human	known	74_37	rna	25.00	6	2	DEL	0.942:0.941:0.934:0.905	-
TEKT5	146279	genome.wustl.edu	37	16	10788356	10788356	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr16:10788356G>T	ENST00000283025.2	-	1	446	c.375C>A	c.(373-375)gaC>gaA	p.D125E	RP11-109M19.1_ENST00000576710.1_RNA	NM_144674.1	NP_653275.1	Q96M29	TEKT5_HUMAN	tektin 5	125						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)	34						GCTGGTCCTTGTCCTGCAAGA	0.647																																																	0													82.0	88.0	86.0					16																	10788356		2197	4300	6497	SO:0001583	missense	0				CCDS10542.1	16p13.13	2014-01-21			ENSG00000153060	ENSG00000153060			26554	protein-coding gene	gene with protein product							Standard	NM_144674		Approved	FLJ32871, CT149	uc002czz.1	Q96M29	OTTHUMG00000129750	ENST00000283025.2:c.375C>A	16.37:g.10788356G>T	ENSP00000283025:p.Asp125Glu		A1L3Z3	Missense_Mutation	SNP	pfam_Tektin,prints_Tektin	p.D125E	ENST00000283025.2	37	c.375	CCDS10542.1	16	.	.	.	.	.	.	.	.	.	.	.	9.218	1.032529	0.19590	.	.	ENSG00000153060	ENST00000283025	T	0.01725	4.67	5.4	3.43	0.39272	.	0.000000	0.64402	D	0.000004	T	0.01061	0.0035	N	0.16708	0.43	0.47094	D	0.999319	B	0.06786	0.001	B	0.13407	0.009	T	0.44436	-0.9328	10	0.05833	T	0.94	-41.9236	4.843	0.13500	0.2598:0.1574:0.5827:0.0	.	125	Q96M29	TEKT5_HUMAN	E	125	ENSP00000283025:D125E	ENSP00000283025:D125E	D	-	3	2	TEKT5	10695857	0.996000	0.38824	1.000000	0.80357	0.964000	0.63967	0.240000	0.18042	0.737000	0.32582	0.650000	0.86243	GAC	TEKT5	-	pfam_Tektin	ENSG00000153060		0.647	TEKT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT5	HGNC	protein_coding	OTTHUMT00000251963.1	-	0.00	53	0	G	NM_144674		10788356	-1	tier1	-	no_errors	ENST00000283025	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
TENM4	26011	genome.wustl.edu	37	11	78387280	78387280	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:78387280C>T	ENST00000278550.7	-	30	5875	c.5413G>A	c.(5413-5415)Gac>Aac	p.D1805N		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1805					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										AGGCCGTTGTCGATGGGCAGC	0.677																																																	0													22.0	28.0	26.0					11																	78387280		2127	4227	6354	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.5413G>A	11.37:g.78387280C>T	ENSP00000278550:p.Asp1805Asn		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.D1805N	ENST00000278550.7	37	c.5413	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	C	27.9	4.871549	0.91587	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.89875	-2.58;0.82	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.93067	0.7793	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.92365	0.5900	9	.	.	.	.	18.2069	0.89858	0.0:1.0:0.0:0.0	.	1805	Q6N022	TEN4_HUMAN	N	1805;269	ENSP00000278550:D1805N;ENSP00000431711:D269N	.	D	-	1	0	ODZ4	78064928	1.000000	0.71417	0.994000	0.49952	0.852000	0.48524	7.593000	0.82686	2.584000	0.87258	0.650000	0.86243	GAC	TENM4	-	NULL	ENSG00000149256		0.677	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2	-	0.00	158	0	C			78387280	-1	tier1	-	no_errors	ENST00000278550	ensembl	human	known	74_37	missense	46.67	56	49	SNP	1.000	T
TFAP2C	7022	genome.wustl.edu	37	20	55212825	55212825	+	Missense_Mutation	SNP	G	G	A	rs138750457		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr20:55212825G>A	ENST00000201031.2	+	7	1352	c.1109G>A	c.(1108-1110)cGg>cAg	p.R370Q	TFAP2C_ENST00000544508.1_Missense_Mutation_p.R201Q	NM_003222.3	NP_003213.1	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)	370	H-S-H (helix-span-helix), dimerization.				cell-cell signaling (GO:0007267)|cerebral cortex development (GO:0021987)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|forebrain neuron fate commitment (GO:0021877)|germ-line stem cell maintenance (GO:0030718)|hair follicle development (GO:0001942)|keratinocyte development (GO:0003334)|male gonad development (GO:0008584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sebaceous gland development (GO:0048733)|somatic stem cell maintenance (GO:0035019)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			Colorectal(105;0.229)			AGCCAAGACCGGACACCCCAT	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		17838	0.0		0.0	False		,,,				2504	0.001																0								G	GLN/ARG	0,4406		0,0,2203	74.0	71.0	72.0		1109	2.8	0.7	20	dbSNP_134	72	1,8599	1.2+/-3.3	0,1,4299	no	missense	TFAP2C	NM_003222.3	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	370/451	55212825	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS13454.1	20q13.2	2008-07-17	2001-11-28		ENSG00000087510	ENSG00000087510			11744	protein-coding gene	gene with protein product	"""estrogen receptor factor 1"""	601602	"""transcription factor AP-2 gamma (activating enhancer-binding protein 2 gamma)"""			8661133	Standard	NM_003222		Approved	AP2-GAMMA, ERF1, TFAP2G, hAP-2g	uc002xya.3	Q92754	OTTHUMG00000032805	ENST00000201031.2:c.1109G>A	20.37:g.55212825G>A	ENSP00000201031:p.Arg370Gln		B4DWK3|O00685|O00730|Q86V30|Q8IVB6|Q9P1X2	Missense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_C,prints_TF_AP2_gamma	p.R370Q	ENST00000201031.2	37	c.1109	CCDS13454.1	20	.	.	.	.	.	.	.	.	.	.	G	16.45	3.126769	0.56721	0.0	1.16E-4	ENSG00000087510	ENST00000201031;ENST00000544508	D;D	0.97089	-4.24;-4.24	5.76	2.76	0.32466	Transcription factor AP-2, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98419	0.9474	M	0.92122	3.275	0.80722	D	1	D	0.76494	0.999	D	0.65443	0.935	D	0.98572	1.0646	10	0.66056	D	0.02	-34.6636	11.6929	0.51527	0.1931:0.0:0.8069:0.0	.	370	Q92754	AP2C_HUMAN	Q	370;201	ENSP00000201031:R370Q;ENSP00000442274:R201Q	ENSP00000201031:R370Q	R	+	2	0	TFAP2C	54646232	1.000000	0.71417	0.690000	0.30148	0.018000	0.09664	6.525000	0.73795	0.794000	0.33899	-1.056000	0.02311	CGG	TFAP2C	-	pfam_TF_AP2_C	ENSG00000087510		0.517	TFAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2C	HGNC	protein_coding	OTTHUMT00000079823.2	-	0.00	45	0	G	NM_003222		55212825	+1	tier1	rs138750457	no_errors	ENST00000201031	ensembl	human	known	74_37	missense	55.10	22	27	SNP	0.992	A
TFAP2D	83741	genome.wustl.edu	37	6	50696969	50696969	+	Nonsense_Mutation	SNP	T	T	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr6:50696969T>A	ENST00000008391.3	+	5	1055	c.827T>A	c.(826-828)tTa>tAa	p.L276*	TFAP2D_ENST00000492804.1_3'UTR	NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					GGCTTAAACTTACCAGCAGGA	0.418																																																	0													158.0	139.0	146.0					6																	50696969		2203	4300	6503	SO:0001587	stop_gained	0			AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.827T>A	6.37:g.50696969T>A	ENSP00000008391:p.Leu276*			Nonsense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_C	p.L276*	ENST00000008391.3	37	c.827	CCDS4933.1	6	.	.	.	.	.	.	.	.	.	.	T	39	7.736785	0.98462	.	.	ENSG00000008197	ENST00000008391	.	.	.	6.08	4.9	0.64082	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.5664	13.4399	0.61106	0.0:0.0:0.1309:0.8691	.	.	.	.	X	276	.	ENSP00000008391:L276X	L	+	2	0	TFAP2D	50804928	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	8.040000	0.89188	1.087000	0.41251	0.482000	0.46254	TTA	TFAP2D	-	pfam_TF_AP2_C,prints_TF_AP2_C	ENSG00000008197		0.418	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2D	HGNC	protein_coding	OTTHUMT00000040881.1	-	0.00	61	0	T	NM_172238		50696969	+1	tier1	-	no_errors	ENST00000008391	ensembl	human	known	74_37	nonsense	75.76	8	25	SNP	1.000	A
TFR2	7036	genome.wustl.edu	37	7	100238328	100238328	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr7:100238328G>A	ENST00000462107.1	-	4	741	c.454C>T	c.(454-456)Cgc>Tgc	p.R152C	TFR2_ENST00000223051.3_Missense_Mutation_p.R152C|TFR2_ENST00000431692.1_Missense_Mutation_p.R152C			Q9UP52	TFR2_HUMAN	transferrin receptor 2	152					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	TCCTCCAGGCGCCCCTCCCCC	0.632																																																	0													38.0	38.0	38.0					7																	100238328		2203	4300	6503	SO:0001583	missense	0			AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.454C>T	7.37:g.100238328G>A	ENSP00000420525:p.Arg152Cys		A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.R152C	ENST00000462107.1	37	c.454	CCDS34707.1	7	.	.	.	.	.	.	.	.	.	.	g	7.920	0.738287	0.15574	.	.	ENSG00000106327	ENST00000223051;ENST00000431692;ENST00000462107	T;T;T	0.56103	0.75;0.48;0.75	4.47	-4.93	0.03066	.	1.493030	0.03793	N	0.263147	T	0.32194	0.0821	L	0.27053	0.805	0.09310	N	1	D	0.56035	0.974	B	0.37422	0.249	T	0.43766	-0.9371	10	0.66056	D	0.02	0.9589	4.6707	0.12687	0.4844:0.0:0.2401:0.2755	.	152	Q9UP52	TFR2_HUMAN	C	152	ENSP00000223051:R152C;ENSP00000413905:R152C;ENSP00000420525:R152C	ENSP00000223051:R152C	R	-	1	0	TFR2	100076264	0.000000	0.05858	0.000000	0.03702	0.372000	0.29890	-0.339000	0.07832	-1.322000	0.02278	-4.333000	0.00007	CGC	TFR2	-	NULL	ENSG00000106327		0.632	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFR2	HGNC	protein_coding	OTTHUMT00000356392.3		0.00	45	0	G	NM_003227		100238328	-1			no_errors	ENST00000223051	ensembl	human	known	74_37	missense	6.82	41	3	SNP	0.001	A
TGFB2	7042	genome.wustl.edu	37	1	218607750	218607750	+	Silent	SNP	C	C	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:218607750C>A	ENST00000366930.4	+	4	1181	c.714C>A	c.(712-714)atC>atA	p.I238I	TGFB2_ENST00000366929.4_Silent_p.I266I|TGFB2_ENST00000479322.1_3'UTR	NM_003238.3	NP_003229.1	P61812	TGFB2_HUMAN	transforming growth factor, beta 2	238					activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cardioblast differentiation (GO:0010002)|cartilage condensation (GO:0001502)|catagen (GO:0042637)|cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|collagen fibril organization (GO:0030199)|dopamine biosynthetic process (GO:0042416)|embryo development (GO:0009790)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|face morphogenesis (GO:0060325)|generation of neurons (GO:0048699)|glial cell migration (GO:0008347)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hemopoiesis (GO:0030097)|menstrual cycle phase (GO:0022601)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|neuron development (GO:0048666)|neuron fate commitment (GO:0048663)|neutrophil chemotaxis (GO:0030593)|odontogenesis (GO:0042476)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activation-induced cell death of T cells (GO:0070237)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of catagen (GO:0051795)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of gene expression (GO:0010628)|positive regulation of heart contraction (GO:0045823)|positive regulation of immune response (GO:0050778)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of ossification (GO:0045778)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein secretion (GO:0050714)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of transforming growth factor beta2 production (GO:0032909)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|signal transduction by phosphorylation (GO:0023014)|SMAD protein import into nucleus (GO:0007184)|somatic stem cell division (GO:0048103)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	axon (GO:0030424)|endosome (GO:0005768)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|platelet alpha granule lumen (GO:0031093)	beta-amyloid binding (GO:0001540)|cytokine activity (GO:0005125)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor binding (GO:0005160)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|endometrium(1)|large_intestine(11)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(1)	31				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		ATAATTACATCATCCCAAATA	0.388																																																	0													67.0	65.0	66.0					1																	218607750		2202	4300	6502	SO:0001819	synonymous_variant	0			M19154	CCDS1521.1, CCDS44318.1	1q41	2014-01-30			ENSG00000092969	ENSG00000092969		"""Endogenous ligands"""	11768	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-2"""	190220					Standard	NM_003238		Approved		uc001hln.3	P61812	OTTHUMG00000039521	ENST00000366930.4:c.714C>A	1.37:g.218607750C>A			B4DKC5|P08112|Q15579|Q15581|Q4VAV9	Silent	SNP	pirsf_TGF-beta,pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C,prints_TGFb2,prints_TGF-beta	p.I266	ENST00000366930.4	37	c.798	CCDS1521.1	1																																																																																			TGFB2	-	pirsf_TGF-beta,prints_TGFb2	ENSG00000092969		0.388	TGFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFB2	HGNC	protein_coding	OTTHUMT00000095359.2		0.00	77	0	C	NM_003238		218607750	+1			no_errors	ENST00000366929	ensembl	human	known	74_37	silent	5.00	57	3	SNP	1.000	A
TLR2	7097	genome.wustl.edu	37	4	154625406	154625406	+	Silent	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr4:154625406C>T	ENST00000260010.6	+	1	2755	c.1347C>T	c.(1345-1347)caC>caT	p.H449H		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	449					apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	CACGAATACACAGTGTAACAG	0.348																																																	0													91.0	93.0	92.0					4																	154625406		2203	4300	6503	SO:0001819	synonymous_variant	0			U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.1347C>T	4.37:g.154625406C>T			B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Silent	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.H449	ENST00000260010.6	37	c.1347	CCDS3784.1	4																																																																																			TLR2	-	pirsf_Toll-like_receptor	ENSG00000137462		0.348	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR2	HGNC	protein_coding	OTTHUMT00000365205.1	-	0.00	46	0	C			154625406	+1	tier1	-	no_errors	ENST00000260010	ensembl	human	known	74_37	silent	11.54	23	3	SNP	0.000	T
TMEM248	55069	genome.wustl.edu	37	7	66415976	66415976	+	Missense_Mutation	SNP	G	G	T	rs555146247		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr7:66415976G>T	ENST00000341567.4	+	5	889	c.634G>T	c.(634-636)Gcc>Tcc	p.A212S		NM_017994.4	NP_060464.1	Q9NWD8	TM248_HUMAN	transmembrane protein 248	212						integral component of membrane (GO:0016021)											GTACAGCAACGCCACGCTCTG	0.507																																																	0													222.0	191.0	201.0					7																	66415976		2203	4300	6503	SO:0001583	missense	0				CCDS5536.1	7q11.21	2012-05-30	2012-05-30	2012-05-30	ENSG00000106609	ENSG00000106609			25476	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 42"""	C7orf42		12477932	Standard	XM_005250482		Approved	FLJ10099, FLJ13090	uc003tvk.3	Q9NWD8	OTTHUMG00000129553	ENST00000341567.4:c.634G>T	7.37:g.66415976G>T	ENSP00000340668:p.Ala212Ser		Q53H07|Q96FR2	Missense_Mutation	SNP	NULL	p.A212S	ENST00000341567.4	37	c.634	CCDS5536.1	7	.	.	.	.	.	.	.	.	.	.	G	21.4	4.149910	0.78001	.	.	ENSG00000106609	ENST00000341567	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.49712	0.1573	L	0.32530	0.975	0.80722	D	1	B	0.33583	0.418	B	0.30855	0.121	T	0.45071	-0.9286	9	0.41790	T	0.15	0.1593	19.5705	0.95413	0.0:0.0:1.0:0.0	.	212	Q9NWD8	CG042_HUMAN	S	212	.	ENSP00000340668:A212S	A	+	1	0	C7orf42	66053411	1.000000	0.71417	0.980000	0.43619	0.780000	0.44128	9.339000	0.96797	2.941000	0.99782	0.655000	0.94253	GCC	TMEM248	-	NULL	ENSG00000106609		0.507	TMEM248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM248	HGNC	protein_coding	OTTHUMT00000251745.2		0.00	76	0	G	NM_017994		66415976	+1			no_errors	ENST00000341567	ensembl	human	known	74_37	missense	5.45	52	3	SNP	1.000	T
TMEM42	131616	genome.wustl.edu	37	3	44905743	44905743	+	Silent	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:44905743C>T	ENST00000302392.4	+	2	303	c.247C>T	c.(247-249)Ctg>Ttg	p.L83L	MIR564_ENST00000385049.1_RNA	NM_144638.1	NP_653239.1	Q69YG0	TMM42_HUMAN	transmembrane protein 42	83						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00839)|KIRC - Kidney renal clear cell carcinoma(197;0.0461)|Kidney(197;0.0576)		CACCAATTCTCTGATGTGGAC	0.507																																																	0													295.0	254.0	268.0					3																	44905743		2203	4300	6503	SO:0001819	synonymous_variant	0			AL834253	CCDS2722.1	3p21.31	2005-01-19			ENSG00000169964	ENSG00000169964			28444	protein-coding gene	gene with protein product						12477932	Standard	NM_144638		Approved	MGC29956	uc003cnz.3	Q69YG0	OTTHUMG00000133092	ENST00000302392.4:c.247C>T	3.37:g.44905743C>T			Q8WUQ6	Silent	SNP	NULL	p.L83	ENST00000302392.4	37	c.247	CCDS2722.1	3																																																																																			TMEM42	-	NULL	ENSG00000169964		0.507	TMEM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM42	HGNC	protein_coding	OTTHUMT00000256750.2	-	0.00	90	0	C	NM_144638		44905743	+1	tier1	-	no_errors	ENST00000302392	ensembl	human	known	74_37	silent	32.97	61	30	SNP	0.963	T
TP53	7157	genome.wustl.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000420246.2_Missense_Mutation_p.R248Q|TP53_ENST00000413465.2_Missense_Mutation_p.R248Q|TP53_ENST00000445888.2_Missense_Mutation_p.R248Q|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	GRCh37	CM920675	TP53	M	rs11540652	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	17.37:g.7577538C>T	ENSP00000269305:p.Arg248Gln		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R248Q	ENST00000269305.4	37	c.743	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	TP53	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	65	0	C	NM_000546		7577538	-1	tier1	rs11540652	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	80.00	11	44	SNP	1.000	T
TP53INP2	58476	genome.wustl.edu	37	20	33297285	33297285	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr20:33297285C>A	ENST00000374810.3	+	4	759	c.370C>A	c.(370-372)Ccg>Acg	p.P124T	NCOA6_ENST00000593786.1_Intron|TP53INP2_ENST00000374809.2_Missense_Mutation_p.P124T	NM_021202.1	NP_067025.1	Q8IXH6	T53I2_HUMAN	tumor protein p53 inducible nuclear protein 2	124					autophagic vacuole assembly (GO:0000045)|osteoblast differentiation (GO:0001649)|positive regulation of autophagy (GO:0010508)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(1)|urinary_tract(1)	2						GTCCCCTTCCCCGCTCCCGGA	0.701																																																	0													23.0	23.0	23.0					20																	33297285		2193	4290	6483	SO:0001583	missense	0			AL109824	CCDS13240.1	20q11.22	2010-01-05	2004-06-18	2004-06-18	ENSG00000078804	ENSG00000078804			16104	protein-coding gene	gene with protein product	"""diabetes and obesity regulated"""		"""chromosome 20 open reading frame 110"""	C20orf110		12477932	Standard	NM_021202		Approved	FLJ21759, FLJ23500, DKFZp434B2411, DKFZp434O0827, dJ1181N3.1, PINH, DOR	uc002xau.1	Q8IXH6	OTTHUMG00000032310	ENST00000374810.3:c.370C>A	20.37:g.33297285C>A	ENSP00000363943:p.Pro124Thr		A8K8S8|E1P5P6|Q5JX64|Q8IYL5|Q9NU00	Missense_Mutation	SNP	NULL	p.P124T	ENST00000374810.3	37	c.370	CCDS13240.1	20	.	.	.	.	.	.	.	.	.	.	C	14.42	2.530697	0.45073	.	.	ENSG00000078804	ENST00000374810;ENST00000374809;ENST00000451665	.	.	.	4.77	3.76	0.43208	.	0.364940	0.26700	N	0.022944	T	0.25606	0.0623	N	0.22421	0.69	0.27754	N	0.944069	B	0.26258	0.145	B	0.29176	0.099	T	0.13845	-1.0494	9	0.11182	T	0.66	-8.0031	9.4208	0.38550	0.2121:0.7879:0.0:0.0	.	124	Q8IXH6	T53I2_HUMAN	T	124;124;84	.	ENSP00000363942:P124T	P	+	1	0	TP53INP2	32760946	0.993000	0.37304	0.863000	0.33907	0.777000	0.43975	2.251000	0.43187	2.207000	0.71202	0.462000	0.41574	CCG	TP53INP2	-	NULL	ENSG00000078804		0.701	TP53INP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53INP2	HGNC	protein_coding	OTTHUMT00000078807.2		0.00	98	0	C	NM_021202		33297285	+1			no_errors	ENST00000374809	ensembl	human	known	74_37	missense	5.15	92	5	SNP	0.698	A
TRAF3IP2	10758	genome.wustl.edu	37	6	111922218	111922218	+	Intron	SNP	T	T	C			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr6:111922218T>C	ENST00000340026.6	-	2	614				TRAF3IP2_ENST00000359831.4_Intron|TRAF3IP2_ENST00000392556.4_Intron|TRAF3IP2-AS1_ENST00000532353.1_RNA|TRAF3IP2_ENST00000368761.5_Intron|C6orf3_ENST00000531702.1_RNA			O43734	CIKS_HUMAN	TRAF3 interacting protein 2						B cell apoptotic process (GO:0001783)|humoral immune response (GO:0006959)|immunoglobulin secretion (GO:0048305)|intracellular signal transduction (GO:0035556)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)					central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	18		all_cancers(87;7.87e-06)|Acute lymphoblastic leukemia(125;3.61e-09)|all_hematologic(75;2.63e-07)|all_epithelial(87;0.0024)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.033)|all cancers(137;0.0412)|Epithelial(106;0.0732)		gtcacatggctattaagtagc	0.443																																																	0																																										SO:0001627	intron_variant	0			AF136405	CCDS5093.1, CCDS55049.1, CCDS55050.1	6q21	2008-09-05	2002-06-20	2005-04-13	ENSG00000056972	ENSG00000056972			1343	protein-coding gene	gene with protein product		607043	"""chromosome 6 open reading frame 5"", ""chromosome 6 open reading frame 2"""	C6orf4, C6orf5, C6orf6, C6orf2		10962033, 10962024	Standard	NR_028338		Approved	DKFZP586G0522, ACT1, CIKS	uc003pvf.4	O43734	OTTHUMG00000015379	ENST00000340026.6:c.19+180A>G	6.37:g.111922218T>C			B2RAY9|E1P555|Q5R3A3|Q7Z6Q1|Q7Z6Q2|Q7Z6Q3|Q9H5W2|Q9H6Y3|Q9NS14|Q9UG72	RNA	SNP	-	NULL	ENST00000340026.6	37	NULL		6																																																																																			C6orf3	-	-	ENSG00000255389		0.443	TRAF3IP2-001	KNOWN	basic	protein_coding	TRAF3IP2-AS1	Clone_based_vega_gene	protein_coding	OTTHUMT00000041841.2	-	0.00	12	0	T			111922218	+1	tier1	-	no_errors	ENST00000531702	ensembl	human	known	74_37	rna	87.50	1	7	SNP	0.000	C
TRAIP	10293	genome.wustl.edu	37	3	49881278	49881278	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr3:49881278G>A	ENST00000331456.2	-	5	477	c.364C>T	c.(364-366)Cag>Tag	p.Q122*	TRAIP_ENST00000469027.1_Intron|TRAIP_ENST00000473863.1_5'Flank	NM_005879.2	NP_005870.2	Q9BWF2	TRAIP_HUMAN	TRAF interacting protein	122					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|receptor signaling protein activity (GO:0005057)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AAGGCCTGCTGCAGAGATACC	0.532																																																	0													205.0	164.0	178.0					3																	49881278		2203	4300	6503	SO:0001587	stop_gained	0			BC019283	CCDS2806.1	3p21.31	2013-01-09			ENSG00000183763	ENSG00000183763		"""RING-type (C3HC4) zinc fingers"""	30764	protein-coding gene	gene with protein product	"""ring finger protein 206"""	605958				9104814	Standard	NM_005879		Approved	TRIP, RNF206	uc003cxs.1	Q9BWF2	OTTHUMG00000158269	ENST00000331456.2:c.364C>T	3.37:g.49881278G>A	ENSP00000328203:p.Gln122*		B5BU84|B5BUL3|O00467	Nonsense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,superfamily_Prefoldin,smart_Znf_RING,pfscan_Znf_RING	p.Q122*	ENST00000331456.2	37	c.364	CCDS2806.1	3	.	.	.	.	.	.	.	.	.	.	G	22.4	4.278718	0.80692	.	.	ENSG00000183763	ENST00000331456;ENST00000482582;ENST00000482243	.	.	.	5.28	5.28	0.74379	.	0.158259	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-7.9264	16.0575	0.80816	0.0:0.0:1.0:0.0	.	.	.	.	X	122;106;124	.	ENSP00000328203:Q122X	Q	-	1	0	TRAIP	49856282	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	4.401000	0.59716	2.474000	0.83562	0.561000	0.74099	CAG	TRAIP	-	superfamily_Prefoldin	ENSG00000183763		0.532	TRAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAIP	HGNC	protein_coding	OTTHUMT00000350518.1	-	0.00	55	0	G	NM_005879		49881278	-1	tier1	-	no_errors	ENST00000331456	ensembl	human	known	74_37	nonsense	41.30	27	19	SNP	1.000	A
TRIM64C	646754	genome.wustl.edu	37	11	49077928	49077928	+	Silent	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:49077928C>T	ENST00000530230.1	-	5	734	c.735G>A	c.(733-735)gtG>gtA	p.V245V		NM_001206631.1	NP_001193560.1	A6NLI5	TR64C_HUMAN	tripartite motif containing 64C	244						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						ATATATTTCCCACATCCTGCA	0.289																																																	0																																										SO:0001819	synonymous_variant	0				CCDS73287.1	11p11.12	2014-04-02	2011-01-25		ENSG00000214891	ENSG00000214891		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	37148	protein-coding gene	gene with protein product			"""tripartite motif-containing 64C"""				Standard	NM_001206631		Approved		uc021qiy.1	A6NLI5	OTTHUMG00000166752	ENST00000530230.1:c.735G>A	11.37:g.49077928C>T				Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.V245	ENST00000530230.1	37	c.735		11																																																																																			TRIM64C	-	NULL	ENSG00000214891		0.289	TRIM64C-001	KNOWN	basic|appris_principal	protein_coding	TRIM64C	HGNC	protein_coding	OTTHUMT00000391366.1	-	0.00	236	0	C			49077928	-1	tier1	-	no_errors	ENST00000530230	ensembl	human	known	74_37	silent	25.57	163	56	SNP	0.000	T
TTC8	123016	genome.wustl.edu	37	14	89305916	89305916	+	Splice_Site	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr14:89305916C>T	ENST00000345383.5	+	2	319	c.235C>T	c.(235-237)Cgc>Tgc	p.R79C	TTC8_ENST00000346301.4_Splice_Site_p.R79C|TTC8_ENST00000380656.2_Splice_Site_p.R89C|TTC8_ENST00000338104.6_Splice_Site_p.R79C|TTC8_ENST00000536576.1_5'UTR|Y_RNA_ENST00000384612.1_RNA|TTC8_ENST00000358622.5_5'Flank|TTC8_ENST00000354441.6_Intron	NM_198309.2	NP_938051.1	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8	89					axon guidance (GO:0007411)|camera-type eye photoreceptor cell differentiation (GO:0060219)|cilium assembly (GO:0042384)|establishment of anatomical structure orientation (GO:0048560)|fat cell differentiation (GO:0045444)|multicellular organism growth (GO:0035264)|nonmotile primary cilium assembly (GO:0035058)|olfactory bulb development (GO:0021772)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|renal tubule development (GO:0061326)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)	BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						TCAAGTTCCACGTAAGTATTG	0.323																																																	0													114.0	115.0	115.0					14																	89305916		2203	4300	6503	SO:0001630	splice_region_variant	0			AK093891	CCDS9885.1, CCDS9886.1, CCDS32137.1, CCDS73674.1, CCDS73675.1	14q31.3	2013-02-14				ENSG00000165533		"""Tetratricopeptide (TTC) repeat domain containing"""	20087	protein-coding gene	gene with protein product		608132				14520415, 20451172	Standard	NM_144596		Approved	BBS8, RP51	uc001xxi.3	Q8TAM2		ENST00000345383.5:c.235+1C>T	14.37:g.89305916C>T			A6NFG2|B3KWA5|Q67B97|Q86SY0|Q86TV9|Q86U26|Q8NDH9|Q96DG8	Missense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R79C	ENST00000345383.5	37	c.235	CCDS9885.1	14	.	.	.	.	.	.	.	.	.	.	C	18.99	3.738902	0.69304	.	.	ENSG00000165533	ENST00000343648;ENST00000345383;ENST00000346301;ENST00000338104;ENST00000380656;ENST00000556651	D;D;D;D	0.86030	-1.75;-2.06;-1.99;-1.79	6.02	6.02	0.97574	.	0.054606	0.64402	D	0.000001	D	0.94192	0.8136	M	0.89785	3.06	0.80722	D	1	D;D;D;D;D	0.89917	0.997;1.0;0.999;1.0;0.999	D;P;D;D;D	0.75020	0.962;0.859;0.985;0.911;0.948	D	0.94335	0.7565	10	0.87932	D	0	-5.1313	20.547	0.99278	0.0:1.0:0.0:0.0	.	89;79;89;79;89	Q8TAM2;G3V2Z9;Q8TAM2-3;G3V324;Q8TAM2-4	TTC8_HUMAN;.;.;.;.	C	132;79;79;79;89;79	ENSP00000339486:R79C;ENSP00000298324:R79C;ENSP00000337653:R79C;ENSP00000370031:R89C	ENSP00000337653:R79C	R	+	1	0	TTC8	88375669	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.599000	0.67592	2.850000	0.98022	0.650000	0.86243	CGC	TTC8	-	NULL	ENSG00000165533		0.323	TTC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC8	HGNC	protein_coding	OTTHUMT00000410861.1	-	0.00	55	0	C	NM_144596	Missense_Mutation	89305916	+1	tier1	-	no_errors	ENST00000338104	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
UNC13A	23025	genome.wustl.edu	37	19	17758177	17758177	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr19:17758177C>A	ENST00000519716.2	-	17	1940	c.1941G>T	c.(1939-1941)gaG>gaT	p.E647D	UNC13A_ENST00000552293.1_Missense_Mutation_p.E647D|UNC13A_ENST00000551649.1_Missense_Mutation_p.E647D|UNC13A_ENST00000252773.7_Missense_Mutation_p.E647D|UNC13A_ENST00000428389.2_Missense_Mutation_p.E735D|UNC13A_ENST00000550896.1_Missense_Mutation_p.E645D	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	647					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)	p.E647D(1)|p.E735D(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CCGCGAAGATCTCCTGGATGA	0.602																																																	2	Substitution - Missense(2)	lung(2)											68.0	73.0	72.0					19																	17758177		2150	4272	6422	SO:0001583	missense	0			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.1941G>T	19.37:g.17758177C>A	ENSP00000429562:p.Glu647Asp		E5RHY9	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_dom,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.E735D	ENST00000519716.2	37	c.2205	CCDS46013.2	19	.	.	.	.	.	.	.	.	.	.	C	6.617	0.482295	0.12581	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	3.76	3.76	0.43208	.	0.132009	0.49305	U	0.000149	T	0.42966	0.1226	L	0.31664	0.95	0.29039	N	0.88522	B	0.09022	0.002	B	0.08055	0.003	T	0.21348	-1.0248	10	0.12766	T	0.61	-26.0515	7.5586	0.27839	0.0:0.8771:0.0:0.1229	.	647	Q9UPW8	UN13A_HUMAN	D	647;735;647;647;647;645	ENSP00000429562:E647D;ENSP00000400409:E735D;ENSP00000252773:E647D;ENSP00000447236:E647D;ENSP00000447572:E647D;ENSP00000446831:E645D	ENSP00000252773:E647D	E	-	3	2	UNC13A	17619177	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.075000	0.30716	1.812000	0.52913	0.313000	0.20887	GAG	UNC13A	-	NULL	ENSG00000130477		0.602	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2		0.00	30	0	C	XM_038604		17758177	-1			no_errors	ENST00000428389	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	A
USP40	55230	genome.wustl.edu	37	2	234438130	234438130	+	Silent	SNP	T	T	C			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr2:234438130T>C	ENST00000427112.2	-	11	1532	c.1497A>G	c.(1495-1497)ccA>ccG	p.P499P	USP40_ENST00000251722.6_Silent_p.P499P|USP40_ENST00000450966.1_Silent_p.P511P			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	499					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		GTAAATGACATGGAACCCCAT	0.358																																																	0													88.0	81.0	83.0					2																	234438130		1835	4070	5905	SO:0001819	synonymous_variant	0			AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.1497A>G	2.37:g.234438130T>C			Q6NX38|Q70EL0	Silent	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.P511	ENST00000427112.2	37	c.1533	CCDS46547.1	2																																																																																			USP40	-	NULL	ENSG00000085982		0.358	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	USP40	HGNC	protein_coding	OTTHUMT00000397235.1	-	0.00	102	0	T	XM_114294		234438130	-1	tier1	-	no_errors	ENST00000450966	ensembl	human	known	74_37	silent	38.89	44	28	SNP	0.000	C
VGLL2	245806	genome.wustl.edu	37	6	117591852	117591852	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr6:117591852G>A	ENST00000326274.5	+	3	728	c.538G>A	c.(538-540)Gcc>Acc	p.A180T	VGLL2_ENST00000352536.3_Intron	NM_182645.3	NP_872586.1	Q8N8G2	VGLL2_HUMAN	vestigial-like family member 2	180					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			central_nervous_system(1)|kidney(1)|lung(3)	5				GBM - Glioblastoma multiforme(226;0.0254)|all cancers(137;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.0757)		CTACTCGCCCGCCGCGCTGCA	0.771																																																	0													3.0	4.0	3.0					6																	117591852		1635	3321	4956	SO:0001583	missense	0			AY056583	CCDS5114.1, CCDS5115.1	6q22.31	2014-03-03	2014-03-03		ENSG00000170162	ENSG00000170162			20232	protein-coding gene	gene with protein product		609979	"""vestigial like 2 (Drosophila)"""			12376544	Standard	NM_153453		Approved		uc003pxn.3	Q8N8G2	OTTHUMG00000015451	ENST00000326274.5:c.538G>A	6.37:g.117591852G>A	ENSP00000320957:p.Ala180Thr		Q8WWX1	Missense_Mutation	SNP	pfam_Vg_Tdu	p.A180T	ENST00000326274.5	37	c.538	CCDS5115.1	6	.	.	.	.	.	.	.	.	.	.	G	12.02	1.813837	0.32053	.	.	ENSG00000170162	ENST00000326274	T	0.46063	0.88	4.76	3.87	0.44632	.	0.247775	0.39544	N	0.001329	T	0.17066	0.0410	L	0.54323	1.7	0.40758	D	0.982972	B	0.19583	0.037	B	0.09377	0.004	T	0.05818	-1.0862	10	0.16420	T	0.52	-16.8591	9.4368	0.38643	0.0776:0.0:0.7795:0.1429	.	180	Q8N8G2	VGLL2_HUMAN	T	180	ENSP00000320957:A180T	ENSP00000320957:A180T	A	+	1	0	VGLL2	117698545	0.529000	0.26322	0.053000	0.19242	0.081000	0.17604	2.212000	0.42835	0.952000	0.37798	0.549000	0.68633	GCC	VGLL2	-	NULL	ENSG00000170162		0.771	VGLL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VGLL2	HGNC	protein_coding	OTTHUMT00000041975.2	-	0.00	12	0	G	NM_153453		117591852	+1	tier1	-	no_errors	ENST00000326274	ensembl	human	known	74_37	missense	40.00	6	4	SNP	0.989	A
WASH3P	374666	genome.wustl.edu	37	15	102506929	102506930	+	RNA	INS	-	-	TATAG			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr15:102506929_102506930insTATAG	ENST00000557932.1	+	0	172							C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						ACTAATATTCATATAAACCGTG	0.366																																																	0																																												0					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102506929_102506930insTATAG				RNA	INS	-	NULL	ENST00000557932.1	37	NULL		15																																																																																			WASH3P	-	-	ENSG00000185596		0.366	WASH3P-001	KNOWN	basic	processed_transcript	WASH3P	HGNC	pseudogene	OTTHUMT00000417608.1		0.00	8	0	0	NM_199163		102506930	+1			no_errors	ENST00000559884	ensembl	human	known	74_37	rna	37.50	5	3	INS	0.000:0.000	TATAG
WWC2	80014	genome.wustl.edu	37	4	184019123	184019123	+	5'Flank	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr4:184019123C>T	ENST00000403733.3	+	0	0				WWC2_ENST00000378925.3_5'Flank|WWC2_ENST00000513834.1_5'Flank|RP11-335L23.5_ENST00000610012.1_lincRNA|WWC2-AS2_ENST00000578387.1_lincRNA|WWC2_ENST00000448232.2_5'Flank	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2						negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		CGGGGCCTTCCTCGGTGTTGC	0.577																																																	0													33.0	38.0	37.0					4																	184019123		692	1591	2283	SO:0001631	upstream_gene_variant	0			BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685		4.37:g.184019123C>T	Exception_encountered		Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	RNA	SNP	-	NULL	ENST00000403733.3	37	NULL	CCDS34109.2	4																																																																																			WWC2-AS2	-	-	ENSG00000251359		0.577	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC2-AS2	HGNC	protein_coding	OTTHUMT00000319608.1	-	0.00	31	0	C	NM_024949		184019123	-1	tier1	-	no_errors	ENST00000506413	ensembl	human	known	74_37	rna	66.67	6	12	SNP	0.000	T
ZAK	51776	genome.wustl.edu	37	2	174074531	174074531	+	Silent	SNP	T	T	C			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr2:174074531T>C	ENST00000375213.3	+	10	897	c.819T>C	c.(817-819)tgT>tgC	p.C273C	MLTK_ENST00000431503.2_Silent_p.C172C|MLK7-AS1_ENST00000419609.1_RNA|MLTK_ENST00000409176.2_Silent_p.C273C|MLK7-AS1_ENST00000422703.1_RNA|MLTK_ENST00000539448.1_Silent_p.C273C|MLK7-AS1_ENST00000423106.2_RNA|MLTK_ENST00000338983.3_Silent_p.C273C	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN		273	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										CTGACAAGTGTAACTCATTCC	0.468																																																	0													106.0	92.0	97.0					2																	174074531		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000375213.3:c.819T>C	2.37:g.174074531T>C			B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SAM_type1,pfam_SAM_2,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.C273	ENST00000375213.3	37	c.819	CCDS42777.1	2																																																																																			MLTK	-	pfscan_Prot_kinase_dom	ENSG00000091436		0.468	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAK	Uniprot_gn	protein_coding	OTTHUMT00000255401.1		0.00	34	0	T			174074531	+1			no_errors	ENST00000375213	ensembl	human	known	74_37	silent	8.57	32	3	SNP	1.000	C
ZBED1	9189	genome.wustl.edu	37	X	2408326	2408326	+	Silent	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chrX:2408326G>A	ENST00000381223.4	-	2	638	c.435C>T	c.(433-435)gaC>gaT	p.D145D	ZBED1_ENST00000381218.3_Silent_p.D145D|DHRSX_ENST00000334651.5_Intron|ZBED1_ENST00000381222.2_Silent_p.D145D|ZBED1_ENST00000515319.1_5'Flank	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	145					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)			endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				AGGTGGGCTCGTCCACGATGG	0.647																																																	0													77.0	80.0	79.0					X																	2408326		2203	4296	6499	SO:0001819	synonymous_variant	0			AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.435C>T	X.37:g.2408326G>A			Q96BY4	Silent	SNP	pfam_HATC_dom_C,pfam_Znf_BED_prd,superfamily_RNaseH-like_dom,smart_Znf_BED_prd,pfscan_Znf_BED_prd	p.D145	ENST00000381223.4	37	c.435	CCDS14118.1	X																																																																																			ZBED1	-	NULL	ENSG00000214717		0.647	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED1	HGNC	protein_coding	OTTHUMT00000144310.3	-	0.00	79	0	G	NM_004729		2408326	-1	tier1	-	no_errors	ENST00000381218	ensembl	human	known	74_37	silent	64.20	29	52	SNP	0.989	A
ZDHHC5	25921	genome.wustl.edu	37	11	57449967	57449967	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr11:57449967G>A	ENST00000287169.3	+	3	1540	c.178G>A	c.(178-180)Gcc>Acc	p.A60T	ZDHHC5_ENST00000527985.1_Missense_Mutation_p.A7T	NM_015457.2	NP_056272.2	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC-type containing 5	60					protein palmitoylation (GO:0018345)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(3)|lung(5)|skin(1)	18						CTTTGTGTTGGCCAACTTCAG	0.453																																																	0													170.0	140.0	151.0					11																	57449967		2201	4296	6497	SO:0001583	missense	0			AB051535	CCDS7965.1	11q13.1	2008-05-02			ENSG00000156599	ENSG00000156599		"""Zinc fingers, DHHC-type"""	18472	protein-coding gene	gene with protein product		614586				11214970	Standard	NM_015457		Approved	KIAA1748, ZNF375	uc001nkx.1	Q9C0B5	OTTHUMG00000167198	ENST00000287169.3:c.178G>A	11.37:g.57449967G>A	ENSP00000287169:p.Ala60Thr		Q2TGF0|Q6ZMF0|Q8TAK8|Q9H923|Q9UFI7	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase	p.A60T	ENST00000287169.3	37	c.178	CCDS7965.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.179828	0.94846	.	.	ENSG00000156599	ENST00000527985;ENST00000287169	D;D	0.95821	-3.82;-3.82	4.96	4.05	0.47172	.	0.291814	0.37906	N	0.001883	D	0.97145	0.9067	M	0.73430	2.235	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97214	0.9873	10	0.59425	D	0.04	-15.943	12.9971	0.58652	0.079:0.0:0.921:0.0	.	60	Q9C0B5	ZDHC5_HUMAN	T	7;60	ENSP00000432202:A7T;ENSP00000287169:A60T	ENSP00000287169:A60T	A	+	1	0	ZDHHC5	57206543	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.263000	0.95617	1.312000	0.45043	0.561000	0.74099	GCC	ZDHHC5	-	NULL	ENSG00000156599		0.453	ZDHHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC5	HGNC	protein_coding	OTTHUMT00000393694.1		0.00	105	0	G	NM_015457		57449967	+1			no_errors	ENST00000287169	ensembl	human	known	74_37	missense	6.25	45	3	SNP	1.000	A
ZFAND4	93550	genome.wustl.edu	37	10	46111990	46111990	+	Missense_Mutation	SNP	C	C	T	rs371324279		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr10:46111990C>T	ENST00000344646.5	-	10	2293	c.2078G>A	c.(2077-2079)cGt>cAt	p.R693H	ZFAND4_ENST00000374371.2_3'UTR|ZFAND4_ENST00000374370.1_5'UTR|ZFAND4_ENST00000374366.3_Missense_Mutation_p.R619H	NM_001128324.2|NM_174890.2	NP_001121796.1|NP_777550.2	Q86XD8	ZFAN4_HUMAN	zinc finger, AN1-type domain 4	693							zinc ion binding (GO:0008270)										TTCTGCATAACGATGAGATGC	0.418																																																	0								C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	168.0	147.0	154.0		2078,2078	5.9	1.0	10		154	0,8600		0,0,4300	no	missense,missense	ANUBL1	NM_001128324.1,NM_174890.2	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	693/728,693/728	46111990	1,13005	2203	4300	6503	SO:0001583	missense	0			AF311324	CCDS7214.1, CCDS60520.1	10q11.22	2013-01-09	2011-11-10	2011-11-10	ENSG00000172671	ENSG00000172671		"""Zinc fingers, AN1-type domain containing"""	23504	protein-coding gene	gene with protein product			"""AN1, ubiquitin-like, homolog (Xenopus laevis)"""	ANUBL1			Standard	XM_005271837		Approved	FLJ40185	uc001jcp.4	Q86XD8	OTTHUMG00000018085	ENST00000344646.5:c.2078G>A	10.37:g.46111990C>T	ENSP00000339484:p.Arg693His		A8K8V4|B2RAX2|Q5VVY5	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Znf_AN1,smart_Ubiquitin_dom,smart_Znf_AN1,pfscan_Znf_AN1,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	p.R693H	ENST00000344646.5	37	c.2078	CCDS7214.1	10	.	.	.	.	.	.	.	.	.	.	C	28.9	4.963687	0.92791	2.27E-4	0.0	ENSG00000172671	ENST00000344646;ENST00000374366;ENST00000374370	T;T	0.60299	0.2;0.2	5.86	5.86	0.93980	Zinc finger, AN1-type (4);	0.157574	0.41294	D	0.000918	T	0.81269	0.4787	M	0.89785	3.06	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84410	0.0565	10	0.87932	D	0	-8.8451	17.6957	0.88281	0.0:1.0:0.0:0.0	.	693	Q86XD8	ANUB1_HUMAN	H	693;619;575	ENSP00000339484:R693H;ENSP00000363486:R619H	ENSP00000339484:R693H	R	-	2	0	ANUBL1	45431996	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.452000	0.80683	2.776000	0.95493	0.655000	0.94253	CGT	ZFAND4	-	pfam_Znf_AN1,smart_Znf_AN1,pfscan_Znf_AN1	ENSG00000172671		0.418	ZFAND4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAND4	HGNC	protein_coding	OTTHUMT00000047790.1	-	0.00	88	0	C	NM_174890		46111990	-1	tier1	-	no_errors	ENST00000344646	ensembl	human	known	74_37	missense	25.00	39	13	SNP	1.000	T
ZFHX4	79776	genome.wustl.edu	37	8	77620259	77620259	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr8:77620259C>A	ENST00000521891.2	+	3	3517	c.3069C>A	c.(3067-3069)caC>caA	p.H1023Q	ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000518282.1_Missense_Mutation_p.H997Q|ZFHX4_ENST00000050961.6_Missense_Mutation_p.H997Q|ZFHX4_ENST00000455469.2_Missense_Mutation_p.H997Q	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	997					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.H1023H(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATCACAGGCACGAGGCGGCCC	0.468										HNSCC(33;0.089)																																							1	Substitution - coding silent(1)	lung(1)											97.0	97.0	97.0					8																	77620259		1997	4162	6159	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.3069C>A	8.37:g.77620259C>A	ENSP00000430497:p.His1023Gln		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.H1023Q	ENST00000521891.2	37	c.3069	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	C	12.23	1.874586	0.33069	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	5.02	-1.83	0.07833	.	0.000000	0.46442	U	0.000297	T	0.71779	0.3380	M	0.87758	2.905	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.995;0.998;0.998;1.0	T	0.73908	-0.3834	10	0.87932	D	0	.	13.1619	0.59548	0.0:0.2175:0.0:0.7825	.	997;997;1023;997	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	Q	1023;1023;997;997;997	ENSP00000430497:H1023Q;ENSP00000399605:H997Q;ENSP00000050961:H997Q;ENSP00000430848:H997Q	ENSP00000050961:H997Q	H	+	3	2	ZFHX4	77782814	0.005000	0.15991	0.971000	0.41717	0.987000	0.75469	-1.167000	0.03126	-0.633000	0.05545	-0.759000	0.03464	CAC	ZFHX4	-	NULL	ENSG00000091656		0.468	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	-	0.00	39	0	C	NM_024721		77620259	+1	tier1	-	no_errors	ENST00000521891	ensembl	human	known	74_37	missense	66.67	12	24	SNP	0.983	A
ZNF169	169841	genome.wustl.edu	37	9	97062288	97062288	+	Missense_Mutation	SNP	G	G	T	rs536175880		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr9:97062288G>T	ENST00000395395.2	+	5	538	c.448G>T	c.(448-450)Gac>Tac	p.D150Y	ZNF169_ENST00000340911.4_3'UTR	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	150					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D150N(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				AGAAGGCCCCGACAGCTCATT	0.488																																																	1	Substitution - Missense(1)	lung(1)											51.0	49.0	50.0					9																	97062288		2203	4300	6503	SO:0001583	missense	0			U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.448G>T	9.37:g.97062288G>T	ENSP00000378792:p.Asp150Tyr		A2AGP5|A8K127|Q6PI28	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D150Y	ENST00000395395.2	37	c.448	CCDS6709.2	9	.	.	.	.	.	.	.	.	.	.	G	6.615	0.481897	0.12581	.	.	ENSG00000175787	ENST00000395395	T	0.06768	3.26	2.44	-2.4	0.06583	.	.	.	.	.	T	0.02267	0.0070	N	0.08118	0	0.09310	N	1	P	0.39282	0.666	B	0.34779	0.189	T	0.27502	-1.0072	9	0.05833	T	0.94	.	0.7534	0.00994	0.4191:0.1701:0.2386:0.1722	.	150	Q14929	ZN169_HUMAN	Y	150	ENSP00000378792:D150Y	ENSP00000378792:D150Y	D	+	1	0	ZNF169	96102109	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	0.664000	0.25068	-0.635000	0.05531	-0.306000	0.09157	GAC	ZNF169	-	NULL	ENSG00000175787		0.488	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF169	HGNC	protein_coding	OTTHUMT00000253714.1		0.00	48	0	G	NM_194320		97062288	+1			no_errors	ENST00000395395	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.000	T
ZNF208	7757	genome.wustl.edu	37	19	22156812	22156812	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr19:22156812T>G	ENST00000397126.4	-	4	1172	c.1024A>C	c.(1024-1026)Aaa>Caa	p.K342Q	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	342					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TCTTTACATTTGTAGGGCTTC	0.398																																																	0													47.0	48.0	48.0					19																	22156812		2038	4198	6236	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1024A>C	19.37:g.22156812T>G	ENSP00000380315:p.Lys342Gln			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K342Q	ENST00000397126.4	37	c.1024	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	T	11.08	1.534137	0.27475	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.08370	3.1	2.65	-1.64	0.08318	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04318	0.0119	.	.	.	0.09310	N	1	B	0.16396	0.017	B	0.06405	0.002	T	0.42899	-0.9424	8	0.38643	T	0.18	.	0.7357	0.00965	0.1589:0.2678:0.278:0.2954	.	342	O43345	ZN208_HUMAN	Q	342	ENSP00000380315:K342Q	ENSP00000380315:K342Q	K	-	1	0	ZNF208	21948652	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-4.110000	0.00293	0.030000	0.15379	0.254000	0.18369	AAA	ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.398	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	-	0.00	107	0	T	NM_007153		22156812	-1	tier1	-	no_errors	ENST00000397126	ensembl	human	novel	74_37	missense	50.46	53	55	SNP	0.000	G
ZNF23	7571	genome.wustl.edu	37	16	71482560	71482560	+	Silent	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr16:71482560G>A	ENST00000393539.2	-	6	2181	c.1368C>T	c.(1366-1368)gcC>gcT	p.A456A	ZNF23_ENST00000417828.1_Silent_p.A456A|ZNF23_ENST00000539742.1_5'UTR|AC010547.9_ENST00000561908.1_3'UTR|ZNF23_ENST00000497160.1_3'UTR|ZNF23_ENST00000358700.2_3'UTR|ZNF23_ENST00000564528.1_Silent_p.A398A|ZNF23_ENST00000428724.2_Silent_p.A398A|ZNF23_ENST00000357254.4_Silent_p.A456A	NM_145911.1	NP_666016.1	P17027	ZNF23_HUMAN	zinc finger protein 23	456					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(14)|stomach(1)|urinary_tract(1)	29		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		TAACGCTGAAGGCCTTTCCAC	0.443																																																	0													60.0	61.0	61.0					16																	71482560		2198	4300	6498	SO:0001819	synonymous_variant	0			X52347	CCDS10900.1	16q22.2	2013-03-28	2012-07-12		ENSG00000167377	ENSG00000167377		"""Zinc fingers, C2H2-type"""	13023	protein-coding gene	gene with protein product		194527	"""zinc finger protein 359"""	ZNF359			Standard	NM_145911		Approved	KOX16, Zfp612, ZNF612	uc002faf.3	P17027	OTTHUMG00000176797	ENST00000393539.2:c.1368C>T	16.37:g.71482560G>A			Q8NDP5|Q96IT3|Q9UG42	Silent	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A456	ENST00000393539.2	37	c.1368	CCDS10900.1	16																																																																																			ZNF23	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167377		0.443	ZNF23-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF23	HGNC	protein_coding	OTTHUMT00000268985.23	-	0.00	119	0	G	NM_145911		71482560	-1	tier1	-	no_errors	ENST00000357254	ensembl	human	known	74_37	silent	71.43	12	30	SNP	1.000	A
ZNF234	10780	genome.wustl.edu	37	19	44662023	44662023	+	Silent	SNP	C	C	T			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr19:44662023C>T	ENST00000426739.2	+	6	2112	c.1854C>T	c.(1852-1854)caC>caT	p.H618H	ZNF234_ENST00000592437.1_Silent_p.H618H	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	618					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				AGAGTGTCCACACAGGAGAGA	0.463																																																	0													135.0	143.0	140.0					19																	44662023		2197	4298	6495	SO:0001819	synonymous_variant	0			X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.1854C>T	19.37:g.44662023C>T			A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H618	ENST00000426739.2	37	c.1854	CCDS46101.1	19																																																																																			ZNF234	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000263002		0.463	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF234	HGNC	protein_coding	OTTHUMT00000460586.2	-	0.00	94	0	C			44662023	+1	tier1	-	no_errors	ENST00000426739	ensembl	human	known	74_37	silent	39.34	37	24	SNP	1.000	T
ZNF415	55786	genome.wustl.edu	37	19	53625748	53625748	+	5'UTR	SNP	G	G	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr19:53625748G>A	ENST00000500065.4	-	0	257				ZNF415_ENST00000421033.1_Intron|ZNF415_ENST00000594011.1_Intron|ZNF415_ENST00000601215.1_Intron|ZNF415_ENST00000597503.1_Intron|ZNF415_ENST00000440291.1_Intron|ZNF415_ENST00000601493.1_Intron|ZNF415_ENST00000599261.1_5'UTR|ZNF415_ENST00000595193.1_Intron|ZNF415_ENST00000596683.1_Intron|ZNF415_ENST00000243643.4_Intron|ZNF415_ENST00000595813.1_5'UTR|ZNF415_ENST00000448501.1_Intron|ZNF415_ENST00000597748.1_Intron|ZNF415_ENST00000600574.1_Intron|ZNF415_ENST00000455735.2_Intron	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		AGGGTGAGACGGAATCTCAGT	0.557																																																	0													64.0	62.0	62.0					19																	53625748		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.-77C>T	19.37:g.53625748G>A			F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	RNA	SNP	-	NULL	ENST00000500065.4	37	NULL	CCDS54313.1	19																																																																																			ZNF415	-	-	ENSG00000170954		0.557	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF415	HGNC	protein_coding	OTTHUMT00000464043.1	-	0.00	31	0	G	NM_018355		53625748	-1	tier1	-	no_errors	ENST00000594286	ensembl	human	known	74_37	rna	30.56	25	11	SNP	0.001	A
ZNF521	25925	genome.wustl.edu	37	18	22806976	22806976	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr18:22806976C>A	ENST00000361524.3	-	4	1054	c.906G>T	c.(904-906)caG>caT	p.Q302H	ZNF521_ENST00000584787.1_Missense_Mutation_p.Q82H|ZNF521_ENST00000538137.2_Missense_Mutation_p.Q302H|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	302					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CGCTATGCACCTGCTCCATGT	0.552			T	PAX5	ALL																																			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													114.0	108.0	110.0					18																	22806976		2203	4300	6503	SO:0001583	missense	0			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.906G>T	18.37:g.22806976C>A	ENSP00000354794:p.Gln302His		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q302H	ENST00000361524.3	37	c.906	CCDS32806.1	18	.	.	.	.	.	.	.	.	.	.	C	8.134	0.783704	0.16189	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.09350	2.99;3.02	6.02	5.15	0.70609	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.10252	0.0251	L	0.31371	0.925	0.37605	D	0.920701	B	0.18013	0.025	B	0.27715	0.082	T	0.09228	-1.0684	10	0.72032	D	0.01	-32.7903	10.766	0.46295	0.0:0.8011:0.1309:0.0681	.	302	Q96K83	ZN521_HUMAN	H	302;336;302	ENSP00000354794:Q302H;ENSP00000382352:Q302H	ENSP00000354794:Q302H	Q	-	3	2	ZNF521	21060974	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.498000	0.45363	1.570000	0.49709	-0.136000	0.14681	CAG	ZNF521	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198795		0.552	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	-	0.00	67	0	C	NM_015461		22806976	-1	tier1	-	no_errors	ENST00000361524	ensembl	human	known	74_37	missense	59.38	13	19	SNP	1.000	A
ZNF676	163223	genome.wustl.edu	37	19	22364151	22364151	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr19:22364151T>A	ENST00000397121.2	-	3	685	c.368A>T	c.(367-369)cAt>cTt	p.H123L		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	123					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TGAACATTTATGAAAGACGTT	0.333																																																	0													137.0	130.0	132.0					19																	22364151		1988	4196	6184	SO:0001583	missense	0			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.368A>T	19.37:g.22364151T>A	ENSP00000380310:p.His123Leu		A8MVX5	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H123L	ENST00000397121.2	37	c.368	CCDS42539.1	19	.	.	.	.	.	.	.	.	.	.	.	4.008	-0.001202	0.07819	.	.	ENSG00000196109	ENST00000397121	T	0.26518	1.73	0.63	-1.26	0.09376	.	.	.	.	.	T	0.13200	0.0320	L	0.42245	1.32	0.09310	N	1	P	0.37864	0.61	B	0.31751	0.135	T	0.23511	-1.0186	9	0.12103	T	0.63	.	1.9827	0.03429	0.2664:0.2107:0.0:0.5229	.	123	Q8N7Q3	ZN676_HUMAN	L	123	ENSP00000380310:H123L	ENSP00000380310:H123L	H	-	2	0	ZNF676	22155991	0.242000	0.23868	0.001000	0.08648	0.152000	0.21847	0.010000	0.13242	-0.522000	0.06417	0.156000	0.16432	CAT	ZNF676	-	NULL	ENSG00000196109		0.333	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF676	HGNC	protein_coding	OTTHUMT00000464392.1	-	0.00	156	0	T	NM_001001411		22364151	-1	tier1	-	no_errors	ENST00000397121	ensembl	human	known	74_37	missense	8.84	227	22	SNP	0.007	A
ZP4	57829	genome.wustl.edu	37	1	238051808	238051808	+	Silent	SNP	G	G	T	rs199659999		TCGA-JY-A93C-01A-11D-A387-09	TCGA-JY-A93C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e330a3a7-6be8-48b5-bb3c-1e4d1b75a6a6	4966dbe0-8508-4888-8d41-4909e3a71c98	g.chr1:238051808G>T	ENST00000366570.4	-	4	561	c.403C>A	c.(403-405)Cga>Aga	p.R135R	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	135					acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GGAGCATCTCGGGCTAGGTTT	0.453																																					NSCLC(166;160 2029 11600 18754 19936)												0													86.0	85.0	85.0					1																	238051808		2203	4300	6503	SO:0001819	synonymous_variant	0			U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.403C>A	1.37:g.238051808G>T			B2RAE1	Silent	SNP	pfam_ZP_dom,pfam_P_trefoil,superfamily_P_trefoil,smart_P_trefoil,smart_ZP_dom,pfscan_ZP_dom,prints_ZP_dom	p.R135	ENST00000366570.4	37	c.403	CCDS1615.1	1																																																																																			ZP4	-	NULL	ENSG00000116996		0.453	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZP4	HGNC	protein_coding	OTTHUMT00000095476.1	-	0.00	71	0	G			238051808	-1	tier1	-	no_errors	ENST00000366570	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.004	T
