#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
A2M	2	genome.wustl.edu	37	12	9227282	9227282	+	Silent	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:9227282G>T	ENST00000318602.7	-	29	3937	c.3630C>A	c.(3628-3630)tcC>tcA	p.S1210S		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	1210					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	GGAGCACATAGGATGTCATCT	0.567																																																	0													76.0	75.0	75.0					12																	9227282		2203	4300	6503	SO:0001819	synonymous_variant	0			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.3630C>A	12.37:g.9227282G>T			Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Silent	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,superfamily_Beta-lactam/transpept-like,superfamily_Cupredoxin	p.S1210	ENST00000318602.7	37	c.3630	CCDS44827.1	12																																																																																			A2M	-	pfam_A2M_comp,superfamily_Terpenoid_cyclase/PrenylTrfase	ENSG00000175899		0.567	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2M	HGNC	protein_coding	OTTHUMT00000317233.2		0.00	106	0	G	NM_000014		9227282	-1			no_errors	ENST00000318602	ensembl	human	known	74_37	silent	6.35	59	4	SNP	1.000	T
ABCA13	154664	genome.wustl.edu	37	7	48619925	48619925	+	Nonsense_Mutation	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr7:48619925T>G	ENST00000435803.1	+	56	14484	c.14460T>G	c.(14458-14460)taT>taG	p.Y4820*	ABCA13_ENST00000544596.1_Nonsense_Mutation_p.Y550*	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4820	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						AACATCTCTATTATTACTGTA	0.542																																																	0													53.0	54.0	53.0					7																	48619925		1920	4112	6032	SO:0001587	stop_gained	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.14460T>G	7.37:g.48619925T>G	ENSP00000411096:p.Tyr4820*		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.Y4820*	ENST00000435803.1	37	c.14460	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	T	53	21.296898	0.99939	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	.	.	.	5.11	-8.92	0.00774	.	1.173460	0.06319	N	0.704076	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	2.1601	0.03822	0.2435:0.3894:0.1186:0.2485	.	.	.	.	X	4820;593;550	.	ENSP00000391042:Y593X	Y	+	3	2	ABCA13	48590471	0.000000	0.05858	0.000000	0.03702	0.153000	0.21895	-1.158000	0.03153	-2.187000	0.00759	-0.276000	0.10085	TAT	ABCA13	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000179869		0.542	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	-	0.00	43	0	T	NM_152701		48619925	+1	tier1	-	no_errors	ENST00000435803	ensembl	human	known	74_37	nonsense	17.91	55	12	SNP	0.001	G
ABCA2	20	genome.wustl.edu	37	9	139906125	139906125	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:139906125G>A	ENST00000371605.3	-	35	5756	c.5609C>T	c.(5608-5610)aCc>aTc	p.T1870I	ABCA2_ENST00000341511.6_Missense_Mutation_p.T1871I|ABCA2_ENST00000265662.5_Missense_Mutation_p.T1871I			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1870					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		AGGGAAGTTGGTGGGCGACGT	0.657																																																	0													31.0	37.0	35.0					9																	139906125		2026	4132	6158	SO:0001583	missense	0			U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.5609C>T	9.37:g.139906125G>A	ENSP00000360666:p.Thr1870Ile		A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.T1871I	ENST00000371605.3	37	c.5612		9	.	.	.	.	.	.	.	.	.	.	g	15.42	2.829374	0.50845	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.82526	-1.62;-1.62;-1.62	4.03	4.03	0.46877	.	0.124071	0.53938	U	0.000060	D	0.88284	0.6395	L	0.58810	1.83	0.45930	D	0.998763	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.88851	0.3319	10	0.62326	D	0.03	.	12.3845	0.55325	0.0:0.0:0.8309:0.1691	.	1870;1901	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	I	1871;1870;1901;1871	ENSP00000265662:T1871I;ENSP00000360666:T1870I;ENSP00000344155:T1871I	ENSP00000265662:T1871I	T	-	2	0	ABCA2	139025946	1.000000	0.71417	0.998000	0.56505	0.472000	0.32918	3.560000	0.53763	2.073000	0.62155	0.298000	0.19748	ACC	ABCA2	-	NULL	ENSG00000107331		0.657	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	HGNC	protein_coding		-	0.00	116	0	G	NM_001606		139906125	-1	tier1	-	no_errors	ENST00000265662	ensembl	human	known	74_37	missense	36.27	65	37	SNP	1.000	A
ACOT7	11332	genome.wustl.edu	37	1	6378592	6378592	+	Silent	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:6378592C>A	ENST00000377855.2	-	6	848	c.702G>T	c.(700-702)gtG>gtT	p.V234V	ACOT7_ENST00000545482.1_Silent_p.V119V|ACOT7_ENST00000608083.1_Silent_p.V192V|ACOT7_ENST00000377845.3_Silent_p.V204V|ACOT7_ENST00000541130.1_Silent_p.V204V|ACOT7_ENST00000377842.3_Silent_p.V183V|ACOT7_ENST00000361521.4_Silent_p.V224V	NM_181864.2	NP_863654.1	O00154	BACH_HUMAN	acyl-CoA thioesterase 7	234					coenzyme A biosynthetic process (GO:0015937)|fatty acid catabolic process (GO:0009062)|long-chain fatty-acyl-CoA catabolic process (GO:0036116)|medium-chain fatty acid biosynthetic process (GO:0051792)|medium-chain fatty-acyl-CoA catabolic process (GO:0036114)|palmitic acid biosynthetic process (GO:1900535)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)	carboxylic ester hydrolase activity (GO:0052689)|fatty-acyl-CoA binding (GO:0000062)|long-chain fatty acyl-CoA binding (GO:0036042)|palmitoyl-CoA hydrolase activity (GO:0016290)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	16	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)		CTGAAGGCCCCACCAGGTGGA	0.552																																					GBM(74;673 1226 4974 11850 13190)												0													76.0	68.0	71.0					1																	6378592		2203	4300	6503	SO:0001819	synonymous_variant	0			AB074417	CCDS65.1, CCDS66.1, CCDS67.1, CCDS30573.1	1p36	2008-08-14			ENSG00000097021	ENSG00000097021		"""Acyl CoA thioesterases"""	24157	protein-coding gene	gene with protein product	"""brain acyl CoA hydrolase"""	602587				10578051, 16103133, 16940157	Standard	XM_005263427		Approved	BACH, ACH1, ACT, CTE-II, LACH1, MGC1126, hBACH	uc001amt.3	O00154	OTTHUMG00000001295	ENST00000377855.2:c.702G>T	1.37:g.6378592C>A			A8K0K7|A8K232|A8K6B8|A8K837|B3KQ12|O43703|Q53Y78|Q5JYL2|Q5JYL3|Q5JYL4|Q5JYL5|Q5JYL6|Q5TGR4|Q9UJM9|Q9Y539|Q9Y540	Silent	SNP	pfam_Thioestr_supf	p.V234	ENST00000377855.2	37	c.702	CCDS65.1	1																																																																																			ACOT7	-	NULL	ENSG00000097021		0.552	ACOT7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACOT7	HGNC	protein_coding	OTTHUMT00000003773.1	-	0.00	106	0	C	NM_007274		6378592	-1	tier1	-	no_errors	ENST00000377855	ensembl	human	known	74_37	silent	6.25	60	4	SNP	1.000	A
ACTL9	284382	genome.wustl.edu	37	19	8807932	8807932	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:8807932G>T	ENST00000324436.3	-	1	1240	c.1120C>A	c.(1120-1122)Ccc>Acc	p.P374T		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	374						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.P374S(1)		NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						TTCCTGGTGGGCTGGGCAGCC	0.682																																																	1	Substitution - Missense(1)	kidney(1)											27.0	31.0	29.0					19																	8807932		2203	4300	6503	SO:0001583	missense	0				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.1120C>A	19.37:g.8807932G>T	ENSP00000316674:p.Pro374Thr		A8K893|Q6X960	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.P374T	ENST00000324436.3	37	c.1120	CCDS12207.1	19	.	.	.	.	.	.	.	.	.	.	g	15.48	2.845800	0.51164	.	.	ENSG00000181786	ENST00000324436	T	0.09445	2.98	4.51	2.24	0.28232	.	0.557431	0.14814	N	0.296900	T	0.16300	0.0392	M	0.76938	2.355	0.34591	D	0.71552	B	0.20550	0.046	B	0.25614	0.062	T	0.07986	-1.0744	10	0.87932	D	0	.	9.9001	0.41342	0.0:0.1518:0.6908:0.1574	.	374	Q8TC94	ACTL9_HUMAN	T	374	ENSP00000316674:P374T	ENSP00000316674:P374T	P	-	1	0	ACTL9	8668932	1.000000	0.71417	0.205000	0.23548	0.577000	0.36160	3.929000	0.56514	0.569000	0.29329	0.457000	0.33378	CCC	ACTL9	-	pfam_Actin-related,smart_Actin-related	ENSG00000181786		0.682	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL9	HGNC	protein_coding	OTTHUMT00000459953.1		0.00	46	0	G	NM_178525		8807932	-1			no_errors	ENST00000324436	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.998	T
AGPAT9	84803	genome.wustl.edu	37	4	84519790	84519790	+	Intron	SNP	A	A	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr4:84519790A>T	ENST00000395226.2	+	12	1343				AGPAT9_ENST00000509044.1_3'UTR|AGPAT9_ENST00000264409.4_Intron	NM_001256421.1	NP_001243350.1	Q53EU6	GPAT3_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 9						CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|regulation of TOR signaling (GO:0032006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(3)	13		Hepatocellular(203;0.114)				TTTTTTTTTTAAACCAGGAAG	0.328																																																	0													64.0	69.0	67.0					4																	84519790		2203	4300	6503	SO:0001627	intron_variant	0			AK055749	CCDS3606.1	4q21.23	2014-02-13	2008-01-29		ENSG00000138678	ENSG00000138678	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	28157	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, theta"""	610958	"""1-acylglycerol-3-phosphate O-acyltransferase 9 (lysophosphatidic acid acyltransferase, theta)"""			12975309	Standard	NM_001256421		Approved	MGC11324, LPAAT-theta, MAG1, HMFN0839	uc003how.4	Q53EU6	OTTHUMG00000130431	ENST00000395226.2:c.1126-7A>T	4.37:g.84519790A>T			Q68CJ4|Q6GPI6|Q96NA3	RNA	SNP	-	NULL	ENST00000395226.2	37	NULL	CCDS3606.1	4																																																																																			AGPAT9	-	-	ENSG00000138678		0.328	AGPAT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPAT9	HGNC	protein_coding	OTTHUMT00000252821.3	-	0.00	135	0	A	NM_032717		84519790	+1	tier1	-	no_errors	ENST00000509044	ensembl	human	putative	74_37	rna	5.78	163	10	SNP	0.000	T
AHDC1	27245	genome.wustl.edu	37	1	27874814	27874814	+	Silent	SNP	C	C	T	rs376593773		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:27874814C>T	ENST00000247087.5	-	5	4409	c.3813G>A	c.(3811-3813)ccG>ccA	p.P1271P	AHDC1_ENST00000374011.2_Silent_p.P1271P			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1271							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GTCCACCTCGCGGCTGCCGGG	0.677																																																	0								C		1,4403		0,1,2201	40.0	51.0	48.0		3813	-9.8	0.8	1		48	1,8591		0,1,4295	no	coding-synonymous	AHDC1	NM_001029882.2		0,2,6496	TT,TC,CC		0.0116,0.0227,0.0154		1271/1604	27874814	2,12994	2202	4296	6498	SO:0001819	synonymous_variant	0			AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.3813G>A	1.37:g.27874814C>T			Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Silent	SNP	NULL	p.P1271	ENST00000247087.5	37	c.3813	CCDS30652.1	1																																																																																			AHDC1	-	NULL	ENSG00000126705		0.677	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHDC1	HGNC	protein_coding	OTTHUMT00000009523.3		0.00	33	0	C			27874814	-1			no_errors	ENST00000247087	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.168	T
ALG13	79868	genome.wustl.edu	37	X	110952267	110952267	+	Silent	SNP	T	T	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chrX:110952267T>A	ENST00000394780.3	+	5	837	c.825T>A	c.(823-825)acT>acA	p.T275T	ALG13_ENST00000251943.4_Silent_p.T171T|ALG13-AS1_ENST00000430794.1_RNA	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	Q9NP73	ALG13_HUMAN	ALG13, UDP-N-acetylglucosaminyltransferase subunit	275	Deubiquitinase activity.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipid glycosylation (GO:0030259)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	carbohydrate binding (GO:0030246)|cysteine-type peptidase activity (GO:0008234)|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity (GO:0004577)|poly(A) RNA binding (GO:0044822)			endometrium(2)|lung(10)|skin(1)	13						ATCAACAAACTTTTGAGTCTG	0.393																																																	0													90.0	74.0	79.0					X																	110952267		1568	3578	5146	SO:0001819	synonymous_variant	0			AF220051	CCDS14559.1, CCDS55477.1, CCDS59173.1, CCDS76011.1, CCDS76012.1, CCDS76013.1	Xq23	2014-02-24	2013-02-21	2006-11-07	ENSG00000101901	ENSG00000101901	2.4.1.141	"""Tudor domain containing"", ""OTU domain containing"""	30881	protein-coding gene	gene with protein product	"""tudor domain containing 13"", ""N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"""	300776	"""glycosyltransferase 28 domain containing 1"", ""chromosome X open reading frame 45"", ""asparagine-linked glycosylation 13 homolog (S. cerevisiae)"""	GLT28D1, CXorf45		12477932	Standard	NM_018466		Approved	MDS031, YGL047W, FLJ23018, TDRD13	uc011msy.2	Q9NP73	OTTHUMG00000022209	ENST00000394780.3:c.825T>A	X.37:g.110952267T>A			B1AKD6|B1AKM1|B2R5L5|B7Z6J0|B7Z804|B7Z847|B7Z9A8|B7ZAJ1|B7ZB57|Q17RC3|Q5JXY9|Q9H5U8	Silent	SNP	pfam_OTU,pfscan_OTU,pfscan_Tudor	p.T171	ENST00000394780.3	37	c.513	CCDS55477.1	X																																																																																			ALG13	-	pfam_OTU,pfscan_OTU	ENSG00000101901		0.393	ALG13-011	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ALG13	HGNC	protein_coding	OTTHUMT00000272895.1	-	0.00	48	0	T	NM_018466		110952267	+1	tier1	-	no_errors	ENST00000251943	ensembl	human	known	74_37	silent	10.87	41	5	SNP	0.288	A
ALPI	248	genome.wustl.edu	37	2	233323430	233323430	+	Silent	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:233323430G>T	ENST00000295463.3	+	10	1349	c.1272G>T	c.(1270-1272)gtG>gtT	p.V424V		NM_001631.3	NP_001622.2	P09923	PPBI_HUMAN	alkaline phosphatase, intestinal	424					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(2)|upper_aerodigestive_tract(1)	24		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)		ACTCAGGCGTGCGACCAGACG	0.642																																																	0													73.0	65.0	68.0					2																	233323430		2203	4300	6503	SO:0001819	synonymous_variant	0			M15694	CCDS2492.1	2q37.1	2008-02-05			ENSG00000163295	ENSG00000163295	3.1.3.1		437	protein-coding gene	gene with protein product		171740				3468508, 3469665	Standard	NM_001631		Approved		uc002vst.4	P09923	OTTHUMG00000133258	ENST00000295463.3:c.1272G>T	2.37:g.233323430G>T			B2R7Y4|Q53S80|Q9UBV5|Q9UCL2	Silent	SNP	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase	p.V424	ENST00000295463.3	37	c.1272	CCDS2492.1	2																																																																																			ALPI	-	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase	ENSG00000163295		0.642	ALPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPI	HGNC	protein_coding	OTTHUMT00000257035.2		0.00	74	0	G	NM_001631		233323430	+1			no_errors	ENST00000295463	ensembl	human	known	74_37	silent	6.56	57	4	SNP	0.000	T
ANGEL1	23357	genome.wustl.edu	37	14	77256975	77256975	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr14:77256975A>G	ENST00000251089.2	-	9	1943	c.1831T>C	c.(1831-1833)Tgt>Cgt	p.C611R	ANGEL1_ENST00000557179.1_Missense_Mutation_p.C176R	NM_015305.3	NP_056120.2	Q9UNK9	ANGE1_HUMAN	angel homolog 1 (Drosophila)	611										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	22			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)		CCATTCTCACAGGACTCAGCT	0.527																																																	0													128.0	109.0	115.0					14																	77256975		2203	4300	6503	SO:0001583	missense	0			AF111169	CCDS9852.1	14q24.3	2014-06-17		2005-08-04	ENSG00000013523	ENSG00000013523			19961	protein-coding gene	gene with protein product				KIAA0759		11943475	Standard	NM_015305		Approved	Ccr4e	uc001xsv.3	Q9UNK9	OTTHUMG00000171494	ENST00000251089.2:c.1831T>C	14.37:g.77256975A>G	ENSP00000251089:p.Cys611Arg		B4DWL7|O94859|Q8NCS9	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.C611R	ENST00000251089.2	37	c.1831	CCDS9852.1	14	.	.	.	.	.	.	.	.	.	.	A	1.884	-0.457099	0.04540	.	.	ENSG00000013523	ENST00000251089;ENST00000557179	T;T	0.79749	1.63;-1.3	5.76	5.76	0.90799	Endonuclease/exonuclease/phosphatase (2);	1.292320	0.04541	N	0.388193	T	0.61714	0.2369	N	0.03608	-0.345	0.25093	N	0.990847	B	0.02656	0.0	B	0.06405	0.002	T	0.54282	-0.8317	10	0.10377	T	0.69	-0.1375	8.2724	0.31853	0.7348:0.1352:0.0:0.1299	.	611	Q9UNK9	ANGE1_HUMAN	R	611;176	ENSP00000251089:C611R;ENSP00000451534:C176R	ENSP00000251089:C611R	C	-	1	0	ANGEL1	76326728	0.137000	0.22531	0.827000	0.32855	0.305000	0.27757	1.550000	0.36223	2.223000	0.72356	0.454000	0.30748	TGT	ANGEL1	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	ENSG00000013523		0.527	ANGEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL1	HGNC	protein_coding	OTTHUMT00000413712.2		0.00	40	0	A	NM_015305		77256975	-1			no_errors	ENST00000251089	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.354	G
ANKRD26P1	124149	genome.wustl.edu	37	16	46513115	46513115	+	RNA	SNP	T	T	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr16:46513115T>C	ENST00000571006.1	-	0	1556							Q6NSI1	AR26L_HUMAN	ankyrin repeat domain 26 pseudogene 1																		ACCTCCTGTTTATAGTGTTCC	0.363																																																	0																																												0			BC070117		16q11.2	2014-03-18	2009-06-12		ENSG00000261239	ENSG00000261239			32955	pseudogene	pseudogene							Standard	NR_026556		Approved	FLJ43980	uc002eeb.3	Q6NSI1	OTTHUMG00000175593		16.37:g.46513115T>C				RNA	SNP	-	NULL	ENST00000571006.1	37	NULL		16																																																																																			ANKRD26P1	-	-	ENSG00000261239		0.363	ANKRD26P1-007	KNOWN	basic	processed_transcript	ANKRD26P1	HGNC	pseudogene	OTTHUMT00000437932.1	-	0.00	60	0	T	NR_026556		46513115	-1	tier1	-	no_errors	ENST00000566201	ensembl	human	known	74_37	rna	8.20	56	5	SNP	0.017	C
ANKS1B	56899	genome.wustl.edu	37	12	100219102	100219102	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:100219102G>T	ENST00000547776.2	-	2	199	c.200C>A	c.(199-201)gCc>gAc	p.A67D	ANKS1B_ENST00000329257.7_Missense_Mutation_p.A67D|ANKS1B_ENST00000547010.1_Intron	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	67						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		TCCATTTAAGGCTGCGTGGTG	0.433																																																	0													75.0	71.0	72.0					12																	100219102		1977	4171	6148	SO:0001583	missense	0			AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.200C>A	12.37:g.100219102G>T	ENSP00000449629:p.Ala67Asp		A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_PTB/PI_dom,pfam_SAM_2,pfam_PTB,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,smart_PTB/PI_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PTB/PI_dom,pfscan_SAM,prints_Ankyrin_rpt	p.A67D	ENST00000547776.2	37	c.200	CCDS55872.1	12	.	.	.	.	.	.	.	.	.	.	G	26.8	4.771005	0.90108	.	.	ENSG00000185046	ENST00000547776;ENST00000329257;ENST00000549866	T;T;T	0.69806	-0.43;-0.43;-0.43	5.5	5.5	0.81552	Ankyrin repeat-containing domain (4);	0.075720	0.53938	D	0.000045	D	0.88455	0.6441	H	0.97315	3.98	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.80764	0.948;0.994	D	0.92305	0.5853	9	.	.	.	-6.9524	17.1826	0.86858	0.0:0.0:1.0:0.0	.	67;67	F8VVQ4;Q7Z6G8	.;ANS1B_HUMAN	D	67	ENSP00000449629:A67D;ENSP00000331381:A67D;ENSP00000449894:A67D	.	A	-	2	0	ANKS1B	98743233	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.123000	0.89586	2.588000	0.87417	0.655000	0.94253	GCC	ANKS1B	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	ENSG00000185046		0.433	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ANKS1B	HGNC	protein_coding	OTTHUMT00000408421.3	-	0.00	65	0	G	NM_020140		100219102	-1	tier1	-	no_errors	ENST00000329257	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
ANO8	57719	genome.wustl.edu	37	19	17435735	17435735	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:17435735C>T	ENST00000159087.4	-	17	3280	c.3122G>A	c.(3121-3123)cGc>cAc	p.R1041H		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	1041					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						TGAGTGGCTGCGCTCAGAGTC	0.692																																																	0													63.0	77.0	72.0					19																	17435735		2203	4300	6503	SO:0001583	missense	0			AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.3122G>A	19.37:g.17435735C>T	ENSP00000159087:p.Arg1041His		A6NIJ0	Missense_Mutation	SNP	pfam_Anoctamin	p.R1041H	ENST00000159087.4	37	c.3122	CCDS32949.1	19	.	.	.	.	.	.	.	.	.	.	C	16.30	3.083453	0.55861	.	.	ENSG00000074855	ENST00000159087	T	0.69685	-0.42	3.63	3.63	0.41609	.	0.000000	0.85682	U	0.000000	T	0.75598	0.3871	L	0.52573	1.65	0.36598	D	0.874485	D	0.89917	1.0	D	0.78314	0.991	T	0.81413	-0.0944	10	0.62326	D	0.03	.	12.7871	0.57512	0.0:1.0:0.0:0.0	.	1041	Q9HCE9	ANO8_HUMAN	H	1041	ENSP00000159087:R1041H	ENSP00000159087:R1041H	R	-	2	0	ANO8	17296735	1.000000	0.71417	1.000000	0.80357	0.706000	0.40770	2.667000	0.46808	1.572000	0.49736	0.297000	0.19635	CGC	ANO8	-	NULL	ENSG00000074855		0.692	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO8	HGNC	protein_coding	OTTHUMT00000462943.1	-	0.00	90	0	C	XM_050644		17435735	-1	tier1	-	no_errors	ENST00000159087	ensembl	human	known	74_37	missense	14.47	65	11	SNP	1.000	T
AP1G1	164	genome.wustl.edu	37	16	71784219	71784219	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr16:71784219C>T	ENST00000299980.4	-	14	1742	c.1301G>A	c.(1300-1302)cGt>cAt	p.R434H	AP1G1_ENST00000423132.2_Missense_Mutation_p.R437H|AP1G1_ENST00000564155.1_5'Flank|AP1G1_ENST00000433195.2_Missense_Mutation_p.R457H|AP1G1_ENST00000569748.1_Missense_Mutation_p.R434H|AP1G1_ENST00000393512.3_Missense_Mutation_p.R437H	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	434					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				TGCATCATCACGAACATAACT	0.373																																																	0													118.0	115.0	116.0					16																	71784219		2198	4300	6498	SO:0001583	missense	0			Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.1301G>A	16.37:g.71784219C>T	ENSP00000299980:p.Arg434His		O75709|O75842|Q9UG09|Q9Y3U4	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP1_complex_gsu,pfscan_Clathrin_g-adaptin_app	p.R457H	ENST00000299980.4	37	c.1370	CCDS32480.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.600149	0.96614	.	.	ENSG00000166747	ENST00000299980;ENST00000393512;ENST00000423132;ENST00000433195;ENST00000425422	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	5.18	5.18	0.71444	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.49575	0.1565	M	0.89095	3.005	0.80722	D	1	D;D;D	0.89917	0.998;0.999;1.0	D;D;D	0.68765	0.919;0.919;0.96	T	0.58736	-0.7584	10	0.59425	D	0.04	-8.216	18.6902	0.91580	0.0:1.0:0.0:0.0	.	434;457;437	O43747;B3KXW5;O43747-2	AP1G1_HUMAN;.;.	H	434;437;437;457;519	ENSP00000299980:R434H;ENSP00000377148:R437H;ENSP00000409153:R437H;ENSP00000403259:R457H	ENSP00000299980:R434H	R	-	2	0	AP1G1	70341720	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.451000	0.80668	2.414000	0.81942	0.462000	0.41574	CGT	AP1G1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP1_complex_gsu	ENSG00000166747		0.373	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1G1	HGNC	protein_coding	OTTHUMT00000434147.1	-	0.00	59	0	C			71784219	-1	tier1	-	no_errors	ENST00000433195	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
AP3D1	8943	genome.wustl.edu	37	19	2118609	2118609	+	Silent	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:2118609C>T	ENST00000345016.5	-	15	1935	c.1704G>A	c.(1702-1704)gtG>gtA	p.V568V	AP3D1_ENST00000356926.4_Silent_p.V477V|AP3D1_ENST00000350812.6_Silent_p.V399V|AP3D1_ENST00000590683.1_5'Flank|AP3D1_ENST00000355272.6_Silent_p.V568V	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	568					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCGCTCCTGCACCTCCAGGT	0.672																																																	0													24.0	28.0	26.0					19																	2118609		2116	4219	6335	SO:0001819	synonymous_variant	0			U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.1704G>A	19.37:g.2118609C>T			O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Silent	SNP	pfam_BLV_receptor,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu	p.V568	ENST00000345016.5	37	c.1704	CCDS42459.1	19																																																																																			AP3D1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu	ENSG00000065000		0.672	AP3D1-002	KNOWN	basic|CCDS	protein_coding	AP3D1	HGNC	protein_coding	OTTHUMT00000450912.1	-	0.00	92	0	C			2118609	-1	tier1	-	no_errors	ENST00000355272	ensembl	human	known	74_37	silent	6.17	76	5	SNP	1.000	T
APOB	338	genome.wustl.edu	37	2	21242612	21242612	+	Silent	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:21242612C>T	ENST00000233242.1	-	19	3109	c.2982G>A	c.(2980-2982)ccG>ccA	p.P994P		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	994					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.P994P(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCCGGTCAGCGGATAGTAGG	0.537																																																	1	Substitution - coding silent(1)	large_intestine(1)											85.0	75.0	79.0					2																	21242612		2203	4300	6503	SO:0001819	synonymous_variant	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.2982G>A	2.37:g.21242612C>T			O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.P994	ENST00000233242.1	37	c.2982	CCDS1703.1	2																																																																																			APOB	-	pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell	ENSG00000084674		0.537	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1		0.00	98	0	C			21242612	-1			no_errors	ENST00000233242	ensembl	human	known	74_37	silent	6.12	92	6	SNP	0.510	T
ARFIP2	23647	genome.wustl.edu	37	11	6500011	6500011	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:6500011C>T	ENST00000254584.2	-	5	577	c.494G>A	c.(493-495)gGt>gAt	p.G165D	TIMM10B_ENST00000530751.1_5'Flank|TIMM10B_ENST00000472836.1_5'Flank|ARFIP2_ENST00000445086.2_Missense_Mutation_p.G80D|ARFIP2_ENST00000423813.2_Missense_Mutation_p.G127D|TIMM10B_ENST00000254616.6_5'Flank|ARFIP2_ENST00000396777.3_Missense_Mutation_p.G165D|ARFIP2_ENST00000525235.1_Missense_Mutation_p.G165D	NM_012402.3	NP_036534.1	P53365	ARFP2_HUMAN	ADP-ribosylation factor interacting protein 2	165	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				actin cytoskeleton organization (GO:0030036)|cellular component movement (GO:0006928)|lamellipodium assembly (GO:0030032)|ruffle organization (GO:0031529)|small GTPase mediated signal transduction (GO:0007264)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|Rac GTPase binding (GO:0048365)	p.G165V(1)		endometrium(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(2)	15		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;3.41e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AAAGGCATCACCCAGTGCATG	0.622																																					Melanoma(119;796 1674 9049 20480 24794)												1	Substitution - Missense(1)	lung(1)											49.0	40.0	43.0					11																	6500011		2201	4296	6497	SO:0001583	missense	0			BC000392	CCDS7765.1, CCDS55739.1, CCDS55740.1, CCDS73250.1	11p15	2008-08-01	2008-08-01		ENSG00000132254	ENSG00000132254			17160	protein-coding gene	gene with protein product	"""arfaptin 2"""	601638				8670882, 9038142	Standard	NM_012402		Approved	POR1	uc010ran.2	P53365	OTTHUMG00000133406	ENST00000254584.2:c.494G>A	11.37:g.6500011C>T	ENSP00000254584:p.Gly165Asp		B4DX86|B4E306|D3DQT5	Missense_Mutation	SNP	pfam_AH_dom,pfscan_AH_dom	p.G165D	ENST00000254584.2	37	c.494	CCDS7765.1	11	.	.	.	.	.	.	.	.	.	.	C	19.29	3.800007	0.70567	.	.	ENSG00000132254	ENST00000254584;ENST00000396777;ENST00000445086;ENST00000423813;ENST00000525235	D;D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14;-2.14	5.67	5.67	0.87782	Arfaptin-like (3);	0.000000	0.85682	D	0.000000	D	0.93507	0.7928	M	0.79693	2.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.93979	0.7256	10	0.87932	D	0	.	15.7317	0.77810	0.0:0.8632:0.1368:0.0	.	80;165	B4E306;P53365	.;ARFP2_HUMAN	D	165;165;80;127;165	ENSP00000254584:G165D;ENSP00000379998:G165D;ENSP00000391427:G80D;ENSP00000398375:G127D;ENSP00000434124:G165D	ENSP00000254584:G165D	G	-	2	0	ARFIP2	6456587	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	5.994000	0.70623	2.677000	0.91161	0.561000	0.74099	GGT	ARFIP2	-	pfam_AH_dom,pfscan_AH_dom	ENSG00000132254		0.622	ARFIP2-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARFIP2	HGNC	protein_coding	OTTHUMT00000387044.1		0.00	28	0	C	NM_012402		6500011	-1			no_errors	ENST00000254584	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
ASPG	374569	genome.wustl.edu	37	14	104561907	104561907	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr14:104561907G>T	ENST00000551177.1	+	4	435	c.343G>T	c.(343-345)Ggc>Tgc	p.G115C	ASPG_ENST00000455920.2_Missense_Mutation_p.G115C|ASPG_ENST00000546892.2_Missense_Mutation_p.G115C	NM_001080464.2	NP_001073933.2	Q86U10	LPP60_HUMAN	asparaginase	115	Asparaginase.|Asparaginase/glutaminase. {ECO:0000255|PROSITE-ProRule:PRU01068}.				asparagine metabolic process (GO:0006528)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)		1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|asparaginase activity (GO:0004067)|lysophospholipase activity (GO:0004622)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	11						GGTCATCCACGGCACCGACAC	0.627																																																	0													75.0	81.0	79.0					14																	104561907		2166	4256	6422	SO:0001583	missense	0				CCDS45170.1, CCDS45170.2	14q32.33	2014-03-14	2014-03-14	2008-11-06	ENSG00000166183	ENSG00000166183	3.1.1.5, 3.5.1.1	"""Ankyrin repeat domain containing"""	20123	protein-coding gene	gene with protein product	"""60-kDa-lysophospholipase"""		"""chromosome 14 open reading frame 76"", ""asparaginase homolog (S. cerevisiae)"""	C14orf76			Standard	NM_001080464		Approved		uc001yoq.2	Q86U10		ENST00000551177.1:c.343G>T	14.37:g.104561907G>T	ENSP00000450040:p.Gly115Cys		B9EGQ2|Q8IV80	Missense_Mutation	SNP	pfam_Asparaginase/glutaminase,pfam_Ankyrin_rpt,superfamily_Asparaginase/glutaminase,superfamily_Ankyrin_rpt-contain_dom,smart_Asparaginase/glutaminase,smart_Ankyrin_rpt,prints_Asparaginase/glutaminase,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_AsnASEI	p.G115C	ENST00000551177.1	37	c.343	CCDS45170.2	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.1|24.1	4.491910|4.491910	0.84962|0.84962	.|.	.|.	ENSG00000166183|ENSG00000166183	ENST00000551177;ENST00000299234;ENST00000546892;ENST00000455920|ENST00000551170	T;T;T|.	0.81330|.	-1.48;-1.48;-1.48|.	4.26|4.26	4.26|4.26	0.50523|0.50523	Asparaginase/glutaminase, conserved site (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87974|0.87974	0.6313|0.6313	H|H	0.97340|0.97340	3.985|3.985	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0|.	D|D	0.92572|0.92572	0.6067|0.6067	10|5	0.87932|.	D|.	0|.	-34.7374|-34.7374	15.8003|15.8003	0.78450|0.78450	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	115;115;115;143|.	G3V1Y8;Q86U10;Q86U10-3;E5RFC2|.	.;LPP60_HUMAN;.;.|.	C|L	115;143;115;115|51	ENSP00000450040:G115C;ENSP00000448911:G115C;ENSP00000389003:G115C|.	ENSP00000299234:G143C|.	G|R	+|+	1|2	0|0	ASPG|ASPG	103631660|103631660	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.834000|0.834000	0.47266|0.47266	5.848000|5.848000	0.69458|0.69458	2.070000|2.070000	0.61991|0.61991	0.555000|0.555000	0.69702|0.69702	GGC|CGG	ASPG	-	pfam_Asparaginase/glutaminase,superfamily_Asparaginase/glutaminase,smart_Asparaginase/glutaminase,prints_Asparaginase/glutaminase,tigrfam_AsnASEI	ENSG00000166183		0.627	ASPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPG	HGNC	protein_coding	OTTHUMT00000407005.1	-	0.00	69	0	G	NM_001080464		104561907	+1	tier1	-	no_errors	ENST00000455920	ensembl	human	known	74_37	missense	6.94	67	5	SNP	1.000	T
ATP13A5	344905	genome.wustl.edu	37	3	193071969	193071969	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr3:193071969G>T	ENST00000342358.4	-	6	670	c.553C>A	c.(553-555)Ccc>Acc	p.P185T		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	185						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		ATGGCGTTGGGCCCACACACT	0.383																																																	0													122.0	108.0	113.0					3																	193071969		2203	4300	6503	SO:0001583	missense	0			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.553C>A	3.37:g.193071969G>T	ENSP00000341942:p.Pro185Thr		Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.P185T	ENST00000342358.4	37	c.553	CCDS33914.1	3	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631628	0.29068	.	.	ENSG00000187527	ENST00000342358	T	0.81330	-1.48	5.13	4.25	0.50352	ATPase, P-type cation-transporter, N-terminal (2);	0.000000	0.64402	D	0.000009	D	0.85885	0.5801	M	0.76433	2.335	0.33394	D	0.576526	D	0.64830	0.994	P	0.62014	0.897	D	0.86749	0.1959	10	0.19147	T	0.46	-6.6594	11.671	0.51401	0.0874:0.0:0.9126:0.0	.	185	Q4VNC0	AT135_HUMAN	T	185	ENSP00000341942:P185T	ENSP00000341942:P185T	P	-	1	0	ATP13A5	194554663	1.000000	0.71417	1.000000	0.80357	0.326000	0.28443	4.727000	0.61993	1.168000	0.42723	0.655000	0.94253	CCC	ATP13A5	-	pfam_ATPase_P-typ_cation-transptr_N,tigrfam_ATPase_P-typ_Cation_typ_V	ENSG00000187527		0.383	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A5	HGNC	protein_coding	OTTHUMT00000343012.1	-	0.00	56	0	G	NM_198505		193071969	-1	tier1	-	no_errors	ENST00000342358	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
ATP4A	495	genome.wustl.edu	37	19	36050724	36050724	+	Silent	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:36050724G>A	ENST00000262623.3	-	7	1067	c.1039C>T	c.(1039-1041)Ctg>Ttg	p.L347L		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	347					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	GTGGCCAGCAGCCCCTCAGGC	0.587																																																	0													41.0	37.0	38.0					19																	36050724		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.1039C>T	19.37:g.36050724G>A			O00738	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATPase_P-typ_H/K-transp_N,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.L347	ENST00000262623.3	37	c.1039	CCDS12467.1	19																																																																																			ATP4A	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000105675		0.587	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP4A	HGNC	protein_coding	OTTHUMT00000109470.2	-	0.00	33	0	G	NM_000704		36050724	-1	tier1	-	no_errors	ENST00000262623	ensembl	human	known	74_37	silent	13.33	26	4	SNP	1.000	A
ATP8B5P	158381	genome.wustl.edu	37	9	35482170	35482170	+	IGR	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:35482170G>T								ATP8B5P (31058 upstream) : RUSC2 (56458 downstream)																							GCAAGATAGTGAAGCCCAGGA	0.488																																																	0																																										SO:0001628	intergenic_variant	0																															9.37:g.35482170G>T				RNA	SNP	-	NULL		37	NULL		9																																																																																			ATP8B5P	-	-	ENSG00000179766	0	0.488					ATP8B5P	HGNC			-	0.00	33	0	G			35482170	+1	tier1	-	no_errors	ENST00000329395	ensembl	human	known	74_37	rna	10.81	33	4	SNP	0.008	T
BAMBI	25805	genome.wustl.edu	37	10	28971125	28971125	+	Missense_Mutation	SNP	G	G	A	rs575182425		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr10:28971125G>A	ENST00000375533.3	+	3	1134	c.578G>A	c.(577-579)cGt>cAt	p.R193H		NM_012342.2	NP_036474.1	Q13145	BAMBI_HUMAN	BMP and activin membrane-bound inhibitor	193					cell migration (GO:0016477)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell shape (GO:0008360)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|type II transforming growth factor beta receptor binding (GO:0005114)			central_nervous_system(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	17						ATGCTCTCCCGTTTGCACTAC	0.507													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20174	0.0		0.0	False		,,,				2504	0.0																0													115.0	102.0	107.0					10																	28971125		2203	4300	6503	SO:0001583	missense	0			U23070	CCDS7162.1	10p12.3-p11.2	2013-07-23	2013-07-23		ENSG00000095739	ENSG00000095739			30251	protein-coding gene	gene with protein product		604444	"""BMP and activin membrane-bound inhibitor homolog (Xenopus laevis)"""			8621228, 19758997	Standard	NM_012342		Approved	NMA	uc001iuj.1	Q13145	OTTHUMG00000017874	ENST00000375533.3:c.578G>A	10.37:g.28971125G>A	ENSP00000364683:p.Arg193His			Missense_Mutation	SNP	pfam_BMP/activin_membr-bound_inhib,pfam_Activin_rcpt,pirsf_BMP/activin_membr-bound_inhib	p.R193H	ENST00000375533.3	37	c.578	CCDS7162.1	10	.	.	.	.	.	.	.	.	.	.	G	28.9	4.964119	0.92791	.	.	ENSG00000095739	ENST00000375533;ENST00000542444	.	.	.	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.77184	0.4093	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.76200	-0.3046	9	0.66056	D	0.02	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	193	Q13145	BAMBI_HUMAN	H	193;180	.	ENSP00000364683:R193H	R	+	2	0	BAMBI	29011131	1.000000	0.71417	0.836000	0.33094	0.999000	0.98932	9.804000	0.99143	2.894000	0.99253	0.655000	0.94253	CGT	BAMBI	-	pirsf_BMP/activin_membr-bound_inhib	ENSG00000095739		0.507	BAMBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAMBI	HGNC	protein_coding	OTTHUMT00000047374.1	-	0.00	62	0	G	NM_012342		28971125	+1	tier1	-	no_errors	ENST00000375533	ensembl	human	known	74_37	missense	11.11	40	5	SNP	1.000	A
BBS1	582	genome.wustl.edu	37	11	66299217	66299217	+	Intron	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:66299217G>T	ENST00000318312.7	+	16	1746				BBS1_ENST00000393994.2_Missense_Mutation_p.G438C|CTD-3074O7.11_ENST00000419755.3_Intron|ZDHHC24_ENST00000526986.1_Intron|BBS1_ENST00000455748.2_Intron	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1						cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						CATCAAGGTAGGCCCCGCACT	0.582									Bardet-Biedl syndrome																												GBM(152;173 2612 9770 10137)												0													130.0	115.0	120.0					11																	66299217		2200	4295	6495	SO:0001627	intron_variant	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.1695+4G>T	11.37:g.66299217G>T			Q32MM9|Q32MN0|Q96SN4	Missense_Mutation	SNP	NULL	p.G438C	ENST00000318312.7	37	c.1312	CCDS8142.1	11	.	.	.	.	.	.	.	.	.	.	G	18.51	3.638646	0.67130	.	.	ENSG00000174483	ENST00000393994	D	0.96041	-3.89	5.42	2.36	0.29203	.	.	.	.	.	D	0.89434	0.6714	.	.	.	0.09310	N	0.999998	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.09377	0.004;0.004;0.004	T	0.77038	-0.2736	7	.	.	.	.	6.6388	0.22897	0.3306:0.0:0.6694:0.0	.	242;438;455	B4DH75;Q32MM9;Q4G0L2	.;.;.	C	438	ENSP00000377563:G438C	.	G	+	1	0	BBS1	66055793	0.795000	0.28851	0.028000	0.17463	0.437000	0.31866	0.275000	0.18698	0.197000	0.20387	0.563000	0.77884	GGC	BBS1	-	NULL	ENSG00000174483		0.582	BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS1	HGNC	protein_coding	OTTHUMT00000393235.2	-	0.00	61	0	G			66299217	+1	tier1	-	no_errors	ENST00000393994	ensembl	human	putative	74_37	missense	7.69	48	4	SNP	0.054	T
BCAM	4059	genome.wustl.edu	37	19	45316510	45316510	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:45316510G>A	ENST00000270233.6	+	5	530	c.508G>A	c.(508-510)Gcc>Acc	p.A170T	BCAM_ENST00000589651.1_Missense_Mutation_p.A170T	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	170	Ig-like V-type 2.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				GCCTCAGATCGCCACCTGCAA	0.642																																																	0													41.0	42.0	42.0					19																	45316510		2201	4295	6496	SO:0001583	missense	0			X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.508G>A	19.37:g.45316510G>A	ENSP00000270233:p.Ala170Thr		A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A170T	ENST00000270233.6	37	c.508	CCDS12644.1	19	.	.	.	.	.	.	.	.	.	.	.	15.90	2.969354	0.53614	.	.	ENSG00000187244	ENST00000270233;ENST00000391955	T;T	0.17054	2.3;2.3	3.95	3.95	0.45737	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.39809	0.1092	M	0.74881	2.28	0.34716	D	0.728268	D	0.89917	1.0	D	0.85130	0.997	T	0.53450	-0.8437	9	0.52906	T	0.07	-28.9633	11.6869	0.51492	0.0:0.0:1.0:0.0	.	170	P50895	BCAM_HUMAN	T	170	ENSP00000270233:A170T;ENSP00000375817:A170T	ENSP00000270233:A170T	A	+	1	0	BCAM	50008350	1.000000	0.71417	0.978000	0.43139	0.172000	0.22775	4.717000	0.61923	2.202000	0.70862	0.462000	0.41574	GCC	BCAM	-	pfam_CD80_C2-set,pfscan_Ig-like_dom	ENSG00000187244		0.642	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAM	HGNC	protein_coding	OTTHUMT00000453220.1	-	0.00	133	0	G	NM_005581		45316510	+1	tier1	-	no_errors	ENST00000270233	ensembl	human	known	74_37	missense	22.46	107	31	SNP	0.978	A
BCDIN3D	144233	genome.wustl.edu	37	12	50236768	50236768	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:50236768G>T	ENST00000333924.4	-	1	144	c.103C>A	c.(103-105)Cct>Act	p.P35T	BCDIN3D-AS1_ENST00000549124.1_RNA|BCDIN3D-AS1_ENST00000548872.1_RNA	NM_181708.2	NP_859059.1	Q7Z5W3	BN3D2_HUMAN	BCDIN3 domain containing	35					miRNA metabolic process (GO:0010586)|negative regulation of pre-miRNA processing (GO:2000632)|RNA methylation (GO:0001510)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	O-methyltransferase activity (GO:0008171)|RNA methyltransferase activity (GO:0008173)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|stomach(1)	9						GAATAATGAGGAAAATTTCCG	0.627																																																	0													68.0	76.0	73.0					12																	50236768		2203	4300	6503	SO:0001583	missense	0				CCDS8790.1	12q13.13	2008-03-12				ENSG00000186666			27050	protein-coding gene	gene with protein product							Standard	NM_181708		Approved		uc001rvh.3	Q7Z5W3	OTTHUMG00000169807	ENST00000333924.4:c.103C>A	12.37:g.50236768G>T	ENSP00000335201:p.Pro35Thr		A8K829	Missense_Mutation	SNP	pfam_Bin3	p.P35T	ENST00000333924.4	37	c.103	CCDS8790.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.80|17.80	3.478141|3.478141	0.63849|0.63849	.|.	.|.	ENSG00000186666|ENSG00000186666	ENST00000550861|ENST00000333924	.|T	.|0.43294	.|0.95	6.08|6.08	6.08|6.08	0.98989|0.98989	.|.	.|0.100209	.|0.64402	.|D	.|0.000001	T|T	0.50377|0.50377	0.1612|0.1612	L|L	0.34521|0.34521	1.04|1.04	0.27499|0.27499	N|N	0.95205|0.95205	.|D	.|0.76494	.|0.999	.|D	.|0.64144	.|0.922	T|T	0.42361|0.42361	-0.9456|-0.9456	6|10	0.87932|0.13108	D|T	0|0.6	.|.	18.1659|18.1659	0.89727|0.89727	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|35	.|Q7Z5W3	.|BN3D2_HUMAN	L|T	27|35	.|ENSP00000335201:P35T	ENSP00000447796:F27L|ENSP00000335201:P35T	F|P	-|-	3|1	2|0	BCDIN3D|BCDIN3D	48523035|48523035	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	4.513000|4.513000	0.60476|0.60476	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	TTC|CCT	BCDIN3D	-	NULL	ENSG00000186666		0.627	BCDIN3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCDIN3D	HGNC	protein_coding	OTTHUMT00000405982.1	-	0.00	75	0	G	NM_181708		50236768	-1	tier1	-	no_errors	ENST00000333924	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
BCL9	607	genome.wustl.edu	37	1	147095863	147095863	+	Silent	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:147095863G>A	ENST00000234739.3	+	10	4124	c.3384G>A	c.(3382-3384)ccG>ccA	p.P1128P		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	1128	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					AGGAGCCACCGATGGTACCTC	0.612			T	"""IGH@, IGL@"""	B-ALL																																			Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	0													100.0	102.0	102.0					1																	147095863		2203	4300	6503	SO:0001819	synonymous_variant	0			Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.3384G>A	1.37:g.147095863G>A			Q5T489	Silent	SNP	pfam_BCL9_beta-catenin-bd_dom	p.P1128	ENST00000234739.3	37	c.3384	CCDS30833.1	1																																																																																			BCL9	-	NULL	ENSG00000116128		0.612	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9	HGNC	protein_coding	OTTHUMT00000039468.1	-	0.00	77	0	G	NM_004326		147095863	+1	tier1	-	no_errors	ENST00000234739	ensembl	human	known	74_37	silent	18.37	40	9	SNP	0.478	A
BEND7	222389	genome.wustl.edu	37	10	13481306	13481306	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr10:13481306G>T	ENST00000396900.2	-	9	1425	c.1426C>A	c.(1426-1428)Caa>Aaa	p.Q476K	BEND7_ENST00000341083.3_Missense_Mutation_p.Q425K|BEND7_ENST00000486542.1_5'UTR			Q8N7W2	BEND7_HUMAN	BEN domain containing 7	476						extracellular vesicular exosome (GO:0070062)				breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|stomach(1)	17						TTGAAGTCTTGGCTGGTTTGG	0.517																																																	0													268.0	243.0	251.0					10																	13481306		2203	4300	6503	SO:0001583	missense	0			BC031618	CCDS7099.1, CCDS41490.1	10p14	2012-11-22	2008-10-03	2008-10-03	ENSG00000165626	ENSG00000165626		"""BEN domain containing"""	23514	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 30"""	C10orf30			Standard	NM_152751		Approved	FLJ40283	uc001imm.2	Q8N7W2	OTTHUMG00000017699	ENST00000396900.2:c.1426C>A	10.37:g.13481306G>T	ENSP00000380108:p.Gln476Lys		Q5SYY7|Q5SYY8|Q5SYY9|Q8N5T7	Missense_Mutation	SNP	pfam_BEN_domain	p.Q476K	ENST00000396900.2	37	c.1426		10	.	.	.	.	.	.	.	.	.	.	G	10.50	1.366236	0.24684	.	.	ENSG00000165626	ENST00000396900;ENST00000341083	T;T	0.46451	0.88;0.87	2.32	2.32	0.28847	.	.	.	.	.	T	0.23532	0.0569	N	0.08118	0	0.21861	N	0.999505	B	0.23490	0.086	B	0.24848	0.056	T	0.20174	-1.0283	9	0.87932	D	0	.	8.2379	0.31638	0.0:0.0:1.0:0.0	.	425	Q8N7W2-3	.	K	476;425	ENSP00000380108:Q476K;ENSP00000345773:Q425K	ENSP00000345773:Q425K	Q	-	1	0	BEND7	13521312	0.000000	0.05858	0.005000	0.12908	0.003000	0.03518	-0.247000	0.08866	1.634000	0.50500	0.655000	0.94253	CAA	BEND7	-	NULL	ENSG00000165626		0.517	BEND7-202	KNOWN	basic	protein_coding	BEND7	HGNC	protein_coding			0.00	68	0	G	NM_152751		13481306	-1			no_errors	ENST00000396900	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.005	T
BIRC6	57448	genome.wustl.edu	37	2	32640137	32640137	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:32640137G>A	ENST00000421745.2	+	10	1912	c.1778G>A	c.(1777-1779)gGt>gAt	p.G593D		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	593					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TCACTGGATGGTTTAAGCAGA	0.393																																					Pancreas(94;175 1509 16028 18060 45422)												0													59.0	59.0	59.0					2																	32640137		2203	4300	6503	SO:0001583	missense	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.1778G>A	2.37:g.32640137G>A	ENSP00000393596:p.Gly593Asp		Q9ULD1	Missense_Mutation	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.G593D	ENST00000421745.2	37	c.1778	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	G	8.693	0.907787	0.17833	.	.	ENSG00000115760	ENST00000421745	T	0.74632	-0.86	5.07	4.16	0.48862	.	0.408702	0.26522	N	0.023907	T	0.50257	0.1605	N	0.08118	0	0.31679	N	0.643363	B	0.02656	0.0	B	0.01281	0.0	T	0.49523	-0.8931	10	0.17369	T	0.5	.	8.7287	0.34485	0.0771:0.2893:0.6337:0.0	.	593	Q9NR09	BIRC6_HUMAN	D	593	ENSP00000393596:G593D	ENSP00000393596:G593D	G	+	2	0	BIRC6	32493641	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.703000	0.47110	1.214000	0.43395	0.650000	0.86243	GGT	BIRC6	-	NULL	ENSG00000115760		0.393	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	-	0.00	38	0	G	NM_016252		32640137	+1	tier1	-	no_errors	ENST00000421745	ensembl	human	known	74_37	missense	20.00	24	6	SNP	0.983	A
BTN2A1	11120	genome.wustl.edu	37	6	26458908	26458908	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:26458908T>C	ENST00000312541.5	+	2	292	c.44T>C	c.(43-45)cTc>cCc	p.L15P	BTN2A1_ENST00000541522.1_Intron|BTN2A1_ENST00000469185.1_Missense_Mutation_p.L15P|BTN2A1_ENST00000429381.1_Missense_Mutation_p.L15P	NM_007049.3|NM_078476.2	NP_008980.1|NP_510961.1	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1	15					lipid metabolic process (GO:0006629)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(3)	27						CCAGCCTCCCTCCTCCTCCTC	0.582																																																	0													187.0	142.0	157.0					6																	26458908		2203	4300	6503	SO:0001583	missense	0			U90543	CCDS4613.1, CCDS47390.1, CCDS56404.1, CCDS56405.1	6p22.1	2014-01-14			ENSG00000112763	ENSG00000112763		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1136	protein-coding gene	gene with protein product		613590				9382921, 9149941	Standard	NM_007049		Approved	BT2.1, BTF1, BTN2.1	uc003nib.2	Q7KYR7	OTTHUMG00000014457	ENST00000312541.5:c.44T>C	6.37:g.26458908T>C	ENSP00000312158:p.Leu15Pro		B4DLP9|E9PGR4|O00475|P78408|Q59EN4|Q7KYQ7|Q7Z386|Q96AV7|Q9NU62	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Ig-like_dom	p.L15P	ENST00000312541.5	37	c.44	CCDS4613.1	6	.	.	.	.	.	.	.	.	.	.	T	13.85	2.360847	0.41801	.	.	ENSG00000112763	ENST00000312541;ENST00000429381;ENST00000265424;ENST00000469185	T;T;T	0.81078	-0.78;-1.45;-1.45	3.03	1.83	0.25207	Immunoglobulin-like (1);	0.656368	0.12607	N	0.454165	D	0.83778	0.5328	M	0.85462	2.755	0.09310	N	0.999994	D;D	0.76494	0.981;0.999	P;D	0.85130	0.725;0.997	T	0.71882	-0.4458	10	0.87932	D	0	.	6.2417	0.20795	0.0:0.0:0.2598:0.7402	.	15;15	Q96AV7;Q7KYR7	.;BT2A1_HUMAN	P	15	ENSP00000312158:L15P;ENSP00000416945:L15P;ENSP00000419043:L15P	ENSP00000265424:L15P	L	+	2	0	BTN2A1	26566887	0.015000	0.18098	0.002000	0.10522	0.013000	0.08279	1.449000	0.35123	0.539000	0.28788	0.397000	0.26171	CTC	BTN2A1	-	pfscan_Ig-like_dom	ENSG00000112763		0.582	BTN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN2A1	HGNC	protein_coding	OTTHUMT00000040122.2		0.00	83	0	T	NM_007049		26458908	+1			no_errors	ENST00000312541	ensembl	human	known	74_37	missense	5.81	81	5	SNP	0.003	C
BTNL3	10917	genome.wustl.edu	37	5	180424394	180424394	+	Silent	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:180424394C>A	ENST00000342868.6	+	3	763	c.579C>A	c.(577-579)atC>atA	p.I193I		NM_197975.2	NP_932079.1	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3	193	Ig-like V-type.					integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(10)|prostate(2)|skin(1)	25	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			ATGTGGAGATCTCCATTATAG	0.493																																																	0													109.0	97.0	101.0					5																	180424394		2123	3927	6050	SO:0001819	synonymous_variant	0			AB020625	CCDS47358.1	5q35	2014-01-14			ENSG00000168903	ENSG00000168903		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1143	protein-coding gene	gene with protein product	"""butyrophilin-like receptor"""	606192				10429365	Standard	NM_197975		Approved	BTNLR, BTN9.1	uc003mmr.3	Q6UXE8	OTTHUMG00000162091	ENST00000342868.6:c.579C>A	5.37:g.180424394C>A			Q496L7|Q9Y2C7	Silent	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like_dom,prints_Butyrophylin	p.I193	ENST00000342868.6	37	c.579	CCDS47358.1	5																																																																																			BTNL3	-	pfscan_Ig-like_dom	ENSG00000168903		0.493	BTNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTNL3	HGNC	protein_coding	OTTHUMT00000367176.2	-	0.00	96	0	C	NM_197975		180424394	+1	tier1	-	no_errors	ENST00000342868	ensembl	human	known	74_37	silent	10.39	68	8	SNP	0.000	A
BYSL	705	genome.wustl.edu	37	6	41899282	41899282	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:41899282G>T	ENST00000230340.4	+	5	1228	c.853G>T	c.(853-855)Gcc>Tcc	p.A285S		NM_004053.3	NP_004044.3	Q13895	BYST_HUMAN	bystin-like	285					cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|female pregnancy (GO:0007565)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|trophectodermal cell differentiation (GO:0001829)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(5)|skin(1)	8	Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000473)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CAAACCTGGAGCCTGGTTCAA	0.532																																																	0													70.0	72.0	72.0					6																	41899282		2203	4300	6503	SO:0001583	missense	0			L36720	CCDS34450.1	6p21.1	2008-08-29			ENSG00000112578	ENSG00000112578			1157	protein-coding gene	gene with protein product		603871				9925933, 17381424	Standard	NM_004053		Approved		uc003orl.3	Q13895	OTTHUMG00000014687	ENST00000230340.4:c.853G>T	6.37:g.41899282G>T	ENSP00000230340:p.Ala285Ser		Q6P5W4|Q86W44|Q96IP8	Missense_Mutation	SNP	pfam_Bystin	p.A285S	ENST00000230340.4	37	c.853	CCDS34450.1	6	.	.	.	.	.	.	.	.	.	.	G	28.8	4.951042	0.92660	.	.	ENSG00000112578	ENST00000230340	T	0.56611	0.45	5.27	5.27	0.74061	.	0.050726	0.85682	D	0.000000	T	0.70245	0.3202	M	0.87328	2.875	0.80722	D	1	D	0.53462	0.96	P	0.59357	0.856	T	0.75190	-0.3405	10	0.72032	D	0.01	-31.2821	18.6543	0.91445	0.0:0.0:1.0:0.0	.	285	Q13895	BYST_HUMAN	S	285	ENSP00000230340:A285S	ENSP00000230340:A285S	A	+	1	0	BYSL	42007260	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	9.330000	0.96422	2.745000	0.94114	0.643000	0.83706	GCC	BYSL	-	pfam_Bystin	ENSG00000112578		0.532	BYSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BYSL	HGNC	protein_coding	OTTHUMT00000040535.2	-	0.00	81	0	G			41899282	+1	tier1	-	no_errors	ENST00000230340	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
BZRAP1	9256	genome.wustl.edu	37	17	56385999	56385999	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:56385999C>T	ENST00000343736.4	-	22	4797	c.4634G>A	c.(4633-4635)gGc>gAc	p.G1545D	BZRAP1_ENST00000268893.6_Missense_Mutation_p.G1485D|BZRAP1_ENST00000355701.3_Missense_Mutation_p.G1545D			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1545						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GGGCTTGGGGCCTGAATTGGC	0.677																																																	0													30.0	32.0	32.0					17																	56385999		2201	4300	6501	SO:0001583	missense	0			AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.4634G>A	17.37:g.56385999C>T	ENSP00000345824:p.Gly1545Asp		O75111|Q8N5W3	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain	p.G1545D	ENST00000343736.4	37	c.4634	CCDS11605.1	17	.	.	.	.	.	.	.	.	.	.	C	16.18	3.050643	0.55218	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	T;T;T	0.04809	3.56;3.55;3.56	5.26	1.28	0.21552	.	1.040040	0.07463	N	0.900925	T	0.08179	0.0204	L	0.27053	0.805	0.22989	N	0.99847	B;D;D	0.69078	0.18;0.997;0.996	B;D;P	0.63283	0.082;0.913;0.881	T	0.41088	-0.9528	10	0.29301	T	0.29	.	3.6941	0.08357	0.2392:0.4481:0.2284:0.0844	.	1545;1485;1545	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	D	1545;1545;1485	ENSP00000347929:G1545D;ENSP00000345824:G1545D;ENSP00000268893:G1485D	ENSP00000268893:G1485D	G	-	2	0	BZRAP1	53740998	0.927000	0.31430	0.822000	0.32727	0.898000	0.52572	0.736000	0.26130	0.601000	0.29879	0.455000	0.32223	GGC	BZRAP1	-	NULL	ENSG00000005379		0.677	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BZRAP1	HGNC	protein_coding	OTTHUMT00000443980.1		0.00	87	0	C	NM_004758		56385999	-1			no_errors	ENST00000355701	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.336	T
BZRAP1	9256	genome.wustl.edu	37	17	56387907	56387907	+	Missense_Mutation	SNP	C	C	A	rs201358584		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:56387907C>A	ENST00000343736.4	-	20	3828	c.3665G>T	c.(3664-3666)gGa>gTa	p.G1222V	BZRAP1_ENST00000268893.6_Missense_Mutation_p.G1162V|BZRAP1_ENST00000355701.3_Missense_Mutation_p.G1222V			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1222						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCCTGGGTCTCCTCCTTGGCA	0.637																																																	0													42.0	48.0	46.0					17																	56387907		2201	4298	6499	SO:0001583	missense	0			AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.3665G>T	17.37:g.56387907C>A	ENSP00000345824:p.Gly1222Val		O75111|Q8N5W3	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain	p.G1222V	ENST00000343736.4	37	c.3665	CCDS11605.1	17	.	.	.	.	.	.	.	.	.	.	C	28.7	4.946651	0.92593	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	D;D;D	0.86497	-2.13;-2.13;-2.13	5.49	5.49	0.81192	.	0.358158	0.28877	N	0.013842	D	0.91290	0.7254	L	0.59436	1.845	0.52501	D	0.999953	D;D;P	0.89917	1.0;0.97;0.855	D;P;P	0.72075	0.976;0.74;0.448	D	0.89383	0.3683	10	0.30854	T	0.27	.	14.876	0.70493	0.0:1.0:0.0:0.0	.	1222;1162;1222	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	V	1222;1222;1162	ENSP00000347929:G1222V;ENSP00000345824:G1222V;ENSP00000268893:G1162V	ENSP00000268893:G1162V	G	-	2	0	BZRAP1	53742906	0.936000	0.31750	0.945000	0.38365	0.459000	0.32528	1.640000	0.37186	2.588000	0.87417	0.462000	0.41574	GGA	BZRAP1	-	NULL	ENSG00000005379		0.637	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BZRAP1	HGNC	protein_coding	OTTHUMT00000443980.1	-	0.00	58	0	C	NM_004758		56387907	-1	tier1	rs201358584	no_errors	ENST00000355701	ensembl	human	known	74_37	missense	26.83	30	11	SNP	0.965	A
CFAP54	144535	genome.wustl.edu	37	12	96974774	96974774	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:96974774C>T	ENST00000524981.4	+	22	2989	c.2966C>T	c.(2965-2967)gCc>gTc	p.A989V	C12orf55_ENST00000554108.2_3'UTR			Q96N23	CL055_HUMAN		0																	GCAGTTGCTGCCTATTCTAAC	0.378																																																	0																																										SO:0001583	missense	0																														ENST00000524981.4:c.2966C>T	12.37:g.96974774C>T	ENSP00000431759:p.Ala989Val			Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.A989V	ENST00000524981.4	37	c.2966		12	.	.	.	.	.	.	.	.	.	.	C	14.89	2.671392	0.47781	.	.	ENSG00000188596	ENST00000524981	.	.	.	5.52	3.6	0.41247	.	.	.	.	.	T	0.60196	0.2250	L	0.39898	1.24	0.80722	D	1	.	.	.	.	.	.	T	0.64394	-0.6418	6	0.87932	D	0	.	13.4346	0.61076	0.1226:0.7585:0.1188:0.0	.	.	.	.	V	989	.	ENSP00000431759:A989V	A	+	2	0	C12orf63	95498905	1.000000	0.71417	1.000000	0.80357	0.276000	0.26787	3.771000	0.55318	2.611000	0.88343	0.484000	0.47621	GCC	C12orf55	-	superfamily_Fibronectin_type3	ENSG00000188596		0.378	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	-	0.00	67	0	C			96974774	+1	tier1	-	no_errors	ENST00000524981	ensembl	human	putative	74_37	missense	6.56	57	4	SNP	1.000	T
CFAP54	144535	genome.wustl.edu	37	12	97038026	97038026	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:97038026A>G	ENST00000524981.4	+	33	4410	c.4387A>G	c.(4387-4389)Agt>Ggt	p.S1463G				Q96N23	CL055_HUMAN		0																	TCTAATATTAAGTTATGTTAA	0.403																																																	0																																										SO:0001583	missense	0																														ENST00000524981.4:c.4387A>G	12.37:g.97038026A>G	ENSP00000431759:p.Ser1463Gly			Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.S1463G	ENST00000524981.4	37	c.4387		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.59|10.59	1.392766|1.392766	0.25118|0.25118	.|.	.|.	ENSG00000188596|ENSG00000188596	ENST00000550977|ENST00000524981	.|.	.|.	.|.	5.68|5.68	1.58|1.58	0.23477|0.23477	.|.	.|.	.|.	.|.	.|.	T|T	0.22513|0.22513	0.0543|0.0543	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.19679|0.19679	-1.0298|-1.0298	5|8	.|0.30854	.|T	.|0.27	.|.	5.6166|5.6166	0.17434|0.17434	0.7018:0.1194:0.0731:0.1057|0.7018:0.1194:0.0731:0.1057	.|.	.|1463	.|E9PJL5	.|.	R|G	209|1463	.|.	.|ENSP00000431759:S1463G	K|S	+|+	2|1	0|0	C12orf63|C12orf63	95562157|95562157	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.453000|0.453000	0.21811|0.21811	0.070000|0.070000	0.16634|0.16634	-1.139000|-1.139000	0.01908|0.01908	AAG|AGT	C12orf55	-	NULL	ENSG00000188596		0.403	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	-	0.00	50	0	A			97038026	+1	tier1	-	no_errors	ENST00000524981	ensembl	human	putative	74_37	missense	25.00	30	10	SNP	0.000	G
ERICH3	127254	genome.wustl.edu	37	1	75102068	75102068	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:75102068G>A	ENST00000326665.5	-	6	717	c.499C>T	c.(499-501)Cag>Tag	p.Q167*	C1orf173_ENST00000420661.2_5'Flank	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		167										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						GGAAGAGGCTGTAATCGAATT	0.413																																																	0													227.0	236.0	233.0					1																	75102068		2203	4300	6503	SO:0001587	stop_gained	0																														ENST00000326665.5:c.499C>T	1.37:g.75102068G>A	ENSP00000322609:p.Gln167*		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Nonsense_Mutation	SNP	NULL	p.Q167*	ENST00000326665.5	37	c.499	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.047389	0.93740	.	.	ENSG00000178965	ENST00000326665	.	.	.	5.65	3.71	0.42584	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-2.0972	11.3623	0.49651	0.0:0.132:0.7177:0.1502	.	.	.	.	X	167	.	ENSP00000322609:Q167X	Q	-	1	0	C1orf173	74874656	1.000000	0.71417	0.988000	0.46212	0.348000	0.29142	2.862000	0.48388	0.677000	0.31305	0.557000	0.71058	CAG	C1orf173	-	NULL	ENSG00000178965		0.413	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	-	0.00	75	0	G			75102068	-1	tier1	-	no_errors	ENST00000326665	ensembl	human	known	74_37	nonsense	6.15	61	4	SNP	0.995	A
C1orf112	55732	genome.wustl.edu	37	1	169796899	169796899	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:169796899G>T	ENST00000286031.6	+	12	1745	c.1045G>T	c.(1045-1047)Gtc>Ttc	p.V349F	C1orf112_ENST00000413811.2_Intron|C1orf112_ENST00000498289.1_3'UTR|C1orf112_ENST00000359326.4_Missense_Mutation_p.V349F	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112	349										breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TCTGGTTGTTGTCATGGATAA	0.413																																																	0													384.0	381.0	382.0					1																	169796899		2203	4300	6503	SO:0001583	missense	0			AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.1045G>T	1.37:g.169796899G>T	ENSP00000286031:p.Val349Phe		A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Missense_Mutation	SNP	NULL	p.V349F	ENST00000286031.6	37	c.1045	CCDS1285.1	1	.	.	.	.	.	.	.	.	.	.	G	17.67	3.446964	0.63178	.	.	ENSG00000000460	ENST00000359326;ENST00000286031	T;T	0.48836	0.8;0.8	5.53	0.956	0.19608	.	0.366153	0.33813	N	0.004533	T	0.27278	0.0669	L	0.38175	1.15	0.29134	N	0.879446	P;P	0.51240	0.943;0.943	P;P	0.54312	0.748;0.748	T	0.13255	-1.0516	10	0.72032	D	0.01	-1.1176	4.2784	0.10820	0.3801:0.1941:0.4259:0.0	.	291;349	B4DGF2;Q9NSG2	.;CA112_HUMAN	F	349	ENSP00000352276:V349F;ENSP00000286031:V349F	ENSP00000286031:V349F	V	+	1	0	C1orf112	168063523	0.040000	0.19996	0.052000	0.19188	0.915000	0.54546	0.410000	0.21098	-0.048000	0.13401	0.491000	0.48974	GTC	C1orf112	-	NULL	ENSG00000000460		0.413	C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf112	HGNC	protein_coding	OTTHUMT00000087126.3	-	0.00	67	0	G	NM_018186		169796899	+1	tier1	-	no_errors	ENST00000286031	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.223	T
CACNA1A	773	genome.wustl.edu	37	19	13441142	13441142	+	Silent	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:13441142G>T	ENST00000360228.5	-	10	1260	c.1261C>A	c.(1261-1263)Cgg>Agg	p.R421R	CACNA1A_ENST00000573710.2_Silent_p.R422R	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	422					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GTGGTTCTCCGCAGAGCTCCA	0.478																																																	0													69.0	68.0	68.0					19																	13441142		1899	4112	6011	SO:0001819	synonymous_variant	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.1261C>A	19.37:g.13441142G>T			J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.R421	ENST00000360228.5	37	c.1261	CCDS45998.1	19																																																																																			CACNA1A	-	NULL	ENSG00000141837		0.478	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2		0.00	51	0	G	NM_000068		13441142	-1			no_errors	ENST00000360228	ensembl	human	known	74_37	silent	6.00	47	3	SNP	1.000	T
CACNB2	783	genome.wustl.edu	37	10	18690939	18690939	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr10:18690939G>T	ENST00000324631.7	+	3	360	c.300G>T	c.(298-300)gaG>gaT	p.E100D	CACNB2_ENST00000377319.3_Missense_Mutation_p.E45D|CACNB2_ENST00000377331.2_Missense_Mutation_p.E72D|CACNB2_ENST00000352115.6_Missense_Mutation_p.E100D|CACNB2_ENST00000377328.1_Missense_Mutation_p.E100D|CACNB2_ENST00000377329.4_Missense_Mutation_p.E46D|CACNB2_ENST00000396576.2_Missense_Mutation_p.E45D|CACNB2_ENST00000377315.4_Missense_Mutation_p.E52D|CACNB2_ENST00000282343.8_Missense_Mutation_p.E72D	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit	100				ER -> Q (in Ref. 5; AAD33729). {ECO:0000305}.	axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)	p.E45E(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GAGAAGCGGAGCGGCAGGCCC	0.557																																																	1	Substitution - coding silent(1)	central_nervous_system(1)											72.0	61.0	65.0					10																	18690939		2203	4300	6503	SO:0001583	missense	0			U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.300G>T	10.37:g.18690939G>T	ENSP00000320025:p.Glu100Asp		A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Missense_Mutation	SNP	pfam_GK/Ca_channel_bsu,pfam_VDCC_L_bsu,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_SH3_domain,prints_VDCC_L_bsu,prints_VDCC_L_b2su	p.E100D	ENST00000324631.7	37	c.300	CCDS7125.1	10	.	.	.	.	.	.	.	.	.	.	G	15.52	2.856605	0.51376	.	.	ENSG00000165995	ENST00000324631;ENST00000352115;ENST00000377328;ENST00000282343;ENST00000377331;ENST00000396576;ENST00000377319;ENST00000377329;ENST00000377315	D;D;D;D;D;D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75	5.87	4.04	0.47022	Src homology-3 domain (1);	0.136026	0.64402	D	0.000003	D	0.88239	0.6383	M	0.64997	1.995	0.58432	D	0.999999	D;D;P;P;P;B;P;D;P;D;D;D;D;D;D;D	0.89917	0.999;0.992;0.948;0.884;0.948;0.026;0.948;1.0;0.935;0.998;0.997;0.999;0.972;0.997;0.998;0.978	D;D;D;D;D;B;D;D;D;D;D;D;D;D;D;D	0.91635	0.998;0.987;0.987;0.942;0.987;0.015;0.983;0.999;0.977;0.996;0.99;0.998;0.983;0.991;0.997;0.99	D	0.87261	0.2279	10	0.52906	T	0.07	-12.2252	10.2483	0.43354	0.2017:0.0:0.7983:0.0	.	52;52;46;46;72;100;52;46;46;56;45;72;72;100;100;100	B7Z1U5;B7Z2U3;Q5QJ99;Q6TME0;Q5QJA0;A6PVM6;Q5VVH1;Q6TME1;Q08289-3;Q59H42;Q08289-6;A6PVM7;Q08289-4;Q08289-7;Q08289-8;Q08289	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CACB2_HUMAN	D	100;100;100;72;72;45;45;46;52	ENSP00000320025:E100D;ENSP00000344474:E100D;ENSP00000366545:E100D;ENSP00000282343:E72D;ENSP00000366548:E72D;ENSP00000379821:E45D;ENSP00000366536:E45D;ENSP00000366546:E46D;ENSP00000366532:E52D	ENSP00000282343:E72D	E	+	3	2	CACNB2	18730945	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.897000	0.48664	0.953000	0.37825	0.655000	0.94253	GAG	CACNB2	-	pfam_VDCC_L_bsu,superfamily_SH3_domain	ENSG00000165995		0.557	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CACNB2	HGNC	protein_coding	OTTHUMT00000047072.2		0.00	46	0	G	NM_000724		18690939	+1			no_errors	ENST00000324631	ensembl	human	known	74_37	missense	6.00	47	3	SNP	1.000	T
CAPN6	827	genome.wustl.edu	37	X	110494492	110494492	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chrX:110494492T>G	ENST00000324068.1	-	7	1083	c.916A>C	c.(916-918)Act>Cct	p.T306P	CAPN6_ENST00000541758.1_Missense_Mutation_p.T51P	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	306	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						TCTGATGCAGTCAGTTGCTGC	0.413																																																	0													41.0	35.0	37.0					X																	110494492		2203	4300	6503	SO:0001583	missense	0			AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.916A>C	X.37:g.110494492T>G	ENSP00000317214:p.Thr306Pro		D3DUY7|Q9UEQ1|Q9UJA8	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,pfam_C2_dom,superfamily_Calpain_domain_III,superfamily_C2_dom,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_C2_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.T306P	ENST00000324068.1	37	c.916	CCDS14555.1	X	.	.	.	.	.	.	.	.	.	.	T	11.55	1.673255	0.29693	.	.	ENSG00000077274	ENST00000324068;ENST00000541758	D;D	0.87334	-2.24;-2.24	5.82	5.82	0.92795	Peptidase C2, calpain, catalytic domain (3);	0.102450	0.64402	D	0.000008	T	0.79992	0.4542	N	0.04959	-0.14	0.42596	D	0.993263	P	0.48230	0.907	P	0.48063	0.565	T	0.83025	-0.0165	10	0.41790	T	0.15	.	15.1414	0.72612	0.0:0.0:0.0:1.0	.	306	Q9Y6Q1	CAN6_HUMAN	P	306;51	ENSP00000317214:T306P;ENSP00000441736:T51P	ENSP00000317214:T306P	T	-	1	0	CAPN6	110381148	1.000000	0.71417	0.995000	0.50966	0.338000	0.28826	4.663000	0.61532	1.958000	0.56883	0.430000	0.28490	ACT	CAPN6	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat	ENSG00000077274		0.413	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN6	HGNC	protein_coding	OTTHUMT00000057922.1	-	0.00	42	0	T			110494492	-1	tier1	-	no_errors	ENST00000324068	ensembl	human	known	74_37	missense	17.65	28	6	SNP	1.000	G
CASP8AP2	9994	genome.wustl.edu	37	6	90578430	90578430	+	RNA	DEL	A	A	-	rs371166110		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:90578430delA	ENST00000551025.1	+	0	6858									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		CATGTGAAGTAAAAAAAGATG	0.388																																					Colon(187;1656 2025 17045 31481 39901)												0													51.0	49.0	50.0					6																	90578430		1844	4095	5939			0			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90578430delA				RNA	DEL	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			CASP8AP2	-	-	ENSG00000118412		0.388	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	HGNC	processed_transcript			0.00	27	0	A	NM_001137667		90578430	+1	tier1		no_errors	ENST00000237177	ensembl	human	known	74_37	rna	6.45	29	2	DEL	0.004	-
CASS4	57091	genome.wustl.edu	37	20	55012570	55012570	+	Silent	SNP	A	A	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr20:55012570A>G	ENST00000360314.3	+	3	612	c.387A>G	c.(385-387)caA>caG	p.Q129Q	CASS4_ENST00000371336.3_Silent_p.Q129Q|CASS4_ENST00000434344.1_Silent_p.Q129Q	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	129					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)			breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						CTACTGCCCAAGTCTATGAAT	0.567																																																	0													68.0	74.0	72.0					20																	55012570		2191	4284	6475	SO:0001819	synonymous_variant	0			AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.387A>G	20.37:g.55012570A>G			E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Silent	SNP	pfam_Serine_rich,pfam_CAS_DUF3513,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.Q129	ENST00000360314.3	37	c.387	CCDS33492.1	20																																																																																			CASS4	-	NULL	ENSG00000087589		0.567	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASS4	HGNC	protein_coding	OTTHUMT00000079789.2	-	0.00	41	0	A	NM_020356		55012570	+1	tier1	-	no_errors	ENST00000360314	ensembl	human	known	74_37	silent	13.16	33	5	SNP	0.584	G
CBLB	868	genome.wustl.edu	37	3	105421029	105421029	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr3:105421029G>T	ENST00000264122.4	-	12	2189	c.1868C>A	c.(1867-1869)tCa>tAa	p.S623*	CBLB_ENST00000403724.1_Nonsense_Mutation_p.S623*|CBLB_ENST00000394027.3_Nonsense_Mutation_p.S645*|CBLB_ENST00000405772.1_Nonsense_Mutation_p.S623*	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	623	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						ATTGACATTTGAACTCGCTGT	0.502			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)			Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	0													129.0	127.0	128.0					3																	105421029		2203	4300	6503	SO:0001587	stop_gained	0			U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.1868C>A	3.37:g.105421029G>T	ENSP00000264122:p.Ser623*		A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Nonsense_Mutation	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/Ts_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.S623*	ENST00000264122.4	37	c.1868	CCDS2948.1	3	.	.	.	.	.	.	.	.	.	.	G	41	9.052328	0.99050	.	.	ENSG00000114423	ENST00000394030;ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	.	.	.	5.67	5.67	0.87782	.	0.466770	0.22152	N	0.063905	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.6088	17.9312	0.88998	0.0:0.0:1.0:0.0	.	.	.	.	X	6;623;645;623;623	.	ENSP00000264122:S623X	S	-	2	0	CBLB	106903719	0.998000	0.40836	0.706000	0.30403	0.462000	0.32619	4.995000	0.63908	2.663000	0.90544	0.536000	0.68110	TCA	CBLB	-	NULL	ENSG00000114423		0.502	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLB	HGNC	protein_coding	OTTHUMT00000319417.2		0.00	41	0	G	NM_170662		105421029	-1			no_errors	ENST00000264122	ensembl	human	known	74_37	nonsense	5.26	35	2	SNP	0.367	T
CCBL2	56267	genome.wustl.edu	37	1	89453970	89453970	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:89453970A>G	ENST00000260508.4	-	2	401	c.64T>C	c.(64-66)Tct>Cct	p.S22P	RBMXL1_ENST00000321792.5_Intron|CCBL2_ENST00000370491.3_Intron|RBMXL1_ENST00000413769.1_5'UTR|CCBL2_ENST00000446900.2_5'UTR|CCBL2_ENST00000370485.2_Missense_Mutation_p.S22P|RBMXL1_ENST00000399794.2_5'UTR	NM_001008661.2	NP_001008661.1	Q6YP21	KAT3_HUMAN	cysteine conjugate-beta lyase 2	22					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine metabolic process (GO:0097052)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	mitochondrion (GO:0005739)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|kynurenine-glyoxylate transaminase activity (GO:0047315)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|poly(A) RNA binding (GO:0044822)|pyridoxal phosphate binding (GO:0030170)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|ovary(2)|skin(2)|soft_tissue(1)	18		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)		TTGGAAGAAGAAATTGTCTTC	0.348																																																	0													59.0	64.0	62.0					1																	89453970		2203	4300	6503	SO:0001583	missense	0			AF091090	CCDS30766.1, CCDS30767.1	1p22.2	2009-06-23			ENSG00000137944	ENSG00000137944			33238	protein-coding gene	gene with protein product		610656				16376499	Standard	NM_001008662		Approved	RBM1, RP11-82K18.3, KAT3	uc001dmp.2	Q6YP21	OTTHUMG00000010617	ENST00000260508.4:c.64T>C	1.37:g.89453970A>G	ENSP00000260508:p.Ser22Pro		B3KQ13|O95335|Q5JS27|Q5T9T7|Q5T9T8|Q6AI27|Q6ICW1|Q9BVY5	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.S22P	ENST00000260508.4	37	c.64	CCDS30766.1	1	.	.	.	.	.	.	.	.	.	.	A	6.550	0.469674	0.12461	.	.	ENSG00000137944	ENST00000260508;ENST00000370485;ENST00000370486	T;T	0.72725	-0.68;-0.52	5.5	0.397	0.16314	.	1.532570	0.03620	N	0.236183	T	0.33904	0.0879	L	0.29908	0.895	0.18873	N	0.999981	B	0.02656	0.0	B	0.01281	0.0	T	0.08700	-1.0709	10	0.35671	T	0.21	1.9953	4.0256	0.09685	0.6141:0.0:0.2384:0.1475	.	22	Q6YP21	KAT3_HUMAN	P	22	ENSP00000260508:S22P;ENSP00000359517:S22P	ENSP00000260508:S22P	S	-	1	0	CCBL2	89226558	0.124000	0.22315	0.287000	0.24848	0.262000	0.26303	0.320000	0.19540	0.061000	0.16311	0.528000	0.53228	TCT	CCBL2	-	NULL	ENSG00000137944		0.348	CCBL2-004	KNOWN	basic|CCDS	protein_coding	CCBL2	HGNC	protein_coding	OTTHUMT00000029300.3	-	0.00	78	0	A	NM_001008661		89453970	-1	tier1	-	no_errors	ENST00000260508	ensembl	human	known	74_37	missense	34.85	43	23	SNP	0.029	G
CCDC144NL	339184	genome.wustl.edu	37	17	20799142	20799142	+	Silent	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:20799142G>A	ENST00000327925.5	-	1	311	c.192C>T	c.(190-192)caC>caT	p.H64H	RP11-344E13.3_ENST00000439794.2_RNA|RP11-344E13.3_ENST00000583962.1_RNA|RP11-344E13.3_ENST00000582324.1_RNA|RNU6-1178P_ENST00000516674.1_RNA|RP11-344E13.3_ENST00000577537.1_RNA|RP11-344E13.3_ENST00000577860.1_RNA|RP11-344E13.3_ENST00000417232.2_RNA	NM_001004306.1	NP_001004306.1	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family, N-terminal like	64										large_intestine(3)|lung(3)|skin(1)	7						CGCCCTCACCGTGCTTGCTCT	0.652																																																	0													75.0	84.0	81.0					17																	20799142		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32591.1	17p11.2	2009-01-15			ENSG00000205212	ENSG00000205212			33735	protein-coding gene	gene with protein product							Standard	NM_001004306		Approved	MGC87631	uc002gyf.3	Q6NUI1	OTTHUMG00000132271	ENST00000327925.5:c.192C>T	17.37:g.20799142G>A				Silent	SNP	NULL	p.H64	ENST00000327925.5	37	c.192	CCDS32591.1	17																																																																																			CCDC144NL	-	NULL	ENSG00000205212		0.652	CCDC144NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC144NL	HGNC	protein_coding	OTTHUMT00000255361.2	-	0.00	86	0	G	NM_001004306		20799142	-1	tier1	-	no_errors	ENST00000327925	ensembl	human	known	74_37	silent	30.51	41	18	SNP	0.000	A
CCDC103	388389	genome.wustl.edu	37	17	42979018	42979018	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:42979018C>A	ENST00000417826.2	+	3	369	c.274C>A	c.(274-276)Ccg>Acg	p.P92T	CCDC103_ENST00000410027.1_Missense_Mutation_p.P92T|CCDC103_ENST00000410006.2_Missense_Mutation_p.P92T|EFTUD2_ENST00000591382.1_5'Flank|EFTUD2_ENST00000426333.2_5'Flank|EFTUD2_ENST00000402521.3_5'Flank|FAM187A_ENST00000331733.4_5'UTR|AC015936.3_ENST00000441312.1_RNA|FAM187A_ENST00000412523.2_Intron|EFTUD2_ENST00000592576.1_5'Flank	NM_001258399.1|NM_213607.2	NP_001245328.1|NP_998772.1	Q8IW40	CC103_HUMAN	coiled-coil domain containing 103	92					axonemal dynein complex assembly (GO:0070286)|cell projection organization (GO:0030030)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|outer dynein arm assembly (GO:0036158)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(3)|prostate(1)|skin(1)	7		Prostate(33;0.109)				TGAAATCTCCCCGGTAGGTGA	0.468																																																	0													94.0	81.0	85.0					17																	42979018		2203	4300	6503	SO:0001583	missense	0			AK023156	CCDS11490.1, CCDS58554.1	17q21.31	2013-02-22			ENSG00000167131	ENSG00000167131			32700	protein-coding gene	gene with protein product		614677				22581229	Standard	NM_213607		Approved	FLJ13094, FLJ34211, PR46b, CILD17	uc031ray.1	Q8IW40	OTTHUMG00000154264	ENST00000417826.2:c.274C>A	17.37:g.42979018C>A	ENSP00000391692:p.Pro92Thr		A8K145|B8ZZU0	Missense_Mutation	SNP	NULL	p.P92T	ENST00000417826.2	37	c.274	CCDS11490.1	17	.	.	.	.	.	.	.	.	.	.	C	11.86	1.765068	0.31228	.	.	ENSG00000167131	ENST00000357776;ENST00000410027;ENST00000417826;ENST00000410006	T;T;T	0.78003	-1.13;-1.14;-1.14	5.63	5.63	0.86233	.	0.749130	0.11298	U	0.578574	T	0.63850	0.2546	N	0.19112	0.55	0.27697	N	0.945905	B	0.23937	0.094	B	0.15870	0.014	T	0.47661	-0.9100	10	0.12430	T	0.62	-13.4064	13.6245	0.62157	0.1547:0.8453:0.0:0.0	.	92	Q8IW40	CC103_HUMAN	T	92	ENSP00000350420:P92T;ENSP00000391692:P92T;ENSP00000387252:P92T	ENSP00000350420:P92T	P	+	1	0	CCDC103	40334544	0.685000	0.27652	0.077000	0.20336	0.787000	0.44495	2.502000	0.45398	2.676000	0.91093	0.555000	0.69702	CCG	CCDC103	-	NULL	ENSG00000167131		0.468	CCDC103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC103	HGNC	protein_coding	OTTHUMT00000334578.1		0.00	69	0	C	NM_213607		42979018	+1			no_errors	ENST00000410006	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.652	A
CCDC82	79780	genome.wustl.edu	37	11	96117597	96117597	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:96117597G>T	ENST00000278520.5	-	3	743	c.315C>A	c.(313-315)aaC>aaA	p.N105K	CCDC82_ENST00000542662.1_Missense_Mutation_p.N105K|CCDC82_ENST00000525786.1_5'Flank|CCDC82_ENST00000423339.2_Missense_Mutation_p.N105K			Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82	105								p.N105N(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		ATGTTGAACCGTTGCCAGAGT	0.338																																																	1	Substitution - coding silent(1)	endometrium(1)											194.0	185.0	188.0					11																	96117597		2201	4297	6498	SO:0001583	missense	0			AF245436	CCDS8307.1	11q21	2006-03-09			ENSG00000149231	ENSG00000149231			26282	protein-coding gene	gene with protein product						12477932	Standard	NM_024725		Approved	FLJ23518	uc001pfx.4	Q8N4S0	OTTHUMG00000167678	ENST00000278520.5:c.315C>A	11.37:g.96117597G>T	ENSP00000278520:p.Asn105Lys		B3KPU7|Q8WV71|Q9H2Q5|Q9H5E3	Missense_Mutation	SNP	NULL	p.N105K	ENST00000278520.5	37	c.315	CCDS8307.1	11	.	.	.	.	.	.	.	.	.	.	G	10.65	1.410901	0.25465	.	.	ENSG00000149231	ENST00000278520;ENST00000542662;ENST00000423339;ENST00000538597	T;T;T;T	0.26810	1.71;1.71;1.71;1.71	5.51	0.933	0.19471	.	0.474648	0.21365	N	0.075723	T	0.16854	0.0405	N	0.20986	0.625	0.09310	N	1	P;P	0.51537	0.946;0.48	P;B	0.49683	0.619;0.216	T	0.17107	-1.0380	10	0.10111	T	0.7	-4.9086	5.5396	0.17031	0.4546:0.1374:0.408:0.0	.	105;105	Q8N4S0-2;Q8N4S0	.;CCD82_HUMAN	K	105	ENSP00000278520:N105K;ENSP00000444010:N105K;ENSP00000397156:N105K;ENSP00000442723:N105K	ENSP00000278520:N105K	N	-	3	2	CCDC82	95757245	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	0.127000	0.15790	-0.021000	0.14009	0.655000	0.94253	AAC	CCDC82	-	NULL	ENSG00000149231		0.338	CCDC82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC82	HGNC	protein_coding	OTTHUMT00000395542.2	-	0.00	75	0	G	NM_024725		96117597	-1	tier1	-	no_errors	ENST00000278520	ensembl	human	known	74_37	missense	6.10	77	5	SNP	0.000	T
CD1A	909	genome.wustl.edu	37	1	158224912	158224912	+	Missense_Mutation	SNP	G	G	T	rs140904380		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:158224912G>T	ENST00000289429.5	+	2	630	c.97G>T	c.(97-99)Gca>Tca	p.A33S		NM_001763.2	NP_001754.2	P06126	CD1A_HUMAN	CD1a molecule	33					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)		p.A33T(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	32	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	CACCTGGATCGCATCCTTTTA	0.468																																																	1	Substitution - Missense(1)	large_intestine(1)											137.0	115.0	123.0					1																	158224912		2203	4300	6503	SO:0001583	missense	0			M28825	CCDS1174.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158477	ENSG00000158477		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1634	protein-coding gene	gene with protein product		188370	"""CD1A antigen, a polypeptide"", ""CD1a antigen"""	CD1		2447586, 2784820	Standard	NM_001763		Approved		uc001frt.3	P06126	OTTHUMG00000017512	ENST00000289429.5:c.97G>T	1.37:g.158224912G>T	ENSP00000289429:p.Ala33Ser		D3DVD7|Q13962|Q5TDJ8|Q9UMM4|Q9Y5M5	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.A33S	ENST00000289429.5	37	c.97	CCDS1174.1	1	.	.	.	.	.	.	.	.	.	.	G	0.022	-1.416365	0.01136	.	.	ENSG00000158477	ENST00000289429	T	0.17528	2.27	4.54	-0.785	0.10950	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	1.826170	0.03768	N	0.259261	T	0.00637	0.0021	N	0.00097	-2.15	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.45877	-0.9231	10	0.02654	T	1	-0.0225	4.9472	0.13994	0.3014:0.0:0.3237:0.3748	.	33	P06126	CD1A_HUMAN	S	33	ENSP00000289429:A33S	ENSP00000289429:A33S	A	+	1	0	CD1A	156491536	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.636000	0.05465	-0.297000	0.08934	-1.810000	0.00614	GCA	CD1A	-	superfamily_MHC_I/II-like_Ag-recog	ENSG00000158477		0.468	CD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD1A	HGNC	protein_coding	OTTHUMT00000046349.2		0.00	40	0	G	NM_001763		158224912	+1			no_errors	ENST00000289429	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.000	T
CD1E	913	genome.wustl.edu	37	1	158324338	158324338	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:158324338T>G	ENST00000368167.3	+	2	469	c.230T>G	c.(229-231)cTg>cGg	p.L77R	CD1E_ENST00000434258.1_Missense_Mutation_p.L75R|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000368166.3_Intron|CD1E_ENST00000368165.3_Missense_Mutation_p.L77R|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368161.3_Missense_Mutation_p.L77R|CD1E_ENST00000444681.2_Intron|CD1E_ENST00000464822.1_Intron|CD1E_ENST00000368163.3_Missense_Mutation_p.L77R|CD1E_ENST00000452291.2_Intron|CD1E_ENST00000368160.3_Missense_Mutation_p.L77R|CD1E_ENST00000368155.3_Missense_Mutation_p.L77R|CD1E_ENST00000368156.1_Missense_Mutation_p.L77R	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	77					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					ATCCGCTTTCTGAAGCCCTGG	0.517																																																	0													57.0	62.0	60.0					1																	158324338		2145	4285	6430	SO:0001583	missense	0			AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.230T>G	1.37:g.158324338T>G	ENSP00000357149:p.Leu77Arg		B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.L77R	ENST00000368167.3	37	c.230	CCDS41417.1	1	.	.	.	.	.	.	.	.	.	.	T	12.86	2.065369	0.36470	.	.	ENSG00000158488	ENST00000434258;ENST00000368167;ENST00000368165;ENST00000368163;ENST00000368160;ENST00000368161;ENST00000368156;ENST00000368155	T;T;T;T;T;T;T;T	0.08193	3.22;3.22;3.12;3.22;3.22;3.22;3.34;3.31	3.8	1.31	0.21738	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.267886	0.20027	N	0.100782	T	0.08846	0.0219	M	0.77103	2.36	0.09310	N	1	B;D;D;P;B;P;B;B	0.63046	0.313;0.985;0.992;0.515;0.204;0.843;0.325;0.356	B;P;P;P;B;B;B;B	0.55824	0.089;0.785;0.785;0.475;0.107;0.291;0.108;0.238	T	0.07501	-1.0769	10	0.56958	D	0.05	-2.6472	6.2929	0.21069	0.4063:0.0:0.0:0.5937	.	75;77;77;77;77;77;77;77	E7ET31;P15812-5;P15812-7;P15812-2;P15812;P15812-3;P15812-6;P15812-4	.;.;.;.;CD1E_HUMAN;.;.;.	R	75;77;77;77;77;77;77;77	ENSP00000401957:L75R;ENSP00000357149:L77R;ENSP00000357147:L77R;ENSP00000357145:L77R;ENSP00000357142:L77R;ENSP00000357143:L77R;ENSP00000357138:L77R;ENSP00000357137:L77R	ENSP00000357137:L77R	L	+	2	0	CD1E	156590962	0.019000	0.18553	0.002000	0.10522	0.681000	0.39784	1.189000	0.32114	0.247000	0.21414	0.460000	0.39030	CTG	CD1E	-	superfamily_MHC_I/II-like_Ag-recog	ENSG00000158488		0.517	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD1E	HGNC	protein_coding	OTTHUMT00000046353.3	-	0.00	56	0	T	NM_030893		158324338	+1	tier1	-	no_errors	ENST00000368167	ensembl	human	known	74_37	missense	23.81	32	10	SNP	0.002	G
CDC6	990	genome.wustl.edu	37	17	38449839	38449839	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:38449839G>T	ENST00000209728.4	+	5	1263	c.792G>T	c.(790-792)atG>atT	p.M264I		NM_001254.3	NP_001245.1	Q99741	CDC6_HUMAN	cell division cycle 6	264					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|positive regulation of chromosome segregation (GO:0051984)|positive regulation of cytokinesis (GO:0032467)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|traversing start control point of mitotic cell cycle (GO:0007089)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|kinase binding (GO:0019900)|nucleotide binding (GO:0000166)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	21						AGGACATGATGAGGAAATTGG	0.473																																																	0													94.0	86.0	89.0					17																	38449839		2203	4300	6503	SO:0001583	missense	0			U77949	CCDS11365.1	17q21.3	2013-01-17	2013-01-17		ENSG00000094804	ENSG00000094804			1744	protein-coding gene	gene with protein product		602627	"""CDC6 (cell division cycle 6, S. cerevisiae) homolog"", ""CDC6 cell division cycle 6 homolog (S. cerevisiae)"", ""cell division cycle 6 homolog (S. cerevisiae)"""	CDC18L		8990175, 9566895	Standard	NM_001254		Approved		uc002huj.1	Q99741	OTTHUMG00000133324	ENST00000209728.4:c.792G>T	17.37:g.38449839G>T	ENSP00000209728:p.Met264Ile		Q8TB30	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Cdc6_C_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pirsf_Cell_div_Cdc6/18	p.M264I	ENST00000209728.4	37	c.792	CCDS11365.1	17	.	.	.	.	.	.	.	.	.	.	G	11.83	1.756650	0.31137	.	.	ENSG00000094804	ENST00000209728	T	0.54866	0.55	6.17	5.2	0.72013	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.279534	0.44902	D	0.000418	T	0.26231	0.0640	N	0.03154	-0.405	0.32649	N	0.519663	B	0.02656	0.0	B	0.06405	0.002	T	0.14755	-1.0461	10	0.52906	T	0.07	-13.3699	5.9945	0.19487	0.0735:0.133:0.6561:0.1375	.	264	Q99741	CDC6_HUMAN	I	264	ENSP00000209728:M264I	ENSP00000209728:M264I	M	+	3	0	CDC6	35703365	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.725000	0.38074	2.941000	0.99782	0.655000	0.94253	ATG	CDC6	-	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pirsf_Cell_div_Cdc6/18	ENSG00000094804		0.473	CDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC6	HGNC	protein_coding	OTTHUMT00000257129.1	-	0.00	76	0	G			38449839	+1	tier1	-	no_errors	ENST00000209728	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
CDKN2A	1029	genome.wustl.edu	37	9	21971025	21971026	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	GC	GC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:21971025_21971026delGC	ENST00000304494.5	-	2	602_603	c.332_333delGC	c.(331-333)ggcfs	p.G111fs	CDKN2A_ENST00000498124.1_Frame_Shift_Del_p.G111fs|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000494262.1_Frame_Shift_Del_p.G60fs|CDKN2A_ENST00000497750.1_Frame_Shift_Del_p.G60fs|CDKN2A_ENST00000579122.1_Frame_Shift_Del_p.G111fs|CDKN2A_ENST00000579755.1_Frame_Shift_Del_p.P126fs|CDKN2A_ENST00000498628.2_Frame_Shift_Del_p.G60fs|CDKN2A_ENST00000361570.3_Frame_Shift_Del_p.P167fs|CDKN2A_ENST00000578845.2_Frame_Shift_Del_p.G60fs|CDKN2A_ENST00000479692.2_Frame_Shift_Del_p.G60fs|CDKN2A_ENST00000446177.1_Frame_Shift_Del_p.G111fs|CDKN2A_ENST00000530628.2_Frame_Shift_Del_p.P126fs	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	111					cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.G111G(3)|p.H83fs*2(2)|p.G111D(1)|p.D105fs*8(1)|p.0(1)|p.P167S(1)|p.A68fs*3(1)|p.R107fs*33(1)|p.R112fs*32(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CGGGCAGACGGCCCCAGGCATC	0.738		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																																							1371	Whole gene deletion(1316)|Unknown(44)|Deletion - Frameshift(6)|Substitution - coding silent(3)|Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(283)|skin(174)|central_nervous_system(167)|lung(148)|urinary_tract(92)|bone(74)|soft_tissue(57)|pleura(51)|oesophagus(51)|upper_aerodigestive_tract(50)|ovary(36)|pancreas(33)|kidney(32)|breast(32)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(9)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)																																								SO:0001589	frameshift_variant	0			L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.332_333delGC	9.37:g.21971025_21971026delGC	ENSP00000307101:p.Gly111fs		A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Frame_Shift_Del	DEL	pfam_Cyclin_kinase-Inhib_2A	p.P167fs	ENST00000304494.5	37	c.499_498	CCDS6510.1	9																																																																																			CDKN2A	-	NULL	ENSG00000147889		0.738	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDKN2A	HGNC	protein_coding	OTTHUMT00000051915.1		0.00	62	0	GC	NM_000077		21971026	-1	tier1		no_errors	ENST00000361570	ensembl	human	known	74_37	frame_shift_del	47.06	18	16	DEL	0.998:1.000	-
CHD1	1105	genome.wustl.edu	37	5	98223808	98223808	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:98223808C>T	ENST00000284049.3	-	16	2629	c.2480G>A	c.(2479-2481)cGt>cAt	p.R827H	RNU6-402P_ENST00000410678.1_RNA	NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	827	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	GGGGAATTGACGATATTTCAA	0.289																																																	0													68.0	69.0	69.0					5																	98223808		2202	4299	6501	SO:0001583	missense	0			AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.2480G>A	5.37:g.98223808C>T	ENSP00000284049:p.Arg827His		Q17RZ3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R827H	ENST00000284049.3	37	c.2480	CCDS34204.1	5	.	.	.	.	.	.	.	.	.	.	C	25.3	4.627436	0.87560	.	.	ENSG00000153922	ENST00000284049	T	0.76578	-1.03	5.11	5.11	0.69529	Helicase, C-terminal (3);	0.000000	0.34460	U	0.003953	D	0.88213	0.6376	M	0.76433	2.335	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.89600	0.3834	10	0.87932	D	0	.	18.548	0.91054	0.0:1.0:0.0:0.0	.	827	O14646	CHD1_HUMAN	H	827	ENSP00000284049:R827H	ENSP00000284049:R827H	R	-	2	0	CHD1	98251708	0.998000	0.40836	1.000000	0.80357	0.851000	0.48451	3.763000	0.55257	2.381000	0.81170	0.467000	0.42956	CGT	CHD1	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	ENSG00000153922		0.289	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1	HGNC	protein_coding	OTTHUMT00000370295.1		0.00	68	0	C	NM_001270		98223808	-1			no_errors	ENST00000284049	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
CHD6	84181	genome.wustl.edu	37	20	40045933	40045933	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr20:40045933C>T	ENST00000373233.3	-	32	6361	c.6184G>A	c.(6184-6186)Gga>Aga	p.G2062R	CHD6_ENST00000480022.1_5'Flank	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2062					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				CCAATGTCTCCTGTGATGCCC	0.473																																																	0													122.0	124.0	123.0					20																	40045933		2203	4300	6503	SO:0001583	missense	0			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.6184G>A	20.37:g.40045933C>T	ENSP00000362330:p.Gly2062Arg		Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_BRK_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.G2062R	ENST00000373233.3	37	c.6184	CCDS13317.1	20	.	.	.	.	.	.	.	.	.	.	C	19.16	3.774344	0.69992	.	.	ENSG00000124177	ENST00000373233	D	0.86366	-2.11	5.44	5.44	0.79542	.	0.000000	0.56097	D	0.000032	D	0.93070	0.7794	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93124	0.6527	10	0.66056	D	0.02	-18.2481	19.623	0.95667	0.0:1.0:0.0:0.0	.	2062	Q8TD26	CHD6_HUMAN	R	2062	ENSP00000362330:G2062R	ENSP00000362330:G2062R	G	-	1	0	CHD6	39479347	0.976000	0.34144	0.818000	0.32626	0.158000	0.22134	6.224000	0.72265	2.702000	0.92279	0.655000	0.94253	GGA	CHD6	-	NULL	ENSG00000124177		0.473	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	HGNC	protein_coding	OTTHUMT00000079270.1		0.00	44	0	C			40045933	-1			no_errors	ENST00000373233	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.997	T
CHL1	10752	genome.wustl.edu	37	3	382518	382518	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr3:382518G>T	ENST00000256509.2	+	6	1069	c.427G>T	c.(427-429)Gtg>Ttg	p.V143L	CHL1_ENST00000397491.2_Missense_Mutation_p.V143L	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.V143L(2)		NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		CCCTCTTGAAGTGGAGGAGGG	0.368																																																	2	Substitution - Missense(2)	lung(2)											64.0	62.0	63.0					3																	382518		2203	4300	6503	SO:0001583	missense	0			AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.427G>T	3.37:g.382518G>T	ENSP00000256509:p.Val143Leu		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V143L	ENST00000256509.2	37	c.427	CCDS2556.1	3	.	.	.	.	.	.	.	.	.	.	G	27.9	4.873756	0.91664	.	.	ENSG00000134121	ENST00000256509;ENST00000397491;ENST00000435603	T;T;T	0.80123	0.8;0.8;-1.34	5.2	5.2	0.72013	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.89619	0.6767	M	0.80616	2.505	0.80722	D	1	D;P;D	0.89917	0.972;0.927;1.0	P;P;D	0.91635	0.851;0.634;0.999	D	0.88648	0.3180	10	0.33940	T	0.23	.	16.8964	0.86101	0.0:0.0:1.0:0.0	.	143;143;143	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	L	143	ENSP00000256509:V143L;ENSP00000380628:V143L;ENSP00000397445:V143L	ENSP00000256509:V143L	V	+	1	0	CHL1	357518	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	7.036000	0.76524	2.404000	0.81709	0.650000	0.86243	GTG	CHL1	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000134121		0.368	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHL1	HGNC	protein_coding	OTTHUMT00000207155.2		0.00	44	0	G	NM_006614		382518	+1			no_errors	ENST00000256509	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	T
CLCN7	1186	genome.wustl.edu	37	16	1498746	1498746	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr16:1498746G>T	ENST00000382745.4	-	20	2424	c.1819C>A	c.(1819-1821)Cag>Aag	p.Q607K	CLCN7_ENST00000448525.1_Missense_Mutation_p.Q583K|CLCN7_ENST00000262318.8_Missense_Mutation_p.Q583K|LA16c-390E6.5_ENST00000566287.1_RNA	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	607					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				CTCTGCAGCTGAATGTGCATG	0.677																																																	0													74.0	76.0	75.0					16																	1498746		2197	4300	6497	SO:0001583	missense	0			Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.1819C>A	16.37:g.1498746G>T	ENSP00000372193:p.Gln607Lys		A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Missense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_CBS_dom,superfamily_Cl-channel_core,smart_CBS_dom,prints_Cl-channel_volt-gated,prints_Cl_channel-7	p.Q607K	ENST00000382745.4	37	c.1819	CCDS32361.1	16	.	.	.	.	.	.	.	.	.	.	G	9.154	1.017066	0.19355	.	.	ENSG00000103249	ENST00000448525;ENST00000262318;ENST00000382745;ENST00000428756	D;D	0.92545	-3.06;-3.06	5.27	5.27	0.74061	Chloride channel, core (2);	0.049108	0.85682	D	0.000000	T	0.79986	0.4541	N	0.04508	-0.205	0.54753	D	0.999982	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.09377	0.002;0.001;0.004	T	0.75068	-0.3448	10	0.08599	T	0.76	-37.1228	12.542	0.56177	0.0:0.0:0.8333:0.1667	.	583;607;56	E9PDB9;P51798;B3KUD9	.;CLCN7_HUMAN;.	K	583;560;607;549	ENSP00000410907:Q583K;ENSP00000372193:Q607K	ENSP00000262318:Q560K	Q	-	1	0	CLCN7	1438747	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.752000	0.68728	2.451000	0.82905	0.561000	0.74099	CAG	CLCN7	-	superfamily_Cl-channel_core,prints_Cl-channel_volt-gated	ENSG00000103249		0.677	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN7	HGNC	protein_coding	OTTHUMT00000103598.2	-	0.00	121	0	G	NM_001287		1498746	-1	tier1	-	no_errors	ENST00000382745	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
CLDN16	10686	genome.wustl.edu	37	3	190122688	190122688	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr3:190122688G>A	ENST00000264734.2	+	3	813	c.565G>A	c.(565-567)Gtt>Att	p.V189I	CLDN16_ENST00000468220.1_3'UTR|CLDN16_ENST00000456423.1_Intron	NM_006580.3	NP_006571.1	Q9Y5I7	CLD16_HUMAN	claudin 16	189					calcium-independent cell-cell adhesion (GO:0016338)|cellular metal ion homeostasis (GO:0006875)|excretion (GO:0007588)|magnesium ion transport (GO:0015693)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|skin(1)	19	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		CATCTGCTTTGTTGCTGGAGC	0.507																																																	0													138.0	124.0	129.0					3																	190122688		2203	4300	6503	SO:0001583	missense	0			AF152101	CCDS3296.1	3q28	2008-12-10			ENSG00000113946	ENSG00000113946		"""Claudins"""	2037	protein-coding gene	gene with protein product	"""paracellin-1"", ""hypomagnesemia 3, with hypercalciuria and nephrocalcinosis"""	603959				10390358	Standard	NM_006580		Approved	PCLN1, HOMG3	uc003fsi.3	Q9Y5I7	OTTHUMG00000156215	ENST00000264734.2:c.565G>A	3.37:g.190122688G>A	ENSP00000264734:p.Val189Ile			Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin16,prints_Claudin	p.V189I	ENST00000264734.2	37	c.565	CCDS3296.1	3	.	.	.	.	.	.	.	.	.	.	G	13.88	2.369336	0.42003	.	.	ENSG00000113946	ENST00000264734	D	0.89875	-2.58	5.93	4.16	0.48862	.	0.159866	0.43110	N	0.000617	D	0.85877	0.5799	M	0.72894	2.215	0.80722	D	1	B	0.25772	0.134	B	0.17433	0.018	T	0.80596	-0.1312	10	0.36615	T	0.2	-3.0013	8.8427	0.35151	0.2234:0.0:0.7766:0.0	.	189	Q9Y5I7	CLD16_HUMAN	I	189	ENSP00000264734:V189I	ENSP00000264734:V189I	V	+	1	0	CLDN16	191605382	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.283000	0.43470	0.848000	0.35191	0.655000	0.94253	GTT	CLDN16	-	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	ENSG00000113946		0.507	CLDN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN16	HGNC	protein_coding	OTTHUMT00000343519.1	-	0.00	60	0	G	NM_006580		190122688	+1	tier1	-	no_errors	ENST00000264734	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	A
COG4	25839	genome.wustl.edu	37	16	70551549	70551549	+	Missense_Mutation	SNP	G	G	A	rs149620212	byFrequency	TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr16:70551549G>A	ENST00000323786.5	-	3	370	c.349C>T	c.(349-351)Cgt>Tgt	p.R117C	COG4_ENST00000564653.1_Missense_Mutation_p.R117C|COG4_ENST00000393612.4_Missense_Mutation_p.R113C	NM_001195139.1|NM_015386.2	NP_001182068.1|NP_056201.2	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	113	Interacts with STX5.				Golgi organization (GO:0007030)|Golgi vesicle prefusion complex stabilization (GO:0048213)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)		p.R117C(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|pancreas(1)|prostate(2)	33		Ovarian(137;0.0694)				TCAAGCTGACGAACTTTGCTG	0.458													g|||	2	0.000399361	0.0	0.0014	5008	,	,		15606	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	large_intestine(1)							CYS/ARG,CYS/ARG	0,4396		0,0,2198	137.0	121.0	126.0		349,349	5.3	1.0	16	dbSNP_134	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	COG4	NM_001195139.1,NM_015386.2	180,180	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	117/769,117/790	70551549	1,12995	2198	4300	6498	SO:0001583	missense	0			AL050101	CCDS10892.2, CCDS73909.1	16q22.1	2013-09-20			ENSG00000103051	ENSG00000103051		"""Components of oligomeric golgi complex"""	18620	protein-coding gene	gene with protein product		606976				11980916	Standard	NM_015386		Approved	COD1, DKFZP586E1519	uc002ezc.3	Q9H9E3	OTTHUMG00000128515	ENST00000323786.5:c.349C>T	16.37:g.70551549G>A	ENSP00000315775:p.Arg117Cys		B4DMN8|C9JS23|Q96D40|Q9BRF0|Q9BVZ2|Q9H5Y4|Q9Y3W3	Missense_Mutation	SNP	pfam_COG_su4,smart_COG_su4	p.R117C	ENST00000323786.5	37	c.349	CCDS10892.2	16	.	.	.	.	.	.	.	.	.	.	g	20.6	4.015934	0.75161	0.0	1.16E-4	ENSG00000103051	ENST00000323786;ENST00000338984;ENST00000393612;ENST00000534772	T;T;T	0.47869	0.83;0.83;0.83	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.72953	0.3525	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.991;0.999	T	0.77365	-0.2615	10	0.87932	D	0	-5.2429	19.0495	0.93038	0.0:0.0:1.0:0.0	.	112;113	Q6PIW8;Q9H9E3	.;COG4_HUMAN	C	117;113;113;40	ENSP00000315775:R117C;ENSP00000377236:R113C;ENSP00000461912:R40C	ENSP00000315775:R117C	R	-	1	0	COG4	69109050	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	4.144000	0.58057	2.496000	0.84212	0.450000	0.29827	CGT	COG4	-	NULL	ENSG00000103051		0.458	COG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG4	HGNC	protein_coding	OTTHUMT00000250326.3	-	0.00	31	0	G			70551549	-1	tier1	rs149620212	no_errors	ENST00000323786	ensembl	human	known	74_37	missense	24.14	22	7	SNP	1.000	A
COL21A1	81578	genome.wustl.edu	37	6	55990409	55990409	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:55990409C>A	ENST00000244728.5	-	14	2003	c.1606G>T	c.(1606-1608)Ggt>Tgt	p.G536C	COL21A1_ENST00000370819.1_Missense_Mutation_p.G533C|COL21A1_ENST00000535941.1_Missense_Mutation_p.G536C	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	536	Collagen-like 2.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			CCTTTGGCACCCATTTCACCC	0.274																																																	0													90.0	78.0	82.0					6																	55990409		1802	4072	5874	SO:0001583	missense	0			AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.1606G>T	6.37:g.55990409C>A	ENSP00000244728:p.Gly536Cys		A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.G536C	ENST00000244728.5	37	c.1606	CCDS55025.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.87|10.87	1.471460|1.471460	0.26423|0.26423	.|.	.|.	ENSG00000124749|ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811|ENST00000456983	D;D;D|.	0.99637|.	-6.29;-6.29;-6.29|.	4.6|4.6	4.6|4.6	0.57074|0.57074	.|.	0.000000|.	0.53938|.	D|.	0.000047|.	D|D	0.86167|0.86167	0.5868|0.5868	H|H	0.97983|0.97983	4.12|4.12	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.90569|0.90569	0.4521|0.4521	10|5	0.87932|.	D|.	0|.	.|.	13.2756|13.2756	0.60186|0.60186	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	533;536|.	Q96P44-3;Q96P44|.	.;COLA1_HUMAN|.	C|C	536;533;536;533|99	ENSP00000244728:G536C;ENSP00000359855:G533C;ENSP00000444384:G536C|.	ENSP00000244728:G536C|.	G|W	-|-	1|3	0|0	COL21A1|COL21A1	56098368|56098368	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.397000|0.397000	0.30659|0.30659	3.876000|3.876000	0.56115|0.56115	2.279000|2.279000	0.76181|0.76181	0.650000|0.650000	0.86243|0.86243	GGT|TGG	COL21A1	-	pfam_Collagen	ENSG00000124749		0.274	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	COL21A1	HGNC	protein_coding	OTTHUMT00000041004.2	-	0.00	76	0	C			55990409	-1	tier1	-	no_errors	ENST00000244728	ensembl	human	known	74_37	missense	10.71	75	9	SNP	1.000	A
COL12A1	1303	genome.wustl.edu	37	6	75866113	75866113	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:75866113T>G	ENST00000322507.8	-	15	3419	c.3110A>C	c.(3109-3111)aAg>aCg	p.K1037T	COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000483888.2_Missense_Mutation_p.K1037T|COL12A1_ENST00000416123.2_Missense_Mutation_p.K1037T	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1037	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						AACCATTTGCTTCCCTCTCCC	0.468																																																	0													244.0	228.0	233.0					6																	75866113		1967	4157	6124	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.3110A>C	6.37:g.75866113T>G	ENSP00000325146:p.Lys1037Thr		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.K1037T	ENST00000322507.8	37	c.3110	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	t	12.79	2.043957	0.36085	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.57273	0.41;0.41;0.41	5.46	2.76	0.32466	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.067283	0.64402	D	0.000011	T	0.22898	0.0553	N	0.17800	0.525	0.26627	N	0.972532	B	0.27192	0.171	B	0.36608	0.229	T	0.23332	-1.0191	10	0.56958	D	0.05	.	11.1643	0.48533	0.0:0.7979:0.0:0.2021	.	1037	Q99715	COCA1_HUMAN	T	1037	ENSP00000325146:K1037T;ENSP00000412864:K1037T;ENSP00000421216:K1037T	ENSP00000325146:K1037T	K	-	2	0	COL12A1	75922833	0.755000	0.28372	0.670000	0.29842	0.008000	0.06430	1.934000	0.40163	0.279000	0.22186	-0.212000	0.12691	AAG	COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.468	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	-	0.00	81	0	T	NM_004370		75866113	-1	tier1	-	no_errors	ENST00000322507	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.873	G
CORO2A	7464	genome.wustl.edu	37	9	100887124	100887124	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:100887124G>A	ENST00000343933.5	-	12	1767	c.1510C>T	c.(1510-1512)Cga>Tga	p.R504*	CORO2A_ENST00000375077.4_Nonsense_Mutation_p.R504*	NM_003389.3	NP_003380.3	Q92828	COR2A_HUMAN	coronin, actin binding protein, 2A	504					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	actin cytoskeleton (GO:0015629)|transcriptional repressor complex (GO:0017053)	actin filament binding (GO:0051015)			endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|skin(4)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				TGGACCTCTCGCTGGGTCAAC	0.572																																																	0													76.0	65.0	69.0					9																	100887124		2203	4300	6503	SO:0001587	stop_gained	0			U57057	CCDS6735.1	9q22.3	2013-01-10	2001-11-28		ENSG00000106789	ENSG00000106789		"""Coronins"", ""WD repeat domain containing"""	2255	protein-coding gene	gene with protein product	"""coronin 2A"", ""coronin-like protein B"", ""WD protein IR10"", ""WD-repeat protein 2"""	602159	"""coronin, actin-binding protein, 2A"""			8985118	Standard	NM_052820		Approved	IR10, WDR2	uc004aym.3	Q92828	OTTHUMG00000020340	ENST00000343933.5:c.1510C>T	9.37:g.100887124G>A	ENSP00000343746:p.Arg504*		Q5TBR5|Q92829|Q9BWS5	Nonsense_Mutation	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R504*	ENST00000343933.5	37	c.1510	CCDS6735.1	9	.	.	.	.	.	.	.	.	.	.	G	37	6.456900	0.97581	.	.	ENSG00000106789	ENST00000343933;ENST00000375077	.	.	.	5.6	2.31	0.28768	.	0.100945	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.9132	13.6111	0.62078	0.0:0.0:0.4387:0.5613	.	.	.	.	X	504	.	ENSP00000343746:R504X	R	-	1	2	CORO2A	99926945	0.929000	0.31497	1.000000	0.80357	0.996000	0.88848	1.213000	0.32407	0.645000	0.30675	-0.274000	0.10170	CGA	CORO2A	-	NULL	ENSG00000106789		0.572	CORO2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO2A	HGNC	protein_coding	OTTHUMT00000053357.1	-	0.00	49	0	G	NM_003389		100887124	-1	tier1	-	no_errors	ENST00000343933	ensembl	human	known	74_37	nonsense	9.30	39	4	SNP	1.000	A
CPT1A	1374	genome.wustl.edu	37	11	68540864	68540864	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:68540864C>T	ENST00000265641.5	-	14	1763	c.1609G>A	c.(1609-1611)Gca>Aca	p.A537T	CPT1A_ENST00000540367.1_Missense_Mutation_p.A537T|CPT1A_ENST00000537756.2_5'UTR|CPT1A_ENST00000539743.1_Missense_Mutation_p.A537T|CPT1A_ENST00000376618.2_Missense_Mutation_p.A537T	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	537					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	AGAAGATTTGCGGTGTTCAGG	0.473																																																	0													109.0	90.0	96.0					11																	68540864		2200	4294	6494	SO:0001583	missense	0			L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.1609G>A	11.37:g.68540864C>T	ENSP00000265641:p.Ala537Thr		Q8TCU0|Q9BWK0	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.A537T	ENST00000265641.5	37	c.1609	CCDS8185.1	11	.	.	.	.	.	.	.	.	.	.	C	22.4	4.278647	0.80692	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	D;D;D;D	0.89270	-2.49;-2.49;-2.49;-2.49	4.79	3.87	0.44632	.	0.000000	0.85682	D	0.000000	D	0.94598	0.8259	M	0.91920	3.255	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.70716	0.966;0.97	D	0.93742	0.7051	10	0.23891	T	0.37	.	13.4509	0.61169	0.0:0.9228:0.0:0.0772	.	537;537	P50416;P50416-2	CPT1A_HUMAN;.	T	537	ENSP00000439084:A537T;ENSP00000365803:A537T;ENSP00000265641:A537T;ENSP00000446108:A537T	ENSP00000265641:A537T	A	-	1	0	CPT1A	68297440	1.000000	0.71417	0.018000	0.16275	0.897000	0.52465	7.458000	0.80787	1.139000	0.42245	0.297000	0.19635	GCA	CPT1A	-	pfam_Carn_acyl_trans	ENSG00000110090		0.473	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CPT1A	HGNC	protein_coding	OTTHUMT00000397457.2	-	0.00	61	0	C	NM_001876		68540864	-1	tier1	-	no_errors	ENST00000265641	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.996	T
CRB1	23418	genome.wustl.edu	37	1	197396706	197396706	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:197396706T>G	ENST00000367400.3	+	7	2386	c.2251T>G	c.(2251-2253)Tta>Gta	p.L751V	CRB1_ENST00000367397.1_Missense_Mutation_p.L132V|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000543483.1_3'UTR|CRB1_ENST00000367399.2_Missense_Mutation_p.L639V|CRB1_ENST00000544212.1_Missense_Mutation_p.L232V|CRB1_ENST00000535699.1_Missense_Mutation_p.L682V	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	751	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						ACCATCAGGCTTACTTCTAGC	0.463																																																	0													78.0	71.0	73.0					1																	197396706		2203	4300	6503	SO:0001583	missense	0				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2251T>G	1.37:g.197396706T>G	ENSP00000356370:p.Leu751Val		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.L751V	ENST00000367400.3	37	c.2251	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	T	12.09	1.833114	0.32421	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	T;T;T;T;T	0.80214	-1.35;-1.35;-1.35;-1.35;-1.35	5.75	4.63	0.57726	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.79845	0.4516	M	0.77616	2.38	0.40483	D	0.980461	P;P;P;P	0.51351	0.94;0.925;0.944;0.892	P;B;P;P	0.47044	0.535;0.352;0.475;0.492	T	0.76274	-0.3019	9	0.15952	T	0.53	.	6.9878	0.24737	0.1318:0.0698:0.0:0.7984	.	682;639;400;751	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	V	682;751;639;232;132;400	ENSP00000438786:L682V;ENSP00000356370:L751V;ENSP00000356369:L639V;ENSP00000444556:L232V;ENSP00000356367:L132V	ENSP00000356367:L132V	L	+	1	2	CRB1	195663329	0.854000	0.29725	0.976000	0.42696	0.035000	0.12851	0.644000	0.24766	0.992000	0.38840	-0.297000	0.09499	TTA	CRB1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000134376		0.463	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2	-	0.00	48	0	T	NM_201253		197396706	+1	tier1	-	no_errors	ENST00000367400	ensembl	human	known	74_37	missense	15.56	38	7	SNP	0.999	G
CROT	54677	genome.wustl.edu	37	7	86990707	86990707	+	Splice_Site	SNP	T	T	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr7:86990707T>C	ENST00000331536.3	+	5	427	c.242T>C	c.(241-243)cTg>cCg	p.L81P	CROT_ENST00000419147.2_Splice_Site_p.L109P|CROT_ENST00000442291.1_Splice_Site_p.L81P	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase	81					carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	TTCTTTTAGCTGGAAGAGTGG	0.363																																																	0													133.0	122.0	126.0					7																	86990707		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653	ENST00000331536.3:c.241-1T>C	7.37:g.86990707T>C			A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.L81P	ENST00000331536.3	37	c.242	CCDS5604.1	7	.	.	.	.	.	.	.	.	.	.	T	23.6	4.437092	0.83885	.	.	ENSG00000005469	ENST00000419147;ENST00000331536;ENST00000442291	D;D;D	0.91124	-2.79;-2.79;-2.79	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.96775	0.8947	H	0.94503	3.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.97732	1.0203	10	0.87932	D	0	-10.3524	16.6407	0.85098	0.0:0.0:0.0:1.0	.	109;81	E7EQF2;Q9UKG9	.;OCTC_HUMAN	P	109;81;81	ENSP00000413575:L109P;ENSP00000331981:L81P;ENSP00000411983:L81P	ENSP00000331981:L81P	L	+	2	0	CROT	86828643	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.740000	0.84986	2.326000	0.78906	0.533000	0.62120	CTG	CROT	-	pfam_Carn_acyl_trans	ENSG00000005469		0.363	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROT	HGNC	protein_coding	OTTHUMT00000253485.1	-	0.00	63	0	T	NM_021151	Missense_Mutation	86990707	+1	tier1	-	no_errors	ENST00000331536	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	C
CREB3L2	64764	genome.wustl.edu	37	7	137565290	137565290	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr7:137565290C>T	ENST00000330387.6	-	12	1846	c.1495G>A	c.(1495-1497)Gcc>Acc	p.A499T		NM_194071.3	NP_919047.2	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like 2	499					cartilage development (GO:0051216)|chondrocyte differentiation (GO:0002062)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of transcription, DNA-templated (GO:0045893)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cAMP response element binding (GO:0035497)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)		FUS/CREB3L2(158)	breast(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						TCCAGTTTGGCGCTGACCCTG	0.458			T	FUS	fibromyxoid sarcoma																																			Dom	yes		7	7q34	64764	cAMP responsive element binding protein 3-like 2		M	0													124.0	97.0	106.0					7																	137565290		2203	4300	6503	SO:0001583	missense	0			AJ549092	CCDS34760.1, CCDS59083.1	7q34	2013-01-10			ENSG00000182158	ENSG00000182158		"""basic leucine zipper proteins"""	23720	protein-coding gene	gene with protein product		608834					Standard	NM_194071		Approved	BBF2H7, TCAG_1951439	uc003vtw.3	Q70SY1	OTTHUMG00000155744	ENST00000330387.6:c.1495G>A	7.37:g.137565290C>T	ENSP00000329140:p.Ala499Thr		Q6P454|Q6ZMR6	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.A499T	ENST00000330387.6	37	c.1495	CCDS34760.1	7	.	.	.	.	.	.	.	.	.	.	C	13.53	2.264711	0.40095	.	.	ENSG00000182158	ENST00000330387	T	0.57752	0.38	5.3	-7.39	0.01402	.	1.247950	0.05251	N	0.514033	T	0.26412	0.0645	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.07195	-1.0785	10	0.12766	T	0.61	-0.4631	9.9392	0.41570	0.1659:0.139:0.0:0.6951	.	499	Q70SY1	CR3L2_HUMAN	T	499	ENSP00000329140:A499T	ENSP00000329140:A499T	A	-	1	0	CREB3L2	137215830	0.672000	0.27530	0.318000	0.25279	0.994000	0.84299	-0.646000	0.05403	-2.087000	0.00862	-0.136000	0.14681	GCC	CREB3L2	-	NULL	ENSG00000182158		0.458	CREB3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREB3L2	HGNC	protein_coding	OTTHUMT00000341462.1	-	0.00	57	0	C	NM_194071		137565290	-1	tier1	-	no_errors	ENST00000330387	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.774	T
CSAD	51380	genome.wustl.edu	37	12	53553458	53553458	+	Frame_Shift_Del	DEL	G	G	-			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:53553458delG	ENST00000444623.1	-	16	1524	c.1257delC	c.(1255-1257)cccfs	p.P419fs	CSAD_ENST00000453446.2_Frame_Shift_Del_p.P419fs|CSAD_ENST00000267085.4_Frame_Shift_Del_p.P446fs|CSAD_ENST00000379846.1_Frame_Shift_Del_p.P272fs|CSAD_ENST00000379843.3_Frame_Shift_Del_p.P272fs|RP11-1136G11.8_ENST00000550908.1_lincRNA	NM_001244705.1	NP_001231634.1	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase	419					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|taurine biosynthetic process (GO:0042412)		pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(4)	14					L-Cysteine(DB00151)	CTCGCAGGCTGGGGGGTACGA	0.537											OREG0021859	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Ovarian(109;252 1546 16882 28524 44645)												0													105.0	85.0	91.0					12																	53553458		2203	4300	6503	SO:0001589	frameshift_variant	0			AB044561	CCDS8848.2, CCDS58235.1	12q13.11-q14.3	2008-08-04			ENSG00000139631	ENSG00000139631			18966	protein-coding gene	gene with protein product	"""P-selectin cytoplasmic tail-associated protein"""					15489334	Standard	NM_015989		Approved	PCAP, CSD	uc001sbz.3	Q9Y600	OTTHUMG00000048076	ENST00000444623.1:c.1257delC	12.37:g.53553458delG	ENSP00000415485:p.Pro419fs	993	A8K0U4|Q4QQH9|Q9UNJ5|Q9Y601	Frame_Shift_Del	DEL	pfam_PyrdxlP-dep_de-COase,pfam_Aminotrans_V/Cys_dSase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase	p.S447fs	ENST00000444623.1	37	c.1338	CCDS58235.1	12																																																																																			CSAD	-	superfamily_PyrdxlP-dep_Trfase	ENSG00000139631		0.537	CSAD-017	KNOWN	basic|appris_principal|CCDS	protein_coding	CSAD	HGNC	protein_coding	OTTHUMT00000343697.1		0.00	53	0	G	NM_015989		53553458	-1	tier1		no_errors	ENST00000267085	ensembl	human	known	74_37	frame_shift_del	5.77	49	3	DEL	1.000	-
CSMD1	64478	genome.wustl.edu	37	8	2986325	2986326	+	5'UTR	INS	-	-	T	rs544200463	byFrequency	TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr8:2986325_2986326insT	ENST00000523387.1	-	0	2570_2571				CSMD1_ENST00000520002.1_Intron|CSMD1_ENST00000537824.1_Intron|CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000400186.3_Intron|CSMD1_ENST00000542608.1_Intron|CSMD1_ENST00000602557.1_Intron			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1							integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCGAGTTTTTGTTTTTTTTTTA	0.332																																																	0																																										SO:0001623	5_prime_UTR_variant	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000523387.1:c.-1419->A	8.37:g.2986335_2986335dupT			Q0H0J5|Q96QU9|Q96RM4	RNA	INS	-	NULL	ENST00000523387.1	37	NULL		8																																																																																			CSMD1	-	-	ENSG00000183117		0.332	CSMD1-007	KNOWN	basic	processed_transcript	CSMD1	HGNC	protein_coding	OTTHUMT00000374659.2		0.00	30	0	-	NM_033225		2986326	-1	tier1		no_errors	ENST00000523387	ensembl	human	known	74_37	rna	13.79	25	4	INS	0.000:0.001	T
CYBB	1536	genome.wustl.edu	37	X	37655265	37655265	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chrX:37655265T>C	ENST00000378588.4	+	6	612	c.545T>C	c.(544-546)aTc>aCc	p.I182T	CYBB_ENST00000536160.1_Intron|TM4SF2_ENST00000465127.1_Intron|CYBB_ENST00000545017.1_Missense_Mutation_p.I150T	NM_000397.3	NP_000388.2	P04839	CY24B_HUMAN	cytochrome b-245, beta polypeptide	182	Ferric oxidoreductase.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|rough endoplasmic reticulum (GO:0005791)	flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|prostate(2)|skin(2)	32					Dextromethorphan(DB00514)	GGAGTTGTCATCACGCTGTGC	0.458																																																	0													169.0	126.0	141.0					X																	37655265		2202	4300	6502	SO:0001583	missense	0			X04011	CCDS14242.1	Xp21.1	2014-09-17	2008-07-29		ENSG00000165168	ENSG00000165168		"""Cytochrome b genes"""	2578	protein-coding gene	gene with protein product		300481	"""chronic granulomatous disease"""	CGD			Standard	NM_000397		Approved	GP91-PHOX, NOX2	uc004ddr.2	P04839	OTTHUMG00000033175	ENST00000378588.4:c.545T>C	X.37:g.37655265T>C	ENSP00000367851:p.Ile182Thr		A8K138|Q2PP16	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.I182T	ENST00000378588.4	37	c.545	CCDS14242.1	X	.	.	.	.	.	.	.	.	.	.	T	19.61	3.860209	0.71834	.	.	ENSG00000165168	ENST00000378588;ENST00000545017	D;D	0.90732	-2.72;-2.72	5.4	5.4	0.78164	Flavoprotein transmembrane component (1);	0.000000	0.85682	D	0.000000	D	0.95708	0.8604	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.972;0.999	D	0.96359	0.9264	10	0.87932	D	0	.	14.5291	0.67912	0.0:0.0:0.0:1.0	.	150;182	F5GWD2;P04839	.;CY24B_HUMAN	T	182;150	ENSP00000367851:I182T;ENSP00000441896:I150T	ENSP00000367851:I182T	I	+	2	0	CYBB	37540205	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	5.887000	0.69751	1.811000	0.52892	0.437000	0.28790	ATC	CYBB	-	pfam_Fe3_Rdtase_TM_dom,prints_Cyt_b245_heavy_chain	ENSG00000165168		0.458	CYBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYBB	HGNC	protein_coding	OTTHUMT00000080881.1	-	0.00	29	0	T			37655265	+1	tier1	-	no_errors	ENST00000378588	ensembl	human	known	74_37	missense	16.00	21	4	SNP	1.000	C
CYBB	1536	genome.wustl.edu	37	X	37655341	37655341	+	Silent	SNP	C	C	T	rs371655268		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chrX:37655341C>T	ENST00000378588.4	+	6	688	c.621C>T	c.(619-621)taC>taT	p.Y207Y	CYBB_ENST00000536160.1_Intron|TM4SF2_ENST00000465127.1_Intron|CYBB_ENST00000545017.1_Silent_p.Y175Y	NM_000397.3	NP_000388.2	P04839	CY24B_HUMAN	cytochrome b-245, beta polypeptide	207	Ferric oxidoreductase.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|rough endoplasmic reticulum (GO:0005791)	flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|prostate(2)|skin(2)	32					Dextromethorphan(DB00514)	TCTTTTGGTACACACATCATC	0.433																																																	0			GRCh37	CS920747	CYBB	S		C		0,3833		0,0,1631,571	249.0	182.0	205.0		621	3.7	1.0	X		205	1,6727		0,1,2427,1872	no	coding-synonymous	CYBB	NM_000397.3		0,1,4058,2443	TT,TC,CC,C		0.0149,0.0,0.0095		207/571	37655341	1,10560	2202	4300	6502	SO:0001819	synonymous_variant	0			X04011	CCDS14242.1	Xp21.1	2014-09-17	2008-07-29		ENSG00000165168	ENSG00000165168		"""Cytochrome b genes"""	2578	protein-coding gene	gene with protein product		300481	"""chronic granulomatous disease"""	CGD			Standard	NM_000397		Approved	GP91-PHOX, NOX2	uc004ddr.2	P04839	OTTHUMG00000033175	ENST00000378588.4:c.621C>T	X.37:g.37655341C>T			A8K138|Q2PP16	Silent	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.Y207	ENST00000378588.4	37	c.621	CCDS14242.1	X																																																																																			CYBB	-	pfam_Fe3_Rdtase_TM_dom,prints_Cyt_b245_heavy_chain	ENSG00000165168		0.433	CYBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYBB	HGNC	protein_coding	OTTHUMT00000080881.1	-	0.00	50	0	C			37655341	+1	tier1	-	no_errors	ENST00000378588	ensembl	human	known	74_37	silent	9.76	37	4	SNP	1.000	T
CYP4F12	66002	genome.wustl.edu	37	19	15789138	15789138	+	Missense_Mutation	SNP	C	C	T	rs200483875		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:15789138C>T	ENST00000550308.1	+	3	646	c.266C>T	c.(265-267)aCg>aTg	p.T89M	CYP4F12_ENST00000324632.10_Missense_Mutation_p.T89M	NM_023944.3	NP_076433	Q9HCS2	CP4FC_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 12	89					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|leukotriene B4 catabolic process (GO:0036101)|long-chain fatty acid metabolic process (GO:0001676)|negative regulation of blood coagulation (GO:0030195)|oxidation-reduction process (GO:0055114)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|very long-chain fatty acid metabolic process (GO:0000038)|vitamin E metabolic process (GO:0042360)|vitamin K biosynthetic process (GO:0042371)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)	p.T89M(1)		NS(1)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	41	Acute lymphoblastic leukemia(2;0.0367)				Fingolimod(DB08868)	CAGGGCTTTACGATATGGCTG	0.537																																																	1	Substitution - Missense(1)	central_nervous_system(1)											139.0	140.0	139.0					19																	15789138		2177	4281	6458	SO:0001583	missense	0			AB035130	CCDS42517.1	19p13.1	2008-02-05	2003-01-14		ENSG00000186204	ENSG00000186204		"""Cytochrome P450s"""	18857	protein-coding gene	gene with protein product		611485	"""cytochrome P450, subfamily IVF, polypeptide 12"""			11162607	Standard	NM_023944		Approved		uc002nbl.3	Q9HCS2	OTTHUMG00000164477	ENST00000550308.1:c.266C>T	19.37:g.15789138C>T	ENSP00000448998:p.Thr89Met		E7ET51|O60389|Q5JPJ7|Q9HCS1	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.T89M	ENST00000550308.1	37	c.266	CCDS42517.1	19	.	.	.	.	.	.	.	.	.	.	.	2.662	-0.279522	0.05642	.	.	ENSG00000186204	ENST00000550308;ENST00000551607;ENST00000324632	D;D;D	0.88046	-2.33;-2.33;-2.33	2.92	-5.84	0.02318	.	1.167450	0.06492	N	0.734839	T	0.71400	0.3335	N	0.25245	0.725	0.09310	N	1	B;B;B	0.19073	0.023;0.033;0.0	B;B;B	0.17722	0.019;0.019;0.001	T	0.55379	-0.8150	10	0.31617	T	0.26	.	0.2117	0.00157	0.2841:0.2343:0.1439:0.3376	.	89;89;89	B4E2R2;B4E270;Q9HCS2	.;.;CP4FC_HUMAN	M	89;42;89	ENSP00000448998:T89M;ENSP00000447922:T42M;ENSP00000321821:T89M	ENSP00000321821:T89M	T	+	2	0	CYP4F12	15650138	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.913000	0.04042	-1.588000	0.01627	-2.605000	0.00161	ACG	CYP4F12	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000186204		0.537	CYP4F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F12	HGNC	protein_coding	OTTHUMT00000378938.9		0.00	86	0	C			15789138	+1			no_errors	ENST00000324632	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.000	T
DAB2IP	153090	genome.wustl.edu	37	9	124535156	124535156	+	Silent	SNP	C	C	T	rs377593194		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:124535156C>T	ENST00000408936.3	+	12	2531	c.2349C>T	c.(2347-2349)gcC>gcT	p.A783A	DAB2IP_ENST00000259371.2_Silent_p.A755A|DAB2IP_ENST00000309989.1_Silent_p.A659A			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	783	Necessary for interaction with AKT1.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						AGCTGGTGGCCGGGTGGCCGG	0.756																																																	0								C	,	1,4183		0,1,2091	7.0	9.0	9.0		2265,1977	-5.6	1.0	9		9	2,8182		0,2,4090	no	coding-synonymous,coding-synonymous	DAB2IP	NM_032552.2,NM_138709.1	,	0,3,6181	TT,TC,CC		0.0244,0.0239,0.0243	,	755/1133,659/1066	124535156	3,12365	2092	4092	6184	SO:0001819	synonymous_variant	0			AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.2349C>T	9.37:g.124535156C>T			A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Silent	SNP	pfam_DUF3498,pfam_RasGAP,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.A783	ENST00000408936.3	37	c.2349		9																																																																																			DAB2IP	-	pfam_DUF3498	ENSG00000136848		0.756	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	DAB2IP	HGNC	protein_coding	OTTHUMT00000317857.1	-	0.00	28	0	C	NM_032552		124535156	+1	tier1	-	no_errors	ENST00000408936	ensembl	human	known	74_37	silent	44.44	10	8	SNP	0.063	T
DAO	1610	genome.wustl.edu	37	12	109293195	109293195	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:109293195C>T	ENST00000228476.3	+	10	1060	c.856C>T	c.(856-858)Cgc>Tgc	p.R286C	DAO_ENST00000551281.1_Missense_Mutation_p.R220C	NM_001917.4	NP_001908.3	P14920	OXDA_HUMAN	D-amino-acid oxidase	286					cellular nitrogen compound metabolic process (GO:0034641)|D-alanine catabolic process (GO:0055130)|D-serine catabolic process (GO:0036088)|D-serine metabolic process (GO:0070178)|dopamine biosynthetic process (GO:0042416)|glyoxylate metabolic process (GO:0046487)|leucine metabolic process (GO:0006551)|proline catabolic process (GO:0006562)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-amino-acid oxidase activity (GO:0003884)|FAD binding (GO:0071949)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|skin(1)	26					Flavin adenine dinucleotide(DB03147)	CCGGCCAGTACGCCCCCAGAT	0.468																																																	0													42.0	36.0	38.0					12																	109293195		2203	4300	6503	SO:0001583	missense	0			D11370	CCDS9122.1	12q24.11	2013-09-20			ENSG00000110887	ENSG00000110887	1.4.3.3		2671	protein-coding gene	gene with protein product		124050				1356107, 8182053	Standard	NM_001917		Approved	DAMOX	uc001tnr.4	P14920	OTTHUMG00000169360	ENST00000228476.3:c.856C>T	12.37:g.109293195C>T	ENSP00000228476:p.Arg286Cys		B2R7I5|Q16758|Q8N6R2	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase	p.R286C	ENST00000228476.3	37	c.856	CCDS9122.1	12	.	.	.	.	.	.	.	.	.	.	c	16.06	3.014861	0.54468	.	.	ENSG00000110887	ENST00000551281;ENST00000228476;ENST00000547768	T;T;T	0.81415	-1.49;-1.49;-1.49	5.14	5.14	0.70334	FAD dependent oxidoreductase (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.93167	0.7824	H	0.96970	3.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95311	0.8412	10	0.87932	D	0	-18.7759	16.0921	0.81098	0.0:1.0:0.0:0.0	.	286;269	P14920;Q7Z312	OXDA_HUMAN;.	C	220;286;163	ENSP00000446853:R220C;ENSP00000228476:R286C;ENSP00000449967:R163C	ENSP00000228476:R286C	R	+	1	0	DAO	107817324	1.000000	0.71417	0.484000	0.27391	0.089000	0.18198	5.977000	0.70492	2.409000	0.81822	0.542000	0.68232	CGC	DAO	-	pfam_FAD-dep_OxRdtase	ENSG00000110887		0.468	DAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAO	HGNC	protein_coding	OTTHUMT00000403682.1		0.00	67	0	C			109293195	+1			no_errors	ENST00000228476	ensembl	human	known	74_37	missense	5.00	57	3	SNP	0.982	T
DBF4B	80174	genome.wustl.edu	37	17	42828478	42828478	+	Silent	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:42828478C>A	ENST00000315005.3	+	14	1843	c.1705C>A	c.(1705-1707)Cga>Aga	p.R569R	DBF4B_ENST00000393547.2_Intron	NM_145663.2	NP_663696.1	Q8NFT6	DBF4B_HUMAN	DBF4 zinc finger B	569					cell cycle (GO:0007049)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of protein kinase activity (GO:0045860)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(5)	7		Prostate(33;0.0322)				ACCCATTCCCCGAACCTCACA	0.557																																																	0													132.0	110.0	117.0					17																	42828478		2203	4300	6503	SO:0001819	synonymous_variant	0			AF465820	CCDS11485.1, CCDS45706.1, CCDS45706.2	17q21.31	2014-02-17	2014-02-17		ENSG00000161692	ENSG00000161692		"""Zinc fingers, DBF-type"""	17883	protein-coding gene	gene with protein product	"""chiffon homolog B (Drosophila)"", ""zinc finger, DBF-type containing 1B"""	611661	"""DBF4 homolog B (S. cerevisiae)"""			15668232	Standard	NM_145663		Approved	FLJ13087, DRF1, ASKL1, chifb, ZDBF1B	uc002ihf.3	Q8NFT6	OTTHUMG00000165717	ENST00000315005.3:c.1705C>A	17.37:g.42828478C>A			D3DX56|Q8TEX0|Q96B19|Q9H912	Silent	SNP	pfam_Znf_DBF,superfamily_BRCT_dom,smart_Znf_DBF	p.R569	ENST00000315005.3	37	c.1705	CCDS11485.1	17																																																																																			DBF4B	-	NULL	ENSG00000161692		0.557	DBF4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DBF4B	HGNC	protein_coding	OTTHUMT00000385930.1		0.00	69	0	C	NM_025104		42828478	+1			no_errors	ENST00000315005	ensembl	human	known	74_37	silent	5.17	55	3	SNP	0.000	A
DCAF4	26094	genome.wustl.edu	37	14	73423169	73423169	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr14:73423169C>T	ENST00000358377.2	+	13	1475	c.1255C>T	c.(1255-1257)Ccc>Tcc	p.P419S	DCAF4_ENST00000353777.3_Missense_Mutation_p.P249S|DCAF4_ENST00000555042.1_Missense_Mutation_p.P413S|DCAF4_ENST00000509153.1_Missense_Mutation_p.P359S|DCAF4_ENST00000553457.1_Missense_Mutation_p.P319S|DCAF4_ENST00000394234.2_Missense_Mutation_p.P319S	NM_001163509.1|NM_015604.3	NP_001156981.1|NP_056419.2	Q8WV16	DCAF4_HUMAN	DDB1 and CUL4 associated factor 4	419					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|skin(1)	22						CGCCTACCTGCCCCTGCATGT	0.562																																																	0													96.0	57.0	71.0					14																	73423169		2203	4300	6503	SO:0001583	missense	0			BC018979	CCDS9809.1, CCDS9810.1, CCDS41968.1, CCDS41968.2, CCDS55926.1	14q24.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000119599		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20229	protein-coding gene	gene with protein product			"""WD repeat domain 21"", ""WD repeat domain 21A"""	WDR21, WDR21A			Standard	NM_015604		Approved	DKFZp434K114	uc010ttr.2	Q8WV16		ENST00000358377.2:c.1255C>T	14.37:g.73423169C>T	ENSP00000351147:p.Pro419Ser		B4DUT6|G3V522|Q86U31|Q8IV10|Q96K22|Q9Y4P5	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P419S	ENST00000358377.2	37	c.1255	CCDS9809.1	14	.	.	.	.	.	.	.	.	.	.	C	24.8	4.572961	0.86542	.	.	ENSG00000119599	ENST00000358377;ENST00000353777;ENST00000394234;ENST00000509153;ENST00000555042;ENST00000553457	T;T;T;T;T;T	0.70164	-0.46;0.16;0.16;0.16;0.16;0.16	5.19	5.19	0.71726	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.78432	0.4282	M	0.77820	2.39	0.58432	D	0.999999	P;P;D;D;P;D	0.61697	0.589;0.952;0.972;0.972;0.883;0.99	B;P;D;D;P;P	0.64506	0.347;0.878;0.926;0.926;0.621;0.904	T	0.75133	-0.3425	10	0.02654	T	1	.	18.7308	0.91734	0.0:1.0:0.0:0.0	.	359;398;419;413;249;419	B4DUT6;B4DN30;Q8WV16-2;G3V522;Q86SY2;Q8WV16	.;.;.;.;.;DCAF4_HUMAN	S	419;249;319;359;413;319	ENSP00000351147:P419S;ENSP00000345176:P249S;ENSP00000377781:P319S;ENSP00000426178:P359S;ENSP00000452131:P413S;ENSP00000451186:P319S	ENSP00000345176:P249S	P	+	1	0	DCAF4	72492922	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	7.487000	0.81328	2.429000	0.82318	0.462000	0.41574	CCC	DCAF4	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000119599		0.562	DCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCAF4	HGNC	protein_coding	OTTHUMT00000361058.1	-	0.00	67	0	C	NM_015604		73423169	+1	tier1	-	no_errors	ENST00000358377	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
DCHS1	8642	genome.wustl.edu	37	11	6647467	6647467	+	Missense_Mutation	SNP	C	C	T	rs147106756		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:6647467C>T	ENST00000299441.3	-	16	6920	c.6509G>A	c.(6508-6510)cGt>cAt	p.R2170H		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2170	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCGCAGGAAACGGGGAGCATT	0.632																																																	0								C	HIS/ARG	0,4402		0,0,2201	54.0	46.0	49.0		6509	4.9	1.0	11	dbSNP_134	49	2,8590	1.2+/-3.3	0,2,4294	no	missense	DCHS1	NM_003737.2	29	0,2,6495	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	2170/3299	6647467	2,12992	2201	4296	6497	SO:0001583	missense	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.6509G>A	11.37:g.6647467C>T	ENSP00000299441:p.Arg2170His		O15098	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R2170H	ENST00000299441.3	37	c.6509	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455682	0.84209	0.0	2.33E-4	ENSG00000166341	ENST00000299441	T	0.61158	0.13	4.91	4.91	0.64330	Cadherin (2);Cadherin-like (1);	0.000000	0.45361	D	0.000371	T	0.68302	0.2986	L	0.46670	1.46	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.61068	-0.7137	10	0.15066	T	0.55	.	17.2622	0.87073	0.0:1.0:0.0:0.0	.	2170	Q96JQ0	PCD16_HUMAN	H	2170	ENSP00000299441:R2170H	ENSP00000299441:R2170H	R	-	2	0	DCHS1	6604043	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.617000	0.67716	2.571000	0.86741	0.563000	0.77884	CGT	DCHS1	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000166341		0.632	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1	-	0.00	23	0	C	NM_003737		6647467	-1	tier1	rs147106756	no_errors	ENST00000299441	ensembl	human	known	74_37	missense	23.53	13	4	SNP	1.000	T
DCHS2	54798	genome.wustl.edu	37	4	155158150	155158150	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr4:155158150T>G	ENST00000357232.4	-	25	6288	c.6289A>C	c.(6289-6291)Aaa>Caa	p.K2097Q		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2097	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TTATAGGATTTGACTGTGAAT	0.423																																																	0													151.0	148.0	149.0					4																	155158150		2203	4300	6503	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.6289A>C	4.37:g.155158150T>G	ENSP00000349768:p.Lys2097Gln		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K2097Q	ENST00000357232.4	37	c.6289	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	T	0.044	-1.273547	0.01421	.	.	ENSG00000197410	ENST00000357232	T	0.63417	-0.04	5.82	3.15	0.36227	Cadherin (2);Cadherin-like (1);	0.638607	0.15443	N	0.262062	T	0.40815	0.1132	N	0.17872	0.535	0.09310	N	0.999996	B	0.21452	0.056	B	0.21151	0.033	T	0.20840	-1.0263	10	0.14252	T	0.57	.	6.7168	0.23308	0.0:0.6555:0.129:0.2155	.	2097	Q6V1P9	PCD23_HUMAN	Q	2097	ENSP00000349768:K2097Q	ENSP00000349768:K2097Q	K	-	1	0	DCHS2	155377600	0.000000	0.05858	0.001000	0.08648	0.031000	0.12232	1.065000	0.30592	0.792000	0.33850	-0.479000	0.04858	AAA	DCHS2	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000197410		0.423	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	-	0.00	78	0	T	NM_001142552		155158150	-1	tier1	-	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	17.24	48	10	SNP	0.001	G
DEPDC5	9681	genome.wustl.edu	37	22	32206513	32206513	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr22:32206513G>T	ENST00000382112.3	+	19	1401	c.1331G>T	c.(1330-1332)gGg>gTg	p.G444V	DEPDC5_ENST00000400242.3_Missense_Mutation_p.G444V|DEPDC5_ENST00000536766.1_Missense_Mutation_p.G416V|DEPDC5_ENST00000382111.2_Missense_Mutation_p.G444V|DEPDC5_ENST00000266091.3_Missense_Mutation_p.G444V|DEPDC5_ENST00000400248.2_Missense_Mutation_p.G444V|DEPDC5_ENST00000400246.1_Missense_Mutation_p.G444V|DEPDC5_ENST00000535622.1_Missense_Mutation_p.G444V|DEPDC5_ENST00000400249.2_Missense_Mutation_p.G444V|DEPDC5_ENST00000382105.2_Missense_Mutation_p.G444V	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	444					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TCAGCTCTCGGGAGTCCAAAA	0.433																																																	0													78.0	72.0	74.0					22																	32206513		1829	4099	5928	SO:0001583	missense	0			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.1331G>T	22.37:g.32206513G>T	ENSP00000371546:p.Gly444Val		A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	pfam_IML1,pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.G444V	ENST00000382112.3	37	c.1331	CCDS46692.1	22	.	.	.	.	.	.	.	.	.	.	G	9.924	1.213073	0.22289	.	.	ENSG00000100150	ENST00000535622;ENST00000536766;ENST00000400242;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	T;T;T;T;T;T;T;T;T;T	0.42513	1.55;1.55;0.97;1.94;1.94;1.93;1.53;1.95;1.93;1.94	5.61	4.6	0.57074	.	0.102956	0.64402	D	0.000002	T	0.53334	0.1790	L	0.54323	1.7	0.80722	D	1	P;D;D;P;P;B	0.76494	0.704;0.986;0.999;0.947;0.651;0.006	B;P;D;B;B;B	0.64144	0.162;0.76;0.922;0.382;0.122;0.005	T	0.48352	-0.9043	10	0.15066	T	0.55	.	13.6188	0.62126	0.0743:0.0:0.9257:0.0	.	444;416;444;444;444;444	B9EGN9;F5GYZ8;B4DH93;A8MPX9;O75140;O75140-2	.;.;.;.;DEPD5_HUMAN;.	V	444;416;444;444;444;444;444;444;444;444;444	ENSP00000440210:G444V;ENSP00000441358:G416V;ENSP00000383101:G444V;ENSP00000266091:G444V;ENSP00000383108:G444V;ENSP00000383105:G444V;ENSP00000371539:G444V;ENSP00000371546:G444V;ENSP00000371545:G444V;ENSP00000383107:G444V	ENSP00000266091:G444V	G	+	2	0	DEPDC5	30536513	1.000000	0.71417	0.170000	0.22879	0.282000	0.26991	7.389000	0.79806	1.388000	0.46506	0.555000	0.69702	GGG	DEPDC5	-	NULL	ENSG00000100150		0.433	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	HGNC	protein_coding	OTTHUMT00000129087.1	-	0.00	78	0	G	NM_014662		32206513	+1	tier1	-	no_errors	ENST00000266091	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.947	T
DHCR7	1717	genome.wustl.edu	37	11	71155041	71155041	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:71155041G>T	ENST00000355527.3	-	4	595	c.319C>A	c.(319-321)Cag>Aag	p.Q107K	DHCR7_ENST00000407721.2_Missense_Mutation_p.Q107K	NM_001163817.1|NM_001360.2	NP_001157289.1|NP_001351.2	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase	107			Q -> H (in SLOS). {ECO:0000269|PubMed:10677299}.		blood vessel development (GO:0001568)|cell differentiation (GO:0030154)|cholesterol biosynthetic process (GO:0006695)|lung development (GO:0030324)|multicellular organism growth (GO:0035264)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|regulation of cholesterol biosynthetic process (GO:0045540)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear outer membrane (GO:0005640)	7-dehydrocholesterol reductase activity (GO:0047598)			endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(1)|skin(1)	19						CTGCTGACCTGGAAGGTGACC	0.612									Smith-Lemli-Opitz syndrome																																								0													34.0	27.0	29.0					11																	71155041		2200	4294	6494	SO:0001583	missense	0	Familial Cancer Database	SLOS type I & II	AF034544	CCDS8200.1	11q13.4	2014-09-17	2004-02-13				1.3.1.21		2860	protein-coding gene	gene with protein product		602858	"""Smith-Lemli-Opitz syndrome"""	SLOS		9465114, 9634533	Standard	NM_001360		Approved		uc001oql.3	Q9UBM7		ENST00000355527.3:c.319C>A	11.37:g.71155041G>T	ENSP00000347717:p.Gln107Lys		B2R6Z2|O60492|O60717	Missense_Mutation	SNP	pfam_Ergosterol_biosynth_ERG4_ERG24	p.Q107K	ENST00000355527.3	37	c.319	CCDS8200.1	11	.	.	.	.	.	.	.	.	.	.	G	20.7	4.027975	0.75390	.	.	ENSG00000172893	ENST00000407721;ENST00000355527;ENST00000524694;ENST00000527316;ENST00000526780;ENST00000525346	D;D;D;D;D	0.98717	-4.71;-4.71;-4.71;-5.09;-3.66	3.83	3.83	0.44106	.	0.000000	0.85682	D	0.000000	D	0.99115	0.9695	M	0.91663	3.23	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	D	0.98799	1.0739	10	0.52906	T	0.07	-21.5092	11.4313	0.50043	0.0:0.0:1.0:0.0	.	107	Q9UBM7	DHCR7_HUMAN	K	107;107;107;75;107;107	ENSP00000384739:Q107K;ENSP00000347717:Q107K;ENSP00000435047:Q75K;ENSP00000435668:Q107K;ENSP00000435707:Q107K	ENSP00000347717:Q107K	Q	-	1	0	DHCR7	70832689	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	8.225000	0.89784	2.137000	0.66172	0.442000	0.29010	CAG	DHCR7	-	pfam_Ergosterol_biosynth_ERG4_ERG24	ENSG00000172893		0.612	DHCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHCR7	HGNC	protein_coding	OTTHUMT00000394243.1	-	0.00	74	0	G	NM_001360		71155041	-1	tier1	-	no_errors	ENST00000355527	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
DHX32	55760	genome.wustl.edu	37	10	127569206	127569206	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr10:127569206G>T	ENST00000284690.3	-	1	678	c.188C>A	c.(187-189)cCt>cAt	p.P63H	DHX32_ENST00000284688.6_Missense_Mutation_p.P63H	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32	63						mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TTTCCATATAGGAAGATCTTC	0.383																																																	0													80.0	78.0	79.0					10																	127569206		2203	4300	6503	SO:0001583	missense	0				CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.188C>A	10.37:g.127569206G>T	ENSP00000284690:p.Pro63His		A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,superfamily_P-loop_NTPase,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd	p.P63H	ENST00000284690.3	37	c.188	CCDS7652.1	10	.	.	.	.	.	.	.	.	.	.	G	24.8	4.568808	0.86439	.	.	ENSG00000089876	ENST00000284690;ENST00000284688;ENST00000415732	T;T;T	0.10860	2.83;2.83;2.83	4.94	4.94	0.65067	.	0.257143	0.40144	N	0.001163	T	0.44829	0.1312	H	0.96333	3.805	0.37712	D	0.924611	D	0.71674	0.998	P	0.60173	0.87	T	0.68074	-0.5505	10	0.87932	D	0	-19.8743	18.3528	0.90344	0.0:0.0:1.0:0.0	.	63	Q7L7V1	DHX32_HUMAN	H	63	ENSP00000284690:P63H;ENSP00000284688:P63H;ENSP00000406781:P63H	ENSP00000284688:P63H	P	-	2	0	DHX32	127559196	1.000000	0.71417	0.908000	0.35775	0.981000	0.71138	6.628000	0.74262	2.557000	0.86248	0.555000	0.69702	CCT	DHX32	-	superfamily_P-loop_NTPase	ENSG00000089876		0.383	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX32	HGNC	protein_coding	OTTHUMT00000050945.2	-	0.00	56	0	G	NM_018180		127569206	-1	tier1	-	no_errors	ENST00000284690	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
DMD	1756	genome.wustl.edu	37	X	31224764	31224764	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chrX:31224764C>T	ENST00000357033.4	-	66	9790	c.9584G>A	c.(9583-9585)cGt>cAt	p.R3195H	DMD_ENST00000541735.1_Missense_Mutation_p.R735H|DMD_ENST00000474231.1_Missense_Mutation_p.R735H|DMD_ENST00000378707.3_Missense_Mutation_p.R735H|DMD_ENST00000359836.1_Missense_Mutation_p.R735H|DMD_ENST00000378723.3_Missense_Mutation_p.R127H|DMD_ENST00000361471.4_Missense_Mutation_p.R127H|DMD_ENST00000378702.4_Missense_Mutation_p.R127H|DMD_ENST00000378677.2_Missense_Mutation_p.R3191H|DMD_ENST00000378680.2_Missense_Mutation_p.R127H|DMD_ENST00000343523.2_Missense_Mutation_p.R735H	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3195	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.R3190H(2)|p.R735H(2)|p.R1854H(1)|p.R3191P(1)|p.R3195P(1)|p.R127P(1)|p.R1854P(1)|p.R3190P(1)|p.R735P(1)|p.R3191H(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AGACAGGACACGGATCCTCCC	0.373																																																	12	Substitution - Missense(12)	large_intestine(6)|endometrium(6)											97.0	81.0	87.0					X																	31224764		2202	4300	6502	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.9584G>A	X.37:g.31224764C>T	ENSP00000354923:p.Arg3195His		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.R3195H	ENST00000357033.4	37	c.9584	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	28.1	4.888553	0.91814	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378723;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000378702;ENST00000474231;ENST00000361471;ENST00000378680	T;T;T;T;T;T;T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	5.21	5.21	0.72293	EF-hand domain, type 1 (1);	0.000000	0.37053	U	0.002276	D	0.86314	0.5903	M	0.92219	3.285	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.999;0.998;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.83275	0.965;0.979;0.996;0.996;0.996;0.996;0.984;0.963;0.973;0.996;0.993;0.99;0.972;0.973;0.953;0.991	D	0.89765	0.3950	10	0.87932	D	0	.	17.8941	0.88881	0.0:1.0:0.0:0.0	.	127;3187;3195;3191;1854;1851;735;735;735;735;735;3072;127;127;127;127	B4DSV7;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3;P11532-5;Q8N754;Q6NSJ9;E9PDN1	.;.;DMD_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.	H	3187;1854;1851;127;891;3191;3195;735;735;3195;3072;735;735;127;735;127;127	ENSP00000367997:R127H;ENSP00000350765:R891H;ENSP00000367948:R3191H;ENSP00000354923:R3195H;ENSP00000352894:R735H;ENSP00000340057:R735H;ENSP00000367979:R735H;ENSP00000444119:R735H;ENSP00000367974:R127H;ENSP00000417123:R735H;ENSP00000354464:R127H;ENSP00000367951:R127H	ENSP00000340057:R735H	R	-	2	0	DMD	31134685	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.458000	0.80787	2.415000	0.81967	0.600000	0.82982	CGT	DMD	-	pfam_EF-hand_dom_typ1,pirsf_Dystrophin/utrophin	ENSG00000198947		0.373	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	-	0.00	20	0	C	NM_004006		31224764	-1	tier1	-	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	21.74	18	5	SNP	1.000	T
DNAH5	1767	genome.wustl.edu	37	5	13717530	13717530	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:13717530T>G	ENST00000265104.4	-	73	12703	c.12599A>C	c.(12598-12600)aAg>aCg	p.K4200T		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4200	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K4200T(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GGCACCGAACTTGCGCCTCTC	0.552									Kartagener syndrome																																								1	Substitution - Missense(1)	pancreas(1)											70.0	64.0	66.0					5																	13717530		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.12599A>C	5.37:g.13717530T>G	ENSP00000265104:p.Lys4200Thr		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.K4200T	ENST00000265104.4	37	c.12599	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	T	24.6	4.546348	0.86022	.	.	ENSG00000039139	ENST00000265104	T	0.12147	2.71	5.45	5.45	0.79879	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.48978	0.1530	M	0.93150	3.385	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63395	-0.6647	10	0.87932	D	0	.	15.5182	0.75842	0.0:0.0:0.0:1.0	.	4200	Q8TE73	DYH5_HUMAN	T	4200	ENSP00000265104:K4200T	ENSP00000265104:K4200T	K	-	2	0	DNAH5	13770530	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	8.020000	0.88740	2.067000	0.61834	0.533000	0.62120	AAG	DNAH5	-	pfam_Dynein_heavy_dom	ENSG00000039139		0.552	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	38	0	T	NM_001369		13717530	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	22.50	31	9	SNP	1.000	G
DNAH5	1767	genome.wustl.edu	37	5	13717543	13717543	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:13717543G>T	ENST00000265104.4	-	73	12690	c.12586C>A	c.(12586-12588)Cag>Aag	p.Q4196K		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4196	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.Q4196K(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CGCCTCTCCTGGACAGTGGAG	0.552									Kartagener syndrome																																								1	Substitution - Missense(1)	large_intestine(1)											67.0	60.0	62.0					5																	13717543		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.12586C>A	5.37:g.13717543G>T	ENSP00000265104:p.Gln4196Lys		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.Q4196K	ENST00000265104.4	37	c.12586	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	24.8	4.571457	0.86542	.	.	ENSG00000039139	ENST00000265104	T	0.09630	2.96	5.45	5.45	0.79879	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.54208	0.1844	H	0.98769	4.325	0.80722	D	1	D	0.71674	0.998	D	0.77557	0.99	T	0.74893	-0.3509	10	0.72032	D	0.01	.	19.2888	0.94090	0.0:0.0:1.0:0.0	.	4196	Q8TE73	DYH5_HUMAN	K	4196	ENSP00000265104:Q4196K	ENSP00000265104:Q4196K	Q	-	1	0	DNAH5	13770543	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	9.843000	0.99491	2.557000	0.86248	0.655000	0.94253	CAG	DNAH5	-	pfam_Dynein_heavy_dom	ENSG00000039139		0.552	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2		0.00	44	0	G	NM_001369		13717543	-1			no_errors	ENST00000265104	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
DNAH7	56171	genome.wustl.edu	37	2	196729724	196729724	+	Missense_Mutation	SNP	G	G	A	rs375752812		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:196729724G>A	ENST00000312428.6	-	41	6755	c.6655C>T	c.(6655-6657)Cgc>Tgc	p.R2219C		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2219					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TCCAGAAGGCGGTCATAATAC	0.333																																																	0								G	CYS/ARG	0,3626		0,0,1813	70.0	67.0	68.0		6655	5.5	1.0	2		68	1,8147		0,1,4073	no	missense	DNAH7	NM_018897.2	180	0,1,5886	AA,AG,GG		0.0123,0.0,0.0085	probably-damaging	2219/4025	196729724	1,11773	1813	4074	5887	SO:0001583	missense	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.6655C>T	2.37:g.196729724G>A	ENSP00000311273:p.Arg2219Cys		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.R2219C	ENST00000312428.6	37	c.6655	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	G	17.20	3.329769	0.60743	0.0	1.23E-4	ENSG00000118997	ENST00000312428	T	0.46819	0.86	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.79981	0.4540	H	0.96048	3.76	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86347	0.1708	10	0.87932	D	0	.	18.9883	0.92780	0.0:0.0:1.0:0.0	.	2219	Q8WXX0	DYH7_HUMAN	C	2219	ENSP00000311273:R2219C	ENSP00000311273:R2219C	R	-	1	0	DNAH7	196437969	1.000000	0.71417	1.000000	0.80357	0.176000	0.22953	9.558000	0.98132	2.601000	0.87937	0.558000	0.71614	CGC	DNAH7	-	superfamily_P-loop_NTPase	ENSG00000118997		0.333	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	-	0.00	39	0	G	NM_018897		196729724	-1	tier1	-	no_errors	ENST00000312428	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	A
DPP8	54878	genome.wustl.edu	37	15	65756200	65756200	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr15:65756200T>C	ENST00000341861.5	-	15	3498	c.1918A>G	c.(1918-1920)Agt>Ggt	p.S640G	DPP8_ENST00000321147.6_Missense_Mutation_p.S640G|DPP8_ENST00000321118.7_Missense_Mutation_p.S640G|DPP8_ENST00000300141.6_Missense_Mutation_p.S624G|DPP8_ENST00000358939.4_Missense_Mutation_p.S624G|DPP8_ENST00000339244.5_Missense_Mutation_p.S467G|DPP8_ENST00000559233.1_Missense_Mutation_p.S640G	NM_197960.2	NP_932064.1	Q6V1X1	DPP8_HUMAN	dipeptidyl-peptidase 8	640					immune response (GO:0006955)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(2)|endometrium(3)|large_intestine(11)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CCAGTAGTACTTTCAAAAGAG	0.398																																																	0													85.0	84.0	84.0					15																	65756200		2201	4299	6500	SO:0001583	missense	0			AF221634	CCDS10207.1, CCDS10208.1, CCDS10209.1, CCDS10210.1	15q22	2008-07-18	2006-01-12		ENSG00000074603	ENSG00000074603			16490	protein-coding gene	gene with protein product	"""dipeptidyl peptidase VIII"", ""dipeptidyl peptidase IV-related protein-1"", ""prolyl dipeptidase DPP8"""	606819	"""dipeptidylpeptidase 8"""			11012666	Standard	XM_005254500		Approved	DP8, DPRP1, MSTP141, FLJ14920, FLJ20283, MGC26191	uc002aox.3	Q6V1X1	OTTHUMG00000133150	ENST00000341861.5:c.1918A>G	15.37:g.65756200T>C	ENSP00000339208:p.Ser640Gly		Q7Z4C8|Q7Z4D3|Q7Z4E1|Q8IWG7|Q8NEM5|Q96JX1|Q9HBM2|Q9HBM3|Q9HBM4|Q9HBM5|Q9NXF4	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_X-Pro-like_dom	p.S640G	ENST00000341861.5	37	c.1918	CCDS10207.1	15	.	.	.	.	.	.	.	.	.	.	T	14.65	2.598240	0.46318	.	.	ENSG00000074603	ENST00000341861;ENST00000358939;ENST00000300141;ENST00000321147;ENST00000321118;ENST00000339244;ENST00000395652	T;T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9;0.9	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.40595	0.1123	L	0.28504	0.86	0.46356	D	0.999005	B;B;P;B;B	0.41450	0.047;0.044;0.75;0.044;0.026	B;B;P;B;B	0.45310	0.028;0.03;0.476;0.03;0.013	T	0.21999	-1.0229	10	0.42905	T	0.14	-16.4446	16.0502	0.80755	0.0:0.0:0.0:1.0	.	467;624;624;640;640	C9JSG1;Q6V1X1-3;Q6V1X1-4;Q6V1X1-2;Q6V1X1	.;.;.;.;DPP8_HUMAN	G	640;624;624;640;640;467;640	ENSP00000339208:S640G;ENSP00000351817:S624G;ENSP00000300141:S624G;ENSP00000318111:S640G;ENSP00000316373:S640G;ENSP00000341230:S467G;ENSP00000379013:S640G	ENSP00000300141:S624G	S	-	1	0	DPP8	63543253	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.773000	0.68898	2.197000	0.70478	0.528000	0.53228	AGT	DPP8	-	NULL	ENSG00000074603		0.398	DPP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DPP8	HGNC	protein_coding	OTTHUMT00000256847.1	-	0.00	35	0	T	NM_017743		65756200	-1	tier1	-	no_errors	ENST00000341861	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	C
DST	667	genome.wustl.edu	37	6	56484508	56484508	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:56484508C>A	ENST00000370765.6	-	23	4431	c.4324G>T	c.(4324-4326)Ggt>Tgt	p.G1442C	DST_ENST00000244364.6_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000421834.2_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	6280					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AATTGCCTACCAAGCTCTCTG	0.393																																																	0													149.0	151.0	150.0					6																	56484508		2203	4300	6503	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.4324G>T	6.37:g.56484508C>A	ENSP00000359801:p.Gly1442Cys		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_Spectrin_repeat,superfamily_Ig/albumin-bd,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.G1442C	ENST00000370765.6	37	c.4324	CCDS4959.1	6	.	.	.	.	.	.	.	.	.	.	C	9.886	1.202826	0.22121	.	.	ENSG00000151914	ENST00000370765	T	0.22743	1.94	5.23	-4.4	0.03600	.	.	.	.	.	T	0.05823	0.0152	.	.	.	0.22479	N	0.999064	P	0.38617	0.64	B	0.36378	0.223	T	0.18398	-1.0338	7	0.59425	D	0.04	.	8.8438	0.35157	0.0:0.4765:0.0964:0.4271	.	1442	Q03001-3	.	C	1442	ENSP00000359801:G1442C	ENSP00000359801:G1442C	G	-	1	0	DST	56592467	0.000000	0.05858	0.000000	0.03702	0.739000	0.42172	0.329000	0.19698	-0.885000	0.03971	0.650000	0.86243	GGT	DST	-	NULL	ENSG00000151914		0.393	DST-010	KNOWN	basic|CCDS	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041027.2	-	0.00	64	0	C	NM_001723		56484508	-1	tier1	-	no_errors	ENST00000370765	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.000	A
EDA2R	60401	genome.wustl.edu	37	X	65822517	65822517	+	Missense_Mutation	SNP	A	A	C	rs149166760		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chrX:65822517A>C	ENST00000374719.3	-	5	531	c.475T>G	c.(475-477)Ttc>Gtc	p.F159V	EDA2R_ENST00000253392.5_Missense_Mutation_p.F159V|EDA2R_ENST00000451436.2_Intron|EDA2R_ENST00000456230.2_Missense_Mutation_p.F159V|EDA2R_ENST00000396050.1_Missense_Mutation_p.F159V|EDA2R_ENST00000450752.1_Missense_Mutation_p.F159V	NM_021783.3	NP_068555	Q9HAV5	TNR27_HUMAN	ectodysplasin A2 receptor	159					cell differentiation (GO:0030154)|embryo development (GO:0009790)|epidermis development (GO:0008544)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						CAGTAGAGGAAGAAGAGCCCC	0.532																																																	0													65.0	44.0	51.0					X																	65822517		2203	4299	6502	SO:0001583	missense	0			AF298812	CCDS14386.1, CCDS56603.1	Xq11.1	2013-05-22			ENSG00000131080	ENSG00000131080		"""Tumor necrosis factor receptor superfamily"""	17756	protein-coding gene	gene with protein product		300276				11039935	Standard	NM_021783		Approved	XEDAR, EDA-A2R, EDAA2R, TNFRSF27	uc004dwt.2	Q9HAV5	OTTHUMG00000021736	ENST00000374719.3:c.475T>G	X.37:g.65822517A>C	ENSP00000363851:p.Phe159Val		Q5VYX9|Q5VYY0|Q6UWM2|Q8IZA6	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_27	p.F159V	ENST00000374719.3	37	c.475	CCDS14386.1	X	.	.	.	.	.	.	.	.	.	.	A	5.808	0.333320	0.11013	.	.	ENSG00000131080	ENST00000374719;ENST00000396050;ENST00000253392;ENST00000456230;ENST00000450752	T;T;D;T;D	0.81908	-1.49;-1.49;-1.55;-1.49;-1.55	4.37	3.13	0.36017	.	0.288450	0.25211	N	0.032312	T	0.66548	0.2800	L	0.27053	0.805	0.80722	D	1	B;B;B	0.23990	0.095;0.033;0.028	B;B;B	0.28465	0.09;0.015;0.004	T	0.56817	-0.7916	10	0.02654	T	1	-4.2761	6.5133	0.22234	0.784:0.0:0.0:0.216	.	159;159;159	Q9HAV5-2;B2RBZ9;Q9HAV5	.;.;TNR27_HUMAN	V	159	ENSP00000363851:F159V;ENSP00000379365:F159V;ENSP00000253392:F159V;ENSP00000393935:F159V;ENSP00000402929:F159V	ENSP00000253392:F159V	F	-	1	0	EDA2R	65739242	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	0.935000	0.28924	1.409000	0.46915	0.486000	0.48141	TTC	EDA2R	-	NULL	ENSG00000131080		0.532	EDA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDA2R	HGNC	protein_coding	OTTHUMT00000057002.1	-	0.00	17	0	A	NM_021783		65822517	-1	tier1	-	no_errors	ENST00000253392	ensembl	human	known	74_37	missense	37.50	10	6	SNP	0.975	C
EIF4A2	1974	genome.wustl.edu	37	3	186504993	186504993	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr3:186504993G>T	ENST00000323963.5	+	8	913	c.849G>T	c.(847-849)agG>agT	p.R283S	SNORA63_ENST00000363450.1_RNA|SNORA4_ENST00000584302.1_RNA|SNORA63_ENST00000363548.1_RNA|EIF4A2_ENST00000356531.5_Missense_Mutation_p.R188S|SNORD2_ENST00000459163.1_RNA|SNORA81_ENST00000408493.2_RNA|EIF4A2_ENST00000440191.2_Missense_Mutation_p.R284S			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	283	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.R283S(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		TCAATACGAGGCGCAAGGTGG	0.423			T	BCL6	NHL																																			Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	1	Substitution - Missense(1)	lung(1)											110.0	108.0	108.0					3																	186504993		2203	4300	6503	SO:0001583	missense	0			D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.849G>T	3.37:g.186504993G>T	ENSP00000326381:p.Arg283Ser		D3DNU9|Q53XJ6|Q96B90|Q96EA8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R284S	ENST00000323963.5	37	c.852	CCDS3282.1	3	.	.	.	.	.	.	.	.	.	.	G	15.95	2.983896	0.53827	.	.	ENSG00000156976	ENST00000323963;ENST00000440191;ENST00000356531	T;T;T	0.06294	3.32;3.32;3.32	5.12	1.37	0.22104	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.13970	0.0338	M	0.73217	2.22	0.80722	D	1	D;P;B;B	0.61080	0.989;0.686;0.373;0.256	P;P;B;B	0.55508	0.777;0.45;0.19;0.093	T	0.01225	-1.1413	10	0.87932	D	0	-9.765	6.7407	0.23435	0.4542:0.0:0.5458:0.0	.	139;188;284;283	B4DJX6;Q9NZE6;Q14240-2;Q14240	.;.;.;IF4A2_HUMAN	S	283;284;188	ENSP00000326381:R283S;ENSP00000398370:R284S;ENSP00000348925:R188S	ENSP00000326381:R283S	R	+	3	2	EIF4A2	187987687	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.919000	0.40015	0.426000	0.26116	0.563000	0.77884	AGG	EIF4A2	-	superfamily_P-loop_NTPase,pfscan_Helicase_C	ENSG00000156976		0.423	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A2	HGNC	protein_coding	OTTHUMT00000344609.1		0.00	65	0	G	NM_001967		186504993	+1			no_errors	ENST00000440191	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
ELMO1	9844	genome.wustl.edu	37	7	37251021	37251021	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr7:37251021G>T	ENST00000310758.4	-	13	1703	c.1056C>A	c.(1054-1056)taC>taA	p.Y352*	ELMO1_ENST00000448602.1_Nonsense_Mutation_p.Y352*|ELMO1_ENST00000442504.1_Nonsense_Mutation_p.Y352*	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	352	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						AATCTCGCGTGTACATGGACT	0.483																																																	0													183.0	131.0	148.0					7																	37251021		2203	4300	6503	SO:0001587	stop_gained	0			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.1056C>A	7.37:g.37251021G>T	ENSP00000312185:p.Tyr352*		A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Nonsense_Mutation	SNP	pfam_DUF3361,pfam_Engulfment_cell_motility_ELMO,superfamily_ARM-type_fold	p.Y352*	ENST00000310758.4	37	c.1056	CCDS5449.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	10.242987|10.242987	0.99367|0.99367	.|.	.|.	ENSG00000155849|ENSG00000155849	ENST00000433246|ENST00000310758;ENST00000361912;ENST00000442504;ENST00000448602;ENST00000424212	.|.	.|.	.|.	4.9|4.9	4.9|4.9	0.64082|0.64082	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.31949|.	0.0813|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.18398|.	-1.0338|.	4|.	.|0.02654	.|T	.|1	.|.	10.276|10.276	0.43510|0.43510	0.1255:0.0:0.8745:0.0|0.1255:0.0:0.8745:0.0	.|.	.|.	.|.	.|.	K|X	132|352;256;352;352;93	.|.	.|ENSP00000312185:Y352X	T|Y	-|-	2|3	0|2	ELMO1|ELMO1	37217546|37217546	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.803000|0.803000	0.45373|0.45373	4.668000|4.668000	0.61568|0.61568	2.652000|2.652000	0.90054|0.90054	0.491000|0.491000	0.48974|0.48974	ACA|TAC	ELMO1	-	pfam_Engulfment_cell_motility_ELMO	ENSG00000155849		0.483	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMO1	HGNC	protein_coding	OTTHUMT00000219830.4		0.00	82	0	G	NM_130442		37251021	-1			no_errors	ENST00000310758	ensembl	human	known	74_37	nonsense	5.06	75	4	SNP	1.000	T
RP11-782C8.2	0	genome.wustl.edu	37	1	143207727	143207727	+	lincRNA	SNP	T	T	G	rs200863174		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:143207727T>G	ENST00000412204.2	-	0	1790				RP11-782C8.1_ENST00000438000.1_lincRNA																							CCATACATACTTGACTTTCCA	0.328																																																	0																																												0																															1.37:g.143207727T>G				RNA	SNP	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			RP11-782C8.2	-	-	ENSG00000232274		0.328	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	Clone_based_vega_gene	lincRNA	OTTHUMT00000037567.2	-	0.00	120	0	T			143207727	-1	tier1	-	no_errors	ENST00000412204	ensembl	human	known	74_37	rna	9.85	119	13	SNP	0.315	G
CPXM2	119587	genome.wustl.edu	37	10	125673543	125673543	+	Intron	SNP	A	A	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr10:125673543A>C	ENST00000368854.3	-	2	174				AC068058.1_ENST00000408510.1_RNA|RP11-285A18.2_ENST00000435782.1_RNA			Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		TCAGAATCCAACCTTAAAGGC	0.537																																																	0													22.0	17.0	18.0					10																	125673543		876	1990	2866	SO:0001627	intron_variant	0			AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000368854.3:c.2474+25449T>G	10.37:g.125673543A>C			B4E3Q2	Splice_Site	SNP	-	NULL	ENST00000368854.3	37	c.NULL		10																																																																																			RP11-285A18.2	-	-	ENSG00000234677		0.537	CPXM2-001	KNOWN	basic	processed_transcript	ENSG00000234677	Clone_based_vega_gene	protein_coding	OTTHUMT00000050852.2	-	0.00	68	0	A	NM_198148		125673543	-1	tier1	-	no_errors	ENST00000435782	ensembl	human	known	74_37	splice_site	28.30	38	15	SNP	0.004	C
RP11-527L4.6	0	genome.wustl.edu	37	17	42009954	42009954	+	lincRNA	SNP	A	A	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:42009954A>G	ENST00000592842.1	+	0	485																											TCCCGGCAGCAGAAGCAGCTC	0.672																																																	0																																												0																															17.37:g.42009954A>G				RNA	SNP	-	NULL	ENST00000592842.1	37	NULL		17																																																																																			RP11-527L4.6	-	-	ENSG00000267420		0.672	RP11-527L4.6-001	KNOWN	basic	lincRNA	ENSG00000267420	Clone_based_vega_gene	lincRNA	OTTHUMT00000457651.1	-	0.00	23	0	A			42009954	+1	tier1	-	no_errors	ENST00000592842	ensembl	human	known	74_37	rna	28.57	15	6	SNP	1.000	G
AGO3	192669	genome.wustl.edu	37	1	36475027	36475027	+	Intron	DEL	A	A	-			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:36475027delA	ENST00000373191.4	+	9	1378				AGO3_ENST00000246314.6_Intron|RP4-665N4.8_ENST00000466576.2_RNA|RP4-665N4.8_ENST00000479395.2_RNA	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3						epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										AGTAAGAGCTAAAAAAAAAAG	0.274																																																	0									,	21,123,4122		0,0,21,1,121,1990	32.0	34.0	33.0		,	2.9	0.0	1	dbSNP_134	34	47,186,8015		0,0,47,1,184,3892	no	intron,intron	EIF2C3	NM_177422.2,NM_024852.3	,	0,0,68,2,305,5882	A1A1,A1A2,A1R,A2A2,A2R,RR		2.8249,3.3755,3.0126	,	,	36475027	68,309,12137	2203	4298	6501	SO:0001627	intron_variant	0			AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.1030-49A>-	1.37:g.36475027delA			B1ALI0|Q5TA55|Q9H1U6	RNA	DEL	-	NULL	ENST00000373191.4	37	NULL	CCDS399.1	1																																																																																			RP4-665N4.8	-	-	ENSG00000271554		0.274	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000271554	Clone_based_vega_gene	protein_coding	OTTHUMT00000019831.4		0.00	18	0	A	NM_024852		36475027	-1	tier1		no_errors	ENST00000479395	ensembl	human	known	74_37	rna	16.67	15	3	DEL	0.011	-
EPB41L4A	64097	genome.wustl.edu	37	5	111504484	111504484	+	Silent	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:111504484C>T	ENST00000261486.5	-	22	2160	c.1884G>A	c.(1882-1884)gtG>gtA	p.V628V	EPB41L4A_ENST00000507810.1_5'UTR	NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A	628						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		AAGAACGGGTCACCGGAAGTG	0.393																																																	0													95.0	94.0	94.0					5																	111504484		1882	4112	5994	SO:0001819	synonymous_variant	0			AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.1884G>A	5.37:g.111504484C>T			A4FUI6	Silent	SNP	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.V628	ENST00000261486.5	37	c.1884	CCDS43350.1	5																																																																																			EPB41L4A	-	NULL	ENSG00000129595		0.393	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L4A	HGNC	protein_coding	OTTHUMT00000370969.1	-	0.00	66	0	C			111504484	-1	tier1	-	no_errors	ENST00000261486	ensembl	human	known	74_37	silent	7.84	47	4	SNP	1.000	T
EPHB6	2051	genome.wustl.edu	37	7	142568320	142568320	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr7:142568320T>A	ENST00000392957.2	+	19	3626	c.2839T>A	c.(2839-2841)Ttt>Att	p.F947I	EPHB6_ENST00000411471.2_Missense_Mutation_p.F670I|EPHB6_ENST00000476059.1_Intron|EPHB6_ENST00000442129.1_Missense_Mutation_p.F947I	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	947						extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					GGCCCTGGACTTTCCTTGTCT	0.567																																																	0													79.0	83.0	82.0					7																	142568320		2203	4300	6503	SO:0001583	missense	0			D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.2839T>A	7.37:g.142568320T>A	ENSP00000376684:p.Phe947Ile		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.F947I	ENST00000392957.2	37	c.2839	CCDS5873.2	7	.	.	.	.	.	.	.	.	.	.	T	24.6	4.550474	0.86127	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	T;T;T	0.06218	3.33;3.33;3.33	5.43	5.43	0.79202	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);	0.000000	0.49305	D	0.000158	T	0.13586	0.0329	L	0.52126	1.63	0.48830	D	0.999711	P;P	0.49862	0.929;0.831	P;P	0.52309	0.695;0.487	T	0.01688	-1.1295	10	0.38643	T	0.18	.	14.6626	0.68882	0.0:0.0:0.0:1.0	.	947;670	O15197;O15197-2	EPHB6_HUMAN;.	I	947;947;670	ENSP00000376684:F947I;ENSP00000410789:F947I;ENSP00000409061:F670I	ENSP00000376684:F947I	F	+	1	0	EPHB6	142278442	1.000000	0.71417	0.993000	0.49108	0.983000	0.72400	4.360000	0.59455	2.043000	0.60533	0.533000	0.62120	TTT	EPHB6	-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_SAM/pointed,smart_SAM	ENSG00000106123		0.567	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB6	HGNC	protein_coding	OTTHUMT00000341329.1	-	0.00	53	0	T			142568320	+1	tier1	-	no_errors	ENST00000392957	ensembl	human	known	74_37	missense	16.33	41	8	SNP	1.000	A
ETFDH	2110	genome.wustl.edu	37	4	159629656	159629656	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr4:159629656G>T	ENST00000511912.1	+	13	2163	c.1831G>T	c.(1831-1833)Gga>Tga	p.G611*	ETFDH_ENST00000307738.5_Nonsense_Mutation_p.G564*	NM_001281738.1|NM_004453.2	NP_001268667.1|NP_004444.2	Q16134	ETFD_HUMAN	electron-transferring-flavoprotein dehydrogenase	611					cellular metabolic process (GO:0044237)|electron transport chain (GO:0022900)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|electron-transferring-flavoprotein dehydrogenase activity (GO:0004174)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, oxidizing metal ions with flavin as acceptor (GO:0043783)|quinone binding (GO:0048038)|ubiquinone binding (GO:0048039)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|prostate(1)|skin(3)	28	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0172)		AGGTGGAGGAGGACCTGCTTA	0.378																																																	0													121.0	115.0	117.0					4																	159629656		2203	4300	6503	SO:0001587	stop_gained	0			S69232	CCDS3800.1, CCDS64090.1	4q32-q35	2008-08-26			ENSG00000171503	ENSG00000171503			3483	protein-coding gene	gene with protein product		231675					Standard	NM_004453		Approved	ETFQO	uc003iqb.3	Q16134	OTTHUMG00000161684	ENST00000511912.1:c.1831G>T	4.37:g.159629656G>T	ENSP00000426638:p.Gly611*		B4E3R9|J3KND9|Q7Z347	Nonsense_Mutation	SNP	pfam_ETFD_OxRdtase,pfam_FAD_bind_dom,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Pyridine_nuc-diS_OxRdtase_2	p.G611*	ENST00000511912.1	37	c.1831	CCDS3800.1	4	.	.	.	.	.	.	.	.	.	.	G	38	7.164624	0.98107	.	.	ENSG00000171503	ENST00000511912;ENST00000307738	.	.	.	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-24.9387	20.6087	0.99469	0.0:0.0:1.0:0.0	.	.	.	.	X	611;564	.	ENSP00000303552:G564X	G	+	1	0	ETFDH	159849106	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.864000	0.99589	2.866000	0.98385	0.650000	0.86243	GGA	ETFDH	-	NULL	ENSG00000171503		0.378	ETFDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETFDH	HGNC	protein_coding	OTTHUMT00000365718.2	-	0.00	75	0	G			159629656	+1	tier1	-	no_errors	ENST00000511912	ensembl	human	known	74_37	nonsense	6.56	57	4	SNP	1.000	T
F13B	2165	genome.wustl.edu	37	1	197021845	197021845	+	Missense_Mutation	SNP	A	A	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:197021845A>C	ENST00000367412.1	-	9	1517	c.1474T>G	c.(1474-1476)Tta>Gta	p.L492V	F13B_ENST00000490002.1_5'Flank	NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	492	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						AATGGAGATAAGTCATATCCC	0.323																																																	0													112.0	113.0	113.0					1																	197021845		2203	4294	6497	SO:0001583	missense	0			M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.1474T>G	1.37:g.197021845A>C	ENSP00000356382:p.Leu492Val		A8K3E5|Q5VYL5	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.L492V	ENST00000367412.1	37	c.1474	CCDS1388.1	1	.	.	.	.	.	.	.	.	.	.	A	6.682	0.494367	0.12702	.	.	ENSG00000143278	ENST00000367412	D	0.83250	-1.7	5.47	1.86	0.25419	Complement control module (1);	0.000000	0.27139	N	0.020749	T	0.75693	0.3884	L	0.55834	1.745	0.09310	N	1	P	0.39060	0.657	B	0.39971	0.315	T	0.68078	-0.5504	10	0.66056	D	0.02	.	3.234	0.06758	0.5095:0.0:0.2158:0.2747	.	492	P05160	F13B_HUMAN	V	492	ENSP00000356382:L492V	ENSP00000356382:L492V	L	-	1	2	F13B	195288468	0.348000	0.24861	0.003000	0.11579	0.077000	0.17291	1.459000	0.35234	0.349000	0.23975	0.533000	0.62120	TTA	F13B	-	superfamily_Sushi_SCR_CCP	ENSG00000143278		0.323	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F13B	HGNC	protein_coding	OTTHUMT00000088821.2	-	0.00	39	0	A	NM_001994		197021845	-1	tier1	-	no_errors	ENST00000367412	ensembl	human	known	74_37	missense	12.00	66	9	SNP	0.006	C
F8	2157	genome.wustl.edu	37	X	154158656	154158656	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chrX:154158656G>T	ENST00000360256.4	-	14	3609	c.3409C>A	c.(3409-3411)Ctg>Atg	p.L1137M		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1137	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	CCAGAGTTCAGAGAGTTCTTT	0.423																																																	0													65.0	66.0	65.0					X																	154158656		2203	4298	6501	SO:0001583	missense	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.3409C>A	X.37:g.154158656G>T	ENSP00000353393:p.Leu1137Met		Q14286|Q5HY69	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.L1137M	ENST00000360256.4	37	c.3409	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	g	7.332	0.619054	0.14129	.	.	ENSG00000185010	ENST00000360256	D	0.99239	-5.61	5.47	-1.14	0.09741	.	1.400650	0.04732	N	0.421324	D	0.98902	0.9628	M	0.72118	2.19	0.09310	N	1	D	0.71674	0.998	P	0.61940	0.896	D	0.95280	0.8385	10	0.40728	T	0.16	-0.3018	3.5095	0.07703	0.2661:0.0:0.3004:0.4334	.	1137	P00451	FA8_HUMAN	M	1137	ENSP00000353393:L1137M	ENSP00000353393:L1137M	L	-	1	2	F8	153811850	0.002000	0.14202	0.000000	0.03702	0.011000	0.07611	0.070000	0.14573	-0.382000	0.07870	0.597000	0.82753	CTG	F8	-	NULL	ENSG00000185010		0.423	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4		0.00	15	0	G			154158656	-1			no_errors	ENST00000360256	ensembl	human	known	74_37	missense	17.39	19	4	SNP	0.000	T
FAM171A2	284069	genome.wustl.edu	37	17	42432356	42432356	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:42432356G>A	ENST00000293443.7	-	8	1386	c.1226C>T	c.(1225-1227)gCc>gTc	p.A409V		NM_198475.2	NP_940877.2	A8MVW0	F1712_HUMAN	family with sequence similarity 171, member A2	409						integral component of membrane (GO:0016021)											CCGGGAGGAGGCCAAGTCCCG	0.751																																																	0													6.0	8.0	7.0					17																	42432356		680	1574	2254	SO:0001583	missense	0				CCDS45701.1	17q21.31	2008-06-16			ENSG00000161682	ENSG00000161682			30480	protein-coding gene	gene with protein product						12477932	Standard	NM_198475		Approved	MGC34829	uc002igs.2	A8MVW0	OTTHUMG00000132421	ENST00000293443.7:c.1226C>T	17.37:g.42432356G>A	ENSP00000293443:p.Ala409Val		A8MQB4	Missense_Mutation	SNP	pfam_Uncharacterised_FAM171,superfamily_Collagen-bd_Cna_B-typ_dom	p.A409V	ENST00000293443.7	37	c.1226	CCDS45701.1	17	.	.	.	.	.	.	.	.	.	.	G	10.87	1.472719	0.26423	.	.	ENSG00000161682	ENST00000293443	T	0.31510	1.49	5.13	5.13	0.70059	.	1.526610	0.04261	U	0.340397	T	0.24314	0.0589	N	0.11927	0.2	0.09310	N	1	B	0.27013	0.166	B	0.28916	0.096	T	0.17319	-1.0373	10	0.30078	T	0.28	-7.6948	13.0423	0.58906	0.0:0.0:0.8382:0.1618	.	409	A8MVW0	F1712_HUMAN	V	409	ENSP00000293443:A409V	ENSP00000293443:A409V	A	-	2	0	FAM171A2	39787882	0.097000	0.21791	0.205000	0.23548	0.627000	0.37826	1.347000	0.33975	2.394000	0.81467	0.297000	0.19635	GCC	FAM171A2	-	pfam_Uncharacterised_FAM171	ENSG00000161682		0.751	FAM171A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A2	HGNC	protein_coding	OTTHUMT00000255559.2	-	0.00	111	0	G	NM_198475		42432356	-1	tier1	-	no_errors	ENST00000293443	ensembl	human	known	74_37	missense	9.09	70	7	SNP	0.065	A
FAM186B	84070	genome.wustl.edu	37	12	49999107	49999107	+	Intron	DEL	C	C	-			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:49999107delC	ENST00000257894.2	-	1	258				FAM186B_ENST00000551047.1_Intron|FAM186B_ENST00000544141.1_5'UTR	NM_032130.2	NP_115506.1	Q8IYM0	F186B_HUMAN	family with sequence similarity 186, member B							protein complex (GO:0043234)				breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CTGGGATCAGCCCCCAGTCTC	0.522																																																	0																																										SO:0001627	intron_variant	0			AL136748	CCDS8788.1	12q13.12	2008-09-17	2008-09-17	2008-09-17	ENSG00000135436	ENSG00000135436			25296	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 25"""	C12orf25		11230166	Standard	NM_032130		Approved	DKFZP434J0113	uc001ruo.3	Q8IYM0	OTTHUMG00000167427	ENST00000257894.2:c.96+57G>-	12.37:g.49999107delC			B4DZ15|Q8TCP7|Q9H0L3	Frame_Shift_Del	DEL	NULL	p.A52fs	ENST00000257894.2	37	c.154	CCDS8788.1	12																																																																																			FAM186B	-	NULL	ENSG00000135436		0.522	FAM186B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM186B	HGNC	protein_coding	OTTHUMT00000394583.2		0.00	42	0	C	NM_032130		49999107	-1	tier1		no_errors	ENST00000533372	ensembl	human	known	74_37	frame_shift_del	8.33	22	2	DEL	0.077	-
FAM19A5	25817	genome.wustl.edu	37	22	49145967	49145969	+	3'UTR	DEL	GAG	GAG	-			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr22:49145967_49145969delGAG	ENST00000402357.1	+	0	840_842				FAM19A5_ENST00000473898.1_3'UTR|FAM19A5_ENST00000358295.5_3'UTR|FAM19A5_ENST00000406880.1_3'UTR	NM_001082967.1	NP_001076436.1	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A5							extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				large_intestine(1)|lung(6)	7		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		GCTGTCCTCAGAGGAGGAGGAGG	0.714																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY325118	CCDS46728.1, CCDS46729.1	22q13.32	2005-09-20			ENSG00000219438	ENSG00000219438			21592	protein-coding gene	gene with protein product						15028294	Standard	NM_015381		Approved	TAFA-5	uc003bim.4	Q7Z5A7	OTTHUMG00000150308	ENST00000402357.1:c.*310GAG>-	22.37:g.49145976_49145978delGAG			A6NII9|B0QZ13|B0QZ14|B0QZ15|O95902|Q5H9C4|Q6UWC9|Q8IXR8	RNA	DEL	-	NULL	ENST00000402357.1	37	NULL	CCDS46728.1	22																																																																																			FAM19A5	-	-	ENSG00000219438		0.714	FAM19A5-003	PUTATIVE	basic|CCDS	protein_coding	FAM19A5	HGNC	protein_coding	OTTHUMT00000317504.1		0.00	41	0	GAG	NM_015381		49145969	+1	tier1		no_errors	ENST00000473898	ensembl	human	known	74_37	rna	6.67	28	2	DEL	0.002:0.000:0.000	-
FAM218A	152756	genome.wustl.edu	37	4	165878495	165878495	+	Silent	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr4:165878495G>A	ENST00000513876.2	+	1	396	c.321G>A	c.(319-321)acG>acA	p.T107T	TRIM61_ENST00000329314.5_Intron	NM_153027.1	NP_694572.1	Q96MZ4	F218A_HUMAN	family with sequence similarity 218, member A	107								p.T107T(1)									CGGCTGTCACGCCACCGAAAT	0.547																																																	1	Substitution - coding silent(1)	lung(1)											48.0	46.0	47.0					4																	165878495		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056221	CCDS3807.1	4q32.3	2012-03-01	2012-03-01	2012-03-01	ENSG00000250486	ENSG00000250486			26466	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 39"""	C4orf39		12477932	Standard	NM_153027		Approved	FLJ31659	uc003iqx.1	Q96MZ4	OTTHUMG00000161252	ENST00000513876.2:c.321G>A	4.37:g.165878495G>A				Silent	SNP	NULL	p.T107	ENST00000513876.2	37	c.321	CCDS3807.1	4																																																																																			FAM218A	-	NULL	ENSG00000250486		0.547	FAM218A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM218A	HGNC	protein_coding	OTTHUMT00000364308.1	-	0.00	56	0	G	NM_153027		165878495	+1	tier1	-	no_errors	ENST00000513876	ensembl	human	known	74_37	silent	12.12	29	4	SNP	0.000	A
FANCD2	2177	genome.wustl.edu	37	3	10108913	10108913	+	Missense_Mutation	SNP	G	G	T	rs80258959		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr3:10108913G>T	ENST00000419585.1	+	26	2567	c.2406G>T	c.(2404-2406)caG>caT	p.Q802H	FANCD2_ENST00000383806.1_Missense_Mutation_p.Q802H|FANCD2_ENST00000287647.3_Missense_Mutation_p.Q802H|FANCD2_ENST00000383807.1_Missense_Mutation_p.Q802H			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	802					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)	p.Q802H(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CCTTCTGCCAGGAAACATCAC	0.378			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	2	Substitution - Missense(2)	prostate(2)											82.0	72.0	75.0					3																	10108913		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2406G>T	3.37:g.10108913G>T	ENSP00000398754:p.Gln802His		Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.Q802H	ENST00000419585.1	37	c.2406	CCDS33696.1	3	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373535	0.61624	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.44	1.83	0.25207	.	0.551240	0.20789	N	0.085651	T	0.50240	0.1604	M	0.63428	1.95	0.30837	N	0.736052	P;P	0.50710	0.938;0.938	P;P	0.53988	0.739;0.739	T	0.53229	-0.8468	10	0.54805	T	0.06	.	3.6289	0.08124	0.3156:0.0:0.4962:0.1881	.	802;802	Q9BXW9-2;Q9BXW9	.;FACD2_HUMAN	H	802	ENSP00000287647:Q802H;ENSP00000373318:Q802H;ENSP00000373317:Q802H;ENSP00000398754:Q802H	ENSP00000287647:Q802H	Q	+	3	2	FANCD2	10083913	0.804000	0.28969	0.409000	0.26459	0.904000	0.53231	1.055000	0.30467	0.519000	0.28406	0.585000	0.79938	CAG	FANCD2	-	NULL	ENSG00000144554		0.378	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCD2	HGNC	protein_coding	OTTHUMT00000339873.1	-	0.00	32	0	G			10108913	+1	tier1	rs80258959	no_errors	ENST00000287647	ensembl	human	known	74_37	missense	11.11	24	3	SNP	0.852	T
FBN2	2201	genome.wustl.edu	37	5	127610319	127610319	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:127610319G>T	ENST00000508053.1	-	66	8625	c.7651C>A	c.(7651-7653)Ctg>Atg	p.L2551M	FBN2_ENST00000262464.4_Missense_Mutation_p.L2551M			P35556	FBN2_HUMAN	fibrillin 2	2551	EGF-like 43; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AACCCCCCCAGGGTGTTGACA	0.418																																																	0													97.0	94.0	95.0					5																	127610319		2203	4300	6503	SO:0001583	missense	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.7651C>A	5.37:g.127610319G>T	ENSP00000424571:p.Leu2551Met		B4DU01|Q59ES6	Missense_Mutation	SNP	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.L2551M	ENST00000508053.1	37	c.7651	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	G	18.39	3.612508	0.66672	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.92249	-3.0;-3.0	4.92	4.06	0.47325	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.46442	D	0.000290	D	0.89815	0.6824	L	0.28400	0.85	0.38751	D	0.954105	P	0.45634	0.863	P	0.52514	0.701	D	0.89541	0.3792	10	0.48119	T	0.1	.	8.9475	0.35767	0.075:0.0:0.7785:0.1464	.	2551	P35556	FBN2_HUMAN	M	2551	ENSP00000262464:L2551M;ENSP00000424571:L2551M	ENSP00000262464:L2551M	L	-	1	2	FBN2	127638218	0.994000	0.37717	1.000000	0.80357	0.887000	0.51463	2.237000	0.43061	1.433000	0.47394	-0.203000	0.12734	CTG	FBN2	-	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000138829		0.418	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	-	0.00	71	0	G	NM_001999		127610319	-1	tier1	-	no_errors	ENST00000262464	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
FDXACB1	91893	genome.wustl.edu	37	11	111749781	111749781	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:111749781G>A	ENST00000260257.4	-	1	123	c.76C>T	c.(76-78)Cag>Tag	p.Q26*	C11orf1_ENST00000260276.3_5'Flank|ALG9_ENST00000524880.1_Nonsense_Mutation_p.Q26*|C11orf1_ENST00000530214.1_5'Flank|FDXACB1_ENST00000542429.1_5'UTR|ALG9_ENST00000527377.1_5'Flank|C11orf1_ENST00000528125.1_Intron|C11orf1_ENST00000529270.1_5'Flank	NM_138378.2	NP_612387.1	Q9BRP7	FDXA1_HUMAN	ferredoxin-fold anticodon binding domain containing 1	26					phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA processing (GO:0008033)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(3)	19						TGAGTGCTCTGATCCAGGGTT	0.672											OREG0021330	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													29.0	38.0	35.0					11																	111749781		1989	4178	6167	SO:0001587	stop_gained	0				CCDS44729.1	11q23.1	2011-04-15			ENSG00000255561	ENSG00000255561			25110	protein-coding gene	gene with protein product	"""hypothetical protein BC006136"""						Standard	NR_038364		Approved	LOC91893, hCG_2033039	uc001pmc.4	Q9BRP7	OTTHUMG00000166795	ENST00000260257.4:c.76C>T	11.37:g.111749781G>A	ENSP00000260257:p.Gln26*	1437	A0PJW7|B4DUU2	Nonsense_Mutation	SNP	pfam_DUF2431,pfam_PheS_beta_Fdx_antiC-bd,superfamily_PheS_beta_Fdx_antiC-bd,smart_PheS_beta_Fdx_antiC-bd	p.Q26*	ENST00000260257.4	37	c.76	CCDS44729.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.413705	0.96072	.	.	ENSG00000086848;ENSG00000255561	ENST00000428306;ENST00000260257	.	.	.	6.17	-1.73	0.08081	.	1.340910	0.04165	N	0.323810	.	.	.	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	11.4644	0.50230	0.1246:0.5613:0.3142:0.0	.	.	.	.	X	26	.	ENSP00000387627:Q26X	Q	-	1	0	FDXACB1;ALG9	111254991	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.513000	0.22770	-0.595000	0.05828	-0.176000	0.13171	CAG	FDXACB1	-	pfam_DUF2431	ENSG00000255561		0.672	FDXACB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FDXACB1	HGNC	protein_coding	OTTHUMT00000391497.1	-	0.00	179	0	G	NM_138378		111749781	-1	tier1	-	no_errors	ENST00000260257	ensembl	human	known	74_37	nonsense	23.53	91	28	SNP	0.000	A
FGA	2243	genome.wustl.edu	37	4	155507462	155507462	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr4:155507462C>T	ENST00000302053.3	-	5	1197	c.1119G>A	c.(1117-1119)tgG>tgA	p.W373*	FGA_ENST00000403106.3_Nonsense_Mutation_p.W373*	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	373					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TCTCAGAGGTCCAGTGCCCAG	0.547																																					NSCLC(143;340 1922 20892 22370 48145)												0													64.0	69.0	67.0					4																	155507462		2203	4299	6502	SO:0001587	stop_gained	0				CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1119G>A	4.37:g.155507462C>T	ENSP00000306361:p.Trp373*		A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Nonsense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,pfam_Fibrinogen_a/b/g_coil_dom,pfam_Fibrinogen_aC,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.W373*	ENST00000302053.3	37	c.1119	CCDS3787.1	4	.	.	.	.	.	.	.	.	.	.	C	17.83	3.484447	0.63962	.	.	ENSG00000171560	ENST00000302053;ENST00000403106	.	.	.	4.52	3.64	0.41730	.	19.814700	0.00871	N	0.002035	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.975	0.41777	0.349:0.651:0.0:0.0	.	.	.	.	X	373	.	ENSP00000306361:W373X	W	-	3	0	FGA	155726912	0.009000	0.17119	0.031000	0.17742	0.010000	0.07245	0.737000	0.26144	2.046000	0.60703	0.650000	0.86243	TGG	FGA	-	NULL	ENSG00000171560		0.547	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FGA	HGNC	protein_coding	OTTHUMT00000317593.1	-	0.00	68	0	C	NM_000508		155507462	-1	tier1	-	no_errors	ENST00000302053	ensembl	human	known	74_37	nonsense	13.11	53	8	SNP	0.013	T
FGD5	152273	genome.wustl.edu	37	3	14965554	14965554	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr3:14965554G>T	ENST00000285046.5	+	17	4087	c.3977G>T	c.(3976-3978)cGc>cTc	p.R1326L	FGD5_ENST00000543601.1_Missense_Mutation_p.R1085L|FGD5_ENST00000476851.1_3'UTR|FGD5-AS1_ENST00000430166.1_RNA	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1326					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						TCTTCACCCCGCTTCTCGGGC	0.557																																																	0													84.0	84.0	84.0					3																	14965554		2041	4208	6249	SO:0001583	missense	0			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.3977G>T	3.37:g.14965554G>T	ENSP00000285046:p.Arg1326Leu		B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.R1326L	ENST00000285046.5	37	c.3977	CCDS46767.1	3	.	.	.	.	.	.	.	.	.	.	G	15.71	2.913099	0.52439	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.11604	2.76;2.76	4.9	4.9	0.64082	.	0.000000	0.50627	D	0.000105	T	0.16854	0.0405	M	0.68317	2.08	0.58432	D	0.999998	B;B	0.18013	0.022;0.025	B;B	0.21360	0.019;0.034	T	0.02603	-1.1135	10	0.42905	T	0.14	-26.7201	18.0698	0.89403	0.0:0.0:1.0:0.0	.	1085;1326	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	L	1326;1085	ENSP00000285046:R1326L;ENSP00000445949:R1085L	ENSP00000285046:R1326L	R	+	2	0	FGD5	14940558	1.000000	0.71417	1.000000	0.80357	0.576000	0.36127	3.675000	0.54605	2.260000	0.74910	0.305000	0.20034	CGC	FGD5	-	NULL	ENSG00000154783		0.557	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD5	HGNC	protein_coding	OTTHUMT00000340628.1		0.00	50	0	G	NM_152536		14965554	+1			no_errors	ENST00000285046	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
DMBT1P1	375940	genome.wustl.edu	37	10	124516522	124516522	+	RNA	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr10:124516522C>T	ENST00000439464.2	+	0	313					NR_003570.1																						CTGGAGGATGCCAGTGTCATC	0.468																																																	0																																												0																															10.37:g.124516522C>T				RNA	SNP	-	NULL	ENST00000439464.2	37	NULL		10																																																																																			RP11-318C4.2	-	-	ENSG00000176584		0.468	RP11-318C4.2-001	KNOWN	basic	processed_transcript	FLJ46361	Clone_based_vega_gene	pseudogene	OTTHUMT00000471298.1		0.00	39	0	C			124516522	+1			no_errors	ENST00000439464	ensembl	human	known	74_37	rna	8.89	41	4	SNP	0.983	T
FLRT2	23768	genome.wustl.edu	37	14	86089572	86089572	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr14:86089572T>C	ENST00000330753.4	+	2	2481	c.1714T>C	c.(1714-1716)Tac>Cac	p.Y572H	FLRT2_ENST00000554746.1_Missense_Mutation_p.Y572H	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	572					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		AAAGGGGCGCTACACCTCCCA	0.557																																																	0													76.0	82.0	80.0					14																	86089572		2203	4300	6503	SO:0001583	missense	0			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1714T>C	14.37:g.86089572T>C	ENSP00000332879:p.Tyr572His		A0AV84|B7ZLP3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Fibronectin_type3,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Fibronectin_type3	p.Y572H	ENST00000330753.4	37	c.1714	CCDS9877.1	14	.	.	.	.	.	.	.	.	.	.	T	16.13	3.036760	0.54896	.	.	ENSG00000185070	ENST00000330753;ENST00000554746;ENST00000535800	T;T	0.55930	0.49;0.49	6.17	6.17	0.99709	.	0.132994	0.53938	D	0.000057	T	0.42223	0.1193	N	0.22421	0.69	0.36716	D	0.88092	P	0.52316	0.952	B	0.42692	0.395	T	0.46062	-0.9218	10	0.24483	T	0.36	-23.1501	16.8222	0.85835	0.0:0.0:0.0:1.0	.	572	O43155	FLRT2_HUMAN	H	572;572;225	ENSP00000332879:Y572H;ENSP00000451050:Y572H	ENSP00000332879:Y572H	Y	+	1	0	FLRT2	85159325	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.020000	0.64066	2.371000	0.80710	0.533000	0.62120	TAC	FLRT2	-	NULL	ENSG00000185070		0.557	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT2	HGNC	protein_coding	OTTHUMT00000413193.1	-	0.00	21	0	T			86089572	+1	tier1	-	no_errors	ENST00000330753	ensembl	human	known	74_37	missense	32.14	19	9	SNP	1.000	C
FMN2	56776	genome.wustl.edu	37	1	240256817	240256817	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:240256817C>T	ENST00000319653.9	+	1	1638	c.1408C>T	c.(1408-1410)Cgg>Tgg	p.R470W		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	470					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CAAGAAGCACCGGGCCGACGG	0.736																																																	0													12.0	16.0	15.0					1																	240256817		2158	4191	6349	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.1408C>T	1.37:g.240256817C>T	ENSP00000318884:p.Arg470Trp		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_Formin_homology_1,smart_FH2_Formin,pfscan_DEP_dom	p.R470W	ENST00000319653.9	37	c.1408	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	C	13.00	2.107057	0.37145	.	.	ENSG00000155816	ENST00000319653	T	0.77750	-1.12	4.61	2.53	0.30540	.	0.304425	0.25863	N	0.027819	T	0.76407	0.3983	L	0.34521	1.04	0.58432	D	0.999994	D	0.76494	0.999	P	0.56434	0.798	T	0.78145	-0.2318	10	0.87932	D	0	.	11.0168	0.47693	0.5856:0.4144:0.0:0.0	.	470	Q9NZ56	FMN2_HUMAN	W	470	ENSP00000318884:R470W	ENSP00000318884:R470W	R	+	1	2	FMN2	238323440	1.000000	0.71417	0.864000	0.33941	0.941000	0.58515	2.541000	0.45735	1.127000	0.42034	0.563000	0.77884	CGG	FMN2	-	NULL	ENSG00000155816		0.736	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2		0.00	30	0	C	XM_371352		240256817	+1			no_errors	ENST00000319653	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.742	T
FSHR	2492	genome.wustl.edu	37	2	49190059	49190059	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:49190059C>T	ENST00000406846.2	-	10	2020	c.1901G>A	c.(1900-1902)cGc>cAc	p.R634H	FSHR_ENST00000541117.1_Missense_Mutation_p.R370H|FSHR_ENST00000346173.3_Missense_Mutation_p.R572H|FSHR_ENST00000304421.4_Missense_Mutation_p.R608H	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	634					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	GAAATCTCTGCGAAAGTTTTT	0.453									Gonadal Dysgenesis, 46 XX																																								0													79.0	81.0	80.0					2																	49190059		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1901G>A	2.37:g.49190059C>T	ENSP00000384708:p.Arg634His		A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_GnHR_TM,pfam_LRR-contain_N,pfam_Leu-rich_rpt,smart_LRR-contain_N,pfscan_GPCR_Rhodpsn_7TM,prints_FSH_rcpt,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,prints_TSH_rcpt	p.R634H	ENST00000406846.2	37	c.1901	CCDS1843.1	2	.	.	.	.	.	.	.	.	.	.	C	19.45	3.830299	0.71258	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000541117	T;T;T;T	0.58358	0.34;0.34;0.34;0.34	5.35	5.35	0.76521	.	0.122723	0.52532	D	0.000068	T	0.79299	0.4422	M	0.91510	3.215	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.996	T	0.82733	-0.0311	9	.	.	.	.	18.5892	0.91202	0.0:1.0:0.0:0.0	.	608;572;634	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	H	634;572;608;370	ENSP00000384708:R634H;ENSP00000333908:R572H;ENSP00000306780:R608H;ENSP00000444172:R370H	.	R	-	2	0	FSHR	49043563	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.520000	0.60524	2.941000	0.99782	0.655000	0.94253	CGC	FSHR	-	prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn	ENSG00000170820		0.453	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSHR	HGNC	protein_coding	OTTHUMT00000251367.2	-	0.00	61	0	C			49190059	-1	tier1	-	no_errors	ENST00000406846	ensembl	human	known	74_37	missense	25.00	21	7	SNP	1.000	T
GAMT	2593	genome.wustl.edu	37	19	1399827	1399827	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:1399827G>A	ENST00000252288.2	-	2	358	c.292C>T	c.(292-294)Cgg>Tgg	p.R98W	GAMT_ENST00000447102.3_Missense_Mutation_p.R98W	NM_000156.5	NP_000147.1	Q14353	GAMT_HUMAN	guanidinoacetate N-methyltransferase	98	RMT2. {ECO:0000255|PROSITE- ProRule:PRU00892}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine biosynthetic process (GO:0006601)|creatine metabolic process (GO:0006600)|muscle contraction (GO:0006936)|organ morphogenesis (GO:0009887)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	guanidinoacetate N-methyltransferase activity (GO:0030731)|methyltransferase activity (GO:0008168)			central_nervous_system(1)|endometrium(3)|kidney(1)|upper_aerodigestive_tract(1)	6		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Lung NSC(49;0.000195)|Breast(49;0.000231)|all_lung(49;0.000247)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Creatine(DB00148)|Guanidine(DB00536)	TCCCGGAGCCGCTGGAAGACG	0.657																																					Colon(167;1531 1939 13427 28842 31956)												0													31.0	28.0	29.0					19																	1399827		2185	4289	6474	SO:0001583	missense	0			Z49878	CCDS12064.1, CCDS45897.1	19p13.3	2008-02-05							4136	protein-coding gene	gene with protein product		601240				9570966, 8547310	Standard	NM_000156		Approved	PIG2, TP53I2	uc002lsk.4	Q14353		ENST00000252288.2:c.292C>T	19.37:g.1399827G>A	ENSP00000252288:p.Arg98Trp		A8K0A0|Q53Y34|Q8WVJ1	Missense_Mutation	SNP	NULL	p.R98W	ENST00000252288.2	37	c.292	CCDS12064.1	19	.	.	.	.	.	.	.	.	.	.	G	20.4	3.983150	0.74474	.	.	ENSG00000130005	ENST00000252288;ENST00000447102	D;D	0.90732	-2.72;-2.72	4.18	3.07	0.35406	.	0.106321	0.64402	D	0.000010	D	0.95014	0.8386	M	0.87180	2.865	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.74674	0.984;0.955	D	0.94890	0.8047	10	0.52906	T	0.07	-41.9674	12.7985	0.57571	0.0:0.1649:0.8351:0.0	.	98;98	A8K0A0;Q14353	.;GAMT_HUMAN	W	98	ENSP00000252288:R98W;ENSP00000403536:R98W	ENSP00000252288:R98W	R	-	1	2	GAMT	1350827	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	0.860000	0.27871	2.147000	0.66899	0.462000	0.41574	CGG	GAMT	-	NULL	ENSG00000130005		0.657	GAMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAMT	HGNC	protein_coding	OTTHUMT00000449739.1	-	0.00	50	0	G	NM_138924		1399827	-1	tier1	-	no_errors	ENST00000447102	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	A
GCLC	2729	genome.wustl.edu	37	6	53363689	53363689	+	Silent	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:53363689T>G	ENST00000229416.6	-	16	2262	c.1779A>C	c.(1777-1779)atA>atC	p.I593I		NM_001197115.1|NM_001498.3	NP_001184044.1|NP_001489.1	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit	593					apoptotic mitochondrial changes (GO:0008637)|cell redox homeostasis (GO:0045454)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to arsenic-containing substance (GO:0046685)|response to heat (GO:0009408)|response to hormone (GO:0009725)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|coenzyme binding (GO:0050662)|glutamate binding (GO:0016595)|glutamate-cysteine ligase activity (GO:0004357)|magnesium ion binding (GO:0000287)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|Vitamin E(DB00163)	TTTCATCAGTTATGACACTGT	0.408																																																	0													148.0	133.0	138.0					6																	53363689		2203	4300	6503	SO:0001819	synonymous_variant	0			M90656	CCDS4952.1, CCDS75471.1	6p12	2008-02-05				ENSG00000001084	6.3.2.2		4311	protein-coding gene	gene with protein product		606857		GLCLC, GLCL		1350904	Standard	NM_001498		Approved	GCS	uc003pbw.2	P48506		ENST00000229416.6:c.1779A>C	6.37:g.53363689T>G			Q14399	Silent	SNP	pfam_GCS	p.I593	ENST00000229416.6	37	c.1779	CCDS4952.1	6																																																																																			GCLC	-	pfam_GCS	ENSG00000001084		0.408	GCLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCLC	HGNC	protein_coding	OTTHUMT00000359710.2		0.00	36	0	T			53363689	-1			no_errors	ENST00000229416	ensembl	human	known	74_37	silent	6.98	40	3	SNP	0.847	G
GCNT4	51301	genome.wustl.edu	37	5	74325823	74325823	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:74325823G>T	ENST00000322348.4	-	1	901	c.40C>A	c.(40-42)Cag>Aag	p.Q14K		NM_016591.2	NP_057675.1	Q9P109	GCNT4_HUMAN	glucosaminyl (N-acetyl) transferase 4, core 2	14					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|homeostasis of number of cells (GO:0048872)|inter-male aggressive behavior (GO:0002121)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|thyroid hormone metabolic process (GO:0042403)|tissue morphogenesis (GO:0048729)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|skin(1)|stomach(2)	19		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		AAAACTTTCTGCTGTAGGGTA	0.333																																																	0													106.0	124.0	118.0					5																	74325823		2182	4235	6417	SO:0001583	missense	0			AF132035	CCDS4026.1	5q12	2013-02-25	2010-03-16		ENSG00000176928	ENSG00000176928	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	17973	protein-coding gene	gene with protein product	"""core 2 beta-1,6-N-acetylglucosaminyltransferase 3"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 4"""		"""glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""			10753916	Standard	NM_016591		Approved	C2GNT3	uc003kdn.3	Q9P109	OTTHUMG00000131272	ENST00000322348.4:c.40C>A	5.37:g.74325823G>T	ENSP00000317027:p.Gln14Lys			Missense_Mutation	SNP	pfam_Glyco_trans_14	p.Q14K	ENST00000322348.4	37	c.40	CCDS4026.1	5	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788598	0.31685	.	.	ENSG00000176928	ENST00000322348	T	0.07800	3.16	5.95	5.95	0.96441	.	0.347351	0.27080	N	0.021038	T	0.09905	0.0243	L	0.50333	1.59	0.29174	N	0.876968	B	0.23442	0.085	B	0.19666	0.026	T	0.06972	-1.0797	10	0.29301	T	0.29	-0.0155	13.0999	0.59214	0.0:0.0:0.8005:0.1995	.	14	Q9P109	GCNT4_HUMAN	K	14	ENSP00000317027:Q14K	ENSP00000317027:Q14K	Q	-	1	0	GCNT4	74361579	0.977000	0.34250	0.997000	0.53966	0.984000	0.73092	1.667000	0.37471	2.824000	0.97209	0.655000	0.94253	CAG	GCNT4	-	NULL	ENSG00000176928		0.333	GCNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCNT4	HGNC	protein_coding	OTTHUMT00000254040.1		0.00	38	0	G	NM_016591		74325823	-1			no_errors	ENST00000322348	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.997	T
GDI1	2664	genome.wustl.edu	37	X	153668793	153668793	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chrX:153668793G>A	ENST00000447750.2	+	6	994	c.659G>A	c.(658-660)gGc>gAc	p.G220D		NM_001493.2	NP_001484.1	P31150	GDIA_HUMAN	GDP dissociation inhibitor 1	220					negative regulation of axonogenesis (GO:0050771)|negative regulation of protein targeting to membrane (GO:0090315)|protein transport (GO:0015031)|Rab protein signal transduction (GO:0032482)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|midbody (GO:0030496)|neuron projection (GO:0043005)|protein complex (GO:0043234)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|Rab GDP-dissociation inhibitor activity (GO:0005093)			autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	16	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCCCGGTATGGCAAGAGCCCA	0.557																																																	0													113.0	97.0	103.0					X																	153668793		2203	4300	6503	SO:0001583	missense	0			X79353	CCDS35452.1	Xq28	2008-08-01			ENSG00000203879	ENSG00000203879			4226	protein-coding gene	gene with protein product	"""mental retardation, X-linked 41"", ""mental retardation, X-linked 48"", ""rab GDP-dissociation inhibitor, alpha"""	300104		MRX48, MRX41, GDIL		7543319, 7849400	Standard	NM_001493		Approved	RABGDIA, XAP-4, OPHN2, FLJ41411	uc004fli.4	P31150	OTTHUMG00000033293	ENST00000447750.2:c.659G>A	X.37:g.153668793G>A	ENSP00000394071:p.Gly220Asp		P50394|Q6FG50|Q7Z2G6|Q7Z2G9|Q7Z2H5|Q7Z2I6	Missense_Mutation	SNP	pfam_GDP_dissociation_inhibitor,prints_RabGDI,prints_GDP_dissociation_inhibitor	p.G220D	ENST00000447750.2	37	c.659	CCDS35452.1	X	.	.	.	.	.	.	.	.	.	.	G	31	5.104700	0.94245	.	.	ENSG00000203879	ENST00000447750;ENST00000369741	D	0.87412	-2.25	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.92776	0.7703	M	0.78456	2.415	0.80722	D	1	P	0.51057	0.941	P	0.62298	0.9	D	0.93332	0.6702	10	0.66056	D	0.02	-22.2056	16.0507	0.80760	0.0:0.0:1.0:0.0	.	220	P31150	GDIA_HUMAN	D	220;204	ENSP00000394071:G220D	ENSP00000358756:G204D	G	+	2	0	GDI1	153321987	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.797000	0.99108	2.391000	0.81399	0.600000	0.82982	GGC	GDI1	-	pfam_GDP_dissociation_inhibitor,prints_GDP_dissociation_inhibitor	ENSG00000203879		0.557	GDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDI1	HGNC	protein_coding	OTTHUMT00000081649.2	-	0.00	32	0	G	NM_001493		153668793	+1	tier1	-	no_errors	ENST00000447750	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	A
GOLGA8A	23015	genome.wustl.edu	37	15	34673778	34673778	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr15:34673778G>C	ENST00000359187.4	-	16	1710	c.1646C>G	c.(1645-1647)cCt>cGt	p.P549R	MIR1233-1_ENST00000408722.1_RNA|GOLGA8A_ENST00000360553.3_Missense_Mutation_p.P549R|GOLGA8A_ENST00000543376.1_Missense_Mutation_p.P406R|GOLGA8A_ENST00000432566.2_Missense_Mutation_p.P579R	NM_181077.3	NP_851422.1	A7E2F4	GOG8A_HUMAN	golgin A8 family, member A	577	Golgi-targeting domain. {ECO:0000250}.					Golgi apparatus (GO:0005794)|membrane (GO:0016020)							all_lung(180;2.78e-08)		all cancers(64;8.27e-19)|GBM - Glioblastoma multiforme(113;6.98e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		TCCTTGTGCAGGCTCCACGCT	0.622																																																	0													38.0	33.0	35.0					15																	34673778		2199	4291	6490	SO:0001583	missense	0			BX648160	CCDS10038.1	15q14	2011-10-25	2010-02-12		ENSG00000175265	ENSG00000175265			31972	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 8A"""			10660574, 10677249	Standard	NM_181077		Approved	GM88, GOLGIN-67	uc001zii.3	A7E2F4	OTTHUMG00000129447	ENST00000359187.4:c.1646C>G	15.37:g.34673778G>C	ENSP00000352111:p.Pro549Arg		A7MCY9|B7ZMK5|O94937|Q52M46|Q68DK6|Q9NZG8|Q9NZW0|Q9NZW3	Missense_Mutation	SNP	NULL	p.P579R	ENST00000359187.4	37	c.1736	CCDS10038.1	15	.	.	.	.	.	.	.	.	.	.	g	9.271	1.045716	0.19748	.	.	ENSG00000175265	ENST00000359187;ENST00000360553;ENST00000432566;ENST00000543376	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	0.514	0.514	0.17007	.	.	.	.	.	T	0.44787	0.1310	M	0.75150	2.29	0.09310	N	1	D;D	0.55385	0.971;0.971	P;P	0.56042	0.79;0.79	T	0.28202	-1.0051	8	0.87932	D	0	.	.	.	.	.	549;577	A7E2F4-3;A7E2F4	.;GOG8A_HUMAN	R	549;549;579;406	ENSP00000352111:P549R;ENSP00000353755:P549R;ENSP00000402791:P579R;ENSP00000438613:P406R	ENSP00000352111:P549R	P	-	2	0	GOLGA8A	32461070	0.533000	0.26354	0.020000	0.16555	0.029000	0.11900	2.017000	0.40981	0.540000	0.28808	0.398000	0.26397	CCT	GOLGA8A	-	NULL	ENSG00000175265		0.622	GOLGA8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA8A	HGNC	protein_coding	OTTHUMT00000251830.2	-	0.00	173	0	G	NM_181076		34673778	-1	tier1	-	no_errors	ENST00000432566	ensembl	human	known	74_37	missense	27.12	86	32	SNP	0.020	C
GPR116	221395	genome.wustl.edu	37	6	46826150	46826150	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:46826150G>T	ENST00000283296.7	-	17	3778	c.3490C>A	c.(3490-3492)Ctc>Atc	p.L1164I	GPR116_ENST00000362015.4_Missense_Mutation_p.L1164I|GPR116_ENST00000456426.2_Missense_Mutation_p.L1022I|GPR116_ENST00000545669.1_Missense_Mutation_p.L593I|GPR116_ENST00000265417.7_Missense_Mutation_p.L1164I	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	1164					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L1164F(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			TCCCAGTTGAGCCAACAGACA	0.547																																					NSCLC(59;410 1274 8751 36715 50546)												1	Substitution - Missense(1)	endometrium(1)											42.0	39.0	40.0					6																	46826150		2203	4300	6503	SO:0001583	missense	0			AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.3490C>A	6.37:g.46826150G>T	ENSP00000283296:p.Leu1164Ile		O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_SEA_dom,pfam_GPS_dom,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom,prints_GPCR_2_Ig-hepta_rcpt,prints_GPCR_2_secretin-like	p.L1164I	ENST00000283296.7	37	c.3490	CCDS4919.1	6	.	.	.	.	.	.	.	.	.	.	G	27.8	4.863712	0.91511	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000545557;ENST00000265417;ENST00000545669	T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2	5.38	5.38	0.77491	GPCR, family 2-like (1);	0.000000	0.53938	D	0.000055	T	0.58323	0.2114	M	0.79258	2.445	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;1.0;0.997;1.0	D;D;D;D;D	0.97110	1.0;0.994;0.999;0.99;0.999	T	0.62464	-0.6849	10	0.87932	D	0	-21.8327	19.5002	0.95091	0.0:0.0:1.0:0.0	.	593;719;1164;1022;1164	F5GWK9;B4DTV3;E9PBS6;Q8IZF2-3;Q8IZF2	.;.;.;.;GP116_HUMAN	I	1164;1164;1164;1022;535;1164;593	ENSP00000283296:L1164I;ENSP00000354563:L1164I;ENSP00000412866:L1022I;ENSP00000265417:L1164I;ENSP00000441581:L593I	ENSP00000265417:L1164I	L	-	1	0	GPR116	46934109	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.755000	0.98912	2.679000	0.91253	0.650000	0.86243	CTC	GPR116	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_Ig-hepta_rcpt	ENSG00000069122		0.547	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR116	HGNC	protein_coding	OTTHUMT00000040806.2		0.00	57	0	G	NM_015234		46826150	-1			no_errors	ENST00000265417	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	T
GPR98	84059	genome.wustl.edu	37	5	89971204	89971204	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:89971204G>T	ENST00000405460.2	+	24	5351	c.5255G>T	c.(5254-5256)aGg>aTg	p.R1752M	GPR98_ENST00000450321.2_3'UTR	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1752	Calx-beta 12. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CTTCTGGGAAGGGTGACTGCG	0.468																																																	0													89.0	95.0	93.0					5																	89971204		2016	4174	6190	SO:0001583	missense	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.5255G>T	5.37:g.89971204G>T	ENSP00000384582:p.Arg1752Met		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.R1752M	ENST00000405460.2	37	c.5255	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	G	14.73	2.621472	0.46736	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.30448	1.53	5.16	3.3	0.37823	Na-Ca exchanger/integrin-beta4 (2);	0.187495	0.53938	D	0.000045	T	0.44138	0.1279	M	0.83953	2.67	0.23607	N	0.997302	P	0.37636	0.603	P	0.48738	0.588	T	0.38714	-0.9648	10	0.56958	D	0.05	.	5.4983	0.16815	0.0772:0.2754:0.5201:0.1274	.	1752	Q8WXG9	GPR98_HUMAN	M	1752	ENSP00000384582:R1752M	ENSP00000296619:R1752M	R	+	2	0	GPR98	90006960	0.999000	0.42202	0.496000	0.27539	0.600000	0.36913	1.445000	0.35079	1.248000	0.43934	0.591000	0.81541	AGG	GPR98	-	pfam_Calx_beta,smart_Calx_beta	ENSG00000164199		0.468	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	-	0.00	75	0	G	NM_032119		89971204	+1	tier1	-	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.258	T
GRAP2	9402	genome.wustl.edu	37	22	40356069	40356069	+	Nonsense_Mutation	SNP	G	G	T	rs138713668		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr22:40356069G>T	ENST00000344138.4	+	4	444	c.181G>T	c.(181-183)Gaa>Taa	p.E61*	GRAP2_ENST00000540310.1_Intron|RP3-370M22.8_ENST00000424496.1_RNA|GRAP2_ENST00000544756.1_5'UTR|GRAP2_ENST00000478445.1_3'UTR|GRAP2_ENST00000407075.3_Nonsense_Mutation_p.E61*|GRAP2_ENST00000399090.2_Missense_Mutation_p.R4L|GRAP2_ENST00000543252.1_Intron	NM_004810.2	NP_004801.1	O75791	GRAP2_HUMAN	GRB2-related adaptor protein 2	61	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell-cell signaling (GO:0007267)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						ATGGTTTCACGAAGGCCTCTC	0.552																																																	0													301.0	317.0	311.0					22																	40356069		2203	4300	6503	SO:0001587	stop_gained	0			AF102694	CCDS13999.1	22q13.2	2013-02-14			ENSG00000100351	ENSG00000100351		"""SH2 domain containing"""	4563	protein-coding gene	gene with protein product		604518				9878555, 10224278	Standard	XM_005261836		Approved	Grf40, GrbX, GRBLG, GADS, Mona	uc003ayh.2	O75791	OTTHUMG00000151097	ENST00000344138.4:c.181G>T	22.37:g.40356069G>T	ENSP00000339186:p.Glu61*		B7Z8I3|O43726|Q9NRB7	Nonsense_Mutation	SNP	pfam_SH3_domain,pfam_SH2,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.E61*	ENST00000344138.4	37	c.181	CCDS13999.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	6.725504|6.725504	0.97792|0.97792	.|.	.|.	ENSG00000100351|ENSG00000100351	ENST00000344138;ENST00000544006;ENST00000420971;ENST00000407075|ENST00000399090	.|T	.|0.56611	.|0.45	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.102676|.	0.64402|.	D|.	0.000004|.	.|T	.|0.62441	.|0.2428	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|D	.|0.59357	.|0.985	.|P	.|0.48901	.|0.594	.|T	.|0.68093	.|-0.5500	.|8	0.05351|0.87932	T|D	0.99|0	-12.3951|-12.3951	19.2272|19.2272	0.93822|0.93822	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|4	.|B7Z8I3	.|.	X|L	61;35;61;61|4	.|ENSP00000382040:R4L	ENSP00000339186:E61X|ENSP00000382040:R4L	E|R	+|+	1|2	0|0	GRAP2|GRAP2	38686015|38686015	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.963000|0.963000	0.63663|0.63663	6.603000|6.603000	0.74145|0.74145	2.540000|2.540000	0.85666|0.85666	0.655000|0.655000	0.94253|0.94253	GAA|CGA	GRAP2	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	ENSG00000100351		0.552	GRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAP2	HGNC	protein_coding	OTTHUMT00000321295.1		0.00	111	0	G	NM_004810		40356069	+1			no_errors	ENST00000344138	ensembl	human	known	74_37	nonsense	5.80	65	4	SNP	1.000	T
GSK3B	2932	genome.wustl.edu	37	3	119624622	119624622	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr3:119624622G>A	ENST00000264235.8	-	7	1775	c.793C>T	c.(793-795)Cag>Tag	p.Q265*	GSK3B_ENST00000316626.5_Nonsense_Mutation_p.Q265*	NM_001146156.1|NM_002093.3	NP_001139628.1|NP_002084.2	P49841	GSK3B_HUMAN	glycogen synthase kinase 3 beta	265	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell migration (GO:0016477)|cellular response to interleukin-3 (GO:0036016)|cellular response to mechanical stimulus (GO:0071260)|circadian rhythm (GO:0007623)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition (GO:0001837)|ER overload response (GO:0006983)|establishment of cell polarity (GO:0030010)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hippocampus development (GO:0021766)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|myoblast fusion (GO:0007520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron maturation (GO:0014043)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of type B pancreatic cell development (GO:2000077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein binding (GO:0032092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|protein localization to microtubule (GO:0035372)|protein phosphorylation (GO:0006468)|re-entry into mitotic cell cycle (GO:0000320)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of microtubule-based process (GO:0032886)|regulation of neuronal synaptic plasticity (GO:0048168)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|superior temporal gyrus development (GO:0071109)	beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|kinase activity (GO:0016301)|NF-kappaB binding (GO:0051059)|p53 binding (GO:0002039)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II transcription factor binding (GO:0001085)|tau-protein kinase activity (GO:0050321)|ubiquitin protein ligase binding (GO:0031625)	p.Q265*(2)		endometrium(1)|large_intestine(8)|lung(7)|prostate(2)	18				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)	TCTACCAACTGATCCACACCA	0.378																																																	2	Substitution - Nonsense(2)	lung(2)											274.0	288.0	283.0					3																	119624622		2203	4300	6503	SO:0001587	stop_gained	0			BC012760	CCDS2996.1, CCDS54628.1	3q13.3	2008-02-15			ENSG00000082701	ENSG00000082701			4617	protein-coding gene	gene with protein product		605004				10486203	Standard	NM_002093		Approved		uc003edm.3	P49841	OTTHUMG00000133765	ENST00000264235.8:c.793C>T	3.37:g.119624622G>A	ENSP00000264235:p.Gln265*		D3DN89|Q9BWH3|Q9UL47	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q265*	ENST00000264235.8	37	c.793	CCDS54628.1	3	.	.	.	.	.	.	.	.	.	.	G	37	6.480426	0.97603	.	.	ENSG00000082701	ENST00000264235;ENST00000316626	.	.	.	4.99	4.11	0.48088	.	0.112285	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-0.5724	13.0355	0.58867	0.0787:0.0:0.9213:0.0	.	.	.	.	X	265	.	ENSP00000264235:Q265X	Q	-	1	0	GSK3B	121107312	1.000000	0.71417	0.999000	0.59377	0.865000	0.49528	9.070000	0.93974	1.322000	0.45245	0.491000	0.48974	CAG	GSK3B	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000082701		0.378	GSK3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSK3B	HGNC	protein_coding	OTTHUMT00000258240.2	-	0.00	53	0	G			119624622	-1	tier1	-	no_errors	ENST00000316626	ensembl	human	known	74_37	nonsense	7.41	50	4	SNP	1.000	A
GSN	2934	genome.wustl.edu	37	9	124064311	124064311	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:124064311G>T	ENST00000373818.4	+	2	284	c.215G>T	c.(214-216)cGt>cTt	p.R72L	GSN_ENST00000394353.2_Missense_Mutation_p.R32L|GSN_ENST00000341272.2_Missense_Mutation_p.R21L|GSN_ENST00000545652.1_Missense_Mutation_p.R29L|GSN_ENST00000412819.1_Missense_Mutation_p.R21L|GSN_ENST00000373808.2_Missense_Mutation_p.R21L|GSN_ENST00000373823.3_Missense_Mutation_p.R21L|GSN_ENST00000449733.1_Missense_Mutation_p.R21L|GSN_ENST00000436847.1_Missense_Mutation_p.R32L	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin	72	Actin-severing. {ECO:0000255}.				actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						CAGATCTGGCGTGTGGAGAAG	0.597																																																	0													151.0	136.0	141.0					9																	124064311		2203	4300	6503	SO:0001583	missense	0			X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.215G>T	9.37:g.124064311G>T	ENSP00000362924:p.Arg72Leu		A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	Missense_Mutation	SNP	pfam_Gelsolin_dom,smart_Villin/Gelsolin,prints_Villin/Gelsolin	p.R72L	ENST00000373818.4	37	c.215	CCDS6828.1	9	.	.	.	.	.	.	.	.	.	.	G	35	5.422979	0.96111	.	.	ENSG00000148180	ENST00000373823;ENST00000432226;ENST00000449773;ENST00000436847;ENST00000394353;ENST00000449733;ENST00000412819;ENST00000341272;ENST00000373808;ENST00000394352;ENST00000456109;ENST00000545652;ENST00000373818	T;T;T;T;T;T;T;T;T;T;T	0.20069	2.1;2.1;2.1;2.1;2.1;2.1;2.1;2.1;2.1;2.1;2.1	5.24	5.24	0.73138	.	0.086425	0.85682	D	0.000000	T	0.43122	0.1233	L	0.52126	1.63	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.31752	-0.9932	10	0.87932	D	0	-8.8849	17.8184	0.88642	0.0:0.0:1.0:0.0	.	45;29;32;72	B7Z9A0;F5H1A8;B7Z373;P06396	.;.;.;GELS_HUMAN	L	21;21;32;32;32;21;21;21;21;21;21;29;72	ENSP00000362929:R21L;ENSP00000404226:R21L;ENSP00000410657:R32L;ENSP00000411293:R32L;ENSP00000377882:R32L;ENSP00000409358:R21L;ENSP00000416586:R21L;ENSP00000340888:R21L;ENSP00000362914:R21L;ENSP00000445823:R29L;ENSP00000362924:R72L	ENSP00000340888:R21L	R	+	2	0	GSN	123104132	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.802000	0.99131	2.424000	0.82194	0.557000	0.71058	CGT	GSN	-	smart_Villin/Gelsolin	ENSG00000148180		0.597	GSN-001	KNOWN	basic|CCDS	protein_coding	GSN	HGNC	protein_coding	OTTHUMT00000053861.1	-	0.00	61	0	G	NM_000177		124064311	+1	tier1	-	no_errors	ENST00000373818	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
GSTK1	373156	genome.wustl.edu	37	7	142965910	142965910	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr7:142965910G>A	ENST00000358406.5	+	8	732	c.661G>A	c.(661-663)Gcc>Acc	p.A221T	GSTK1_ENST00000409500.3_Missense_Mutation_p.A209T|AC073342.12_ENST00000427392.1_RNA|GSTK1_ENST00000443571.2_Missense_Mutation_p.A178T|GSTK1_ENST00000479303.1_Missense_Mutation_p.A277T	NM_015917.2	NP_057001.1	Q9Y2Q3	GSTK1_HUMAN	glutathione S-transferase kappa 1	221					epithelial cell differentiation (GO:0030855)|glutathione metabolic process (GO:0006749)|oxidation-reduction process (GO:0055114)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|peroxisome (GO:0005777)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)|protein disulfide oxidoreductase activity (GO:0015035)|receptor binding (GO:0005102)			lung(4)	4	Melanoma(164;0.059)				Glutathione(DB00143)	TATACCTCCAGCCGTGAATGC	0.507																																																	0													95.0	85.0	88.0					7																	142965910		2203	4300	6503	SO:0001583	missense	0				CCDS5877.1, CCDS47730.1, CCDS47731.1, CCDS47732.1	7q34	2012-06-21			ENSG00000197448	ENSG00000197448	2.5.1.18	"""Glutathione S-transferases / Mitochondrial (kappa)"""	16906	protein-coding gene	gene with protein product		602321				12720545, 14742434	Standard	NM_015917		Approved	GST13	uc003wcj.3	Q9Y2Q3	OTTHUMG00000152637	ENST00000358406.5:c.661G>A	7.37:g.142965910G>A	ENSP00000351181:p.Ala221Thr		B4DIH1|B4DSY2|Q6P4H0|Q7Z520|Q9P1S4	Missense_Mutation	SNP	pfam_DSBA-like_thioredoxin_dom,superfamily_Thioredoxin-like_fold	p.A277T	ENST00000358406.5	37	c.829	CCDS5877.1	7	.	.	.	.	.	.	.	.	.	.	G	15.82	2.944795	0.53079	.	.	ENSG00000197448	ENST00000409500;ENST00000443571;ENST00000358406;ENST00000479303	.	.	.	5.58	2.33	0.28932	Thioredoxin-like fold (1);	0.299685	0.38005	N	0.001857	T	0.25005	0.0607	L	0.31926	0.97	0.09310	N	1	B;B;B;B	0.26876	0.038;0.082;0.162;0.0	B;B;B;B	0.22386	0.007;0.034;0.039;0.001	T	0.12682	-1.0538	9	0.20046	T	0.44	-13.6256	5.6233	0.17469	0.1319:0.0:0.6984:0.1697	.	209;178;277;221	Q9Y2Q3-3;Q9Y2Q3-4;Q9Y2Q3-2;Q9Y2Q3	.;.;.;GSTK1_HUMAN	T	209;178;221;277	.	ENSP00000351181:A221T	A	+	1	0	GSTK1	142676032	0.000000	0.05858	0.125000	0.21846	0.937000	0.57800	0.344000	0.19962	0.552000	0.29026	0.650000	0.86243	GCC	GSTK1	-	superfamily_Thioredoxin-like_fold	ENSG00000197448		0.507	GSTK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTK1	HGNC	protein_coding	OTTHUMT00000327091.1	-	0.00	56	0	G	NM_015917		142965910	+1	tier1	-	no_errors	ENST00000479303	ensembl	human	known	74_37	missense	25.86	43	15	SNP	0.008	A
ANO8	57719	genome.wustl.edu	37	19	17445818	17445818	+	5'Flank	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:17445818G>A	ENST00000159087.4	-	0	0				GTPBP3_ENST00000358792.7_5'Flank|GTPBP3_ENST00000324894.8_5'Flank|GTPBP3_ENST00000361619.5_Silent_p.V2V|GTPBP3_ENST00000600625.1_5'Flank	NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8						chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						CACTGATGGTGCATTCTCCAA	0.602																																																	0																																										SO:0001631	upstream_gene_variant	0			AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9			19.37:g.17445818G>A	Exception_encountered		A6NIJ0	Silent	SNP	pfam_GTP-bd_TrmE_N,pfam_GTP_binding_domain,superfamily_P-loop_NTPase,tigrfam_Small_GTP-bd_dom	p.V2	ENST00000159087.4	37	c.6	CCDS32949.1	19																																																																																			GTPBP3	-	NULL	ENSG00000130299		0.602	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP3	HGNC	protein_coding	OTTHUMT00000462943.1	-	0.00	46	0	G	XM_050644		17445818	+1	tier1	-	no_errors	ENST00000361619	ensembl	human	known	74_37	silent	8.89	40	4	SNP	0.002	A
GUCY2C	2984	genome.wustl.edu	37	12	14766072	14766072	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:14766072G>T	ENST00000261170.3	-	27	3337	c.3201C>A	c.(3199-3201)gaC>gaA	p.D1067E	RP11-695J4.2_ENST00000545424.1_RNA|RP11-695J4.2_ENST00000542401.1_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	1067					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	TGCTCTCCTTGTCTGTGGTAT	0.438																																																	0													199.0	196.0	197.0					12																	14766072		2203	4300	6503	SO:0001583	missense	0				CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.3201C>A	12.37:g.14766072G>T	ENSP00000261170:p.Asp1067Glu		B2RMY6	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_A/G_cyclase,superfamily_Peripla_BP_I,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.D1067E	ENST00000261170.3	37	c.3201	CCDS8664.1	12	.	.	.	.	.	.	.	.	.	.	G	4.414	0.076493	0.08485	.	.	ENSG00000070019	ENST00000261170	D	0.81499	-1.5	5.71	2.74	0.32292	.	0.186630	0.56097	D	0.000039	T	0.72170	0.3427	L	0.55743	1.74	0.22911	N	0.998572	B	0.23591	0.088	B	0.25291	0.059	T	0.63060	-0.6721	10	0.48119	T	0.1	.	5.4628	0.16626	0.11:0.3171:0.4632:0.1097	.	1067	P25092	GUC2C_HUMAN	E	1067	ENSP00000261170:D1067E	ENSP00000261170:D1067E	D	-	3	2	GUCY2C	14657339	0.173000	0.23056	0.104000	0.21259	0.006000	0.05464	-0.375000	0.07475	1.396000	0.46663	0.655000	0.94253	GAC	GUCY2C	-	NULL	ENSG00000070019		0.438	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2C	HGNC	protein_coding	OTTHUMT00000400835.1		0.00	121	0	G			14766072	-1			no_errors	ENST00000261170	ensembl	human	known	74_37	missense	6.41	73	5	SNP	0.004	T
HBP1	26959	genome.wustl.edu	37	7	106823018	106823018	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr7:106823018C>T	ENST00000222574.4	+	3	556	c.370C>T	c.(370-372)Cca>Tca	p.P124S	HBP1_ENST00000485846.1_Missense_Mutation_p.P124S|HBP1_ENST00000468410.1_Missense_Mutation_p.P124S	NM_012257.3	NP_036389.2	O60381	HBP1_HUMAN	HMG-box transcription factor 1	124					cell cycle arrest (GO:0007050)|positive regulation of potassium ion transport (GO:0043268)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			large_intestine(4)|lung(3)|prostate(1)|skin(2)	10						TCCACAAAGTCCACTGATGCA	0.343																																																	0													49.0	45.0	47.0					7																	106823018		2203	4300	6503	SO:0001583	missense	0			BC017069	CCDS5741.1	7q22-q31	2003-10-08			ENSG00000105856	ENSG00000105856			23200	protein-coding gene	gene with protein product						9030690, 11500377	Standard	NM_001244262		Approved		uc011klv.2	O60381	OTTHUMG00000157642	ENST00000222574.4:c.370C>T	7.37:g.106823018C>T	ENSP00000222574:p.Pro124Ser		B3KVB7|Q8TBM1|Q8TE93|Q96AJ2	Missense_Mutation	SNP	pfam_Ataxin-1_HBP1,pfam_HMG_box_dom,superfamily_Ataxin-1_HBP1,superfamily_HMG_box_dom,smart_Ataxin_AXH_dom,smart_HMG_box_dom,pfscan_Ataxin-1_HBP1,pfscan_HMG_box_dom	p.P124S	ENST00000222574.4	37	c.370	CCDS5741.1	7	.	.	.	.	.	.	.	.	.	.	C	18.43	3.622743	0.66787	.	.	ENSG00000105856	ENST00000468410;ENST00000464009;ENST00000222574;ENST00000485846;ENST00000498408	D;D;D	0.99797	-6.79;-6.79;-6.79	5.86	5.86	0.93980	.	0.044304	0.85682	D	0.000000	D	0.99318	0.9761	L	0.34521	1.04	0.80722	D	1	P;D;D	0.61697	0.799;0.99;0.983	B;P;P	0.51806	0.234;0.68;0.481	D	0.99301	1.0901	10	0.87932	D	0	-12.5515	20.1865	0.98220	0.0:1.0:0.0:0.0	.	134;124;124	B4DJ36;O60381-3;O60381	.;.;HBP1_HUMAN	S	124;124;124;124;116	ENSP00000420500:P124S;ENSP00000222574:P124S;ENSP00000418738:P124S	ENSP00000222574:P124S	P	+	1	0	HBP1	106610254	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	5.949000	0.70257	2.775000	0.95449	0.655000	0.94253	CCA	HBP1	-	NULL	ENSG00000105856		0.343	HBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBP1	HGNC	protein_coding	OTTHUMT00000349297.1	-	0.00	56	0	C	NM_012257		106823018	+1	tier1	-	no_errors	ENST00000222574	ensembl	human	known	74_37	missense	11.11	40	5	SNP	1.000	T
HDLBP	3069	genome.wustl.edu	37	2	242207918	242207918	+	5'UTR	SNP	T	T	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:242207918T>C	ENST00000391975.1	-	0	164				HDLBP_ENST00000427183.2_5'UTR|HDLBP_ENST00000310931.4_5'UTR|HDLBP_ENST00000391976.2_5'UTR	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein						cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		AGCCAGAAGGTCCGTCCTGAG	0.547																																																	0																																										SO:0001623	5_prime_UTR_variant	0				CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.-64A>G	2.37:g.242207918T>C			B4DTQ2|E7EM71|Q53QU2|Q9UCY3	RNA	SNP	-	NULL	ENST00000391975.1	37	NULL	CCDS2547.1	2																																																																																			HDLBP	-	-	ENSG00000115677		0.547	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDLBP	HGNC	protein_coding	OTTHUMT00000257245.5	-	0.00	71	0	T	NM_203346		242207918	-1	tier1	-	no_errors	ENST00000462130	ensembl	human	known	74_37	rna	11.76	45	6	SNP	1.000	C
HHIPL2	79802	genome.wustl.edu	37	1	222712025	222712025	+	Silent	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:222712025G>A	ENST00000343410.6	-	5	1600	c.1542C>T	c.(1540-1542)ctC>ctT	p.L514L		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	514					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		ACAGGCCATTGAGATTTGGGG	0.423																																																	0													117.0	100.0	106.0					1																	222712025		2203	4300	6503	SO:0001819	synonymous_variant	0			BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.1542C>T	1.37:g.222712025G>A			Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Silent	SNP	pfam_Folate_rcpt-like,pfam_Glc/Sorbosone_DH,superfamily_Quinoprot_gluc/sorb_DH,superfamily_Saposin-like	p.L514	ENST00000343410.6	37	c.1542	CCDS1530.2	1																																																																																			HHIPL2	-	pfam_Glc/Sorbosone_DH,superfamily_Quinoprot_gluc/sorb_DH	ENSG00000143512		0.423	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIPL2	HGNC	protein_coding	OTTHUMT00000091499.2	-	0.00	37	0	G	NM_024746		222712025	-1	tier1	-	no_errors	ENST00000343410	ensembl	human	known	74_37	silent	7.69	60	5	SNP	0.936	A
HLA-DPB1	3115	genome.wustl.edu	37	6	33043881	33043881	+	Silent	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:33043881G>T	ENST00000418931.2	+	1	179	c.63G>T	c.(61-63)gtG>gtT	p.V21V	HLA-DPA1_ENST00000428995.1_5'Flank|HLA-DPB1_ENST00000535465.1_Silent_p.V21V|HLA-DPA1_ENST00000419277.1_Intron|HLA-DPA1_ENST00000463066.1_5'Flank	NM_002121.5	NP_002112.3	P04440	DPB1_HUMAN	major histocompatibility complex, class II, DP beta 1	21					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	peptide antigen binding (GO:0042605)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	11						TACTGATGGTGCTGCTCACAT	0.562																																																	0													48.0	42.0	44.0					6																	33043881		1508	2709	4217	SO:0001819	synonymous_variant	0				CCDS4765.1	6p21.3	2013-01-11			ENSG00000223865	ENSG00000223865		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4940	protein-coding gene	gene with protein product		142858		HLA-DP1B			Standard	NM_002121		Approved		uc003ocu.2	P04440	OTTHUMG00000031076	ENST00000418931.2:c.63G>T	6.37:g.33043881G>T			A0PFJ7|A5I886|A8YPB3|B5U8B4|B7VF80|B7VF87|B8ZX68|B8ZYT0|B9W5S8|B9W6F7|B9W6F9|C0MPP5|C0MPQ2|C0MPQ3|C0MPQ5|C0MPQ6|C0MPQ7|C4R9J5|C5IZL1|O00259|O19698|O19700|O19702|O19749|O46884|O77952|O98215|O98216|O98217|O98218|O98219|O98222|O98223|P01916|P04232|P13763|P79493|P79608|Q0P0L4|Q0ZFN3|Q14279|Q27S71|Q29682|Q29684|Q29698|Q29714|Q29775|Q29776|Q29778|Q29779|Q29781|Q29827|Q29828|Q29879|Q29880|Q29898|Q29977|Q2MGW3|Q30015|Q30031|Q30032|Q30033|Q30034|Q30050|Q30051|Q30052|Q30053|Q30054|Q30055|Q30174|Q4GY31|Q4JHD8|Q5ENE0|Q5ENE1|Q5ENW3|Q5EP46|Q5EP47|Q5EP49|Q5EP51|Q5EP52|Q5EP53|Q5EP56|Q5I4H8|Q5I4H9|Q5ISH4|Q5ISH5|Q5SQ73|Q5STP2|Q5YLA6|Q6IVX1|Q6LBX2|Q6LBX3|Q6LBX4|Q6LBX5|Q6LBX6|Q6LBX7|Q6PWX6|Q6TAS4|Q714U1|Q714U2|Q7YQ10|Q860Z7|Q8HWL7|Q8HWT5|Q8SNC4|Q95HC1|Q95IT7|Q95IT8|Q9BD13|Q9GIM2|Q9GIM4|Q9GIX6|Q9GJ41|Q9MY67|Q9TNT7|Q9TQE2|Q9XS11|Q9XS12	Silent	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.V21	ENST00000418931.2	37	c.63	CCDS4765.1	6																																																																																			HLA-DPB1	-	superfamily_MHC_I/II-like_Ag-recog	ENSG00000223865		0.562	HLA-DPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DPB1	HGNC	protein_coding	OTTHUMT00000076106.2	-	0.00	85	0	G	NM_002121		33043881	+1	tier1	-	no_errors	ENST00000418931	ensembl	human	known	74_37	silent	6.90	54	4	SNP	0.054	T
HLX	3142	genome.wustl.edu	37	1	221055546	221055546	+	Silent	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:221055546G>A	ENST00000366903.6	+	3	2314	c.813G>A	c.(811-813)acG>acA	p.T271T	HLX_ENST00000549319.1_Silent_p.T57T|HLA-AS1_ENST00000552026.1_RNA	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	271					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		TGCCGCAGACGTACAAAAGGA	0.562																																																	0													68.0	55.0	59.0					1																	221055546		2203	4300	6503	SO:0001819	synonymous_variant	0			BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.813G>A	1.37:g.221055546G>A			B2R8A8|Q15988|Q59HE7|Q9NZ75	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.T271	ENST00000366903.6	37	c.813	CCDS1527.1	1																																																																																			HLX	-	superfamily_Homeodomain-like	ENSG00000136630		0.562	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLX	HGNC	protein_coding	OTTHUMT00000090902.3		0.00	45	0	G	NM_021958		221055546	+1			no_errors	ENST00000366903	ensembl	human	known	74_37	silent	9.09	40	4	SNP	0.001	A
HUWE1	10075	genome.wustl.edu	37	X	53630391	53630391	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chrX:53630391G>T	ENST00000342160.3	-	26	3271	c.2814C>A	c.(2812-2814)agC>agA	p.S938R	HUWE1_ENST00000218328.8_Missense_Mutation_p.S938R|HUWE1_ENST00000262854.6_Missense_Mutation_p.S938R			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	938					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						AGTATAACTGGCTCAGCTTGC	0.448																																																	0													108.0	83.0	91.0					X																	53630391		2203	4300	6503	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.2814C>A	X.37:g.53630391G>T	ENSP00000340648:p.Ser938Arg		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.S938R	ENST00000342160.3	37	c.2814	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	G	20.2	3.950934	0.73787	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.51071	1.03;1.03;0.72	5.62	4.75	0.60458	.	0.124831	0.56097	D	0.000023	T	0.61763	0.2373	L	0.59436	1.845	0.51233	D	0.999913	D	0.76494	0.999	D	0.68765	0.96	T	0.63550	-0.6612	10	0.59425	D	0.04	.	11.9192	0.52783	0.0872:0.0:0.9128:0.0	.	938	Q7Z6Z7	HUWE1_HUMAN	R	938	ENSP00000340648:S938R;ENSP00000262854:S938R;ENSP00000218328:S938R	ENSP00000218328:S938R	S	-	3	2	HUWE1	53647116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.865000	0.48412	2.363000	0.80096	0.600000	0.82982	AGC	HUWE1	-	NULL	ENSG00000086758		0.448	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	-	0.00	34	0	G	XM_497119		53630391	-1	tier1	-	no_errors	ENST00000262854	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
IER3	8870	genome.wustl.edu	37	6	30712267	30712267	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:30712267G>C	ENST00000259874.5	-	1	64	c.29C>G	c.(28-30)aCc>aGc	p.T10S	FLOT1_ENST00000376389.3_5'Flank|XXbac-BPG252P9.10_ENST00000607333.1_RNA|FLOT1_ENST00000456573.2_5'Flank|FLOT1_ENST00000470643.1_5'Flank|IER3_ENST00000376377.2_Missense_Mutation_p.T10S	NM_003897.3	NP_003888.2	P46695	IEX1_HUMAN	immediate early response 3	10					anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glycolytic process (GO:0045820)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|negative regulation of systemic arterial blood pressure (GO:0003085)|positive regulation of protein catabolic process (GO:0045732)|regulation of DNA repair (GO:0006282)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of response to DNA damage stimulus (GO:2001020)|response to protozoan (GO:0001562)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				NS(1)	1						GATGGTCATGGTCGGGTGGCA	0.652																																																	0													5.0	4.0	5.0					6																	30712267		1349	2405	3754	SO:0001583	missense	0			AF083421	CCDS4689.1	6p21.3	2010-02-17			ENSG00000137331	ENSG00000137331			5392	protein-coding gene	gene with protein product		602996				8603392, 9703517	Standard	NM_003897		Approved	IEX-1, DIF-2, PRG1, IEX-1L	uc003nrn.3	P46695	OTTHUMG00000031265	ENST00000259874.5:c.29C>G	6.37:g.30712267G>C	ENSP00000259874:p.Thr10Ser		Q5SU30|Q92691|Q93044	Missense_Mutation	SNP	NULL	p.T10S	ENST00000259874.5	37	c.29	CCDS4689.1	6	.	.	.	.	.	.	.	.	.	.	G	15.85	2.953962	0.53293	.	.	ENSG00000137331	ENST00000259874;ENST00000376377;ENST00000376382	T	0.46819	0.86	5.04	3.19	0.36642	.	0.404731	0.23898	N	0.043478	T	0.24392	0.0591	L	0.57536	1.79	0.09310	N	0.999999	B	0.28971	0.229	B	0.32289	0.143	T	0.17776	-1.0358	10	0.51188	T	0.08	.	8.2663	0.31815	0.0:0.1718:0.6501:0.1781	.	10	P46695	IEX1_HUMAN	S	10	ENSP00000259874:T10S	ENSP00000259874:T10S	T	-	2	0	IER3	30820246	0.618000	0.27051	0.996000	0.52242	0.822000	0.46500	3.157000	0.50716	0.484000	0.27630	0.549000	0.68633	ACC	IER3	-	NULL	ENSG00000137331		0.652	IER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IER3	HGNC	protein_coding	OTTHUMT00000076578.2		0.00	13	0	G			30712267	-1			no_errors	ENST00000259874	ensembl	human	known	74_37	missense	30.00	7	3	SNP	0.314	C
TRIM59	286827	genome.wustl.edu	37	3	160156367	160156368	+	Frame_Shift_Ins	INS	-	-	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr3:160156367_160156368insT	ENST00000309784.4	-	3	789_790	c.604_605insA	c.(604-606)agtfs	p.S202fs	RP11-432B6.3_ENST00000483754.1_Frame_Shift_Ins_p.S202fs|TRIM59_ENST00000543469.1_Frame_Shift_Ins_p.S202fs	NM_173084.2	NP_775107.1	Q8IWR1	TRI59_HUMAN	tripartite motif containing 59	202					innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral entry into host cell (GO:0046597)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S202fs*3(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|urinary_tract(3)	15			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CGTTAGGAAACTTTTTTTTTTC	0.342																																																	1	Deletion - Frameshift(1)	ovary(1)																																								SO:0001589	frameshift_variant	0			AY159379	CCDS3190.1	3q26	2013-01-09	2011-01-25		ENSG00000213186	ENSG00000213186		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	30834	protein-coding gene	gene with protein product			"""tripartite motif-containing 57"", ""tripartite motif-containing 59"""	TRIM57		12095697	Standard	NM_173084		Approved	TSBF1, Mrf1, RNF104	uc003fdm.3	Q8IWR1	OTTHUMG00000159034	ENST00000309784.4:c.605dupA	3.37:g.160156377_160156377dupT	ENSP00000311219:p.Ser202fs		A8K5G9|D3DNL9	Frame_Shift_Ins	INS	pfam_WD40_repeat,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_WD40_repeat_dom,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_B-box,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S202fs	ENST00000309784.4	37	c.605_604	CCDS3190.1	3																																																																																			RP11-432B6.3	-	NULL	ENSG00000248710		0.342	TRIM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT80	Clone_based_vega_gene	protein_coding	OTTHUMT00000352963.1		0.00	33	0	-	NM_173084		160156368	-1	tier1		no_errors	ENST00000483754	ensembl	human	known	74_37	frame_shift_ins	20.59	27	7	INS	0.000:0.000	T
IGFN1	91156	genome.wustl.edu	37	1	201182749	201182749	+	Splice_Site	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:201182749G>T	ENST00000335211.4	+	12	8858	c.8728G>T	c.(8728-8730)Ggc>Tgc	p.G2910C	IGFN1_ENST00000295591.8_Splice_Site_p.G70C|IGFN1_ENST00000451870.2_Splice_Site_p.G453C	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	453						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GGATGCCCAAGGTAGGTGCTT	0.587																																																	0													59.0	55.0	57.0					1																	201182749		2203	4300	6503	SO:0001630	splice_region_variant	0			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.8728+1G>T	1.37:g.201182749G>T			F8WAI1|Q9NT72	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G2910C	ENST00000335211.4	37	c.8728	CCDS53455.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.6|22.6	4.308458|4.308458	0.81247|0.81247	.|.	.|.	ENSG00000163395|ENSG00000163395	ENST00000335211;ENST00000451870;ENST00000295591|ENST00000412892	T;T;T|.	0.62232|.	0.43;0.04;0.65|.	3.01|3.01	3.01|3.01	0.34805|0.34805	.|.	0.777662|.	0.09715|.	U|.	0.765190|.	T|T	0.45955|0.45955	0.1368|0.1368	L|L	0.34521|0.34521	1.04|1.04	0.38868|0.38868	D|D	0.956638|0.956638	P|.	0.45474|.	0.859|.	P|.	0.52672|.	0.706|.	T|T	0.39418|0.39418	-0.9615|-0.9615	10|5	0.56958|.	D|.	0.05|.	.|.	9.307|9.307	0.37881|0.37881	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2910|.	F8WAI1|.	.|.	C|M	2910;453;70|327	ENSP00000334714:G2910C;ENSP00000398386:G453C;ENSP00000295591:G70C|.	ENSP00000295591:G70C|.	G|R	+|+	1|2	0|0	IGFN1|IGFN1	199449372|199449372	1.000000|1.000000	0.71417|0.71417	0.258000|0.258000	0.24420|0.24420	0.029000|0.029000	0.11900|0.11900	3.514000|3.514000	0.53422|0.53422	1.515000|1.515000	0.48885|0.48885	0.491000|0.491000	0.48974|0.48974	GGC|AGG	IGFN1	-	NULL	ENSG00000163395		0.587	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		-	0.00	39	0	G	NM_178275	Missense_Mutation	201182749	+1	tier1	-	no_errors	ENST00000335211	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.927	T
IGSF9B	22997	genome.wustl.edu	37	11	133801606	133801606	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:133801606G>A	ENST00000321016.8	-	9	1425	c.1195C>T	c.(1195-1197)Cct>Tct	p.P399S	IGSF9B_ENST00000533871.2_Missense_Mutation_p.P399S			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	399	Ig-like 4.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GTGTTGTAAGGCACACAGGTA	0.602																																																	0													41.0	46.0	44.0					11																	133801606		2022	4185	6207	SO:0001583	missense	0			AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.1195C>T	11.37:g.133801606G>A	ENSP00000317980:p.Pro399Ser		G5EA26	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P399S	ENST00000321016.8	37	c.1195		11	.	.	.	.	.	.	.	.	.	.	G	31	5.098016	0.94197	.	.	ENSG00000080854	ENST00000321016;ENST00000533871;ENST00000527648	T;T;T	0.12255	2.7;2.7;2.7	5.21	5.21	0.72293	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.40839	0.1133	M	0.77616	2.38	0.80722	D	1	D	0.60160	0.987	D	0.69824	0.966	T	0.33137	-0.9880	9	0.66056	D	0.02	.	18.767	0.91878	0.0:0.0:1.0:0.0	.	399	Q9UPX0	TUTLB_HUMAN	S	399;241;399	ENSP00000317980:P399S;ENSP00000436552:P241S;ENSP00000436576:P399S	ENSP00000317980:P399S	P	-	1	0	IGSF9B	133306816	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.625000	0.83145	2.423000	0.82170	0.543000	0.68304	CCT	IGSF9B	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000080854		0.602	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	IGSF9B	HGNC	protein_coding		-	0.00	40	0	G	XM_290502		133801606	-1	tier1	-	no_errors	ENST00000321016	ensembl	human	known	74_37	missense	15.38	22	4	SNP	1.000	A
IRX4	50805	genome.wustl.edu	37	5	1878122	1878122	+	Silent	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:1878122G>A	ENST00000505790.1	-	6	1977	c.1521C>T	c.(1519-1521)ctC>ctT	p.L507L	IRX4_ENST00000505938.1_5'Flank|IRX4_ENST00000231357.2_Silent_p.L507L|IRX4_ENST00000513692.1_Silent_p.L507L	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	507					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		TGGGCAGGGCGAGCAGCTCCC	0.756																																																	0													1.0	1.0	1.0					5																	1878122		1065	2418	3483	SO:0001819	synonymous_variant	0			AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.1521C>T	5.37:g.1878122G>A			B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,smart_Iroquois_homeo,pfscan_Homeobox_dom	p.L507	ENST00000505790.1	37	c.1521	CCDS3867.1	5																																																																																			IRX4	-	NULL	ENSG00000113430		0.756	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	IRX4	HGNC	protein_coding	OTTHUMT00000365500.1	-	0.00	18	0	G	NM_016358		1878122	-1	tier1	-	no_errors	ENST00000231357	ensembl	human	known	74_37	silent	23.53	13	4	SNP	0.021	A
ITGA7	3679	genome.wustl.edu	37	12	56091595	56091595	+	Silent	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:56091595G>A	ENST00000555728.1	-	10	1453	c.1425C>T	c.(1423-1425)ggC>ggT	p.G475G	ITGA7_ENST00000257880.7_Silent_p.G475G|ITGA7_ENST00000257879.6_Silent_p.G431G|ITGA7_ENST00000553804.1_Silent_p.G435G|ITGA7_ENST00000347027.6_Silent_p.G431G|ITGA7_ENST00000394230.2_Silent_p.G435G|ITGA7_ENST00000452168.2_Silent_p.G338G|ITGA7_ENST00000394229.2_Silent_p.G431G			Q13683	ITA7_HUMAN	integrin, alpha 7	475					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CCACAGCCTCGCCCTCCAGCA	0.612																																																	0													96.0	100.0	98.0					12																	56091595		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.1425C>T	12.37:g.56091595G>A			B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Silent	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.G475	ENST00000555728.1	37	c.1425		12																																																																																			ITGA7	-	NULL	ENSG00000135424		0.612	ITGA7-014	KNOWN	basic	protein_coding	ITGA7	HGNC	protein_coding	OTTHUMT00000410138.1	-	0.00	34	0	G	NM_002206		56091595	-1	tier1	-	no_errors	ENST00000555728	ensembl	human	known	74_37	silent	20.59	27	7	SNP	0.453	A
IVL	3713	genome.wustl.edu	37	1	152883269	152883269	+	Missense_Mutation	SNP	A	A	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:152883269A>C	ENST00000368764.3	+	2	1060	c.996A>C	c.(994-996)caA>caC	p.Q332H	IVL_ENST00000392667.2_Missense_Mutation_p.Q186H			P07476	INVO_HUMAN	involucrin	332	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.Q332Q(3)		breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			aggaggggcaactggagcagc	0.662																																																	3	Substitution - coding silent(3)	endometrium(3)											17.0	17.0	17.0					1																	152883269		2117	4166	6283	SO:0001583	missense	0			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.996A>C	1.37:g.152883269A>C	ENSP00000357753:p.Gln332His		Q5T7P4	Missense_Mutation	SNP	pfam_Involucrin_N,pfam_Involucrin_rpt	p.Q332H	ENST00000368764.3	37	c.996	CCDS1030.1	1	.	.	.	.	.	.	.	.	.	.	G	11.07	1.531006	0.27387	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.11277	2.94;2.79	3.82	1.89	0.25635	.	.	.	.	.	T	0.07773	0.0195	L	0.29908	0.895	0.28288	N	0.923696	D	0.89917	1.0	D	0.71870	0.975	T	0.24119	-1.0169	9	0.34782	T	0.22	.	8.1689	0.31243	0.2117:0.0:0.7883:0.0	.	332	P07476	INVO_HUMAN	H	332;186	ENSP00000357753:Q332H;ENSP00000376435:Q186H	ENSP00000357753:Q332H	Q	+	3	2	IVL	151149893	0.001000	0.12720	0.019000	0.16419	0.003000	0.03518	-0.459000	0.06728	0.221000	0.20879	-0.259000	0.10710	CAA	IVL	-	pfam_Involucrin_rpt	ENSG00000163207		0.662	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVL	HGNC	protein_coding	OTTHUMT00000034664.1	-	0.00	115	0	A	NM_005547		152883269	+1	tier1	-	no_errors	ENST00000368764	ensembl	human	known	74_37	missense	7.34	98	8	SNP	0.767	C
KAT6A	7994	genome.wustl.edu	37	8	41800501	41800501	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr8:41800501C>T	ENST00000396930.3	-	15	2789	c.2246G>A	c.(2245-2247)cGg>cAg	p.R749Q	KAT6A_ENST00000485568.1_Missense_Mutation_p.R749Q|KAT6A_ENST00000406337.1_Missense_Mutation_p.R749Q|KAT6A_ENST00000265713.2_Missense_Mutation_p.R749Q	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	749	Catalytic.|MYST-type HAT.|Mediates interaction with BRPF1, required for histone H3 acetyltransferase activity.				aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										AAGTTTTTCCCGGCGGATAAT	0.428																																																	0													86.0	82.0	83.0					8																	41800501		2203	4300	6503	SO:0001583	missense	0			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.2246G>A	8.37:g.41800501C>T	ENSP00000380136:p.Arg749Gln		Q76L81	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5_H15,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.R749Q	ENST00000396930.3	37	c.2246	CCDS6124.1	8	.	.	.	.	.	.	.	.	.	.	C	19.48	3.835720	0.71373	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000418721;ENST00000485568	T;T;T;D	0.84146	0.2;0.2;0.2;-1.81	6.04	6.04	0.98038	.	0.000000	0.64402	D	0.000001	D	0.92482	0.7613	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.75484	0.948;0.986	D	0.90894	0.4763	10	0.44086	T	0.13	-24.6532	20.5792	0.99380	0.0:1.0:0.0:0.0	.	749;749	A5PLL3;Q92794	.;KAT6A_HUMAN	Q	749;749;749;329;749	ENSP00000265713:R749Q;ENSP00000385888:R749Q;ENSP00000380136:R749Q;ENSP00000430606:R749Q	ENSP00000265713:R749Q	R	-	2	0	KAT6A	41919658	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.727000	0.68523	2.873000	0.98535	0.561000	0.74099	CGG	KAT6A	-	superfamily_Acyl_CoA_acyltransferase	ENSG00000083168		0.428	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6A	HGNC	protein_coding	OTTHUMT00000318163.1	-	0.00	65	0	C	NM_006766		41800501	-1	tier1	-	no_errors	ENST00000265713	ensembl	human	known	74_37	missense	9.38	58	6	SNP	1.000	T
KCND2	3751	genome.wustl.edu	37	7	119915139	119915139	+	Silent	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr7:119915139C>T	ENST00000331113.4	+	1	1418	c.453C>T	c.(451-453)gaC>gaT	p.D151D		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	151					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TGCAGGACGACGCGGATACCG	0.627																																																	0													75.0	77.0	77.0					7																	119915139		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.453C>T	7.37:g.119915139C>T			O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Silent	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Shal-type,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.2,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.D151	ENST00000331113.4	37	c.453	CCDS5776.1	7																																																																																			KCND2	-	prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.2	ENSG00000184408		0.627	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCND2	HGNC	protein_coding	OTTHUMT00000346996.1	-	0.00	21	0	C	NM_012281		119915139	+1	tier1	-	no_errors	ENST00000331113	ensembl	human	known	74_37	silent	69.23	4	9	SNP	0.859	T
KCNT2	343450	genome.wustl.edu	37	1	196397362	196397362	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:196397362T>C	ENST00000294725.9	-	10	1772	c.857A>G	c.(856-858)aAg>aGg	p.K286R	KCNT2_ENST00000367431.4_Missense_Mutation_p.K286R|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000451324.2_Intron|KCNT2_ENST00000609185.1_Missense_Mutation_p.K286R|KCNT2_ENST00000367433.5_Missense_Mutation_p.K286R			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	286					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TCCTCCTGACTTTTGTCTCTC	0.343																																																	0													117.0	107.0	111.0					1																	196397362		2203	4300	6503	SO:0001583	missense	0			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.857A>G	1.37:g.196397362T>C	ENSP00000294725:p.Lys286Arg		Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom	p.K286R	ENST00000294725.9	37	c.857	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	T	17.34	3.364287	0.61513	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000535608;ENST00000294725	T;T;T	0.24151	1.87;1.87;1.87	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000005	T	0.41926	0.1180	L	0.61036	1.89	0.80722	D	1	P;P;B;P	0.49696	0.927;0.72;0.229;0.927	P;P;B;P	0.53224	0.721;0.6;0.112;0.721	T	0.26360	-1.0105	10	0.56958	D	0.05	-22.6575	16.0329	0.80593	0.0:0.0:0.0:1.0	.	286;286;286;286	A9LNM6;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	R	286;286;107;286	ENSP00000356403:K286R;ENSP00000356401:K286R;ENSP00000294725:K286R	ENSP00000294725:K286R	K	-	2	0	KCNT2	194663985	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	2.197000	0.70478	0.533000	0.62120	AAG	KCNT2	-	NULL	ENSG00000162687		0.343	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	-	0.00	31	0	T	NM_198503		196397362	-1	tier1	-	no_errors	ENST00000294725	ensembl	human	known	74_37	missense	30.43	16	7	SNP	1.000	C
KIF26B	55083	genome.wustl.edu	37	1	245851229	245851231	+	In_Frame_Del	DEL	CAG	CAG	-	rs376944873		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:245851229_245851231delCAG	ENST00000407071.2	+	12	5384_5386	c.4944_4946delCAG	c.(4942-4947)gccagc>gcc	p.S1652del	KIF26B_ENST00000366518.4_In_Frame_Del_p.S1271del	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1652	Ser-rich.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			CGAAGGACGCCAGCAGCAGCAGC	0.665																																																	0										40,3764		1,38,1863						2.5	0.0			11	112,7748		2,108,3820	no	coding	KIF26B	NM_018012.3		3,146,5683	A1A1,A1R,RR		1.4249,1.0515,1.3032				152,11512				SO:0001651	inframe_deletion	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.4944_4946delCAG	1.37:g.245851238_245851240delCAG	ENSP00000385545:p.Ser1652del		Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	In_Frame_Del	DEL	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S1652in_frame_del	ENST00000407071.2	37	c.4944_4946	CCDS44342.1	1																																																																																			KIF26B	-	NULL	ENSG00000162849		0.665	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1		0.00	32	0	CAG	XM_371354		245851231	+1	tier1		no_errors	ENST00000407071	ensembl	human	known	74_37	in_frame_del	16.67	10	2	DEL	0.206:0.210:0.240	-
KLHDC10	23008	genome.wustl.edu	37	7	129736765	129736765	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr7:129736765G>T	ENST00000335420.5	+	2	305	c.171G>T	c.(169-171)aaG>aaT	p.K57N		NM_014997.3	NP_055812.1	Q6PID8	KLD10_HUMAN	kelch domain containing 10	57						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.K57N(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|liver(2)|lung(10)|prostate(1)	17						TAACAGGTAAGAAGAAAATAC	0.383																																																	1	Substitution - Missense(1)	lung(1)											136.0	139.0	138.0					7																	129736765		2203	4300	6503	SO:0001583	missense	0				CCDS5815.1	7q32.2	2008-08-20			ENSG00000128607	ENSG00000128607			22194	protein-coding gene	gene with protein product	"""scruin like at the midline homolog (Drosophila)"""	615152					Standard	NM_014997		Approved	KIAA0265, slim	uc003vpj.2	Q6PID8	OTTHUMG00000157654	ENST00000335420.5:c.171G>T	7.37:g.129736765G>T	ENSP00000334140:p.Lys57Asn		Q86Y99|Q92554	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,smart_Kelch_1	p.K57N	ENST00000335420.5	37	c.171	CCDS5815.1	7	.	.	.	.	.	.	.	.	.	.	G	22.6	4.313351	0.81358	.	.	ENSG00000128607	ENST00000335420	T	0.06294	3.32	4.87	4.87	0.63330	.	0.391386	0.27876	N	0.017492	T	0.05686	0.0149	N	0.24115	0.695	0.58432	D	0.999997	B	0.27498	0.18	B	0.27170	0.077	T	0.48703	-0.9012	10	0.20519	T	0.43	-10.2928	15.8749	0.79154	0.0:0.0:1.0:0.0	.	57	Q6PID8	KLD10_HUMAN	N	57	ENSP00000334140:K57N	ENSP00000334140:K57N	K	+	3	2	KLHDC10	129524001	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.120000	0.71596	2.693000	0.91896	0.491000	0.48974	AAG	KLHDC10	-	NULL	ENSG00000128607		0.383	KLHDC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC10	HGNC	protein_coding	OTTHUMT00000349347.2		0.00	37	0	G			129736765	+1			no_errors	ENST00000335420	ensembl	human	known	74_37	missense	5.45	52	3	SNP	1.000	T
KLHL32	114792	genome.wustl.edu	37	6	97423886	97423886	+	Silent	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:97423886C>T	ENST00000369261.4	+	3	400	c.37C>T	c.(37-39)Ctg>Ttg	p.L13L	KLHL32_ENST00000544166.1_5'UTR|KLHL32_ENST00000536676.1_Silent_p.L13L|KLHL32_ENST00000539200.1_Silent_p.L13L	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	13										breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		TCAAGAAATGCTGACAGGCCA	0.512																																																	0													65.0	62.0	63.0					6																	97423886		2203	4300	6503	SO:0001819	synonymous_variant	0			AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.37C>T	6.37:g.97423886C>T			B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.L13	ENST00000369261.4	37	c.37	CCDS5038.1	6																																																																																			KLHL32	-	pirsf_Kelch-like_gigaxonin	ENSG00000186231		0.512	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL32	HGNC	protein_coding	OTTHUMT00000041570.1		0.00	60	0	C	NM_052904		97423886	+1			no_errors	ENST00000369261	ensembl	human	known	74_37	silent	6.25	30	2	SNP	1.000	T
KLHL38	340359	genome.wustl.edu	37	8	124663967	124663967	+	Silent	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr8:124663967G>A	ENST00000325995.7	-	1	1223	c.1200C>T	c.(1198-1200)tcC>tcT	p.S400S	CTD-2552K11.2_ENST00000524355.1_RNA	NM_001081675.2	NP_001075144.2	Q2WGJ6	KLH38_HUMAN	kelch-like family member 38	400										breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(16)|pancreas(1)|prostate(3)|stomach(1)	38						ACCTTTCCATGGAGCCCATGA	0.577																																																	0													68.0	67.0	67.0					8																	124663967		2024	4182	6206	SO:0001819	synonymous_variant	0				CCDS43766.1	8q24.13	2013-02-22	2013-02-22		ENSG00000175946	ENSG00000175946		"""Kelch-like"", ""BTB/POZ domain containing"""	34435	protein-coding gene	gene with protein product			"""kelch-like 38 (Drosophila)"""				Standard	NM_001081675		Approved	C8ORFK36	uc003yqs.1	Q2WGJ6	OTTHUMG00000164983	ENST00000325995.7:c.1200C>T	8.37:g.124663967G>A			A0PK12	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.S400	ENST00000325995.7	37	c.1200	CCDS43766.1	8																																																																																			KLHL38	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000175946		0.577	KLHL38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL38	HGNC	protein_coding	OTTHUMT00000381288.1		0.00	24	0	G			124663967	-1			no_errors	ENST00000325995	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.986	A
KLKP1	606293	genome.wustl.edu	37	19	51391637	51391637	+	RNA	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:51391637C>T	ENST00000600104.1	-	0	280							Q107X0	KRIP1_HUMAN	kallikrein pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)											ACACCTGATCCAGTCCCCAAG	0.498																																																	0																																												0			AY302756		19q13.33	2014-03-18			ENSG00000197588	ENSG00000197588		"""Kallikreins"""	21260	pseudogene	pseudogene	"""kallikrein 31 pseudogene"""					15498522, 16541416, 18196551	Standard	NR_002948		Approved	YKLK1, PsiKLK1, KLK31P	uc002ptw.3	Q107X0	OTTHUMG00000183118		19.37:g.51391637C>T				RNA	SNP	-	NULL	ENST00000600104.1	37	NULL		19																																																																																			KLKP1	-	-	ENSG00000197588		0.498	KLKP1-002	KNOWN	basic	processed_transcript	KLKP1	HGNC	pseudogene	OTTHUMT00000465166.1		0.00	15	0	C	NG_005220		51391637	-1			no_errors	ENST00000600104	ensembl	human	known	74_37	rna	23.53	13	4	SNP	0.008	T
KMT2D	8085	genome.wustl.edu	37	12	49445673	49445673	+	Missense_Mutation	SNP	C	C	T	rs377761041		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:49445673C>T	ENST00000301067.7	-	10	1792	c.1793G>A	c.(1792-1794)cGt>cAt	p.R598H		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	598	15 X 5 AA repeats of S/P-P-P-E/P-E/A.|Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TGGGAACAGACGAGATGCCTC	0.612																																																	0								C	HIS/ARG	0,4270		0,0,2135	97.0	100.0	99.0		1793	2.1	0.0	12		99	2,8456		0,2,4227	no	missense	MLL2	NM_003482.3	29	0,2,6362	TT,TC,CC		0.0236,0.0,0.0157	possibly-damaging	598/5538	49445673	2,12726	2135	4229	6364	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.1793G>A	12.37:g.49445673C>T	ENSP00000301067:p.Arg598His		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.R598H	ENST00000301067.7	37	c.1793	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	5.766	0.325685	0.10900	0.0	2.36E-4	ENSG00000167548	ENST00000301067	T	0.79247	-1.25	3.99	2.07	0.26955	.	.	.	.	.	T	0.53238	0.1784	N	0.08118	0	0.09310	N	1	P	0.44006	0.824	B	0.28385	0.089	T	0.45308	-0.9270	9	0.87932	D	0	.	11.8012	0.52128	0.0:0.471:0.529:0.0	.	598	O14686	MLL2_HUMAN	H	598	ENSP00000301067:R598H	ENSP00000301067:R598H	R	-	2	0	MLL2	47731940	0.002000	0.14202	0.011000	0.14972	0.784000	0.44337	0.287000	0.18920	0.597000	0.29811	0.313000	0.20887	CGT	KMT2D	-	NULL	ENSG00000167548		0.612	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	-	0.00	76	0	C			49445673	-1	tier1	-	no_errors	ENST00000301067	ensembl	human	known	74_37	missense	11.76	60	8	SNP	0.138	T
KPNA1	3836	genome.wustl.edu	37	3	122180154	122180154	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr3:122180154G>T	ENST00000344337.6	-	5	525	c.349C>A	c.(349-351)Cct>Act	p.P117T	KPNA1_ENST00000466923.1_5'Flank	NM_002264.3	NP_002255.3	P52294	IMA5_HUMAN	karyopherin alpha 1 (importin alpha 5)	117					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|regulation of DNA recombination (GO:0000018)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	21				GBM - Glioblastoma multiforme(114;0.0898)		TCATCAATAGGAGGGTTAGGT	0.378																																					Melanoma(12;340 801 11196 19797)												0													69.0	70.0	70.0					3																	122180154		2203	4300	6503	SO:0001583	missense	0			S75295	CCDS3013.1	3q21	2013-02-14			ENSG00000114030	ENSG00000114030		"""Importins"", ""Armadillo repeat containing"""	6394	protein-coding gene	gene with protein product		600686				8052633	Standard	NM_002264		Approved	SRP1, RCH2, NPI-1, IPOA5	uc003efe.2	P52294	OTTHUMG00000159487	ENST00000344337.6:c.349C>A	3.37:g.122180154G>T	ENSP00000343701:p.Pro117Thr		D3DN93|Q6IBQ9|Q9BQ56	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.P117T	ENST00000344337.6	37	c.349	CCDS3013.1	3	.	.	.	.	.	.	.	.	.	.	G	25.2	4.614906	0.87359	.	.	ENSG00000114030	ENST00000344337;ENST00000465882;ENST00000482287;ENST00000476916;ENST00000493510	T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41	5.1	5.1	0.69264	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85230	0.5649	M	0.94101	3.495	0.80722	D	1	D	0.69078	0.997	P	0.61201	0.885	D	0.88933	0.3374	10	0.87932	D	0	-12.5199	18.0465	0.89334	0.0:0.0:1.0:0.0	.	117	P52294	IMA1_HUMAN	T	117	ENSP00000343701:P117T;ENSP00000419890:P117T;ENSP00000417166:P117T;ENSP00000417319:P117T;ENSP00000419257:P117T	ENSP00000343701:P117T	P	-	1	0	KPNA1	123662844	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.569000	0.98170	2.805000	0.96524	0.655000	0.94253	CCT	KPNA1	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000114030		0.378	KPNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA1	HGNC	protein_coding	OTTHUMT00000355740.1		0.00	59	0	G	NM_002264		122180154	-1			no_errors	ENST00000344337	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	T
KRT13	3860	genome.wustl.edu	37	17	39659587	39659587	+	Silent	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:39659587G>T	ENST00000246635.3	-	3	733	c.687C>A	c.(685-687)atC>atA	p.I229I	AC019349.5_ENST00000411759.1_RNA|KRT13_ENST00000587544.1_Silent_p.I229I|KRT13_ENST00000336861.3_Silent_p.I229I|KRT13_ENST00000587118.1_5'Flank	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	229	Coil 1B.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.I229I(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				TCAGGCTCTCGATCTGCATCT	0.577																																																	1	Substitution - coding silent(1)	large_intestine(1)											128.0	125.0	126.0					17																	39659587		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.687C>A	17.37:g.39659587G>T			Q53G54|Q6AZK5|Q8N240	Silent	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.I229	ENST00000246635.3	37	c.687	CCDS11396.1	17																																																																																			KRT13	-	pfam_IF,superfamily_Prefoldin	ENSG00000171401		0.577	KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRT13	HGNC	protein_coding	OTTHUMT00000257297.1		0.00	84	0	G	NM_153490		39659587	-1			no_errors	ENST00000246635	ensembl	human	known	74_37	silent	6.00	47	3	SNP	0.870	T
KRTAP19-4	337971	genome.wustl.edu	37	21	31869189	31869189	+	Silent	SNP	A	A	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr21:31869189A>G	ENST00000334058.2	-	1	262	c.240T>C	c.(238-240)aaT>aaC	p.N80N		NM_181610.1	NP_853641.1	Q3LI73	KR194_HUMAN	keratin associated protein 19-4	80						intermediate filament (GO:0005882)				central_nervous_system(1)|large_intestine(2)|lung(1)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						ATTTGGTTAAATTGAATGATC	0.368																																																	0													174.0	172.0	173.0					21																	31869189		2203	4300	6503	SO:0001819	synonymous_variant	0			AP001708	CCDS33534.1	21q22.1	2011-02-10			ENSG00000186967	ENSG00000186967		"""Keratin associated proteins"""	18939	protein-coding gene	gene with protein product						12359730	Standard	NM_181610		Approved	KAP19.4	uc011acz.2	Q3LI73	OTTHUMG00000057767	ENST00000334058.2:c.240T>C	21.37:g.31869189A>G			Q17RT4|Q17RT6	Silent	SNP	pfam_KRTAP_type6/8/16/19/20	p.N80	ENST00000334058.2	37	c.240	CCDS33534.1	21																																																																																			KRTAP19-4	-	NULL	ENSG00000186967		0.368	KRTAP19-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP19-4	HGNC	protein_coding	OTTHUMT00000128219.2	-	0.00	127	0	A			31869189	-1	tier1	-	no_errors	ENST00000334058	ensembl	human	known	74_37	silent	13.24	59	9	SNP	0.000	G
KRTAP11-1	337880	genome.wustl.edu	37	21	32253565	32253565	+	Silent	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr21:32253565G>T	ENST00000332378.4	-	1	309	c.279C>A	c.(277-279)tcC>tcA	p.S93S		NM_175858.2	NP_787054.1	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	93						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|pancreas(1)	18						AGCAGGGGTTGGAAATACAGG	0.577																																																	0													85.0	83.0	83.0					21																	32253565		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ457065	CCDS13608.1	21q22.1	2003-03-11			ENSG00000182591	ENSG00000182591		"""Keratin associated proteins"""	18922	protein-coding gene	gene with protein product		600064				12359730	Standard	NM_175858		Approved	KAP11.1	uc002yov.3	Q8IUC1	OTTHUMG00000057773	ENST00000332378.4:c.279C>A	21.37:g.32253565G>T			A1L4I8	Silent	SNP	pfam_KRTAP_PMG	p.S93	ENST00000332378.4	37	c.279	CCDS13608.1	21																																																																																			KRTAP11-1	-	pfam_KRTAP_PMG	ENSG00000182591		0.577	KRTAP11-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP11-1	HGNC	protein_coding	OTTHUMT00000128225.1		0.00	25	0	G			32253565	-1			no_errors	ENST00000332378	ensembl	human	known	74_37	silent	13.33	13	2	SNP	0.533	T
KY	339855	genome.wustl.edu	37	3	134348480	134348480	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr3:134348480T>G	ENST00000423778.2	-	4	381	c.320A>C	c.(319-321)aAg>aCg	p.K107T	KY_ENST00000503669.1_Missense_Mutation_p.K107T|KY_ENST00000508956.1_Missense_Mutation_p.K86T|KY_ENST00000508041.1_5'Flank	NM_178554.4	NP_848649.3	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	107					muscle organ development (GO:0007517)|neuromuscular junction development (GO:0007528)	cytoskeleton (GO:0005856)|Z disc (GO:0030018)	peptidase activity (GO:0008233)			central_nervous_system(1)|endometrium(3)|kidney(1)|lung(12)|ovary(2)|upper_aerodigestive_tract(2)	21						CAAGGAGAACTTCTTGAGCAG	0.532																																																	0													99.0	99.0	99.0					3																	134348480		1996	4184	6180	SO:0001583	missense	0			AK090526	CCDS46920.1	3q22.1	2010-11-23			ENSG00000174611	ENSG00000174611			26576	protein-coding gene	gene with protein product		605739					Standard	NM_178554		Approved	FLJ33207	uc010hty.3	Q8NBH2	OTTHUMG00000159788	ENST00000423778.2:c.320A>C	3.37:g.134348480T>G	ENSP00000397598:p.Lys107Thr		B7Z1S4|Q6ZT15	Missense_Mutation	SNP	pfam_Transglutaminase-like,smart_Transglutaminase-like	p.K107T	ENST00000423778.2	37	c.320	CCDS46920.1	3	.	.	.	.	.	.	.	.	.	.	T	15.47	2.843148	0.51057	.	.	ENSG00000174611	ENST00000508956;ENST00000423778;ENST00000503669;ENST00000310263	.	.	.	5.58	5.58	0.84498	.	0.134153	0.50627	D	0.000106	T	0.57169	0.2035	L	0.59436	1.845	0.38097	D	0.937144	B;B;B;B	0.24721	0.003;0.11;0.015;0.11	B;B;B;B	0.18561	0.005;0.02;0.011;0.022	T	0.57871	-0.7736	9	0.30854	T	0.27	-11.403	13.2757	0.60186	0.0:0.0:0.0:1.0	.	86;107;107;68	Q8NBH2-3;B4DGA7;Q8NBH2-4;Q8NBH2-2	.;.;.;.	T	86;107;107;107	.	ENSP00000309520:K107T	K	-	2	0	KY	135831170	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	2.920000	0.48844	2.119000	0.64992	0.455000	0.32223	AAG	KY	-	NULL	ENSG00000174611		0.532	KY-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KY	HGNC	protein_coding	OTTHUMT00000357320.1	-	0.00	29	0	T	NM_178554		134348480	-1	tier1	-	no_errors	ENST00000423778	ensembl	human	known	74_37	missense	20.00	28	7	SNP	1.000	G
L1TD1	54596	genome.wustl.edu	37	1	62676046	62676046	+	Nonsense_Mutation	SNP	G	G	T	rs146015306		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:62676046G>T	ENST00000498273.1	+	4	1895	c.1600G>T	c.(1600-1602)Gag>Tag	p.E534*	Y_RNA_ENST00000363304.1_RNA	NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	534	Poly-Glu.							p.E534K(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						CAAAACCCAGGAGGAAGAGGA	0.468																																																	1	Substitution - Missense(1)	skin(1)											60.0	59.0	59.0					1																	62676046		2203	4300	6503	SO:0001587	stop_gained	0			BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.1600G>T	1.37:g.62676046G>T	ENSP00000419901:p.Glu534*		Q8NDA1|Q9NUV8|Q9NV78	Nonsense_Mutation	SNP	pfam_Transposase_22,superfamily_STAT_TF_coiled-coil	p.E534*	ENST00000498273.1	37	c.1600	CCDS619.1	1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.138619	0.77775	.	.	ENSG00000240563	ENST00000498273	.	.	.	1.68	-3.35	0.04928	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	1.4784	0.02431	0.207:0.1823:0.4293:0.1814	.	.	.	.	X	534	.	ENSP00000419901:E534X	E	+	1	0	L1TD1	62448634	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.441000	0.06879	-1.920000	0.01069	-1.233000	0.01565	GAG	L1TD1	-	pfam_Transposase_22	ENSG00000240563		0.468	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L1TD1	HGNC	protein_coding	OTTHUMT00000024688.1	-	0.00	46	0	G	NM_019079		62676046	+1	tier1	-	no_errors	ENST00000498273	ensembl	human	known	74_37	nonsense	10.00	36	4	SNP	0.000	T
LBH	81606	genome.wustl.edu	37	2	30457270	30457270	+	Splice_Site	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:30457270G>A	ENST00000395323.3	+	2	234		c.e2-1		LBH_ENST00000401506.1_Splice_Site|LBH_ENST00000467242.1_Splice_Site|LBH_ENST00000407930.2_Splice_Site|LBH_ENST00000404397.1_Splice_Site|LBH_ENST00000406087.1_Splice_Site	NM_030915.3	NP_112177.2	Q53QV2	LBH_HUMAN	limb bud and heart development						multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(2)	5	Acute lymphoblastic leukemia(172;0.155)					TTTCTTGGCAGCCCCGACTAT	0.542																																																	0													133.0	112.0	119.0					2																	30457270		2203	4300	6503	SO:0001630	splice_region_variant	0			AF110224	CCDS33173.1	2p23.1	2012-12-07	2012-12-07		ENSG00000213626	ENSG00000213626			29532	protein-coding gene	gene with protein product		611763	"""limb bud and heart development homolog (mouse)"""			11230166, 11336496	Standard	NM_030915		Approved		uc002rne.2	Q53QV2	OTTHUMG00000152051	ENST00000395323.3:c.27-1G>A	2.37:g.30457270G>A			B2RBC2|Q9H0Q1	Splice_Site	SNP	-	e2-1	ENST00000395323.3	37	c.27-1	CCDS33173.1	2	.	.	.	.	.	.	.	.	.	.	G	17.17	3.321824	0.60634	.	.	ENSG00000213626	ENST00000395323;ENST00000406087;ENST00000404397;ENST00000401506	.	.	.	4.47	4.47	0.54385	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6316	0.68660	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LBH	30310774	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.091000	0.76923	2.028000	0.59812	0.455000	0.32223	.	LBH	-	-	ENSG00000213626		0.542	LBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LBH	HGNC	protein_coding	OTTHUMT00000325091.1		0.00	91	0	G	NM_030915	Intron	30457270	+1			no_errors	ENST00000395323	ensembl	human	known	74_37	splice_site	6.35	59	4	SNP	1.000	A
LCN9	392399	genome.wustl.edu	37	9	138555211	138555211	+	Missense_Mutation	SNP	C	C	T	rs560303340		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:138555211C>T	ENST00000277526.3	+	1	44	c.44C>T	c.(43-45)gCc>gTc	p.A15V	LCN9_ENST00000430290.2_3'UTR	NM_001001676.1	NP_001001676.1	Q8WX39	LCN9_HUMAN	lipocalin 9	15						extracellular region (GO:0005576)	pheromone binding (GO:0005550)|transporter activity (GO:0005215)			kidney(1)|large_intestine(2)|lung(2)|urinary_tract(1)	6		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;3.43e-07)|Epithelial(140;1.97e-06)|all cancers(34;6.1e-05)		CTCATCGCAGCCCAGGAGTTC	0.637													C|||	1	0.000199681	0.0	0.0	5008	,	,		19104	0.001		0.0	False		,,,				2504	0.0																0													76.0	83.0	81.0					9																	138555211		2077	4210	6287	SO:0001583	missense	0			AY301270	CCDS56593.1	9q34	2011-11-14			ENSG00000148386	ENSG00000148386		"""Lipocalins"""	17442	protein-coding gene	gene with protein product	"""MUP-like lipocalin"", ""epididymal-specific lipocalin-9"""	612903				15363845	Standard	NM_001001676		Approved		uc004cgk.2	Q8WX39	OTTHUMG00000020916	ENST00000277526.3:c.44C>T	9.37:g.138555211C>T	ENSP00000277526:p.Ala15Val		C9J5F0|Q6JVE7	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Maj_urinary,prints_Odour-bd,prints_Blactoglobulin	p.A15V	ENST00000277526.3	37	c.44	CCDS56593.1	9	.	.	.	.	.	.	.	.	.	.	c	14.50	2.554972	0.45487	.	.	ENSG00000148386	ENST00000277526	T	0.19669	2.13	2.56	1.63	0.23807	.	1.426080	0.05062	N	0.480019	T	0.28101	0.0693	L	0.55834	1.745	0.21105	N	0.999781	P	0.51057	0.941	P	0.46917	0.531	T	0.27571	-1.0070	10	0.51188	T	0.08	-29.3266	8.6329	0.33930	0.2305:0.7695:0.0:0.0	.	15	Q8WX39	LCN9_HUMAN	V	15	ENSP00000277526:A15V	ENSP00000277526:A15V	A	+	2	0	LCN9	137695032	0.156000	0.22821	0.077000	0.20336	0.002000	0.02628	0.516000	0.22817	0.644000	0.30656	-0.535000	0.04281	GCC	LCN9	-	NULL	ENSG00000148386		0.637	LCN9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LCN9	HGNC	protein_coding	OTTHUMT00000410711.1		0.00	78	0	C	NM_001001676		138555211	+1			no_errors	ENST00000277526	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.544	T
LGALS2	3957	genome.wustl.edu	37	22	37966318	37966318	+	Silent	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr22:37966318C>A	ENST00000215886.4	-	4	525	c.351G>T	c.(349-351)ctG>ctT	p.L117L		NM_006498.2	NP_006489.1	P05162	LEG2_HUMAN	lectin, galactoside-binding, soluble, 2	117	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.						carbohydrate binding (GO:0030246)|galactoside binding (GO:0016936)	p.L117L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|stomach(1)	11	Melanoma(58;0.0574)					CCCTTACGCTCAGGTAGCTCA	0.502																																					GBM(193;1840 2185 13711 20676 24505)												1	Substitution - coding silent(1)	lung(1)											91.0	94.0	93.0					22																	37966318		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13950.1	22q13.1	2011-08-04	2007-02-01		ENSG00000100079	ENSG00000100079		"""Lectins, galactoside-binding"""	6562	protein-coding gene	gene with protein product	"""galectin 2"""	150571				1988031, 15356130	Standard	NM_006498		Approved	HL14	uc003ata.3	P05162	OTTHUMG00000150590	ENST00000215886.4:c.351G>T	22.37:g.37966318C>A			Q6FGY4	Silent	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl_sf,smart_Galectin_CRD	p.L117	ENST00000215886.4	37	c.351	CCDS13950.1	22																																																																																			LGALS2	-	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl_sf,smart_Galectin_CRD	ENSG00000100079		0.502	LGALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALS2	HGNC	protein_coding	OTTHUMT00000318991.1		0.00	47	0	C	NM_006498		37966318	-1			no_errors	ENST00000215886	ensembl	human	known	74_37	silent	6.98	40	3	SNP	0.064	A
SPACA6P-AS	102238594	genome.wustl.edu	37	19	52197753	52197753	+	lincRNA	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:52197753G>T	ENST00000602324.1	-	0	0				MIR125A_ENST00000385273.1_RNA|MIR99B_ENST00000384819.1_RNA|LINC00085_ENST00000573266.1_RNA|MIRLET7E_ENST00000362102.1_RNA	NR_029482.1|NR_029693.1																						GAAGCCACCTGCATGACACCT	0.607																																																	0																																												0																															19.37:g.52197753G>T				RNA	SNP	-	NULL	ENST00000602324.1	37	NULL		19																																																																																			LINC00085	-	-	ENSG00000182310		0.607	hsa-mir-125a.1-001	KNOWN	basic	lincRNA	LINC00085	HGNC	lincRNA	OTTHUMT00000467329.1	-	0.00	27	0	G			52197753	+1	tier1	-	no_errors	ENST00000573266	ensembl	human	known	74_37	rna	17.39	19	4	SNP	1.000	T
LINC00937	389634	genome.wustl.edu	37	12	8543176	8543176	+	lincRNA	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:8543176G>T	ENST00000544461.1	-	0	770									long intergenic non-protein coding RNA 937																		CGCGGGCTCGGTGGGTCCGCG	0.786																																																	0																																												0			BC073935		12p13.31	2013-05-30			ENSG00000226091	ENSG00000226091		"""Long non-coding RNAs"""	48629	non-coding RNA	RNA, long non-coding							Standard	NR_024420		Approved				OTTHUMG00000168663		12.37:g.8543176G>T				RNA	SNP	-	NULL	ENST00000544461.1	37	NULL		12																																																																																			LINC00937	-	-	ENSG00000226091		0.786	LINC00937-001	KNOWN	basic	lincRNA	LINC00937	HGNC	lincRNA	OTTHUMT00000400511.1		0.00	10	0	G			8543176	-1			no_errors	ENST00000420040	ensembl	human	known	74_37	rna	59.09	9	13	SNP	0.992	T
LINC01020	340094	genome.wustl.edu	37	5	5057986	5057986	+	lincRNA	SNP	A	A	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:5057986A>C	ENST00000508201.1	+	0	624									long intergenic non-protein coding RNA 1020																		TACAAGGGCAAGTTACTGGGC	0.328																																																	0																																												0					5p15.32	2013-07-26			ENSG00000215231	ENSG00000215231		"""Long non-coding RNAs"""	27968	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_026994		Approved				OTTHUMG00000161653		5.37:g.5057986A>C				RNA	SNP	-	NULL	ENST00000508201.1	37	NULL		5																																																																																			LINC01020	-	-	ENSG00000215231		0.328	LINC01020-001	KNOWN	basic	lincRNA	LINC01020	HGNC	lincRNA	OTTHUMT00000365595.1	-	0.00	41	0	A			5057986	+1	tier1	-	no_errors	ENST00000507599	ensembl	human	known	74_37	rna	29.63	38	16	SNP	0.000	C
LINGO1	84894	genome.wustl.edu	37	15	77907463	77907463	+	Silent	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr15:77907463G>T	ENST00000355300.6	-	2	960	c.786C>A	c.(784-786)ggC>ggA	p.G262G	LINGO1_ENST00000561030.1_Silent_p.G256G	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	262					central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						TCAGGTTGAGGCCGTAGAGGC	0.582																																																	0													131.0	136.0	134.0					15																	77907463		2187	4286	6473	SO:0001819	synonymous_variant	0			AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.786C>A	15.37:g.77907463G>T			D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Silent	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G262	ENST00000355300.6	37	c.786	CCDS45313.1	15																																																																																			LINGO1	-	NULL	ENSG00000169783		0.582	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO1	HGNC	protein_coding	OTTHUMT00000419546.1	-	0.00	87	0	G	NM_032808		77907463	-1	tier1	-	no_errors	ENST00000355300	ensembl	human	known	74_37	silent	5.88	64	4	SNP	1.000	T
LIPT2	387787	genome.wustl.edu	37	11	74203390	74203390	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:74203390G>T	ENST00000310109.4	-	2	515	c.486C>A	c.(484-486)caC>caA	p.H162Q	AP001372.2_ENST00000526036.1_lincRNA	NM_001144869.1	NP_001138341.1	A6NK58	LIPT2_HUMAN	lipoyl(octanoyl) transferase 2 (putative)	162	BPL/LPL catalytic. {ECO:0000255|PROSITE- ProRule:PRU01067}.				cellular protein modification process (GO:0006464)|lipoate biosynthetic process (GO:0009107)	mitochondrion (GO:0005739)	ligase activity (GO:0016874)|lipoyl(octanoyl) transferase activity (GO:0033819)|octanoyltransferase activity (GO:0016415)			endometrium(1)|prostate(1)|stomach(1)	3						GGGATGTGATGTGCCTTCCAC	0.572																																																	0													47.0	44.0	45.0					11																	74203390		692	1591	2283	SO:0001583	missense	0				CCDS44679.1	11q13.4	2009-09-09			ENSG00000175536	ENSG00000175536			37216	protein-coding gene	gene with protein product							Standard	NM_001144869		Approved		uc010rrk.2	A6NK58	OTTHUMG00000165646	ENST00000310109.4:c.486C>A	11.37:g.74203390G>T	ENSP00000309463:p.His162Gln			Missense_Mutation	SNP	pfam_BPL_LipA_LipB,tigrfam_Octanoyltransferase	p.H162Q	ENST00000310109.4	37	c.486	CCDS44679.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.15|12.15	1.850620|1.850620	0.32699|0.32699	.|.	.|.	ENSG00000175536|ENSG00000175536	ENST00000527115|ENST00000310109;ENST00000528085	.|D	.|0.93712	.|-3.27	5.25|5.25	2.34|2.34	0.29019|0.29019	.|Biotin/lipoate A/B protein ligase (1);	0.060473|0.060473	0.64402|0.64402	D|D	0.000002|0.000002	D|D	0.90154|0.90154	0.6923|0.6923	N|N	0.20401|0.20401	0.57|0.57	0.36714|0.36714	D|D	0.880783|0.880783	.|P	.|0.48016	.|0.904	.|P	.|0.53490	.|0.727	D|D	0.89475|0.89475	0.3746|0.3746	6|10	.|0.48119	.|T	.|0.1	-39.0307|-39.0307	9.2599|9.2599	0.37605|0.37605	0.2461:0.0:0.7539:0.0|0.2461:0.0:0.7539:0.0	.|.	.|162	.|A6NK58	.|LIPT2_HUMAN	N|Q	46|162;67	.|ENSP00000309463:H162Q	.|ENSP00000309463:H162Q	H|H	-|-	1|3	0|2	LIPT2|LIPT2	73881038|73881038	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.966000|0.966000	0.64601|0.64601	2.172000|2.172000	0.42463|0.42463	0.596000|0.596000	0.29794|0.29794	-0.254000|-0.254000	0.11334|0.11334	CAT|CAC	LIPT2	-	pfam_BPL_LipA_LipB,tigrfam_Octanoyltransferase	ENSG00000175536		0.572	LIPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPT2	HGNC	protein_coding	OTTHUMT00000385544.1	-	0.00	83	0	G	NM_001144869		74203390	-1	tier1	-	no_errors	ENST00000310109	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
LLGL2	3993	genome.wustl.edu	37	17	73552199	73552199	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:73552199G>A	ENST00000392550.3	+	3	265	c.148G>A	c.(148-150)Ggc>Agc	p.G50S	LLGL2_ENST00000167462.5_Missense_Mutation_p.G50S|LLGL2_ENST00000578363.1_Missense_Mutation_p.G50S|LLGL2_ENST00000577200.1_Missense_Mutation_p.G50S|LLGL2_ENST00000375227.4_Missense_Mutation_p.G50S	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	50					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			CCTGGCCATCGGCACCCGTTC	0.662																																																	0													77.0	62.0	67.0					17																	73552199		2203	4300	6503	SO:0001583	missense	0			X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.148G>A	17.37:g.73552199G>A	ENSP00000376333:p.Gly50Ser		Q14521|Q9BR62	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,prints_Lethal2_giant	p.G50S	ENST00000392550.3	37	c.148	CCDS32733.1	17	.	.	.	.	.	.	.	.	.	.	G	14.84	2.654790	0.47467	.	.	ENSG00000073350	ENST00000167462;ENST00000392550;ENST00000375227	T;T;T	0.70631	1.28;1.28;-0.5	4.68	4.68	0.58851	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.82802	0.5116	M	0.73962	2.25	0.80722	D	1	D;D;D	0.76494	0.999;0.982;0.999	P;P;D	0.64237	0.866;0.545;0.923	D	0.85227	0.1030	10	0.66056	D	0.02	-16.2036	17.7752	0.88505	0.0:0.0:1.0:0.0	.	50;50;50	Q6P1M3-2;Q6P1M3;Q6P1M3-3	.;L2GL2_HUMAN;.	S	50	ENSP00000167462:G50S;ENSP00000376333:G50S;ENSP00000364375:G50S	ENSP00000167462:G50S	G	+	1	0	LLGL2	71063794	1.000000	0.71417	0.994000	0.49952	0.262000	0.26303	9.595000	0.98260	2.431000	0.82371	0.563000	0.77884	GGC	LLGL2	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000073350		0.662	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LLGL2	HGNC	protein_coding	OTTHUMT00000447633.1	-	0.00	177	0	G	NM_004524		73552199	+1	tier1	-	no_errors	ENST00000392550	ensembl	human	known	74_37	missense	6.54	200	14	SNP	1.000	A
SMG1P7	100506060	genome.wustl.edu	37	16	70253497	70253497	+	RNA	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr16:70253497C>T	ENST00000581050.1	-	0	1877					NR_033959.1																						atttcacgtacatgaaacttt	0.388																																																	0																																												0																															16.37:g.70253497C>T				RNA	SNP	-	NULL	ENST00000581050.1	37	NULL		16																																																																																			RP11-296I10.6	-	-	ENSG00000261556		0.388	RP11-296I10.6-006	KNOWN	basic	processed_transcript	LOC100506060	Clone_based_vega_gene	pseudogene	OTTHUMT00000441629.1		0.00	11	0	C			70253497	-1			no_errors	ENST00000573141	ensembl	human	known	74_37	rna	21.43	11	3	SNP	0.001	T
LOC101927285	101927285	genome.wustl.edu	37	2	59504864	59504865	+	lincRNA	DEL	TG	TG	-	rs56011039		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:59504864_59504865delTG	ENST00000409590.1	+	0	365_366				AC007131.2_ENST00000444001.2_lincRNA|RP11-444A22.1_ENST00000606382.1_lincRNA																							CATGCACGAAtgtgtgtgtgtg	0.371																																																	0																																												0																															2.37:g.59504874_59504875delTG				RNA	DEL	-	NULL	ENST00000409590.1	37	NULL		2																																																																																			AC007131.1	-	-	ENSG00000222030		0.371	AC007131.1-001	KNOWN	basic	lincRNA	LOC101927285	Clone_based_vega_gene	lincRNA	OTTHUMT00000327020.2		0.00	8	0	TG			59504865	+1			no_errors	ENST00000409590	ensembl	human	known	74_37	rna	25.00	6	2	DEL	0.139:0.134	0
PKD1P1	339044	genome.wustl.edu	37	16	16414934	16414934	+	IGR	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr16:16414934C>T	ENST00000537112.1	+	0	0					NR_036447.1																						TGCCCACCAACGGCTCAGCCT	0.697																																																	0																																										SO:0001628	intergenic_variant	0																															16.37:g.16414934C>T				RNA	SNP	-	NULL	ENST00000537112.1	37	NULL		16																																																																																			AC138969.4	-	-	ENSG00000183889		0.697	AC138969.4-005	KNOWN	non_canonical_other|basic	processed_transcript	LOC101930008	Clone_based_vega_gene	protein_coding	OTTHUMT00000399242.1	-	0.00	65	0	C			16414934	+1	tier1	-	no_errors	ENST00000536260	ensembl	human	known	74_37	rna	17.95	32	7	SNP	0.036	T
LRIG2	9860	genome.wustl.edu	37	1	113667283	113667283	+	3'UTR	DEL	T	T	-			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:113667283delT	ENST00000361127.5	+	0	3956				LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2						innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TTCTTGTGAATTTTTTTTTTT	0.363																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.*560T>-	1.37:g.113667283delT			Q9NSN2	RNA	DEL	-	NULL	ENST00000361127.5	37	NULL	CCDS30808.1	1																																																																																			LRIG2	-	-	ENSG00000198799		0.363	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	HGNC	protein_coding	OTTHUMT00000033549.2		0.00	10	0	T	NM_014813		113667283	+1	tier1		no_errors	ENST00000466161	ensembl	human	known	74_37	rna	27.27	8	3	DEL	0.014	-
LRRC55	219527	genome.wustl.edu	37	11	56949646	56949646	+	Silent	SNP	T	T	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:56949646T>C	ENST00000497933.1	+	1	426	c.279T>C	c.(277-279)gaT>gaC	p.D93D		NM_001005210.2	NP_001005210.1	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	63					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|skin(2)	25						AGGTGGTGGATTGTAGCAGCC	0.627																																																	0													54.0	59.0	57.0					11																	56949646		2201	4296	6497	SO:0001819	synonymous_variant	0				CCDS31539.1	11q12.1	2008-02-05			ENSG00000183908	ENSG00000183908			32324	protein-coding gene	gene with protein product		615213					Standard	NM_001005210		Approved	FLJ45686	uc001njl.2	Q6ZSA7	OTTHUMG00000159309	ENST00000497933.1:c.279T>C	11.37:g.56949646T>C			A7E2U7|B2RN81	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.D93	ENST00000497933.1	37	c.279	CCDS31539.1	11																																																																																			LRRC55	-	pfam_LRR-contain_N,smart_LRR-contain_N	ENSG00000183908		0.627	LRRC55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC55	HGNC	protein_coding	OTTHUMT00000354503.2	-	0.00	115	0	T	NM_001005210		56949646	+1	tier1	-	no_errors	ENST00000497933	ensembl	human	known	74_37	silent	29.55	62	26	SNP	0.906	C
LRRK2	120892	genome.wustl.edu	37	12	40716130	40716130	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:40716130T>A	ENST00000298910.7	+	37	5385	c.5327T>A	c.(5326-5328)cTt>cAt	p.L1776H		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1776					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GGCTGTATTCTTTTGGGCCAA	0.378																																																	0													226.0	211.0	216.0					12																	40716130		2203	4300	6503	SO:0001583	missense	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.5327T>A	12.37:g.40716130T>A	ENSP00000298910:p.Leu1776His		A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.L1776H	ENST00000298910.7	37	c.5327	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	T	22.7	4.322910	0.81580	.	.	ENSG00000188906	ENST00000298910	T	0.77358	-1.09	5.58	5.58	0.84498	.	0.137040	0.49916	D	0.000137	D	0.86205	0.5877	M	0.71206	2.165	0.50467	D	0.999875	D;D	0.76494	0.998;0.999	P;P	0.62649	0.871;0.905	D	0.87923	0.2705	10	0.87932	D	0	.	15.7465	0.77949	0.0:0.0:0.0:1.0	.	1776;1776	Q17RV3;Q5S007	.;LRRK2_HUMAN	H	1776	ENSP00000298910:L1776H	ENSP00000298910:L1776H	L	+	2	0	LRRK2	39002397	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.416000	0.80143	2.103000	0.63969	0.528000	0.53228	CTT	LRRK2	-	NULL	ENSG00000188906		0.378	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	-	0.00	84	0	T	XM_058513		40716130	+1	tier1	-	no_errors	ENST00000298910	ensembl	human	known	74_37	missense	7.69	72	6	SNP	1.000	A
LTBP3	4054	genome.wustl.edu	37	11	65320651	65320651	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:65320651G>T	ENST00000301873.5	-	5	1315	c.1047C>A	c.(1045-1047)aaC>aaA	p.N349K	LTBP3_ENST00000536982.1_Intron|LTBP3_ENST00000322147.4_Missense_Mutation_p.N349K	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	349					bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						AGTGGGTGCTGTTAAGCCTCT	0.632																																																	0													76.0	71.0	73.0					11																	65320651		2201	4297	6498	SO:0001583	missense	0			AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.1047C>A	11.37:g.65320651G>T	ENSP00000301873:p.Asn349Lys		O15107|Q96HB9|Q9H7K2|Q9UFN4	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.N349K	ENST00000301873.5	37	c.1047	CCDS44647.1	11	.	.	.	.	.	.	.	.	.	.	G	11.06	1.527844	0.27299	.	.	ENSG00000168056	ENST00000322147;ENST00000301873;ENST00000530866;ENST00000530426	D;D;D;D	0.92545	-1.56;-1.56;-2.3;-3.06	4.24	3.31	0.37934	Matrix fibril-associated (2);	0.000000	0.85682	D	0.000000	D	0.88570	0.6472	L	0.55834	1.745	0.80722	D	1	B;B;B;B	0.29232	0.012;0.089;0.012;0.238	B;B;B;B	0.31495	0.012;0.043;0.012;0.131	T	0.82629	-0.0363	10	0.38643	T	0.18	.	9.0617	0.36438	0.1975:0.0:0.8025:0.0	.	260;232;349;349	E9PKW1;B9EG76;Q9NS15;Q9NS15-2	.;.;LTBP3_HUMAN;.	K	349;349;260;70	ENSP00000326647:N349K;ENSP00000301873:N349K;ENSP00000435276:N260K;ENSP00000432476:N70K	ENSP00000301873:N349K	N	-	3	2	LTBP3	65077227	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	2.858000	0.48356	0.445000	0.26639	-1.233000	0.01565	AAC	LTBP3	-	superfamily_TB_dom	ENSG00000168056		0.632	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP3	HGNC	protein_coding	OTTHUMT00000390538.1	-	0.00	65	0	G	NM_021070		65320651	-1	tier1	-	no_errors	ENST00000301873	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
LZTS1	11178	genome.wustl.edu	37	8	20110624	20110624	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr8:20110624C>T	ENST00000381569.1	-	3	1175	c.818G>A	c.(817-819)aGg>aAg	p.R273K	LZTS1_ENST00000265801.6_Missense_Mutation_p.R273K|LZTS1_ENST00000522290.1_Missense_Mutation_p.R273K			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	273					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GGCGCCCTCCCTCTCCAACAG	0.667																																																	0													42.0	39.0	40.0					8																	20110624		2192	4288	6480	SO:0001583	missense	0			AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.818G>A	8.37:g.20110624C>T	ENSP00000370981:p.Arg273Lys		D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Missense_Mutation	SNP	NULL	p.R273K	ENST00000381569.1	37	c.818	CCDS6015.1	8	.	.	.	.	.	.	.	.	.	.	C	20.9	4.073340	0.76415	.	.	ENSG00000061337	ENST00000381569;ENST00000265801;ENST00000522290;ENST00000360248	T;T;T	0.24350	2.22;2.22;1.86	5.52	5.52	0.82312	.	0.180431	0.64402	D	0.000020	T	0.42720	0.1215	L	0.41415	1.275	0.54753	D	0.999981	D;D	0.76494	0.996;0.999	D;D	0.78314	0.919;0.991	T	0.05402	-1.0887	10	0.28530	T	0.3	-68.3567	17.9799	0.89138	0.0:1.0:0.0:0.0	.	273;273	Q9Y250-4;Q9Y250	.;LZTS1_HUMAN	K	273	ENSP00000370981:R273K;ENSP00000265801:R273K;ENSP00000429263:R273K	ENSP00000265801:R273K	R	-	2	0	LZTS1	20154904	1.000000	0.71417	0.999000	0.59377	0.275000	0.26752	2.690000	0.47001	2.594000	0.87642	0.561000	0.74099	AGG	LZTS1	-	NULL	ENSG00000061337		0.667	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTS1	HGNC	protein_coding	OTTHUMT00000214122.1	-	0.00	55	0	C	NM_021020		20110624	-1	tier1	-	no_errors	ENST00000265801	ensembl	human	known	74_37	missense	5.68	83	5	SNP	1.000	T
MACC1	346389	genome.wustl.edu	37	7	20201457	20201457	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr7:20201457C>G	ENST00000400331.5	-	4	337	c.29G>C	c.(28-30)cGg>cCg	p.R10P	MACC1_ENST00000589011.1_Missense_Mutation_p.R10P|MACC1_ENST00000332878.4_Missense_Mutation_p.R10P|MACC1_ENST00000471019.1_5'Flank	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	10					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						TCTTCCTGACCGAAAATGTTT	0.323																																																	0													131.0	129.0	129.0					7																	20201457		2202	4300	6502	SO:0001583	missense	0				CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.29G>C	7.37:g.20201457C>G	ENSP00000383185:p.Arg10Pro		A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	pfam_SH3_2,superfamily_DEATH-like_dom	p.R10P	ENST00000400331.5	37	c.29	CCDS5369.1	7	.	.	.	.	.	.	.	.	.	.	C	1.159	-0.644296	0.03531	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.10668	2.85;2.85	5.47	0.851	0.18989	.	0.388697	0.24381	N	0.039011	T	0.04861	0.0131	N	0.08118	0	0.09310	N	1	B	0.21309	0.054	B	0.23716	0.048	T	0.37731	-0.9693	10	0.35671	T	0.21	3.7954	6.7622	0.23546	0.3929:0.4931:0.0:0.1141	.	10	Q6ZN28	MACC1_HUMAN	P	10	ENSP00000383185:R10P;ENSP00000328410:R10P	ENSP00000328410:R10P	R	-	2	0	MACC1	20167982	0.000000	0.05858	0.036000	0.18154	0.080000	0.17528	-0.409000	0.07160	0.339000	0.23719	-0.147000	0.13772	CGG	MACC1	-	NULL	ENSG00000183742		0.323	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MACC1	HGNC	protein_coding	OTTHUMT00000250202.5	-	0.00	49	0	C	NM_182762		20201457	-1	tier1	-	no_errors	ENST00000332878	ensembl	human	known	74_37	missense	8.77	51	5	SNP	0.000	G
MADD	8567	genome.wustl.edu	37	11	47304039	47304039	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:47304039G>T	ENST00000311027.5	+	9	1742	c.1577G>T	c.(1576-1578)gGc>gTc	p.G526V	MADD_ENST00000402192.2_Missense_Mutation_p.G526V|MADD_ENST00000489415.1_3'UTR|MADD_ENST00000406482.1_Missense_Mutation_p.G526V|MADD_ENST00000342922.4_Missense_Mutation_p.G526V|MADD_ENST00000395344.3_Missense_Mutation_p.G526V|MADD_ENST00000402799.1_Missense_Mutation_p.G526V|MADD_ENST00000395336.3_Missense_Mutation_p.G526V|MADD_ENST00000407859.3_Missense_Mutation_p.G526V|MADD_ENST00000349238.3_Missense_Mutation_p.G526V	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		TTTCAAGCTGGCTCCTTTCTA	0.557																																																	0													97.0	94.0	95.0					11																	47304039		2201	4298	6499	SO:0001583	missense	0			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.1577G>T	11.37:g.47304039G>T	ENSP00000310933:p.Gly526Val			Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.G526V	ENST00000311027.5	37	c.1577	CCDS7930.1	11	.	.	.	.	.	.	.	.	.	.	G	19.93	3.918481	0.73098	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192	T;T;T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95	5.77	5.77	0.91146	dDENN (3);	0.236068	0.44483	D	0.000450	T	0.31949	0.0813	N	0.14661	0.345	0.80722	D	1	B;B;B;B;B;B;B;B;B;B	0.34147	0.343;0.053;0.438;0.257;0.257;0.257;0.142;0.433;0.095;0.257	B;B;B;B;B;B;B;B;B;B	0.43575	0.424;0.158;0.36;0.098;0.098;0.062;0.098;0.234;0.158;0.211	T	0.19679	-1.0298	10	0.59425	D	0.04	-22.5816	7.0549	0.25093	0.1084:0.173:0.7186:0.0	.	526;526;526;526;526;526;526;526;526;526	B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;MADD_HUMAN;.	V	526	ENSP00000343902:G526V;ENSP00000385585:G526V;ENSP00000384435:G526V;ENSP00000304505:G526V;ENSP00000310933:G526V;ENSP00000384204:G526V;ENSP00000378753:G526V;ENSP00000378745:G526V;ENSP00000384287:G526V	ENSP00000310933:G526V	G	+	2	0	MADD	47260615	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.216000	0.58540	2.884000	0.98904	0.655000	0.94253	GGC	MADD	-	pfam_dDENN_dom,smart_dDENN_dom,pfscan_dDENN_dom	ENSG00000110514		0.557	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	HGNC	protein_coding	OTTHUMT00000317746.1		0.00	61	0	G			47304039	+1			no_errors	ENST00000311027	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
MAG	4099	genome.wustl.edu	37	19	35801001	35801001	+	Missense_Mutation	SNP	G	G	A	rs142036180		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:35801001G>A	ENST00000392213.3	+	8	1615	c.1456G>A	c.(1456-1458)Gtc>Atc	p.V486I	MAG_ENST00000593348.1_3'UTR|MAG_ENST00000361922.4_Missense_Mutation_p.V486I|MAG_ENST00000537831.2_Missense_Mutation_p.V461I	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	486	Ig-like C2-type 4.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCCGCCCCGCGTCATCTGCAC	0.697																																																	0								G	ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	34.0	34.0	34.0		1381,1456,1456	4.7	1.0	19	dbSNP_134	34	2,8592		0,2,4295	no	missense,missense,missense	MAG	NM_001199216.1,NM_002361.3,NM_080600.2	29,29,29	0,2,6498	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging,possibly-damaging	461/602,486/627,486/583	35801001	2,12998	2203	4297	6500	SO:0001583	missense	0			M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1456G>A	19.37:g.35801001G>A	ENSP00000376048:p.Val486Ile		B7Z2E5|F5GYC0|Q567S4	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_CD80_C2-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V486I	ENST00000392213.3	37	c.1456	CCDS12455.1	19	.	.	.	.	.	.	.	.	.	.	G	13.76	2.333059	0.41297	0.0	2.33E-4	ENSG00000105695	ENST00000262624;ENST00000361922;ENST00000392213;ENST00000537831	T;T;T	0.13778	2.56;2.56;2.56	4.68	4.68	0.58851	.	0.063541	0.64402	D	0.000007	T	0.06234	0.0161	N	0.14661	0.345	0.43412	D	0.995558	B;P;P	0.37688	0.336;0.605;0.605	B;B;B	0.24155	0.051;0.033;0.033	T	0.29761	-1.0001	10	0.45353	T	0.12	.	8.6702	0.34145	0.1022:0.0:0.8978:0.0	.	523;486;486	Q59GD9;P20916;Q567S4	.;MAG_HUMAN;.	I	523;486;486;461	ENSP00000355234:V486I;ENSP00000376048:V486I;ENSP00000440695:V461I	ENSP00000262624:V523I	V	+	1	0	MAG	40492841	0.998000	0.40836	1.000000	0.80357	0.988000	0.76386	2.884000	0.48562	2.431000	0.82371	0.462000	0.41574	GTC	MAG	-	NULL	ENSG00000105695		0.697	MAG-001	KNOWN	basic|CCDS	protein_coding	MAG	HGNC	protein_coding	OTTHUMT00000466071.1	-	0.00	33	0	G	NM_080600		35801001	+1	tier1	rs142036180	no_errors	ENST00000392213	ensembl	human	known	74_37	missense	19.05	34	8	SNP	0.999	A
MAMDC4	158056	genome.wustl.edu	37	9	139750588	139750588	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:139750588G>T	ENST00000317446.2	+	14	1757	c.1707G>T	c.(1705-1707)caG>caT	p.Q569H	MAMDC4_ENST00000445819.1_Missense_Mutation_p.Q569H|MAMDC4_ENST00000485732.1_3'UTR	NM_206920.2	NP_996803.2			MAM domain containing 4											breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	19	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		ATTATTTACAGAGCCAGCCCC	0.677																																																	0													51.0	60.0	57.0					9																	139750588		2203	4297	6500	SO:0001583	missense	0			AL834531	CCDS7010.1	9q34.3	2013-10-21			ENSG00000177943	ENSG00000177943			24083	protein-coding gene	gene with protein product	"""apical early endosomal glycoprotein precursor"", ""endotubin"""					7829488	Standard	NM_206920		Approved	AEGP, DKFZp434M1411	uc004cjs.3	Q6UXC1	OTTHUMG00000020951	ENST00000317446.2:c.1707G>T	9.37:g.139750588G>T	ENSP00000319388:p.Gln569His			Missense_Mutation	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_LDrepeatLR_classA_rpt	p.Q569H	ENST00000317446.2	37	c.1707	CCDS7010.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.014|0.014	-1.581801|-1.581801	0.00879|0.00879	.|.	.|.	ENSG00000177943|ENSG00000177943	ENST00000413647|ENST00000317446;ENST00000445819	.|T;T	.|0.01981	.|4.52;4.52	4.97|4.97	-0.472|-0.472	0.12115|0.12115	.|.	.|0.680110	.|0.13423	.|N	.|0.389007	.|T	.|0.01222	.|0.0040	N|N	0.12569|0.12569	0.235|0.235	0.09310|0.09310	N|N	1|1	.|B	.|0.09022	.|0.002	.|B	.|0.09377	.|0.004	.|T	.|0.46843	.|-0.9162	.|10	.|0.39692	.|T	.|0.17	-3.026|-3.026	1.3349|1.3349	0.02142|0.02142	0.1527:0.2751:0.2499:0.3224|0.1527:0.2751:0.2499:0.3224	.|.	.|569	.|Q6UXC1-2	.|.	X|H	555|569	.|ENSP00000319388:Q569H;ENSP00000411339:Q569H	.|ENSP00000319388:Q569H	E|Q	+|+	1|3	0|2	MAMDC4|MAMDC4	138870409|138870409	0.045000|0.045000	0.20229|0.20229	0.002000|0.002000	0.10522|0.10522	0.005000|0.005000	0.04900|0.04900	-0.224000|-0.224000	0.09164|0.09164	-0.311000|-0.311000	0.08754|0.08754	-0.215000|-0.215000	0.12644|0.12644	GAG|CAG	MAMDC4	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom	ENSG00000177943		0.677	MAMDC4-005	KNOWN	basic|CCDS	protein_coding	MAMDC4	HGNC	protein_coding	OTTHUMT00000254642.3		0.00	59	0	G	NM_206920		139750588	+1			no_errors	ENST00000445819	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.001	T
MAMDC4	158056	genome.wustl.edu	37	9	139751001	139751001	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:139751001C>T	ENST00000445819.1	+	16	1981	c.1931C>T	c.(1930-1932)cCc>cTc	p.P644L	MAMDC4_ENST00000317446.2_Intron|MAMDC4_ENST00000485732.1_3'UTR					MAM domain containing 4											breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	19	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		GACTGTAGCCCCACAGTGACC	0.622																																																	0													92.0	87.0	88.0					9																	139751001		876	1991	2867	SO:0001583	missense	0			AL834531	CCDS7010.1	9q34.3	2013-10-21			ENSG00000177943	ENSG00000177943			24083	protein-coding gene	gene with protein product	"""apical early endosomal glycoprotein precursor"", ""endotubin"""					7829488	Standard	NM_206920		Approved	AEGP, DKFZp434M1411	uc004cjs.3	Q6UXC1	OTTHUMG00000020951	ENST00000445819.1:c.1931C>T	9.37:g.139751001C>T	ENSP00000411339:p.Pro644Leu			Missense_Mutation	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_LDrepeatLR_classA_rpt	p.P644L	ENST00000445819.1	37	c.1931		9	.	.	.	.	.	.	.	.	.	.	.	15.06	2.720132	0.48728	.	.	ENSG00000177943	ENST00000445819	T	0.02369	4.32	4.94	4.0	0.46444	.	.	.	.	.	T	0.03263	0.0095	.	.	.	0.34786	D	0.735205	.	.	.	.	.	.	T	0.50906	-0.8772	6	0.17369	T	0.5	.	8.7155	0.34408	0.0:0.7586:0.1546:0.0868	.	.	.	.	L	644	ENSP00000411339:P644L	ENSP00000411339:P644L	P	+	2	0	MAMDC4	138870822	0.000000	0.05858	0.955000	0.39395	0.286000	0.27126	0.608000	0.24223	2.264000	0.75181	0.549000	0.68633	CCC	MAMDC4	-	superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom	ENSG00000177943		0.622	MAMDC4-201	KNOWN	basic|appris_principal	protein_coding	MAMDC4	HGNC	protein_coding			0.00	24	0	C	NM_206920		139751001	+1			no_errors	ENST00000445819	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.606	T
MARK1	4139	genome.wustl.edu	37	1	220825486	220825486	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:220825486G>T	ENST00000366917.4	+	15	1996	c.1730G>T	c.(1729-1731)cGg>cTg	p.R577L	MARK1_ENST00000402574.1_Missense_Mutation_p.R442L|MARK1_ENST00000366918.4_Missense_Mutation_p.R555L					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		GAAGCTTACCGGCCTGGGTAA	0.438																																																	0													122.0	114.0	117.0					1																	220825486		2203	4300	6503	SO:0001583	missense	0			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.1730G>T	1.37:g.220825486G>T	ENSP00000355884:p.Arg577Leu			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.R577L	ENST00000366917.4	37	c.1730	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.802659	0.70682	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.28666	1.6;1.6;1.6	5.74	5.74	0.90152	.	0.143972	0.49305	D	0.000149	T	0.32041	0.0816	L	0.46157	1.445	0.48511	D	0.999668	B;B;B;B	0.30104	0.268;0.081;0.0;0.001	B;B;B;B	0.25506	0.061;0.045;0.002;0.001	T	0.04781	-1.0927	10	0.51188	T	0.08	.	20.2982	0.98569	0.0:0.0:1.0:0.0	.	577;442;577;555	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	L	442;555;577	ENSP00000386017:R442L;ENSP00000355885:R555L;ENSP00000355884:R577L	ENSP00000355884:R577L	R	+	2	0	MARK1	218892109	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.861000	0.69553	2.873000	0.98535	0.563000	0.77884	CGG	MARK1	-	NULL	ENSG00000116141		0.438	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1	-	0.00	55	0	G			220825486	+1	tier1	-	no_errors	ENST00000366917	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
MARK2	2011	genome.wustl.edu	37	11	63670095	63670095	+	Silent	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:63670095C>A	ENST00000509502.2	+	13	1618	c.1155C>A	c.(1153-1155)acC>acA	p.T385T	MARK2_ENST00000402010.2_Silent_p.T419T|MARK2_ENST00000513765.2_Silent_p.T386T|MARK2_ENST00000350490.7_Silent_p.T418T|MARK2_ENST00000361128.5_Silent_p.T419T|MARK2_ENST00000502399.3_Silent_p.T418T|MARK2_ENST00000413835.2_Silent_p.T419T|MARK2_ENST00000377809.4_Silent_p.T419T|MARK2_ENST00000508192.1_Silent_p.T418T|MARK2_ENST00000425897.2_Silent_p.T385T|MARK2_ENST00000377810.3_Silent_p.T385T|MARK2_ENST00000408948.3_Silent_p.T385T|MARK2_ENST00000315032.8_Silent_p.T419T	NM_017490.3	NP_059672.2			MAP/microtubule affinity-regulating kinase 2											autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33						CCATTCCCACCTCTAATTCTT	0.572																																																	0													32.0	32.0	32.0					11																	63670095		2201	4297	6498	SO:0001819	synonymous_variant	0			BC008771	CCDS8051.1, CCDS41665.1, CCDS8051.2, CCDS53649.1, CCDS53650.1, CCDS53651.1	11q13.1	2013-06-27	2002-07-26	2002-08-01	ENSG00000072518	ENSG00000072518			3332	protein-coding gene	gene with protein product	"""ELKL motif kinase 1"", ""serine/threonine kinase"", ""protein-serine/threonine kinase"", ""Ser/Thr protein kinase PAR-1B"""	600526	"""ELKL motif kinase"""	EMK1		9730619, 10516437	Standard	NM_017490		Approved	PAR-1, Par1b, PAR-1B	uc001nxw.3	Q7KZI7	OTTHUMG00000160504	ENST00000509502.2:c.1155C>A	11.37:g.63670095C>A				Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T419	ENST00000509502.2	37	c.1257	CCDS41665.1	11																																																																																			MARK2	-	NULL	ENSG00000072518		0.572	MARK2-003	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	MARK2	HGNC	protein_coding	OTTHUMT00000360862.2		0.00	120	0	C	NM_017490		63670095	+1			no_errors	ENST00000402010	ensembl	human	known	74_37	silent	5.13	74	4	SNP	0.997	A
MATN4	8785	genome.wustl.edu	37	20	43933303	43933303	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr20:43933303C>T	ENST00000372754.1	-	2	216	c.208G>A	c.(208-210)Gcc>Acc	p.A70T	RBPJL_ENST00000343694.3_5'Flank|MATN4_ENST00000360607.6_Missense_Mutation_p.A70T|MATN4_ENST00000372751.4_Intron|MATN4_ENST00000353917.5_Missense_Mutation_p.A70T|MATN4_ENST00000372756.1_Missense_Mutation_p.A70T|MATN4_ENST00000342716.4_Missense_Mutation_p.A70T|RBPJL_ENST00000372743.1_5'Flank|RBPJL_ENST00000372741.3_5'Flank|MATN4_ENST00000537548.1_Missense_Mutation_p.A70T			O95460	MATN4_HUMAN	matrilin 4	70	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)		p.N69fs*3(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				ACGCGCGTGGCGTTGGGACCC	0.642																																																	1	Deletion - Frameshift(1)	skin(1)											36.0	34.0	35.0					20																	43933303		2202	4298	6500	SO:0001583	missense	0			AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.208G>A	20.37:g.43933303C>T	ENSP00000361840:p.Ala70Thr		A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Missense_Mutation	SNP	pfam_VWF_A,pfam_EGF-like_Ca-bd_dom,pfam_Matrilin_coiled-coil_trimer,smart_VWF_A,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_VWF_A	p.A70T	ENST00000372754.1	37	c.208		20	.	.	.	.	.	.	.	.	.	.	C	15.31	2.794888	0.50102	.	.	ENSG00000124159	ENST00000372754;ENST00000372756;ENST00000353917;ENST00000360607;ENST00000342716;ENST00000537548;ENST00000255132	T;T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13;-1.13	4.2	4.2	0.49525	.	0.000000	0.41938	D	0.000785	T	0.73148	0.3550	N	0.26092	0.79	0.80722	D	1	P;D;P	0.58620	0.749;0.983;0.764	B;P;B	0.55011	0.135;0.766;0.23	T	0.70479	-0.4860	10	0.31617	T	0.26	.	9.4942	0.38978	0.0:0.9031:0.0:0.0969	.	70;70;70	A6NNA4;O95460-4;O95460-2	.;.;.	T	70	ENSP00000361840:A70T;ENSP00000361842:A70T;ENSP00000243983:A70T;ENSP00000353819:A70T;ENSP00000343164:A70T;ENSP00000440328:A70T	ENSP00000255132:A70T	A	-	1	0	MATN4	43366717	0.999000	0.42202	1.000000	0.80357	0.811000	0.45836	2.923000	0.48868	2.161000	0.67846	0.462000	0.41574	GCC	MATN4	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000124159		0.642	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	MATN4	HGNC	protein_coding	OTTHUMT00000080335.1	-	0.00	21	0	C			43933303	-1	tier1	-	no_errors	ENST00000372754	ensembl	human	known	74_37	missense	18.92	30	7	SNP	1.000	T
MCF2	4168	genome.wustl.edu	37	X	138667261	138667261	+	Silent	SNP	A	A	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chrX:138667261A>G	ENST00000370576.4	-	24	2918	c.2709T>C	c.(2707-2709)acT>acC	p.T903T	MCF2_ENST00000370573.4_Intron|MCF2_ENST00000370578.4_Silent_p.T1048T|MCF2_ENST00000536274.1_Intron|MCF2_ENST00000338585.6_Silent_p.T919T|MCF2_ENST00000520602.1_Silent_p.T963T|MCF2_ENST00000414978.1_Silent_p.T963T|MCF2_ENST00000519895.1_Silent_p.T979T	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	903					apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					TTTCATCATAAGTAGGGTAGA	0.363																																																	0													165.0	160.0	162.0					X																	138667261		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.2709T>C	X.37:g.138667261A>G			B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.T1048	ENST00000370576.4	37	c.3144	CCDS14667.1	X																																																																																			MCF2	-	NULL	ENSG00000101977		0.363	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MCF2	HGNC	protein_coding	OTTHUMT00000058560.1	-	0.00	51	0	A	NM_005369		138667261	-1	tier1	-	no_errors	ENST00000370578	ensembl	human	known	74_37	silent	32.26	41	20	SNP	0.000	G
MECOM	2122	genome.wustl.edu	37	3	168819859	168819859	+	Silent	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr3:168819859G>T	ENST00000464456.1	-	9	3369	c.2169C>A	c.(2167-2169)cgC>cgA	p.R723R	MECOM_ENST00000433243.2_Silent_p.R733R|MECOM_ENST00000460814.1_Silent_p.R723R|MECOM_ENST00000264674.3_Silent_p.R797R|MECOM_ENST00000392736.3_Silent_p.R732R|MECOM_ENST00000494292.1_Silent_p.R911R|MECOM_ENST00000472280.1_Silent_p.R733R|MECOM_ENST00000468789.1_Silent_p.R732R	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						TGCAGGTATAGCGCTCCTTTC	0.488																																																	0													66.0	63.0	64.0					3																	168819859		2203	4300	6503	SO:0001819	synonymous_variant	0			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.2169C>A	3.37:g.168819859G>T			Q13466|Q6FH90	Silent	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.R911	ENST00000464456.1	37	c.2733	CCDS54669.1	3																																																																																			MECOM	-	pfam_Znf_BED_prd	ENSG00000085276		0.488	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	MECOM	HGNC	protein_coding	OTTHUMT00000351519.1	-	0.00	53	0	G	NM_005241, NM_004991		168819859	-1	tier1	-	no_errors	ENST00000494292	ensembl	human	known	74_37	silent	10.00	54	6	SNP	1.000	T
MEGF6	1953	genome.wustl.edu	37	1	3425796	3425796	+	Silent	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:3425796C>T	ENST00000356575.4	-	12	1597	c.1371G>A	c.(1369-1371)ccG>ccA	p.P457P	MEGF6_ENST00000294599.4_Silent_p.P352P	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	457						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		GGTCCACCATCGGCTCCTCCA	0.706																																					Ovarian(73;978 3658)												0													9.0	13.0	12.0					1																	3425796		2015	4145	6160	SO:0001819	synonymous_variant	0			AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.1371G>A	1.37:g.3425796C>T			Q4AC86|Q5VV39	Silent	SNP	pfam_EGF_laminin,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.P457	ENST00000356575.4	37	c.1371	CCDS41237.1	1																																																																																			MEGF6	-	NULL	ENSG00000162591		0.706	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF6	HGNC	protein_coding	OTTHUMT00000354866.1	-	0.00	19	0	C	NM_001409		3425796	-1	tier1	-	no_errors	ENST00000356575	ensembl	human	known	74_37	silent	20.00	16	4	SNP	0.000	T
METTL13	51603	genome.wustl.edu	37	1	171761202	171761202	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:171761202T>C	ENST00000361735.3	+	6	1786	c.1520T>C	c.(1519-1521)cTc>cCc	p.L507P	METTL13_ENST00000362019.3_Missense_Mutation_p.L421P|METTL13_ENST00000458517.1_Missense_Mutation_p.L506P|METTL13_ENST00000367737.5_Missense_Mutation_p.L351P|METTL13_ENST00000466643.1_3'UTR	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	507							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						GGGGGCAGCCTCCCCCTCTTT	0.517																																																	0													130.0	117.0	122.0					1																	171761202		2203	4300	6503	SO:0001583	missense	0			AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.1520T>C	1.37:g.171761202T>C	ENSP00000354920:p.Leu507Pro		A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_Spermidine/spermine_synthase	p.L507P	ENST00000361735.3	37	c.1520	CCDS1299.1	1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.401108	0.83120	.	.	ENSG00000010165	ENST00000458517;ENST00000362019;ENST00000367737;ENST00000361735;ENST00000367736;ENST00000341850	T;T;T;T;T	0.79940	-0.26;-0.26;-0.26;-0.26;-1.32	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.88894	0.6561	M	0.92026	3.265	0.80722	D	1	D;P;D	0.89917	1.0;0.61;1.0	D;B;D	0.91635	0.999;0.176;0.999	D	0.88244	0.2912	10	0.17832	T	0.49	-47.6862	15.8164	0.78604	0.0:0.0:0.0:1.0	.	506;351;507	B4E2X3;Q8N6R0-1;Q8N6R0	.;.;MTL13_HUMAN	P	506;421;351;507;207;204	ENSP00000401955:L506P;ENSP00000355393:L421P;ENSP00000356711:L351P;ENSP00000354920:L507P;ENSP00000356710:L207P	ENSP00000341732:L204P	L	+	2	0	METTL13	170027825	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.683000	0.84093	2.209000	0.71365	0.533000	0.62120	CTC	METTL13	-	NULL	ENSG00000010165		0.517	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL13	HGNC	protein_coding	OTTHUMT00000084528.5		0.00	51	0	T	NM_014955		171761202	+1			no_errors	ENST00000361735	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	C
MGAT3	4248	genome.wustl.edu	37	22	39884893	39884893	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr22:39884893G>A	ENST00000341184.6	+	2	1756	c.1541G>A	c.(1540-1542)cGc>cAc	p.R514H		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	514					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)			endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					GGCGGGTGGCGCCACAGGGGT	0.652																																																	0													14.0	18.0	17.0					22																	39884893		2170	4248	6418	SO:0001583	missense	0			D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.1541G>A	22.37:g.39884893G>A	ENSP00000345270:p.Arg514His		A6NGD0|Q14CK5|Q6IC49|Q9UH32	Missense_Mutation	SNP	pfam_Glyco_trans_17	p.R514H	ENST00000341184.6	37	c.1541	CCDS13994.2	22	.	.	.	.	.	.	.	.	.	.	g	14.43	2.532331	0.45073	.	.	ENSG00000128268	ENST00000341184	.	.	.	5.38	2.1	0.27182	.	1.043170	0.07690	N	0.938582	T	0.26557	0.0649	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.25606	-1.0127	9	0.56958	D	0.05	.	6.7775	0.23628	0.2134:0.1268:0.6599:0.0	.	514	Q09327	MGAT3_HUMAN	H	514	.	ENSP00000345270:R514H	R	+	2	0	MGAT3	38214839	0.001000	0.12720	0.007000	0.13788	0.012000	0.07955	0.907000	0.28531	0.342000	0.23796	-0.127000	0.14921	CGC	MGAT3	-	NULL	ENSG00000128268		0.652	MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT3	HGNC	protein_coding	OTTHUMT00000075039.2		0.00	19	0	G	NM_002409		39884893	+1			no_errors	ENST00000341184	ensembl	human	known	74_37	missense	13.04	20	3	SNP	0.012	A
ELMO1	9844	genome.wustl.edu	37	7	36958972	36958972	+	Intron	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr7:36958972G>T	ENST00000310758.4	-	17	2085				ELMO1_ENST00000396045.3_Intron|ELMO1_ENST00000448602.1_Intron|MIR1200_ENST00000408398.1_RNA|ELMO1_ENST00000442504.1_Intron|ELMO1_ENST00000341056.3_Intron|ELMO1_ENST00000396040.2_Intron	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1						actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GGCTATCCCTGACAAATTCCT	0.463																																																	0													97.0	87.0	90.0					7																	36958972		1568	3582	5150	SO:0001627	intron_variant	0			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.1438-24350C>A	7.37:g.36958972G>T			A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	RNA	SNP	-	NULL	ENST00000310758.4	37	NULL	CCDS5449.1	7																																																																																			MIR1200	-	-	ENSG00000221325		0.463	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR1200	HGNC	protein_coding	OTTHUMT00000219830.4	-	0.00	51	0	G	NM_130442		36958972	-1	tier1	-	no_errors	ENST00000408398	ensembl	human	known	74_37	rna	5.48	69	4	SNP	0.000	T
STRBP	55342	genome.wustl.edu	37	9	125874236	125874236	+	Intron	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:125874236G>T	ENST00000530364.1	-	2	31				MIR600HG_ENST00000385007.1_RNA			Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein						cellular component movement (GO:0006928)|mechanosensory behavior (GO:0007638)|multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(6)|prostate(1)|skin(2)	26						CTGATTATCAGAGATTAGCAA	0.542																																																	0																																										SO:0001627	intron_variant	0			AK002169	CCDS6851.1, CCDS55337.1	9q33.1-q33.3	2008-08-29	2001-11-28		ENSG00000165209	ENSG00000165209			16462	protein-coding gene	gene with protein product		611138	"""spermatid perinuclear RNA-binding protein"", ""interleukin enhancer binding factor 3-like"""	ILF3L			Standard	NM_018387		Approved	FLJ11307, SPNR	uc004bns.3	Q96SI9	OTTHUMG00000020636	ENST00000530364.1:c.255-2204C>A	9.37:g.125874236G>T			Q32NB9|Q9BUE1|Q9BXG4|Q9H0B4|Q9H7V1|Q9NUK4	RNA	SNP	-	NULL	ENST00000530364.1	37	NULL		9																																																																																			MIR600HG	-	-	ENSG00000236901		0.542	STRBP-009	PUTATIVE	basic	processed_transcript	MIR600HG	HGNC	protein_coding	OTTHUMT00000392598.1	-	0.00	80	0	G			125874236	-1	tier1	-	no_errors	ENST00000449175	ensembl	human	known	74_37	rna	6.78	55	4	SNP	0.007	T
MLKL	197259	genome.wustl.edu	37	16	74716588	74716588	+	Missense_Mutation	SNP	C	C	T	rs201073938		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr16:74716588C>T	ENST00000308807.7	-	6	1380	c.917G>A	c.(916-918)cGc>cAc	p.R306H	MLKL_ENST00000306247.7_Intron	NM_152649.2	NP_689862.1			mixed lineage kinase domain-like											breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(6)|skin(1)|stomach(2)	19						TAGGACCATGCGCTTGCCAAG	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		19379	0.0		0.001	False		,,,				2504	0.0																0													103.0	93.0	97.0					16																	74716588		2198	4300	6498	SO:0001583	missense	0			AK091708	CCDS32487.1, CCDS45528.1	16q22.3	2008-02-05				ENSG00000168404			26617	protein-coding gene	gene with protein product		615153				12477932	Standard	NM_152649		Approved	FLJ34389	uc002fdb.2	Q8NB16		ENST00000308807.7:c.917G>A	16.37:g.74716588C>T	ENSP00000308351:p.Arg306His			Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R306H	ENST00000308807.7	37	c.917	CCDS32487.1	16	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.30	3.594268	0.66219	.	.	ENSG00000168404	ENST00000308807	D	0.94232	-3.38	4.7	4.7	0.59300	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.052669	0.64402	D	0.000001	D	0.97117	0.9058	M	0.92555	3.32	0.19300	N	0.999972	D	0.89917	1.0	D	0.70227	0.968	D	0.92051	0.5648	10	0.66056	D	0.02	-13.4717	13.8398	0.63432	0.0:1.0:0.0:0.0	.	306	Q8NB16	MLKL_HUMAN	H	306	ENSP00000308351:R306H	ENSP00000308351:R306H	R	-	2	0	MLKL	73274089	0.755000	0.28372	0.051000	0.19133	0.002000	0.02628	2.250000	0.43178	2.544000	0.85801	0.508000	0.49915	CGC	MLKL	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000168404		0.562	MLKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLKL	HGNC	protein_coding	OTTHUMT00000436403.3		0.00	50	0	C	NM_152649		74716588	-1			no_errors	ENST00000308807	ensembl	human	known	74_37	missense	6.38	44	3	SNP	0.127	T
MLLT6	4302	genome.wustl.edu	37	17	36873150	36873150	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:36873150G>A	ENST00000325718.7	+	10	1658	c.1567G>A	c.(1567-1569)Ggc>Agc	p.G523S	MIR4726_ENST00000577947.1_RNA|CTB-58E17.9_ENST00000579499.1_RNA	NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6	523					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					GGTCAGCTCCGGCCTGGGAGG	0.657			T	MLL	AL																																			Dom	yes		17	17q21	4302	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""		L	0													24.0	24.0	24.0					17																	36873150		2203	4300	6503	SO:0001583	missense	0				CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498	ENST00000325718.7:c.1567G>A	17.37:g.36873150G>A	ENSP00000316426:p.Gly523Ser		Q59F28|Q96IU3|Q9H5F6|Q9UF49	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.G523S	ENST00000325718.7	37	c.1567	CCDS11327.1	17	.	.	.	.	.	.	.	.	.	.	G	10.64	1.408393	0.25378	.	.	ENSG00000108292	ENST00000325718	T	0.12569	2.67	5.17	4.18	0.49190	.	0.472205	0.23086	N	0.052091	T	0.06188	0.0160	N	0.10809	0.05	0.40585	D	0.981431	B	0.18166	0.026	B	0.10450	0.005	T	0.13953	-1.0490	10	0.02654	T	1	.	11.8109	0.52181	0.0868:0.0:0.9132:0.0	.	523	P55198	AF17_HUMAN	S	523	ENSP00000316426:G523S	ENSP00000316426:G523S	G	+	1	0	MLLT6	34126676	0.998000	0.40836	0.976000	0.42696	0.985000	0.73830	3.291000	0.51764	2.700000	0.92200	0.561000	0.74099	GGC	MLLT6	-	NULL	ENSG00000108292		0.657	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLLT6	HGNC	protein_coding	OTTHUMT00000256799.1	-	0.00	96	0	G	NM_005937		36873150	+1	tier1	-	no_errors	ENST00000325718	ensembl	human	known	74_37	missense	9.23	59	6	SNP	0.943	A
MLPH	79083	genome.wustl.edu	37	2	238402114	238402114	+	Silent	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:238402114C>T	ENST00000264605.3	+	2	339	c.45C>T	c.(43-45)gcC>gcT	p.A15A	MLPH_ENST00000338530.4_Silent_p.A15A|MLPH_ENST00000410032.1_Silent_p.A15A|MLPH_ENST00000409373.1_Silent_p.A15A|MLPH_ENST00000468178.1_3'UTR|MLPH_ENST00000445024.2_Silent_p.A15A	NM_024101.5	NP_077006.1	Q9BV36	MELPH_HUMAN	melanophilin	15	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				melanocyte differentiation (GO:0030318)|melanosome localization (GO:0032400)|protein targeting (GO:0006605)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|microtubule plus-end (GO:0035371)|stress fiber (GO:0001725)	metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)		ATGAAGAGGCCCAGCATGTCT	0.527																																																	0													180.0	176.0	177.0					2																	238402114		2203	4300	6503	SO:0001819	synonymous_variant	0			AY358857	CCDS2518.1, CCDS42836.1, CCDS63172.1, CCDS63173.1	2q37.2	2014-09-17			ENSG00000115648	ENSG00000115648			29643	protein-coding gene	gene with protein product		606526				11980908, 11504925	Standard	NM_024101		Approved	l1Rk3, l(1)-3Rk, Slac-2a, ln, exophilin-3	uc002vwt.3	Q9BV36	OTTHUMG00000133298	ENST00000264605.3:c.45C>T	2.37:g.238402114C>T			B3KSS2|B4DKW7|G5E9G5|Q9HA71	Silent	SNP	pfam_Myrip/Melanophilin,superfamily_Znf_FYVE_PHD,pfscan_Znf_FYVE-typ	p.A15	ENST00000264605.3	37	c.45	CCDS2518.1	2																																																																																			MLPH	-	superfamily_Znf_FYVE_PHD,pfscan_Znf_FYVE-typ	ENSG00000115648		0.527	MLPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLPH	HGNC	protein_coding	OTTHUMT00000257083.2		0.00	64	0	C	NM_024101		238402114	+1			no_errors	ENST00000264605	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.987	T
MOB3C	148932	genome.wustl.edu	37	1	47080726	47080726	+	Intron	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:47080726G>T	ENST00000319928.3	-	1	181				MKNK1_ENST00000545730.1_Intron|MOB3C_ENST00000477318.1_Intron|MOB3C_ENST00000271139.8_Missense_Mutation_p.A8D|MOB3C_ENST00000371940.1_5'UTR	NM_201403.2	NP_958805.1	Q70IA8	MOB3C_HUMAN	MOB kinase activator 3C								metal ion binding (GO:0046872)										AGTTTCCAGAGCAAAGAGATT	0.493																																																	0													74.0	75.0	74.0					1																	47080726		2203	4300	6503	SO:0001627	intron_variant	0			AK091808	CCDS539.1, CCDS540.1	1p34.1	2011-09-28	2011-09-28	2011-09-28	ENSG00000142961	ENSG00000142961		"""MOB kinase activators"""	29800	protein-coding gene	gene with protein product			"""MOB1, Mps One Binder kinase activator-like 2C (yeast)"""	MOBKL2C		12477932	Standard	NM_145279		Approved	MOB1E	uc001cqe.4	Q70IA8	OTTHUMG00000007989	ENST00000319928.3:c.49+1656C>A	1.37:g.47080726G>T			D3DQ22|Q0VA98|Q5TC10|Q5TC11|Q8NAZ2|Q8NF28	Missense_Mutation	SNP	pfam_Mob1_phocein,superfamily_Mob1_phocein	p.A8D	ENST00000319928.3	37	c.23	CCDS540.1	1	.	.	.	.	.	.	.	.	.	.	G	11.01	1.512878	0.27123	.	.	ENSG00000142961	ENST00000271139	.	.	.	3.31	-6.34	0.01982	.	.	.	.	.	T	0.24198	0.0586	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38542	-0.9656	5	0.87932	D	0	.	0.192	0.00135	0.3047:0.2131:0.1448:0.3374	.	.	.	.	D	8	.	ENSP00000271139:A8D	A	-	2	0	MOBKL2C	46853313	0.007000	0.16637	0.000000	0.03702	0.061000	0.15899	-1.041000	0.03542	-1.195000	0.02680	-0.150000	0.13652	GCT	MOB3C	-	NULL	ENSG00000142961		0.493	MOB3C-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MOB3C	HGNC	protein_coding		-	0.00	62	0	G	NM_145279		47080726	-1	tier1	-	no_errors	ENST00000271139	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.000	T
MRC1	4360	genome.wustl.edu	37	10	18145181	18145181	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr10:18145181G>T	ENST00000239761.3	+	9	1521	c.1418G>T	c.(1417-1419)tGg>tTg	p.W473L		NM_002438.2	NP_002429.1	P22897	MRC1_HUMAN	mannose receptor, C type 1	473	C-type lectin 2. {ECO:0000255|PROSITE- ProRule:PRU00040}.				receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	mannose binding (GO:0005537)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|kidney(1)|lung(2)|prostate(1)|urinary_tract(1)	6						GATGGGTACTGGGCAGATCGG	0.443																																					GBM(115;1153 1594 28187 28781 35884)												0													14.0	12.0	13.0					10																	18145181		1512	2156	3668	SO:0001583	missense	0			J05550	CCDS7123.1, CCDS7123.2	10p13	2014-04-10			ENSG00000120586	ENSG00000260314		"""CD molecules"", ""C-type lectin domain containing"""	7228	protein-coding gene	gene with protein product		153618	"""mannose receptor, C type 1-like 1"""	MRC1L1		1294118	Standard	NM_002438		Approved	CLEC13D, CD206, bA541I19.1, CLEC13DL	uc031ptj.1	P22897	OTTHUMG00000174646	ENST00000239761.3:c.1418G>T	10.37:g.18145181G>T	ENSP00000239761:p.Trp473Leu		A5PKW3|Q5VSJ2|Q5VSK2	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Ricin_B_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin,prints_AntifreezeII	p.W473L	ENST00000239761.3	37	c.1418	CCDS7123.1	10	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831782	0.71258	.	.	ENSG00000120586	ENST00000239761	T	0.26067	1.76	4.58	4.58	0.56647	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.51477	U	0.000093	T	0.63189	0.2490	H	0.95043	3.615	0.58432	D	0.999998	D	0.89917	1.0	D	0.81914	0.995	T	0.76613	-0.2895	10	0.87932	D	0	-36.7873	15.5269	0.75919	0.0:0.0:1.0:0.0	.	473	P22897	MRC1_HUMAN	L	473	ENSP00000239761:W473L	ENSP00000239761:W473L	W	+	2	0	MRC1	18185187	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	6.282000	0.72639	2.083000	0.62718	0.505000	0.49811	TGG	MRC1	-	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000120586		0.443	MRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC1	HGNC	protein_coding	OTTHUMT00000047057.1	-	0.00	25	0	G	NM_002438		18145181	+1	tier1	-	no_errors	ENST00000239761	ensembl	human	known	74_37	missense	21.05	15	4	SNP	1.000	T
MRPL16	54948	genome.wustl.edu	37	11	59577339	59577339	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:59577339G>T	ENST00000300151.4	-	2	323	c.110C>A	c.(109-111)cCa>cAa	p.P37Q		NM_017840.3	NP_060310.1	Q9NX20	RM16_HUMAN	mitochondrial ribosomal protein L16	37					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(1)|liver(1)|lung(8)	11						TTCAAAACTTGGTACTGGGAG	0.493																																																	0													60.0	56.0	57.0					11																	59577339		2201	4295	6496	SO:0001583	missense	0			AF183428	CCDS7976.1	11q12.1	2012-09-13			ENSG00000166902	ENSG00000166902		"""Mitochondrial ribosomal proteins / large subunits"""	14476	protein-coding gene	gene with protein product		611829					Standard	NM_017840		Approved	FLJ20484, PNAS-111	uc001noh.2	Q9NX20	OTTHUMG00000167410	ENST00000300151.4:c.110C>A	11.37:g.59577339G>T	ENSP00000300151:p.Pro37Gln		Q9BYD0|Q9HB70	Missense_Mutation	SNP	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,prints_Ribosomal_L16	p.P37Q	ENST00000300151.4	37	c.110	CCDS7976.1	11	.	.	.	.	.	.	.	.	.	.	G	17.44	3.389069	0.61956	.	.	ENSG00000166902	ENST00000300151	T	0.24151	1.87	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.44286	0.1286	M	0.65498	2.005	0.80722	D	1	D	0.64830	0.994	P	0.59357	0.856	T	0.08371	-1.0725	10	0.23302	T	0.38	-11.6383	15.779	0.78246	0.0:0.0:1.0:0.0	.	37	Q9NX20	RM16_HUMAN	Q	37	ENSP00000300151:P37Q	ENSP00000300151:P37Q	P	-	2	0	MRPL16	59333915	0.999000	0.42202	0.970000	0.41538	0.174000	0.22865	4.489000	0.60309	2.788000	0.95919	0.650000	0.86243	CCA	MRPL16	-	NULL	ENSG00000166902		0.493	MRPL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL16	HGNC	protein_coding	OTTHUMT00000394521.1	-	0.00	68	0	G	NM_017840		59577339	-1	tier1	-	no_errors	ENST00000300151	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.987	T
MRPL22	29093	genome.wustl.edu	37	5	154336728	154336728	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:154336728C>A	ENST00000523037.1	+	5	336	c.295C>A	c.(295-297)Cag>Aag	p.Q99K	MRPL22_ENST00000265229.8_Missense_Mutation_p.Q19K|MRPL22_ENST00000522038.1_Missense_Mutation_p.Q105K|MRPL22_ENST00000439747.3_Missense_Mutation_p.Q125K	NM_014180.3	NP_054899.2	Q9NWU5	RM22_HUMAN	mitochondrial ribosomal protein L22	99					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GGCTTTGGCTCAGTTGGAATT	0.378																																																	0													112.0	124.0	120.0					5																	154336728		2203	4300	6503	SO:0001583	missense	0			AB051622	CCDS4331.1, CCDS43391.1	5q33.2	2012-09-13			ENSG00000082515	ENSG00000082515		"""Mitochondrial ribosomal proteins / large subunits"""	14480	protein-coding gene	gene with protein product		611835					Standard	NM_014180		Approved	MRP-L25, RPML25, HSPC158	uc003lvy.4	Q9NWU5	OTTHUMG00000130190	ENST00000523037.1:c.295C>A	5.37:g.154336728C>A	ENSP00000431040:p.Gln99Lys		A6NGJ8|Q5H9Q1|Q96Q51|Q9P006	Missense_Mutation	SNP	pfam_Ribosomal_L22,superfamily_Ribosomal_L22	p.Q99K	ENST00000523037.1	37	c.295	CCDS4331.1	5	.	.	.	.	.	.	.	.	.	.	C	26.6	4.749399	0.89753	.	.	ENSG00000082515	ENST00000523037;ENST00000265229;ENST00000439747;ENST00000522038	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.54	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.69637	0.3133	M	0.88310	2.945	0.80722	D	1	D	0.64830	0.994	D	0.71184	0.972	T	0.77294	-0.2641	10	0.72032	D	0.01	-4.7257	16.1057	0.81220	0.0:0.8659:0.1341:0.0	.	99	Q9NWU5	RM22_HUMAN	K	99;19;125;105	ENSP00000431040:Q99K;ENSP00000265229:Q19K;ENSP00000411177:Q125K;ENSP00000429039:Q105K	ENSP00000265229:Q19K	Q	+	1	0	MRPL22	154316921	1.000000	0.71417	0.954000	0.39281	0.988000	0.76386	5.561000	0.67339	1.272000	0.44329	0.591000	0.81541	CAG	MRPL22	-	pfam_Ribosomal_L22,superfamily_Ribosomal_L22	ENSG00000082515		0.378	MRPL22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MRPL22	HGNC	protein_coding	OTTHUMT00000252508.2	-	0.00	88	0	C			154336728	+1	tier1	-	no_errors	ENST00000523037	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	A
MRPS14	63931	genome.wustl.edu	37	1	174987553	174987553	+	Splice_Site	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:174987553C>T	ENST00000476371.1	-	2	221		c.e2+1			NM_022100.2	NP_071383.1			mitochondrial ribosomal protein S14											large_intestine(2)|lung(5)|pancreas(1)|prostate(2)	10						AATTAGCTAACCTGAAGAATT	0.368																																																	0													171.0	159.0	163.0					1																	174987553		2203	4300	6503	SO:0001630	splice_region_variant	0			AB051350	CCDS1316.1	1q25.1	2012-09-13			ENSG00000120333	ENSG00000120333		"""Mitochondrial ribosomal proteins / small subunits"""	14049	protein-coding gene	gene with protein product		611978					Standard	NR_037606		Approved	HSMRPS14	uc001gkk.3	O60783	OTTHUMG00000034878	ENST00000476371.1:c.204+1G>A	1.37:g.174987553C>T				Splice_Site	SNP	-	e2+1	ENST00000476371.1	37	c.204+1	CCDS1316.1	1	.	.	.	.	.	.	.	.	.	.	C	14.75	2.627522	0.46944	.	.	ENSG00000120333	ENST00000476371	.	.	.	3.97	3.97	0.46021	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3537	0.87330	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MRPS14	173254176	1.000000	0.71417	1.000000	0.80357	0.370000	0.29829	7.595000	0.82710	2.496000	0.84212	0.655000	0.94253	.	MRPS14	-	-	ENSG00000120333		0.368	MRPS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS14	HGNC	protein_coding	OTTHUMT00000084416.2	-	0.00	62	0	C	NM_022100	Intron	174987553	-1	tier1	-	no_errors	ENST00000476371	ensembl	human	known	74_37	splice_site	5.80	65	4	SNP	1.000	T
MTUS2	23281	genome.wustl.edu	37	13	29933537	29933537	+	Missense_Mutation	SNP	C	C	T	rs201118258		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr13:29933537C>T	ENST00000431530.3	+	6	3132	c.3074C>T	c.(3073-3075)gCg>gTg	p.A1025V		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	1015	Localization to the growing distal tip of microtubules.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CTGGGCGTTGCGCAAGGGGAG	0.637																																																	0								C	VAL/ALA	1,4189		0,1,2094	22.0	25.0	24.0		3074	-8.9	0.0	13		24	1,8445		0,1,4222	yes	missense	MTUS2	NM_001033602.2	64	0,2,6316	TT,TC,CC		0.0118,0.0239,0.0158	benign	1025/1380	29933537	2,12634	2095	4223	6318	SO:0001583	missense	0			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.3074C>T	13.37:g.29933537C>T	ENSP00000392057:p.Ala1025Val		A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	NULL	p.A1025V	ENST00000431530.3	37	c.3074	CCDS45022.1	13	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.222020	0.00283	2.39E-4	1.18E-4	ENSG00000132938	ENST00000431530	T	0.11169	2.8	4.91	-8.92	0.00774	.	1.684160	0.03298	N	0.188627	T	0.09379	0.0231	N	0.25647	0.755	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19418	-1.0306	9	.	.	.	.	20.687	0.99705	0.0:0.7997:0.0:0.2003	.	1015	Q5JR59	MTUS2_HUMAN	V	1025	ENSP00000392057:A1025V	.	A	+	2	0	MTUS2	28831537	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.316000	0.08071	-2.214000	0.00734	-2.156000	0.00330	GCG	MTUS2	-	NULL	ENSG00000132938		0.637	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3	-	0.00	77	0	C	XM_166270		29933537	+1	tier1	rs201118258	no_errors	ENST00000431530	ensembl	human	known	74_37	missense	21.31	48	13	SNP	0.000	T
MUC12	10071	genome.wustl.edu	37	7	100635141	100635141	+	Missense_Mutation	SNP	C	C	G	rs373756770		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr7:100635141C>G	ENST00000379442.3	+	5	1726	c.1726C>G	c.(1726-1728)Cgt>Ggt	p.R576G	MUC12_ENST00000536621.1_Missense_Mutation_p.R433G			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	576	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						AATCTCAGGCCGTAGTGAGGA	0.527																																																	0													359.0	398.0	386.0					7																	100635141		692	1591	2283	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.1726C>G	7.37:g.100635141C>G	ENSP00000368755:p.Arg576Gly		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.R433G	ENST00000379442.3	37	c.1297		7	.	.	.	.	.	.	.	.	.	.	C	1.641	-0.516483	0.04200	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.13538	2.58;2.58	0.131	0.131	0.14755	.	.	.	.	.	T	0.05960	0.0155	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.43621	-0.9380	7	0.22706	T	0.39	.	5.9742	0.19369	0.0:0.9994:0.0:6.0E-4	.	.	.	.	G	576;433	ENSP00000368755:R576G;ENSP00000441929:R433G	ENSP00000368755:R576G	R	+	1	0	MUC12	100421861	0.000000	0.05858	0.026000	0.17262	0.026000	0.11368	0.041000	0.13927	0.171000	0.19730	0.174000	0.16983	CGT	MUC12	-	NULL	ENSG00000205277		0.527	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	132	0	C	XM_379904		100635141	+1	tier1	-	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	44.74	63	51	SNP	0.145	G
MUC6	4588	genome.wustl.edu	37	11	1016412	1016414	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:1016412_1016414delGAG	ENST00000421673.2	-	31	6437_6439	c.6387_6389delCTC	c.(6385-6390)tcctca>tca	p.2129_2130SS>S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2129	Ser-rich.|Thr-rich.			S -> F (in Ref. 6; BAC04860). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.S2130delS(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGAGAAAATGAGGAGGACAGCT	0.522																																																	1	Deletion - In frame(1)	stomach(1)								1,3949		0,1,1974						2.9	0.0			96	0,8040		0,0,4020	no	coding	MUC6	NM_005961.2		0,1,5994	A1A1,A1R,RR		0.0,0.0253,0.0083				1,11989				SO:0001651	inframe_deletion	0			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6387_6389delCTC	11.37:g.1016415_1016417delGAG	ENSP00000406861:p.Ser2130del		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	In_Frame_Del	DEL	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.S2130in_frame_del	ENST00000421673.2	37	c.6389_6387	CCDS44513.1	11																																																																																			MUC6	-	NULL	ENSG00000184956		0.522	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	HGNC	protein_coding	OTTHUMT00000382120.2		0.00	55	0	GAG	XM_290540		1016414	-1	tier1		no_errors	ENST00000421673	ensembl	human	known	74_37	in_frame_del	16.67	25	5	DEL	0.002:0.002:0.018	-
MUC2	4583	genome.wustl.edu	37	11	1103846	1103846	+	Silent	SNP	C	C	T	rs373650802	byFrequency	TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:1103846C>T	ENST00000441003.2	+	48	8172	c.8145C>T	c.(8143-8145)acC>acT	p.T2715T		NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	5077					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCTGCTCCACCGTCCCCGTCA	0.647													C|||	4	0.000798722	0.0023	0.0014	5008	,	,		14849	0.0		0.0	False		,,,				2504	0.0																0								C		8,4018		0,8,2005	19.0	22.0	21.0		8130	-0.5	0.3	11		21	0,8256		0,0,4128	no	coding-synonymous	MUC2	NM_002457.2		0,8,6133	TT,TC,CC		0.0,0.1987,0.0651		2710/2813	1103846	8,12274	2013	4128	6141	SO:0001819	synonymous_variant	0			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.8145C>T	11.37:g.1103846C>T			Q14878	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.T2715	ENST00000441003.2	37	c.8145		11																																																																																			MUC2	-	smart_Cys_knot_C,pfscan_Cys_knot_C	ENSG00000198788		0.647	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	-	0.00	63	0	C	NM_002457		1103846	+1	tier1	-	no_errors	ENST00000441003	ensembl	human	known	74_37	silent	8.33	55	5	SNP	0.003	T
MYBPC2	4606	genome.wustl.edu	37	19	50944200	50944200	+	Silent	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:50944200G>A	ENST00000357701.5	+	8	687	c.636G>A	c.(634-636)ccG>ccA	p.P212P		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	212					cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		GCATCCCCCCGGAGATTTGGG	0.582																																																	0																																										SO:0001819	synonymous_variant	0				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.636G>A	19.37:g.50944200G>A			A1L4G9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P212	ENST00000357701.5	37	c.636	CCDS46152.1	19																																																																																			MYBPC2	-	NULL	ENSG00000086967		0.582	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	HGNC	protein_coding	OTTHUMT00000464751.1	-	0.00	54	0	G	NM_004533		50944200	+1	tier1	-	no_errors	ENST00000357701	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.995	A
MYCBP2	23077	genome.wustl.edu	37	13	77740653	77740653	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr13:77740653C>T	ENST00000544440.2	-	41	6054	c.6037G>A	c.(6037-6039)Gaa>Aaa	p.E2013K	MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000357337.6_Missense_Mutation_p.E2013K|MYCBP2_ENST00000407578.2_Missense_Mutation_p.E2051K					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GGGTCAAATTCGATTGTCATC	0.413																																																	0													120.0	112.0	115.0					13																	77740653		2203	4300	6503	SO:0001583	missense	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.6037G>A	13.37:g.77740653C>T	ENSP00000444596:p.Glu2013Lys			Missense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.E2051K	ENST00000544440.2	37	c.6151		13	.	.	.	.	.	.	.	.	.	.	C	28.8	4.953810	0.92660	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.32988	1.43;1.43;1.43	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.54854	0.1884	M	0.61703	1.905	0.80722	D	1	D	0.63046	0.992	D	0.65443	0.935	T	0.54200	-0.8329	10	0.87932	D	0	.	20.0221	0.97508	0.0:1.0:0.0:0.0	.	2013	O75592	MYCB2_HUMAN	K	2013;2051;2013	ENSP00000349892:E2013K;ENSP00000384288:E2051K;ENSP00000444596:E2013K	ENSP00000349892:E2013K	E	-	1	0	MYCBP2	76638654	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.818000	0.86416	2.732000	0.93576	0.650000	0.86243	GAA	MYCBP2	-	superfamily_ARM-type_fold	ENSG00000005810		0.413	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1		0.00	24	0	C	NM_015057		77740653	-1			no_errors	ENST00000407578	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
MYEOV	26579	genome.wustl.edu	37	11	69063836	69063836	+	Missense_Mutation	SNP	C	C	A	rs147884839		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:69063836C>A	ENST00000308946.3	+	3	1369	c.919C>A	c.(919-921)Ctc>Atc	p.L307I	MYEOV_ENST00000441339.2_Missense_Mutation_p.L307I|MYEOV_ENST00000535407.1_Missense_Mutation_p.L249I	NM_138768.2	NP_620123.2	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	307								p.L307I(3)		endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|urinary_tract(1)	24	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		cctcctcctcctcatcatcat	0.547																																																	3	Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(3)						C	ILE/LEU	0,4394		0,0,2197	34.0	30.0	32.0		919	-1.5	0.0	11	dbSNP_134	32	2,8576		0,2,4287	yes	missense	MYEOV	NM_138768.2	5	0,2,6484	AA,AC,CC		0.0233,0.0,0.0154	benign	307/314	69063836	2,12970	2197	4289	6486	SO:0001583	missense	0			AJ223366	CCDS8190.1, CCDS73340.1	11q13.2	2013-03-27	2013-03-27			ENSG00000172927			7563	protein-coding gene	gene with protein product		605625	"""myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas)"""			10753852	Standard	XM_005273908		Approved	OCIM	uc001oov.3	Q96EZ4		ENST00000308946.3:c.919C>A	11.37:g.69063836C>A	ENSP00000308330:p.Leu307Ile		Q9UGN6|Q9UGN7	Missense_Mutation	SNP	NULL	p.L307I	ENST00000308946.3	37	c.919	CCDS8190.1	11	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.613296	0.00835	0.0	2.33E-4	ENSG00000172927	ENST00000441339;ENST00000308946;ENST00000535407	T;T;T	0.25250	1.81;1.81;1.81	0.761	-1.52	0.08637	.	.	.	.	.	T	0.11922	0.0290	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18147	-1.0346	9	0.87932	D	0	.	6.2599	0.20893	0.6536:0.3464:0.0:0.0	.	307	Q96EZ4	MYEOV_HUMAN	I	307;307;249	ENSP00000412482:L307I;ENSP00000308330:L307I;ENSP00000438100:L249I	ENSP00000308330:L307I	L	+	1	0	MYEOV	68820412	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.000000	0.00653	-2.447000	0.00545	-3.020000	0.00074	CTC	MYEOV	-	NULL	ENSG00000172927		0.547	MYEOV-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	MYEOV	HGNC	protein_coding	OTTHUMT00000396548.1		0.00	25	0	C			69063836	+1			no_errors	ENST00000308946	ensembl	human	known	74_37	missense	13.64	19	3	SNP	0.000	A
MYO10	4651	genome.wustl.edu	37	5	16701589	16701589	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:16701589G>T	ENST00000513610.1	-	25	3369	c.2915C>A	c.(2914-2916)gCt>gAt	p.A972D	MYO10_ENST00000274203.9_Missense_Mutation_p.A329D|MYO10_ENST00000505695.1_Missense_Mutation_p.A311D|MYO10_ENST00000515803.1_Missense_Mutation_p.A311D|MYO10_ENST00000512061.1_5'Flank|MYO10_ENST00000427430.2_Missense_Mutation_p.A329D	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	972					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						TGCGCTCTCAGCCAGCTCGCT	0.587																																																	0													36.0	39.0	38.0					5																	16701589		2120	4238	6358	SO:0001583	missense	0			AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.2915C>A	5.37:g.16701589G>T	ENSP00000421280:p.Ala972Asp		A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_Pleckstrin_homology,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_Ras-assoc,superfamily_P-loop_NTPase,superfamily_FERM_central,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology,prints_Myosin_head_motor_dom	p.A972D	ENST00000513610.1	37	c.2915	CCDS54834.1	5	.	.	.	.	.	.	.	.	.	.	G	4.520	0.096563	0.08681	.	.	ENSG00000145555	ENST00000513610;ENST00000515803;ENST00000274203;ENST00000505695;ENST00000427430	D;T;T;T;T	0.87412	-2.25;1.91;1.91;1.91;1.91	4.66	2.82	0.32997	.	.	.	.	.	T	0.70902	0.3277	N	0.08118	0	0.09310	N	1	B;B	0.23650	0.089;0.013	B;B	0.18871	0.023;0.01	T	0.53373	-0.8448	9	0.10902	T	0.67	.	9.5774	0.39465	0.0782:0.1429:0.7789:0.0	.	613;972	Q69YP8;Q9HD67	.;MYO10_HUMAN	D	972;311;329;311;329	ENSP00000421280:A972D;ENSP00000425051:A311D;ENSP00000274203:A329D;ENSP00000421170:A311D;ENSP00000391106:A329D	ENSP00000274203:A329D	A	-	2	0	MYO10	16754589	0.828000	0.29307	0.007000	0.13788	0.025000	0.11179	3.341000	0.52151	0.377000	0.24735	-0.251000	0.11542	GCT	MYO10	-	NULL	ENSG00000145555		0.587	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO10	HGNC	protein_coding	OTTHUMT00000366167.1		0.00	32	0	G	NM_012334		16701589	-1			no_errors	ENST00000513610	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.011	T
MYO18B	84700	genome.wustl.edu	37	22	26348261	26348261	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr22:26348261G>T	ENST00000407587.2	+	38	6014	c.5845G>T	c.(5845-5847)Gct>Tct	p.A1949S	MYO18B_ENST00000536101.1_Missense_Mutation_p.A1948S|MYO18B_ENST00000335473.7_Missense_Mutation_p.A1948S			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1948	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GCTGCAGGTGGCTCAGATGCG	0.552																																																	0													53.0	57.0	56.0					22																	26348261		2077	4217	6294	SO:0001583	missense	0			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.5845G>T	22.37:g.26348261G>T	ENSP00000386096:p.Ala1949Ser		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1948S	ENST00000407587.2	37	c.5842		22	.	.	.	.	.	.	.	.	.	.	G	16.55	3.155059	0.57259	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.87887	-2.29;-2.29;-2.31	5.49	4.48	0.54585	.	0.325585	0.29940	N	0.010804	D	0.83303	0.5225	L	0.41236	1.265	0.28829	N	0.897246	P;P;P;P	0.45827	0.867;0.578;0.865;0.702	B;B;B;B	0.43838	0.433;0.171;0.421;0.321	T	0.81052	-0.1107	10	0.62326	D	0.03	.	12.7944	0.57551	0.0783:0.0:0.9217:0.0	.	1461;1948;1949;1948	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	S	1948;1948;1949	ENSP00000441229:A1948S;ENSP00000334563:A1948S;ENSP00000386096:A1949S	ENSP00000334563:A1948S	A	+	1	0	MYO18B	24678261	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.337000	0.43947	2.592000	0.87571	0.655000	0.94253	GCT	MYO18B	-	NULL	ENSG00000133454		0.552	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	-	0.00	39	0	G	NM_032608		26348261	+1	tier1	-	no_errors	ENST00000335473	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.999	T
MYOM2	9172	genome.wustl.edu	37	8	2000309	2000309	+	Silent	SNP	C	C	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr8:2000309C>G	ENST00000262113.4	+	3	282	c.141C>G	c.(139-141)tcC>tcG	p.S47S	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	47					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		CCCAGAAGTCCTTGAGTCAGC	0.552																																																	0													205.0	184.0	191.0					8																	2000309		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.141C>G	8.37:g.2000309C>G			Q7Z3Y2	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S47	ENST00000262113.4	37	c.141	CCDS5957.1	8																																																																																			MYOM2	-	NULL	ENSG00000036448		0.552	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	-	0.00	44	0	C	NM_003970		2000309	+1	tier1	-	no_errors	ENST00000262113	ensembl	human	known	74_37	silent	13.51	32	5	SNP	0.000	G
MYT1L	23040	genome.wustl.edu	37	2	1926321	1926321	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:1926321T>C	ENST00000399161.2	-	10	1967	c.1220A>G	c.(1219-1221)gAg>gGg	p.E407G	MYT1L_ENST00000428368.2_Missense_Mutation_p.E407G	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	407					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GTCGTCCCGCTCATGACACCC	0.572																																																	0													68.0	68.0	68.0					2																	1926321		2144	4247	6391	SO:0001583	missense	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1220A>G	2.37:g.1926321T>C	ENSP00000382114:p.Glu407Gly		A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.E407G	ENST00000399161.2	37	c.1220		2	.	.	.	.	.	.	.	.	.	.	T	13.92	2.381381	0.42207	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.54071	0.59;0.59	5.97	4.82	0.62117	.	0.351636	0.36338	N	0.002651	T	0.43100	0.1232	L	0.27053	0.805	0.52099	D	0.999946	P;P	0.52316	0.919;0.952	B;B	0.43916	0.253;0.436	T	0.44236	-0.9341	10	0.87932	D	0	-23.3261	12.0589	0.53550	0.0:0.0669:0.0:0.9331	.	407;407	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	G	407;355;407	ENSP00000382114:E407G;ENSP00000396103:E407G	ENSP00000295067:E355G	E	-	2	0	MYT1L	1905328	1.000000	0.71417	0.275000	0.24674	0.256000	0.26092	3.485000	0.53208	1.090000	0.41315	0.533000	0.62120	GAG	MYT1L	-	NULL	ENSG00000186487		0.572	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	-	0.00	51	0	T	NM_015025		1926321	-1	tier1	-	no_errors	ENST00000399161	ensembl	human	known	74_37	missense	24.07	41	13	SNP	1.000	C
NAA15	80155	genome.wustl.edu	37	4	140291507	140291507	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr4:140291507T>G	ENST00000296543.5	+	15	2219	c.1896T>G	c.(1894-1896)gaT>gaG	p.D632E	NAA15_ENST00000398947.1_Missense_Mutation_p.D632E	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit	632	Interaction with HYPK.|Poly-Asp.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)			NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						atgatgatgatgaggagatag	0.363																																																	0																																										SO:0001583	missense	0			AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	ENST00000296543.5:c.1896T>G	4.37:g.140291507T>G	ENSP00000296543:p.Asp632Glu		D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Missense_Mutation	SNP	pfam_NatA_aux_su,smart_TPR_repeat,pirsf_NatA_aux_su,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D632E	ENST00000296543.5	37	c.1896	CCDS43270.1	4	.	.	.	.	.	.	.	.	.	.	T	10.14	1.269630	0.23221	.	.	ENSG00000164134	ENST00000296543;ENST00000544077;ENST00000398947	T;T	0.38560	1.13;1.13	5.77	3.21	0.36854	.	0.432007	0.24922	N	0.034537	T	0.19406	0.0466	N	0.05510	-0.035	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.08330	-1.0727	10	0.06891	T	0.86	-10.1192	10.3717	0.44058	0.0:0.1373:0.0:0.8627	.	632	Q9BXJ9	NAA15_HUMAN	E	632;506;632	ENSP00000296543:D632E;ENSP00000381920:D632E	ENSP00000296543:D632E	D	+	3	2	NAA15	140510957	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.148000	0.42235	0.402000	0.25451	0.528000	0.53228	GAT	NAA15	-	pirsf_NatA_aux_su	ENSG00000164134		0.363	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAA15	HGNC	protein_coding	OTTHUMT00000267839.2	-	0.00	48	0	T	NM_057175		140291507	+1	tier1	-	no_errors	ENST00000296543	ensembl	human	known	74_37	missense	14.29	48	8	SNP	1.000	G
NAA20	51126	genome.wustl.edu	37	20	20013263	20013263	+	Silent	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr20:20013263G>T	ENST00000334982.4	+	5	698	c.417G>T	c.(415-417)tcG>tcT	p.S139S	NAA20_ENST00000310450.4_Intron|NAA20_ENST00000484480.1_3'UTR|NAA20_ENST00000398602.2_Silent_p.S127S	NM_016100.4	NP_057184.1	P61599	NAA20_HUMAN	N(alpha)-acetyltransferase 20, NatB catalytic subunit	139	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.					cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)			endometrium(3)|lung(2)|prostate(1)	6						AGTACTATTCGGCCAGCAACG	0.438																																																	0													92.0	86.0	88.0					20																	20013263		2203	4300	6503	SO:0001819	synonymous_variant	0			AF085355	CCDS13141.1, CCDS13142.1, CCDS42854.1	20p11.23	2010-05-07	2010-01-14	2010-01-14	ENSG00000173418	ENSG00000173418	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	15908	protein-coding gene	gene with protein product	"""N-acetyltransferase 3 homolog (S. cerevisiae)"""	610833	"""N-acetyltransferase 5, ARD1 subunit (arrest-defective 1, S. cerevisiae, homolog)"", ""N-acetyltransferase 5 (ARD1 homolog, S. cerevisiae)"", ""N-acetyltransferase 5"", ""N-acetyltransferase 5 (GCN5-related, putative)"""	NAT5		12888564, 19660095	Standard	NM_016100		Approved	dJ1002M8.1, NAT3	uc002wrp.3	P61599	OTTHUMG00000031998	ENST00000334982.4:c.417G>T	20.37:g.20013263G>T			A6NHA3|B2R4G4|Q5TFT7|Q9D7H8|Q9H0Y4|Q9NQH6|Q9Y6D2	Silent	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.S139	ENST00000334982.4	37	c.417	CCDS13141.1	20																																																																																			NAA20	-	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000173418		0.438	NAA20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA20	HGNC	protein_coding	OTTHUMT00000078217.2	-	0.00	81	0	G	NM_016100		20013263	+1	tier1	-	no_errors	ENST00000334982	ensembl	human	known	74_37	silent	5.13	74	4	SNP	0.618	T
NAP1L2	4674	genome.wustl.edu	37	X	72433664	72433666	+	In_Frame_Del	DEL	TCC	TCC	-	rs369450592		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chrX:72433664_72433666delTCC	ENST00000373517.3	-	1	1018_1020	c.663_665delGGA	c.(661-666)gaggac>gac	p.E221del	NAP1L2_ENST00000536638.1_In_Frame_Del_p.E79del	NM_021963.3	NP_068798.1	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	221	Glu-rich (acidic).				nucleosome assembly (GO:0006334)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of neuron differentiation (GO:0045666)|regulation of stem cell division (GO:2000035)	nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(12)|skin(3)	29	Renal(35;0.156)					CTCAATGTCGtcctcctcctcct	0.424														95	0.0251656	0.0272	0.0173	3775	,	,		14422	0.0069		0.0089	False		,,,				2504	0.0317																0																																										SO:0001651	inframe_deletion	0			AF136178	CCDS14423.1	Xq13	2008-02-05			ENSG00000186462	ENSG00000186462			7638	protein-coding gene	gene with protein product		300026				8789438	Standard	NM_021963		Approved	BPX, MGC26243	uc004ebi.3	Q9ULW6	OTTHUMG00000021827	ENST00000373517.3:c.663_665delGGA	X.37:g.72433673_72433675delTCC	ENSP00000362616:p.Glu221del		B2RE61|B4E161|Q8TAN6	In_Frame_Del	DEL	pfam_NAP_family	p.E221in_frame_del	ENST00000373517.3	37	c.665_663	CCDS14423.1	X																																																																																			NAP1L2	-	pfam_NAP_family	ENSG00000186462		0.424	NAP1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L2	HGNC	protein_coding	OTTHUMT00000057225.1		0.00	23	0	TCC	NM_021963		72433666	-1	tier1		no_errors	ENST00000373517	ensembl	human	known	74_37	in_frame_del	14.71	29	5	DEL	0.004:0.003:0.000	-
NEDD8	4738	genome.wustl.edu	37	14	24686231	24686231	+	3'UTR	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr14:24686231G>T	ENST00000250495.5	-	0	534				MDP1_ENST00000396833.2_5'Flank|AL136419.6_ENST00000565988.1_RNA|MDP1_ENST00000288087.7_5'Flank|MDP1_ENST00000532557.1_5'Flank|NEDD8-MDP1_ENST00000604306.1_Intron|NEDD8-MDP1_ENST00000534348.1_Intron	NM_006156.2	NP_006147.1	Q15843	NEDD8_HUMAN	neural precursor cell expressed, developmentally down-regulated 8						anatomical structure morphogenesis (GO:0009653)|cellular protein modification process (GO:0006464)|protein localization (GO:0008104)|protein neddylation (GO:0045116)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to organic cyclic compound (GO:0014070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5				GBM - Glioblastoma multiforme(265;0.0186)		ACATTACTGGGCATCCAGGGG	0.532																																																	0																																										SO:0001624	3_prime_UTR_variant	0			D23662	CCDS9621.1	14q11.2	2008-08-13			ENSG00000129559	ENSG00000129559			7732	protein-coding gene	gene with protein product		603171				9353319	Standard	NM_006156		Approved	Nedd-8		Q15843	OTTHUMG00000029325	ENST00000250495.5:c.*102C>A	14.37:g.24686231G>T			Q3SXN8|Q6LES6	RNA	SNP	-	NULL	ENST00000250495.5	37	NULL	CCDS9621.1	14																																																																																			NEDD8	-	-	ENSG00000129559		0.532	NEDD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEDD8	HGNC	protein_coding	OTTHUMT00000073146.2	-	0.00	32	0	G	NM_006156		24686231	-1	tier1	-	no_errors	ENST00000526430	ensembl	human	known	74_37	rna	9.76	37	4	SNP	1.000	T
NEK5	341676	genome.wustl.edu	37	13	52636037	52636037	+	IGR	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr13:52636037C>T	ENST00000355568.4	-	0	2918				NEK5_ENST00000529080.1_5'UTR	NM_199289.1	NP_954983.1	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5						positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of striated muscle cell differentiation (GO:0051155)		ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		GAGCTTCATGCCGCCACTGTT	0.388																																																	0																																										SO:0001628	intergenic_variant	0			BC063885	CCDS31979.1	13q14.2	2012-11-15	2012-11-15		ENSG00000197168	ENSG00000197168			7748	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)-related kinase 5"""			9552363	Standard	XM_006719807		Approved		uc001vge.3	Q6P3R8	OTTHUMG00000016957		13.37:g.52636037C>T			Q5TAP5	RNA	SNP	-	NULL	ENST00000355568.4	37	NULL	CCDS31979.1	13																																																																																			NEK5	-	-	ENSG00000197168		0.388	NEK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK5	HGNC	protein_coding	OTTHUMT00000045045.3	-	0.00	52	0	C	NM_199289		52636037	-1	tier1	-	no_errors	ENST00000529080	ensembl	human	known	74_37	rna	6.45	58	4	SNP	0.001	T
NME7	29922	genome.wustl.edu	37	1	169256597	169256597	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:169256597G>T	ENST00000367811.3	-	7	954	c.698C>A	c.(697-699)aCt>aAt	p.T233N	NME7_ENST00000469474.1_5'UTR|NME7_ENST00000472647.1_Missense_Mutation_p.T197N	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7	233					brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					AAATTTAGCAGTGTTTGCCGG	0.363																																																	0													234.0	231.0	232.0					1																	169256597		2203	4300	6503	SO:0001583	missense	0			AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.698C>A	1.37:g.169256597G>T	ENSP00000356785:p.Thr233Asn		A8K3T6|A8MY09|B3KSW9|Q5TGZ4	Missense_Mutation	SNP	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Uncharacterised_DM10,smart_Nucleoside_diP_kinase,pirsf_NDK7,prints_Nucleoside_diP_kinase	p.T233N	ENST00000367811.3	37	c.698	CCDS1277.1	1	.	.	.	.	.	.	.	.	.	.	G	19.98	3.926446	0.73327	.	.	ENSG00000143156	ENST00000472647;ENST00000367811	T;T	0.57436	0.4;0.4	4.57	4.57	0.56435	.	0.155986	0.56097	D	0.000028	T	0.58104	0.2099	M	0.87682	2.9	0.45718	D	0.998624	D;P	0.54964	0.969;0.644	P;P	0.51193	0.662;0.461	T	0.70575	-0.4834	9	0.87932	D	0	-19.6576	12.6991	0.57020	0.0:0.1671:0.8328:0.0	.	237;233	Q59GR0;Q9Y5B8	.;NDK7_HUMAN	N	197;233	ENSP00000433341:T197N;ENSP00000356785:T233N	ENSP00000356785:T233N	T	-	2	0	NME7	167523221	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.626000	0.54245	2.088000	0.63022	0.637000	0.83480	ACT	NME7	-	pirsf_NDK7	ENSG00000143156		0.363	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME7	HGNC	protein_coding	OTTHUMT00000083688.1	-	0.00	43	0	G	NM_013330		169256597	-1	tier1	-	no_errors	ENST00000367811	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
NOTCH3	4854	genome.wustl.edu	37	19	15302299	15302299	+	Silent	SNP	G	G	A	rs149725987		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:15302299G>A	ENST00000263388.2	-	6	1047	c.972C>T	c.(970-972)ttC>ttT	p.F324F		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	324	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.F324F(1)		breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			TGGCCCCATGGAAGCACACGG	0.597																																																	1	Substitution - coding silent(1)	skin(1)											52.0	42.0	45.0					19																	15302299		2203	4300	6503	SO:0001819	synonymous_variant	0			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.972C>T	19.37:g.15302299G>A			Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.F324	ENST00000263388.2	37	c.972	CCDS12326.1	19																																																																																			NOTCH3	-	pirsf_Notch,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000074181		0.597	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	-	0.00	51	0	G	NM_000435		15302299	-1	tier1	rs149725987	no_errors	ENST00000263388	ensembl	human	known	74_37	silent	20.83	38	10	SNP	1.000	A
NSD1	64324	genome.wustl.edu	37	5	176638912	176638912	+	Missense_Mutation	SNP	G	G	T	rs111638717		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:176638912G>T	ENST00000439151.2	+	5	3557	c.3512G>T	c.(3511-3513)cGt>cTt	p.R1171L	NSD1_ENST00000361032.4_Missense_Mutation_p.R1068L|NSD1_ENST00000354179.4_Missense_Mutation_p.R902L|NSD1_ENST00000347982.4_Missense_Mutation_p.R902L	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1171					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		ACTAAACCTCGTAAGCGCATG	0.458			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0													76.0	71.0	73.0					5																	176638912		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.3512G>T	5.37:g.176638912G>T	ENSP00000395929:p.Arg1171Leu		Q96PD8|Q96RN7	Missense_Mutation	SNP	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.R1171L	ENST00000439151.2	37	c.3512	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	G	13.45	2.241033	0.39598	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.92858	-3.02;-3.02;-3.02;-3.12	4.49	4.49	0.54785	.	0.366954	0.22886	N	0.054456	D	0.83271	0.5218	N	0.19112	0.55	0.24740	N	0.99305	B;B;B	0.27679	0.185;0.185;0.049	B;B;B	0.26094	0.041;0.066;0.018	T	0.70212	-0.4934	9	.	.	.	.	8.649	0.34022	0.1024:0.0:0.8976:0.0	.	902;1068;1171	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	L	902;1171;902;1068	ENSP00000346111:R902L;ENSP00000395929:R1171L;ENSP00000343209:R902L;ENSP00000354310:R1068L	.	R	+	2	0	NSD1	176571518	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.256000	0.51492	2.497000	0.84241	0.655000	0.94253	CGT	NSD1	-	NULL	ENSG00000165671		0.458	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2		0.00	44	0	G	NM_172349		176638912	+1			no_errors	ENST00000439151	ensembl	human	known	74_37	missense	5.71	32	2	SNP	1.000	T
NSD1	64324	genome.wustl.edu	37	5	176719030	176719030	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:176719030G>A	ENST00000439151.2	+	22	6379	c.6334G>A	c.(6334-6336)Gaa>Aaa	p.E2112K	NSD1_ENST00000347982.4_Missense_Mutation_p.E1843K|NSD1_ENST00000361032.4_Missense_Mutation_p.E2009K|NSD1_ENST00000354179.4_Missense_Mutation_p.E1843K	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2112					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GACCCAGGGTGAAATCACAAA	0.478			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0													84.0	69.0	74.0					5																	176719030		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.6334G>A	5.37:g.176719030G>A	ENSP00000395929:p.Glu2112Lys		Q96PD8|Q96RN7	Missense_Mutation	SNP	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.E2112K	ENST00000439151.2	37	c.6334	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.843629	0.97016	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9	5.44	5.44	0.79542	Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000009	D	0.88890	0.6560	L	0.45470	1.425	0.58432	D	0.999996	D;B	0.58970	0.984;0.398	P;B	0.58454	0.839;0.244	D	0.88623	0.3164	10	0.49607	T	0.09	.	19.3518	0.94392	0.0:0.0:1.0:0.0	.	1843;2112	Q96L73-2;Q96L73	.;NSD1_HUMAN	K	1843;2112;1843;2009	ENSP00000346111:E1843K;ENSP00000395929:E2112K;ENSP00000343209:E1843K;ENSP00000354310:E2009K	ENSP00000343209:E1843K	E	+	1	0	NSD1	176651636	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	7.935000	0.87658	2.571000	0.86741	0.650000	0.86243	GAA	NSD1	-	superfamily_Znf_FYVE_PHD	ENSG00000165671		0.478	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2		0.00	54	0	G	NM_172349		176719030	+1			no_errors	ENST00000439151	ensembl	human	known	74_37	missense	6.52	43	3	SNP	1.000	A
NUP153	9972	genome.wustl.edu	37	6	17633076	17633076	+	Splice_Site	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:17633076C>A	ENST00000262077.2	-	17	2464		c.e17-1		NUP153_ENST00000537253.1_Splice_Site	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			ACTGAACTTCCTAAAAAAAAA	0.408																																																	0													25.0	26.0	25.0					6																	17633076		2202	4299	6501	SO:0001630	splice_region_variant	0			Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.2465-1G>T	6.37:g.17633076C>A			B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Splice_Site	SNP	-	e18-1	ENST00000262077.2	37	c.2558-1	CCDS4541.1	6	.	.	.	.	.	.	.	.	.	.	C	13.42	2.232825	0.39498	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3358	0.90287	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NUP153	17741055	1.000000	0.71417	0.901000	0.35422	0.455000	0.32408	4.237000	0.58681	2.419000	0.82065	0.655000	0.94253	.	NUP153	-	-	ENSG00000124789		0.408	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP153	HGNC	protein_coding	OTTHUMT00000039953.1	-	0.00	33	0	C		Intron	17633076	-1	tier1	-	no_errors	ENST00000537253	ensembl	human	known	74_37	splice_site	22.86	27	8	SNP	0.996	A
OR10X1	128367	genome.wustl.edu	37	1	158549213	158549213	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:158549213T>G	ENST00000368150.1	-	1	476	c.477A>C	c.(475-477)caA>caC	p.Q159H		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					AGGCCACAAGTTGTCCACATA	0.453																																																	0													58.0	59.0	59.0					1																	158549213		2203	4300	6503	SO:0001583	missense	0			BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.477A>C	1.37:g.158549213T>G	ENSP00000357132:p.Gln159His		Q6IFR8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q159H	ENST00000368150.1	37	c.477	CCDS30900.1	1	.	.	.	.	.	.	.	.	.	.	T	3.887	-0.024752	0.07589	.	.	ENSG00000186400	ENST00000368150	T	0.00137	8.68	5.0	-5.32	0.02722	GPCR, rhodopsin-like superfamily (1);	0.462899	0.18191	N	0.148813	T	0.00039	0.0001	L	0.56280	1.765	0.09310	N	1	B	0.11235	0.004	B	0.17098	0.017	T	0.44574	-0.9319	10	0.46703	T	0.11	.	8.6313	0.33922	0.2404:0.5706:0.0:0.189	.	159	Q8NGY0	O10X1_HUMAN	H	159	ENSP00000357132:Q159H	ENSP00000357132:Q159H	Q	-	3	2	OR10X1	156815837	0.000000	0.05858	0.067000	0.19924	0.729000	0.41735	-0.496000	0.06436	-0.916000	0.03818	0.455000	0.32223	CAA	OR10X1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000186400		0.453	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10X1	HGNC	protein_coding	OTTHUMT00000051850.2	-	0.00	36	0	T	NM_001004477		158549213	-1	tier1	-	no_errors	ENST00000368150	ensembl	human	known	74_37	missense	15.00	34	6	SNP	0.000	G
OR2C3	81472	genome.wustl.edu	37	1	247695607	247695607	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:247695607G>T	ENST00000366487.3	-	2	568	c.207C>A	c.(205-207)ttC>ttA	p.F69L	GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000366489.1_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			TCATGTCCAGGAAGGGGAGGT	0.512																																																	0													135.0	121.0	125.0					1																	247695607		2203	4300	6503	SO:0001583	missense	0			BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.207C>A	1.37:g.247695607G>T	ENSP00000355443:p.Phe69Leu		Q5JQS4|Q6IEZ1|Q8NGW7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F69L	ENST00000366487.3	37	c.207	CCDS1634.2	1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.605618	0.46527	.	.	ENSG00000196242	ENST00000366487	T	0.00966	5.49	4.04	2.16	0.27623	GPCR, rhodopsin-like superfamily (1);	0.188302	0.25555	N	0.029877	T	0.01061	0.0035	L	0.45051	1.395	0.24466	N	0.99442	B	0.20887	0.049	B	0.17433	0.018	T	0.45131	-0.9282	10	0.38643	T	0.18	.	8.028	0.30448	0.2028:0.0:0.7972:0.0	.	69	Q8N628	OR2C3_HUMAN	L	69	ENSP00000355443:F69L	ENSP00000355443:F69L	F	-	3	2	OR2C3	245762230	0.000000	0.05858	1.000000	0.80357	0.732000	0.41865	-0.387000	0.07361	0.485000	0.27652	-0.142000	0.14014	TTC	OR2C3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000196242		0.512	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2C3	HGNC	protein_coding	OTTHUMT00000097626.2	-	0.00	72	0	G	NM_198074		247695607	-1	tier1	-	no_errors	ENST00000366487	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.998	T
OR2D3	120775	genome.wustl.edu	37	11	6943185	6943185	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:6943185G>T	ENST00000317834.3	+	1	981	c.953G>T	c.(952-954)aGg>aTg	p.R318M		NM_001004684.1	NP_001004684.1	Q8NGH3	OR2D3_HUMAN	olfactory receptor, family 2, subfamily D, member 3	318						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|prostate(3)|skin(1)|stomach(1)	27		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GGGGCTCTCAGGAAACTAGTT	0.403																																																	0													64.0	66.0	65.0					11																	6943185		2201	4296	6497	SO:0001583	missense	0			BK004294	CCDS31417.1	11p15.4	2012-08-09			ENSG00000178358	ENSG00000178358		"""GPCR / Class A : Olfactory receptors"""	15146	protein-coding gene	gene with protein product							Standard	NM_001004684		Approved		uc010rav.2	Q8NGH3	OTTHUMG00000165742	ENST00000317834.3:c.953G>T	11.37:g.6943185G>T	ENSP00000320560:p.Arg318Met		B2RP06|Q6IFG8|Q96R51	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R318M	ENST00000317834.3	37	c.953	CCDS31417.1	11	.	.	.	.	.	.	.	.	.	.	G	3.604	-0.080894	0.07141	.	.	ENSG00000178358	ENST00000317834	T	0.39997	1.05	5.07	-3.41	0.04839	.	0.632596	0.14071	N	0.343367	T	0.42381	0.1200	M	0.88906	2.99	0.09310	N	1	B	0.27416	0.178	B	0.25291	0.059	T	0.46048	-0.9219	10	0.87932	D	0	-1.8422	6.1118	0.20104	0.5054:0.0:0.3703:0.1243	.	318	Q8NGH3	OR2D3_HUMAN	M	318	ENSP00000320560:R318M	ENSP00000320560:R318M	R	+	2	0	OR2D3	6899761	0.000000	0.05858	0.006000	0.13384	0.062000	0.15995	-1.028000	0.03589	-0.772000	0.04602	-0.140000	0.14226	AGG	OR2D3	-	NULL	ENSG00000178358		0.403	OR2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2D3	HGNC	protein_coding	OTTHUMT00000385987.1	-	0.00	56	0	G	NM_001004684		6943185	+1	tier1	-	no_errors	ENST00000317834	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.000	T
OR2M4	26245	genome.wustl.edu	37	1	248403118	248403118	+	Missense_Mutation	SNP	A	A	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:248403118A>C	ENST00000306687.1	+	1	888	c.888A>C	c.(886-888)gaA>gaC	p.E296D		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	296					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GCAACAAAGAAGTGTTCAGGG	0.418																																																	0													70.0	65.0	67.0					1																	248403118		2203	4300	6503	SO:0001583	missense	0			X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.888A>C	1.37:g.248403118A>C	ENSP00000306688:p.Glu296Asp		Q15611|Q8NG82	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E296D	ENST00000306687.1	37	c.888	CCDS31108.1	1	.	.	.	.	.	.	.	.	.	.	a	0.013	-1.620594	0.00828	.	.	ENSG00000171180	ENST00000306687	T	0.37411	1.2	3.34	-4.11	0.03928	.	0.162849	0.28393	N	0.015513	T	0.13372	0.0324	N	0.11560	0.145	0.09310	N	0.99999	B	0.23735	0.09	B	0.23574	0.047	T	0.29397	-1.0013	10	0.12430	T	0.62	.	7.429	0.27115	0.6311:0.1309:0.238:0.0	.	296	Q96R27	OR2M4_HUMAN	D	296	ENSP00000306688:E296D	ENSP00000306688:E296D	E	+	3	2	OR2M4	246469741	0.000000	0.05858	0.046000	0.18839	0.069000	0.16628	-2.278000	0.01159	-1.119000	0.02958	-0.427000	0.05922	GAA	OR2M4	-	prints_GPCR_Rhodpsn	ENSG00000171180		0.418	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M4	HGNC	protein_coding	OTTHUMT00000097352.1	-	0.00	28	0	A	NM_017504		248403118	+1	tier1	-	no_errors	ENST00000306687	ensembl	human	known	74_37	missense	23.53	26	8	SNP	0.462	C
OR2T6	254879	genome.wustl.edu	37	1	248551763	248551763	+	Nonsense_Mutation	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:248551763T>G	ENST00000355728.2	+	1	854	c.854T>G	c.(853-855)tTa>tGa	p.L285*		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	285						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACACCCTTATTAAACCCTCTC	0.463																																																	0													91.0	89.0	90.0					1																	248551763		2203	4300	6503	SO:0001587	stop_gained	0			AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.854T>G	1.37:g.248551763T>G	ENSP00000347965:p.Leu285*		A6NE36	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.L285*	ENST00000355728.2	37	c.854	CCDS31114.1	1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.980776	0.74474	.	.	ENSG00000198104	ENST00000355728	.	.	.	4.2	4.2	0.49525	.	0.000000	0.34906	N	0.003588	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3949	0.60846	0.0:0.0:0.0:1.0	.	.	.	.	X	285	.	ENSP00000347965:L285X	L	+	2	0	OR2T6	246618386	0.894000	0.30519	0.595000	0.28798	0.815000	0.46073	6.783000	0.75078	1.888000	0.54679	0.523000	0.50628	TTA	OR2T6	-	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000198104		0.463	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T6	HGNC	protein_coding	OTTHUMT00000097344.1	-	0.00	39	0	T	NM_001005471		248551763	+1	tier1	-	no_errors	ENST00000355728	ensembl	human	known	74_37	nonsense	33.33	24	12	SNP	0.740	G
OR4C13	283092	genome.wustl.edu	37	11	49974054	49974054	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:49974054T>A	ENST00000555099.1	+	1	112	c.80T>A	c.(79-81)gTt>gAt	p.V27D		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	27						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						ATCATATTTGTTGTGTTTTCT	0.388																																																	0													160.0	151.0	154.0					11																	49974054		2201	4296	6497	SO:0001583	missense	0			AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.80T>A	11.37:g.49974054T>A	ENSP00000452277:p.Val27Asp		A6NJJ3|B9EH30|Q6IF48|Q96R68	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V27D	ENST00000555099.1	37	c.80	CCDS31495.1	11	.	.	.	.	.	.	.	.	.	.	.	9.569	1.120614	0.20877	.	.	ENSG00000258817	ENST00000555099	T	0.00466	7.23	2.95	-3.26	0.05064	.	1.104210	0.07247	U	0.865212	T	0.01320	0.0043	H	0.96576	3.845	0.09310	N	1	P	0.40834	0.73	P	0.47206	0.541	T	0.07424	-1.0773	9	.	.	.	.	8.8484	0.35184	0.0:0.4161:0.0:0.5839	.	27	Q8NGP0	OR4CD_HUMAN	D	27	ENSP00000452277:V27D	.	V	+	2	0	OR4C13	49930630	0.000000	0.05858	0.001000	0.08648	0.249000	0.25844	-0.520000	0.06252	-0.611000	0.05709	0.164000	0.16699	GTT	OR4C13	-	prints_GPCR_Rhodpsn	ENSG00000258817		0.388	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C13	HGNC	protein_coding	OTTHUMT00000391103.1	-	0.00	73	0	T	NM_001001955		49974054	+1	tier1	-	no_errors	ENST00000555099	ensembl	human	known	74_37	missense	11.76	45	6	SNP	0.001	A
OR4C6	219432	genome.wustl.edu	37	11	55433080	55433080	+	Silent	SNP	T	T	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:55433080T>C	ENST00000314259.3	+	1	467	c.438T>C	c.(436-438)gcT>gcC	p.A146A		NM_001004704.1	NP_001004704.1	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C, member 6	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|lung(49)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	71						TAGGAGGGGCTTGGGTGGGGG	0.473																																																	0													91.0	89.0	90.0					11																	55433080		2200	4296	6496	SO:0001819	synonymous_variant	0			CR593785	CCDS31506.1	11q11	2012-08-09			ENSG00000181903	ENSG00000181903		"""GPCR / Class A : Olfactory receptors"""	14743	protein-coding gene	gene with protein product							Standard	NM_001004704		Approved		uc010rik.2	Q8NH72	OTTHUMG00000166800	ENST00000314259.3:c.438T>C	11.37:g.55433080T>C			B2RP11|Q6IFD2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A146	ENST00000314259.3	37	c.438	CCDS31506.1	11																																																																																			OR4C6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181903		0.473	OR4C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C6	HGNC	protein_coding	OTTHUMT00000391504.1	-	0.00	69	0	T	NM_001004704		55433080	+1	tier1	-	no_errors	ENST00000314259	ensembl	human	known	74_37	silent	8.33	55	5	SNP	0.913	C
OR5A2	219981	genome.wustl.edu	37	11	59189883	59189883	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:59189883G>T	ENST00000302040.4	-	1	566	c.544C>A	c.(544-546)Ctc>Atc	p.L182I		NM_001001954.1	NP_001001954.1	Q8NGI9	OR5A2_HUMAN	olfactory receptor, family 5, subfamily A, member 2	182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L182I(1)		large_intestine(3)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	21						ACTGGAGGGAGGTCACAGAAA	0.478																																																	1	Substitution - Missense(1)	lung(1)											102.0	90.0	94.0					11																	59189883		2201	4295	6496	SO:0001583	missense	0			AB065805	CCDS31560.1	11q12.1	2012-08-09			ENSG00000172324	ENSG00000172324		"""GPCR / Class A : Olfactory receptors"""	15249	protein-coding gene	gene with protein product							Standard	NM_001001954		Approved		uc010rkt.2	Q8NGI9	OTTHUMG00000167419	ENST00000302040.4:c.544C>A	11.37:g.59189883G>T	ENSP00000303834:p.Leu182Ile		B9EH21|Q6IFF4|Q96RB0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L182I	ENST00000302040.4	37	c.544	CCDS31560.1	11	.	.	.	.	.	.	.	.	.	.	G	11.75	1.732263	0.30684	.	.	ENSG00000172324	ENST00000302040	T	0.37411	1.2	5.47	3.53	0.40419	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31936	U	0.006840	T	0.24122	0.0584	N	0.04116	-0.275	0.22112	N	0.999359	D	0.55800	0.973	P	0.57009	0.811	T	0.21621	-1.0240	10	0.02654	T	1	.	10.3915	0.44171	0.0:0.1416:0.7015:0.1569	.	182	Q8NGI9	OR5A2_HUMAN	I	182	ENSP00000303834:L182I	ENSP00000303834:L182I	L	-	1	0	OR5A2	58946459	0.000000	0.05858	0.818000	0.32626	0.924000	0.55760	-0.453000	0.06778	0.740000	0.32651	0.585000	0.79938	CTC	OR5A2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000172324		0.478	OR5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5A2	HGNC	protein_coding	OTTHUMT00000394552.1		0.00	37	0	G	NM_001001954		59189883	-1			no_errors	ENST00000302040	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.926	T
OR6M1	390261	genome.wustl.edu	37	11	123676267	123676267	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:123676267G>T	ENST00000309154.2	-	1	828	c.791C>A	c.(790-792)tCa>tAa	p.S264*		NM_001005325.1	NP_001005325.1	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M, member 1	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(2)|skin(5)|urinary_tract(1)	29		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		ATAATCCAGTGAGGAGTTCTG	0.488																																																	0													115.0	107.0	109.0					11																	123676267		2202	4299	6501	SO:0001587	stop_gained	0			AB065762	CCDS31696.1	11q24.1	2012-08-09			ENSG00000196099	ENSG00000196099		"""GPCR / Class A : Olfactory receptors"""	14711	protein-coding gene	gene with protein product							Standard	NM_001005325		Approved		uc010rzz.2	Q8NGM8	OTTHUMG00000166012	ENST00000309154.2:c.791C>A	11.37:g.123676267G>T	ENSP00000311038:p.Ser264*		B2RNK0|Q6IEW9|Q96R37	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S264*	ENST00000309154.2	37	c.791	CCDS31696.1	11	.	.	.	.	.	.	.	.	.	.	G	10.65	1.408500	0.25378	.	.	ENSG00000196099	ENST00000309154	.	.	.	3.48	2.56	0.30785	.	0.000000	0.29205	U	0.012835	.	.	.	.	.	.	0.50467	D	0.999879	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	8.2822	0.31906	0.1223:0.0:0.8777:0.0	.	.	.	.	X	264	.	ENSP00000311038:S264X	S	-	2	0	OR6M1	123181477	0.002000	0.14202	0.001000	0.08648	0.180000	0.23129	1.177000	0.31969	0.642000	0.30620	0.655000	0.94253	TCA	OR6M1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196099		0.488	OR6M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6M1	HGNC	protein_coding	OTTHUMT00000387437.1	-	0.00	59	0	G	NM_001005325		123676267	-1	tier1	-	no_errors	ENST00000309154	ensembl	human	known	74_37	nonsense	19.23	42	10	SNP	0.000	T
OR6Y1	391112	genome.wustl.edu	37	1	158517076	158517076	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:158517076T>A	ENST00000302617.3	-	1	819	c.820A>T	c.(820-822)Aat>Tat	p.N274Y		NM_001005189.1	NP_001005189.1	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y, member 1	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_hematologic(112;0.0378)					TTGTTGGAATTGTAGGCATAC	0.468																																																	0													214.0	199.0	204.0					1																	158517076		2203	4300	6503	SO:0001583	missense	0			BK004192	CCDS30899.1	1q23.1	2012-08-09			ENSG00000197532	ENSG00000197532		"""GPCR / Class A : Olfactory receptors"""	14823	protein-coding gene	gene with protein product				OR6Y2			Standard	NM_001005189		Approved		uc010pil.2	Q8NGX8	OTTHUMG00000019629	ENST00000302617.3:c.820A>T	1.37:g.158517076T>A	ENSP00000304807:p.Asn274Tyr		Q6IFS0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N274Y	ENST00000302617.3	37	c.820	CCDS30899.1	1	.	.	.	.	.	.	.	.	.	.	T	14.96	2.690299	0.48097	.	.	ENSG00000197532	ENST00000302617	T	0.00091	8.74	5.34	5.34	0.76211	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45126	D	0.000396	T	0.00178	0.0005	L	0.58354	1.805	0.09310	N	1	D	0.76494	0.999	D	0.71870	0.975	T	0.25984	-1.0116	10	0.87932	D	0	.	10.1544	0.42814	0.1495:0.0:0.0:0.8504	.	274	Q8NGX8	OR6Y1_HUMAN	Y	274	ENSP00000304807:N274Y	ENSP00000304807:N274Y	N	-	1	0	OR6Y1	156783700	0.000000	0.05858	0.866000	0.34008	0.996000	0.88848	-0.116000	0.10724	2.230000	0.72887	0.533000	0.62120	AAT	OR6Y1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000197532		0.468	OR6Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6Y1	HGNC	protein_coding	OTTHUMT00000051844.1	-	0.00	52	0	T	NM_001005189		158517076	-1	tier1	-	no_errors	ENST00000302617	ensembl	human	known	74_37	missense	24.49	37	12	SNP	0.000	A
OR8H1	219469	genome.wustl.edu	37	11	56058494	56058494	+	Silent	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:56058494C>T	ENST00000313022.2	-	1	72	c.45G>A	c.(43-45)acG>acA	p.T15T		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	15						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					CTGACAGTCCCGTAAGGATGA	0.378																																																	0													108.0	104.0	105.0					11																	56058494		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.45G>A	11.37:g.56058494C>T			B2RNI7|Q6IFC5	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T15	ENST00000313022.2	37	c.45	CCDS31526.1	11																																																																																			OR8H1	-	NULL	ENSG00000181693		0.378	OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H1	HGNC	protein_coding	OTTHUMT00000370019.1		0.00	41	0	C	NM_001005199		56058494	-1			no_errors	ENST00000313022	ensembl	human	known	74_37	silent	8.11	34	3	SNP	0.002	T
PALB2	79728	genome.wustl.edu	37	16	23646351	23646351	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr16:23646351G>T	ENST00000261584.4	-	4	1668	c.1516C>A	c.(1516-1518)Caa>Aaa	p.Q506K		NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	506	DNA-binding (with the preference D loop > dsDNA > ssDNA).				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		CCAGGTGCTTGGGCAACTGCC	0.463			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																															yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	0													154.0	150.0	151.0					16																	23646351		2197	4300	6497	SO:0001583	missense	0				CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.1516C>A	16.37:g.23646351G>T	ENSP00000261584:p.Gln506Lys		A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.Q506K	ENST00000261584.4	37	c.1516	CCDS32406.1	16	.	.	.	.	.	.	.	.	.	.	G	11.97	1.796531	0.31777	.	.	ENSG00000083093	ENST00000261584	T	0.14893	2.47	5.67	2.09	0.27110	.	0.543382	0.17861	N	0.159517	T	0.10637	0.0260	L	0.29908	0.895	0.09310	N	1	B	0.19583	0.037	B	0.18561	0.022	T	0.33904	-0.9850	10	0.07482	T	0.82	-1.5659	11.3015	0.49309	0.0:0.0:0.439:0.561	.	506	Q86YC2	PALB2_HUMAN	K	506	ENSP00000261584:Q506K	ENSP00000261584:Q506K	Q	-	1	0	PALB2	23553852	0.045000	0.20229	0.002000	0.10522	0.086000	0.17979	1.890000	0.39728	0.819000	0.34492	0.655000	0.94253	CAA	PALB2	-	NULL	ENSG00000083093		0.463	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALB2	HGNC	protein_coding	OTTHUMT00000435287.2	-	0.00	91	0	G	NM_024675		23646351	-1	tier1	-	no_errors	ENST00000261584	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.000	T
PCDH15	65217	genome.wustl.edu	37	10	55582052	55582052	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr10:55582052G>A	ENST00000320301.6	-	33	5828	c.5434C>T	c.(5434-5436)Cct>Tct	p.P1812S	PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000361849.3_Missense_Mutation_p.P1814S|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395433.1_Missense_Mutation_p.P1789S|PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395430.1_Missense_Mutation_p.P1809S|PCDH15_ENST00000395432.2_Missense_Mutation_p.P1772S|PCDH15_ENST00000437009.1_Missense_Mutation_p.P1743S	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1812					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				ggaaatggaggtagaagaggt	0.507										HNSCC(58;0.16)																																							0													80.0	69.0	72.0					10																	55582052		2203	4300	6503	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.5434C>T	10.37:g.55582052G>A	ENSP00000322604:p.Pro1812Ser		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P1812S	ENST00000320301.6	37	c.5434	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	G	12.64	1.999365	0.35226	.	.	ENSG00000150275	ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T	0.62788	0.04;0.0;0.06;0.19;0.19;0.16	4.31	2.43	0.29744	.	.	.	.	.	T	0.39809	0.1092	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B;B;B	0.15719	0.003;0.003;0.003;0.003;0.014;0.003;0.003;0.003	B;B;B;B;B;B;B;B	0.10450	0.005;0.005;0.005;0.005;0.005;0.005;0.005;0.005	T	0.22277	-1.0221	9	0.38643	T	0.18	.	3.8924	0.09125	0.2833:0.0:0.5469:0.1698	.	1789;1812;1814;1819;1743;1772;1809;1812	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;Q96QU1	.;.;.;.;.;.;.;PCD15_HUMAN	S	1772;1814;1789;1812;1809;1819;1743	ENSP00000378820:P1772S;ENSP00000354950:P1814S;ENSP00000378821:P1789S;ENSP00000322604:P1812S;ENSP00000378818:P1809S;ENSP00000412628:P1743S	ENSP00000322604:P1812S	P	-	1	0	PCDH15	55252058	0.110000	0.22057	0.002000	0.10522	0.109000	0.19521	1.035000	0.30216	0.539000	0.28788	0.655000	0.94253	CCT	PCDH15	-	NULL	ENSG00000150275		0.507	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2		0.00	27	0	G	NM_033056		55582052	-1			no_errors	ENST00000320301	ensembl	human	known	74_37	missense	33.33	8	4	SNP	0.060	A
PCDHB7	56129	genome.wustl.edu	37	5	140552670	140552670	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:140552670T>G	ENST00000231137.3	+	1	428	c.254T>G	c.(253-255)cTt>cGt	p.L85R		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	85	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L85P(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGATCTACTTCTAAATGAG	0.468																																																	1	Substitution - Missense(1)	endometrium(1)											84.0	88.0	87.0					5																	140552670		2203	4300	6503	SO:0001583	missense	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.254T>G	5.37:g.140552670T>G	ENSP00000231137:p.Leu85Arg		A1L3Y8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L85R	ENST00000231137.3	37	c.254	CCDS4249.1	5	.	.	.	.	.	.	.	.	.	.	T	9.521	1.108348	0.20714	.	.	ENSG00000113212	ENST00000231137	T	0.33216	1.42	4.61	2.17	0.27698	Cadherin, N-terminal (1);Cadherin (1);	.	.	.	.	T	0.48822	0.1521	M	0.89715	3.055	0.09310	N	1	P	0.36647	0.563	P	0.48454	0.578	T	0.49790	-0.8902	9	0.87932	D	0	.	4.3211	0.11018	0.1456:0.1641:0.0:0.6903	.	85	Q9Y5E2	PCDB7_HUMAN	R	85	ENSP00000231137:L85R	ENSP00000231137:L85R	L	+	2	0	PCDHB7	140532854	0.000000	0.05858	0.108000	0.21378	0.404000	0.30871	0.259000	0.18405	0.227000	0.20999	0.533000	0.62120	CTT	PCDHB7	-	pfam_Cadherin_N,superfamily_Cadherin-like,prints_Cadherin	ENSG00000113212		0.468	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	-	0.00	51	0	T	NM_018940		140552670	+1	tier1	-	no_errors	ENST00000231137	ensembl	human	known	74_37	missense	15.56	38	7	SNP	0.004	G
PCDHB8	56128	genome.wustl.edu	37	5	140559406	140559406	+	Silent	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:140559406G>A	ENST00000239444.2	+	1	2036	c.1791G>A	c.(1789-1791)tcG>tcA	p.S597S	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	597	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACGGCGACTCGGGCCAGAACG	0.721																																																	0													6.0	11.0	10.0					5																	140559406		1673	3567	5240	SO:0001819	synonymous_variant	0			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1791G>A	5.37:g.140559406G>A			B9EGV1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S597	ENST00000239444.2	37	c.1791	CCDS4250.1	5																																																																																			PCDHB8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120322		0.721	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	HGNC	protein_coding	OTTHUMT00000251816.2		0.00	191	0	G	NM_019120		140559406	+1			no_errors	ENST00000239444	ensembl	human	known	74_37	silent	7.41	124	10	SNP	0.956	A
PCDHGC3	5098	genome.wustl.edu	37	5	140857013	140857013	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:140857013C>T	ENST00000308177.3	+	1	1434	c.1330C>T	c.(1330-1332)Cgt>Tgt	p.R444C	PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA4_ENST00000571252.1_Intron|RN7SL68P_ENST00000488078.2_RNA|PCDHGA5_ENST00000518069.1_Intron|PCDHGA11_ENST00000518882.1_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	444	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R444C(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACAATAGTGCGTGTTCAAGT	0.522																																																	2	Substitution - Missense(2)	large_intestine(2)											124.0	124.0	124.0					5																	140857013		2203	4300	6503	SO:0001583	missense	0			AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.1330C>T	5.37:g.140857013C>T	ENSP00000312070:p.Arg444Cys		O60622|Q08192|Q9Y5C4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R444C	ENST00000308177.3	37	c.1330	CCDS4261.1	5	.	.	.	.	.	.	.	.	.	.	C	9.017	0.984037	0.18889	.	.	ENSG00000240184	ENST00000308177	T	0.54279	0.58	5.19	0.914	0.19360	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.48095	0.1481	M	0.62209	1.925	0.09310	N	1	P;D	0.57257	0.941;0.979	B;B	0.43360	0.417;0.409	T	0.37384	-0.9708	9	0.38643	T	0.18	.	8.9568	0.35823	0.4851:0.4446:0.0:0.0703	.	444;444	Q9UN70;Q9UN70-2	PCDGK_HUMAN;.	C	444	ENSP00000312070:R444C	ENSP00000312070:R444C	R	+	1	0	PCDHGC3	140837197	0.000000	0.05858	0.134000	0.22075	0.431000	0.31685	0.205000	0.17356	0.362000	0.24319	0.655000	0.94253	CGT	PCDHGC3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000240184		0.522	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGC3	HGNC	protein_coding	OTTHUMT00000251808.2		0.00	74	0	C	NM_002588		140857013	+1			no_errors	ENST00000308177	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.007	T
PDCD11	22984	genome.wustl.edu	37	10	105193741	105193741	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr10:105193741G>T	ENST00000369797.3	+	23	3605	c.3511G>T	c.(3511-3513)Gcc>Tcc	p.A1171S		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	1171	S1 motif 10. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GGTGGAGATTGCCCCAGACAT	0.483																																																	0													120.0	119.0	120.0					10																	105193741		2203	4300	6503	SO:0001583	missense	0			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.3511G>T	10.37:g.105193741G>T	ENSP00000358812:p.Ala1171Ser		Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Suf,superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,smart_HAT,pfscan_TPR-contain_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,prints_Ribosomal_S1	p.A1171S	ENST00000369797.3	37	c.3511	CCDS31276.1	10	.	.	.	.	.	.	.	.	.	.	G	8.769	0.925573	0.18056	.	.	ENSG00000148843	ENST00000369797	T	0.16743	2.32	5.43	2.19	0.27852	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (1);	0.522537	0.22548	N	0.058639	T	0.04588	0.0125	N	0.04335	-0.225	0.22601	N	0.998946	B	0.20550	0.046	B	0.12837	0.008	T	0.40136	-0.9579	10	0.02654	T	1	-2.3854	2.16	0.03822	0.3607:0.0:0.402:0.2373	.	1171	Q14690	RRP5_HUMAN	S	1171	ENSP00000358812:A1171S	ENSP00000358812:A1171S	A	+	1	0	PDCD11	105183731	0.011000	0.17503	0.998000	0.56505	0.992000	0.81027	0.408000	0.21065	1.296000	0.44742	0.462000	0.41574	GCC	PDCD11	-	superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	ENSG00000148843		0.483	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD11	HGNC	protein_coding	OTTHUMT00000050151.1		0.00	86	0	G			105193741	+1			no_errors	ENST00000369797	ensembl	human	known	74_37	missense	7.84	46	4	SNP	0.989	T
PDE7B	27115	genome.wustl.edu	37	6	136468525	136468525	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:136468525A>G	ENST00000308191.6	+	4	506	c.203A>G	c.(202-204)aAg>aGg	p.K68R	RP13-143G15.4_ENST00000591521.1_RNA|RP13-143G15.4_ENST00000417643.1_RNA|RP13-143G15.4_ENST00000585946.1_RNA	NM_018945.3	NP_061818.1	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B	68					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	ACCAAGAAAAAGGTGAAAAGA	0.408																																																	0													111.0	114.0	113.0					6																	136468525		2203	4300	6503	SO:0001583	missense	0			AB038040	CCDS5175.1	6q23-q24	2008-03-18			ENSG00000171408	ENSG00000171408	3.1.4.17	"""Phosphodiesterases"""	8792	protein-coding gene	gene with protein product		604645				10618442	Standard	XM_005266931		Approved		uc003qgp.3	Q9NP56	OTTHUMG00000015641	ENST00000308191.6:c.203A>G	6.37:g.136468525A>G	ENSP00000310661:p.Lys68Arg		Q5W154	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.K68R	ENST00000308191.6	37	c.203	CCDS5175.1	6	.	.	.	.	.	.	.	.	.	.	A	13.84	2.355780	0.41700	.	.	ENSG00000171408	ENST00000308191;ENST00000367787	T	0.69306	-0.39	5.15	5.15	0.70609	.	0.685525	0.14394	N	0.322327	T	0.43100	0.1232	N	0.24115	0.695	0.50467	D	0.999878	D;B	0.56521	0.976;0.011	P;B	0.47206	0.541;0.013	T	0.36311	-0.9753	10	0.11485	T	0.65	.	15.2748	0.73734	1.0:0.0:0.0:0.0	.	120;68	A1E5M1;Q9NP56	.;PDE7B_HUMAN	R	68;204	ENSP00000310661:K68R	ENSP00000310661:K68R	K	+	2	0	PDE7B	136510218	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.676000	0.74498	2.072000	0.62099	0.533000	0.62120	AAG	PDE7B	-	NULL	ENSG00000171408		0.408	PDE7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE7B	HGNC	protein_coding	OTTHUMT00000042371.1	-	0.00	58	0	A			136468525	+1	tier1	-	no_errors	ENST00000308191	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	G
PDZD2	23037	genome.wustl.edu	37	5	32074390	32074390	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:32074390A>G	ENST00000438447.1	+	18	3566	c.3178A>G	c.(3178-3180)Acg>Gcg	p.T1060A	PDZD2_ENST00000282493.3_Missense_Mutation_p.T1060A			O15018	PDZD2_HUMAN	PDZ domain containing 2	1060					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						AGCCAACCTCACGGACTCTGC	0.567																																																	0													101.0	114.0	110.0					5																	32074390		2203	4300	6503	SO:0001583	missense	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.3178A>G	5.37:g.32074390A>G	ENSP00000402033:p.Thr1060Ala		Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.T1060A	ENST00000438447.1	37	c.3178	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	A	9.977	1.227089	0.22542	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.05649	3.41;3.41	5.45	2.2	0.27929	.	0.663319	0.12501	N	0.463395	T	0.04588	0.0125	L	0.36672	1.1	0.09310	N	1	B;B	0.14805	0.011;0.007	B;B	0.12156	0.007;0.004	T	0.45687	-0.9244	10	0.16420	T	0.52	.	3.181	0.06584	0.412:0.405:0.0:0.1829	.	886;1060	B4E3P2;O15018	.;PDZD2_HUMAN	A	1060;862;1060	ENSP00000402033:T1060A;ENSP00000282493:T1060A	ENSP00000282493:T1060A	T	+	1	0	PDZD2	32110147	0.043000	0.20138	0.006000	0.13384	0.001000	0.01503	0.642000	0.24735	0.637000	0.30526	-0.460000	0.05396	ACG	PDZD2	-	NULL	ENSG00000133401		0.567	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	-	0.00	46	0	A			32074390	+1	tier1	-	no_errors	ENST00000282493	ensembl	human	known	74_37	missense	27.50	29	11	SNP	0.001	G
PDZD2	23037	genome.wustl.edu	37	5	32077649	32077649	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:32077649G>T	ENST00000438447.1	+	19	4007	c.3619G>T	c.(3619-3621)Gcc>Tcc	p.A1207S	PDZD2_ENST00000282493.3_Missense_Mutation_p.A1207S			O15018	PDZD2_HUMAN	PDZ domain containing 2	1207					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CCATCTGGATGCCAGCCACCT	0.498																																																	0													108.0	104.0	105.0					5																	32077649		2203	4300	6503	SO:0001583	missense	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.3619G>T	5.37:g.32077649G>T	ENSP00000402033:p.Ala1207Ser		Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A1207S	ENST00000438447.1	37	c.3619	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	G	12.40	1.926402	0.34002	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.06608	3.28;3.28	4.98	-9.97	0.00440	.	0.972277	0.08394	N	0.952434	T	0.04952	0.0133	L	0.44542	1.39	0.09310	N	1	B;B	0.20368	0.044;0.01	B;B	0.18561	0.022;0.021	T	0.37056	-0.9722	10	0.59425	D	0.04	.	8.2572	0.31763	0.3018:0.2876:0.4106:0.0	.	1033;1207	B4E3P2;O15018	.;PDZD2_HUMAN	S	1207;1012;1207	ENSP00000402033:A1207S;ENSP00000282493:A1207S	ENSP00000282493:A1207S	A	+	1	0	PDZD2	32113406	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.446000	0.06837	-2.197000	0.00750	-1.264000	0.01445	GCC	PDZD2	-	NULL	ENSG00000133401		0.498	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1		0.00	33	0	G			32077649	+1			no_errors	ENST00000282493	ensembl	human	known	74_37	missense	10.00	27	3	SNP	0.000	T
PFKL	5211	genome.wustl.edu	37	21	45725224	45725224	+	Intron	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr21:45725224G>T	ENST00000349048.4	+	2	140				PFKL_ENST00000403390.1_Missense_Mutation_p.G5V|PFKL_ENST00000496824.1_Intron	NM_002626.4	NP_002617.3	P17858	PFKAL_HUMAN	phosphofructokinase, liver						carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of insulin secretion (GO:0046676)|protein homotetramerization (GO:0051289)|protein oligomerization (GO:0051259)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|fructose-6-phosphate binding (GO:0070095)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	23				Colorectal(79;0.0811)		TGTAACCAGGGTAGAGGTCGA	0.627											OREG0026250	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													44.0	32.0	36.0					21																	45725224		2197	4298	6495	SO:0001627	intron_variant	0				CCDS33582.1	21q22.3	1992-12-17			ENSG00000141959	ENSG00000141959	2.7.1.11		8876	protein-coding gene	gene with protein product		171860					Standard	NR_024108		Approved		uc002zel.3	P17858	OTTHUMG00000086910	ENST00000349048.4:c.86-1340G>T	21.37:g.45725224G>T		933	Q96A64|Q96IH4|Q9BR91	Missense_Mutation	SNP	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,prints_Phosphofructokinase,tigrfam_6-phosphofructokinase_euk	p.G5V	ENST00000349048.4	37	c.14	CCDS33582.1	21	.	.	.	.	.	.	.	.	.	.	g	10.42	1.345700	0.24426	.	.	ENSG00000141959	ENST00000381188;ENST00000403390	T	0.81415	-1.49	1.8	-1.32	0.09201	.	.	.	.	.	T	0.65657	0.2712	.	.	.	0.09310	N	1	B	0.21821	0.061	B	0.18561	0.022	T	0.55250	-0.8170	8	0.87932	D	0	.	0.7755	0.01031	0.1638:0.2364:0.3594:0.2404	.	5	P17858-2	.	V	8;5	ENSP00000384038:G5V	ENSP00000370584:G8V	G	+	2	0	PFKL	44549652	0.002000	0.14202	0.000000	0.03702	0.021000	0.10359	0.145000	0.16157	-0.402000	0.07633	-0.323000	0.08544	GGT	PFKL	-	pirsf_6-phosphofructokinase_euk	ENSG00000141959		0.627	PFKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKL	HGNC	protein_coding	OTTHUMT00000195805.1	-	0.00	91	0	G			45725224	+1	tier1	-	no_errors	ENST00000403390	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.000	T
PGBD1	84547	genome.wustl.edu	37	6	28264657	28264657	+	Missense_Mutation	SNP	G	G	T	rs150118191		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:28264657G>T	ENST00000405948.2	+	5	1127	c.707G>T	c.(706-708)aGt>aTt	p.S236I	PGBD1_ENST00000259883.3_Missense_Mutation_p.S236I	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	236						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						TCACATCTGAGTCTGACTCGG	0.502																																																	0													116.0	108.0	111.0					6																	28264657		2203	4300	6503	SO:0001583	missense	0			D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.707G>T	6.37:g.28264657G>T	ENSP00000385213:p.Ser236Ile		Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,pfscan_SRCR,pfscan_Tscrpt_reg_SCAN	p.S236I	ENST00000405948.2	37	c.707	CCDS4648.1	6	.	.	.	.	.	.	.	.	.	.	G	11.15	1.553307	0.27739	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.01359	4.98;4.98	4.13	2.3	0.28687	.	1.173980	0.06520	N	0.739490	T	0.00412	0.0013	N	0.24115	0.695	0.09310	N	1	P	0.37015	0.578	B	0.27796	0.083	T	0.46843	-0.9162	10	0.72032	D	0.01	-7.4744	5.6591	0.17658	0.109:0.2002:0.6909:0.0	.	236	Q96JS3	PGBD1_HUMAN	I	236	ENSP00000385213:S236I;ENSP00000259883:S236I	ENSP00000259883:S236I	S	+	2	0	PGBD1	28372636	0.001000	0.12720	0.003000	0.11579	0.807000	0.45602	0.432000	0.21461	0.655000	0.30866	0.655000	0.94253	AGT	PGBD1	-	superfamily_Krueppel-associated_box	ENSG00000137338		0.502	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PGBD1	HGNC	protein_coding	OTTHUMT00000040188.2		0.00	53	0	G			28264657	+1			no_errors	ENST00000259883	ensembl	human	known	74_37	missense	5.77	49	3	SNP	0.004	T
PHTF1	10745	genome.wustl.edu	37	1	114248546	114248546	+	Frame_Shift_Del	DEL	A	A	-	rs201254988		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:114248546delA	ENST00000369604.1	-	13	2120	c.1637delT	c.(1636-1638)ttcfs	p.F546fs	PHTF1_ENST00000369600.1_Frame_Shift_Del_p.F493fs|PHTF1_ENST00000369596.2_Frame_Shift_Del_p.F493fs|PHTF1_ENST00000393357.2_Frame_Shift_Del_p.F546fs|PHTF1_ENST00000369598.1_Frame_Shift_Del_p.F501fs|PHTF1_ENST00000474926.1_5'UTR|PHTF1_ENST00000357783.2_Frame_Shift_Del_p.F546fs			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	546					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACACATCATGAAAAAAAACAT	0.323																																																	0													78.0	74.0	75.0					1																	114248546		2203	4300	6503	SO:0001589	frameshift_variant	0			AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.1637delT	1.37:g.114248546delA	ENSP00000358617:p.Phe546fs		Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Frame_Shift_Del	DEL	pfam_TF_homeodomain_male	p.F546fs	ENST00000369604.1	37	c.1637	CCDS861.1	1																																																																																			PHTF1	-	NULL	ENSG00000116793		0.323	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHTF1	HGNC	protein_coding	OTTHUMT00000032666.1		0.00	28	0	A	NM_006608		114248546	-1	tier1		no_errors	ENST00000369604	ensembl	human	known	74_37	frame_shift_del	6.52	43	3	DEL	1.000	-
PHGDH	26227	genome.wustl.edu	37	1	120277963	120277963	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:120277963G>A	ENST00000369409.4	+	7	825	c.689G>A	c.(688-690)cGt>cAt	p.R230H	PHGDH_ENST00000369407.3_Missense_Mutation_p.R196H	NM_006623.3	NP_006614.2	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase	230					brain development (GO:0007420)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|G1 to G0 transition (GO:0070314)|gamma-aminobutyric acid metabolic process (GO:0009448)|glial cell development (GO:0021782)|glutamine metabolic process (GO:0006541)|glycine metabolic process (GO:0006544)|L-serine biosynthetic process (GO:0006564)|neural tube development (GO:0021915)|neuron projection development (GO:0031175)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|taurine metabolic process (GO:0019530)|threonine metabolic process (GO:0006566)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|phosphoglycerate dehydrogenase activity (GO:0004617)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	18	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)		AAGGGGGTGCGTGTGGTGAAC	0.627																																																	0													113.0	115.0	114.0					1																	120277963		2203	4300	6503	SO:0001583	missense	0			BC011262	CCDS904.1	1p12	2008-02-05			ENSG00000092621	ENSG00000092621	1.1.1.95		8923	protein-coding gene	gene with protein product		606879					Standard	NM_006623		Approved	SERA, PGDH, PDG	uc001ehz.3	O43175	OTTHUMG00000012100	ENST00000369409.4:c.689G>A	1.37:g.120277963G>A	ENSP00000358417:p.Arg230His		B2RD08|Q5SZU3|Q9BQ01	Missense_Mutation	SNP	pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_D-isomer_2_OHA_DH_cat_dom,tigrfam_D-3-Phosphoglycerate_DH	p.R230H	ENST00000369409.4	37	c.689	CCDS904.1	1	.	.	.	.	.	.	.	.	.	.	.	16.94	3.260059	0.59321	.	.	ENSG00000092621	ENST00000369409;ENST00000537497;ENST00000535091;ENST00000369407	T;T	0.80214	-1.35;-1.35	5.23	4.31	0.51392	D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (2);D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain (1);NAD(P)-binding domain (1);	0.166982	0.51477	D	0.000081	T	0.61565	0.2357	M	0.65677	2.01	0.36542	D	0.871366	P;P;P;P;B	0.36647	0.563;0.563;0.563;0.508;0.336	B;B;B;B;B	0.27170	0.077;0.029;0.029;0.063;0.029	T	0.67601	-0.5629	10	0.66056	D	0.02	-7.5781	7.2602	0.26199	0.2598:0.0:0.7402:0.0	.	102;196;196;103;230	Q9UMY2;B3KSC3;Q5SZU1;F5H634;O43175	.;.;.;.;SERA_HUMAN	H	230;103;62;196	ENSP00000358417:R230H;ENSP00000358415:R196H	ENSP00000358415:R196H	R	+	2	0	PHGDH	120079486	1.000000	0.71417	0.778000	0.31720	0.972000	0.66771	3.440000	0.52886	1.211000	0.43351	0.655000	0.94253	CGT	PHGDH	-	pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_D-isomer_2_OHA_DH_cat_dom,tigrfam_D-3-Phosphoglycerate_DH	ENSG00000092621		0.627	PHGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHGDH	HGNC	protein_coding	OTTHUMT00000033464.1	-	0.00	40	0	G	NM_006623		120277963	+1	tier1	-	no_errors	ENST00000369409	ensembl	human	known	74_37	missense	23.53	39	12	SNP	0.882	A
PLA2G6	8398	genome.wustl.edu	37	22	38565366	38565366	+	Missense_Mutation	SNP	C	C	T	rs34482513|rs372291638		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr22:38565366C>T	ENST00000332509.3	-	2	251	c.68G>A	c.(67-69)cGg>cAg	p.R23Q	PLA2G6_ENST00000435484.1_Missense_Mutation_p.R23Q|PLA2G6_ENST00000447598.2_Missense_Mutation_p.R23Q|PLA2G6_ENST00000436218.1_Missense_Mutation_p.R23Q|PLA2G6_ENST00000417303.2_Missense_Mutation_p.R23Q|PLA2G6_ENST00000335539.3_Missense_Mutation_p.R23Q|PLA2G6_ENST00000402064.1_Missense_Mutation_p.R23Q	NM_003560.2	NP_003551.2	O60733	PLPL9_HUMAN	phospholipase A2, group VI (cytosolic, calcium-independent)	23					cardiolipin acyl-chain remodeling (GO:0035965)|cardiolipin biosynthetic process (GO:0032049)|cell death (GO:0008219)|chemotaxis (GO:0006935)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of exocytosis (GO:0045921)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of vasodilation (GO:0045909)|regulation of store-operated calcium channel activity (GO:1901339)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|urinary bladder smooth muscle contraction (GO:0014832)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipase A2 activity (GO:0004623)			breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	24	Melanoma(58;0.045)				Quinacrine(DB01103)	CTCCTTCACCCGGAATGGGTT	0.602																																																	0								C	GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	86.0	70.0	76.0		68,68,68	4.6	1.0	22		76	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	PLA2G6	NM_001004426.1,NM_001199562.1,NM_003560.2	43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	23/753,23/753,23/807	38565366	1,13005	2203	4300	6503	SO:0001583	missense	0			AF064594	CCDS13967.1, CCDS33645.1	22q13.1	2013-01-10			ENSG00000184381	ENSG00000184381	3.1.1.4	"""Patatin-like phospholipase domain containing"", ""Parkinson disease"", ""Ankyrin repeat domain containing"""	9039	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 2"""	603604				9417066, 16799181, 19029121	Standard	NM_001199562		Approved	iPLA2, PNPLA9, PARK14, iPLA2beta, NBIA2	uc003aux.1	O60733	OTTHUMG00000151246	ENST00000332509.3:c.68G>A	22.37:g.38565366C>T	ENSP00000333142:p.Arg23Gln		A8K597|B0QYE8|O75645|Q8N452|Q9UG29|Q9UIT0|Q9Y671	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Patatin/PLipase_A2-rel,superfamily_Ankyrin_rpt-contain_dom,superfamily_Acyl_Trfase/lysoPLipase,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R23Q	ENST00000332509.3	37	c.68	CCDS13967.1	22	.	.	.	.	.	.	.	.	.	.	C	26.8	4.773205	0.90108	0.0	1.16E-4	ENSG00000184381	ENST00000332509;ENST00000419848;ENST00000335539;ENST00000402064;ENST00000335538;ENST00000396860;ENST00000451461;ENST00000430886;ENST00000455341	T;T;T;T;T	0.78364	-0.01;0.04;0.04;1.01;-1.17	4.63	4.63	0.57726	.	0.063173	0.64402	D	0.000005	T	0.80565	0.4647	L	0.29908	0.895	0.29341	N	0.86603	D;D;D	0.69078	0.99;0.997;0.989	P;D;P	0.69479	0.629;0.964;0.621	T	0.76473	-0.2946	10	0.48119	T	0.1	-26.5384	14.3905	0.66975	0.0:1.0:0.0:0.0	.	23;23;23	B7Z6K3;O60733-2;O60733	.;.;PA2G6_HUMAN	Q	23	ENSP00000333142:R23Q;ENSP00000335149:R23Q;ENSP00000386100:R23Q;ENSP00000395464:R23Q;ENSP00000393761:R23Q	ENSP00000333142:R23Q	R	-	2	0	PLA2G6	36895312	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.826000	0.62715	2.128000	0.65567	0.555000	0.69702	CGG	PLA2G6	-	NULL	ENSG00000184381		0.602	PLA2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G6	HGNC	protein_coding	OTTHUMT00000321860.1	-	0.00	31	0	C	NM_001004426		38565366	-1	tier1	-	no_errors	ENST00000332509	ensembl	human	known	74_37	missense	31.58	13	6	SNP	1.000	T
PPP1R14D	54866	genome.wustl.edu	37	15	41120652	41120652	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr15:41120652C>A	ENST00000299174.5	-	1	255	c.188G>T	c.(187-189)cGg>cTg	p.R63L	PPP1R14D_ENST00000427255.2_Missense_Mutation_p.R63L	NM_017726.7	NP_060196.1	Q9NXH3	PP14D_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 14D	63					regulation of phosphorylation (GO:0042325)	cytoplasm (GO:0005737)	protein phosphatase inhibitor activity (GO:0004864)			breast(1)|large_intestine(2)|lung(2)|skin(1)	6		all_cancers(109;6.29e-14)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.88e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		GAGCTGGCCCCGGTCATACTT	0.592																																																	0													71.0	73.0	72.0					15																	41120652		2203	4300	6503	SO:0001583	missense	0			AK000258	CCDS10066.1, CCDS45230.1	15q11.2-q14	2012-04-17			ENSG00000166143	ENSG00000166143		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14953	protein-coding gene	gene with protein product	"""gut and brain phosphatase inhibitor 1"", ""PKC-dependent PP1 inhibitory protein"""	613256				11948623	Standard	NM_017726		Approved	CPI17-like, FLJ20251, GBPI-1, MGC119014, MGC119016	uc001zmz.3	Q9NXH3	OTTHUMG00000130064	ENST00000299174.5:c.188G>T	15.37:g.41120652C>A	ENSP00000299174:p.Arg63Leu		Q4V773	Missense_Mutation	SNP	pfam_PP1_inhibitor,superfamily_PP1_inhibitor	p.R63L	ENST00000299174.5	37	c.188	CCDS10066.1	15	.	.	.	.	.	.	.	.	.	.	C	13.92	2.380270	0.42207	.	.	ENSG00000166143	ENST00000299174;ENST00000427255	.	.	.	5.58	-0.197	0.13228	.	0.462653	0.18342	N	0.144154	T	0.54515	0.1863	M	0.69358	2.11	0.32805	D	0.50065	B;B	0.15930	0.015;0.011	B;B	0.20184	0.013;0.028	T	0.61357	-0.7079	9	0.52906	T	0.07	-6.0977	13.858	0.63542	0.6671:0.3329:0.0:0.0	.	63;63	E9PAT1;Q9NXH3	.;PP14D_HUMAN	L	63	.	ENSP00000299174:R63L	R	-	2	0	PPP1R14D	38907944	0.005000	0.15991	0.985000	0.45067	0.773000	0.43773	-0.309000	0.08145	0.009000	0.14813	-0.188000	0.12872	CGG	PPP1R14D	-	pfam_PP1_inhibitor,superfamily_PP1_inhibitor	ENSG00000166143		0.592	PPP1R14D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R14D	HGNC	protein_coding	OTTHUMT00000252355.2	-	0.00	78	0	C	NM_017726		41120652	-1	tier1	-	no_errors	ENST00000427255	ensembl	human	known	74_37	missense	21.15	41	11	SNP	0.987	A
PPP2R5C	5527	genome.wustl.edu	37	14	102378890	102378891	+	Intron	INS	-	-	G	rs397800575|rs58436253	byFrequency	TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr14:102378890_102378891insG	ENST00000334743.5	+	12	1374				PPP2R5C_ENST00000328724.5_Intron|PPP2R5C_ENST00000422945.2_Intron|PPP2R5C_ENST00000445439.3_3'UTR|PPP2R5C_ENST00000350249.3_Intron	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma						DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						GTCTTCACCATGGGGGGGGTCT	0.361													GGGGGGGG|GGGGGGGG|GGGGGGGGG|insertion	795	0.158746	0.3419	0.0865	5008	,	,		17352	0.0119		0.1103	False		,,,				2504	0.1636																0																																										SO:0001627	intron_variant	0			L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.1326+80->G	14.37:g.102378898_102378898dupG			B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	RNA	INS	-	NULL	ENST00000334743.5	37	NULL	CCDS9964.1	14																																																																																			PPP2R5C	-	-	ENSG00000078304		0.361	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5C	HGNC	protein_coding	OTTHUMT00000414373.2		0.00	16	0	-	NM_002719		102378891	+1	tier1		no_errors	ENST00000556218	ensembl	human	known	74_37	rna	22.22	14	4	INS	0.000:0.000	G
PRB4	5545	genome.wustl.edu	37	12	11462332	11462332	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:11462332G>T	ENST00000535904.1	-	2	105	c.72C>A	c.(70-72)agC>agA	p.S24R	PRB4_ENST00000279575.1_Missense_Mutation_p.S24R|PRB4_ENST00000445719.2_Missense_Mutation_p.S24R			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	24						extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						ATTCTTCCTGGCTGACATCTA	0.393										HNSCC(22;0.051)																																							0													175.0	152.0	160.0					12																	11462332		2203	4300	6503	SO:0001583	missense	0				CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.72C>A	12.37:g.11462332G>T	ENSP00000442834:p.Ser24Arg		A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	NULL	p.S24R	ENST00000535904.1	37	c.72	CCDS8641.1	12	.	.	.	.	.	.	.	.	.	.	.	3.447	-0.112871	0.06881	.	.	ENSG00000230657	ENST00000279575;ENST00000535904;ENST00000445719	T;T;T	0.05025	3.51;3.51;3.51	1.11	-1.12	0.09808	.	.	.	.	.	T	0.06096	0.0158	L	0.59436	1.845	0.09310	N	1	B	0.27192	0.171	B	0.18561	0.022	T	0.35549	-0.9784	9	0.72032	D	0.01	.	2.6078	0.04882	0.2299:0.3115:0.4586:0.0	.	24	E9PAL0	.	R	24	ENSP00000279575:S24R;ENSP00000442834:S24R;ENSP00000412740:S24R	ENSP00000279575:S24R	S	-	3	2	PRB4	11353599	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.035000	0.12205	-0.421000	0.07416	-2.053000	0.00404	AGC	PRB4	-	NULL	ENSG00000230657		0.393	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRB4	HGNC	protein_coding	OTTHUMT00000402308.1	-	0.00	86	0	G	NM_002723		11462332	-1	tier1	-	no_errors	ENST00000279575	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.000	T
PRIM1	5557	genome.wustl.edu	37	12	57127930	57127930	+	Splice_Site	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:57127930C>T	ENST00000338193.6	-	12	1280		c.e12+1			NM_000946.2	NP_000937.1	P49642	PRI1_HUMAN	primase, DNA, polypeptide 1 (49kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			kidney(1)|lung(6)|prostate(1)	8						TAGCGTCTTACCACTCTTCTT	0.348																																																	0													86.0	84.0	85.0					12																	57127930		1817	4074	5891	SO:0001630	splice_region_variant	0			BC005266	CCDS44926.1	12q13.3	2007-06-19	2007-06-19			ENSG00000198056			9369	protein-coding gene	gene with protein product		176635				8530050	Standard	NM_000946		Approved		uc001smd.3	P49642	OTTHUMG00000170034	ENST00000338193.6:c.1243+1G>A	12.37:g.57127930C>T				Splice_Site	SNP	-	e12+1	ENST00000338193.6	37	c.1243+1	CCDS44926.1	12	.	.	.	.	.	.	.	.	.	.	C	16.13	3.036736	0.54896	.	.	ENSG00000198056	ENST00000537418;ENST00000338193	.	.	.	4.34	4.34	0.51931	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7191	0.57131	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRIM1	55414197	1.000000	0.71417	1.000000	0.80357	0.580000	0.36256	4.882000	0.63121	2.726000	0.93360	0.585000	0.79938	.	PRIM1	-	-	ENSG00000198056		0.348	PRIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRIM1	HGNC	protein_coding	OTTHUMT00000406956.1	-	0.00	33	0	C	NM_000946	Intron	57127930	-1	tier1	-	no_errors	ENST00000338193	ensembl	human	known	74_37	splice_site	8.70	42	4	SNP	1.000	T
PRKACG	5568	genome.wustl.edu	37	9	71628850	71628850	+	Silent	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:71628850G>T	ENST00000377276.2	-	1	189	c.159C>A	c.(157-159)ggC>ggA	p.G53G		NM_002732.3	NP_002723.2	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic, gamma	53	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|male gonad development (GO:0008584)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						GCCCGAAGGAGCCCATGCCCA	0.592																																					Esophageal Squamous(110;2236 2623 32146)												0													109.0	100.0	103.0					9																	71628850		2203	4300	6503	SO:0001819	synonymous_variant	0			M34182	CCDS6625.1	9q13	2012-10-02			ENSG00000165059	ENSG00000165059	2.7.11.1		9382	protein-coding gene	gene with protein product		176893				2342480, 9598317	Standard	NM_002732		Approved	PKACg	uc004agy.3	P22612	OTTHUMG00000019974	ENST00000377276.2:c.159C>A	9.37:g.71628850G>T			O60850|Q5VZ02|Q86YI1	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G53	ENST00000377276.2	37	c.159	CCDS6625.1	9																																																																																			PRKACG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000165059		0.592	PRKACG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKACG	HGNC	protein_coding	OTTHUMT00000052559.1	-	0.00	58	0	G			71628850	-1	tier1	-	no_errors	ENST00000377276	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.974	T
PROX1	5629	genome.wustl.edu	37	1	214170645	214170645	+	Missense_Mutation	SNP	A	A	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:214170645A>C	ENST00000366958.4	+	2	1375	c.767A>C	c.(766-768)aAg>aCg	p.K256T	PROX1_ENST00000498508.2_Missense_Mutation_p.K256T|PROX1_ENST00000261454.4_Missense_Mutation_p.K256T|PROX1_ENST00000435016.1_Missense_Mutation_p.K256T	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	256					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		CTGCAGGAAAAGTTCTACCAA	0.532																																																	0													48.0	49.0	49.0					1																	214170645		2203	4300	6503	SO:0001583	missense	0			U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.767A>C	1.37:g.214170645A>C	ENSP00000355925:p.Lys256Thr		A6NK29|A8K2B1|Q5SW76|Q8TB91	Missense_Mutation	SNP	pfam_Homeo_prospero_dom,superfamily_Homeodomain-like	p.K256T	ENST00000366958.4	37	c.767	CCDS31021.1	1	.	.	.	.	.	.	.	.	.	.	A	16.27	3.075712	0.55646	.	.	ENSG00000117707	ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.36054	0.0953	M	0.65498	2.005	0.80722	D	1	B	0.31655	0.334	B	0.43155	0.41	T	0.13202	-1.0518	10	0.62326	D	0.03	-6.8127	16.05	0.80749	1.0:0.0:0.0:0.0	.	256	Q92786	PROX1_HUMAN	T	256	ENSP00000420283:K256T;ENSP00000355925:K256T;ENSP00000400694:K256T;ENSP00000261454:K256T	ENSP00000261454:K256T	K	+	2	0	PROX1	212237268	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.339000	0.96797	2.263000	0.75096	0.533000	0.62120	AAG	PROX1	-	pfam_Homeo_prospero_dom	ENSG00000117707		0.532	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROX1	HGNC	protein_coding	OTTHUMT00000089727.6	-	0.00	21	0	A	NM_002763		214170645	+1	tier1	-	no_errors	ENST00000261454	ensembl	human	known	74_37	missense	25.00	15	5	SNP	1.000	C
PSAT1	29968	genome.wustl.edu	37	9	80921272	80921272	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:80921272C>G	ENST00000376588.3	+	5	508	c.440C>G	c.(439-441)tCc>tGc	p.S147C	PSAT1_ENST00000347159.2_Missense_Mutation_p.S147C	NM_058179.2	NP_478059.1	Q9Y617	SERC_HUMAN	phosphoserine aminotransferase 1	147					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-serine biosynthetic process (GO:0006564)|pyridoxine biosynthetic process (GO:0008615)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	O-phospho-L-serine:2-oxoglutarate aminotransferase activity (GO:0004648)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	20						CCAGATGCCTCCTACGTGTAT	0.448																																					Colon(34;187 791 10662 18313 37609)												0													280.0	261.0	267.0					9																	80921272		2203	4300	6503	SO:0001583	missense	0			BC004863	CCDS6659.1, CCDS6660.1	9q21.2	2008-08-11			ENSG00000135069	ENSG00000135069			19129	protein-coding gene	gene with protein product		610936				12633500, 3651428	Standard	NM_058179		Approved	PSA	uc004ala.3	Q9Y617	OTTHUMG00000020066	ENST00000376588.3:c.440C>G	9.37:g.80921272C>G	ENSP00000365773:p.Ser147Cys		Q5T7G5|Q5T7G6|Q96AW2|Q9BQ12	Missense_Mutation	SNP	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase,pirsf_Pser_aminoTfrase,tigrfam_Pser_aminoTfrase_subgr	p.S147C	ENST00000376588.3	37	c.440	CCDS6660.1	9	.	.	.	.	.	.	.	.	.	.	C	23.1	4.379362	0.82682	.	.	ENSG00000135069	ENST00000347159;ENST00000376588	D;D	0.87179	-2.22;-2.22	5.85	5.85	0.93711	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.000000	0.85682	D	0.000000	D	0.94335	0.8179	M	0.83012	2.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.983;0.999	D	0.94245	0.7488	10	0.72032	D	0.01	-16.709	20.1634	0.98142	0.0:1.0:0.0:0.0	.	147;147	Q9Y617-2;Q9Y617	.;SERC_HUMAN	C	147	ENSP00000317606:S147C;ENSP00000365773:S147C	ENSP00000317606:S147C	S	+	2	0	PSAT1	80111092	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	7.487000	0.81328	2.773000	0.95371	0.655000	0.94253	TCC	PSAT1	-	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase,pirsf_Pser_aminoTfrase,tigrfam_Pser_aminoTfrase_subgr	ENSG00000135069		0.448	PSAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSAT1	HGNC	protein_coding	OTTHUMT00000052777.1	-	0.00	59	0	C	NM_021154		80921272	+1	tier1	-	no_errors	ENST00000376588	ensembl	human	known	74_37	missense	30.61	34	15	SNP	1.000	G
PTPN22	26191	genome.wustl.edu	37	1	114377580	114377580	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:114377580G>T	ENST00000359785.5	-	14	1981	c.1846C>A	c.(1846-1848)Cca>Aca	p.P616T	PTPN22_ENST00000420377.2_Missense_Mutation_p.P616T|PTPN22_ENST00000525799.1_Missense_Mutation_p.P489T|PTPN22_ENST00000528414.1_Missense_Mutation_p.P561T|PTPN22_ENST00000538253.1_Missense_Mutation_p.P372T|PTPN22_ENST00000460620.1_Intron	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	616					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACAGGAAGTGGAGGGGGGATT	0.378																																																	0													115.0	117.0	117.0					1																	114377580		2203	4300	6503	SO:0001583	missense	0			AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.1846C>A	1.37:g.114377580G>T	ENSP00000352833:p.Pro616Thr		A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Non-rcpt_Tyr_Pase_8/22,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.P616T	ENST00000359785.5	37	c.1846	CCDS863.1	1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.410881	0.83340	.	.	ENSG00000134242	ENST00000359785;ENST00000528414;ENST00000538253;ENST00000420377;ENST00000525799;ENST00000354605	T;T;T;T;T	0.59083	2.74;2.38;0.29;2.51;1.82	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000017	T	0.72542	0.3473	M	0.74258	2.255	0.52501	D	0.999954	D;D;D;D;D;D	0.89917	1.0;0.999;0.979;1.0;0.99;0.996	D;D;P;D;D;P	0.91635	0.999;0.927;0.826;0.998;0.916;0.89	T	0.74777	-0.3550	10	0.87932	D	0	.	17.1237	0.86709	0.0:0.0:1.0:0.0	.	372;489;616;561;616;616	F5H2S8;E9PPI1;E9PMT0;E9PLD8;G5E984;Q9Y2R2	.;.;.;.;.;PTN22_HUMAN	T	616;561;372;616;489;616	ENSP00000352833:P616T;ENSP00000435176:P561T;ENSP00000439372:P372T;ENSP00000388229:P616T;ENSP00000432674:P489T	ENSP00000346621:P616T	P	-	1	0	PTPN22	114179103	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.410000	0.66381	2.779000	0.95612	0.655000	0.94253	CCA	PTPN22	-	pirsf_Non-rcpt_Tyr_Pase_8/22	ENSG00000134242		0.378	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN22	HGNC	protein_coding	OTTHUMT00000033015.1	-	0.00	61	0	G	NM_015967		114377580	-1	tier1	-	no_errors	ENST00000359785	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
PTPRQ	374462	genome.wustl.edu	37	12	81063245	81063246	+	Splice_Site	INS	-	-	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:81063245_81063246insA	ENST00000266688.5	+	46	6441		c.e46+2					Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q						regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						ATTGAAAGGGTAAAAAAAAAAG	0.332																																																	0																																										SO:0001630	splice_region_variant	0			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.6441+2->A	12.37:g.81063255_81063255dupA				Splice_Site	INS	-	e46+2	ENST00000266688.5	37	c.6441+2_6441+1		12																																																																																			PTPRQ	-	-	ENSG00000139304		0.332	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding			0.00	33	0	-	NM_001145026	Intron	81063246	+1	tier1		no_errors	ENST00000266688	ensembl	human	known	74_37	splice_site_ins	14.81	23	4	INS	1.000:1.000	A
PTPRQ	374462	genome.wustl.edu	37	12	80935615	80935615	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:80935615G>A	ENST00000266688.5	+	26	3424	c.3424G>A	c.(3424-3426)Gaa>Aaa	p.E1142K				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1188	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)	p.E1142K(1)		breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						CATCAAGACTGAAGAAGATGG	0.323																																																	1	Substitution - Missense(1)	skin(1)											7.0	6.0	6.0					12																	80935615		682	1552	2234	SO:0001583	missense	0			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.3424G>A	12.37:g.80935615G>A	ENSP00000266688:p.Glu1142Lys			Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.E1142K	ENST00000266688.5	37	c.3424		12	.	.	.	.	.	.	.	.	.	.	G	12.08	1.829807	0.32329	.	.	ENSG00000139304	ENST00000266688	T	0.52754	0.65	5.77	4.86	0.63082	Fibronectin, type III (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.31575	0.0801	.	.	.	0.32938	D	0.518047	P	0.40578	0.722	B	0.39185	0.293	T	0.27502	-1.0072	8	0.06891	T	0.86	.	15.0175	0.71597	0.0:0.1418:0.8581:0.0	.	1188	Q9UMZ3	PTPRQ_HUMAN	K	1142	ENSP00000266688:E1142K	ENSP00000266688:E1142K	E	+	1	0	PTPRQ	79459746	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.968000	0.63728	1.404000	0.46819	0.655000	0.94253	GAA	PTPRQ	-	superfamily_Fibronectin_type3	ENSG00000139304		0.323	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding			0.00	27	0	G	NM_001145026		80935615	+1			no_errors	ENST00000266688	ensembl	human	known	74_37	missense	8.33	22	2	SNP	1.000	A
PXDN	7837	genome.wustl.edu	37	2	1668815	1668815	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:1668815G>T	ENST00000252804.4	-	11	1373	c.1323C>A	c.(1321-1323)gaC>gaA	p.D441E	PXDN_ENST00000483018.1_5'Flank	NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	441	Ig-like C2-type 3.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		TAACGACTCTGTCCTGAGGCG	0.547																																																	0													47.0	50.0	49.0					2																	1668815		1948	4151	6099	SO:0001583	missense	0			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.1323C>A	2.37:g.1668815G>T	ENSP00000252804:p.Asp441Glu		A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.D441E	ENST00000252804.4	37	c.1323	CCDS46221.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.69|15.69	2.908682|2.908682	0.52439|0.52439	.|.	.|.	ENSG00000130508|ENSG00000130508	ENST00000252804|ENST00000433670	T|.	0.68765|.	-0.35|.	5.55|5.55	3.74|3.74	0.42951|0.42951	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.271361|.	0.41097|.	D|.	0.000952|.	T|T	0.70124|0.70124	0.3188|0.3188	M|M	0.69823|0.69823	2.125|2.125	0.42171|0.42171	D|D	0.99164|0.99164	P;P|.	0.39696|.	0.538;0.683|.	P;P|.	0.53593|.	0.492;0.73|.	T|T	0.70622|0.70622	-0.4821|-0.4821	10|5	0.66056|.	D|.	0.02|.	-49.9523|-49.9523	11.7026|11.7026	0.51579|0.51579	0.1428:0.0:0.8572:0.0|0.1428:0.0:0.8572:0.0	.|.	441;441|.	Q92626-2;Q92626|.	.;PXDN_HUMAN|.	E|K	441|437	ENSP00000252804:D441E|.	ENSP00000252804:D441E|.	D|T	-|-	3|2	2|0	PXDN|PXDN	1647822|1647822	1.000000|1.000000	0.71417|0.71417	0.149000|0.149000	0.22428|0.22428	0.104000|0.104000	0.19210|0.19210	2.883000|2.883000	0.48554|0.48554	1.339000|1.339000	0.45563|0.45563	0.563000|0.563000	0.77884|0.77884	GAC|ACA	PXDN	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000130508		0.547	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDN	HGNC	protein_coding	OTTHUMT00000322505.1	-	0.00	76	0	G	XM_056455		1668815	-1	tier1	-	no_errors	ENST00000252804	ensembl	human	known	74_37	missense	30.14	51	22	SNP	1.000	T
RABL6	55684	genome.wustl.edu	37	9	139734633	139734635	+	In_Frame_Del	DEL	AGA	AGA	-	rs571278001|rs145591109		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	AGA	AGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:139734633_139734635delAGA	ENST00000311502.7	+	14	2194_2196	c.1958_1960delAGA	c.(1957-1962)gagaag>gag	p.K660del	RABL6_ENST00000357466.2_Intron|RABL6_ENST00000371675.3_In_Frame_Del_p.K545del|RABL6_ENST00000432842.2_3'UTR|RABL6_ENST00000371663.4_In_Frame_Del_p.K661del			Q3YEC7	RABL6_HUMAN	RAB, member RAS oncogene family-like 6	660	Interaction with CDKN2A.|Lys-rich.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										CCCTCTaaggagaagaagaagaa	0.571																																																	0									,	149,3501		4,141,1680					,	2.6	1.0		dbSNP_134	65	433,7429		12,409,3510	no	coding,coding	C9orf86	NM_024718.4,NM_001173988.1	,	16,550,5190	A1A1,A1R,RR		5.5075,4.0822,5.0556	,	,		582,10930				SO:0001651	inframe_deletion	0			AK094382	CCDS48058.1, CCDS55352.1, CCDS55353.1	9q34.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000196642	ENSG00000196642			24703	protein-coding gene	gene with protein product	"""Rab-like protein 1"", ""partner of ARF"""	610615	"""chromosome 9 open reading frame 86"""	C9orf86		14702039, 16582619, 17962191, 19433581	Standard	NM_024718		Approved	FLJ10101, FLJ13045, pp8875, bA216L13.9, Parf, RBEL1	uc004cjj.1	Q3YEC7	OTTHUMG00000020947	ENST00000311502.7:c.1958_1960delAGA	9.37:g.139734642_139734644delAGA	ENSP00000311134:p.Lys660del		A8QVZ7|A8QVZ8|C6K8I4|C6K8I5|Q4F968|Q5T5R7|Q8IWK1|Q8TCL4|Q8WU94|Q96SR8|Q9BU21|Q9H935	In_Frame_Del	DEL	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Rab_type,prints_Small_GTPase	p.K658in_frame_del	ENST00000311502.7	37	c.1961_1963	CCDS48058.1	9																																																																																			RABL6	-	NULL	ENSG00000196642		0.571	RABL6-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	RABL6	HGNC	protein_coding	OTTHUMT00000055141.4		0.00	40	0	AGA	NM_024718		139734635	+1	tier1		no_errors	ENST00000371663	ensembl	human	known	74_37	in_frame_del	19.44	29	7	DEL	1.000:1.000:1.000	-
RAD54B	25788	genome.wustl.edu	37	8	95390589	95390589	+	Silent	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr8:95390589G>T	ENST00000336148.5	-	14	2458	c.2334C>A	c.(2332-2334)atC>atA	p.I778I		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	778	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			GCCTTTGATAGATCTTTTCTT	0.323								Direct reversal of damage;Homologous recombination																																									0													76.0	67.0	70.0					8																	95390589		2203	4300	6503	SO:0001819	synonymous_variant	0			AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.2334C>A	8.37:g.95390589G>T			F6WBS8	Silent	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_HDA_complex_subunit-2/3,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.I778	ENST00000336148.5	37	c.2334	CCDS6262.1	8																																																																																			RAD54B	-	pfam_HDA_complex_subunit-2/3,superfamily_P-loop_NTPase,pfscan_Helicase_C	ENSG00000197275		0.323	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54B	HGNC	protein_coding	OTTHUMT00000257806.3		0.00	30	0	G	NM_012415		95390589	-1			no_errors	ENST00000336148	ensembl	human	known	74_37	silent	6.06	31	2	SNP	0.994	T
RAP1GAP2	23108	genome.wustl.edu	37	17	2808623	2808623	+	Silent	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:2808623G>A	ENST00000254695.8	+	3	216	c.126G>A	c.(124-126)cgG>cgA	p.R42R	RAP1GAP2_ENST00000366401.4_Silent_p.R42R|RAP1GAP2_ENST00000542807.1_Silent_p.R42R|RAP1GAP2_ENST00000540393.2_Silent_p.R23R	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2	42					negative regulation of neuron projection development (GO:0010977)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|nuclear membrane (GO:0031965)	Rap GTPase activator activity (GO:0046582)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11						TCCCAGACCGGCCGCTCTCCC	0.617																																																	0													30.0	35.0	34.0					17																	2808623		2002	4145	6147	SO:0001819	synonymous_variant	0			AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359			29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4		15632203	Standard	NM_015085		Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.126G>A	17.37:g.2808623G>A			B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	Silent	SNP	pfam_Rap_GAP_dom,pfscan_Rap_GAP_dom	p.R42	ENST00000254695.8	37	c.126	CCDS45573.1	17																																																																																			RAP1GAP2	-	NULL	ENSG00000132359		0.617	RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAP1GAP2	HGNC	protein_coding	OTTHUMT00000438208.2	-	0.00	88	0	G			2808623	+1	tier1	-	no_errors	ENST00000254695	ensembl	human	known	74_37	silent	8.00	46	4	SNP	0.999	A
RBBP6	5930	genome.wustl.edu	37	16	24582975	24582975	+	Frame_Shift_Del	DEL	A	A	-			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr16:24582975delA	ENST00000319715.4	+	18	5020	c.4588delA	c.(4588-4590)aaafs	p.K1531fs	RBBP6_ENST00000381039.3_Frame_Shift_Del_p.K691fs|RBBP6_ENST00000348022.2_Frame_Shift_Del_p.K1497fs	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1531	Interaction with p53. {ECO:0000250}.				embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		AGGAGATTCCAAAAAAAGTAA	0.373																																																	0													38.0	37.0	37.0					16																	24582975		2197	4297	6494	SO:0001589	frameshift_variant	0				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.4588delA	16.37:g.24582975delA	ENSP00000317872:p.Lys1531fs		Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Frame_Shift_Del	DEL	pfam_DWNN_domain,pfam_Ubox_domain,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,smart_Znf_RING,pfscan_Znf_RING,pfscan_Znf_CCHC	p.S1532fs	ENST00000319715.4	37	c.4588	CCDS10621.1	16																																																																																			RBBP6	-	NULL	ENSG00000122257		0.373	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP6	HGNC	protein_coding	OTTHUMT00000214067.2		0.00	31	0	A	NM_006910		24582975	+1	tier1		no_errors	ENST00000319715	ensembl	human	known	74_37	frame_shift_del	5.26	36	2	DEL	0.967	-
RBM15B	29890	genome.wustl.edu	37	3	51430822	51430824	+	In_Frame_Del	DEL	CCA	CCA	-	rs147738916	byFrequency	TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	CCA	CCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr3:51430822_51430824delCCA	ENST00000323686.4	+	1	2092_2094	c.1992_1994delCCA	c.(1990-1995)ggccac>ggc	p.H670del		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	670	His-rich.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AGGAACGGGGCCACCACCACCAC	0.635																																																	0																																										SO:0001651	inframe_deletion	0			AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.1992_1994delCCA	3.37:g.51430831_51430833delCCA	ENSP00000313890:p.His670del		A4QPG7|Q6QE19|Q9BV96	In_Frame_Del	DEL	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC_like_C_dom,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.H668in_frame_del	ENST00000323686.4	37	c.1992_1994	CCDS33764.1	3																																																																																			RBM15B	-	NULL	ENSG00000179837		0.635	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM15B	HGNC	protein_coding	OTTHUMT00000346489.1		0.00	16	0	CCA	NM_013286		51430824	+1	tier1		no_errors	ENST00000323686	ensembl	human	known	74_37	in_frame_del	12.50	14	2	DEL	1.000:1.000:0.998	-
RECQL	5965	genome.wustl.edu	37	12	21627896	21627896	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:21627896C>T	ENST00000444129.2	-	11	1702	c.1234G>A	c.(1234-1236)Gca>Aca	p.A412T	RECQL_ENST00000421138.2_Missense_Mutation_p.A412T	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	412	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						ATACAGTCTGCTTTCATGTCA	0.363								Other identified genes with known or suspected DNA repair function																																									0													111.0	101.0	104.0					12																	21627896		2203	4299	6502	SO:0001583	missense	0			D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.1234G>A	12.37:g.21627896C>T	ENSP00000416739:p.Ala412Thr		A8K6G2	Missense_Mutation	SNP	pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_RQC_domain,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.A412T	ENST00000444129.2	37	c.1234	CCDS31756.1	12	.	.	.	.	.	.	.	.	.	.	C	34	5.373698	0.95923	.	.	ENSG00000004700	ENST00000444129;ENST00000421138	T;T	0.31769	1.48;1.48	5.76	5.76	0.90799	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.65637	0.2710	M	0.90870	3.155	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.72724	-0.4207	10	0.72032	D	0.01	-16.4283	18.157	0.89694	0.0:1.0:0.0:0.0	.	412	P46063	RECQ1_HUMAN	T	412	ENSP00000416739:A412T;ENSP00000395449:A412T	ENSP00000395449:A412T	A	-	1	0	RECQL	21519163	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.788000	0.69020	2.733000	0.93635	0.467000	0.42956	GCA	RECQL	-	superfamily_P-loop_NTPase,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000004700		0.363	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECQL	HGNC	protein_coding	OTTHUMT00000402371.1	-	0.00	23	0	C	NM_002907		21627896	-1	tier1	-	no_errors	ENST00000421138	ensembl	human	known	74_37	missense	62.79	16	27	SNP	1.000	T
RECQL5	9400	genome.wustl.edu	37	17	73626918	73626918	+	Splice_Site	SNP	C	C	G	rs142406301		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:73626918C>G	ENST00000317905.5	-	12	1745		c.e12-1		RECQL5_ENST00000423245.2_Splice_Site|RECQL5_ENST00000443199.2_Splice_Site|SMIM5_ENST00000375215.3_5'Flank	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5						chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)	p.?(1)		breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CAGTTCTCATCTGTGGGGGGG	0.647								Other identified genes with known or suspected DNA repair function																																									1	Unknown(1)	upper_aerodigestive_tract(1)											9.0	12.0	11.0					17																	73626918		1796	4036	5832	SO:0001630	splice_region_variant	0			AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762		ENST00000317905.5:c.1586-1G>C	17.37:g.73626918C>G			Q9H0B1|Q9P1W7|Q9UNC8	Splice_Site	SNP	-	e11-1	ENST00000317905.5	37	c.1586-1	CCDS42380.1	17	.	.	.	.	.	.	.	.	.	.	C	21.2	4.112969	0.77210	.	.	ENSG00000108469	ENST00000443199;ENST00000423245;ENST00000317905	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.24	0.93877	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RECQL5	71138513	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	6.501000	0.73691	2.539000	0.85634	0.563000	0.77884	.	RECQL5	-	-	ENSG00000108469		0.647	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	RECQL5	HGNC	protein_coding	OTTHUMT00000448207.1		0.00	38	0	C	NM_004259	Intron	73626918	-1			no_errors	ENST00000317905	ensembl	human	known	74_37	splice_site	8.33	32	3	SNP	1.000	G
RNF219	79596	genome.wustl.edu	37	13	79190358	79190358	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr13:79190358G>T	ENST00000282003.6	-	6	1596	c.1538C>A	c.(1537-1539)tCt>tAt	p.S513Y	RNF219-AS1_ENST00000560209.2_RNA|RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000560584.2_RNA	NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219	513	Ser-rich.						zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		AGAGCGAATAGAATTCAACCT	0.378																																																	0													90.0	93.0	92.0					13																	79190358		2203	4300	6503	SO:0001583	missense	0			BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.1538C>A	13.37:g.79190358G>T	ENSP00000282003:p.Ser513Tyr		B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Missense_Mutation	SNP	pfscan_Znf_RING	p.S513Y	ENST00000282003.6	37	c.1538	CCDS31997.1	13	.	.	.	.	.	.	.	.	.	.	G	14.12	2.441541	0.43326	.	.	ENSG00000152193	ENST00000282003	T	0.15718	2.4	5.86	4.09	0.47781	.	0.187507	0.38492	N	0.001673	T	0.21718	0.0523	L	0.47716	1.5	0.24464	N	0.994429	P	0.46395	0.877	P	0.45037	0.467	T	0.03993	-1.0986	10	0.72032	D	0.01	-12.7766	15.2222	0.73320	0.0:0.2321:0.7679:0.0	.	513	Q5W0B1	RN219_HUMAN	Y	513	ENSP00000282003:S513Y	ENSP00000282003:S513Y	S	-	2	0	RNF219	78088359	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	3.457000	0.53007	0.772000	0.33382	0.655000	0.94253	TCT	RNF219	-	NULL	ENSG00000152193		0.378	RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF219	HGNC	protein_coding	OTTHUMT00000045363.1		0.00	20	0	G	NM_024546		79190358	-1			no_errors	ENST00000282003	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.999	T
ROR2	4920	genome.wustl.edu	37	9	94486191	94486191	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:94486191T>A	ENST00000375708.3	-	9	2783	c.2585A>T	c.(2584-2586)cAc>cTc	p.H862L	ROR2_ENST00000375715.1_Intron|ROR2_ENST00000550066.1_5'UTR	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	862	Ser/Thr-rich.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GCCACTGTGGTGTGAGCTGGG	0.642																																																	0													93.0	92.0	92.0					9																	94486191		2203	4300	6503	SO:0001583	missense	0			M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.2585A>T	9.37:g.94486191T>A	ENSP00000364860:p.His862Leu		Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	pirsf_Tyr_kinase_rcpt_ROR,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Kringle,pfam_Frizzled_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Kringle-like,superfamily_Frizzled_dom,smart_Ig_sub,smart_Ig_sub2,smart_Kringle,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Frizzled_dom,pfscan_Kringle,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.H862L	ENST00000375708.3	37	c.2585	CCDS6691.1	9	.	.	.	.	.	.	.	.	.	.	T	13.59	2.283215	0.40394	.	.	ENSG00000169071	ENST00000375708	T	0.76709	-1.04	4.73	3.6	0.41247	.	0.000000	0.44483	D	0.000456	T	0.55242	0.1908	N	0.24115	0.695	0.53688	D	0.999975	P	0.44734	0.842	B	0.27887	0.084	T	0.53251	-0.8465	10	0.28530	T	0.3	.	10.1344	0.42697	0.0:0.0784:0.0:0.9216	.	862	Q01974	ROR2_HUMAN	L	862	ENSP00000364860:H862L	ENSP00000364860:H862L	H	-	2	0	ROR2	93526012	1.000000	0.71417	0.989000	0.46669	0.535000	0.34838	4.597000	0.61062	0.849000	0.35215	0.379000	0.24179	CAC	ROR2	-	pirsf_Tyr_kinase_rcpt_ROR	ENSG00000169071		0.642	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR2	HGNC	protein_coding	OTTHUMT00000053040.1	-	0.00	70	0	T			94486191	-1	tier1	-	no_errors	ENST00000375708	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	A
RPH3A	22895	genome.wustl.edu	37	12	113285565	113285565	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:113285565C>A	ENST00000389385.4	+	5	645	c.148C>A	c.(148-150)Ctg>Atg	p.L50M	RPH3A_ENST00000420983.2_Missense_Mutation_p.L50M|RPH3A_ENST00000551052.1_Missense_Mutation_p.L46M|RPH3A_ENST00000548866.1_Intron|RPH3A_ENST00000447659.2_Intron|RPH3A_ENST00000543106.2_Missense_Mutation_p.L50M|RPH3A_ENST00000415485.3_Missense_Mutation_p.L50M	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	50	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		GCAGGAAGAGCTGACTGATGA	0.557																																																	0													92.0	80.0	84.0					12																	113285565		2203	4300	6503	SO:0001583	missense	0			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.148C>A	12.37:g.113285565C>A	ENSP00000374036:p.Leu50Met		B7Z3C3|Q96AE0	Missense_Mutation	SNP	pfam_C2_dom,pfam_Znf_FYVE-typ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,smart_C2_dom,pfscan_C2_dom,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel,prints_Synaptotagmin,prints_C2_dom	p.L50M	ENST00000389385.4	37	c.148	CCDS44979.1	12	.	.	.	.	.	.	.	.	.	.	C	22.0	4.230631	0.79688	.	.	ENSG00000089169	ENST00000548197;ENST00000547686;ENST00000543106;ENST00000551593;ENST00000551748;ENST00000546703;ENST00000547840;ENST00000547728;ENST00000549769;ENST00000552667;ENST00000389385;ENST00000551198;ENST00000551052;ENST00000415485;ENST00000553114;ENST00000420983	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73;-1.73	5.07	4.16	0.48862	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Rabphilin-3A effector, zinc-binding (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.48286	D	0.000196	D	0.90174	0.6929	M	0.81112	2.525	0.58432	D	0.999999	D;D;D	0.64830	0.994;0.994;0.993	D;D;D	0.83275	0.996;0.992;0.987	D	0.90227	0.4276	9	.	.	.	.	12.2082	0.54365	0.0:0.9149:0.0:0.0851	.	50;50;46	B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;RP3A_HUMAN;.	M	50;50;50;50;50;50;50;50;50;50;50;50;46;50;50;50	ENSP00000446570:L50M;ENSP00000449705:L50M;ENSP00000440384:L50M;ENSP00000446780:L50M;ENSP00000447306:L50M;ENSP00000446556:L50M;ENSP00000450382:L50M;ENSP00000449613:L50M;ENSP00000447505:L50M;ENSP00000449650:L50M;ENSP00000374036:L50M;ENSP00000447083:L50M;ENSP00000448297:L46M;ENSP00000405357:L50M;ENSP00000450216:L50M;ENSP00000408889:L50M	.	L	+	1	2	RPH3A	111769948	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.233000	0.58651	2.492000	0.84095	0.655000	0.94253	CTG	RPH3A	-	pfam_Znf_FYVE-typ,superfamily_Znf_FYVE_PHD,pfscan_Znf_FYVE-typ	ENSG00000089169		0.557	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPH3A	HGNC	protein_coding	OTTHUMT00000405561.1	-	0.00	39	0	C	NM_014954		113285565	+1	tier1	-	no_errors	ENST00000389385	ensembl	human	known	74_37	missense	25.81	23	8	SNP	1.000	A
RPL3	6122	genome.wustl.edu	37	22	39712982	39712982	+	Intron	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr22:39712982G>T	ENST00000216146.4	-	4	539				RPL3_ENST00000401609.1_Intron|SNORD43_ENST00000583861.1_RNA|SNORD83A_ENST00000386747.1_RNA|RPL3_ENST00000465618.1_5'UTR	NM_000967.3|NM_001033853.1	NP_000958.1|NP_001029025.1	P39023	RL3_HUMAN	ribosomal protein L3						cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|kidney(4)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	Melanoma(58;0.04)				Homoharringtonine(DB04865)	TTTTCCACCAGCAAGCGGAGC	0.572											OREG0026575	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0			AB007166	CCDS13988.1	22q13	2011-04-06			ENSG00000100316	ENSG00000100316		"""L ribosomal proteins"""	10332	protein-coding gene	gene with protein product		604163				2891103, 9582194	Standard	NM_000967		Approved	L3	uc003axi.3	P39023	OTTHUMG00000151079	ENST00000216146.4:c.366-136C>A	22.37:g.39712982G>T		887	B2RDV9|Q15548|Q5I0G0	Missense_Mutation	SNP	pfam_Ribosomal_L3,superfamily_Transl_B-barrel	p.A137D	ENST00000216146.4	37	c.410	CCDS13988.1	22																																																																																			RPL3	-	pfam_Ribosomal_L3	ENSG00000100316		0.572	RPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL3	HGNC	protein_coding	OTTHUMT00000321196.1	-	0.00	39	0	G	NM_000967		39712982	-1	tier1	-	no_errors	ENST00000420536	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	T
RPS11	6205	genome.wustl.edu	37	19	50000798	50000798	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:50000798G>T	ENST00000270625.2	+	3	252	c.169G>T	c.(169-171)Gac>Tac	p.D57Y	hsa-mir-150_ENST00000602157.1_5'Flank|RPS11_ENST00000596873.1_Missense_Mutation_p.D57Y|RPS11_ENST00000594493.1_5'UTR|SNORD35B_ENST00000363660.1_RNA|RPS11_ENST00000599561.1_Intron	NM_001015.4	NP_001006.1	P62280	RS11_HUMAN	ribosomal protein S11	57					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	7		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00206)|GBM - Glioblastoma multiforme(486;0.0245)		CACCTACATTGACAAGAAATG	0.527																																																	0													84.0	78.0	80.0					19																	50000798		2203	4300	6503	SO:0001583	missense	0			AB007152	CCDS12769.1	19q13.3	2011-08-03			ENSG00000142534	ENSG00000142534		"""S ribosomal proteins"""	10384	protein-coding gene	gene with protein product	"""40S ribosomal protein S11"""	180471				1577483, 9582194	Standard	NM_001015		Approved	S11	uc002pob.2	P62280		ENST00000270625.2:c.169G>T	19.37:g.50000798G>T	ENSP00000270625:p.Asp57Tyr		B2R4F5|P04643|Q498Y6|Q6IRY0	Missense_Mutation	SNP	pfam_Ribosomal_S17,superfamily_NA-bd_OB-fold,prints_Ribosomal_S17,tigrfam_Ribosomal_S17_arc-typ	p.D57Y	ENST00000270625.2	37	c.169	CCDS12769.1	19	.	.	.	.	.	.	.	.	.	.	G	23.1	4.371951	0.82573	.	.	ENSG00000142534	ENST00000270625	.	.	.	5.47	4.44	0.53790	.	0.049331	0.85682	D	0.000000	T	0.77791	0.4183	M	0.85299	2.745	0.80722	D	1	D	0.64830	0.994	D	0.63033	0.91	T	0.80216	-0.1474	8	.	.	.	-42.6146	11.6593	0.51337	0.086:0.0:0.914:0.0	.	57	P62280	RS11_HUMAN	Y	57	.	.	D	+	1	0	RPS11	54692610	1.000000	0.71417	0.995000	0.50966	0.970000	0.65996	9.606000	0.98325	1.317000	0.45149	0.561000	0.74099	GAC	RPS11	-	tigrfam_Ribosomal_S17_arc-typ	ENSG00000142534		0.527	RPS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS11	HGNC	protein_coding	OTTHUMT00000465288.1	-	0.00	66	0	G	NM_001015		50000798	+1	tier1	-	no_errors	ENST00000270625	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
RRN3P2	653390	genome.wustl.edu	37	16	29097556	29097557	+	RNA	INS	-	-	AT	rs61151630|rs72325003	byFrequency	TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr16:29097556_29097557insAT	ENST00000564580.1	+	0	611_612							A6NIE6	RN3P2_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 2																		AATTTTGACACGTCACAGAGCC	0.332														885	0.176717	0.3828	0.0965	5008	,	,		11319	0.0962		0.0646	False		,,,				2504	0.1534																0																																												0					16p11.2	2011-12-02			ENSG00000103472	ENSG00000103472			37619	pseudogene	pseudogene							Standard	NR_003369		Approved		uc002dsf.4	A6NIE6			16.37:g.29097556_29097557insAT				RNA	INS	-	NULL	ENST00000564580.1	37	NULL		16																																																																																			RRN3P2	-	-	ENSG00000103472		0.332	RRN3P2-001	KNOWN	basic	processed_transcript	RRN3P2	HGNC	pseudogene	OTTHUMT00000433243.1		0.00	47	0	-	NR_003369		29097557	+1	tier1		no_errors	ENST00000427965	ensembl	human	known	74_37	rna	5.71	33	2	INS	0.997:1.000	AT
RYR1	6261	genome.wustl.edu	37	19	39019604	39019606	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	AGG	AGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:39019604_39019606delAGG	ENST00000359596.3	+	76	11048_11050	c.11048_11050delAGG	c.(11047-11052)caggag>cag	p.E3689del	RYR1_ENST00000355481.4_In_Frame_Del_p.E3684del|RYR1_ENST00000360985.3_In_Frame_Del_p.E3689del|AC067969.1_ENST00000597015.1_RNA			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3689					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GCTGGggagcaggaggaggagga	0.576																																																	0									,	49,4215		1,47,2084					,	1.7	1.0			45	125,8129		5,115,4007	no	coding,coding	RYR1	NM_001042723.1,NM_000540.2	,	6,162,6091	A1A1,A1R,RR		1.5144,1.1492,1.39	,	,		174,12344				SO:0001651	inframe_deletion	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.11048_11050delAGG	19.37:g.39019613_39019615delAGG	ENSP00000352608:p.Glu3689del		Q16314|Q16368|Q9NPK1|Q9P1U4	In_Frame_Del	DEL	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.E3687in_frame_del	ENST00000359596.3	37	c.11048_11050	CCDS33011.1	19																																																																																			RYR1	-	NULL	ENSG00000196218		0.576	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1		0.00	21	0	AGG			39019606	+1	tier1		no_errors	ENST00000359596	ensembl	human	known	74_37	in_frame_del	10.53	34	4	DEL	1.000:1.000:1.000	-
SCEL	8796	genome.wustl.edu	37	13	78146268	78146268	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr13:78146268G>T	ENST00000349847.3	+	9	573	c.489G>T	c.(487-489)tgG>tgT	p.W163C	SCEL_ENST00000377246.3_Missense_Mutation_p.W163C|SCEL_ENST00000535157.1_Intron	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	163					embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		GGCAGTCCTGGTTTCCACCGC	0.463																																																	0													143.0	112.0	123.0					13																	78146268		2203	4300	6503	SO:0001583	missense	0			AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.489G>T	13.37:g.78146268G>T	ENSP00000302579:p.Trp163Cys		B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Missense_Mutation	SNP	smart_Znf_LIM,pfscan_Znf_LIM	p.W163C	ENST00000349847.3	37	c.489	CCDS9459.1	13	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400264	0.62177	.	.	ENSG00000136155	ENST00000348770;ENST00000377246;ENST00000349847	T;T	0.26518	1.73;1.73	5.16	5.16	0.70880	.	0.000000	0.53938	D	0.000048	T	0.49795	0.1578	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.49370	-0.8947	10	0.66056	D	0.02	-6.5435	14.0055	0.64461	0.0:0.0:1.0:0.0	.	163;163	O95171-2;O95171	.;SCEL_HUMAN	C	140;163;163	ENSP00000366454:W163C;ENSP00000302579:W163C	ENSP00000315127:W140C	W	+	3	0	SCEL	77044269	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	4.235000	0.58666	2.675000	0.91044	0.655000	0.94253	TGG	SCEL	-	NULL	ENSG00000136155		0.463	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCEL	HGNC	protein_coding	OTTHUMT00000045339.2	-	0.00	37	0	G	NM_144777		78146268	+1	tier1	-	no_errors	ENST00000349847	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
SCN2A	6326	genome.wustl.edu	37	2	166245699	166245699	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:166245699T>A	ENST00000375437.2	+	27	5673	c.5383T>A	c.(5383-5385)Ttt>Att	p.F1795I	SCN2A_ENST00000357398.3_Missense_Mutation_p.F1795I|SCN2A_ENST00000283256.6_Missense_Mutation_p.F1795I|SCN2A_ENST00000375427.2_Missense_Mutation_p.F1795I	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1795					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGAGGATGACTTTGAGATGTT	0.468																																																	0													90.0	94.0	93.0					2																	166245699		2203	4297	6500	SO:0001583	missense	0			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.5383T>A	2.37:g.166245699T>A	ENSP00000364586:p.Phe1795Ile		A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.F1795I	ENST00000375437.2	37	c.5383	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	T	20.4	3.979676	0.74360	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.96011	-3.88;-3.88;-3.88;-3.88	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000001	D	0.97483	0.9176	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;0.965	D;D	0.97110	1.0;0.984	D	0.98186	1.0460	10	0.87932	D	0	.	16.3507	0.83204	0.0:0.0:0.0:1.0	.	1795;1795	Q99250-2;Q99250	.;SCN2A_HUMAN	I	1795	ENSP00000364586:F1795I;ENSP00000349973:F1795I;ENSP00000283256:F1795I;ENSP00000364576:F1795I	ENSP00000283256:F1795I	F	+	1	0	SCN2A	165953945	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.963000	0.87922	2.319000	0.78375	0.524000	0.50904	TTT	SCN2A	-	prints_Na_channel_asu	ENSG00000136531		0.468	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	-	0.00	82	0	T	NM_021007		166245699	+1	tier1	-	no_errors	ENST00000283256	ensembl	human	known	74_37	missense	23.75	61	19	SNP	1.000	A
SCNN1G	6340	genome.wustl.edu	37	16	23205507	23205507	+	Frame_Shift_Del	DEL	C	C	-	rs1126943		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr16:23205507delC	ENST00000300061.2	+	5	968	c.825delC	c.(823-825)ttcfs	p.F275fs	CTC-391G2.1_ENST00000563471.1_RNA	NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	275					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)			NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	TCACGCTTTTCCACCACCCGA	0.488																																																	0													113.0	107.0	109.0					16																	23205507		2197	4300	6497	SO:0001589	frameshift_variant	0			U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.825delC	16.37:g.23205507delC	ENSP00000300061:p.Phe275fs		P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Frame_Shift_Del	DEL	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.H276fs	ENST00000300061.2	37	c.825	CCDS10608.1	16																																																																																			SCNN1G	-	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	ENSG00000166828		0.488	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCNN1G	HGNC	protein_coding	OTTHUMT00000254496.1		0.00	17	0	C	NM_001039		23205507	+1	tier1		no_errors	ENST00000300061	ensembl	human	known	74_37	frame_shift_del	8.70	21	2	DEL	1.000	-
SDK1	221935	genome.wustl.edu	37	7	4245555	4245555	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr7:4245555G>A	ENST00000404826.2	+	36	5282	c.5143G>A	c.(5143-5145)Gcc>Acc	p.A1715T	SDK1_ENST00000389531.3_Missense_Mutation_p.A1695T	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1715	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CCCACTCACGGCCAGCCAGCT	0.657																																																	0													58.0	43.0	48.0					7																	4245555		2169	4255	6424	SO:0001583	missense	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.5143G>A	7.37:g.4245555G>A	ENSP00000385899:p.Ala1715Thr		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A1715T	ENST00000404826.2	37	c.5143	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	G	16.43	3.121996	0.56613	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.57273	0.41;0.41	5.46	5.46	0.80206	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.083134	0.49916	D	0.000137	T	0.65375	0.2685	M	0.74546	2.27	0.41569	D	0.988673	P;P;P	0.52170	0.799;0.78;0.951	B;P;P	0.49799	0.359;0.474;0.622	T	0.70687	-0.4803	10	0.66056	D	0.02	.	19.3227	0.94248	0.0:0.0:1.0:0.0	.	1695;202;1715	F8W6X9;F2Z3E9;Q7Z5N4	.;.;SDK1_HUMAN	T	1715;1695	ENSP00000385899:A1715T;ENSP00000374182:A1695T	ENSP00000374182:A1695T	A	+	1	0	SDK1	4212081	1.000000	0.71417	0.995000	0.50966	0.547000	0.35210	5.065000	0.64344	2.557000	0.86248	0.655000	0.94253	GCC	SDK1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000146555		0.657	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	-	0.00	35	0	G	NM_152744		4245555	+1	tier1	-	no_errors	ENST00000404826	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.976	A
SEC31A	22872	genome.wustl.edu	37	4	83788384	83788384	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr4:83788384G>T	ENST00000395310.2	-	9	1150	c.968C>A	c.(967-969)tCg>tAg	p.S323*	SEC31A_ENST00000508502.1_Nonsense_Mutation_p.S323*|SEC31A_ENST00000513858.1_Nonsense_Mutation_p.S323*|SEC31A_ENST00000326950.5_Nonsense_Mutation_p.S323*|SEC31A_ENST00000509142.1_Nonsense_Mutation_p.S323*|SEC31A_ENST00000355196.2_Nonsense_Mutation_p.S323*|SEC31A_ENST00000505472.1_Nonsense_Mutation_p.S323*|SEC31A_ENST00000311785.7_Nonsense_Mutation_p.S323*|SEC31A_ENST00000500777.2_Nonsense_Mutation_p.S323*|SEC31A_ENST00000432794.1_Nonsense_Mutation_p.S323*|SEC31A_ENST00000443462.2_Nonsense_Mutation_p.S318*|SEC31A_ENST00000264405.5_Nonsense_Mutation_p.S95*|SEC31A_ENST00000508479.1_Nonsense_Mutation_p.S323*|SEC31A_ENST00000436790.2_5'UTR|SEC31A_ENST00000448323.1_Nonsense_Mutation_p.S323*|SEC31A_ENST00000505984.1_Nonsense_Mutation_p.S323*|SEC31A_ENST00000348405.4_Nonsense_Mutation_p.S323*	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	323	Interaction with SEC13.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				CCCATCAAACGAAGCAGCTGA	0.423																																																	0													128.0	112.0	117.0					4																	83788384		2203	4300	6503	SO:0001587	stop_gained	0			AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.968C>A	4.37:g.83788384G>T	ENSP00000378721:p.Ser323*		B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S323*	ENST00000395310.2	37	c.968	CCDS3596.1	4	.	.	.	.	.	.	.	.	.	.	G	40	7.919782	0.98563	.	.	ENSG00000138674	ENST00000348405;ENST00000513858;ENST00000395310;ENST00000443462;ENST00000509142;ENST00000432794;ENST00000448323;ENST00000326950;ENST00000311785;ENST00000505472;ENST00000500777;ENST00000508502;ENST00000355196;ENST00000264405;ENST00000505984;ENST00000508479	.	.	.	5.54	5.54	0.83059	.	0.171625	0.51477	D	0.000082	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.8855	19.8364	0.96659	0.0:0.0:1.0:0.0	.	.	.	.	X	323;323;323;318;323;323;323;323;323;323;323;323;323;95;323;323	.	ENSP00000264405:S95X	S	-	2	0	SEC31A	84007408	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.364000	0.73086	2.765000	0.95021	0.573000	0.79308	TCG	SEC31A	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000138674		0.423	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEC31A	HGNC	protein_coding	OTTHUMT00000252640.1		0.00	38	0	G	NM_016211		83788384	-1			no_errors	ENST00000432794	ensembl	human	known	74_37	nonsense	5.71	33	2	SNP	1.000	T
SEMA5A	9037	genome.wustl.edu	37	5	9337840	9337840	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:9337840A>G	ENST00000382496.5	-	4	874	c.209T>C	c.(208-210)cTt>cCt	p.L70P		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	70	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						TCCTACAACAAGTTCTTTCTG	0.398																																																	0													84.0	78.0	80.0					5																	9337840		2203	4300	6503	SO:0001583	missense	0			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.209T>C	5.37:g.9337840A>G	ENSP00000371936:p.Leu70Pro		D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.L70P	ENST00000382496.5	37	c.209	CCDS3875.1	5	.	.	.	.	.	.	.	.	.	.	A	18.06	3.538322	0.65085	.	.	ENSG00000112902	ENST00000382496;ENST00000513968	T;T	0.40756	1.02;1.02	5.21	5.21	0.72293	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.69052	0.3068	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75766	-0.3202	10	0.87932	D	0	.	11.7752	0.51981	1.0:0.0:0.0:0.0	.	70	Q13591	SEM5A_HUMAN	P	70	ENSP00000371936:L70P;ENSP00000421961:L70P	ENSP00000371936:L70P	L	-	2	0	SEMA5A	9390840	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.461000	0.73522	2.103000	0.63969	0.533000	0.62120	CTT	SEMA5A	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000112902		0.398	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	HGNC	protein_coding	OTTHUMT00000206989.2	-	0.00	52	0	A			9337840	-1	tier1	-	no_errors	ENST00000382496	ensembl	human	known	74_37	missense	12.50	35	5	SNP	1.000	G
SETD9	133383	genome.wustl.edu	37	5	56212655	56212655	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:56212655G>T	ENST00000285947.2	+	6	1212	c.826G>T	c.(826-828)Gtt>Ttt	p.V276F	SETD9_ENST00000475908.1_3'UTR|SETD9_ENST00000541720.1_Intron	NM_153706.3	NP_714917.2	Q8NE22	SETD9_HUMAN	SET domain containing 9	276	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						methyltransferase activity (GO:0008168)										ACTTCGATGTGTTGTTCTTGT	0.333																																																	0													167.0	156.0	160.0					5																	56212655		2203	4300	6503	SO:0001583	missense	0			BC036528	CCDS3972.1	5q11.2	2012-02-23	2012-02-23	2012-02-23	ENSG00000155542	ENSG00000155542			28508	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 35"""	C5orf35		20930037	Standard	NM_153706		Approved	MGC33648	uc003jqx.3	Q8NE22	OTTHUMG00000059485	ENST00000285947.2:c.826G>T	5.37:g.56212655G>T	ENSP00000285947:p.Val276Phe		F5H713	Missense_Mutation	SNP	NULL	p.V276F	ENST00000285947.2	37	c.826	CCDS3972.1	5	.	.	.	.	.	.	.	.	.	.	G	26.9	4.783460	0.90282	.	.	ENSG00000155542	ENST00000285947	T	0.46063	0.88	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.66597	0.2805	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71094	-0.4692	10	0.87932	D	0	-13.6371	18.5102	0.90913	0.0:0.0:1.0:0.0	.	276	Q8NE22	CE035_HUMAN	F	276	ENSP00000285947:V276F	ENSP00000285947:V276F	V	+	1	0	C5orf35	56248412	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	4.913000	0.63341	2.380000	0.81148	0.585000	0.79938	GTT	SETD9	-	NULL	ENSG00000155542		0.333	SETD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD9	HGNC	protein_coding	OTTHUMT00000132304.2	-	0.00	110	0	G	NM_153706		56212655	+1	tier1	-	no_errors	ENST00000285947	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
SFMBT2	57713	genome.wustl.edu	37	10	7326106	7326106	+	Silent	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr10:7326106G>T	ENST00000361972.4	-	6	622	c.532C>A	c.(532-534)Cga>Aga	p.R178R	SFMBT2_ENST00000397167.1_Silent_p.R178R	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	178					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)	p.R178*(2)		NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						CCTTTCCCTCGCAGAGGCTGT	0.368																																																	2	Substitution - Nonsense(2)	skin(2)											63.0	63.0	63.0					10																	7326106		2202	4298	6500	SO:0001819	synonymous_variant	0			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.532C>A	10.37:g.7326106G>T			A7MD09|Q9HCF5	Silent	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,superfamily_ARM-type_fold,smart_Mbt,smart_SAM,pfscan_Mbt	p.R178	ENST00000361972.4	37	c.532	CCDS31138.1	10																																																																																			SFMBT2	-	smart_Mbt,pfscan_Mbt	ENSG00000198879		0.368	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	HGNC	protein_coding	OTTHUMT00000046673.1		0.00	42	0	G	NM_001029880		7326106	-1			no_errors	ENST00000361972	ensembl	human	known	74_37	silent	5.00	38	2	SNP	1.000	T
SFXN1	94081	genome.wustl.edu	37	5	174937167	174937167	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:174937167G>A	ENST00000321442.5	+	4	645	c.391G>A	c.(391-393)Gtc>Atc	p.V131I	SFXN1_ENST00000502393.1_Missense_Mutation_p.V131I	NM_022754.5	NP_073591.2	Q9H9B4	SFXN1_HUMAN	sideroflexin 1	131					erythrocyte differentiation (GO:0030218)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(3)	15	all_cancers(89;0.00922)|Renal(175;0.000269)|Lung NSC(126;0.00515)|all_lung(126;0.00873)	Medulloblastoma(196;0.0399)|all_neural(177;0.0663)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CAATGCCGTCGTCAATTACAC	0.498																																																	0													159.0	119.0	133.0					5																	174937167		2203	4300	6503	SO:0001583	missense	0			AF327346	CCDS4394.1	5q35.3	2008-02-05			ENSG00000164466	ENSG00000164466		"""Sideroflexins"""	16085	protein-coding gene	gene with protein product		615569					Standard	NM_022754		Approved	FLJ12876	uc003mda.2	Q9H9B4	OTTHUMG00000130555	ENST00000321442.5:c.391G>A	5.37:g.174937167G>A	ENSP00000316905:p.Val131Ile		B3KPW3|D3DQN2|Q9HA53	Missense_Mutation	SNP	pfam_Mtc,tigrfam_Mtc	p.V131I	ENST00000321442.5	37	c.391	CCDS4394.1	5	.	.	.	.	.	.	.	.	.	.	G	31	5.074441	0.94000	.	.	ENSG00000164466	ENST00000507017;ENST00000321442;ENST00000506963	T;T;T	0.39592	1.07;1.07;1.07	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.63721	0.2535	M	0.70108	2.13	0.80722	D	1	D;D	0.89917	1.0;0.989	D;P	0.67900	0.954;0.787	T	0.62215	-0.6901	10	0.41790	T	0.15	-41.1476	18.3752	0.90433	0.0:0.0:1.0:0.0	.	131;131	D6RFI0;Q9H9B4	.;SFXN1_HUMAN	I	131	ENSP00000420961:V131I;ENSP00000316905:V131I;ENSP00000421467:V131I	ENSP00000316905:V131I	V	+	1	0	SFXN1	174869773	1.000000	0.71417	0.823000	0.32752	0.481000	0.33189	9.731000	0.98807	2.572000	0.86782	0.655000	0.94253	GTC	SFXN1	-	pfam_Mtc,tigrfam_Mtc	ENSG00000164466		0.498	SFXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN1	HGNC	protein_coding	OTTHUMT00000252980.2	-	0.00	106	0	G	NM_022754		174937167	+1	tier1	-	no_errors	ENST00000321442	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	A
SH3BP4	23677	genome.wustl.edu	37	2	235950407	235950407	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:235950407C>T	ENST00000409212.1	+	4	1501	c.994C>T	c.(994-996)Ctt>Ttt	p.L332F	SH3BP4_ENST00000344528.4_Missense_Mutation_p.L332F|SH3BP4_ENST00000392011.2_Missense_Mutation_p.L332F			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	332					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		TGCTGTCCAGCTTCCTGACAC	0.642																																																	0													32.0	37.0	35.0					2																	235950407		2202	4300	6502	SO:0001583	missense	0			AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.994C>T	2.37:g.235950407C>T	ENSP00000386862:p.Leu332Phe		O95082|Q309A3|Q53QD0|Q53TD1	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,pfam_ZU5,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.L332F	ENST00000409212.1	37	c.994	CCDS2513.1	2	.	.	.	.	.	.	.	.	.	.	C	15.76	2.927523	0.52759	.	.	ENSG00000130147	ENST00000392011;ENST00000420127;ENST00000409212;ENST00000344528	T;T;T	0.45668	0.89;0.89;0.89	5.79	5.79	0.91817	ZU5 (1);	0.118034	0.64402	D	0.000015	T	0.66723	0.2818	M	0.74647	2.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.987	T	0.68700	-0.5339	10	0.87932	D	0	-9.4139	18.6073	0.91271	0.0:1.0:0.0:0.0	.	332;332	A8K594;Q9P0V3	.;SH3B4_HUMAN	F	332	ENSP00000375867:L332F;ENSP00000386862:L332F;ENSP00000340237:L332F	ENSP00000340237:L332F	L	+	1	0	SH3BP4	235615146	1.000000	0.71417	0.996000	0.52242	0.199000	0.23934	5.856000	0.69518	2.731000	0.93534	0.650000	0.86243	CTT	SH3BP4	-	pfam_ZU5	ENSG00000130147		0.642	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SH3BP4	HGNC	protein_coding	OTTHUMT00000329763.1	-	0.00	28	0	C			235950407	+1	tier1	-	no_errors	ENST00000344528	ensembl	human	known	74_37	missense	26.09	17	6	SNP	1.000	T
SIRT2	22933	genome.wustl.edu	37	19	39384519	39384519	+	Intron	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:39384519G>A	ENST00000249396.7	-	3	365				SIRT2_ENST00000358931.5_Intron|SIRT2_ENST00000392081.2_Intron	NM_012237.3	NP_036369.2	Q8IXJ6	SIR2_HUMAN	sirtuin 2						autophagy (GO:0006914)|cellular lipid catabolic process (GO:0044242)|cellular response to caloric restriction (GO:0061433)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to hypoxia (GO:0071456)|cellular response to molecule of bacterial origin (GO:0071219)|cellular response to oxidative stress (GO:0034599)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|chromatin silencing at telomere (GO:0006348)|gene silencing (GO:0016458)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|innate immune response (GO:0045087)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|myelination in peripheral nervous system (GO:0022011)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)|negative regulation of defense response to bacterium (GO:1900425)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of oligodendrocyte progenitor proliferation (GO:0070446)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of cell division (GO:0051781)|positive regulation of DNA binding (GO:0043388)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of meiosis (GO:0045836)|positive regulation of oocyte maturation (GO:1900195)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ADP-ribosylation (GO:0006471)|protein deacetylation (GO:0006476)|protein kinase B signaling (GO:0043491)|regulation of cell cycle (GO:0051726)|regulation of exit from mitosis (GO:0007096)|regulation of myelination (GO:0031641)|regulation of phosphorylation (GO:0042325)|response to redox state (GO:0051775)|ripoptosome assembly involved in necroptotic process (GO:1901026)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)	centriole (GO:0005814)|centrosome (GO:0005813)|chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|glial cell projection (GO:0097386)|juxtaparanode region of axon (GO:0044224)|lateral loop (GO:0043219)|meiotic spindle (GO:0072687)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|myelin sheath (GO:0043209)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|spindle (GO:0005819)	chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|NAD-dependent protein deacetylase activity (GO:0034979)|protein deacetylase activity (GO:0033558)|transcription factor binding (GO:0008134)|tubulin deacetylase activity (GO:0042903)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)	9	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00125)|LUSC - Lung squamous cell carcinoma(53;0.00191)			TGGAAGGGGTGGGGTGGAGTG	0.612																																																	0													52.0	56.0	55.0					19																	39384519		2202	4299	6501	SO:0001627	intron_variant	0			AF083107	CCDS12523.1, CCDS46069.1, CCDS74361.1	19q13	2010-06-25	2010-06-25		ENSG00000068903	ENSG00000068903			10886	protein-coding gene	gene with protein product		604480	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 2"", ""sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae)"""	SIR2L		10393250, 10381378	Standard	NM_012237		Approved		uc002ojt.2	Q8IXJ6	OTTHUMG00000150480	ENST00000249396.7:c.64-12C>T	19.37:g.39384519G>A			A8K3V1|B2RB45|O95889|Q924Y7|Q9P0G8|Q9UNT0|Q9Y6E9|U5TP13	Silent	SNP	NULL	p.P52	ENST00000249396.7	37	c.156	CCDS12523.1	19																																																																																			SIRT2	-	NULL	ENSG00000068903		0.612	SIRT2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIRT2	HGNC	protein_coding	OTTHUMT00000318278.1	-	0.00	122	0	G			39384519	-1	tier1	-	no_errors	ENST00000443898	ensembl	human	known	74_37	silent	24.06	101	32	SNP	0.883	A
SIGLEC5	8778	genome.wustl.edu	37	19	52115505	52115505	+	Silent	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:52115505C>T	ENST00000534261.2	-	10	2034	c.1635G>A	c.(1633-1635)tcG>tcA	p.S545S	SIGLEC5_ENST00000429354.3_Silent_p.S545S|SIGLEC5_ENST00000599649.1_Silent_p.S545S|SIGLEC5_ENST00000570106.2_Silent_p.S545S|SIGLEC5_ENST00000222107.4_Silent_p.S545S			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	545					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		TCTTGATCTCCGAGTACTCCG	0.542																																																	0													143.0	120.0	128.0					19																	52115505		2203	4300	6503	SO:0001819	synonymous_variant	0			U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.1635G>A	19.37:g.52115505C>T				Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S545	ENST00000534261.2	37	c.1635	CCDS33088.1	19																																																																																			SIGLEC5	-	NULL	ENSG00000105501		0.542	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	SIGLEC5	HGNC	protein_coding	OTTHUMT00000466897.2	-	0.00	72	0	C	NM_003830		52115505	-1	tier1	-	no_errors	ENST00000222107	ensembl	human	known	74_37	silent	23.08	30	9	SNP	0.189	T
SLC30A5	64924	genome.wustl.edu	37	5	68417624	68417624	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:68417624C>T	ENST00000396591.3	+	13	2283	c.1673C>T	c.(1672-1674)tCt>tTt	p.S558F	CTC-498J12.3_ENST00000504129.1_RNA	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5	558	His-rich loop.				cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)	p.S558C(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TGTCACTCATCTGATCACAGC	0.517																																																	1	Substitution - Missense(1)	breast(1)											88.0	73.0	78.0					5																	68417624		2203	4300	6503	SO:0001583	missense	0			AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.1673C>T	5.37:g.68417624C>T	ENSP00000379836:p.Ser558Phe		B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.S558F	ENST00000396591.3	37	c.1673	CCDS3996.1	5	.	.	.	.	.	.	.	.	.	.	C	14.10	2.435478	0.43224	.	.	ENSG00000145740	ENST00000396591;ENST00000438236	T	0.65364	-0.15	4.46	3.51	0.40186	.	0.269088	0.41500	D	0.000877	T	0.50684	0.1630	L	0.29908	0.895	0.80722	D	1	P;B;P	0.51147	0.942;0.372;0.927	P;B;P	0.46026	0.501;0.206;0.477	T	0.47837	-0.9086	10	0.36615	T	0.2	.	9.7641	0.40550	0.4031:0.5969:0.0:0.0	.	387;387;558	Q9H9X0;Q8TAD4-2;Q8TAD4	.;.;ZNT5_HUMAN	F	558;153	ENSP00000379836:S558F	ENSP00000379836:S558F	S	+	2	0	SLC30A5	68453380	1.000000	0.71417	0.990000	0.47175	0.975000	0.68041	5.118000	0.64673	2.308000	0.77769	0.591000	0.81541	TCT	SLC30A5	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000145740		0.517	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A5	HGNC	protein_coding	OTTHUMT00000254017.2		0.00	31	0	C			68417624	+1			no_errors	ENST00000396591	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
SLC30A8	169026	genome.wustl.edu	37	8	118169955	118169955	+	Silent	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr8:118169955C>A	ENST00000456015.2	+	4	444	c.444C>A	c.(442-444)atC>atA	p.I148I	SLC30A8_ENST00000521243.1_Silent_p.I99I|SLC30A8_ENST00000427715.2_Silent_p.I99I|SLC30A8_ENST00000519688.1_Silent_p.I99I	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	148					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			TGCTCTCCATCCTGTGCATCT	0.512																																					Ovarian(162;1202 1922 6011 16223 52092)												0													315.0	285.0	295.0					8																	118169955		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.444C>A	8.37:g.118169955C>A			A0AVP9|A5YM39|B4DPE0|Q8TCL3	Silent	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.I148	ENST00000456015.2	37	c.444	CCDS6322.1	8																																																																																			SLC30A8	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000164756		0.512	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A8	HGNC	protein_coding	OTTHUMT00000381205.1	-	0.00	85	0	C	NM_173851		118169955	+1	tier1	-	no_errors	ENST00000456015	ensembl	human	known	74_37	silent	20.90	53	14	SNP	0.892	A
SLC35D1	23169	genome.wustl.edu	37	1	67516184	67516184	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:67516184C>A	ENST00000235345.5	-	5	481	c.396G>T	c.(394-396)ttG>ttT	p.L132F	SLC35D1_ENST00000506472.2_Missense_Mutation_p.L53F	NM_015139.2	NP_055954.1	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-GlcA/UDP-GalNAc transporter), member D1	132					carbohydrate transport (GO:0008643)|cellular glucuronidation (GO:0052695)|chondroitin sulfate biosynthetic process (GO:0030206)|embryonic skeletal system development (GO:0048706)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|UDP-glucuronate biosynthetic process (GO:0006065)|UDP-glucuronic acid transport (GO:0015787)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	UDP-glucuronic acid transmembrane transporter activity (GO:0005461)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	10						TAAACATTGGCAAGCTGGAAA	0.289																																																	0													33.0	34.0	34.0					1																	67516184		2203	4299	6502	SO:0001583	missense	0			AB044343	CCDS636.1	1p32-p31	2013-07-17	2013-07-17		ENSG00000116704	ENSG00000116704		"""Solute carriers"""	20800	protein-coding gene	gene with protein product		610804	"""solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1"""			11322953	Standard	NM_015139		Approved	UGTREL7, KIAA0260	uc001ddk.2	Q9NTN3	OTTHUMG00000009360	ENST00000235345.5:c.396G>T	1.37:g.67516184C>A	ENSP00000235345:p.Leu132Phe		A8K185|B7Z3X2|Q52LU5|Q92548	Missense_Mutation	SNP	pfam_Tpt_PEP_trans_dom	p.L132F	ENST00000235345.5	37	c.396	CCDS636.1	1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.936343	0.52972	.	.	ENSG00000116704	ENST00000235345;ENST00000506472	T;T	0.65732	-0.17;0.23	5.43	2.58	0.30949	.	0.000000	0.85682	D	0.000000	T	0.71169	0.3308	M	0.89840	3.065	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.73380	0.969;0.98	T	0.72154	-0.4376	10	0.87932	D	0	-20.4536	5.648	0.17600	0.1399:0.6528:0.0:0.2073	.	53;132	B7Z3X2;Q9NTN3	.;S35D1_HUMAN	F	132;53	ENSP00000235345:L132F;ENSP00000445189:L53F	ENSP00000235345:L132F	L	-	3	2	SLC35D1	67288772	0.996000	0.38824	0.999000	0.59377	0.641000	0.38312	0.463000	0.21972	0.279000	0.22186	0.655000	0.94253	TTG	SLC35D1	-	NULL	ENSG00000116704		0.289	SLC35D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35D1	HGNC	protein_coding	OTTHUMT00000025948.1	-	0.00	46	0	C	NM_015139		67516184	-1	tier1	-	no_errors	ENST00000235345	ensembl	human	known	74_37	missense	7.69	60	5	SNP	1.000	A
SLC35G6	643664	genome.wustl.edu	37	17	7386176	7386176	+	Silent	SNP	G	G	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:7386176G>C	ENST00000412468.2	+	2	988	c.873G>C	c.(871-873)gtG>gtC	p.V291V	ZBTB4_ENST00000311403.4_Intron|POLR2A_ENST00000572844.1_5'Flank|POLR2A_ENST00000322644.6_5'Flank	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	291	EamA 2.					integral component of membrane (GO:0016021)											CCGAGGTGGTGGTGGCCCTTA	0.582																																																	0													197.0	182.0	187.0					17																	7386176		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.873G>C	17.37:g.7386176G>C				Silent	SNP	pfam_DMT	p.V291	ENST00000412468.2	37	c.873	CCDS45603.1	17																																																																																			SLC35G6	-	pfam_DMT	ENSG00000259224		0.582	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35G6	HGNC	protein_coding		-	0.00	189	0	G	NM_001102614		7386176	+1	tier1	-	no_errors	ENST00000412468	ensembl	human	known	74_37	silent	30.00	126	54	SNP	1.000	C
SLC39A2	29986	genome.wustl.edu	37	14	21467630	21467630	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr14:21467630C>A	ENST00000298681.4	+	1	182	c.25C>A	c.(25-27)Ctt>Att	p.L9I	SLC39A2_ENST00000554422.1_Missense_Mutation_p.L9I|RP11-84C10.4_ENST00000557335.1_RNA	NM_014579.3	NP_055394.2	Q9NP94	S39A2_HUMAN	solute carrier family 39 (zinc transporter), member 2	9					transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)	p.L9fs*34(1)		breast(2)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	14	all_cancers(95;0.00267)		OV - Ovarian serous cystadenocarcinoma(11;1.34e-10)|Epithelial(56;1.57e-08)|all cancers(55;7.45e-08)	GBM - Glioblastoma multiforme(265;0.0187)		AGGAATAAAACTTGGCTGCCT	0.507																																																	1	Deletion - Frameshift(1)	breast(1)											163.0	130.0	141.0					14																	21467630		2203	4300	6503	SO:0001583	missense	0			AF186081	CCDS9563.1, CCDS58303.1	14q11.1	2013-05-22			ENSG00000165794	ENSG00000165794		"""Solute carriers"""	17127	protein-coding gene	gene with protein product		612166				10681536, 7751801	Standard	NM_014579		Approved	ZIP2	uc001vyr.3	Q9NP94	OTTHUMG00000029616	ENST00000298681.4:c.25C>A	14.37:g.21467630C>A	ENSP00000298681:p.Leu9Ile		B2RC76|G3V5X2|Q4QQJ1|Q4V9S4|Q96JT6|Q9UD20	Missense_Mutation	SNP	pfam_ZIP	p.L9I	ENST00000298681.4	37	c.25	CCDS9563.1	14	.	.	.	.	.	.	.	.	.	.	C	1.245	-0.620362	0.03636	.	.	ENSG00000165794	ENST00000554422;ENST00000298681	T;T	0.49432	0.78;0.78	5.27	-6.09	0.02145	.	0.537335	0.19532	N	0.112006	T	0.13372	0.0324	N	0.01576	-0.805	0.20196	N	0.999925	B	0.06786	0.001	B	0.08055	0.003	T	0.28522	-1.0041	10	0.02654	T	1	-0.0138	12.079	0.53659	0.1792:0.6794:0.1413:0.0	.	9	Q9NP94	S39A2_HUMAN	I	9	ENSP00000452568:L9I;ENSP00000298681:L9I	ENSP00000298681:L9I	L	+	1	0	SLC39A2	20537470	0.916000	0.31088	0.014000	0.15608	0.935000	0.57460	-0.067000	0.11579	-1.317000	0.02292	-1.028000	0.02416	CTT	SLC39A2	-	pfam_ZIP	ENSG00000165794		0.507	SLC39A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC39A2	HGNC	protein_coding	OTTHUMT00000073829.2		0.00	71	0	C	NM_014579		21467630	+1			no_errors	ENST00000298681	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.501	A
SMCO3	440087	genome.wustl.edu	37	12	14959109	14959109	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:14959109C>T	ENST00000316048.2	-	2	578	c.506G>A	c.(505-507)gGc>gAc	p.G169D	WBP11_ENST00000261167.2_5'Flank|C12orf60_ENST00000330828.2_Intron|C12orf60_ENST00000527783.1_Intron	NM_001013698.2	NP_001013720.2	A2RU48	SMCO3_HUMAN	single-pass membrane protein with coiled-coil domains 3	169						integral component of membrane (GO:0016021)											TATGCCAAGGCCAAGAACAGC	0.453																																																	0													123.0	117.0	119.0					12																	14959109		2016	4176	6192	SO:0001583	missense	0				CCDS41759.1	12p12.3	2013-03-11	2013-03-11	2013-03-11	ENSG00000179256	ENSG00000179256			34401	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 69"""	C12orf69			Standard	NM_001013698		Approved	LOC440087	uc001rck.1	A2RU48	OTTHUMG00000167474	ENST00000316048.2:c.506G>A	12.37:g.14959109C>T	ENSP00000381895:p.Gly169Asp		Q8NAI5	Missense_Mutation	SNP	NULL	p.G169D	ENST00000316048.2	37	c.506	CCDS41759.1	12	.	.	.	.	.	.	.	.	.	.	C	15.66	2.899140	0.52227	.	.	ENSG00000179256	ENST00000316048	T	0.16073	2.37	4.62	4.62	0.57501	.	0.391026	0.18181	U	0.149150	T	0.14141	0.0342	N	0.14661	0.345	0.30738	N	0.746493	P	0.44429	0.835	P	0.44990	0.466	T	0.02512	-1.1148	10	0.62326	D	0.03	-18.0735	13.155	0.59511	0.0:1.0:0.0:0.0	.	169	A2RU48	CL069_HUMAN	D	169	ENSP00000381895:G169D	ENSP00000381895:G169D	G	-	2	0	C12orf69	14850376	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.333000	0.52090	2.544000	0.85801	0.561000	0.74099	GGC	SMCO3	-	NULL	ENSG00000179256		0.453	SMCO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCO3	HGNC	protein_coding	OTTHUMT00000394738.1		0.00	73	0	C	NM_001013698		14959109	-1			no_errors	ENST00000316048	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
SNAI2	6591	genome.wustl.edu	37	8	49832485	49832485	+	Missense_Mutation	SNP	A	A	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr8:49832485A>C	ENST00000396822.1	-	3	952	c.595T>G	c.(595-597)Ttg>Gtg	p.L199V	SNAI2_ENST00000020945.1_Missense_Mutation_p.L199V			O43623	SNAI2_HUMAN	snail family zinc finger 2	199					canonical Wnt signaling pathway (GO:0060070)|cartilage morphogenesis (GO:0060536)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to ionizing radiation (GO:0071479)|desmosome disassembly (GO:0035921)|embryo development (GO:0009790)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|epithelium development (GO:0060429)|negative regulation of anoikis (GO:2000811)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-cell adhesion by negative regulation of transcription from RNA polymerase II promoter (GO:1900387)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|negative regulation of vitamin D receptor signaling pathway (GO:0070563)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone acetylation (GO:0035066)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of chemokine production (GO:0032642)|regulation of osteoblast differentiation (GO:0045667)|regulation of tight junction assembly (GO:2000810)|sensory perception of sound (GO:0007605)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)	18		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				CCTTGAAGCAACCAGGGTCTG	0.488																																																	0													104.0	110.0	108.0					8																	49832485		2203	4300	6503	SO:0001583	missense	0			U97060	CCDS6146.1	8q11.21	2013-05-23	2013-05-23	2002-02-28	ENSG00000019549	ENSG00000019549		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11094	protein-coding gene	gene with protein product		602150	"""slug homolog, zinc finger protein (chicken)"", ""snail homolog 2 (Drosophila)"""	SLUG		9337409, 9721220	Standard	NM_003068		Approved	SLUGH1, SNAIL2	uc003xqp.3	O43623	OTTHUMG00000149912	ENST00000396822.1:c.595T>G	8.37:g.49832485A>C	ENSP00000380034:p.Leu199Val		B2R6P6|Q53FC1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L199V	ENST00000396822.1	37	c.595	CCDS6146.1	8	.	.	.	.	.	.	.	.	.	.	A	16.58	3.163778	0.57476	.	.	ENSG00000019549	ENST00000020945;ENST00000396822	T;T	0.07567	3.18;3.18	5.34	-3.24	0.05094	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.11537	0.0281	N	0.12920	0.275	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.00015	-1.2400	10	0.33141	T	0.24	-8.268	14.7629	0.69619	0.4034:0.0:0.5966:0.0	.	199	O43623	SNAI2_HUMAN	V	199	ENSP00000020945:L199V;ENSP00000380034:L199V	ENSP00000020945:L199V	L	-	1	2	SNAI2	49995038	0.993000	0.37304	0.950000	0.38849	0.985000	0.73830	0.295000	0.19065	-0.852000	0.04141	-0.250000	0.11733	TTG	SNAI2	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000019549		0.488	SNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI2	HGNC	protein_coding	OTTHUMT00000313873.2	-	0.00	63	0	A	NM_003068		49832485	-1	tier1	-	no_errors	ENST00000020945	ensembl	human	known	74_37	missense	35.19	35	19	SNP	0.992	C
SOBP	55084	genome.wustl.edu	37	6	107955614	107955614	+	Silent	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:107955614C>T	ENST00000317357.5	+	6	2225	c.1566C>T	c.(1564-1566)acC>acT	p.T522T		NM_018013.3	NP_060483.3			sine oculis binding protein homolog (Drosophila)											endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	26		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		CGCCCCCGACCCTGCTCGTGC	0.667																																																	0													15.0	18.0	17.0					6																	107955614		2033	4157	6190	SO:0001819	synonymous_variant	0			AK001021	CCDS43488.1	6q21	2007-03-15			ENSG00000112320	ENSG00000112320			29256	protein-coding gene	gene with protein product		613667					Standard	NM_018013		Approved	FLJ10159	uc003prx.3	A7XYQ1	OTTHUMG00000015312	ENST00000317357.5:c.1566C>T	6.37:g.107955614C>T				Silent	SNP	NULL	p.T522	ENST00000317357.5	37	c.1566	CCDS43488.1	6																																																																																			SOBP	-	NULL	ENSG00000112320		0.667	SOBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOBP	HGNC	protein_coding	OTTHUMT00000041693.2	-	0.00	70	0	C	NM_018013		107955614	+1	tier1	-	no_errors	ENST00000317357	ensembl	human	known	74_37	silent	12.50	42	6	SNP	1.000	T
SORBS1	10580	genome.wustl.edu	37	10	97194450	97194450	+	Missense_Mutation	SNP	C	C	T	rs139115529		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr10:97194450C>T	ENST00000361941.3	-	3	127	c.101G>A	c.(100-102)cGc>cAc	p.R34H	SORBS1_ENST00000393949.1_Missense_Mutation_p.R34H|SORBS1_ENST00000354106.3_Missense_Mutation_p.R34H|SORBS1_ENST00000306402.6_Missense_Mutation_p.R34H|SORBS1_ENST00000371241.1_Intron|SORBS1_ENST00000371246.2_Missense_Mutation_p.R34H|SORBS1_ENST00000607232.1_Intron|SORBS1_ENST00000371245.3_Missense_Mutation_p.R34H|SORBS1_ENST00000371239.1_Intron|SORBS1_ENST00000371247.2_Missense_Mutation_p.R34H|SORBS1_ENST00000371249.2_Intron|SORBS1_ENST00000347291.4_Missense_Mutation_p.R34H|SORBS1_ENST00000474353.2_Intron|SORBS1_ENST00000277982.5_Missense_Mutation_p.R34H|SORBS1_ENST00000371227.4_Missense_Mutation_p.R34H|SORBS1_ENST00000353505.5_Missense_Mutation_p.R34H	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		AGAAATAGAGCGTGCGCGTAA	0.473																																																	0													94.0	94.0	94.0					10																	97194450		2203	4300	6503	SO:0001583	missense	0			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.101G>A	10.37:g.97194450C>T	ENSP00000355136:p.Arg34His			Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain	p.R34H	ENST00000361941.3	37	c.101	CCDS31255.1	10	.	.	.	.	.	.	.	.	.	.	C	25.9	4.689918	0.88735	.	.	ENSG00000095637	ENST00000371245;ENST00000306402;ENST00000371247;ENST00000371227;ENST00000371246;ENST00000393949;ENST00000353505;ENST00000347291;ENST00000361941;ENST00000277982;ENST00000354106	T;T;T;T;T;T;T;T;T;T;T	0.23348	2.4;2.1;2.22;2.0;2.54;1.98;2.4;1.91;2.22;2.54;1.98	5.82	5.82	0.92795	.	0.000000	0.42964	D	0.000639	T	0.40570	0.1122	N	0.24115	0.695	0.25844	N	0.984029	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;P;D;D	0.83275	0.996;0.996;0.996;0.902;0.996;0.996	T	0.30621	-0.9972	10	0.87932	D	0	-4.1391	19.0835	0.93192	0.0:1.0:0.0:0.0	.	34;34;34;34;34;34	Q9BX66-11;Q9BX66-9;Q9BX66-3;Q9BX66;Q9BX66-2;Q9BX66-6	.;.;.;SRBS1_HUMAN;.;.	H	34	ENSP00000360291:R34H;ENSP00000302556:R34H;ENSP00000360293:R34H;ENSP00000360271:R34H;ENSP00000360292:R34H;ENSP00000377521:R34H;ENSP00000343998:R34H;ENSP00000277985:R34H;ENSP00000355136:R34H;ENSP00000277982:R34H;ENSP00000277984:R34H	ENSP00000277982:R34H	R	-	2	0	SORBS1	97184440	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	5.431000	0.66507	2.767000	0.95098	0.655000	0.94253	CGC	SORBS1	-	NULL	ENSG00000095637		0.473	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SORBS1	HGNC	protein_coding	OTTHUMT00000049517.1	-	0.00	48	0	C			97194450	-1	tier1	rs139115529	no_errors	ENST00000361941	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
SOX10	6663	genome.wustl.edu	37	22	38369997	38369997	+	Silent	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr22:38369997C>T	ENST00000396884.2	-	4	1188	c.906G>A	c.(904-906)ccG>ccA	p.P302P	POLR2F_ENST00000405557.1_Intron|POLR2F_ENST00000407936.1_Intron|SOX10_ENST00000360880.2_Silent_p.P302P	NM_006941.3	NP_008872.1	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10	302					anatomical structure morphogenesis (GO:0009653)|cell maturation (GO:0048469)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|enteric nervous system development (GO:0048484)|in utero embryonic development (GO:0001701)|melanocyte differentiation (GO:0030318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system development (GO:0007422)|positive regulation of gliogenesis (GO:0014015)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extrinsic component of mitochondrial outer membrane (GO:0031315)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|transcription coactivator activity (GO:0003713)			NS(6)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|skin(2)	20	Melanoma(58;0.045)					GCCCATTGGGCGGCAGGTACT	0.602																																					Melanoma(39;342 1098 6220 32775 40068)|GBM(21;140 497 5227 16059 19275)												0													85.0	76.0	79.0					22																	38369997		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13964.1	22q13.1	2014-09-17			ENSG00000100146	ENSG00000100146		"""SRY (sex determining region Y)-boxes"""	11190	protein-coding gene	gene with protein product	"""dominant megacolon, mouse, human homolog of"""	602229				9462749, 10441344, 12944398	Standard	NM_006941		Approved	DOM, WS4, WS2E	uc003aun.1	P56693	OTTHUMG00000149913	ENST00000396884.2:c.906G>A	22.37:g.38369997C>T			B4DV62|Q6FHW7	Silent	SNP	pfam_Sox_N,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.P302	ENST00000396884.2	37	c.906	CCDS13964.1	22																																																																																			SOX10	-	NULL	ENSG00000100146		0.602	SOX10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SOX10	HGNC	protein_coding	OTTHUMT00000313875.1		0.00	71	0	C	NM_006941		38369997	-1			no_errors	ENST00000360880	ensembl	human	known	74_37	silent	6.90	53	4	SNP	0.319	T
SP6	80320	genome.wustl.edu	37	17	45925508	45925508	+	Silent	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:45925508C>T	ENST00000536300.1	-	2	619	c.288G>A	c.(286-288)ctG>ctA	p.L96L	SP6_ENST00000342234.2_Silent_p.L96L	NM_001258248.1	NP_001245177.1	Q3SY56	SP6_HUMAN	Sp6 transcription factor	96					positive regulation of cell proliferation (GO:0008284)|regulation of odontogenesis (GO:0042481)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(5)|prostate(1)|skin(1)	8						TGTCCGGCTGCAGGAGCTTGG	0.642																																																	0													29.0	29.0	29.0					17																	45925508		2202	4299	6501	SO:0001819	synonymous_variant	0				CCDS11520.1	17q21.32	2013-01-08			ENSG00000189120	ENSG00000189120		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14530	protein-coding gene	gene with protein product	"""epiprofin"""	608613				11087666, 14551215	Standard	NM_001258248		Approved	KLF14, Epfn	uc002img.2	Q3SY56	OTTHUMG00000132067	ENST00000536300.1:c.288G>A	17.37:g.45925508C>T			B3KXS4	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L96	ENST00000536300.1	37	c.288	CCDS11520.1	17																																																																																			SP6	-	NULL	ENSG00000189120		0.642	SP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SP6	HGNC	protein_coding	OTTHUMT00000441395.1	-	0.00	44	0	C	NM_199262		45925508	-1	tier1	-	no_errors	ENST00000342234	ensembl	human	known	74_37	silent	8.00	46	4	SNP	1.000	T
NPR2	4882	genome.wustl.edu	37	9	35808160	35808160	+	Intron	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:35808160C>T	ENST00000342694.2	+	19	2967				SPAG8_ENST00000479751.1_5'Flank|SPAG8_ENST00000340291.2_3'UTR	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2						bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	ACTGGGCCTGCTTTACCTCCT	0.478																																																	0													252.0	182.0	206.0					9																	35808160		2203	4300	6503	SO:0001627	intron_variant	0			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.2713-346C>T	9.37:g.35808160C>T			B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	RNA	SNP	-	NULL	ENST00000342694.2	37	NULL	CCDS6590.1	9																																																																																			SPAG8	-	-	ENSG00000137098		0.478	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG8	HGNC	protein_coding	OTTHUMT00000052345.1	-	0.00	82	0	C			35808160	-1	tier1	-	no_errors	ENST00000463889	ensembl	human	known	74_37	rna	5.48	69	4	SNP	0.002	T
SPTBN1	6711	genome.wustl.edu	37	2	54864938	54864938	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:54864938G>T	ENST00000356805.4	+	18	4137	c.3856G>T	c.(3856-3858)Gag>Tag	p.E1286*	SPTBN1_ENST00000333896.5_Nonsense_Mutation_p.E1273*	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1286					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			AGATTGTCAAGAGGTATGTTA	0.383																																																	0													145.0	147.0	146.0					2																	54864938		2203	4300	6503	SO:0001587	stop_gained	0				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.3856G>T	2.37:g.54864938G>T	ENSP00000349259:p.Glu1286*		B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Nonsense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.E1286*	ENST00000356805.4	37	c.3856	CCDS33198.1	2	.	.	.	.	.	.	.	.	.	.	G	47	13.009946	0.99713	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.7706	0.96363	0.0:0.0:1.0:0.0	.	.	.	.	X	1286;1273	.	ENSP00000334156:E1273X	E	+	1	0	SPTBN1	54718442	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.783000	0.99037	2.697000	0.92050	0.655000	0.94253	GAG	SPTBN1	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000115306		0.383	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN1	HGNC	protein_coding	OTTHUMT00000258115.3	-	0.00	54	0	G			54864938	+1	tier1	-	no_errors	ENST00000356805	ensembl	human	known	74_37	nonsense	9.09	40	4	SNP	1.000	T
SPTBN2	6712	genome.wustl.edu	37	11	66481592	66481592	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:66481592A>G	ENST00000533211.1	-	7	957	c.626T>C	c.(625-627)cTa>cCa	p.L209P	RN7SL12P_ENST00000473849.2_RNA|SPTBN2_ENST00000309996.2_Missense_Mutation_p.L209P|SPTBN2_ENST00000529997.1_Missense_Mutation_p.L209P			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	209	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						GTTGAAAGCTAGTCCATCTCT	0.493																																																	0													167.0	132.0	144.0					11																	66481592		2200	4295	6495	SO:0001583	missense	0			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.626T>C	11.37:g.66481592A>G	ENSP00000432568:p.Leu209Pro		O14872|O14873	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.L209P	ENST00000533211.1	37	c.626	CCDS8150.1	11	.	.	.	.	.	.	.	.	.	.	A	23.7	4.452929	0.84209	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997;ENST00000443262	T;T;T	0.62498	0.02;0.02;0.02	4.8	4.8	0.61643	Calponin homology domain (5);	0.000000	0.64402	D	0.000001	D	0.87394	0.6166	H	0.99249	4.485	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92125	0.5707	10	0.87932	D	0	.	13.4493	0.61161	1.0:0.0:0.0:0.0	.	209	O15020	SPTN2_HUMAN	P	209	ENSP00000432568:L209P;ENSP00000311489:L209P;ENSP00000433593:L209P	ENSP00000311489:L209P	L	-	2	0	SPTBN2	66238168	1.000000	0.71417	0.995000	0.50966	0.949000	0.60115	9.081000	0.94049	2.023000	0.59567	0.374000	0.22700	CTA	SPTBN2	-	pirsf_Spectrin_bsu,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000173898		0.493	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN2	HGNC	protein_coding	OTTHUMT00000393892.2	-	0.00	44	0	A	NM_006946		66481592	-1	tier1	-	no_errors	ENST00000309996	ensembl	human	known	74_37	missense	10.26	34	4	SNP	1.000	G
STAP2	55620	genome.wustl.edu	37	19	4325487	4325487	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:4325487G>T	ENST00000594605.1	-	10	1008	c.885C>A	c.(883-885)gaC>gaA	p.D295E	STAP2_ENST00000600324.1_Missense_Mutation_p.D295E|STAP2_ENST00000597593.1_5'UTR	NM_001013841.1	NP_001013863.1	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	295	Pro-rich.					cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGGCAGCTTGTCCTGGCTAG	0.592																																																	0													91.0	97.0	95.0					19																	4325487		2203	4300	6503	SO:0001583	missense	0			AJ245719	CCDS12128.1, CCDS45926.1	19p13.3	2011-05-03	2007-08-09		ENSG00000178078	ENSG00000178078			30430	protein-coding gene	gene with protein product		607881				10980601, 11441184	Standard	XM_005259592		Approved	STAP-2, BKS	uc002mac.3	Q9UGK3		ENST00000594605.1:c.885C>A	19.37:g.4325487G>T	ENSP00000471052:p.Asp295Glu		A6NKK3|Q9NXI2	Missense_Mutation	SNP	pfscan_SH2	p.D295E	ENST00000594605.1	37	c.885	CCDS45926.1	19	.	.	.	.	.	.	.	.	.	.	G	9.987	1.229682	0.22542	.	.	ENSG00000178078	ENST00000314714;ENST00000424810	.	.	.	4.77	3.72	0.42706	.	0.736773	0.12041	U	0.505017	T	0.20536	0.0494	N	0.08118	0	0.22648	N	0.998892	B;P	0.40731	0.0;0.728	B;B	0.36666	0.001;0.23	T	0.07654	-1.0761	9	0.87932	D	0	-12.5199	11.4356	0.50066	0.0:0.1807:0.8193:0.0	.	295;295	Q9UGK3-2;Q9UGK3	.;STAP2_HUMAN	E	295	.	ENSP00000317912:D295E	D	-	3	2	STAP2	4276487	0.298000	0.24417	0.952000	0.39060	0.443000	0.32047	1.342000	0.33919	1.017000	0.39495	-0.425000	0.05940	GAC	STAP2	-	NULL	ENSG00000178078		0.592	STAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	STAP2	HGNC	protein_coding	OTTHUMT00000458114.2		0.00	52	0	G	NM_001013841		4325487	-1			no_errors	ENST00000600324	ensembl	human	known	74_37	missense	9.30	39	4	SNP	0.740	T
SZT2	23334	genome.wustl.edu	37	1	43909268	43909268	+	Splice_Site	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:43909268C>T	ENST00000562955.1	+	61	8455	c.8455C>T	c.(8455-8457)Cgg>Tgg	p.R2819W	SZT2_ENST00000372442.1_Splice_Site_p.R1977W	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	2876					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)		p.R1977W(2)		NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						ACTCTCATAGCGGCGCCATCG	0.607																																																	2	Substitution - Missense(2)	NS(2)											50.0	52.0	51.0					1																	43909268		2203	4300	6503	SO:0001630	splice_region_variant	0			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.8455-1C>T	1.37:g.43909268C>T			A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	NULL	p.R2819W	ENST00000562955.1	37	c.8455	CCDS30694.2	1	.	.	.	.	.	.	.	.	.	.	C	12.76	2.034298	0.35893	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.36	3.45	0.39498	.	0.198936	0.39834	N	0.001260	T	0.47192	0.1432	N	0.22421	0.69	0.28974	N	0.88904	D	0.89917	1.0	D	0.68765	0.96	T	0.46076	-0.9217	8	.	.	.	.	13.9931	0.64378	0.4641:0.5359:0.0:0.0	.	2819	Q5T011-5	.	W	1977	.	.	R	+	1	2	SZT2	43681855	1.000000	0.71417	0.998000	0.56505	0.378000	0.30076	3.334000	0.52097	0.616000	0.30141	-0.175000	0.13238	CGG	SZT2	-	NULL	ENSG00000198198		0.607	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SZT2	HGNC	protein_coding	OTTHUMT00000019517.3		0.00	19	0	C	NM_015284	Missense_Mutation	43909268	+1			no_errors	ENST00000562955	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
TBC1D13	54662	genome.wustl.edu	37	9	131553894	131553894	+	Silent	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:131553894G>T	ENST00000372648.5	+	5	372	c.222G>T	c.(220-222)ctG>ctT	p.L74L	TBC1D13_ENST00000466056.1_3'UTR|TBC1D13_ENST00000223865.8_Silent_p.L74L|TBC1D13_ENST00000539497.1_Intron	NM_018201.3	NP_060671.3	Q9NVG8	TBC13_HUMAN	TBC1 domain family, member 13	74	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	6						CCCAGTTCCTGAGGGAAATGA	0.577																																																	0													96.0	85.0	88.0					9																	131553894		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001605	CCDS6911.1, CCDS69677.1	9q34.13	2013-07-09			ENSG00000107021	ENSG00000107021			25571	protein-coding gene	gene with protein product						22762500	Standard	XM_005252060		Approved	FLJ10743	uc010myj.3	Q9NVG8	OTTHUMG00000020760	ENST00000372648.5:c.222G>T	9.37:g.131553894G>T			A7E2E7|B3KW04|B9EGJ8|Q5T270|Q5T271	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.L74	ENST00000372648.5	37	c.222	CCDS6911.1	9																																																																																			TBC1D13	-	superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000107021		0.577	TBC1D13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D13	HGNC	protein_coding	OTTHUMT00000054496.1		0.00	32	0	G	NM_018201		131553894	+1			no_errors	ENST00000372648	ensembl	human	known	74_37	silent	6.25	30	2	SNP	1.000	T
TCF4	6925	genome.wustl.edu	37	18	53017614	53017614	+	Silent	SNP	T	T	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr18:53017614T>C	ENST00000356073.4	-	8	1136	c.525A>G	c.(523-525)aaA>aaG	p.K175K	TCF4_ENST00000568673.1_Silent_p.K151K|TCF4_ENST00000565018.2_Silent_p.K175K|TCF4_ENST00000564228.1_Silent_p.K104K|TCF4_ENST00000570177.2_Silent_p.K45K|TCF4_ENST00000566286.1_Silent_p.K173K|TCF4_ENST00000561992.1_Silent_p.K45K|TCF4_ENST00000544241.2_Silent_p.K104K|TCF4_ENST00000568740.1_Silent_p.K150K|TCF4_ENST00000543082.1_Silent_p.K133K|TCF4_ENST00000537578.1_Silent_p.K151K|TCF4_ENST00000564999.1_Silent_p.K175K|TCF4_ENST00000398339.1_Silent_p.K277K|TCF4_ENST00000564403.2_Silent_p.K175K|TCF4_ENST00000354452.3_Silent_p.K175K|TCF4_ENST00000566279.1_Intron|TCF4_ENST00000540999.1_Silent_p.K151K|TCF4_ENST00000567880.1_Intron|TCF4_ENST00000537856.3_Silent_p.K45K	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	175					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		CTGGAGGAACTTTTCGAACTT	0.368																																																	0													145.0	125.0	132.0					18																	53017614		2203	4300	6503	SO:0001819	synonymous_variant	0			M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.525A>G	18.37:g.53017614T>C			B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Silent	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.K277	ENST00000356073.4	37	c.831	CCDS11960.1	18																																																																																			TCF4	-	NULL	ENSG00000196628		0.368	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	TCF4	HGNC	protein_coding	OTTHUMT00000256014.1	-	0.00	57	0	T	NM_003199		53017614	-1	tier1	-	no_errors	ENST00000398339	ensembl	human	known	74_37	silent	31.67	41	19	SNP	1.000	C
TCIRG1	10312	genome.wustl.edu	37	11	67817454	67817454	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:67817454A>G	ENST00000265686.3	+	17	2147	c.2039A>G	c.(2038-2040)gAc>gGc	p.D680G	TCIRG1_ENST00000532635.1_Missense_Mutation_p.D464G|RP11-802E16.3_ENST00000534517.1_RNA|RP11-802E16.3_ENST00000529934.1_RNA|RP11-802E16.3_ENST00000526897.1_RNA	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	680					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						GGGTTGCTGGACCTGCCTGAC	0.647																																																	0													44.0	44.0	44.0					11																	67817454		2200	4294	6494	SO:0001583	missense	0			AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.2039A>G	11.37:g.67817454A>G	ENSP00000265686:p.Asp680Gly		O75877|Q8WVC5	Missense_Mutation	SNP	pfam_V-ATPase_116kDa_su	p.D680G	ENST00000265686.3	37	c.2039	CCDS8177.1	11	.	.	.	.	.	.	.	.	.	.	A	3.681	-0.065573	0.07273	.	.	ENSG00000110719	ENST00000265686;ENST00000532635;ENST00000546315	D;D	0.85773	-2.03;-2.03	3.91	0.0901	0.14462	.	0.706963	0.13741	N	0.365995	T	0.65616	0.2708	N	0.12637	0.245	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.48843	-0.8999	10	0.18276	T	0.48	-28.1401	4.1411	0.10194	0.6109:0.1854:0.2037:0.0	.	680	Q13488	VPP3_HUMAN	G	680;464;38	ENSP00000265686:D680G;ENSP00000434407:D464G	ENSP00000265686:D680G	D	+	2	0	TCIRG1	67574030	0.029000	0.19370	0.009000	0.14445	0.004000	0.04260	1.199000	0.32235	-0.086000	0.12550	-0.609000	0.04063	GAC	TCIRG1	-	pfam_V-ATPase_116kDa_su	ENSG00000110719		0.647	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCIRG1	HGNC	protein_coding	OTTHUMT00000394305.1	-	0.00	23	0	A	NM_006019		67817454	+1	tier1	-	no_errors	ENST00000265686	ensembl	human	known	74_37	missense	24.14	22	7	SNP	0.002	G
TCTE1	202500	genome.wustl.edu	37	6	44253828	44253828	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:44253828A>G	ENST00000371505.4	-	3	841	c.719T>C	c.(718-720)cTg>cCg	p.L240P	TCTE1_ENST00000371503.3_Missense_Mutation_p.L87P|RP11-444E17.6_ENST00000505802.1_Intron|TMEM151B_ENST00000438774.2_Intron|TCTE1_ENST00000371504.1_Missense_Mutation_p.L87P	NM_182539.3	NP_872345.2	Q5JU00	TCTE1_HUMAN	t-complex-associated-testis-expressed 1	240										breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CAGCTCCTCCAGGTGGCTCAG	0.612																																																	0													107.0	100.0	102.0					6																	44253828		2203	4300	6503	SO:0001583	missense	0			BC035022	CCDS4910.1	6q21.1	2014-07-18			ENSG00000146221	ENSG00000146221			11693	protein-coding gene	gene with protein product		186975				2568335, 8646886	Standard	NM_182539		Approved	D6S46, MGC33600, FAP155	uc003oxi.2	Q5JU00	OTTHUMG00000014763	ENST00000371505.4:c.719T>C	6.37:g.44253828A>G	ENSP00000360560:p.Leu240Pro		B4DX59|Q8IYS6	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.L240P	ENST00000371505.4	37	c.719	CCDS4910.1	6	.	.	.	.	.	.	.	.	.	.	A	21.2	4.119806	0.77323	.	.	ENSG00000146221	ENST00000371505;ENST00000371503;ENST00000371504	T;T;T	0.75477	-0.94;0.01;0.01	4.89	4.89	0.63831	.	0.069585	0.64402	D	0.000016	T	0.81833	0.4906	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84965	0.0879	10	0.87932	D	0	-11.5301	14.4897	0.67642	1.0:0.0:0.0:0.0	.	240	Q5JU00	TCTE1_HUMAN	P	240;87;87	ENSP00000360560:L240P;ENSP00000360558:L87P;ENSP00000360559:L87P	ENSP00000360558:L87P	L	-	2	0	TCTE1	44361806	1.000000	0.71417	0.968000	0.41197	0.982000	0.71751	8.933000	0.92911	1.832000	0.53329	0.379000	0.24179	CTG	TCTE1	-	NULL	ENSG00000146221		0.612	TCTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTE1	HGNC	protein_coding	OTTHUMT00000040736.1	-	0.00	48	0	A	NM_182539		44253828	-1	tier1	-	no_errors	ENST00000371505	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	G
TDRD15	100129278	genome.wustl.edu	37	2	21365034	21365034	+	Silent	SNP	A	A	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:21365034A>G	ENST00000405799.1	+	4	5025	c.4695A>G	c.(4693-4695)aaA>aaG	p.K1565K				B5MCY1	TDR15_HUMAN	tudor domain containing 15	1565							hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)										AAGAAGAAAAAAAATCCCCTT	0.249																																																	0																																										SO:0001819	synonymous_variant	0					2p24.1	2013-01-23	2013-01-23	2013-01-23	ENSG00000218819	ENSG00000218819		"""Tudor domain containing"""	45037	protein-coding gene	gene with protein product							Standard	XR_425376		Approved			B5MCY1	OTTHUMG00000151795	ENST00000405799.1:c.4695A>G	2.37:g.21365034A>G				Silent	SNP	pfam_Tudor,superfamily_Staphylococal_nuclease_OB-fold,smart_Tudor,pfscan_Tudor	p.K1565	ENST00000405799.1	37	c.4695		2																																																																																			TDRD15	-	pfam_Tudor	ENSG00000218819		0.249	TDRD15-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	TDRD15	HGNC	protein_coding	OTTHUMT00000323948.1	-	0.00	37	0	A			21365034	+1	tier1	-	no_errors	ENST00000405799	ensembl	human	novel	74_37	silent	33.33	18	9	SNP	0.000	G
THADA	63892	genome.wustl.edu	37	2	43802152	43802152	+	Missense_Mutation	SNP	G	G	A	rs138256193		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:43802152G>A	ENST00000405006.4	-	11	1403	c.1052C>T	c.(1051-1053)aCg>aTg	p.T351M	THADA_ENST00000405975.2_Missense_Mutation_p.T351M|THADA_ENST00000415080.2_Missense_Mutation_p.T61M|THADA_ENST00000330266.7_Missense_Mutation_p.T61M|THADA_ENST00000404790.1_Missense_Mutation_p.T351M|THADA_ENST00000403856.1_Missense_Mutation_p.T351M|THADA_ENST00000402360.2_Missense_Mutation_p.T351M	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	351								p.T351M(1)		breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				CATTTCCAGCGTTGGCTCTTT	0.363													G|||	1	0.000199681	0.0	0.0	5008	,	,		16807	0.0		0.001	False		,,,				2504	0.0																1	Substitution - Missense(1)	endometrium(1)						G	MET/THR,MET/THR	1,3631		0,1,1815	96.0	94.0	94.0		1052,1052	4.7	1.0	2	dbSNP_134	94	3,8145		0,3,4071	yes	missense,missense	THADA	NM_001083953.1,NM_022065.4	81,81	0,4,5886	AA,AG,GG		0.0368,0.0275,0.034	possibly-damaging,possibly-damaging	351/1954,351/1954	43802152	4,11776	1816	4074	5890	SO:0001583	missense	0			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.1052C>T	2.37:g.43802152G>A	ENSP00000385995:p.Thr351Met		A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	pfam_DUF2428_death-receptor-like,superfamily_ARM-type_fold	p.T351M	ENST00000405006.4	37	c.1052	CCDS46268.1	2	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	19.14	3.769643	0.69992	2.75E-4	3.68E-4	ENSG00000115970	ENST00000330266;ENST00000405975;ENST00000356975;ENST00000415080;ENST00000405006;ENST00000402360;ENST00000404790;ENST00000403856	T;T;T;T;T;T;T	0.65178	1.44;1.44;2.67;1.44;-0.14;-0.14;1.44	5.63	4.73	0.59995	.	0.047096	0.85682	D	0.000000	T	0.74465	0.3720	L	0.57536	1.79	0.39859	D	0.973355	D;D;D;D;D	0.89917	1.0;0.997;1.0;1.0;0.999	D;P;P;P;P	0.68621	0.959;0.862;0.899;0.794;0.791	T	0.77710	-0.2486	10	0.72032	D	0.01	1.7807	14.8661	0.70416	0.0:0.2688:0.7312:0.0	.	351;351;351;61;351	B5MC89;Q8IY32;Q6YHU6-5;C9JJB1;Q6YHU6	.;.;.;.;THADA_HUMAN	M	61;351;351;61;351;351;351;351	ENSP00000331105:T61M;ENSP00000386088:T351M;ENSP00000416048:T61M;ENSP00000385995:T351M;ENSP00000385441:T351M;ENSP00000384266:T351M;ENSP00000385469:T351M	ENSP00000331105:T61M	T	-	2	0	THADA	43655656	0.998000	0.40836	0.994000	0.49952	0.944000	0.59088	2.198000	0.42705	2.658000	0.90341	0.561000	0.74099	ACG	THADA	-	NULL	ENSG00000115970		0.363	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THADA	HGNC	protein_coding	OTTHUMT00000326070.3		0.00	30	0	G	NM_022065		43802152	-1			no_errors	ENST00000405006	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.997	A
TIE1	7075	genome.wustl.edu	37	1	43778258	43778258	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:43778258T>G	ENST00000372476.3	+	12	1992	c.1913T>G	c.(1912-1914)cTt>cGt	p.L638R	TIE1_ENST00000433781.2_Missense_Mutation_p.L283R	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	638	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GCACACGTGCTTCTGCCCCCC	0.662																																																	0													34.0	34.0	34.0					1																	43778258		2200	4295	6495	SO:0001583	missense	0			BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.1913T>G	1.37:g.43778258T>G	ENSP00000361554:p.Leu638Arg		B5A949|B5A950	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_EG-like_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L638R	ENST00000372476.3	37	c.1913	CCDS482.1	1	.	.	.	.	.	.	.	.	.	.	T	0.007	-2.016971	0.00418	.	.	ENSG00000066056	ENST00000372476;ENST00000372475;ENST00000433781	T;T	0.50813	0.73;0.73	5.43	1.54	0.23209	Fibronectin, type III (2);	0.760949	0.10721	N	0.641764	T	0.31040	0.0784	L	0.38531	1.155	0.19575	N	0.999966	B;B;P;B;B	0.41366	0.0;0.0;0.747;0.0;0.0	B;B;B;B;B	0.40782	0.001;0.001;0.34;0.0;0.001	T	0.12889	-1.0530	10	0.06494	T	0.89	.	4.6592	0.12634	0.4581:0.0833:0.0:0.4586	.	283;593;638;283;638	E9PG63;B4DTW8;B5A952;B4DKW0;P35590	.;.;.;.;TIE1_HUMAN	R	638;41;283	ENSP00000361554:L638R;ENSP00000411728:L283R	ENSP00000361553:L41R	L	+	2	0	TIE1	43550845	0.741000	0.28217	0.882000	0.34594	0.027000	0.11550	0.795000	0.26972	-0.003000	0.14444	-0.490000	0.04691	CTT	TIE1	-	superfamily_Fibronectin_type3	ENSG00000066056		0.662	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIE1	HGNC	protein_coding	OTTHUMT00000019011.1	-	0.00	53	0	T	NM_005424		43778258	+1	tier1	-	no_errors	ENST00000372476	ensembl	human	known	74_37	missense	16.67	45	9	SNP	0.466	G
TMEM56	148534	genome.wustl.edu	37	1	95614300	95614300	+	Silent	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:95614300C>T	ENST00000370203.4	+	3	489	c.198C>T	c.(196-198)ggC>ggT	p.G66G	RP11-57H12.6_ENST00000604534.1_Silent_p.G66G|TMEM56_ENST00000463375.1_3'UTR	NM_001199679.1|NM_152487.2	NP_001186608.1|NP_689700.1	Q96MV1	TMM56_HUMAN	transmembrane protein 56	66	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(2)|skin(1)|urinary_tract(1)	12		all_lung(203;0.0232)|Lung NSC(277;0.0739)		all cancers(265;0.133)		GTATTTTTGGCCTGTACATTT	0.313																																																	0													222.0	209.0	213.0					1																	95614300		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS753.1	1p21.3	2008-02-05			ENSG00000152078	ENSG00000152078			26477	protein-coding gene	gene with protein product							Standard	NM_152487		Approved	FLJ31842	uc001drb.3	Q96MV1	OTTHUMG00000010847	ENST00000370203.4:c.198C>T	1.37:g.95614300C>T			B2RPI2|D3DT48	Silent	SNP	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	p.G66	ENST00000370203.4	37	c.198	CCDS753.1	1																																																																																			TMEM56	-	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	ENSG00000152078		0.313	TMEM56-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TMEM56	HGNC	protein_coding	OTTHUMT00000029935.1	-	0.00	68	0	C	NM_152487		95614300	+1	tier1	-	no_errors	ENST00000370203	ensembl	human	novel	74_37	silent	5.88	80	5	SNP	0.994	T
TMPRSS5	80975	genome.wustl.edu	37	11	113563829	113563829	+	Missense_Mutation	SNP	C	C	T	rs536521016		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:113563829C>T	ENST00000299882.5	-	9	1076	c.928G>A	c.(928-930)Gcc>Acc	p.A310T	TMPRSS5_ENST00000544634.1_Missense_Mutation_p.A241T|TMPRSS5_ENST00000540540.1_Missense_Mutation_p.A51T|TMPRSS5_ENST00000536856.1_Missense_Mutation_p.A51T|TMPRSS5_ENST00000538955.1_Missense_Mutation_p.A266T|TMPRSS5_ENST00000545265.1_5'UTR|TMPRSS5_ENST00000544476.1_Missense_Mutation_p.A197T|TMPRSS5_ENST00000545579.1_Missense_Mutation_p.A301T	NM_030770.2	NP_110397.2	Q9H3S3	TMPS5_HUMAN	transmembrane protease, serine 5	310	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	peptidase activity (GO:0008233)|scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	10		all_cancers(61;2.71e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.75e-06)|Epithelial(105;6.34e-05)|all cancers(92;0.000502)		CTCAGGAGGGCGACGTCGTAG	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		15425	0.001		0.0	False		,,,				2504	0.0																0													25.0	31.0	29.0					11																	113563829		1963	4149	6112	SO:0001583	missense	0			AB028140	CCDS44735.1, CCDS73390.1, CCDS73391.1, CCDS73392.1, CCDS73393.1	11q	2010-04-13	2008-07-31		ENSG00000166682	ENSG00000166682		"""Serine peptidases / Transmembrane"""	14908	protein-coding gene	gene with protein product	"""spinesin"""	606751					Standard	NM_030770		Approved	MGC141886, MGC148044	uc001poc.4	Q9H3S3	OTTHUMG00000168186	ENST00000299882.5:c.928G>A	11.37:g.113563829C>T	ENSP00000299882:p.Ala310Thr			Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,superfamily_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.A310T	ENST00000299882.5	37	c.928	CCDS44735.1	11	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909172	0.72868	.	.	ENSG00000166682	ENST00000536856;ENST00000540540;ENST00000299882;ENST00000545579;ENST00000538955;ENST00000544634;ENST00000544476	T;T;T;T;T;T;T	0.77750	-1.07;-1.07;-1.12;-1.12;-1.12;-1.07;-1.07	5.38	5.38	0.77491	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.89399	0.6704	M	0.85630	2.765	0.51233	D	0.999918	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.81914	0.992;0.987;0.995;0.981	D	0.90914	0.4778	10	0.87932	D	0	.	17.8935	0.88879	0.0:1.0:0.0:0.0	.	241;51;301;310	F5GYA3;G5EA47;F5GX83;Q9H3S3	.;.;.;TMPS5_HUMAN	T	51;51;310;301;266;241;197	ENSP00000437937:A51T;ENSP00000437761:A51T;ENSP00000299882:A310T;ENSP00000441104:A301T;ENSP00000445528:A266T;ENSP00000440783:A241T;ENSP00000445930:A197T	ENSP00000299882:A310T	A	-	1	0	TMPRSS5	113069039	1.000000	0.71417	0.804000	0.32291	0.054000	0.15201	7.022000	0.76431	2.522000	0.85027	0.462000	0.41574	GCC	TMPRSS5	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	ENSG00000166682		0.642	TMPRSS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS5	HGNC	protein_coding	OTTHUMT00000398652.1		0.00	55	0	C	NM_030770		113563829	-1			no_errors	ENST00000299882	ensembl	human	known	74_37	missense	5.77	49	3	SNP	0.999	T
TOX2	84969	genome.wustl.edu	37	20	42602018	42602018	+	Silent	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr20:42602018C>T	ENST00000358131.5	+	2	346	c.138C>T	c.(136-138)gaC>gaT	p.D46D	TOX2_ENST00000372999.1_5'UTR|TOX2_ENST00000423191.2_5'UTR|TOX2_ENST00000341197.4_Silent_p.D37D	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	46					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			TTGATGGTGACAGTGCCTACG	0.557																																																	0													125.0	107.0	113.0					20																	42602018		2203	4300	6503	SO:0001819	synonymous_variant	0			BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.138C>T	20.37:g.42602018C>T			A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Silent	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.D37	ENST00000358131.5	37	c.111	CCDS42875.1	20																																																																																			TOX2	-	NULL	ENSG00000124191		0.557	TOX2-001	KNOWN	basic|CCDS	protein_coding	TOX2	HGNC	protein_coding	OTTHUMT00000079329.2		0.00	71	0	C			42602018	+1			no_errors	ENST00000341197	ensembl	human	known	74_37	silent	5.88	64	4	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	GRCh37	CM010465|CM900211	TP53	M	rs121912651						151.0	112.0	125.0					17																	7577539		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R248W	ENST00000269305.4	37	c.742	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	66	0	G	NM_000546		7577539	-1	tier1	rs121912651	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	21.05	45	12	SNP	1.000	A
TPO	7173	genome.wustl.edu	37	2	1459924	1459924	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:1459924T>G	ENST00000345913.4	+	7	780	c.689T>G	c.(688-690)cTg>cGg	p.L230R	TPO_ENST00000329066.4_Missense_Mutation_p.L230R|TPO_ENST00000382201.3_Missense_Mutation_p.L230R|TPO_ENST00000497517.2_Intron|TPO_ENST00000382198.1_Missense_Mutation_p.L230R|TPO_ENST00000346956.3_Missense_Mutation_p.L230R|TPO_ENST00000337415.3_Missense_Mutation_p.L230R|TPO_ENST00000349624.3_Missense_Mutation_p.L230R	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	230					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	TCTGACCTCCTGATGGCATGG	0.532																																																	0													125.0	89.0	101.0					2																	1459924		2203	4300	6503	SO:0001583	missense	0				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.689T>G	2.37:g.1459924T>G	ENSP00000318820:p.Leu230Arg		P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_EGF-like_Ca-bd_dom,superfamily_Haem_peroxidase,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.L230R	ENST00000345913.4	37	c.689	CCDS1643.1	2	.	.	.	.	.	.	.	.	.	.	T	16.08	3.021526	0.54576	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464	T;T;T;T;T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69;-0.69;-0.69;-0.69;-0.69	5.04	5.04	0.67666	.	0.240667	0.38720	N	0.001590	D	0.87716	0.6247	M	0.93241	3.395	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.79784	0.989;0.976;0.984;0.993	D	0.91076	0.4896	10	0.87932	D	0	-21.5164	15.0595	0.71942	0.0:0.0:0.0:1.0	.	230;230;230;230	P07202-4;P07202-5;P07202-2;P07202	.;.;.;PERT_HUMAN	R	230;230;230;230;230;230;230;159	ENSP00000337263:L230R;ENSP00000318820:L230R;ENSP00000263886:L230R;ENSP00000332044:L230R;ENSP00000329869:L230R;ENSP00000371636:L230R;ENSP00000371633:L230R;ENSP00000405788:L159R	ENSP00000329869:L230R	L	+	2	0	TPO	1438931	1.000000	0.71417	0.626000	0.29213	0.059000	0.15707	7.133000	0.77259	2.010000	0.58986	0.460000	0.39030	CTG	TPO	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	ENSG00000115705		0.532	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPO	HGNC	protein_coding	OTTHUMT00000206594.2	-	0.00	42	0	T	NM_000547		1459924	+1	tier1	-	no_errors	ENST00000329066	ensembl	human	known	74_37	missense	53.12	15	17	SNP	1.000	G
TPRX1	284355	genome.wustl.edu	37	19	48305105	48305105	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:48305105C>A	ENST00000322175.3	-	2	1318	c.1163G>T	c.(1162-1164)gGg>gTg	p.G388V	TPRX1_ENST00000543508.1_Missense_Mutation_p.G378V|TPRX1_ENST00000535759.1_Missense_Mutation_p.G485V	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	388						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		GGGCTGAGACCCTGAGTGTTT	0.532																																					Esophageal Squamous(123;175 2281 3051 32395)												0													108.0	114.0	112.0					19																	48305105		2203	4300	6503	SO:0001583	missense	0				CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.1163G>T	19.37:g.48305105C>A	ENSP00000323455:p.Gly388Val		A5D8Y3|B2RPL5	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.G485V	ENST00000322175.3	37	c.1454	CCDS33066.1	19	.	.	.	.	.	.	.	.	.	.	t	7.720	0.697024	0.15106	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	D;D	0.94828	-2.37;-3.53	0.468	-0.799	0.10901	.	.	.	.	.	D	0.84275	0.5436	N	0.08118	0	0.09310	N	1	D	0.55172	0.97	B	0.40940	0.344	T	0.78175	-0.2306	8	0.87932	D	0	.	.	.	.	.	388	Q8N7U7	TPRX1_HUMAN	V	388;485;378	ENSP00000323455:G388V;ENSP00000438832:G485V	ENSP00000323455:G388V	G	-	2	0	TPRX1	52996917	0.001000	0.12720	0.003000	0.11579	0.014000	0.08584	0.396000	0.20867	-0.321000	0.08627	-0.320000	0.08662	GGG	TPRX1	-	NULL	ENSG00000178928		0.532	TPRX1-001	KNOWN	basic|CCDS	protein_coding	TPRX1	HGNC	protein_coding	OTTHUMT00000409868.1		0.00	64	0	C	NM_198479		48305105	-1			no_errors	ENST00000535759	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.006	A
TRDN	10345	genome.wustl.edu	37	6	123786032	123786033	+	Intron	INS	-	-	A	rs201431159		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:123786032_123786033insA	ENST00000398178.3	-	10	953				RP11-532N4.2_ENST00000427828.1_RNA|RP11-532N4.2_ENST00000434768.1_RNA|RP11-532N4.2_ENST00000589182.1_RNA|RP11-532N4.2_ENST00000418467.2_RNA|TRDN_ENST00000334268.4_Intron|TRDN_ENST00000546248.1_Frame_Shift_Ins_p.S297fs|RP11-532N4.2_ENST00000587049.1_RNA|RP11-532N4.2_ENST00000587106.2_RNA	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin						cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		AGATCTTTAAGAAAAAAAAAAG	0.386																																																	0																																										SO:0001627	intron_variant	0			U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.931+17->T	6.37:g.123786042_123786042dupA			A5D6W5|F5H2W7|Q6NSB8	Frame_Shift_Ins	INS	pfam_Asp-B-hydro/Triadin_dom	p.S297fs	ENST00000398178.3	37	c.890_889	CCDS55053.1	6																																																																																			TRDN	-	NULL	ENSG00000186439		0.386	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRDN	HGNC	protein_coding			0.00	34	0	-			123786033	-1	tier1		no_errors	ENST00000546248	ensembl	human	known	74_37	frame_shift_ins	12.50	28	4	INS	0.000:0.000	A
TRIM49C	642612	genome.wustl.edu	37	11	89771112	89771112	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr11:89771112G>A	ENST00000448984.1	+	5	1032	c.703G>A	c.(703-705)Gaa>Aaa	p.E235K	TRIM49C_ENST00000432771.1_Missense_Mutation_p.E235K	NM_001195234.1	NP_001182163.1	P0CI26	TR49C_HUMAN	tripartite motif containing 49C	235						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|lung(4)	8						ggagctgaacgaaatgtgcca	0.373																																																	0																																										SO:0001583	missense	0			BC126470	CCDS53694.1	11q14.3	2014-02-17	2012-05-18	2012-05-18	ENSG00000204449	ENSG00000204449		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	38877	protein-coding gene	gene with protein product			"""tripartite motif containing 49-like 2"""	TRIM49L2			Standard	NM_001195234		Approved		uc010rua.2	P0CI26		ENST00000448984.1:c.703G>A	11.37:g.89771112G>A	ENSP00000388299:p.Glu235Lys		A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.E235K	ENST00000448984.1	37	c.703	CCDS53694.1	11	.	.	.	.	.	.	.	.	.	.	G	3.346	-0.133514	0.06711	.	.	ENSG00000204449	ENST00000448984;ENST00000432771	T;T	0.09723	2.95;2.95	1.15	-1.23	0.09465	.	.	.	.	.	T	0.09113	0.0225	L	0.59436	1.845	0.09310	N	1	B	0.19073	0.033	B	0.15052	0.012	T	0.38222	-0.9671	8	.	.	.	.	2.5906	0.04841	0.2314:0.3134:0.4552:0.0	.	235	P0CI26	T49L2_HUMAN	K	235	ENSP00000388299:E235K;ENSP00000396557:E235K	.	E	+	1	0	TRIM49L2	89410760	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.676000	0.01946	-0.384000	0.07845	-0.391000	0.06502	GAA	TRIM49C	-	superfamily_Lambda_DNA-bd_dom	ENSG00000204449		0.373	TRIM49C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM49C	HGNC	protein_coding	OTTHUMT00000395455.1	-	0.00	20	0	G	NM_001195234		89771112	+1	tier1	-	no_errors	ENST00000448984	ensembl	human	known	74_37	missense	50.00	6	6	SNP	0.000	A
TRPM7	54822	genome.wustl.edu	37	15	50925097	50925097	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr15:50925097G>T	ENST00000313478.7	-	9	1381	c.1100C>A	c.(1099-1101)aCa>aAa	p.T367K	TRPM7_ENST00000560955.1_Missense_Mutation_p.T367K	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	367					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		CTCCATCAGTGTTTGAAATAA	0.343																																																	0													104.0	94.0	97.0					15																	50925097		1804	4066	5870	SO:0001583	missense	0			AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.1100C>A	15.37:g.50925097G>T	ENSP00000320239:p.Thr367Lys		Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.T367K	ENST00000313478.7	37	c.1100	CCDS42035.1	15	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667212	0.47677	.	.	ENSG00000092439	ENST00000313478	T	0.24151	1.87	5.29	5.29	0.74685	.	0.115086	0.64402	D	0.000015	T	0.19886	0.0478	N	0.14661	0.345	0.52501	D	0.999953	P	0.50156	0.932	B	0.42030	0.373	T	0.03453	-1.1035	10	0.56958	D	0.05	-21.367	19.126	0.93384	0.0:0.0:1.0:0.0	.	367	Q96QT4	TRPM7_HUMAN	K	367	ENSP00000320239:T367K	ENSP00000320239:T367K	T	-	2	0	TRPM7	48712389	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.412000	0.59787	2.746000	0.94184	0.591000	0.81541	ACA	TRPM7	-	NULL	ENSG00000092439		0.343	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM7	HGNC	protein_coding	OTTHUMT00000418604.1	-	0.00	67	0	G	NM_017672		50925097	-1	tier1	-	no_errors	ENST00000313478	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
TSHZ3	57616	genome.wustl.edu	37	19	31770238	31770240	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:31770238_31770240delCTG	ENST00000240587.4	-	2	786_788	c.459_461delCAG	c.(457-462)agcagt>agt	p.153_154SS>S		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	153	Ser-rich.				in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					gctgctgctactgctgctgctgc	0.611																																																	0																																										SO:0001651	inframe_deletion	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.459_461delCAG	19.37:g.31770247_31770249delCTG	ENSP00000240587:p.Ser159del		Q9H0G6|Q9P254	In_Frame_Del	DEL	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.S157in_frame_del	ENST00000240587.4	37	c.461_459	CCDS12421.2	19																																																																																			TSHZ3	-	NULL	ENSG00000121297		0.611	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2		0.00	48	0	CTG	NM_020856		31770240	-1	tier1		no_errors	ENST00000240587	ensembl	human	known	74_37	in_frame_del	9.68	28	3	DEL	1.000:1.000:1.000	-
NDUFA13	51079	genome.wustl.edu	37	19	19626190	19626190	+	5'Flank	SNP	C	C	T	rs555864009		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:19626190C>T	ENST00000507754.4	+	0	0				NDUFA13_ENST00000512771.3_5'Flank|TSSK6_ENST00000360913.3_Missense_Mutation_p.R16H|NDUFA13_ENST00000428459.2_5'Flank|NDUFA13_ENST00000503283.1_5'Flank|CTC-260F20.3_ENST00000555938.1_5'Flank|NDUFA13_ENST00000252576.5_5'Flank|TSSK6_ENST00000585580.3_Missense_Mutation_p.R16H|YJEFN3_ENST00000608404.1_5'Flank			Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13						apoptotic signaling pathway (GO:0097190)|cellular metabolic process (GO:0044237)|cellular response to interferon-beta (GO:0035458)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of peptidase activity (GO:0010952)|positive regulation of protein catabolic process (GO:0045732)|protein import into mitochondrial inner membrane (GO:0045039)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	12						TCCAATTGTGCGGCCCAGCTT	0.652													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14719	0.0		0.0	False		,,,				2504	0.0																0													77.0	77.0	77.0					19																	19626190		2203	4300	6503	SO:0001631	upstream_gene_variant	0			AF261134	CCDS12404.1, CCDS12404.2	19p13.11	2011-07-04			ENSG00000186010	ENSG00000186010		"""Mitochondrial respiratory chain complex / Complex I"""	17194	protein-coding gene	gene with protein product	"""complex I B16.6 subunit"""	609435				12837546, 10924506, 15367666	Standard	NM_015965		Approved	CGI-39, CDA016, GRIM-19, GRIM19, B16.6		Q9P0J0	OTTHUMG00000162211		19.37:g.19626190C>T	Exception_encountered		B4DF76|K7EK58|Q6PKI0|Q9H2L3|Q9Y327	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R16H	ENST00000507754.4	37	c.47	CCDS12404.2	19	.	.	.	.	.	.	.	.	.	.	C	13.26	2.182752	0.38511	.	.	ENSG00000178093	ENST00000360913	T	0.26810	1.71	5.02	3.99	0.46301	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.328937	0.18055	U	0.153151	T	0.25827	0.0629	L	0.60904	1.88	0.24575	N	0.9939	B	0.19445	0.036	B	0.23419	0.046	T	0.16571	-1.0398	10	0.87932	D	0	.	8.4357	0.32786	0.0:0.8946:0.0:0.1054	.	16	Q9BXA6	TSSK6_HUMAN	H	16	ENSP00000354168:R16H	ENSP00000354168:R16H	R	-	2	0	TSSK6	19487190	0.834000	0.29399	0.997000	0.53966	0.948000	0.59901	0.475000	0.22164	2.353000	0.79882	0.485000	0.47835	CGC	TSSK6	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000178093		0.652	NDUFA13-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	TSSK6	HGNC	protein_coding	OTTHUMT00000367916.6		0.00	55	0	C	NM_015965		19626190	-1			no_errors	ENST00000360913	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.643	T
TTN	7273	genome.wustl.edu	37	2	179393711	179393711	+	Silent	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:179393711G>T	ENST00000591111.1	-	310	102068	c.101844C>A	c.(101842-101844)gtC>gtA	p.V33948V	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Silent_p.V26524V|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Silent_p.V26649V|TTN-AS1_ENST00000592161.1_RNA|TTN-AS1_ENST00000587576.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN_ENST00000589042.1_Silent_p.V35589V|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342992.6_Silent_p.V33021V|TTN_ENST00000342175.6_Silent_p.V26716V|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000588244.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33948					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCCTCATGGACAATGGATT	0.393																																																	0													131.0	119.0	123.0					2																	179393711		1867	4100	5967	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.101844C>A	2.37:g.179393711G>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.V33021	ENST00000591111.1	37	c.99063		2																																																																																			TTN	-	superfamily_RNaseH-like_dom	ENSG00000155657		0.393	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	84	0	G	NM_133378		179393711	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	5.33	71	4	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179437626	179437626	+	Silent	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:179437626G>T	ENST00000591111.1	-	276	68534	c.68310C>A	c.(68308-68310)gcC>gcA	p.A22770A	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Silent_p.A15346A|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Silent_p.A15471A|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Silent_p.A24411A|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342992.6_Silent_p.A21843A|TTN_ENST00000342175.6_Silent_p.A15538A|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586831.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22770	Fibronectin type-III 65. {ECO:0000255|PROSITE-ProRule:PRU00316}.		A -> D. {ECO:0000269|PubMed:17344846}.		adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGGAACAAGGGCAGGTTCCC	0.483																																																	0													86.0	87.0	87.0					2																	179437626		1950	4147	6097	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.68310C>A	2.37:g.179437626G>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.A21843	ENST00000591111.1	37	c.65529		2																																																																																			TTN	-	superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,pfscan_Fibronectin_type3	ENSG00000155657		0.483	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	25	0	G	NM_133378		179437626	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	15.38	22	4	SNP	0.550	T
TWF1	5756	genome.wustl.edu	37	12	44194271	44194271	+	Silent	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:44194271G>A	ENST00000395510.2	-	4	474	c.345C>T	c.(343-345)ggC>ggT	p.G115G	TWF1_ENST00000552521.1_Silent_p.G17G|TWF1_ENST00000325127.4_Silent_p.G149G|TWF1_ENST00000547564.1_5'Flank|TWF1_ENST00000548315.1_Silent_p.G115G	NM_001242397.1|NM_002822.4	NP_001229326.1|NP_002813.3	Q12792	TWF1_HUMAN	twinfilin actin-binding protein 1	115	ADF-H 1. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|negative regulation of actin filament polymerization (GO:0030837)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of actin phosphorylation (GO:0043538)|sequestering of actin monomers (GO:0042989)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|ruffle membrane (GO:0032587)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|stomach(1)	14	all_cancers(12;0.00125)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.0474)		CTTTAATGTGGCCACCTCCAA	0.328																																																	0													163.0	156.0	159.0					12																	44194271		2203	4299	6502	SO:0001819	synonymous_variant	0			U02680	CCDS31780.1, CCDS31780.2, CCDS55818.1	12q12	2013-04-25	2013-04-25	2006-11-13					9620	protein-coding gene	gene with protein product		610932	"""protein tyrosine kinase 9"", ""PTK9 protein tyrosine kinase 9"", ""twinfilin, actin-binding protein, homolog 1 (Drosophila)"""	PTK9		7507208	Standard	NM_002822		Approved	A6	uc001rob.3	Q12792		ENST00000395510.2:c.345C>T	12.37:g.44194271G>A			A8K5A8|B3KXS6|B4DLX9|Q59G07|Q5U0B1|Q6FHJ1|Q6FHL6|Q6NUK9|Q86XL6|Q8TCD3	Silent	SNP	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	p.G149	ENST00000395510.2	37	c.447	CCDS31780.2	12																																																																																			TWF1	-	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	ENSG00000151239		0.328	TWF1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	TWF1	HGNC	protein_coding	OTTHUMT00000403956.1	-	0.00	45	0	G	NM_002822		44194271	-1	tier1	-	no_errors	ENST00000325127	ensembl	human	known	74_37	silent	6.35	59	4	SNP	0.996	A
TXNDC16	57544	genome.wustl.edu	37	14	52899225	52899225	+	Missense_Mutation	SNP	G	G	A	rs367573078		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr14:52899225G>A	ENST00000281741.4	-	21	2646	c.2275C>T	c.(2275-2277)Cgt>Tgt	p.R759C		NM_001160047.1|NM_020784.2	NP_001153519.1|NP_065835.2	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16	759					cell redox homeostasis (GO:0045454)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(3)|skin(1)	21	Breast(41;0.0716)					CTAGTGCCACGTTGAGATGTT	0.403																																																	0								G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	73.0	71.0	71.0		2260,2275	1.3	0.0	14		71	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	TXNDC16	NM_001160047.1,NM_020784.2	180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	754/821,759/826	52899225	1,13005	2203	4300	6503	SO:0001583	missense	0			AB037765	CCDS32083.1	14q22.1	2007-08-16	2007-08-16	2007-08-16		ENSG00000087301			19965	protein-coding gene	gene with protein product			"""KIAA1344"""	KIAA1344			Standard	NM_020784		Approved		uc001wzs.3	Q9P2K2		ENST00000281741.4:c.2275C>T	14.37:g.52899225G>A	ENSP00000281741:p.Arg759Cys		A5PKW9|A7E260|A7MD07|B9EH67|Q9H9W7	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.R759C	ENST00000281741.4	37	c.2275	CCDS32083.1	14	.	.	.	.	.	.	.	.	.	.	G	5.119	0.207629	0.09704	0.0	1.16E-4	ENSG00000087301	ENST00000281741	T	0.18657	2.2	5.42	1.26	0.21427	.	1.072050	0.07145	N	0.848091	T	0.10551	0.0258	N	0.08118	0	0.09310	N	1	B;B	0.28998	0.034;0.23	B;B	0.27796	0.003;0.083	T	0.31613	-0.9937	10	0.41790	T	0.15	-31.323	5.5121	0.16886	0.2332:0.2943:0.4725:0.0	.	754;759	B7ZME4;Q9P2K2	.;TXD16_HUMAN	C	759	ENSP00000281741:R759C	ENSP00000281741:R759C	R	-	1	0	TXNDC16	51968975	0.003000	0.15002	0.007000	0.13788	0.126000	0.20510	1.483000	0.35497	0.755000	0.32990	0.644000	0.83932	CGT	TXNDC16	-	NULL	ENSG00000087301		0.403	TXNDC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNDC16	HGNC	protein_coding	OTTHUMT00000411681.1	-	0.00	57	0	G	XM_051699		52899225	-1	tier1	-	no_errors	ENST00000281741	ensembl	human	known	74_37	missense	20.00	35	9	SNP	0.000	A
UGT3A1	133688	genome.wustl.edu	37	5	35957435	35957435	+	Silent	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr5:35957435C>T	ENST00000274278.3	-	5	1287	c.930G>A	c.(928-930)caG>caA	p.Q310Q	UGT3A1_ENST00000507113.1_Silent_p.Q276Q|UGT3A1_ENST00000503189.1_Silent_p.Q310Q|UGT3A1_ENST00000513233.1_5'UTR	NM_152404.3	NP_689617.3	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	310						integral component of membrane (GO:0016021)|UDP-N-acetylglucosamine transferase complex (GO:0043541)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|skin(4)	46	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGAGGACTTCCTGGGACTGAT	0.498																																																	0													119.0	100.0	106.0					5																	35957435		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3913.1, CCDS54841.1	5p13.2	2014-05-20			ENSG00000145626	ENSG00000145626		"""UDP glucuronosyltransferases"""	26625	protein-coding gene	gene with protein product							Standard	NM_152404		Approved	FLJ34658	uc003jjv.2	Q6NUS8	OTTHUMG00000131107	ENST00000274278.3:c.930G>A	5.37:g.35957435C>T			G5E961|Q8IYS9|Q8NAW4|Q96DM6	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.Q310	ENST00000274278.3	37	c.930	CCDS3913.1	5																																																																																			UGT3A1	-	pfam_UDP_glucos_trans	ENSG00000145626		0.498	UGT3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT3A1	HGNC	protein_coding	OTTHUMT00000253770.2	-	0.00	88	0	C	NM_152404		35957435	-1	tier1	-	no_errors	ENST00000274278	ensembl	human	known	74_37	silent	27.37	69	26	SNP	0.000	T
UHRF2	115426	genome.wustl.edu	37	9	6420988	6420988	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr9:6420988C>A	ENST00000276893.5	+	2	398	c.230C>A	c.(229-231)cCt>cAt	p.P77H	RP11-307L3.4_ENST00000411561.1_RNA|UHRF2_ENST00000381373.3_Missense_Mutation_p.P77H	NM_152896.2	NP_690856.1	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase	77	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|positive regulation of cell cycle arrest (GO:0071158)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P77R(1)		cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)	17		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)		CGCCCAGACCCTGATCATCTT	0.398																																																	1	Substitution - Missense(1)	kidney(1)											139.0	129.0	133.0					9																	6420988		2203	4300	6503	SO:0001583	missense	0			AF274049	CCDS6469.1	9p24.1	2013-01-28	2012-02-23		ENSG00000147854	ENSG00000147854		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	12557	protein-coding gene	gene with protein product	"""Np95-like ring finger protein"""	615211	"""ubiquitin-like with PHD and ring finger domains 2"""			12176013	Standard	NM_152896		Approved	RNF107, NIRF, URF2, MGC33463	uc003zjy.3	Q96PU4	OTTHUMG00000019521	ENST00000276893.5:c.230C>A	9.37:g.6420988C>A	ENSP00000276893:p.Pro77His		Q5VYR1|Q5VYR3|Q659C8|Q8TAG7	Missense_Mutation	SNP	pfam_SRA_YDG,pfam_DUF3590,pfam_Ubiquitin_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Ubiquitin_dom,smart_Znf_PHD,smart_Znf_RING,smart_SRA_YDG,pfscan_SRA_YDG,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_Ubiquitin_supergroup	p.P77H	ENST00000276893.5	37	c.230	CCDS6469.1	9	.	.	.	.	.	.	.	.	.	.	C	18.85	3.710486	0.68730	.	.	ENSG00000147854	ENST00000276893;ENST00000381373	T;T	0.44083	0.93;0.93	5.55	4.66	0.58398	.	0.325583	0.34338	N	0.004059	T	0.47135	0.1429	M	0.61703	1.905	0.31128	N	0.708032	B	0.33073	0.396	B	0.39068	0.289	T	0.58493	-0.7627	10	0.66056	D	0.02	-0.4419	14.6268	0.68626	0.0:0.9298:0.0:0.0702	.	77	Q96PU4	UHRF2_HUMAN	H	77	ENSP00000276893:P77H;ENSP00000370778:P77H	ENSP00000276893:P77H	P	+	2	0	UHRF2	6410988	0.998000	0.40836	0.990000	0.47175	0.980000	0.70556	4.998000	0.63927	1.345000	0.45676	-0.444000	0.05651	CCT	UHRF2	-	NULL	ENSG00000147854		0.398	UHRF2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF2	HGNC	protein_coding	OTTHUMT00000051665.3		0.00	34	0	C	NM_152306		6420988	+1			no_errors	ENST00000276893	ensembl	human	known	74_37	missense	8.70	21	2	SNP	0.998	A
UNC13A	23025	genome.wustl.edu	37	19	17750317	17750317	+	Silent	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:17750317G>A	ENST00000519716.2	-	24	2873	c.2874C>T	c.(2872-2874)agC>agT	p.S958S	UNC13A_ENST00000428389.2_Silent_p.S1046S|UNC13A_ENST00000551649.1_Silent_p.S958S|UNC13A_ENST00000552293.1_Silent_p.S958S|UNC13A_ENST00000550896.1_Silent_p.S956S|UNC13A_ENST00000252773.7_Silent_p.S958S	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	958					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						TCTCCGGGCTGCTGGCTGGGA	0.537																																																	0													67.0	66.0	66.0					19																	17750317		1952	4153	6105	SO:0001819	synonymous_variant	0			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2874C>T	19.37:g.17750317G>A			E5RHY9	Silent	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_dom,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.S1046	ENST00000519716.2	37	c.3138	CCDS46013.2	19																																																																																			UNC13A	-	NULL	ENSG00000130477		0.537	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2	-	0.00	101	0	G	XM_038604		17750317	-1	tier1	-	no_errors	ENST00000428389	ensembl	human	known	74_37	silent	5.00	76	4	SNP	1.000	A
UNC5C	8633	genome.wustl.edu	37	4	96140155	96140155	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr4:96140155T>G	ENST00000453304.1	-	9	1958	c.1610A>C	c.(1609-1611)aAc>aCc	p.N537T	UNC5C_ENST00000506749.1_Missense_Mutation_p.N556T	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	537	ZU5. {ECO:0000255|PROSITE- ProRule:PRU00485}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		TCCCAGCGAGTTGAAGCTGCC	0.453																																																	0													117.0	93.0	101.0					4																	96140155		2203	4300	6503	SO:0001583	missense	0			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1610A>C	4.37:g.96140155T>G	ENSP00000406022:p.Asn537Thr		Q8IUT0	Missense_Mutation	SNP	pfam_ZU5,pfam_Death_domain,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.N537T	ENST00000453304.1	37	c.1610	CCDS3643.1	4	.	.	.	.	.	.	.	.	.	.	T	12.11	1.839060	0.32513	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749	T;T;T	0.44881	0.91;0.91;0.91	5.44	5.44	0.79542	ZU5 (3);	0.205350	0.50627	D	0.000103	T	0.34832	0.0911	L	0.34521	1.04	0.80722	D	1	B;P;P	0.34462	0.015;0.454;0.454	B;B;B	0.34931	0.029;0.192;0.192	T	0.11542	-1.0583	10	0.32370	T	0.25	.	15.5137	0.75806	0.0:0.0:0.0:1.0	.	537;556;537	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	T	537;496;556;556	ENSP00000406022:N537T;ENSP00000426924:N556T;ENSP00000426153:N556T	ENSP00000328673:N496T	N	-	2	0	UNC5C	96359178	1.000000	0.71417	1.000000	0.80357	0.667000	0.39255	2.888000	0.48594	2.063000	0.61619	0.528000	0.53228	AAC	UNC5C	-	pfam_ZU5,smart_ZU5,pfscan_ZU5	ENSG00000182168		0.453	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5C	HGNC	protein_coding	OTTHUMT00000253607.1		0.00	70	0	T	NM_003728		96140155	-1			no_errors	ENST00000453304	ensembl	human	known	74_37	missense	6.38	44	3	SNP	1.000	G
USH2A	7399	genome.wustl.edu	37	1	215987084	215987084	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:215987084G>T	ENST00000307340.3	-	49	10119	c.9733C>A	c.(9733-9735)Cta>Ata	p.L3245I	USH2A_ENST00000366943.2_Missense_Mutation_p.L3245I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3245					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCACCTGGTAGAATTCTAGCG	0.438										HNSCC(13;0.011)																																							0													115.0	109.0	111.0					1																	215987084		2203	4300	6503	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9733C>A	1.37:g.215987084G>T	ENSP00000305941:p.Leu3245Ile		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.L3245I	ENST00000307340.3	37	c.9733	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.101402	0.76983	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.13420	2.6;2.59	5.53	4.63	0.57726	Fibronectin, type III (2);	0.000000	0.33057	U	0.005332	T	0.15435	0.0372	M	0.72479	2.2	0.09310	N	1	P	0.40250	0.709	B	0.40410	0.328	T	0.21759	-1.0236	10	0.36615	T	0.2	.	4.3932	0.11350	0.2097:0.0:0.6152:0.1751	.	3245	O75445	USH2A_HUMAN	I	3245	ENSP00000305941:L3245I;ENSP00000355910:L3245I	ENSP00000305941:L3245I	L	-	1	2	USH2A	214053707	0.962000	0.33011	0.046000	0.18839	0.985000	0.73830	2.313000	0.43735	1.343000	0.45638	0.591000	0.81541	CTA	USH2A	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000042781		0.438	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	-	0.00	72	0	G	NM_007123		215987084	-1	tier1	-	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.013	T
USH2A	7399	genome.wustl.edu	37	1	216011423	216011423	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr1:216011423G>A	ENST00000307340.3	-	47	9667	c.9281C>T	c.(9280-9282)gCc>gTc	p.A3094V	USH2A_ENST00000366943.2_Missense_Mutation_p.A3094V	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3094	Fibronectin type-III 17. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.A3094D(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTTCACGCAGGCATATATTGT	0.378										HNSCC(13;0.011)																																							1	Substitution - Missense(1)	lung(1)											212.0	193.0	200.0					1																	216011423		2203	4300	6503	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9281C>T	1.37:g.216011423G>A	ENSP00000305941:p.Ala3094Val		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.A3094V	ENST00000307340.3	37	c.9281	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860824	0.71834	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.53206	0.63;0.63	5.01	5.01	0.66863	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.44688	D	0.000424	T	0.68613	0.3020	M	0.72479	2.2	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	T	0.70085	-0.4969	10	0.48119	T	0.1	.	17.9566	0.89070	0.0:0.0:1.0:0.0	.	3094	O75445	USH2A_HUMAN	V	3094	ENSP00000305941:A3094V;ENSP00000355910:A3094V	ENSP00000305941:A3094V	A	-	2	0	USH2A	214078046	1.000000	0.71417	0.970000	0.41538	0.181000	0.23173	5.784000	0.68990	2.331000	0.79229	0.655000	0.94253	GCC	USH2A	-	smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.378	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1		0.00	49	0	G	NM_007123		216011423	-1			no_errors	ENST00000366943	ensembl	human	known	74_37	missense	6.25	44	3	SNP	1.000	A
USP29	57663	genome.wustl.edu	37	19	57640428	57640428	+	Missense_Mutation	SNP	A	A	C			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:57640428A>C	ENST00000254181.4	+	4	839	c.385A>C	c.(385-387)Att>Ctt	p.I129L	USP29_ENST00000598197.1_Missense_Mutation_p.I129L	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	129					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GCTGAAGGAAATTGACAAAAC	0.358																																																	0													67.0	63.0	64.0					19																	57640428		2203	4300	6503	SO:0001583	missense	0				CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.385A>C	19.37:g.57640428A>C	ENSP00000254181:p.Ile129Leu			Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.I129L	ENST00000254181.4	37	c.385	CCDS33124.1	19	.	.	.	.	.	.	.	.	.	.	A	7.254	0.603807	0.14002	.	.	ENSG00000131864	ENST00000254181	T	0.44881	0.91	2.64	1.58	0.23477	.	.	.	.	.	T	0.30541	0.0768	L	0.50333	1.59	0.09310	N	1	P	0.39831	0.69	B	0.36666	0.23	T	0.11567	-1.0582	9	0.19590	T	0.45	0.0611	5.8154	0.18490	0.726:0.274:0.0:0.0	.	129	Q9HBJ7	UBP29_HUMAN	L	129	ENSP00000254181:I129L	ENSP00000254181:I129L	I	+	1	0	USP29	62332240	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.069000	0.11542	0.373000	0.24621	0.482000	0.46254	ATT	USP29	-	NULL	ENSG00000131864		0.358	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP29	HGNC	protein_coding	OTTHUMT00000465075.1	-	0.00	19	0	A			57640428	+1	tier1	-	no_errors	ENST00000254181	ensembl	human	known	74_37	missense	36.00	16	9	SNP	0.000	C
USP51	158880	genome.wustl.edu	37	X	55515146	55515146	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chrX:55515146C>T	ENST00000500968.3	-	2	309	c.227G>A	c.(226-228)aGc>aAc	p.S76N	USP51_ENST00000586165.1_5'UTR	NM_201286.3	NP_958443.1	Q70EK9	UBP51_HUMAN	ubiquitin specific peptidase 51	76					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30						GCCGCCGCTGCTGCTCCACGT	0.667																																																	0													28.0	26.0	27.0					X																	55515146		2202	4300	6502	SO:0001583	missense	0			BF741256	CCDS14370.1	Xp11	2009-03-19	2005-08-08		ENSG00000247746	ENSG00000247746		"""Ubiquitin-specific peptidases"""	23086	protein-coding gene	gene with protein product			"""ubiquitin specific protease 51"""			12838346	Standard	NM_201286		Approved		uc004dun.2	Q70EK9	OTTHUMG00000021656	ENST00000500968.3:c.227G>A	X.37:g.55515146C>T	ENSP00000423333:p.Ser76Asn		Q8IWJ8	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.S76N	ENST00000500968.3	37	c.227	CCDS14370.1	X	.	.	.	.	.	.	.	.	.	.	.	5.815	0.334627	0.11013	.	.	ENSG00000247746	ENST00000500968	T	0.10477	2.87	2.17	0.662	0.17880	.	.	.	.	.	T	0.05044	0.0135	N	0.08118	0	0.20403	N	0.99991	B	0.10296	0.003	B	0.04013	0.001	T	0.37709	-0.9694	9	0.56958	D	0.05	.	4.4081	0.11420	0.0:0.71:0.0:0.29	.	76	Q70EK9	UBP51_HUMAN	N	76	ENSP00000423333:S76N	ENSP00000423333:S76N	S	-	2	0	USP51	55531871	0.603000	0.26924	0.417000	0.26559	0.778000	0.44026	0.084000	0.14891	0.105000	0.17753	0.424000	0.28305	AGC	USP51	-	NULL	ENSG00000247746		0.667	USP51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP51	HGNC	protein_coding	OTTHUMT00000056871.2	-	0.00	52	0	C	NM_201286		55515146	-1	tier1	-	no_errors	ENST00000500968	ensembl	human	known	74_37	missense	30.19	37	16	SNP	0.949	T
VIL1	7429	genome.wustl.edu	37	2	219290359	219290359	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr2:219290359C>A	ENST00000248444.5	+	4	260	c.172C>A	c.(172-174)Ctg>Atg	p.L58M	VIL1_ENST00000392114.2_Intron|VIL1_ENST00000440053.1_Missense_Mutation_p.L58M	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	58	Core.|Necessary for homodimerization.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)	p.L58L(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCCAGCAGCCTGTCCTATGA	0.582																																																	1	Substitution - coding silent(1)	lung(1)											69.0	62.0	64.0					2																	219290359		2203	4300	6503	SO:0001583	missense	0			X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.172C>A	2.37:g.219290359C>A	ENSP00000248444:p.Leu58Met		B2R9A7|Q53S11|Q96AC8	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.L58M	ENST00000248444.5	37	c.172	CCDS2417.1	2	.	.	.	.	.	.	.	.	.	.	C	12.85	2.062109	0.36373	.	.	ENSG00000127831	ENST00000248444;ENST00000454069;ENST00000440053	T;T;T	0.19532	2.14;2.14;2.14	4.53	2.7	0.31948	Gelsolin domain (1);	0.080833	0.48286	D	0.000190	T	0.31389	0.0795	M	0.92604	3.325	0.26185	N	0.979673	B;B	0.29162	0.235;0.076	B;B	0.34991	0.193;0.079	T	0.44298	-0.9337	10	0.66056	D	0.02	-9.1013	2.6877	0.05112	0.2071:0.47:0.0:0.3229	.	58;58	Q96AC8;P09327	.;VILI_HUMAN	M	58	ENSP00000248444:L58M;ENSP00000412657:L58M;ENSP00000409270:L58M	ENSP00000248444:L58M	L	+	1	2	VIL1	218998603	0.000000	0.05858	0.991000	0.47740	0.969000	0.65631	0.116000	0.15561	0.519000	0.28406	0.555000	0.69702	CTG	VIL1	-	pfam_Gelsolin_dom,smart_Villin/Gelsolin	ENSG00000127831		0.582	VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIL1	HGNC	protein_coding	OTTHUMT00000256778.3		0.00	34	0	C	NM_007127		219290359	+1			no_errors	ENST00000248444	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.977	A
VIPR1	7433	genome.wustl.edu	37	3	42569372	42569372	+	Intron	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr3:42569372C>T	ENST00000325123.4	+	6	616				VIPR1-AS1_ENST00000593611.1_RNA|VIPR1-AS1_ENST00000600342.1_RNA|VIPR1-AS1_ENST00000602176.1_RNA|VIPR1_ENST00000543411.1_Intron|VIPR1-AS1_ENST00000593621.1_RNA|VIPR1_ENST00000433647.1_Intron|VIPR1_ENST00000438259.2_Intron|VIPR1-AS1_ENST00000596630.1_RNA|VIPR1-AS1_ENST00000452639.3_RNA|VIPR1_ENST00000473575.1_3'UTR|VIPR1-AS1_ENST00000601312.1_RNA|VIPR1-AS1_ENST00000598837.1_RNA	NM_001251885.1|NM_004624.3	NP_001238814.1|NP_004615.2	P32241	VIPR1_HUMAN	vasoactive intestinal peptide receptor 1						digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|muscle contraction (GO:0006936)|positive regulation of cell proliferation (GO:0008284)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|ovary(2)|skin(1)|urinary_tract(3)	18				KIRC - Kidney renal clear cell carcinoma(284;0.241)		GGCCTGCCCTCTGGAGGACAC	0.642																																																	0																																										SO:0001627	intron_variant	0			AH005329	CCDS2698.1, CCDS58827.1, CCDS58828.1, CCDS58829.1	3p22	2012-08-10			ENSG00000114812	ENSG00000114812		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12694	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 1"""	192321				7708752	Standard	NM_004624		Approved	VPAC1, RDC1, HVR1, VPAC1R	uc003clf.2	P32241	OTTHUMG00000131792	ENST00000325123.4:c.504-111C>T	3.37:g.42569372C>T			A5JUT9|B3KPV1|B4DEB5|B4DGI4|F5H1F5|G3V0I1|Q15871|Q6P2M6	RNA	SNP	-	NULL	ENST00000325123.4	37	NULL	CCDS2698.1	3																																																																																			VIPR1	-	-	ENSG00000114812		0.642	VIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIPR1	HGNC	protein_coding	OTTHUMT00000254728.4	-	0.00	37	0	C	NM_004624		42569372	+1	tier1	-	no_errors	ENST00000473575	ensembl	human	known	74_37	rna	23.08	20	6	SNP	0.001	T
VPRBP	9730	genome.wustl.edu	37	3	51452220	51452220	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr3:51452220G>A	ENST00000335891.5	-	11	2357	c.2348C>T	c.(2347-2349)cCt>cTt	p.P783L				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	1232					B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		ATCATCTGTAGGATTAAAGGT	0.428																																																	0													130.0	120.0	123.0					3																	51452220		1916	4136	6052	SO:0001583	missense	0			AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.2348C>T	3.37:g.51452220G>A	ENSP00000338857:p.Pro783Leu		Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.P783L	ENST00000335891.5	37	c.2348		3	.	.	.	.	.	.	.	.	.	.	G	35	5.523677	0.96431	.	.	ENSG00000145041	ENST00000423656;ENST00000335891	T;T	0.02197	4.4;4.4	5.91	5.91	0.95273	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.048362	0.85682	D	0.000000	T	0.09642	0.0237	M	0.83223	2.63	0.80722	D	1	P	0.40731	0.728	P	0.46076	0.503	T	0.00331	-1.1811	10	0.54805	T	0.06	-16.9253	20.3052	0.98627	0.0:0.0:1.0:0.0	.	1232	Q9Y4B6	VPRBP_HUMAN	L	803;783	ENSP00000393183:P803L;ENSP00000338857:P783L	ENSP00000338857:P783L	P	-	2	0	VPRBP	51427260	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.400000	0.97290	2.814000	0.96858	0.650000	0.86243	CCT	VPRBP	-	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold	ENSG00000145041		0.428	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	VPRBP	HGNC	protein_coding			0.00	38	0	G	NM_014703		51452220	-1			no_errors	ENST00000335891	ensembl	human	known	74_37	missense	10.53	17	2	SNP	1.000	A
VPS13B	157680	genome.wustl.edu	37	8	100286533	100286533	+	Frame_Shift_Del	DEL	T	T	-			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr8:100286533delT	ENST00000358544.2	+	18	2734	c.2623delT	c.(2623-2625)tcafs	p.S875fs	VPS13B_ENST00000395996.1_Frame_Shift_Del_p.S875fs|VPS13B_ENST00000357162.2_Frame_Shift_Del_p.S875fs	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	875					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GACCATGGGATCAATAAAAAT	0.453																																					Colon(161;2205 2542 7338 31318)												0													97.0	101.0	100.0					8																	100286533		2203	4300	6503	SO:0001589	frameshift_variant	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.2623delT	8.37:g.100286533delT	ENSP00000351346:p.Ser875fs		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Frame_Shift_Del	DEL	pfam_Autophagy-rel_C	p.S875fs	ENST00000358544.2	37	c.2623	CCDS6280.1	8																																																																																			VPS13B	-	NULL	ENSG00000132549		0.453	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1		0.00	84	0	T	NM_184042		100286533	+1	tier1		no_errors	ENST00000358544	ensembl	human	known	74_37	frame_shift_del	15.62	81	15	DEL	1.000	-
VPS13B	157680	genome.wustl.edu	37	8	100286534	100286534	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr8:100286534C>A	ENST00000358544.2	+	18	2735	c.2624C>A	c.(2623-2625)tCa>tAa	p.S875*	VPS13B_ENST00000395996.1_Nonsense_Mutation_p.S875*|VPS13B_ENST00000357162.2_Nonsense_Mutation_p.S875*	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	875					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ACCATGGGATCAATAAAAATT	0.453																																					Colon(161;2205 2542 7338 31318)												0													95.0	100.0	98.0					8																	100286534		2203	4300	6503	SO:0001587	stop_gained	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.2624C>A	8.37:g.100286534C>A	ENSP00000351346:p.Ser875*		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Nonsense_Mutation	SNP	pfam_Autophagy-rel_C	p.S875*	ENST00000358544.2	37	c.2624	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	C	42	9.815087	0.99271	.	.	ENSG00000132549	ENST00000357162;ENST00000358544;ENST00000395996	.	.	.	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.0822	0.97779	0.0:1.0:0.0:0.0	.	.	.	.	X	875	.	ENSP00000349685:S875X	S	+	2	0	VPS13B	100355710	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.421000	0.80204	2.826000	0.97356	0.563000	0.77884	TCA	VPS13B	-	NULL	ENSG00000132549		0.453	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	-	0.00	86	0	C	NM_184042		100286534	+1	tier1	-	no_errors	ENST00000358544	ensembl	human	known	74_37	nonsense	20.00	80	20	SNP	1.000	A
VWF	7450	genome.wustl.edu	37	12	6128535	6128535	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr12:6128535G>A	ENST00000261405.5	-	28	4303	c.4049C>T	c.(4048-4050)gCg>gTg	p.A1350V		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1350	VWFA 1; binding site for platelet glycoprotein Ib. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CTGGCTGCCCGCATACTTCAC	0.622																																																	0													53.0	49.0	50.0					12																	6128535		2203	4300	6503	SO:0001583	missense	0				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.4049C>T	12.37:g.6128535G>A	ENSP00000261405:p.Ala1350Val		Q8TCE8|Q99806	Missense_Mutation	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.A1350V	ENST00000261405.5	37	c.4049	CCDS8539.1	12	.	.	.	.	.	.	.	.	.	.	.	13.08	2.130196	0.37630	.	.	ENSG00000110799	ENST00000261405	D	0.83250	-1.7	4.98	2.92	0.33932	von Willebrand factor, type A (3);	0.748356	0.11455	N	0.562407	T	0.70456	0.3226	L	0.27975	0.815	0.80722	D	1	B	0.25486	0.127	B	0.17722	0.019	T	0.57335	-0.7829	10	0.22706	T	0.39	.	8.7741	0.34751	0.2319:0.0:0.7681:0.0	.	1350	P04275	VWF_HUMAN	V	1350	ENSP00000261405:A1350V	ENSP00000261405:A1350V	A	-	2	0	VWF	5998796	0.257000	0.24022	0.909000	0.35828	0.911000	0.54048	1.076000	0.30729	0.508000	0.28173	0.555000	0.69702	GCG	VWF	-	pirsf_VWF,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000110799		0.622	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	-	0.00	90	0	G	NM_000552		6128535	-1	tier1	-	no_errors	ENST00000261405	ensembl	human	known	74_37	missense	17.86	69	15	SNP	0.767	A
WBP1L	54838	genome.wustl.edu	37	10	104569775	104569775	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr10:104569775G>T	ENST00000369889.4	+	3	398	c.256G>T	c.(256-258)Gaa>Taa	p.E86*	WBP1L_ENST00000448841.1_Nonsense_Mutation_p.E107*	NM_017787.4	NP_060257.4	Q9NX94	WBP1L_HUMAN	WW domain binding protein 1-like	86						integral component of membrane (GO:0016021)											CGCTTACCGAGAAGCCCACAA	0.572																																																	0													182.0	182.0	182.0					10																	104569775		2203	4300	6503	SO:0001587	stop_gained	0			AK056285	CCDS7540.1, CCDS44473.1	10q24.33	2012-05-02	2012-05-02	2012-05-02	ENSG00000166272	ENSG00000166272			23510	protein-coding gene	gene with protein product	"""outcome predictor in acute leukemia 1"""	611129	"""chromosome 10 open reading frame 26"""	C10orf26			Standard	NM_017787		Approved	FLJ20154, OPAL1	uc001kwf.4	Q9NX94	OTTHUMG00000018968	ENST00000369889.4:c.256G>T	10.37:g.104569775G>T	ENSP00000358905:p.Glu86*		B3KPF4|B7Z6S7|D3DR90|Q1EG70|Q2HIY7|Q5F2G6	Nonsense_Mutation	SNP	pfam_Uncharacterised_WW-bd	p.E107*	ENST00000369889.4	37	c.319	CCDS7540.1	10	.	.	.	.	.	.	.	.	.	.	g	36	5.764243	0.96906	.	.	ENSG00000166272	ENST00000448841;ENST00000369889	.	.	.	5.76	5.76	0.90799	.	0.144262	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-13.4132	20.0677	0.97707	0.0:0.0:1.0:0.0	.	.	.	.	X	107;86	.	ENSP00000358905:E86X	E	+	1	0	C10orf26	104559765	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.828000	0.99408	2.751000	0.94390	0.544000	0.68410	GAA	WBP1L	-	pfam_Uncharacterised_WW-bd	ENSG00000166272		0.572	WBP1L-001	KNOWN	basic|CCDS	protein_coding	WBP1L	HGNC	protein_coding	OTTHUMT00000050100.1	-	0.00	68	0	G	NM_017787		104569775	+1	tier1	-	no_errors	ENST00000448841	ensembl	human	known	74_37	nonsense	6.35	59	4	SNP	1.000	T
WDR13	64743	genome.wustl.edu	37	X	48459019	48459019	+	Intron	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chrX:48459019G>T	ENST00000218056.5	+	5	1336				WDR13_ENST00000376729.5_Intron	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13							cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						ACTGTGGTCAGGCTCCAGGAC	0.597																																																	0													47.0	31.0	37.0					X																	48459019		2202	4300	6502	SO:0001627	intron_variant	0			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.831+5G>T	X.37:g.48459019G>T			Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	RNA	SNP	-	NULL	ENST00000218056.5	37	NULL	CCDS14302.1	X																																																																																			WDR13	-	-	ENSG00000101940		0.597	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR13	HGNC	protein_coding	OTTHUMT00000060743.2	-	0.00	38	0	G			48459019	+1	tier1	-	no_errors	ENST00000482760	ensembl	human	known	74_37	rna	11.11	32	4	SNP	1.000	T
ZAN	7455	genome.wustl.edu	37	7	100377076	100377076	+	RNA	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr7:100377076G>T	ENST00000348028.3	+	0	6490				ZAN_ENST00000546213.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000421100.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			AGTTGTCAGAGTCTCCTGGTA	0.552																																																	0													25.0	27.0	26.0					7																	100377076		2058	4195	6253			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100377076G>T			A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.S2108I	ENST00000348028.3	37	c.6323		7	.	.	.	.	.	.	.	.	.	.	G	12.58	1.980907	0.34942	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585;ENST00000546213	T;T;T;T	0.24350	2.39;2.38;2.35;1.86	4.14	-3.4	0.04853	von Willebrand factor, type D domain (1);	4.479350	0.00639	N	0.000517	T	0.10937	0.0267	.	.	.	0.09310	N	1	B;B;B	0.24651	0.108;0.108;0.066	B;B;B	0.15484	0.013;0.013;0.006	T	0.08371	-1.0725	9	0.17832	T	0.49	.	0.8844	0.01241	0.264:0.3354:0.236:0.1646	.	619;2108;2109	F5GX59;F5H0T8;Q9Y493	.;.;ZAN_HUMAN	I	2108;2108;2108;619	ENSP00000445943:S2108I;ENSP00000445091:S2108I;ENSP00000444427:S2108I;ENSP00000441117:S619I	ENSP00000445091:S2108I	S	+	2	0	ZAN	100215012	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-0.656000	0.05342	-0.481000	0.06792	-0.694000	0.03704	AGT	ZAN	-	NULL	ENSG00000146839		0.552	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	-	0.00	58	0	G	NM_003386		100377076	+1	tier1	-	no_errors	ENST00000546292	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.000	T
ZFP3	124961	genome.wustl.edu	37	17	4995060	4995060	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr17:4995060G>T	ENST00000318833.3	+	2	597	c.261G>T	c.(259-261)gaG>gaT	p.E87D		NM_153018.2	NP_694563.1	Q96NJ6	ZFP3_HUMAN	ZFP3 zinc finger protein	87					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E87D(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(3)|prostate(1)	20						AAGACCGGGAGAATAATGAGA	0.473																																																	1	Substitution - Missense(1)	large_intestine(1)											53.0	54.0	54.0					17																	4995060		2203	4300	6503	SO:0001583	missense	0			BX647638	CCDS11067.1	17p13.2	2013-01-08	2012-11-27		ENSG00000180787	ENSG00000180787		"""Zinc fingers, C2H2-type"""	12861	protein-coding gene	gene with protein product		194480	"""zinc finger protein homologous to Zfp-3 in mouse"", ""zinc finger protein 3 homolog (mouse)"""				Standard	NM_153018		Approved	FLJ30726, ZNF752	uc002gaq.3	Q96NJ6		ENST00000318833.3:c.261G>T	17.37:g.4995060G>T	ENSP00000320347:p.Glu87Asp		A5PLL4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E87D	ENST00000318833.3	37	c.261	CCDS11067.1	17	.	.	.	.	.	.	.	.	.	.	G	10.95	1.496579	0.26861	.	.	ENSG00000180787	ENST00000318833	T	0.10099	2.91	3.82	0.744	0.18353	.	0.254913	0.20437	N	0.092347	T	0.04724	0.0128	N	0.08118	0	0.09310	N	1	B	0.19817	0.039	B	0.16289	0.015	T	0.33624	-0.9861	10	0.59425	D	0.04	-6.5521	5.6756	0.17747	0.3481:0.0:0.6519:0.0	.	87	Q96NJ6	ZFP3_HUMAN	D	87	ENSP00000320347:E87D	ENSP00000320347:E87D	E	+	3	2	ZFP3	4935784	0.000000	0.05858	0.005000	0.12908	0.044000	0.14063	-0.070000	0.11523	0.218000	0.20820	0.563000	0.77884	GAG	ZFP3	-	NULL	ENSG00000180787		0.473	ZFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP3	HGNC	protein_coding	OTTHUMT00000438979.1		0.00	34	0	G	NM_153018		4995060	+1			no_errors	ENST00000318833	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.013	T
ZFPM1	161882	genome.wustl.edu	37	16	88594569	88594569	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr16:88594569C>T	ENST00000319555.3	+	6	957	c.635C>T	c.(634-636)cCg>cTg	p.P212L	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	212					atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		CCCACGTGCCCGGCCCCTGCA	0.701																																					Pancreas(49;850 1106 29641 32847 38344)												0													18.0	21.0	20.0					16																	88594569		2175	4290	6465	SO:0001583	missense	0			AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.635C>T	16.37:g.88594569C>T	ENSP00000326630:p.Pro212Leu			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P212L	ENST00000319555.3	37	c.635	CCDS32502.1	16	.	.	.	.	.	.	.	.	.	.	C	13.04	2.118440	0.37339	.	.	ENSG00000179588	ENST00000319555	T	0.08807	3.05	4.11	-5.68	0.02436	.	0.360209	0.28209	N	0.016182	T	0.05090	0.0136	L	0.33485	1.01	0.24435	N	0.994552	B	0.18310	0.027	B	0.10450	0.005	T	0.14337	-1.0476	10	0.46703	T	0.11	0.0023	8.4812	0.33043	0.1334:0.7224:0.0:0.1442	.	212	Q8IX07	FOG1_HUMAN	L	212	ENSP00000326630:P212L	ENSP00000326630:P212L	P	+	2	0	ZFPM1	87122070	0.345000	0.24835	0.000000	0.03702	0.018000	0.09664	0.978000	0.29488	-1.564000	0.01678	0.313000	0.20887	CCG	ZFPM1	-	NULL	ENSG00000179588		0.701	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM1	HGNC	protein_coding	OTTHUMT00000422270.2		0.00	84	0	C			88594569	+1			no_errors	ENST00000319555	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.112	T
ZFYVE27	118813	genome.wustl.edu	37	10	99509277	99509277	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr10:99509277C>T	ENST00000393677.4	+	6	802	c.598C>T	c.(598-600)Cca>Tca	p.P200S	ZFYVE27_ENST00000357540.4_Missense_Mutation_p.P114S|ZFYVE27_ENST00000359980.3_Missense_Mutation_p.P200S|ZFYVE27_ENST00000337540.7_Missense_Mutation_p.P168S|ZFYVE27_ENST00000356257.4_Missense_Mutation_p.P200S|ZFYVE27_ENST00000370610.3_Missense_Mutation_p.P102S|ZFYVE27_ENST00000453958.2_Missense_Mutation_p.P200S|ZFYVE27_ENST00000370613.3_Missense_Mutation_p.P82S	NM_144588.6	NP_653189.3	Q5T4F4	ZFY27_HUMAN	zinc finger, FYVE domain containing 27	200					cell death (GO:0008219)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein localization to plasma membrane (GO:0072659)	axon (GO:0030424)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)	metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	8		Colorectal(252;0.0846)		Epithelial(162;7.08e-10)|all cancers(201;5.18e-08)		GTATTTGCTGCCACTCTGCTG	0.517																																																	0													145.0	123.0	131.0					10																	99509277		2203	4300	6503	SO:0001583	missense	0			BC030621	CCDS31263.1, CCDS31264.1, CCDS53562.1, CCDS53563.1, CCDS53564.1, CCDS53565.1	10q24.2	2013-09-11			ENSG00000155256	ENSG00000155256		"""Zinc fingers, FYVE domain containing"""	26559	protein-coding gene	gene with protein product	"""protrudin"""	610243				14702039	Standard	NM_144588		Approved	FLJ32919, SPG33	uc001kol.2	Q5T4F4	OTTHUMG00000018867	ENST00000393677.4:c.598C>T	10.37:g.99509277C>T	ENSP00000377282:p.Pro200Ser		B7Z3S0|B7Z404|B7Z626|G8JLC3|G8JLF0|J3KP98|Q5T4F1|Q5T4F2|Q5T4F3|Q8N1K0|Q8N6D6|Q8NCA0|Q8NDE4|Q96M08	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.P200S	ENST00000393677.4	37	c.598	CCDS31263.1	10	.	.	.	.	.	.	.	.	.	.	C	26.2	4.716881	0.89205	.	.	ENSG00000155256	ENST00000337540;ENST00000357540;ENST00000370613;ENST00000370610;ENST00000393677;ENST00000453958;ENST00000359980;ENST00000356257;ENST00000423811	T;T;T;T;T;T;T	0.71222	-0.51;-0.55;-0.37;-0.32;-0.49;-0.48;-0.4	5.79	5.79	0.91817	.	0.046312	0.85682	D	0.000000	T	0.78723	0.4328	L	0.32530	0.975	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.999;0.974;0.977;0.998;1.0;0.996	T	0.79976	-0.1576	10	0.72032	D	0.01	-25.214	18.2147	0.89881	0.0:1.0:0.0:0.0	.	168;102;82;114;200;200;200	B7Z404;B7Z3S0;B7Z626;Q5T4F4-5;Q5T4F4-3;Q5T4F4-2;Q5T4F4	.;.;.;.;.;.;ZFY27_HUMAN	S	168;114;82;102;200;200;200;200;178	ENSP00000337993:P168S;ENSP00000359642:P102S;ENSP00000377282:P200S;ENSP00000401580:P200S;ENSP00000353069:P200S;ENSP00000348593:P200S;ENSP00000409594:P178S	ENSP00000337993:P168S	P	+	1	0	ZFYVE27	99499267	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	6.862000	0.75484	2.753000	0.94483	0.555000	0.69702	CCA	ZFYVE27	-	NULL	ENSG00000155256		0.517	ZFYVE27-003	KNOWN	basic|CCDS	protein_coding	ZFYVE27	HGNC	protein_coding	OTTHUMT00000049745.2		0.00	49	0	C	NM_144588		99509277	+1			no_errors	ENST00000356257	ensembl	human	known	74_37	missense	11.54	23	3	SNP	1.000	T
ZNF106	64397	genome.wustl.edu	37	15	42730815	42730815	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr15:42730815G>T	ENST00000263805.4	-	9	4852	c.4526C>A	c.(4525-4527)tCt>tAt	p.S1509Y	ZNF106_ENST00000565380.1_Missense_Mutation_p.S737Y|ZNF106_ENST00000565611.1_Missense_Mutation_p.S694Y	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106	1509				S -> P (in Ref. 2; BAG63952). {ECO:0000305}.	insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										AATACCTGAAGAATTCTTTGA	0.338																																																	0													61.0	60.0	60.0					15																	42730815		2203	4299	6502	SO:0001583	missense	0			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.4526C>A	15.37:g.42730815G>T	ENSP00000263805:p.Ser1509Tyr		B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_Znf_C2H2-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S1509Y	ENST00000263805.4	37	c.4526	CCDS32208.1	15	.	.	.	.	.	.	.	.	.	.	G	19.92	3.917066	0.73098	.	.	ENSG00000103994	ENST00000263805;ENST00000434903	T	0.58797	0.31	4.93	4.93	0.64822	.	0.153281	0.56097	D	0.000030	T	0.72374	0.3452	L	0.56769	1.78	0.48762	D	0.999708	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.994	T	0.74520	-0.3638	10	0.66056	D	0.02	-13.132	15.4324	0.75112	0.0:0.0:1.0:0.0	.	737;1509	E9PE29;Q9H2Y7	.;ZF106_HUMAN	Y	1509;737	ENSP00000263805:S1509Y	ENSP00000263805:S1509Y	S	-	2	0	ZFP106	40518107	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.367000	0.59498	2.552000	0.86080	0.650000	0.86243	TCT	ZNF106	-	NULL	ENSG00000103994		0.338	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF106	HGNC	protein_coding	OTTHUMT00000422587.1		0.00	33	0	G	NM_022473		42730815	-1			no_errors	ENST00000263805	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
ZNF205	7755	genome.wustl.edu	37	16	3168964	3168964	+	Silent	SNP	G	G	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr16:3168964G>A	ENST00000382192.3	+	6	748	c.543G>A	c.(541-543)tcG>tcA	p.S181S	RP11-473M20.14_ENST00000575139.1_RNA|ZNF205_ENST00000219091.4_Silent_p.S181S|RP11-473M20.14_ENST00000576490.1_RNA	NM_001278158.1|NM_003456.2	NP_001265087.1|NP_003447.2	O95201	ZN205_HUMAN	zinc finger protein 205	181	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hydrogen peroxide biosynthetic process (GO:0010729)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20						GTGAGGCCTCGGGCTCCAGCC	0.672																																																	0													56.0	67.0	63.0					16																	3168964		2196	4300	6496	SO:0001819	synonymous_variant	0			AF060865	CCDS10494.2	16p13.3	2013-01-08			ENSG00000122386	ENSG00000122386		"""Zinc fingers, C2H2-type"", ""-"""	12996	protein-coding gene	gene with protein product		603436		ZNF210		9787081	Standard	NM_003456		Approved	Zfp13	uc002cub.3	O95201	OTTHUMG00000148676	ENST00000382192.3:c.543G>A	16.37:g.3168964G>A			A8MZK0|D3DUB4|Q9BU95	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S181	ENST00000382192.3	37	c.543	CCDS10494.2	16																																																																																			ZNF205	-	smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000122386		0.672	ZNF205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF205	HGNC	protein_coding	OTTHUMT00000309057.1	-	0.00	69	0	G	NM_003456		3168964	+1	tier1	-	no_errors	ENST00000219091	ensembl	human	known	74_37	silent	17.31	43	9	SNP	0.000	A
ZNF292	23036	genome.wustl.edu	37	6	87964759	87964759	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr6:87964759A>G	ENST00000369577.3	+	8	1455	c.1412A>G	c.(1411-1413)gAt>gGt	p.D471G	ZNF292_ENST00000339907.4_Missense_Mutation_p.D466G	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	471						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TCTTCAATAGATGAACTAAAT	0.388																																																	0													109.0	101.0	104.0					6																	87964759		1857	4091	5948	SO:0001583	missense	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.1412A>G	6.37:g.87964759A>G	ENSP00000358590:p.Asp471Gly		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D471G	ENST00000369577.3	37	c.1412	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	A	16.65	3.183207	0.57800	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.36157	1.27;1.27	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.50803	0.1637	M	0.64997	1.995	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	T	0.54990	-0.8210	10	0.72032	D	0.01	.	16.2631	0.82557	1.0:0.0:0.0:0.0	.	471	O60281	ZN292_HUMAN	G	471;466	ENSP00000358590:D471G;ENSP00000342847:D466G	ENSP00000342847:D466G	D	+	2	0	ZNF292	88021478	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	9.339000	0.96797	2.239000	0.73571	0.528000	0.53228	GAT	ZNF292	-	NULL	ENSG00000188994		0.388	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	-	0.00	28	0	A	NM_015021		87964759	+1	tier1	-	no_errors	ENST00000369577	ensembl	human	known	74_37	missense	29.41	24	10	SNP	1.000	G
ZNF626	199777	genome.wustl.edu	37	19	20808302	20808302	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:20808302T>G	ENST00000601440.1	-	4	527	c.381A>C	c.(379-381)aaA>aaC	p.K127N	CTC-513N18.7_ENST00000595094.1_lincRNA	NM_001076675.2	NP_001070143.1	Q68DY1	ZN626_HUMAN	zinc finger protein 626	127					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|lung(3)|skin(1)	6						TATAACCTTCTTTGTGCACCT	0.313																																																	0													103.0	108.0	106.0					19																	20808302		2170	4286	6456	SO:0001583	missense	0			BC007116	CCDS32976.1, CCDS42535.1	19p13.11	2013-01-08				ENSG00000188171		"""Zinc fingers, C2H2-type"", ""-"""	30461	protein-coding gene	gene with protein product						12477932	Standard	NM_145297		Approved		uc002npb.1	Q68DY1		ENST00000601440.1:c.381A>C	19.37:g.20808302T>G	ENSP00000469958:p.Lys127Asn		Q8N8T4|Q96QM1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K127N	ENST00000601440.1	37	c.381	CCDS42535.1	19	.	.	.	.	.	.	.	.	.	.	N	8.423	0.846762	0.16963	.	.	ENSG00000188171	ENST00000392298;ENST00000453075;ENST00000305570	.	.	.	0.898	-1.8	0.07907	.	.	.	.	.	T	0.51466	0.1676	M	0.81112	2.525	0.09310	N	1	P	0.52061	0.95	P	0.58210	0.835	T	0.42396	-0.9454	8	0.39692	T	0.17	.	2.2466	0.04033	0.0:0.2513:0.312:0.4366	.	127	Q68DY1	ZN626_HUMAN	N	127;51;127	.	ENSP00000445201:K127N	K	-	3	2	ZNF626	20600142	0.003000	0.15002	0.003000	0.11579	0.003000	0.03518	0.331000	0.19733	-1.021000	0.03350	-1.058000	0.02302	AAA	ZNF626	-	NULL	ENSG00000188171		0.313	ZNF626-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF626	HGNC	protein_coding	OTTHUMT00000447845.2	-	0.00	145	0	T	NM_145297		20808302	-1	tier1	-	no_errors	ENST00000601440	ensembl	human	known	74_37	missense	14.29	102	17	SNP	0.001	G
ZNF493	284443	genome.wustl.edu	37	19	21606279	21606279	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:21606279C>A	ENST00000355504.4	+	2	700	c.434C>A	c.(433-435)tCt>tAt	p.S145Y	CTD-2561J22.3_ENST00000600810.1_Intron|ZNF493_ENST00000392288.2_Missense_Mutation_p.S273Y	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	145					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S273C(1)|p.S145C(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						TGTGGCACATCTTTCTACCAA	0.348																																																	2	Substitution - Missense(2)	urinary_tract(2)											52.0	54.0	53.0					19																	21606279		2203	4297	6500	SO:0001583	missense	0			AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.434C>A	19.37:g.21606279C>A	ENSP00000347691:p.Ser145Tyr		G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S145Y	ENST00000355504.4	37	c.434	CCDS12412.1	19	.	.	.	.	.	.	.	.	.	.	N	8.277	0.814617	0.16607	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	T;T	0.18810	2.19;2.19	0.927	0.927	0.19437	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.31167	0.0788	M	0.64997	1.995	0.09310	N	1	D;P	0.59767	0.986;0.866	P;B	0.55345	0.774;0.227	T	0.11060	-1.0603	9	0.87932	D	0	.	6.3469	0.21355	0.0:0.4433:0.5567:0.0	.	145;273	Q6ZR52;Q6ZR52-2	ZN493_HUMAN;.	Y	273;145	ENSP00000376110:S273Y;ENSP00000347691:S145Y	ENSP00000347691:S145Y	S	+	2	0	ZNF493	21398119	0.000000	0.05858	0.016000	0.15963	0.016000	0.09150	-0.908000	0.04063	0.378000	0.24764	0.384000	0.25694	TCT	ZNF493	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196268		0.348	ZNF493-003	KNOWN	basic|CCDS	protein_coding	ZNF493	HGNC	protein_coding	OTTHUMT00000280563.1		0.00	35	0	C	NM_175910		21606279	+1			no_errors	ENST00000355504	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.028	A
ZNF568	374900	genome.wustl.edu	37	19	37441138	37441138	+	Silent	SNP	T	T	G			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:37441138T>G	ENST00000333987.7	+	7	1589	c.1083T>G	c.(1081-1083)ccT>ccG	p.P361P	ZNF568_ENST00000415168.1_Silent_p.P297P|ZNF568_ENST00000427117.1_Intron|ZNF568_ENST00000455427.2_Intron	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	361					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGGAGAAACCTTATGCATGTA	0.388																																																	0													77.0	84.0	82.0					19																	37441138		2196	4296	6492	SO:0001819	synonymous_variant	0			BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.1083T>G	19.37:g.37441138T>G			B4DS92|E7ER33|Q6N060|Q8NA64	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P361	ENST00000333987.7	37	c.1083	CCDS42558.1	19																																																																																			ZNF568	-	pfscan_Znf_C2H2	ENSG00000198453		0.388	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF568	HGNC	protein_coding	OTTHUMT00000109572.2	-	0.00	69	0	T	NM_198539		37441138	+1	tier1	-	no_errors	ENST00000333987	ensembl	human	known	74_37	silent	19.05	68	16	SNP	0.003	G
ZNF470	388566	genome.wustl.edu	37	19	57089485	57089485	+	Missense_Mutation	SNP	A	A	T			TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:57089485A>T	ENST00000330619.8	+	6	2374	c.1688A>T	c.(1687-1689)aAg>aTg	p.K563M	ZNF470_ENST00000601902.1_Intron|ZNF470_ENST00000391709.3_Missense_Mutation_p.K563M	NM_001001668.3	NP_001001668.3	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	563					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|large_intestine(12)|lung(11)|ovary(1)|pancreas(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	41		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		ACTGGTGAGAAGCCTTACGAA	0.438																																																	0													100.0	88.0	92.0					19																	57089485		2203	4300	6503	SO:0001583	missense	0			AK129686	CCDS33122.1	19q13.43	2013-01-08				ENSG00000197016		"""Zinc fingers, C2H2-type"", ""-"""	22220	protein-coding gene	gene with protein product						15302581	Standard	NM_001001668		Approved	CZF-1, FLJ26175	uc002qnl.4	Q6ECI4		ENST00000330619.8:c.1688A>T	19.37:g.57089485A>T	ENSP00000333223:p.Lys563Met		A8MTW0|B9EGU1|Q6ZPA1|Q9Y2N9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K563M	ENST00000330619.8	37	c.1688	CCDS33122.1	19	.	.	.	.	.	.	.	.	.	.	A	18.52	3.641678	0.67244	.	.	ENSG00000197016	ENST00000391709;ENST00000330619	T;T	0.27557	1.66;1.66	4.37	3.36	0.38483	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.57710	0.2072	M	0.89478	3.035	0.33593	D	0.601402	D	0.89917	1.0	D	0.77004	0.989	T	0.70132	-0.4956	9	0.87932	D	0	.	8.9195	0.35604	0.9089:0.0:0.0911:0.0	.	563	Q6ECI4	ZN470_HUMAN	M	563	ENSP00000375590:K563M;ENSP00000333223:K563M	ENSP00000333223:K563M	K	+	2	0	ZNF470	61781297	0.987000	0.35691	1.000000	0.80357	0.966000	0.64601	1.544000	0.36158	0.729000	0.32403	0.528000	0.53228	AAG	ZNF470	-	pfscan_Znf_C2H2	ENSG00000197016		0.438	ZNF470-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF470	HGNC	protein_coding	OTTHUMT00000459707.2	-	0.00	73	0	A	NM_001001668		57089485	+1	tier1	-	no_errors	ENST00000330619	ensembl	human	known	74_37	missense	17.50	66	14	SNP	1.000	T
ZNF804B	219578	genome.wustl.edu	37	7	88964744	88964744	+	Missense_Mutation	SNP	A	A	C	rs199698606		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr7:88964744A>C	ENST00000333190.4	+	4	3057	c.2448A>C	c.(2446-2448)caA>caC	p.Q816H		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	816							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			ATCAACAACAATTTTCAGGGC	0.358										HNSCC(36;0.09)																																							0													47.0	48.0	48.0					7																	88964744		2197	4293	6490	SO:0001583	missense	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2448A>C	7.37:g.88964744A>C	ENSP00000329638:p.Gln816His		B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.Q816H	ENST00000333190.4	37	c.2448	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	A	11.63	1.695669	0.30052	.	.	ENSG00000182348	ENST00000333190	T	0.05382	3.45	5.19	-1.49	0.08718	.	0.534272	0.18237	N	0.147346	T	0.07593	0.0191	L	0.27053	0.805	0.09310	N	1	D	0.63880	0.993	P	0.53185	0.72	T	0.31724	-0.9933	10	0.32370	T	0.25	-5.3836	11.5099	0.50488	0.4725:0.0:0.5275:0.0	.	816	A4D1E1	Z804B_HUMAN	H	816	ENSP00000329638:Q816H	ENSP00000329638:Q816H	Q	+	3	2	ZNF804B	88802680	0.000000	0.05858	0.002000	0.10522	0.929000	0.56500	-0.143000	0.10296	-0.120000	0.11809	0.533000	0.62120	CAA	ZNF804B	-	NULL	ENSG00000182348		0.358	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	-	0.00	30	0	A	NM_181646		88964744	+1	tier1	-	no_errors	ENST00000333190	ensembl	human	known	74_37	missense	40.91	13	9	SNP	0.000	C
ZSCAN18	65982	genome.wustl.edu	37	19	58601387	58601387	+	Missense_Mutation	SNP	C	C	T	rs375610615		TCGA-JY-A93D-01A-11D-A387-09	TCGA-JY-A93D-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	47f5b536-9d6f-4d88-a50c-c21574548e75	da2df177-c57c-4de1-882c-07f7a1b1c4db	g.chr19:58601387C>T	ENST00000240727.6	-	2	647	c.248G>A	c.(247-249)cGc>cAc	p.R83H	ZSCAN18_ENST00000421612.2_Intron|ZSCAN18_ENST00000600404.1_Missense_Mutation_p.R139H|ZSCAN18_ENST00000601144.1_Missense_Mutation_p.R83H	NM_023926.4	NP_076415.3	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	83	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|skin(3)	19		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CTCCTTGGAGCGCGCCTCAGG	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		15047	0.001		0.0	False		,,,				2504	0.0																0								C	HIS/ARG,HIS/ARG,,HIS/ARG	1,4405		0,1,2202	39.0	40.0	40.0		416,248,,248	1.3	0.2	19		40	0,8600		0,0,4300	no	missense,missense,intron,missense	ZSCAN18	NM_001145542.1,NM_001145543.1,NM_001145544.1,NM_023926.4	29,29,,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign,,benign	139/567,83/511,,83/511	58601387	1,13005	2203	4300	6503	SO:0001583	missense	0			AY280799, AY279352	CCDS12971.1, CCDS46214.1, CCDS46215.1	19q13.43	2013-01-09	2007-02-20	2007-02-20		ENSG00000121413		"""-"", ""Zinc fingers, C2H2-type"""	21037	protein-coding gene	gene with protein product			"""zinc finger protein 447"""	ZNF447			Standard	NM_001145542		Approved	FLJ12895	uc010yht.1	Q8TBC5		ENST00000240727.6:c.248G>A	19.37:g.58601387C>T	ENSP00000240727:p.Arg83His		B4DG23|E9PBI0|Q9BRK7|Q9H9A0	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R139H	ENST00000240727.6	37	c.416	CCDS12971.1	19	.	.	.	.	.	.	.	.	.	.	C	9.592	1.126414	0.20959	2.27E-4	0.0	ENSG00000121413	ENST00000433686;ENST00000240727	T	0.03772	3.81	3.53	1.32	0.21799	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	1.212910	0.06448	N	0.727169	T	0.01421	0.0046	N	0.01493	-0.835	0.21064	N	0.999798	B;B;B;B	0.33413	0.126;0.012;0.411;0.288	B;B;B;B	0.24155	0.023;0.002;0.024;0.051	T	0.34204	-0.9838	10	0.02654	T	1	-0.621	4.831	0.13439	0.0:0.6128:0.0:0.3872	.	139;153;83;83	B4DG23;Q6ZMK6;Q8TBC5-2;Q8TBC5	.;.;.;ZSC18_HUMAN	H	139;83	ENSP00000240727:R83H	ENSP00000240727:R83H	R	-	2	0	ZSCAN18	63293199	0.000000	0.05858	0.155000	0.22561	0.917000	0.54804	-2.015000	0.01447	0.197000	0.20387	0.561000	0.74099	CGC	ZSCAN18	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000121413		0.657	ZSCAN18-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	ZSCAN18	HGNC	protein_coding	OTTHUMT00000466706.1	-	0.00	90	0	C	NM_023926		58601387	-1	tier1	-	no_errors	ENST00000600404	ensembl	human	known	74_37	missense	22.37	59	17	SNP	0.245	T
