#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ACVRL1	94	genome.wustl.edu	37	12	52307360	52307360	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr12:52307360G>A	ENST00000388922.4	+	4	614	c.331G>A	c.(331-333)Gag>Aag	p.E111K	ACVRL1_ENST00000550683.1_Missense_Mutation_p.E125K|ACVRL1_ENST00000419526.2_Intron	NM_000020.2	NP_000011.2	P37023	ACVL1_HUMAN	activin A receptor type II-like 1	111					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|artery development (GO:0060840)|blood circulation (GO:0008015)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|blood vessel maturation (GO:0001955)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|cellular response to transforming growth factor beta stimulus (GO:0071560)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of focal adhesion assembly (GO:0051895)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of blood pressure (GO:0008217)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of DNA replication (GO:0006275)|regulation of endothelial cell proliferation (GO:0001936)|regulation of transcription, DNA-templated (GO:0006355)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|venous blood vessel development (GO:0060841)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	ACCTCCTTCGGAGCAGCCGGG	0.677																																																	0													17.0	17.0	17.0					12																	52307360		2200	4297	6497	SO:0001583	missense	0			L17075	CCDS31804.1	12q13.13	2014-09-17			ENSG00000139567	ENSG00000139567			175	protein-coding gene	gene with protein product		601284		ACVRLK1, ORW2		8397373, 8640225	Standard	NM_000020		Approved	HHT2, ALK1, HHT	uc001rzk.3	P37023	OTTHUMG00000169507	ENST00000388922.4:c.331G>A	12.37:g.52307360G>A	ENSP00000373574:p.Glu111Lys		A6NGA8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_TGFB_receptor	p.E125K	ENST00000388922.4	37	c.373	CCDS31804.1	12	.	.	.	.	.	.	.	.	.	.	G	10.96	1.499324	0.26861	.	.	ENSG00000139567	ENST00000388922;ENST00000267008;ENST00000550683	D;D	0.85861	-2.01;-2.04	5.54	3.68	0.42216	.	0.574970	0.14566	N	0.311743	T	0.70245	0.3202	N	0.19112	0.55	0.80722	D	1	B	0.15141	0.012	B	0.08055	0.003	T	0.56147	-0.8027	10	0.08179	T	0.78	.	7.5497	0.27788	0.0891:0.1666:0.7443:0.0	.	111	P37023	ACVL1_HUMAN	K	111;111;125	ENSP00000373574:E111K;ENSP00000447884:E125K	ENSP00000267008:E111K	E	+	1	0	ACVRL1	50593627	0.999000	0.42202	0.014000	0.15608	0.183000	0.23260	4.774000	0.62339	0.663000	0.31027	0.591000	0.81541	GAG	ACVRL1	-	NULL	ENSG00000139567		0.677	ACVRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVRL1	HGNC	protein_coding	OTTHUMT00000404520.2		0.00	16	0	G			52307360	+1			no_errors	ENST00000550683	ensembl	human	known	74_37	missense	16.00	21	4	SNP	0.738	A
ADAM12	8038	genome.wustl.edu	37	10	127782586	127782586	+	Missense_Mutation	SNP	C	C	A	rs534081356		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr10:127782586C>A	ENST00000368679.4	-	11	1431	c.1122G>T	c.(1120-1122)gaG>gaT	p.E374D	ADAM12_ENST00000368676.4_Missense_Mutation_p.E374D	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	374	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		AGCCTCCTTTCTCAACCGCCA	0.542																																																	0													190.0	161.0	171.0					10																	127782586		2203	4300	6503	SO:0001583	missense	0			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.1122G>T	10.37:g.127782586C>A	ENSP00000357668:p.Glu374Asp		O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.E374D	ENST00000368679.4	37	c.1122	CCDS7653.1	10	.	.	.	.	.	.	.	.	.	.	C	3.285	-0.146235	0.06627	.	.	ENSG00000148848	ENST00000368679;ENST00000368676	T;T	0.64618	-0.11;-0.11	4.89	-5.32	0.02722	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.125099	0.51477	N	0.000087	T	0.35098	0.0920	L	0.27975	0.815	0.30511	N	0.769393	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.09377	0.004;0.002;0.002;0.004;0.001	T	0.04242	-1.0966	10	0.27785	T	0.31	.	3.5634	0.07890	0.2979:0.2879:0.3329:0.0813	.	371;371;374;371;374	A8K6G4;O43184-3;O43184-2;O43184-4;O43184	.;.;.;.;ADA12_HUMAN	D	374	ENSP00000357668:E374D;ENSP00000357665:E374D	ENSP00000357665:E374D	E	-	3	2	ADAM12	127772576	0.000000	0.05858	0.099000	0.21106	0.084000	0.17831	-2.300000	0.01138	-0.935000	0.03728	-0.519000	0.04390	GAG	ADAM12	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000148848		0.542	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM12	HGNC	protein_coding	OTTHUMT00000050961.1	-	0.00	81	0	C			127782586	-1	tier1	-	no_errors	ENST00000368679	ensembl	human	known	74_37	missense	13.98	80	13	SNP	0.722	A
ADAM28	10863	genome.wustl.edu	37	8	24181395	24181395	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr8:24181395T>C	ENST00000265769.4	+	9	879	c.769T>C	c.(769-771)Tgg>Cgg	p.W257R	ADAM28_ENST00000540823.1_Missense_Mutation_p.W24R|RP11-624C23.1_ENST00000523700.1_RNA|ADAM28_ENST00000437154.2_Missense_Mutation_p.W257R|RP11-624C23.1_ENST00000523578.1_RNA|ADAM28_ENST00000397649.3_Missense_Mutation_p.W4R|RP11-624C23.1_ENST00000518988.1_RNA|ADAM28_ENST00000518516.1_3'UTR|RP11-624C23.1_ENST00000519689.1_RNA	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	257	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		TATGGAAATCTGGACTGACAA	0.363																																					NSCLC(193;488 2149 22258 34798 40734)												0													93.0	93.0	93.0					8																	24181395		2203	4299	6502	SO:0001583	missense	0			AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.769T>C	8.37:g.24181395T>C	ENSP00000265769:p.Trp257Arg		B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.W257R	ENST00000265769.4	37	c.769	CCDS34865.1	8	.	.	.	.	.	.	.	.	.	.	T	18.26	3.584963	0.66105	.	.	ENSG00000042980	ENST00000265769;ENST00000397649;ENST00000540823;ENST00000437154	D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14	5.19	5.19	0.71726	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	D	0.95535	0.8549	H	0.97315	3.98	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96379	0.9280	9	0.87932	D	0	.	11.4396	0.50090	0.0:0.0:0.0:1.0	.	24;257;257	B4DDY3;Q9UKQ2;Q9UKQ2-2	.;ADA28_HUMAN;.	R	257;4;24;257	ENSP00000265769:W257R;ENSP00000380770:W4R;ENSP00000443743:W24R;ENSP00000393699:W257R	ENSP00000265769:W257R	W	+	1	0	ADAM28	24237340	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	5.548000	0.67255	1.955000	0.56771	0.528000	0.53228	TGG	ADAM28	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000042980		0.363	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM28	HGNC	protein_coding	OTTHUMT00000375441.2	-	0.00	34	0	T	NM_021778		24181395	+1	tier1	-	no_errors	ENST00000265769	ensembl	human	known	74_37	missense	18.03	50	11	SNP	1.000	C
ADAMTS10	81794	genome.wustl.edu	37	19	8651466	8651466	+	Silent	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:8651466C>A	ENST00000597188.1	-	20	2649	c.2379G>T	c.(2377-2379)ccG>ccT	p.P793P	ADAMTS10_ENST00000270328.4_Silent_p.P793P|ADAMTS10_ENST00000595838.1_Silent_p.P280P	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	793	Spacer.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						ATGCATTAATCGGTCCCAGGG	0.612											OREG0025221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													71.0	72.0	72.0					19																	8651466		2203	4300	6503	SO:0001819	synonymous_variant	0			AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.2379G>T	19.37:g.8651466C>A		81	M0QZE4	Silent	SNP	pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.P793	ENST00000597188.1	37	c.2379	CCDS12206.1	19																																																																																			ADAMTS10	-	pfam_ADAM_spacer1	ENSG00000142303		0.612	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS10	HGNC	protein_coding	OTTHUMT00000460085.3	-	0.00	46	0	C	NM_030957		8651466	-1	tier1	-	no_errors	ENST00000270328	ensembl	human	known	74_37	silent	23.33	46	14	SNP	0.429	A
ADAMTS16	170690	genome.wustl.edu	37	5	5318251	5318251	+	Missense_Mutation	SNP	C	C	T	rs372733019		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr5:5318251C>T	ENST00000274181.7	+	22	3554	c.3416C>T	c.(3415-3417)aCg>aTg	p.T1139M		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	1139	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						TCACAGTGCACGGCCAGCTGT	0.652																																																	0								C	MET/THR	0,4182		0,0,2091	43.0	49.0	47.0		3416	4.8	1.0	5		47	3,8425		0,3,4211	no	missense	ADAMTS16	NM_139056.2	81	0,3,6302	TT,TC,CC		0.0356,0.0,0.0238	probably-damaging	1139/1225	5318251	3,12607	2091	4214	6305	SO:0001583	missense	0			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.3416C>T	5.37:g.5318251C>T	ENSP00000274181:p.Thr1139Met		C6G490|Q8IVE2	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.T1139M	ENST00000274181.7	37	c.3416	CCDS43299.1	5	.	.	.	.	.	.	.	.	.	.	C	16.87	3.240854	0.58995	0.0	3.56E-4	ENSG00000145536	ENST00000274181	T	0.54866	0.55	4.83	4.83	0.62350	.	0.060052	0.64402	D	0.000004	T	0.80243	0.4587	H	0.95645	3.7	0.80722	D	1	D	0.89917	1.0	D	0.72625	0.978	D	0.86552	0.1835	10	0.87932	D	0	.	15.7989	0.78436	0.0:1.0:0.0:0.0	.	1139	Q8TE57	ATS16_HUMAN	M	1139	ENSP00000274181:T1139M	ENSP00000274181:T1139M	T	+	2	0	ADAMTS16	5371251	0.993000	0.37304	0.963000	0.40424	0.125000	0.20455	5.421000	0.66447	2.396000	0.81511	0.563000	0.77884	ACG	ADAMTS16	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000145536		0.652	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS16	HGNC	protein_coding	OTTHUMT00000365657.1		0.00	20	0	C	NM_139056		5318251	+1			no_errors	ENST00000274181	ensembl	human	known	74_37	missense	15.15	28	5	SNP	0.998	T
ADCY1	107	genome.wustl.edu	37	7	45753493	45753493	+	Frame_Shift_Del	DEL	C	C	-	rs529767948		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr7:45753493delC	ENST00000297323.7	+	20	3281	c.3259delC	c.(3259-3261)cccfs	p.P1088fs		NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	1088					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GGGCAGACGTCCCCCCGTGTG	0.617																																																	0													79.0	74.0	76.0					7																	45753493		2203	4300	6503	SO:0001589	frameshift_variant	0			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.3259delC	7.37:g.45753493delC	ENSP00000297323:p.Pro1088fs		A4D2L8|Q75MI1	Frame_Shift_Del	DEL	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.V1089fs	ENST00000297323.7	37	c.3259	CCDS34631.1	7																																																																																			ADCY1	-	NULL	ENSG00000164742		0.617	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY1	HGNC	protein_coding	OTTHUMT00000340055.2		0.00	58	0	C	NM_021116		45753493	+1	tier1		no_errors	ENST00000297323	ensembl	human	known	74_37	frame_shift_del	15.49	60	11	DEL	0.993	-
ADCY10	55811	genome.wustl.edu	37	1	167844397	167844397	+	Silent	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:167844397G>A	ENST00000367851.4	-	13	1618	c.1434C>T	c.(1432-1434)tgC>tgT	p.C478C	ADCY10_ENST00000367848.1_Silent_p.C386C|ADCY10_ENST00000545172.1_Silent_p.C325C	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	478					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						CCTTTCTGTTGCAGATGAGGC	0.383																																																	0													107.0	100.0	102.0					1																	167844397		2203	4300	6503	SO:0001819	synonymous_variant	0			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.1434C>T	1.37:g.167844397G>A			B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Silent	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,superfamily_P-loop_NTPase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.C478	ENST00000367851.4	37	c.1434	CCDS1265.1	1																																																																																			ADCY10	-	superfamily_P-loop_NTPase,pirsf_Adenylate_cylcase_typ10	ENSG00000143199		0.383	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	-	0.00	37	0	G	NM_018417		167844397	-1	tier1	-	no_errors	ENST00000367851	ensembl	human	known	74_37	silent	16.28	35	7	SNP	0.850	A
ADRA2A	150	genome.wustl.edu	37	10	112838931	112838931	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr10:112838931G>T	ENST00000280155.2	+	1	2142	c.1177G>T	c.(1177-1179)Gtg>Ttg	p.V393L		NM_000681.3	NP_000672.3	P08913	ADA2A_HUMAN	adrenoceptor alpha 2A	378					actin cytoskeleton organization (GO:0030036)|activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|acute inflammatory response (GO:0002526)|adenylate cyclase-inhibiting adrenergic receptor signaling pathway (GO:0071881)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|DNA replication (GO:0006260)|energy reserve metabolic process (GO:0006112)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|fear response (GO:0042596)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intestinal absorption (GO:0050892)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of adrenergic receptor signaling pathway (GO:0071878)|negative regulation of calcium ion transmembrane transporter activity (GO:1901020)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of insulin secretion (GO:0046676)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of norepinephrine secretion (GO:0010700)|negative regulation of uterine smooth muscle contraction (GO:0070473)|phospholipase C-activating adrenergic receptor signaling pathway (GO:0071882)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of vasodilation (GO:0045909)|positive regulation of wound healing (GO:0090303)|Ras protein signal transduction (GO:0007265)|regulation of insulin secretion (GO:0050796)|regulation of vasoconstriction (GO:0019229)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|thermoception (GO:0050955)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	alpha-1B adrenergic receptor binding (GO:0031692)|alpha-2C adrenergic receptor binding (GO:0031696)|alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)|heterotrimeric G-protein binding (GO:0032795)|norepinephrine binding (GO:0051380)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)			breast(1)|cervix(3)|endometrium(6)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(234;0.0735)|Lung NSC(174;0.238)		Epithelial(162;0.000316)|all cancers(201;0.00501)|BRCA - Breast invasive adenocarcinoma(275;0.118)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Dexmedetomidine(DB00633)|Dihydroergotamine(DB00320)|Dipivefrin(DB00449)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupirtine(DB06623)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Lofexidine(DB04948)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methyldopa(DB00968)|Mianserin(DB06148)|Mirtazapine(DB00370)|Naphazoline(DB06711)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phentolamine(DB00692)|Phenylpropanolamine(DB00397)|Pramipexole(DB00413)|Prazosin(DB00457)|Propericiazine(DB01608)|Pseudoephedrine(DB00852)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trazodone(DB00656)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CGTGCTGGCCGTGGTCATCGG	0.677																																					Esophageal Squamous(173;605 2658 7278 49362)												0													130.0	105.0	114.0					10																	112838931		2203	4300	6503	SO:0001583	missense	0			AF284095	CCDS7569.2	10q25.2	2012-08-08	2012-05-09		ENSG00000150594	ENSG00000150594		"""GPCR / Class A : Adrenoceptors : alpha"""	281	protein-coding gene	gene with protein product	"""alpha-2AAR subtype C10"", "" alpha-2A-adrenergic receptor"""	104210	"""adrenergic, alpha-2A-, receptor"""	ADRA2, ADRA2R			Standard	NM_000681		Approved	ADRAR	uc001kzo.3	P08913	OTTHUMG00000019050	ENST00000280155.2:c.1177G>T	10.37:g.112838931G>T	ENSP00000280155:p.Val393Leu		B0LPF6|Q2I8G2|Q2XN99|Q86TH8|Q9BZK1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_ADRA2A_rcpt,prints_GPCR_Rhodpsn,prints_ADR_fam,prints_Musac_Ach_rcpt	p.V393L	ENST00000280155.2	37	c.1177	CCDS7569.2	10	.	.	.	.	.	.	.	.	.	.	G	25.7	4.664089	0.88251	.	.	ENSG00000150594	ENST00000280155	T	0.39406	1.08	3.37	3.37	0.38596	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000001	T	0.61776	0.2374	M	0.68728	2.09	0.58432	D	0.999998	D	0.89917	1.0	D	0.85130	0.997	T	0.67647	-0.5617	10	0.62326	D	0.03	.	15.2452	0.73502	0.0:0.0:1.0:0.0	.	378	P08913	ADA2A_HUMAN	L	393	ENSP00000280155:V393L	ENSP00000280155:V393L	V	+	1	0	ADRA2A	112828921	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.135000	0.94478	1.839000	0.53478	0.462000	0.41574	GTG	ADRA2A	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000150594		0.677	ADRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRA2A	HGNC	protein_coding	OTTHUMT00000050372.2		0.00	33	0	G	NM_000681		112838931	+1			no_errors	ENST00000280155	ensembl	human	known	74_37	missense	6.90	27	2	SNP	1.000	T
AFF1	4299	genome.wustl.edu	37	4	88035615	88035615	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr4:88035615C>T	ENST00000307808.6	+	11	2029	c.1609C>T	c.(1609-1611)Ccc>Tcc	p.P537S	AFF1_ENST00000544085.1_Missense_Mutation_p.P175S|AFF1_ENST00000395146.4_Missense_Mutation_p.P544S	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	537					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		GAGCACAGAGCCCCCACGGCG	0.592																																																	0													16.0	22.0	20.0					4																	88035615		2189	4283	6472	SO:0001583	missense	0			L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.1609C>T	4.37:g.88035615C>T	ENSP00000305689:p.Pro537Ser		B4DTU1|E9PBM3	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.P544S	ENST00000307808.6	37	c.1630	CCDS3616.1	4	.	.	.	.	.	.	.	.	.	.	C	11.87	1.768769	0.31320	.	.	ENSG00000172493	ENST00000395146;ENST00000541943;ENST00000307808;ENST00000544085	T;T;T	0.62498	0.02;0.02;0.02	5.62	2.57	0.30868	.	0.873824	0.10232	N	0.699523	T	0.36771	0.0979	N	0.16790	0.44	0.09310	N	1	B;B;B	0.21071	0.051;0.051;0.051	B;B;B	0.17433	0.018;0.018;0.018	T	0.30909	-0.9962	10	0.05436	T	0.98	-1.3899	3.9748	0.09470	0.1724:0.5824:0.15:0.0952	.	544;537;537	E9PBM3;Q14C88;P51825	.;.;AFF1_HUMAN	S	544;196;537;175	ENSP00000378578:P544S;ENSP00000305689:P537S;ENSP00000440843:P175S	ENSP00000305689:P537S	P	+	1	0	AFF1	88254639	0.000000	0.05858	0.111000	0.21465	0.054000	0.15201	0.417000	0.21214	0.160000	0.19432	0.561000	0.74099	CCC	AFF1	-	pfam_TF_AF4/FMR2	ENSG00000172493		0.592	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AFF1	HGNC	protein_coding	OTTHUMT00000253053.3	-	0.00	15	0	C	NM_005935		88035615	+1	tier1	-	no_errors	ENST00000395146	ensembl	human	known	74_37	missense	38.89	11	7	SNP	0.099	T
AGAP11	119385	genome.wustl.edu	37	10	88760457	88760457	+	RNA	DEL	T	T	-			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr10:88760457delT	ENST00000444431.1	+	0	1587				RP11-96C23.14_ENST00000444180.3_RNA|RP11-96C23.5_ENST00000433214.2_RNA			Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase activating protein 11						regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)										CTGTGCATCGTTTTTTTTTTG	0.368																																																	0																																												0					10q23.2	2013-01-11			ENSG00000151303	ENSG00000151303		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	29421	protein-coding gene	gene with protein product						11853319	Standard	NM_133447		Approved	KIAA1975	uc001kee.2	Q8TF27	OTTHUMG00000018667		10.37:g.88760457delT			B9EIP7|D3DWE4	RNA	DEL	-	NULL	ENST00000444431.1	37	NULL		10																																																																																			AGAP11	-	-	ENSG00000151303		0.368	AGAP11-001	KNOWN	basic|readthrough_transcript	processed_transcript	AGAP11	HGNC	processed_transcript	OTTHUMT00000049193.1		0.00	27	0	T	NM_133447		88760457	+1	tier1		no_errors	ENST00000444431	ensembl	human	known	74_37	rna	16.67	20	4	DEL	0.003	-
ALDH3A2	224	genome.wustl.edu	37	17	19568349	19568349	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr17:19568349T>A	ENST00000176643.6	+	8	1642	c.1196T>A	c.(1195-1197)tTt>tAt	p.F399Y	ALDH3A2_ENST00000395575.2_Missense_Mutation_p.F399Y|ALDH3A2_ENST00000579855.1_Missense_Mutation_p.F399Y|ALDH3A2_ENST00000339618.4_Missense_Mutation_p.F399Y|SNORA31_ENST00000516540.1_RNA|ALDH3A2_ENST00000581518.1_Missense_Mutation_p.F399Y|ALDH3A2_ENST00000571163.1_Missense_Mutation_p.F72Y			P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3 family, member A2	399					cellular aldehyde metabolic process (GO:0006081)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|oxidation-reduction process (GO:0055114)|peripheral nervous system development (GO:0007422)|phytol metabolic process (GO:0033306)|sesquiterpenoid metabolic process (GO:0006714)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|peroxisome (GO:0005777)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|long-chain-alcohol oxidase activity (GO:0046577)|long-chain-aldehyde dehydrogenase activity (GO:0050061)|medium-chain-aldehyde dehydrogenase activity (GO:0052814)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(2)|prostate(1)	13	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)					TCTTTCCCATTTGGAGGAGTG	0.458																																																	0													183.0	130.0	148.0					17																	19568349		2203	4300	6503	SO:0001583	missense	0			L47162	CCDS11210.1, CCDS32589.1	17p11.2	2010-05-07			ENSG00000072210	ENSG00000072210	1.2.1.3	"""Aldehyde dehydrogenases"""	403	protein-coding gene	gene with protein product	"""fatty aldehyde dehydrogenase"""	609523		SLS, ALDH10		7894487	Standard	NM_000382		Approved	FALDH	uc002gwa.1	P51648	OTTHUMG00000059471	ENST00000176643.6:c.1196T>A	17.37:g.19568349T>A	ENSP00000176643:p.Phe399Tyr		Q6I9T3|Q93011|Q96J37	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH,pirsf_Aldehyde_DH_NAD(P)	p.F399Y	ENST00000176643.6	37	c.1196	CCDS11210.1	17	.	.	.	.	.	.	.	.	.	.	T	25.3	4.624888	0.87560	.	.	ENSG00000072210	ENST00000176643;ENST00000395575;ENST00000339618	D;D;D	0.83335	-1.71;-1.71;-1.71	5.41	5.41	0.78517	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	D	0.91968	0.7456	M	0.93062	3.375	0.80722	D	1	P;D	0.58970	0.947;0.984	P;P	0.60541	0.876;0.803	D	0.93606	0.6934	10	0.66056	D	0.02	-23.1629	14.2813	0.66213	0.0:0.0:0.0:1.0	.	399;399	P51648;P51648-2	AL3A2_HUMAN;.	Y	399	ENSP00000176643:F399Y;ENSP00000378942:F399Y;ENSP00000345774:F399Y	ENSP00000176643:F399Y	F	+	2	0	ALDH3A2	19508941	1.000000	0.71417	0.992000	0.48379	0.843000	0.47879	7.683000	0.84093	2.055000	0.61198	0.533000	0.62120	TTT	ALDH3A2	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,pirsf_Aldehyde_DH_NAD(P)	ENSG00000072210		0.458	ALDH3A2-001	KNOWN	basic|CCDS	protein_coding	ALDH3A2	HGNC	protein_coding	OTTHUMT00000132268.1	-	0.00	58	0	T			19568349	+1	tier1	-	no_errors	ENST00000339618	ensembl	human	known	74_37	missense	10.99	81	10	SNP	1.000	A
ANGPT4	51378	genome.wustl.edu	37	20	865893	865893	+	Silent	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr20:865893C>T	ENST00000381922.3	-	4	765	c.663G>A	c.(661-663)gcG>gcA	p.A221A	ANGPT4_ENST00000546022.1_Silent_p.A221A	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	221					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						TCAGCAGCTTCGCCTTCTTGC	0.682																																					Pancreas(181;481 2077 3259 31286 49856)												0													22.0	18.0	19.0					20																	865893		2199	4294	6493	SO:0001819	synonymous_variant	0			AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.663G>A	20.37:g.865893C>T			B4E3J9|Q5TFF4|Q9H4Z4	Silent	SNP	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.A221	ENST00000381922.3	37	c.663	CCDS13009.1	20																																																																																			ANGPT4	-	NULL	ENSG00000101280		0.682	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPT4	HGNC	protein_coding	OTTHUMT00000077493.1	-	0.00	20	0	C	NM_015985		865893	-1	tier1	-	no_errors	ENST00000381922	ensembl	human	known	74_37	silent	20.00	24	6	SNP	0.770	T
ANKRD30B	374860	genome.wustl.edu	37	18	14808688	14808688	+	Intron	SNP	A	A	C			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr18:14808688A>C	ENST00000358984.4	+	25	2493				ANKRD30B_ENST00000579292.1_3'UTR	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B											breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						GTGGAAGGAAAGTTTCTCTTC	0.254																																																	0																																										SO:0001627	intron_variant	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.2313+110A>C	18.37:g.14808688A>C			B4DGP1|F8WAG3|Q4G175	RNA	SNP	-	NULL	ENST00000358984.4	37	NULL	CCDS54182.1	18	.	.	.	.	.	.	.	.	.	.	N	0.589	-0.833947	0.02713	.	.	ENSG00000180777	ENST00000320584;ENST00000277669	.	.	.	0.517	0.517	0.17025	.	.	.	.	.	T	0.40372	0.1114	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38650	-0.9651	4	0.66056	D	0.02	.	.	.	.	.	.	.	.	N	52;78	.	ENSP00000277669:K78N	K	+	3	2	ANKRD30B	14798688	0.044000	0.20184	0.005000	0.12908	0.044000	0.14063	0.628000	0.24522	0.463000	0.27118	0.128000	0.15822	AAA	ANKRD30B	-	-	ENSG00000180777		0.254	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	-	0.00	75	0	A	NM_001145029		14808688	+1	tier1	-	no_errors	ENST00000579292	ensembl	human	known	74_37	rna	14.67	64	11	SNP	0.006	C
ANKRD36	375248	genome.wustl.edu	37	2	97847489	97847489	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:97847489A>G	ENST00000461153.2	+	26	2040	c.1796A>G	c.(1795-1797)aAt>aGt	p.N599S	ANKRD36_ENST00000420699.2_Missense_Mutation_p.N599S			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	599										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						TCTGTTTCAAATATAGCCACA	0.323																																																	0																																										SO:0001583	missense	0			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.1796A>G	2.37:g.97847489A>G	ENSP00000419530:p.Asn599Ser		B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.N599S	ENST00000461153.2	37	c.1796	CCDS54379.1	2	.	.	.	.	.	.	.	.	.	.	.	4.737	0.137106	0.09032	.	.	ENSG00000135976	ENST00000461153;ENST00000420699	T;T	0.76448	-1.02;-1.02	1.25	-1.48	0.08745	.	.	.	.	.	T	0.79185	0.4403	L	0.42245	1.32	0.09310	N	1	B;D	0.67145	0.01;0.996	B;D	0.77557	0.004;0.99	T	0.66528	-0.5901	9	0.72032	D	0.01	.	4.2831	0.10841	0.4981:0.0:0.5019:0.0	.	599;66	A6QL64;Q5JPF3-3	AN36A_HUMAN;.	S	599	ENSP00000419530:N599S;ENSP00000391950:N599S	ENSP00000391950:N599S	N	+	2	0	ANKRD36	97211216	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.091000	0.15046	-0.467000	0.06932	0.155000	0.16302	AAT	ANKRD36	-	NULL	ENSG00000135976		0.323	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36	HGNC	protein_coding	OTTHUMT00000339154.5	-	0.00	93	0	A			97847489	+1	tier1	-	no_errors	ENST00000420699	ensembl	human	known	74_37	missense	10.49	128	15	SNP	0.000	G
ANP32B	10541	genome.wustl.edu	37	9	100745866	100745866	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr9:100745866A>G	ENST00000339399.4	+	1	224	c.29A>G	c.(28-30)gAg>gGg	p.E10G	RP11-535C21.3_ENST00000411981.1_RNA	NM_006401.2	NP_006392.1	Q92688	AN32B_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member B	10					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|inner ear development (GO:0048839)|negative regulation of cell differentiation (GO:0045596)|nucleosome assembly (GO:0006334)|palate development (GO:0060021)|positive regulation of protein export from nucleus (GO:0046827)|vasculature development (GO:0001944)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	histone binding (GO:0042393)|RNA polymerase binding (GO:0070063)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|pancreas(1)	6		Acute lymphoblastic leukemia(62;0.0559)				ATCCACCTGGAGCTGAGGAAC	0.652																																																	0													35.0	37.0	36.0					9																	100745866		2196	4289	6485	SO:0001583	missense	0			Y07969	CCDS6732.1	9q22.32	2010-06-17			ENSG00000136938	ENSG00000136938		"""ANP32 acidic nuclear phosphoproteins"""	16677	protein-coding gene	gene with protein product	"""acidic protein rich in leucines"""					9285060, 9473664	Standard	NM_006401		Approved	SSP29, PHAPI2, APRIL	uc004aya.3	Q92688	OTTHUMG00000020338	ENST00000339399.4:c.29A>G	9.37:g.100745866A>G	ENSP00000345848:p.Glu10Gly		B2R9C7|O00655|P78458|P78459	Missense_Mutation	SNP	smart_U2A'_phosphoprotein32A_C	p.E10G	ENST00000339399.4	37	c.29	CCDS6732.1	9	.	.	.	.	.	.	.	.	.	.	A	13.59	2.283521	0.40394	.	.	ENSG00000136938	ENST00000339399	T	0.00473	7.18	3.57	3.57	0.40892	.	0.218845	0.39475	U	0.001350	T	0.00875	0.0029	M	0.93507	3.425	0.58432	D	0.999999	B	0.22480	0.07	B	0.27500	0.08	T	0.39941	-0.9589	10	0.87932	D	0	-7.2102	9.945	0.41602	1.0:0.0:0.0:0.0	.	10	Q92688	AN32B_HUMAN	G	10	ENSP00000345848:E10G	ENSP00000345848:E10G	E	+	2	0	ANP32B	99785687	1.000000	0.71417	1.000000	0.80357	0.382000	0.30200	4.305000	0.59110	1.402000	0.46780	0.260000	0.18958	GAG	ANP32B	-	NULL	ENSG00000136938		0.652	ANP32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANP32B	HGNC	protein_coding	OTTHUMT00000053346.4		0.00	43	0	A	NM_006401		100745866	+1			no_errors	ENST00000339399	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	G
ANP32BP1	646791	genome.wustl.edu	37	15	75614576	75614576	+	RNA	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr15:75614576C>T	ENST00000564205.1	-	0	458									acidic (leucine-rich) nuclear phosphoprotein 32 family, member B pseudogene 1																		TAAGTTTAGACGTGTGAGATT	0.378																																																	0																																												0					15q24.2	2014-02-12			ENSG00000259790	ENSG00000259790			24267	pseudogene	pseudogene							Standard	NG_022900		Approved				OTTHUMG00000172674		15.37:g.75614576C>T				RNA	SNP	-	NULL	ENST00000564205.1	37	NULL		15																																																																																			ANP32BP1	-	-	ENSG00000259790		0.378	ANP32BP1-002	KNOWN	basic	processed_transcript	ANP32BP1	HGNC	pseudogene	OTTHUMT00000419801.1	-	0.00	56	0	C			75614576	-1	tier1	-	no_errors	ENST00000564205	ensembl	human	known	74_37	rna	21.43	88	24	SNP	1.000	T
ANP32BP1	646791	genome.wustl.edu	37	15	75614593	75614593	+	RNA	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr15:75614593C>T	ENST00000564205.1	-	0	441									acidic (leucine-rich) nuclear phosphoprotein 32 family, member B pseudogene 1																		GATTTGGAAGCTTTTCAGCTA	0.383																																																	0																																												0					15q24.2	2014-02-12			ENSG00000259790	ENSG00000259790			24267	pseudogene	pseudogene							Standard	NG_022900		Approved				OTTHUMG00000172674		15.37:g.75614593C>T				RNA	SNP	-	NULL	ENST00000564205.1	37	NULL		15																																																																																			ANP32BP1	-	-	ENSG00000259790		0.383	ANP32BP1-002	KNOWN	basic	processed_transcript	ANP32BP1	HGNC	pseudogene	OTTHUMT00000419801.1	-	0.00	60	0	C			75614593	-1	tier1	-	no_errors	ENST00000564205	ensembl	human	known	74_37	rna	20.80	99	26	SNP	1.000	T
ANP32BP1	646791	genome.wustl.edu	37	15	75614671	75614671	+	RNA	SNP	A	A	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr15:75614671A>G	ENST00000564205.1	-	0	363									acidic (leucine-rich) nuclear phosphoprotein 32 family, member B pseudogene 1																		GCAGCTTGGGAAGATTTGAAA	0.363																																																	0																																												0					15q24.2	2014-02-12			ENSG00000259790	ENSG00000259790			24267	pseudogene	pseudogene							Standard	NG_022900		Approved				OTTHUMG00000172674		15.37:g.75614671A>G				RNA	SNP	-	NULL	ENST00000564205.1	37	NULL		15																																																																																			ANP32BP1	-	-	ENSG00000259790		0.363	ANP32BP1-002	KNOWN	basic	processed_transcript	ANP32BP1	HGNC	pseudogene	OTTHUMT00000419801.1	-	0.00	45	0	A			75614671	-1	tier1	-	no_errors	ENST00000564205	ensembl	human	known	74_37	rna	18.94	107	25	SNP	0.964	G
ANP32BP1	646791	genome.wustl.edu	37	15	75614710	75614710	+	RNA	SNP	A	A	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr15:75614710A>G	ENST00000564205.1	-	0	324									acidic (leucine-rich) nuclear phosphoprotein 32 family, member B pseudogene 1																		TTATTAAACTAAGGAACTCTA	0.388																																																	0																																												0					15q24.2	2014-02-12			ENSG00000259790	ENSG00000259790			24267	pseudogene	pseudogene							Standard	NG_022900		Approved				OTTHUMG00000172674		15.37:g.75614710A>G				RNA	SNP	-	NULL	ENST00000564205.1	37	NULL		15																																																																																			ANP32BP1	-	-	ENSG00000259790		0.388	ANP32BP1-002	KNOWN	basic	processed_transcript	ANP32BP1	HGNC	pseudogene	OTTHUMT00000419801.1	-	0.00	50	0	A			75614710	-1	tier1	-	no_errors	ENST00000564205	ensembl	human	known	74_37	rna	14.41	101	17	SNP	0.996	G
ATP11C	286410	genome.wustl.edu	37	X	138856967	138856967	+	Silent	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chrX:138856967G>A	ENST00000327569.3	-	19	2205	c.2107C>T	c.(2107-2109)Cta>Tta	p.L703L	ATP11C_ENST00000460773.1_5'UTR|ATP11C_ENST00000370557.1_Silent_p.L700L|ATP11C_ENST00000359686.2_Silent_p.L703L|ATP11C_ENST00000361648.2_Silent_p.L703L|ATP11C_ENST00000370543.1_Silent_p.L703L	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	703					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					TTTGTGGTTAGTTCTAAGAGC	0.423																																																	0													177.0	153.0	161.0					X																	138856967		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.2107C>T	X.37:g.138856967G>A			Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.L703	ENST00000327569.3	37	c.2107	CCDS14668.1	X																																																																																			ATP11C	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000101974		0.423	ATP11C-008	KNOWN	basic|CCDS	protein_coding	ATP11C	HGNC	protein_coding	OTTHUMT00000354945.1	-	0.00	49	0	G	NM_173694		138856967	-1	tier1	-	no_errors	ENST00000327569	ensembl	human	known	74_37	silent	33.33	30	15	SNP	1.000	A
ATP8A1	10396	genome.wustl.edu	37	4	42445670	42445670	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr4:42445670C>T	ENST00000381668.5	-	33	3266	c.3035G>A	c.(3034-3036)tGg>tAg	p.W1012*	ATP8A1_ENST00000264449.10_Nonsense_Mutation_p.W997*|AC084010.1_ENST00000582816.1_RNA	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	1012					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	GATGCTCCCCCATATCGCTAT	0.458																																																	0													109.0	96.0	101.0					4																	42445670		2203	4300	6503	SO:0001587	stop_gained	0			AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.3035G>A	4.37:g.42445670C>T	ENSP00000371084:p.Trp1012*		Q32M35|Q32M36|Q4W5J7|Q4W5P2	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.W1012*	ENST00000381668.5	37	c.3035	CCDS3466.1	4	.	.	.	.	.	.	.	.	.	.	C	44	10.829543	0.99474	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	.	.	.	5.51	5.51	0.81932	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.4234	0.94730	0.0:1.0:0.0:0.0	.	.	.	.	X	1012;997	.	ENSP00000264449:W997X	W	-	2	0	ATP8A1	42140427	1.000000	0.71417	0.997000	0.53966	0.941000	0.58515	7.396000	0.79891	2.602000	0.87976	0.655000	0.94253	TGG	ATP8A1	-	tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000124406		0.458	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP8A1	HGNC	protein_coding	OTTHUMT00000216861.2	-	0.00	36	0	C	NM_006095		42445670	-1	tier1	-	no_errors	ENST00000381668	ensembl	human	known	74_37	nonsense	18.18	45	10	SNP	1.000	T
BBS1	582	genome.wustl.edu	37	11	66283014	66283014	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr11:66283014C>T	ENST00000318312.7	+	5	487	c.436C>T	c.(436-438)Cga>Tga	p.R146*	BBS1_ENST00000537537.1_Intron|BBS1_ENST00000455748.2_Intron|BBS1_ENST00000393994.2_Nonsense_Mutation_p.R146*|CTD-3074O7.11_ENST00000419755.3_Nonsense_Mutation_p.R183*|BBS1_ENST00000529766.1_3'UTR	NM_024649.4	NP_078925.3	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1	146					cilium assembly (GO:0042384)|Golgi to plasma membrane protein transport (GO:0043001)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	patched binding (GO:0005113)|RNA polymerase II repressing transcription factor binding (GO:0001103)|smoothened binding (GO:0005119)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	28						GTCACAGGACCGAATCGACCC	0.572									Bardet-Biedl syndrome																												GBM(152;173 2612 9770 10137)												0			GRCh37	CM031131	BBS1	M							109.0	97.0	101.0					11																	66283014		2200	4295	6495	SO:0001587	stop_gained	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF503941	CCDS8142.1	11q13	2013-01-08			ENSG00000174483	ENSG00000174483			966	protein-coding gene	gene with protein product		209901				9039982, 12567324	Standard	NM_024649		Approved	FLJ23590	uc001oij.1	Q8NFJ9	OTTHUMG00000167110	ENST00000318312.7:c.436C>T	11.37:g.66283014C>T	ENSP00000317469:p.Arg146*		Q32MM9|Q32MN0|Q96SN4	Nonsense_Mutation	SNP	superfamily_Quinonprotein_ADH-like_supfam	p.R183*	ENST00000318312.7	37	c.547	CCDS8142.1	11	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350818	0.41599	.	.	ENSG00000256349;ENSG00000174483;ENSG00000174483;ENSG00000174483;ENSG00000174483	ENST00000419755;ENST00000318312;ENST00000525809;ENST00000393994;ENST00000524705	.	.	.	5.25	4.34	0.51931	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	6.8756	0.24145	0.173:0.7378:0.0:0.0892	.	.	.	.	X	183;146;55;146;53	.	ENSP00000317469:R146X	R	+	1	2	BBS1;CTD-3074O7.11	66039590	1.000000	0.71417	0.790000	0.31976	0.012000	0.07955	3.771000	0.55318	1.220000	0.43490	-0.259000	0.10710	CGA	CTD-3074O7.11	-	NULL	ENSG00000256349		0.572	BBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS1	Clone_based_vega_gene	protein_coding	OTTHUMT00000393235.2	-	0.00	16	0	C			66283014	+1	tier1	-	no_errors	ENST00000419755	ensembl	human	known	74_37	nonsense	19.51	33	8	SNP	0.993	T
BBS4	585	genome.wustl.edu	37	15	72978628	72978628	+	Intron	SNP	A	A	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr15:72978628A>T	ENST00000268057.4	+	1	65				HIGD2B_ENST00000311755.3_5'Flank|BBS4_ENST00000395205.2_5'Flank|BBS4_ENST00000542334.1_Intron|BBS4_ENST00000539603.1_Intron	NM_033028.4	NP_149017.2	Q96RK4	BBS4_HUMAN	Bardet-Biedl syndrome 4						adult behavior (GO:0030534)|brain morphogenesis (GO:0048854)|centrosome organization (GO:0051297)|cerebral cortex development (GO:0021987)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|dendrite development (GO:0016358)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|maintenance of protein location in nucleus (GO:0051457)|melanosome transport (GO:0032402)|metabolic process (GO:0008152)|microtubule anchoring at centrosome (GO:0034454)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of systemic arterial blood pressure (GO:0003085)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of cilium assembly (GO:0045724)|positive regulation of multicellular organism growth (GO:0040018)|protein localization to centrosome (GO:0071539)|protein localization to organelle (GO:0033365)|protein transport (GO:0015031)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of cytokinesis (GO:0032465)|regulation of lipid metabolic process (GO:0019216)|retina homeostasis (GO:0001895)|retinal rod cell development (GO:0046548)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)|spermatid development (GO:0007286)|striatum development (GO:0021756)|visual perception (GO:0007601)	BBSome (GO:0034464)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary membrane (GO:0060170)|cilium (GO:0005929)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|pericentriolar material (GO:0000242)	alpha-tubulin binding (GO:0043014)|beta-tubulin binding (GO:0048487)|dynactin binding (GO:0034452)|microtubule motor activity (GO:0003777)|RNA polymerase II repressing transcription factor binding (GO:0001103)			autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(1)	19						GCCCGGCCGCAGGGCAAGGCA	0.672									Bardet-Biedl syndrome																																								0													16.0	18.0	17.0					15																	72978628		2179	4257	6436	SO:0001627	intron_variant	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF090947	CCDS10246.1, CCDS58377.1	15q22.3-q23	2013-01-10			ENSG00000140463	ENSG00000140463		"""Tetratricopeptide (TTC) repeat domain containing"""	969	protein-coding gene	gene with protein product		600374				7711739, 11381270	Standard	NM_033028		Approved		uc002avb.3	Q96RK4	OTTHUMG00000133510	ENST00000268057.4:c.24+36A>T	15.37:g.72978628A>T			B4E178|Q53DZ5|Q8NHU9|Q96H45	Silent	SNP	NULL	p.A20	ENST00000268057.4	37	c.60	CCDS10246.1	15																																																																																			BBS4	-	NULL	ENSG00000140463		0.672	BBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS4	HGNC	protein_coding	OTTHUMT00000257473.2	-	0.00	80	0	A	NM_033028		72978628	+1	tier1	-	no_errors	ENST00000562084	ensembl	human	known	74_37	silent	16.24	98	19	SNP	0.000	T
BEND7	222389	genome.wustl.edu	37	10	13542011	13542011	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr10:13542011C>T	ENST00000396900.2	-	3	214	c.215G>A	c.(214-216)cGg>cAg	p.R72Q	BEND7_ENST00000378605.3_Missense_Mutation_p.R20Q|BEND7_ENST00000341083.3_Missense_Mutation_p.R20Q|BEND7_ENST00000396898.2_Missense_Mutation_p.R72Q			Q8N7W2	BEND7_HUMAN	BEN domain containing 7	72						extracellular vesicular exosome (GO:0070062)				breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|stomach(1)	17						CTGATAGATCCGCCCAGTGCT	0.473																																																	0													145.0	146.0	146.0					10																	13542011		2203	4300	6503	SO:0001583	missense	0			BC031618	CCDS7099.1, CCDS41490.1	10p14	2012-11-22	2008-10-03	2008-10-03	ENSG00000165626	ENSG00000165626		"""BEN domain containing"""	23514	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 30"""	C10orf30			Standard	NM_152751		Approved	FLJ40283	uc001imm.2	Q8N7W2	OTTHUMG00000017699	ENST00000396900.2:c.215G>A	10.37:g.13542011C>T	ENSP00000380108:p.Arg72Gln		Q5SYY7|Q5SYY8|Q5SYY9|Q8N5T7	Missense_Mutation	SNP	pfam_BEN_domain	p.R72Q	ENST00000396900.2	37	c.215		10	.	.	.	.	.	.	.	.	.	.	C	28.6	4.932553	0.92458	.	.	ENSG00000165626	ENST00000396900;ENST00000341083;ENST00000396898;ENST00000378605	T;T;T;T	0.58210	0.35;0.36;0.41;0.42	5.63	5.63	0.86233	.	0.041576	0.85682	D	0.000000	T	0.71962	0.3402	M	0.61703	1.905	0.48830	D	0.999719	D;D	0.76494	0.999;0.999	D;D	0.77557	0.978;0.99	T	0.73084	-0.4094	10	0.72032	D	0.01	-16.6215	19.7509	0.96268	0.0:1.0:0.0:0.0	.	72;20	E5RFC0;Q8N7W2-3	.;.	Q	72;20;72;20	ENSP00000380108:R72Q;ENSP00000345773:R20Q;ENSP00000380107:R72Q;ENSP00000367868:R20Q	ENSP00000345773:R20Q	R	-	2	0	BEND7	13582017	1.000000	0.71417	0.988000	0.46212	0.614000	0.37383	7.140000	0.77322	2.693000	0.91896	0.650000	0.86243	CGG	BEND7	-	NULL	ENSG00000165626		0.473	BEND7-202	KNOWN	basic	protein_coding	BEND7	HGNC	protein_coding		-	0.00	47	0	C	NM_152751		13542011	-1	tier1	-	no_errors	ENST00000396900	ensembl	human	known	74_37	missense	14.89	80	14	SNP	1.000	T
BRD4	23476	genome.wustl.edu	37	19	15350513	15350513	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:15350513delG	ENST00000263377.2	-	16	3623	c.3402delC	c.(3400-3402)cccfs	p.P1134fs		NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	1134	C-terminal (CTD) region.				cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			CCGGGTGCTTGGGGGGCTCCG	0.701			T	C15orf55	lethal midline carcinoma of young people																																			Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	0													19.0	26.0	23.0					19																	15350513		2148	4230	6378	SO:0001589	frameshift_variant	0			Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.3402delC	19.37:g.15350513delG	ENSP00000263377:p.Pro1134fs		O60433|Q4G0X8|Q86YS8|Q96PD3	Frame_Shift_Del	DEL	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.K1135fs	ENST00000263377.2	37	c.3402	CCDS12328.1	19																																																																																			BRD4	-	NULL	ENSG00000141867		0.701	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	BRD4	HGNC	protein_coding	OTTHUMT00000465800.3		0.00	31	0	G	NM_058243		15350513	-1	tier1		no_errors	ENST00000263377	ensembl	human	known	74_37	frame_shift_del	6.45	29	2	DEL	0.995	-
BRINP3	339479	genome.wustl.edu	37	1	190423854	190423854	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:190423854C>T	ENST00000367462.3	-	2	398	c.167G>A	c.(166-168)cGc>cAc	p.R56H	BRINP3_ENST00000534846.1_Missense_Mutation_p.A18T	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	56					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											TTCCTGTGAGCGATGGAAGGG	0.478																																																	0													88.0	86.0	87.0					1																	190423854		2203	4300	6503	SO:0001583	missense	0			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.167G>A	1.37:g.190423854C>T	ENSP00000356432:p.Arg56His		B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.R56H	ENST00000367462.3	37	c.167	CCDS1373.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.33|15.33	2.801559|2.801559	0.50315|0.50315	.|.	.|.	ENSG00000162670|ENSG00000162670	ENST00000534846|ENST00000367462;ENST00000445957	T|D;T	0.17528|0.84730	2.27|-1.89;0.73	5.42|5.42	4.51|4.51	0.55191|0.55191	.|Membrane attack complex component/perforin (MACPF) domain (1);	.|0.060658	.|0.64402	.|D	.|0.000002	T|T	0.68458|0.68458	0.3003|0.3003	N|N	0.12471|0.12471	0.22|0.22	0.21473|0.21473	N|N	0.999675|0.999675	B|B	0.06786|0.06786	0.001|0.001	B|B	0.04013|0.04013	0.001|0.001	T|T	0.51647|0.51647	-0.8679|-0.8679	9|10	0.52906|0.13470	T|T	0.07|0.59	.|.	8.3132|8.3132	0.32084|0.32084	0.0:0.8231:0.0:0.1769|0.0:0.8231:0.0:0.1769	.|.	18|56	B7Z260|Q76B58	.|FAM5C_HUMAN	T|H	18|56	ENSP00000438022:A18T|ENSP00000356432:R56H;ENSP00000393441:R56H	ENSP00000438022:A18T|ENSP00000356432:R56H	A|R	-|-	1|2	0|0	FAM5C|FAM5C	188690477|188690477	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.969000|0.969000	0.65631|0.65631	3.050000|3.050000	0.49877|0.49877	1.295000|1.295000	0.44724|0.44724	-0.136000|-0.136000	0.14681|0.14681	GCT|CGC	BRINP3	-	pfam_MACPF	ENSG00000162670		0.478	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP3	HGNC	protein_coding	OTTHUMT00000086278.1		0.00	24	0	C	NM_199051		190423854	-1			no_errors	ENST00000367462	ensembl	human	known	74_37	missense	7.50	37	3	SNP	1.000	T
BTBD18	643376	genome.wustl.edu	37	11	57511628	57511628	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr11:57511628G>T	ENST00000436147.3	-	2	2304	c.2117C>A	c.(2116-2118)aCa>aAa	p.T706K	TMX2-CTNND1_ENST00000528395.1_Intron|BTBD18_ENST00000422652.1_Missense_Mutation_p.T706K|RP11-691N7.6_ENST00000531074.1_Intron			B2RXH4	BTBDI_HUMAN	BTB (POZ) domain containing 18	706										endometrium(3)|kidney(1)	4						ATCTACCTCTGTTTCTGACTC	0.537																																																	0													65.0	58.0	61.0					11																	57511628		692	1591	2283	SO:0001583	missense	0				CCDS44603.1	11q12.1	2013-01-08			ENSG00000233436	ENSG00000233436		"""BTB/POZ domain containing"""	37214	protein-coding gene	gene with protein product							Standard	NM_001145101		Approved		uc010rjy.2	B2RXH4	OTTHUMG00000167203	ENST00000436147.3:c.2117C>A	11.37:g.57511628G>T	ENSP00000397020:p.Thr706Lys			Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.T706K	ENST00000436147.3	37	c.2117	CCDS44603.1	11	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935048	0.73442	.	.	ENSG00000233436	ENST00000422652;ENST00000436147	D;D	0.84442	-1.85;-1.85	5.63	5.63	0.86233	.	.	.	.	.	D	0.88314	0.6403	L	0.27053	0.805	0.30987	N	0.721796	D	0.89917	1.0	D	0.83275	0.996	D	0.86957	0.2089	9	0.87932	D	0	.	16.9612	0.86273	0.0:0.0:1.0:0.0	.	706	B2RXH4	BTBDI_HUMAN	K	706	ENSP00000394472:T706K;ENSP00000397020:T706K	ENSP00000394472:T706K	T	-	2	0	BTBD18	57268204	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.977000	0.56874	2.815000	0.96918	0.561000	0.74099	ACA	BTBD18	-	NULL	ENSG00000233436		0.537	BTBD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD18	HGNC	protein_coding	OTTHUMT00000393718.2	-	0.00	39	0	G	NM_001145101		57511628	-1	tier1	-	no_errors	ENST00000422652	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
CFAP54	144535	genome.wustl.edu	37	12	97038038	97038038	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr12:97038038A>G	ENST00000524981.4	+	33	4422	c.4399A>G	c.(4399-4401)Aga>Gga	p.R1467G				Q96N23	CL055_HUMAN		0																	TTATGTTAAAAGAAAGAGGTT	0.408																																																	0																																										SO:0001583	missense	0																														ENST00000524981.4:c.4399A>G	12.37:g.97038038A>G	ENSP00000431759:p.Arg1467Gly			Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.R1467G	ENST00000524981.4	37	c.4399		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.282|8.282	0.815754|0.815754	0.16607|0.16607	.|.	.|.	ENSG00000188596|ENSG00000188596	ENST00000550977|ENST00000524981	.|.	.|.	.|.	5.68|5.68	4.52|4.52	0.55395|0.55395	.|.	.|.	.|.	.|.	.|.	T|T	0.47340|0.47340	0.1440|0.1440	L|L	0.38175|0.38175	1.15|1.15	0.18873|0.18873	N|N	0.999988|0.999988	.|D	.|0.63046	.|0.992	.|P	.|0.57101	.|0.813	T|T	0.31752|0.31752	-0.9932|-0.9932	5|8	.|0.56958	.|D	.|0.05	.|.	10.3529|10.3529	0.43948|0.43948	0.6855:0.3145:0.0:0.0|0.6855:0.3145:0.0:0.0	.|.	.|1467	.|E9PJL5	.|.	R|G	213|1467	.|.	.|ENSP00000431759:R1467G	K|R	+|+	2|1	0|2	C12orf63|C12orf63	95562169|95562169	1.000000|1.000000	0.71417|0.71417	0.081000|0.081000	0.20488|0.20488	0.004000|0.004000	0.04260|0.04260	2.408000|2.408000	0.44574|0.44574	0.947000|0.947000	0.37659|0.37659	0.533000|0.533000	0.62120|0.62120	AAG|AGA	C12orf55	-	NULL	ENSG00000188596		0.408	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	-	0.00	32	0	A			97038038	+1	tier1	-	no_errors	ENST00000524981	ensembl	human	putative	74_37	missense	18.75	39	9	SNP	0.194	G
C16orf74	404550	genome.wustl.edu	37	16	85743840	85743840	+	Silent	SNP	G	G	A	rs374494410		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr16:85743840G>A	ENST00000284245.4	-	3	285	c.102C>T	c.(100-102)gaC>gaT	p.D34D	C16orf74_ENST00000602766.1_De_novo_Start_OutOfFrame|C16orf74_ENST00000602583.1_Silent_p.D22D|C16orf74_ENST00000602675.1_De_novo_Start_OutOfFrame|C16orf74_ENST00000602758.1_Intron|C16orf74_ENST00000602719.1_Silent_p.D34D|C16orf74_ENST00000602914.1_Intron	NM_206967.2	NP_996850.1	Q96GX8	CP074_HUMAN	chromosome 16 open reading frame 74	34																	TGTCGGGCACGTCCAGGTGCT	0.657													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15264	0.0		0.0	False		,,,				2504	0.0																0								G		4,4284		0,4,2140	17.0	22.0	20.0		102	0.4	0.9	16	dbSNP_134	20	0,8498		0,0,4249	no	coding-synonymous	C16orf74	NM_206967.2		0,4,6389	AA,AG,GG		0.0,0.0933,0.0313		34/77	85743840	4,12782	2144	4249	6393	SO:0001819	synonymous_variant	0			BC009078	CCDS45540.1	16q24.1	2014-05-28			ENSG00000154102	ENSG00000154102			23362	protein-coding gene	gene with protein product							Standard	NM_206967		Approved	MGC17624	uc002fjc.4	Q96GX8	OTTHUMG00000183875	ENST00000284245.4:c.102C>T	16.37:g.85743840G>A				Silent	SNP	NULL	p.D34	ENST00000284245.4	37	c.102	CCDS45540.1	16																																																																																			C16orf74	-	NULL	ENSG00000154102		0.657	C16orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf74	HGNC	protein_coding	OTTHUMT00000467253.1	-	0.00	21	0	G	NM_206967		85743840	-1	tier1	-	no_errors	ENST00000284245	ensembl	human	known	74_37	silent	30.77	18	8	SNP	0.976	A
C1orf140	400804	genome.wustl.edu	37	1	221507307	221507307	+	lincRNA	SNP	G	G	A	rs573793344		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:221507307G>A	ENST00000439004.1	-	0	454					NR_024236.1																						CTGATCTTGCGTGTGGAGGAT	0.453													G|||	1	0.000199681	0.0	0.0	5008	,	,		20938	0.0		0.0	False		,,,				2504	0.001																0													147.0	121.0	129.0					1																	221507307		692	1591	2283			0																															1.37:g.221507307G>A				RNA	SNP	-	NULL	ENST00000439004.1	37	NULL		1																																																																																			RP11-421L10.1	-	-	ENSG00000234754		0.453	RP11-421L10.1-001	KNOWN	basic	lincRNA	C1orf140	Clone_based_vega_gene	lincRNA	OTTHUMT00000091116.2	-	0.00	65	0	G			221507307	-1	tier1	-	no_errors	ENST00000434398	ensembl	human	known	74_37	rna	28.12	69	27	SNP	0.000	A
CACNA1B	774	genome.wustl.edu	37	9	141000233	141000233	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr9:141000233C>T	ENST00000371372.1	+	39	5547	c.5402C>T	c.(5401-5403)aCg>aTg	p.T1801M	CACNA1B_ENST00000371355.4_Missense_Mutation_p.T1802M|CACNA1B_ENST00000371365.2_3'UTR|CACNA1B_ENST00000371363.1_Missense_Mutation_p.T1799M|CACNA1B_ENST00000277551.2_Missense_Mutation_p.T1801M|CACNA1B_ENST00000277549.5_Missense_Mutation_p.T995M|CACNA1B_ENST00000371357.1_Missense_Mutation_p.T1800M	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1801					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CTCATCCGGACGGCACTGGAG	0.637																																																	0													31.0	32.0	32.0					9																	141000233		2123	4212	6335	SO:0001583	missense	0			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.5402C>T	9.37:g.141000233C>T	ENSP00000360423:p.Thr1801Met		B1AQK5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.T1802M	ENST00000371372.1	37	c.5405	CCDS59522.1	9	.	.	.	.	.	.	.	.	.	.	C	33	5.248880	0.95305	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	T;T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.32;-0.32	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.81880	0.4916	M	0.92268	3.29	0.80722	D	1	D;D;D	0.61697	0.99;0.99;0.99	P;P;P	0.51701	0.677;0.677;0.677	D	0.87587	0.2488	10	0.87932	D	0	.	18.3018	0.90165	0.0:1.0:0.0:0.0	.	1801;1800;1799	Q00975;B1AQK7;B1AQK6	CAC1B_HUMAN;.;.	M	1801;1801;995;1799;1800;1802	ENSP00000360423:T1801M;ENSP00000277551:T1801M;ENSP00000277549:T995M;ENSP00000360414:T1799M;ENSP00000360408:T1800M;ENSP00000360406:T1802M	ENSP00000277549:T995M	T	+	2	0	CACNA1B	140120054	1.000000	0.71417	0.934000	0.37439	0.961000	0.63080	7.609000	0.82925	2.317000	0.78254	0.561000	0.74099	ACG	CACNA1B	-	NULL	ENSG00000148408		0.637	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	HGNC	protein_coding	OTTHUMT00000055380.1	-	0.00	30	0	C	NM_000718		141000233	+1	tier1	-	no_errors	ENST00000371355	ensembl	human	known	74_37	missense	16.36	46	9	SNP	1.000	T
CACNA1S	779	genome.wustl.edu	37	1	201021764	201021764	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:201021764T>C	ENST00000362061.3	-	32	4100	c.3874A>G	c.(3874-3876)Atc>Gtc	p.I1292V	CACNA1S_ENST00000367338.3_Missense_Mutation_p.I1273V	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1292					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACCAAGGCGATCTTCCCAAAC	0.557																																																	0													229.0	195.0	206.0					1																	201021764		2203	4300	6503	SO:0001583	missense	0			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.3874A>G	1.37:g.201021764T>C	ENSP00000355192:p.Ile1292Val		A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_VDCC_L_a1ssu	p.I1292V	ENST00000362061.3	37	c.3874	CCDS1407.1	1	.	.	.	.	.	.	.	.	.	.	.	14.39	2.521978	0.44866	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.98400	-4.91;-4.91	4.55	4.55	0.56014	Ion transport (1);	0.058274	0.64402	D	0.000002	D	0.95746	0.8616	N	0.20445	0.575	0.46222	D	0.998936	B	0.27286	0.174	B	0.38225	0.268	D	0.94013	0.7286	10	0.25751	T	0.34	.	14.2026	0.65714	0.0:0.0:0.0:1.0	.	1292	Q13698	CAC1S_HUMAN	V	1292;1273	ENSP00000355192:I1292V;ENSP00000356307:I1273V	ENSP00000355192:I1292V	I	-	1	0	CACNA1S	199288387	1.000000	0.71417	0.999000	0.59377	0.953000	0.61014	2.205000	0.42770	1.813000	0.52934	0.372000	0.22366	ATC	CACNA1S	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000081248		0.557	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	HGNC	protein_coding	OTTHUMT00000087049.1	-	0.00	47	0	T	NM_000069		201021764	-1	tier1	-	no_errors	ENST00000362061	ensembl	human	known	74_37	missense	8.00	69	6	SNP	1.000	C
CARTPT	9607	genome.wustl.edu	37	5	71015223	71015223	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr5:71015223C>T	ENST00000296777.4	+	1	234	c.103C>T	c.(103-105)Ccc>Tcc	p.P35S		NM_004291.3	NP_004282.1	Q16568	CART_HUMAN	CART prepropeptide	35					activation of MAPKK activity (GO:0000186)|adult feeding behavior (GO:0008343)|cell-cell signaling (GO:0007267)|cellular glucose homeostasis (GO:0001678)|cellular response to starvation (GO:0009267)|circadian regulation of gene expression (GO:0032922)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of appetite (GO:0032099)|negative regulation of bone resorption (GO:0045779)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of osteoclast differentiation (GO:0045671)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of epinephrine secretion (GO:0032812)|positive regulation of transmission of nerve impulse (GO:0051971)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|somatostatin secretion (GO:0070253)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)|secretory granule (GO:0030141)				large_intestine(1)|lung(2)|ovary(1)	4		Lung NSC(167;0.00153)|Ovarian(174;0.0175)|Prostate(74;0.11)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;8.4e-56)	Amphetamine(DB00182)	CGAGCTCCAGCCCCGAGCCCT	0.672																																																	0													70.0	68.0	69.0					5																	71015223		2203	4300	6503	SO:0001583	missense	0			U16826	CCDS4011.1	5q13.2	2008-02-05			ENSG00000164326	ENSG00000164326			24323	protein-coding gene	gene with protein product	"""cocaine and amphetamine regulated transcript"""	602606				9590691, 8647455	Standard	NM_004291		Approved	CART	uc003kbv.2	Q16568	OTTHUMG00000131261	ENST00000296777.4:c.103C>T	5.37:g.71015223C>T	ENSP00000296777:p.Pro35Ser		Q6FG92	Missense_Mutation	SNP	pfam_CART,superfamily_CART	p.P35S	ENST00000296777.4	37	c.103	CCDS4011.1	5	.	.	.	.	.	.	.	.	.	.	C	17.36	3.370198	0.61624	.	.	ENSG00000164326	ENST00000296777	T	0.54866	0.55	4.24	4.24	0.50183	.	0.284178	0.33610	N	0.004722	T	0.42765	0.1217	L	0.54323	1.7	0.38991	D	0.959154	B	0.34103	0.437	B	0.29077	0.098	T	0.40346	-0.9568	10	0.23302	T	0.38	.	10.8795	0.46929	0.1885:0.8115:0.0:0.0	.	35	Q16568	CART_HUMAN	S	35	ENSP00000296777:P35S	ENSP00000296777:P35S	P	+	1	0	CARTPT	71050979	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.870000	0.48451	2.198000	0.70561	0.561000	0.74099	CCC	CARTPT	-	pfam_CART	ENSG00000164326		0.672	CARTPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARTPT	HGNC	protein_coding	OTTHUMT00000254029.2	-	0.00	54	0	C	NM_004291		71015223	+1	tier1	-	no_errors	ENST00000296777	ensembl	human	known	74_37	missense	8.77	52	5	SNP	1.000	T
CBLN1	869	genome.wustl.edu	37	16	49315306	49315306	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr16:49315306T>G	ENST00000219197.6	-	1	436	c.71A>C	c.(70-72)gAg>gCg	p.E24A	CBLN1_ENST00000536749.1_Missense_Mutation_p.E24A	NM_004352.3	NP_004343.1	P23435	CBLN1_HUMAN	cerebellin 1 precursor	24					cerebellar granule cell differentiation (GO:0021707)|heterophilic cell-cell adhesion (GO:0007157)|nervous system development (GO:0007399)|positive regulation of synapse assembly (GO:0051965)|protein secretion (GO:0009306)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|extracellular region (GO:0005576)|postsynaptic membrane (GO:0045211)				breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(37;0.0766)|all_lung(18;0.24)				GGGCTCCGTCTCATTCTGCCC	0.741																																																	0													19.0	20.0	19.0					16																	49315306		2199	4296	6495	SO:0001583	missense	0			M58583	CCDS10736.1	16q12.1	2008-02-05			ENSG00000102924	ENSG00000102924			1543	protein-coding gene	gene with protein product		600432				7877445, 1704129	Standard	NM_004352		Approved		uc002efq.3	P23435	OTTHUMG00000133148	ENST00000219197.6:c.71A>C	16.37:g.49315306T>G	ENSP00000219197:p.Glu24Ala		B2RAN9|P02682|Q52M09	Missense_Mutation	SNP	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.E24A	ENST00000219197.6	37	c.71	CCDS10736.1	16	.	.	.	.	.	.	.	.	.	.	T	18.23	3.578669	0.65878	.	.	ENSG00000102924	ENST00000219197;ENST00000536749	D;D	0.82433	-1.61;-1.61	3.88	3.88	0.44766	.	0.056754	0.64402	D	0.000002	T	0.78291	0.4260	L	0.50333	1.59	0.58432	D	0.999999	B	0.33135	0.399	B	0.32677	0.15	T	0.79899	-0.1608	10	0.66056	D	0.02	-15.7532	12.5042	0.55972	0.0:0.0:0.0:1.0	.	24	P23435	CBLN1_HUMAN	A	24	ENSP00000219197:E24A;ENSP00000444651:E24A	ENSP00000219197:E24A	E	-	2	0	CBLN1	47872807	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.195000	0.77798	1.622000	0.50330	0.379000	0.24179	GAG	CBLN1	-	NULL	ENSG00000102924		0.741	CBLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLN1	HGNC	protein_coding	OTTHUMT00000256845.4		0.00	40	0	T	NM_004352		49315306	-1			no_errors	ENST00000219197	ensembl	human	known	74_37	missense	11.11	23	3	SNP	1.000	G
CCDC102B	79839	genome.wustl.edu	37	18	66564837	66564837	+	Intron	SNP	T	T	C			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr18:66564837T>C	ENST00000360242.5	+	6	1380				RP11-861L17.3_ENST00000584226.1_5'Flank|CCDC102B_ENST00000577772.1_3'UTR|CCDC102B_ENST00000584156.1_Intron|CCDC102B_ENST00000319445.6_Intron	NM_024781.2	NP_079057	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B											breast(2)|endometrium(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|stomach(1)	36		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				CGTTCATGCATCTGAAACAAA	0.358																																																	0																																										SO:0001627	intron_variant	0			AK027247	CCDS11996.2	18q22.1	2007-11-14	2006-04-10	2006-04-10	ENSG00000150636	ENSG00000150636			26295	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 14"", ""aminoacylase 1-like"""	C18orf14, ACY1L		14702039	Standard	NM_001093729		Approved	FLJ23594, HsT1731, AN	uc002lkk.2	Q68D86	OTTHUMG00000132808	ENST00000360242.5:c.1263+172T>C	18.37:g.66564837T>C			Q7Z467|Q8NDK7|Q9H5C1	RNA	SNP	-	NULL	ENST00000360242.5	37	NULL	CCDS11996.2	18																																																																																			CCDC102B	-	-	ENSG00000150636		0.358	CCDC102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC102B	HGNC	protein_coding	OTTHUMT00000256225.2	-	0.00	36	0	T	NM_024781		66564837	+1	tier1	-	no_errors	ENST00000577772	ensembl	human	known	74_37	rna	25.00	30	10	SNP	0.090	C
CCDC85A	114800	genome.wustl.edu	37	2	56420101	56420101	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:56420101C>T	ENST00000407595.2	+	2	1268	c.766C>T	c.(766-768)Ccc>Tcc	p.P256S	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	256	His-rich.									breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GAGCGCCAGCCCCGAGCATCC	0.657																																																	0													29.0	44.0	39.0					2																	56420101		2023	4200	6223	SO:0001583	missense	0			AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.766C>T	2.37:g.56420101C>T	ENSP00000384040:p.Pro256Ser			Missense_Mutation	SNP	pfam_DUF2216_coiled-coil	p.P256S	ENST00000407595.2	37	c.766	CCDS46290.1	2	.	.	.	.	.	.	.	.	.	.	C	22.0	4.224058	0.79576	.	.	ENSG00000055813	ENST00000407595	T	0.47869	0.83	5.08	5.08	0.68730	.	0.187892	0.48286	D	0.000192	T	0.57946	0.2088	L	0.57536	1.79	0.80722	D	1	D	0.58620	0.983	P	0.55508	0.777	T	0.52290	-0.8595	10	0.15499	T	0.54	-19.4016	18.4789	0.90804	0.0:1.0:0.0:0.0	.	256	Q96PX6	CC85A_HUMAN	S	256	ENSP00000384040:P256S	ENSP00000384040:P256S	P	+	1	0	CCDC85A	56273605	1.000000	0.71417	0.999000	0.59377	0.900000	0.52787	7.400000	0.79949	2.356000	0.79943	0.591000	0.81541	CCC	CCDC85A	-	NULL	ENSG00000055813		0.657	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC85A	HGNC	protein_coding	OTTHUMT00000324993.1	-	0.00	45	0	C			56420101	+1	tier1	-	no_errors	ENST00000407595	ensembl	human	known	74_37	missense	21.05	45	12	SNP	1.000	T
CDH5	1003	genome.wustl.edu	37	16	66426223	66426225	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	AGA	AGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr16:66426223_66426225delAGA	ENST00000341529.3	+	7	1302_1304	c.1154_1156delAGA	c.(1153-1158)cagaag>cag	p.K387del	CDH5_ENST00000563425.2_In_Frame_Del_p.K387del	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	387	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	AAGGAAAACCAGAAGAAGCCTCT	0.537																																																	0																																										SO:0001651	inframe_deletion	0			X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.1154_1156delAGA	16.37:g.66426226_66426228delAGA	ENSP00000344115:p.Lys387del		Q4VAI5|Q4VAI6	In_Frame_Del	DEL	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K387in_frame_del	ENST00000341529.3	37	c.1154_1156	CCDS10804.1	16																																																																																			CDH5	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000179776		0.537	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH5	HGNC	protein_coding	OTTHUMT00000268767.1		0.00	21	0	AGA	NM_001795		66426225	+1	tier1		no_errors	ENST00000341529	ensembl	human	known	74_37	in_frame_del	29.41	12	5	DEL	0.004:0.089:0.738	-
CDK11B	984	genome.wustl.edu	37	1	1575747	1575747	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:1575747C>G	ENST00000407249.3	-	12	1150	c.1151G>C	c.(1150-1152)gGa>gCa	p.G384A	CDK11B_ENST00000317673.7_Missense_Mutation_p.G382A|CDK11B_ENST00000341832.6_Missense_Mutation_p.G337A|CDK11B_ENST00000340677.5_Missense_Mutation_p.G371A			P21127	CD11B_HUMAN	cyclin-dependent kinase 11B	394	Glu-rich.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(3)|lung(4)|skin(1)|stomach(2)	12						CTGCGGCGTTCCCTCACCCAC	0.592																																																	0													40.0	42.0	42.0					1																	1575747		1927	4121	6048	SO:0001583	missense	0			AK000081	CCDS72682.1, CCDS72683.1, CCDS72684.1	1p36.33	2013-09-24	2009-12-16	2009-12-16	ENSG00000248333	ENSG00000248333		"""Cyclin-dependent kinases"""	1729	protein-coding gene	gene with protein product		176873	"""cell division cycle 2-like 1 (PITSLRE proteins)"""	CDC2L1		1774066, 14511641, 19884882	Standard	XM_006711061		Approved	CDK11-p110, CDK11-p58, CDK11-p46	uc001agv.1	P21127	OTTHUMG00000078638	ENST00000407249.3:c.1151G>C	1.37:g.1575747C>G	ENSP00000464036:p.Gly384Ala		O95265|Q12817|Q12818|Q12819|Q12820|Q12822|Q8N530|Q9NZS5|Q9UBJ0|Q9UBQ1|Q9UBR0|Q9UNY2|Q9UP57|Q9UP58|Q9UP59	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G384A	ENST00000407249.3	37	c.1151		1																																																																																			CDK11B	-	NULL	ENSG00000248333		0.592	CDK11B-204	KNOWN	basic|appris_candidate_longest	protein_coding	CDK11B	HGNC	protein_coding			0.00	88	0	C	NM_001787		1575747	-1			no_errors	ENST00000407249	ensembl	human	known	74_37	missense	9.57	85	9	SNP	1.000	G
CENPL	91687	genome.wustl.edu	37	1	173776414	173776414	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:173776414A>T	ENST00000345664.6	-	3	624	c.411T>A	c.(409-411)ttT>ttA	p.F137L	CENPL_ENST00000356198.2_Missense_Mutation_p.F137L|Y_RNA_ENST00000516548.1_RNA|CENPL_ENST00000367710.3_Missense_Mutation_p.F137L	NM_001171182.1	NP_001164653.1	Q8N0S6	CENPL_HUMAN	centromere protein L	137					mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(3)	11						CCTGGACAAGAAATGCTTCCG	0.348																																																	0													56.0	61.0	59.0					1																	173776414		2203	4300	6503	SO:0001583	missense	0			BC033154, BC019022, AK055606	CCDS30938.1, CCDS44277.1	1q25.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000120334	ENSG00000120334			17879	protein-coding gene	gene with protein product		611503	"""chromosome 1 open reading frame 155"""	C1orf155		16622420, 16622419	Standard	NM_033319		Approved	dJ383J4.3, FLJ31044	uc001gje.4	Q8N0S6	OTTHUMG00000034802	ENST00000345664.6:c.411T>A	1.37:g.173776414A>T	ENSP00000323543:p.Phe137Leu		Q5TEL5|Q96ND4	Missense_Mutation	SNP	NULL	p.F137L	ENST00000345664.6	37	c.411	CCDS30938.1	1	.	.	.	.	.	.	.	.	.	.	A	10.01	1.234414	0.22626	.	.	ENSG00000120334	ENST00000356198;ENST00000345664;ENST00000367710	T;T;T	0.39406	2.01;1.08;1.08	5.87	3.52	0.40303	.	0.249934	0.40554	N	0.001070	T	0.16300	0.0392	L	0.57536	1.79	0.80722	D	1	B;B	0.13594	0.008;0.0	B;B	0.08055	0.003;0.001	T	0.06807	-1.0806	10	0.18710	T	0.47	-11.485	6.2549	0.20867	0.7205:0.1363:0.1431:0.0	.	137;137	Q8N0S6-2;Q8N0S6	.;CENPL_HUMAN	L	137	ENSP00000348527:F137L;ENSP00000323543:F137L;ENSP00000356683:F137L	ENSP00000323543:F137L	F	-	3	2	CENPL	172043037	0.998000	0.40836	1.000000	0.80357	0.872000	0.50106	0.613000	0.24299	0.533000	0.28675	-0.274000	0.10170	TTT	CENPL	-	NULL	ENSG00000120334		0.348	CENPL-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPL	HGNC	protein_coding	OTTHUMT00000084213.1	-	0.00	65	0	A	NM_033319		173776414	-1	tier1	-	no_errors	ENST00000356198	ensembl	human	known	74_37	missense	24.71	64	21	SNP	1.000	T
CKS2	1164	genome.wustl.edu	37	9	91930118	91930118	+	Silent	SNP	A	A	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr9:91930118A>G	ENST00000314355.6	+	2	188	c.93A>G	c.(91-93)caA>caG	p.Q31Q	MIR3153_ENST00000580744.1_RNA	NM_001827.1	NP_001818.1	P33552	CKS2_HUMAN	CDC28 protein kinase regulatory subunit 2	31					cell proliferation (GO:0008283)|meiosis I (GO:0007127)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)		cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			kidney(1)|large_intestine(1)	2						TTTCCAAACAAGTACCTAAAA	0.438																																																	0													143.0	135.0	137.0					9																	91930118		2203	4300	6503	SO:0001819	synonymous_variant	0			X54942	CCDS6682.1	9q22	2008-02-05	2002-10-07		ENSG00000123975	ENSG00000123975			2000	protein-coding gene	gene with protein product		116901	"""CDC28 protein kinase 2"""			2227411, 8697818	Standard	NM_001827		Approved		uc004aqh.3	P33552	OTTHUMG00000020180	ENST00000314355.6:c.93A>G	9.37:g.91930118A>G			Q6FGI9|Q6LET5	Silent	SNP	pfam_Cyclin-dep_kinase_reg-sub,superfamily_Cyclin-dep_kinase_reg-sub,prints_Cyclin-dep_kinase_reg-sub	p.Q31	ENST00000314355.6	37	c.93	CCDS6682.1	9																																																																																			CKS2	-	pfam_Cyclin-dep_kinase_reg-sub,superfamily_Cyclin-dep_kinase_reg-sub,prints_Cyclin-dep_kinase_reg-sub	ENSG00000123975		0.438	CKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKS2	HGNC	protein_coding	OTTHUMT00000052988.1	-	0.00	43	0	A	NM_001827		91930118	+1	tier1	-	no_errors	ENST00000314355	ensembl	human	known	74_37	silent	11.94	59	8	SNP	1.000	G
CLASP1	23332	genome.wustl.edu	37	2	122104699	122104699	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:122104699T>G	ENST00000263710.4	-	39	4834	c.4445A>C	c.(4444-4446)aAg>aCg	p.K1482T	CLASP1_ENST00000541859.1_Missense_Mutation_p.K1199T|CLASP1_ENST00000397587.3_Missense_Mutation_p.K1422T|CLASP1_ENST00000545861.1_Missense_Mutation_p.K1189T|CLASP1_ENST00000409078.3_Missense_Mutation_p.K1415T|CLASP1_ENST00000541377.1_Missense_Mutation_p.K1421T|CLASP1_ENST00000455322.2_Missense_Mutation_p.K1438T	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	1482	Interaction with CLIP2. {ECO:0000250}.|Interaction with PHLDB2 and RSN.|Localization to kinetochores.				axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					CACGCTGGCCTTACGCACACT	0.453																																																	0													86.0	82.0	83.0					2																	122104699		2041	4186	6227	SO:0001583	missense	0			AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.4445A>C	2.37:g.122104699T>G	ENSP00000263710:p.Lys1482Thr		B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.K1482T	ENST00000263710.4	37	c.4445		2	.	.	.	.	.	.	.	.	.	.	T	20.9	4.061175	0.76187	.	.	ENSG00000074054	ENST00000263710;ENST00000455322;ENST00000397587;ENST00000541377;ENST00000541859;ENST00000409078;ENST00000545861	T;T;T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39;-0.39;-0.39	5.59	5.59	0.84812	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84138	0.5406	M	0.88775	2.98	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.991;0.997;0.996	D	0.87282	0.2293	10	0.87932	D	0	-23.7129	14.3424	0.66636	0.0:0.0:0.0:1.0	.	1415;1422;1482	E7EUA5;F5GWS0;Q7Z460	.;.;CLAP1_HUMAN	T	1482;1438;1422;1421;1199;1415;1189	ENSP00000263710:K1482T;ENSP00000389372:K1438T;ENSP00000380717:K1422T;ENSP00000441625:K1421T;ENSP00000441770:K1199T;ENSP00000386442:K1415T;ENSP00000438620:K1189T	ENSP00000263710:K1482T	K	-	2	0	CLASP1	121821169	1.000000	0.71417	0.993000	0.49108	0.360000	0.29518	7.717000	0.84732	2.127000	0.65507	0.459000	0.35465	AAG	CLASP1	-	pfam_HEAT,superfamily_ARM-type_fold	ENSG00000074054		0.453	CLASP1-201	KNOWN	basic	protein_coding	CLASP1	HGNC	protein_coding		-	0.00	42	0	T	NM_015282		122104699	-1	tier1	-	no_errors	ENST00000263710	ensembl	human	known	74_37	missense	10.71	50	6	SNP	1.000	G
CLEC9A	283420	genome.wustl.edu	37	12	10205421	10205421	+	Intron	DEL	T	T	-	rs375899502		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr12:10205421delT	ENST00000355819.1	+	4	704				CLEC9A_ENST00000544751.1_3'UTR	NM_207345.2	NP_997228.1	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A						positive regulation of cytokine secretion (GO:0050715)|receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	22						AGAGTTCATGTTTTTTTTTTT	0.378																																																	0													31.0	32.0	32.0					12																	10205421		2203	4300	6503	SO:0001627	intron_variant	0				CCDS8611.1	12p13.31	2010-04-27				ENSG00000197992		"""C-type lectin domain containing"""	26705	protein-coding gene	gene with protein product		612252					Standard	NM_207345		Approved	UNQ9341, HEEE9341	uc001qxa.3	Q6UXN8		ENST00000355819.1:c.91+44T>-	12.37:g.10205421delT			B0ZBM2	RNA	DEL	-	NULL	ENST00000355819.1	37	NULL	CCDS8611.1	12																																																																																			CLEC9A	-	-	ENSG00000197992		0.378	CLEC9A-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	CLEC9A	HGNC	protein_coding	OTTHUMT00000399564.1		0.00	25	0	T	NM_207345		10205421	+1	tier1		no_errors	ENST00000544751	ensembl	human	known	74_37	rna	18.18	18	4	DEL	0.000	-
CMYA5	202333	genome.wustl.edu	37	5	79025231	79025231	+	Silent	SNP	T	T	C			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr5:79025231T>C	ENST00000446378.2	+	2	674	c.643T>C	c.(643-645)Tta>Cta	p.L215L		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	215					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ACACAAGCCATTAGTGTTAAG	0.318																																																	0													53.0	51.0	52.0					5																	79025231		1813	4092	5905	SO:0001819	synonymous_variant	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.643T>C	5.37:g.79025231T>C			A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Silent	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.L215	ENST00000446378.2	37	c.643	CCDS47238.1	5																																																																																			CMYA5	-	NULL	ENSG00000164309		0.318	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	-	0.00	31	0	T	NM_153610		79025231	+1	tier1	-	no_errors	ENST00000446378	ensembl	human	known	74_37	silent	20.45	35	9	SNP	0.069	C
CNTN6	27255	genome.wustl.edu	37	3	1214937	1214937	+	Intron	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr3:1214937C>T	ENST00000446702.2	+	2	682				CNTN6_ENST00000350110.2_Intron|CNTN6_ENST00000539053.1_Intron			Q9UQ52	CNTN6_HUMAN	contactin 6						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TCGTCTCTGGCTTCTTCATTT	0.418																																																	0																																										SO:0001627	intron_variant	0			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.55+25190C>T	3.37:g.1214937C>T			Q2KHM2	Missense_Mutation	SNP	NULL	p.L32F	ENST00000446702.2	37	c.94	CCDS2557.1	3																																																																																			CNTN6	-	NULL	ENSG00000134115		0.418	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2	-	0.00	37	0	C	NM_014461		1214937	+1	tier1	-	no_errors	ENST00000394261	ensembl	human	known	74_37	missense	10.34	52	6	SNP	0.052	T
COG6	57511	genome.wustl.edu	37	13	40261650	40261650	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr13:40261650G>T	ENST00000455146.3	+	9	849	c.799G>T	c.(799-801)Gat>Tat	p.D267Y	COG6_ENST00000416691.1_Missense_Mutation_p.D267Y	NM_020751.2	NP_065802.1	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6	267					glycosylation (GO:0070085)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				NS(1)|kidney(2)|large_intestine(5)|lung(4)|skin(1)	13		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		ATATACCTTAGATGAATTTGG	0.408																																																	0													76.0	80.0	79.0					13																	40261650		2203	4300	6503	SO:0001583	missense	0			AK026638	CCDS9370.1, CCDS45042.1	13q13.2	2011-08-01			ENSG00000133103	ENSG00000133103		"""Components of oligomeric golgi complex"""	18621	protein-coding gene	gene with protein product		606977				11980916	Standard	NM_020751		Approved	COD2, KIAA1134	uc001uxh.2	Q9Y2V7	OTTHUMG00000016768	ENST00000455146.3:c.799G>T	13.37:g.40261650G>T	ENSP00000397441:p.Asp267Tyr		Q5T0U1|Q6AI19|Q86V49|Q9ULT5	Missense_Mutation	SNP	pfam_COG6	p.D267Y	ENST00000455146.3	37	c.799	CCDS9370.1	13	.	.	.	.	.	.	.	.	.	.	G	21.6	4.166696	0.78339	.	.	ENSG00000133103	ENST00000416691;ENST00000255468;ENST00000455146	T;T	0.60548	0.18;0.18	5.68	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.77877	0.4196	M	0.85777	2.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.81897	-0.0722	10	0.87932	D	0	-4.6379	13.8326	0.63391	0.0734:0.0:0.9266:0.0	.	288;267	Q5T0U2;Q9Y2V7	.;COG6_HUMAN	Y	267;298;267	ENSP00000403733:D267Y;ENSP00000397441:D267Y	ENSP00000255468:D298Y	D	+	1	0	COG6	39159650	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.323000	0.79105	1.403000	0.46800	0.591000	0.81541	GAT	COG6	-	pfam_COG6	ENSG00000133103		0.408	COG6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COG6	HGNC	protein_coding	OTTHUMT00000044622.3		0.00	26	0	G			40261650	+1			no_errors	ENST00000455146	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
COL21A1	81578	genome.wustl.edu	37	6	56029249	56029249	+	Missense_Mutation	SNP	G	G	A	rs529924012		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr6:56029249G>A	ENST00000244728.5	-	9	1740	c.1343C>T	c.(1342-1344)cCg>cTg	p.P448L	COL21A1_ENST00000535941.1_Missense_Mutation_p.P448L|COL21A1_ENST00000370819.1_Missense_Mutation_p.P445L	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	448	Collagen-like 1.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			TGGTTTTCCCGGAGGACAAAT	0.423													G|||	1	0.000199681	0.0	0.0	5008	,	,		16703	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001583	missense	0			AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.1343C>T	6.37:g.56029249G>A	ENSP00000244728:p.Pro448Leu		A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.P448L	ENST00000244728.5	37	c.1343	CCDS55025.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.03|15.03	2.712207|2.712207	0.48517|0.48517	.|.	.|.	ENSG00000124749|ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811|ENST00000456983	D;D;D|.	0.98684|.	-5.07;-5.07;-5.07|.	5.26|5.26	3.49|3.49	0.39957|0.39957	.|.	0.000000|.	0.56097|.	D|.	0.000035|.	T|T	0.70815|0.70815	0.3267|0.3267	M|M	0.89030|0.89030	3|3	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.79784|.	0.991;0.993|.	T|T	0.75227|0.75227	-0.3392|-0.3392	10|5	0.52906|.	T|.	0.07|.	.|.	11.9825|11.9825	0.53127|0.53127	0.1413:0.0:0.8587:0.0|0.1413:0.0:0.8587:0.0	.|.	445;448|.	Q96P44-3;Q96P44|.	.;COLA1_HUMAN|.	L|W	448;445;448;445|33	ENSP00000244728:P448L;ENSP00000359855:P445L;ENSP00000444384:P448L|.	ENSP00000244728:P448L|.	P|R	-|-	2|1	0|2	COL21A1|COL21A1	56137208|56137208	1.000000|1.000000	0.71417|0.71417	0.820000|0.820000	0.32676|0.32676	0.882000|0.882000	0.50991|0.50991	6.422000|6.422000	0.73357|0.73357	0.725000|0.725000	0.32318|0.32318	-0.142000|-0.142000	0.14014|0.14014	CCG|CGG	COL21A1	-	NULL	ENSG00000124749		0.423	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	COL21A1	HGNC	protein_coding	OTTHUMT00000041004.2	-	0.00	34	0	G			56029249	-1	tier1	-	no_errors	ENST00000244728	ensembl	human	known	74_37	missense	15.62	27	5	SNP	0.996	A
COL6A3	1293	genome.wustl.edu	37	2	238275737	238275737	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:238275737G>A	ENST00000295550.4	-	11	5545	c.5093C>T	c.(5092-5094)aCc>aTc	p.T1698I	COL6A3_ENST00000347401.3_Missense_Mutation_p.T1497I|COL6A3_ENST00000346358.4_Missense_Mutation_p.T1498I|COL6A3_ENST00000353578.4_Missense_Mutation_p.T1492I|COL6A3_ENST00000409809.1_Missense_Mutation_p.T1492I|COL6A3_ENST00000472056.1_Missense_Mutation_p.T1091I	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1698	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CTGCCTCTTGGTAGAGAAGTC	0.498																																																	0													81.0	68.0	73.0					2																	238275737		2203	4300	6503	SO:0001583	missense	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.5093C>T	2.37:g.238275737G>A	ENSP00000295550:p.Thr1698Ile		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.T1698I	ENST00000295550.4	37	c.5093	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	G	13.34	2.206521	0.39003	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	T;T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24;-1.24	5.49	3.51	0.40186	von Willebrand factor, type A (3);	0.349375	0.24289	N	0.039835	D	0.85860	0.5795	M	0.81112	2.525	0.29161	N	0.877788	D;D;P	0.71674	0.998;0.995;0.896	D;D;P	0.68621	0.959;0.923;0.776	T	0.80410	-0.1394	10	0.72032	D	0.01	.	9.2258	0.37405	0.0:0.2193:0.4916:0.2891	.	1091;1492;1698	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	I	1698;1497;1492;1091;1492;1498	ENSP00000295550:T1698I;ENSP00000315609:T1497I;ENSP00000315873:T1492I;ENSP00000418285:T1091I;ENSP00000386844:T1492I;ENSP00000295546:T1498I	ENSP00000295550:T1698I	T	-	2	0	COL6A3	237940476	1.000000	0.71417	0.992000	0.48379	0.950000	0.60333	1.258000	0.32944	1.241000	0.43820	0.650000	0.86243	ACC	COL6A3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000163359		0.498	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	-	0.00	56	0	G	NM_004369		238275737	-1	tier1	-	no_errors	ENST00000295550	ensembl	human	known	74_37	missense	15.48	71	13	SNP	0.963	A
COL6A3	1293	genome.wustl.edu	37	2	238289897	238289897	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:238289897C>T	ENST00000295550.4	-	5	2010	c.1558G>A	c.(1558-1560)Ggc>Agc	p.G520S	COL6A3_ENST00000347401.3_Missense_Mutation_p.G319S|COL6A3_ENST00000346358.4_Missense_Mutation_p.G520S|COL6A3_ENST00000392003.2_Missense_Mutation_p.G113S|COL6A3_ENST00000392004.3_Missense_Mutation_p.G314S|COL6A3_ENST00000353578.4_Missense_Mutation_p.G314S|COL6A3_ENST00000409809.1_Missense_Mutation_p.G314S|COL6A3_ENST00000472056.1_Missense_Mutation_p.G113S	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	520	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AGGGCCGAGCCGTCCAGGGGC	0.522																																																	0													92.0	104.0	100.0					2																	238289897		2203	4300	6503	SO:0001583	missense	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.1558G>A	2.37:g.238289897C>T	ENSP00000295550:p.Gly520Ser		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.G520S	ENST00000295550.4	37	c.1558	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	C	20.7	4.032573	0.75504	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003;ENST00000433762	T;T;T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77;0.77	5.5	5.5	0.81552	von Willebrand factor, type A (3);	0.000000	0.53938	D	0.000049	T	0.72732	0.3497	M	0.91300	3.195	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.999;0.998;0.998;0.987;0.999	D;D;D;D;P;D	0.70716	0.946;0.97;0.927;0.927;0.842;0.946	T	0.77094	-0.2715	10	0.49607	T	0.09	.	12.6966	0.57008	0.0:0.9247:0.0:0.0753	.	520;113;113;314;314;520	E9PCV6;E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;.;CO6A3_HUMAN	S	520;319;314;113;314;520;314;113;520	ENSP00000295550:G520S;ENSP00000315609:G319S;ENSP00000315873:G314S;ENSP00000418285:G113S;ENSP00000386844:G314S;ENSP00000295546:G520S;ENSP00000375861:G314S;ENSP00000375860:G113S;ENSP00000389539:G520S	ENSP00000295550:G520S	G	-	1	0	COL6A3	237954636	1.000000	0.71417	0.239000	0.24122	0.464000	0.32679	5.839000	0.69395	2.570000	0.86706	0.655000	0.94253	GGC	COL6A3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000163359		0.522	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	-	0.00	41	0	C	NM_004369		238289897	-1	tier1	-	no_errors	ENST00000295550	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.998	T
CORO7	79585	genome.wustl.edu	37	16	4412735	4412735	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr16:4412735C>T	ENST00000251166.4	-	15	1425	c.1280G>A	c.(1279-1281)gGt>gAt	p.G427D	CORO7_ENST00000423908.2_Missense_Mutation_p.G259D|CORO7_ENST00000539968.1_Missense_Mutation_p.G207D|CORO7_ENST00000574025.1_Missense_Mutation_p.G342D|CORO7_ENST00000537233.2_Missense_Mutation_p.G409D|CORO7-PAM16_ENST00000572467.1_Missense_Mutation_p.G427D	NM_024535.4	NP_078811.3	P57737	CORO7_HUMAN	coronin 7	427					actin filament polymerization (GO:0030041)|Golgi to endosome transport (GO:0006895)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)			breast(3)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|prostate(2)|skin(2)|urinary_tract(2)	23						GGAAGAGAAACCCTCCTGGGG	0.677																																																	0													25.0	25.0	25.0					16																	4412735		2186	4296	6482	SO:0001583	missense	0			AK097238	CCDS10513.1, CCDS55982.1, CCDS58417.1	16p13.3	2013-01-10			ENSG00000262246	ENSG00000262246		"""Coronins"", ""WD repeat domain containing"""	26161	protein-coding gene	gene with protein product		611668				15327992	Standard	NM_024535		Approved	FLJ22021		P57737	OTTHUMG00000129465	ENST00000251166.4:c.1280G>A	16.37:g.4412735C>T	ENSP00000251166:p.Gly427Asp		B4DFD6|B4DL18|I3L416|Q17RK4	Missense_Mutation	SNP	pfam_DUF1900,pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G427D	ENST00000251166.4	37	c.1280	CCDS10513.1	16	.	.	.	.	.	.	.	.	.	.	C	8.037	0.763031	0.15914	.	.	ENSG00000103426	ENST00000251166;ENST00000537233;ENST00000539968;ENST00000423908	T;T;T	0.64438	-0.09;-0.1;2.54	5.07	4.12	0.48240	.	0.746502	0.12582	N	0.456339	T	0.56352	0.1979	L	0.60455	1.87	0.42783	D	0.993873	B;B;B;B;B;B	0.16396	0.006;0.003;0.001;0.017;0.001;0.003	B;B;B;B;B;B	0.17098	0.008;0.004;0.001;0.017;0.005;0.003	T	0.46345	-0.9198	10	0.13470	T	0.59	-41.4711	11.6956	0.51542	0.0:0.9162:0.0:0.0838	.	342;409;207;207;427;408	P57737-2;B4DFD6;B3KSY4;B3KUH7;P57737;B4DKU9	.;.;.;.;CORO7_HUMAN;.	D	427;342;207;259	ENSP00000251166:G427D;ENSP00000446221:G207D;ENSP00000391530:G259D	ENSP00000251166:G427D	G	-	2	0	CORO7	4352736	1.000000	0.71417	0.998000	0.56505	0.070000	0.16714	2.504000	0.45416	1.124000	0.41980	-0.263000	0.10527	GGT	CORO7-PAM16	-	NULL	ENSG00000103426		0.677	CORO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO7-PAM16	HGNC	protein_coding	OTTHUMT00000251628.2	-	0.00	38	0	C	NM_024535		4412735	-1	tier1	-	no_errors	ENST00000572467	ensembl	human	known	74_37	missense	36.36	21	12	SNP	1.000	T
CPA5	93979	genome.wustl.edu	37	7	130007803	130007803	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr7:130007803C>A	ENST00000485477.1	+	11	2224	c.1095C>A	c.(1093-1095)taC>taA	p.Y365*	CPA5_ENST00000461828.1_Nonsense_Mutation_p.Y365*|CPA5_ENST00000355388.3_Nonsense_Mutation_p.Y365*|CPA5_ENST00000474905.1_Nonsense_Mutation_p.Y365*|CPA5_ENST00000393213.3_Nonsense_Mutation_p.Y365*|CPA5_ENST00000466363.2_Nonsense_Mutation_p.Y365*|CPA5_ENST00000431780.2_Intron			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	365						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					GGATCGAGTACATTTTTGGCA	0.597																																																	0													141.0	102.0	115.0					7																	130007803		2203	4300	6503	SO:0001587	stop_gained	0			AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.1095C>A	7.37:g.130007803C>A	ENSP00000420237:p.Tyr365*		G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Nonsense_Mutation	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.Y365*	ENST00000485477.1	37	c.1095	CCDS5819.1	7	.	.	.	.	.	.	.	.	.	.	C	40	8.298189	0.98747	.	.	ENSG00000158525	ENST00000355388;ENST00000461828;ENST00000466363;ENST00000485477;ENST00000474905;ENST00000393213	.	.	.	6.06	5.17	0.71159	.	0.000000	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7486	0.69508	0.0:0.9304:0.0:0.0696	.	.	.	.	X	365	.	.	Y	+	3	2	CPA5	129795039	1.000000	0.71417	0.908000	0.35775	0.141000	0.21300	4.471000	0.60182	1.551000	0.49450	0.655000	0.94253	TAC	CPA5	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000158525		0.597	CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA5	HGNC	protein_coding	OTTHUMT00000349712.1	-	0.00	52	0	C	NM_001127441		130007803	+1	tier1	-	no_errors	ENST00000355388	ensembl	human	known	74_37	nonsense	28.07	41	16	SNP	1.000	A
CPD	1362	genome.wustl.edu	37	17	28791735	28791735	+	Missense_Mutation	SNP	G	G	A	rs367904758		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr17:28791735G>A	ENST00000225719.4	+	21	4122	c.4046G>A	c.(4045-4047)cGc>cAc	p.R1349H	CPD_ENST00000543464.2_Missense_Mutation_p.R1102H	NM_001304.4	NP_001295.2	O75976	CBPD_HUMAN	carboxypeptidase D	1349						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metallocarboxypeptidase activity (GO:0004181)|serine-type carboxypeptidase activity (GO:0004185)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(13)|skin(5)|stomach(1)|urinary_tract(1)	36						GATGAAATTCGCATGATGTCT	0.423																																																	0								G	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	181.0	165.0	171.0		3305,4046	5.6	1.0	17		171	0,8600		0,0,4300	no	missense,missense	CPD	NM_001199775.1,NM_001304.4	29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	1102/1134,1349/1381	28791735	1,13005	2203	4300	6503	SO:0001583	missense	0			U65090	CCDS11257.1, CCDS56025.1	17q11.2	2012-02-10			ENSG00000108582	ENSG00000108582	3.4.17.22		2301	protein-coding gene	gene with protein product	"""metallocarboxypeptidase D"""	603102				9628828, 9355738	Standard	NM_001304		Approved	GP180	uc002hfb.2	O75976	OTTHUMG00000132797	ENST00000225719.4:c.4046G>A	17.37:g.28791735G>A	ENSP00000225719:p.Arg1349His		B7Z7T9|B7ZAU4|F5GZH6|O15377|Q86SH9|Q86XE6	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14,prints_Peptidase_M14	p.R1349H	ENST00000225719.4	37	c.4046	CCDS11257.1	17	.	.	.	.	.	.	.	.	.	.	G	24.1	4.495049	0.85069	2.27E-4	0.0	ENSG00000108582	ENST00000225719;ENST00000543464	T;T	0.20200	2.09;3.18	5.63	5.63	0.86233	.	2.727150	0.01079	N	0.004958	T	0.44561	0.1299	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.953;0.996	T	0.13045	-1.0524	10	0.72032	D	0.01	-2.4783	18.6776	0.91534	0.0:0.0:1.0:0.0	.	1102;1349	F5GZH6;O75976	.;CBPD_HUMAN	H	1349;1102	ENSP00000225719:R1349H;ENSP00000444443:R1102H	ENSP00000225719:R1349H	R	+	2	0	CPD	25815861	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.150000	0.77403	2.626000	0.88956	0.655000	0.94253	CGC	CPD	-	NULL	ENSG00000108582		0.423	CPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPD	HGNC	protein_coding	OTTHUMT00000256214.3		0.00	23	0	G	NM_001304		28791735	+1			no_errors	ENST00000225719	ensembl	human	known	74_37	missense	7.89	35	3	SNP	1.000	A
CPQ	10404	genome.wustl.edu	37	8	97797153	97797153	+	Missense_Mutation	SNP	G	G	T	rs369831003		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr8:97797153G>T	ENST00000220763.5	+	2	238	c.28G>T	c.(28-30)Ggt>Tgt	p.G10C		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	10					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										CGCATTTTTCGGTGGTGTTCA	0.338																																																	0													83.0	84.0	83.0					8																	97797153		2203	4300	6503	SO:0001583	missense	0			AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.28G>T	8.37:g.97797153G>T	ENSP00000220763:p.Gly10Cys		B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	SNP	pfam_Peptidase_M28,pfam_Peptidase_M20	p.G10C	ENST00000220763.5	37	c.28	CCDS6273.1	8	.	.	.	.	.	.	.	.	.	.	G	8.025	0.760387	0.15914	.	.	ENSG00000104324	ENST00000220763;ENST00000519900;ENST00000517742;ENST00000519484;ENST00000521142	T;T	0.44482	0.92;0.92	5.4	4.51	0.55191	.	0.411951	0.24267	N	0.040038	T	0.32556	0.0833	L	0.47716	1.5	0.09310	N	1	B;B	0.15719	0.014;0.008	B;B	0.18561	0.022;0.012	T	0.21348	-1.0248	10	0.38643	T	0.18	-2.1546	5.3545	0.16053	0.1232:0.0:0.6803:0.1965	.	10;10	B5MDX4;Q9Y646	.;PGCP_HUMAN	C	10	ENSP00000220763:G10C;ENSP00000429146:G10C	ENSP00000220763:G10C	G	+	1	0	AC010859.1	97866329	0.212000	0.23540	0.002000	0.10522	0.094000	0.18550	1.134000	0.31442	1.262000	0.44165	0.563000	0.77884	GGT	CPQ	-	NULL	ENSG00000104324		0.338	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPQ	HGNC	protein_coding	OTTHUMT00000379757.2		0.00	23	0	G	NM_016134		97797153	+1			no_errors	ENST00000220763	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.002	T
DCDC1	341019	genome.wustl.edu	37	11	31327826	31327826	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr11:31327826C>A	ENST00000452803.1	-	5	745	c.544G>T	c.(544-546)Gga>Tga	p.G182*	DCDC1_ENST00000597505.1_Nonsense_Mutation_p.G182*|RP1-296L11.1_ENST00000528872.1_RNA	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	182	Doublecortin. {ECO:0000255|PROSITE- ProRule:PRU00072}.				intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					GTTCTAGATCCATTTTTGTAA	0.368																																																	0													127.0	122.0	124.0					11																	31327826		2202	4299	6501	SO:0001587	stop_gained	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.544G>T	11.37:g.31327826C>A	ENSP00000389792:p.Gly182*		A6PVL6|B7WNX6|Q6ZU04	Nonsense_Mutation	SNP	pfscan_Doublecortin_dom	p.G182*	ENST00000452803.1	37	c.544	CCDS7872.1	11	.	.	.	.	.	.	.	.	.	.	C	38	7.192218	0.98125	.	.	ENSG00000188682	ENST00000452803	.	.	.	5.95	4.04	0.47022	.	0.114925	0.38663	N	0.001614	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.6917	0.45875	0.0:0.7991:0.131:0.0698	.	.	.	.	X	182	.	ENSP00000343496:G182X	G	-	1	0	DCDC1	31284402	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.585000	0.36600	0.792000	0.33850	0.650000	0.86243	GGA	DCDC1	-	pfscan_Doublecortin_dom	ENSG00000170959		0.368	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000316531.1	-	0.00	24	0	C	NM_181807		31327826	-1	tier1	-	no_errors	ENST00000452803	ensembl	human	known	74_37	nonsense	23.81	32	10	SNP	1.000	A
DENND2A	27147	genome.wustl.edu	37	7	140301551	140301551	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr7:140301551C>T	ENST00000275884.6	-	2	1064	c.647G>A	c.(646-648)aGg>aAg	p.R216K	DENND2A_ENST00000537639.1_Missense_Mutation_p.R216K|DENND2A_ENST00000492720.1_Missense_Mutation_p.R216K|DENND2A_ENST00000496613.1_Missense_Mutation_p.R216K			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	216					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					GGGGTGGACCCTCTGGCTGAC	0.632																																																	0													72.0	73.0	73.0					7																	140301551		1924	4140	6064	SO:0001583	missense	0			AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.647G>A	7.37:g.140301551C>T	ENSP00000275884:p.Arg216Lys		C9JUI3|Q1RMD5|Q86XY0	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.R216K	ENST00000275884.6	37	c.647	CCDS43659.1	7	.	.	.	.	.	.	.	.	.	.	C	0.045	-1.271192	0.01421	.	.	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613;ENST00000492720	T;T;T;T	0.09911	3.66;3.66;3.66;2.93	4.87	2.02	0.26589	.	1.077610	0.07020	N	0.826560	T	0.13670	0.0331	N	0.22421	0.69	0.09310	N	1	D;P	0.58970	0.984;0.865	D;P	0.63793	0.918;0.497	T	0.17471	-1.0368	10	0.05721	T	0.95	-5.8983	6.5432	0.22392	0.0:0.6928:0.1477:0.1595	.	216;216	Q9ULE3-2;Q9ULE3	.;DEN2A_HUMAN	K	216	ENSP00000275884:R216K;ENSP00000442245:R216K;ENSP00000419654:R216K;ENSP00000419464:R216K	ENSP00000275884:R216K	R	-	2	0	DENND2A	139948020	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	1.445000	0.35079	0.244000	0.21351	-0.258000	0.10820	AGG	DENND2A	-	NULL	ENSG00000146966		0.632	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND2A	HGNC	protein_coding	OTTHUMT00000348742.1	-	0.00	27	0	C	NM_015689		140301551	-1	tier1	-	no_errors	ENST00000275884	ensembl	human	known	74_37	missense	12.82	34	5	SNP	0.001	T
DISC1	27185	genome.wustl.edu	37	1	231830164	231830164	+	Silent	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:231830164C>T	ENST00000602281.1	+	2	713	c.660C>T	c.(658-660)gcC>gcT	p.A220A	DISC1_ENST00000537876.1_Silent_p.A220A|DISC1_ENST00000539444.1_Silent_p.A220A|DISC1_ENST00000366633.3_Silent_p.A220A|DISC1_ENST00000366636.4_Silent_p.A220A|TSNAX-DISC1_ENST00000602962.1_3'UTR|DISC1_ENST00000535983.1_Silent_p.A220A|DISC1_ENST00000366637.3_5'UTR|DISC1_ENST00000602873.1_Intron|DISC1_ENST00000317586.4_Silent_p.A220A|DISC1_ENST00000439617.2_Silent_p.A220A	NM_001164542.1|NM_001164544.1	NP_001158014.1|NP_001158016.1	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	220	Interaction with MAP1A.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				TTGGCTCTGCCGGGGAACGTG	0.622																																																	0													45.0	45.0	45.0					1																	231830164		2203	4300	6503	SO:0001819	synonymous_variant	0			AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000602281.1:c.660C>T	1.37:g.231830164C>T			A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Silent	SNP	superfamily_Prefoldin	p.A220	ENST00000602281.1	37	c.660	CCDS59205.1	1																																																																																			DISC1	-	NULL	ENSG00000162946		0.622	DISC1-019	KNOWN	basic|appris_candidate|CCDS	protein_coding	DISC1	HGNC	protein_coding	OTTHUMT00000467451.1	-	0.00	28	0	C	NM_018662		231830164	+1	tier1	-	no_errors	ENST00000439617	ensembl	human	known	74_37	silent	20.83	19	5	SNP	0.214	T
DNASE1L3	1776	genome.wustl.edu	37	3	58179028	58179028	+	Intron	SNP	T	T	C	rs3732630	byFrequency	TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr3:58179028T>C	ENST00000394549.2	-	7	1118				DNASE1L3_ENST00000318316.3_Intron|DNASE1L3_ENST00000483681.1_Silent_p.K281K|DNASE1L3_ENST00000486455.1_Intron	NM_004944.3	NP_004935.1	Q13609	DNSL3_HUMAN	deoxyribonuclease I-like 3						apoptotic DNA fragmentation (GO:0006309)|developmental programmed cell death (GO:0010623)|DNA metabolic process (GO:0006259)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)|deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			breast(2)|large_intestine(4)|lung(6)	12				BRCA - Breast invasive adenocarcinoma(55;0.00021)|KIRC - Kidney renal clear cell carcinoma(284;0.0445)|Kidney(284;0.0556)|OV - Ovarian serous cystadenocarcinoma(275;0.202)		ctAACTCATCTTTCCAGGACA	0.428													T|||	2071	0.413538	0.1982	0.4222	5008	,	,		22758	0.6399		0.328	False		,,,				2504	0.5532				Esophageal Squamous(96;1069 1424 4841 43466 52325)												0								T		1090,3316	374.9+/-321.4	126,838,1239	65.0	55.0	58.0			-0.5	0.0	3	dbSNP_107	58	2689,5911	408.9+/-349.7	414,1861,2025	no	intron	DNASE1L3	NM_004944.2		540,2699,3264	CC,CT,TT		31.2674,24.739,29.0558			58179028	3779,9227	2203	4300	6503	SO:0001627	intron_variant	0			AF047354	CCDS2886.1, CCDS58836.1	3p14.3	2008-05-15			ENSG00000163687	ENSG00000163687			2959	protein-coding gene	gene with protein product	"""DNase gamma"""	602244				9205125, 9714828, 14646506	Standard	NM_004944		Approved	DNAS1L3, LSD	uc003djo.2	Q13609	OTTHUMG00000159153	ENST00000394549.2:c.801+41A>G	3.37:g.58179028T>C			B2R8B1|B7Z707|O75803	Silent	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_DNase_I,pirsf_DNase_I,prints_DNase_I	p.K281	ENST00000394549.2	37	c.843	CCDS2886.1	3																																																																																			DNASE1L3	-	NULL	ENSG00000163687		0.428	DNASE1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNASE1L3	HGNC	protein_coding	OTTHUMT00000353533.1		0.00	28	0	T	NM_004944		58179028	-1			no_errors	ENST00000483681	ensembl	human	putative	74_37	silent	8.11	34	3	SNP	0.000	C
DNMT3A	1788	genome.wustl.edu	37	2	25462040	25462040	+	Silent	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:25462040G>A	ENST00000264709.3	-	20	2704	c.2367C>T	c.(2365-2367)caC>caT	p.H789H	DNMT3A_ENST00000321117.5_Silent_p.H789H|DNMT3A_ENST00000402667.1_Silent_p.H566H|DNMT3A_ENST00000380746.4_Silent_p.H600H|DNMT3A_ENST00000474887.1_5'UTR	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	789	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCGGGCCCTGTGTGCAGCTG	0.572			"""Mis, F, N, S"""		AML																																			Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	0													70.0	62.0	65.0					2																	25462040		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.2367C>T	2.37:g.25462040G>A			E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Silent	SNP	pfam_PWWP_dom,pfam_C5_MeTfrase,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,pfscan_PWWP_dom	p.H789	ENST00000264709.3	37	c.2367	CCDS33157.1	2																																																																																			DNMT3A	-	NULL	ENSG00000119772		0.572	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	DNMT3A	HGNC	protein_coding	OTTHUMT00000211587.1	-	0.00	38	0	G	NM_022552		25462040	-1	tier1	-	no_errors	ENST00000264709	ensembl	human	known	74_37	silent	20.00	44	11	SNP	1.000	A
DOCK3	1795	genome.wustl.edu	37	3	51352437	51352437	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr3:51352437G>T	ENST00000266037.9	+	32	3303	c.3280G>T	c.(3280-3282)Gga>Tga	p.G1094*		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1094					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		CTTTATTCCGGGAATGATTGG	0.453																																																	0													54.0	56.0	55.0					3																	51352437		1888	4100	5988	SO:0001587	stop_gained	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.3280G>T	3.37:g.51352437G>T	ENSP00000266037:p.Gly1094*		O15017	Nonsense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.G1094*	ENST00000266037.9	37	c.3280	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	G	41	8.931785	0.99008	.	.	ENSG00000088538	ENST00000266037	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	20.1236	0.97970	0.0:0.0:1.0:0.0	.	.	.	.	X	1094	.	ENSP00000266037:G1094X	G	+	1	0	DOCK3	51327477	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.790000	0.99075	2.765000	0.95021	0.555000	0.69702	GGA	DOCK3	-	superfamily_ARM-type_fold	ENSG00000088538		0.453	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5		0.00	12	0	G	NM_004947		51352437	+1			no_errors	ENST00000266037	ensembl	human	known	74_37	nonsense	7.14	26	2	SNP	1.000	T
DOCK3	1795	genome.wustl.edu	37	3	51352528	51352528	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr3:51352528G>T	ENST00000266037.9	+	32	3394	c.3371G>T	c.(3370-3372)tGg>tTg	p.W1124L		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1124					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		ATGATGGACTGGGAGCAGAGA	0.478																																																	0													86.0	86.0	86.0					3																	51352528		1915	4123	6038	SO:0001583	missense	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.3371G>T	3.37:g.51352528G>T	ENSP00000266037:p.Trp1124Leu		O15017	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.W1124L	ENST00000266037.9	37	c.3371	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	G	20.2	3.955133	0.73902	.	.	ENSG00000088538	ENST00000266037	T	0.49139	0.79	5.73	5.73	0.89815	.	0.051051	0.85682	D	0.000000	T	0.43211	0.1237	L	0.40543	1.245	0.80722	D	1	B	0.24483	0.104	B	0.21708	0.036	T	0.17868	-1.0355	10	0.25751	T	0.34	.	19.9017	0.96988	0.0:0.0:1.0:0.0	.	1124	Q8IZD9	DOCK3_HUMAN	L	1124	ENSP00000266037:W1124L	ENSP00000266037:W1124L	W	+	2	0	DOCK3	51327568	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.790000	0.99075	2.707000	0.92482	0.561000	0.74099	TGG	DOCK3	-	superfamily_ARM-type_fold	ENSG00000088538		0.478	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	-	0.00	20	0	G	NM_004947		51352528	+1	tier1	-	no_errors	ENST00000266037	ensembl	human	known	74_37	missense	18.92	30	7	SNP	1.000	T
DOCK8	81704	genome.wustl.edu	37	9	428369	428369	+	Missense_Mutation	SNP	C	C	T	rs370123223		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr9:428369C>T	ENST00000453981.1	+	35	4458	c.4346C>T	c.(4345-4347)tCg>tTg	p.S1449L	DOCK8_ENST00000432829.2_Missense_Mutation_p.S1381L|DOCK8_ENST00000382329.1_Missense_Mutation_p.S916L|DOCK8_ENST00000469391.1_Missense_Mutation_p.S1349L			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1449					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.S1381*(2)|p.S1449*(1)		breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CAGGCGAGCTCGGCTCTGGAC	0.502																																																	3	Substitution - Nonsense(3)	prostate(3)						C	LEU/SER,LEU/SER,LEU/SER	0,4406		0,0,2203	125.0	102.0	110.0		4046,4142,4346	5.7	0.8	9		110	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	DOCK8	NM_001190458.1,NM_001193536.1,NM_203447.3	145,145,145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	1349/2000,1381/2032,1449/2100	428369	1,13005	2203	4300	6503	SO:0001583	missense	0			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.4346C>T	9.37:g.428369C>T	ENSP00000408464:p.Ser1449Leu		A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.S1449L	ENST00000453981.1	37	c.4346	CCDS6440.2	9	.	.	.	.	.	.	.	.	.	.	C	8.780	0.927985	0.18131	0.0	1.16E-4	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	5.65	5.65	0.86999	Armadillo-type fold (1);	0.381500	0.30556	N	0.009377	T	0.29321	0.0730	N	0.13198	0.31	0.38749	D	0.954069	B;B;B	0.12013	0.001;0.001;0.005	B;B;B	0.09377	0.002;0.004;0.004	T	0.15263	-1.0443	10	0.33141	T	0.24	.	9.8974	0.41327	0.0:0.8436:0.0:0.1564	.	1349;916;1449	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	L	1449;1417;1381;1349;916	ENSP00000408464:S1449L;ENSP00000394888:S1381L;ENSP00000419438:S1349L;ENSP00000371766:S916L	ENSP00000287364:S1417L	S	+	2	0	DOCK8	418369	0.991000	0.36638	0.756000	0.31282	0.339000	0.28857	2.888000	0.48594	2.648000	0.89879	0.650000	0.86243	TCG	DOCK8	-	superfamily_ARM-type_fold	ENSG00000107099		0.502	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	HGNC	protein_coding	OTTHUMT00000171792.5	-	0.00	84	0	C	XM_036307		428369	+1	tier1	-	no_errors	ENST00000453981	ensembl	human	known	74_37	missense	30.23	59	26	SNP	0.977	T
DPPA3	359787	genome.wustl.edu	37	12	7869565	7869565	+	Silent	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr12:7869565G>A	ENST00000345088.2	+	4	489	c.372G>A	c.(370-372)aaG>aaA	p.K124K		NM_199286.2	NP_954980.1	Q6W0C5	DPPA3_HUMAN	developmental pluripotency associated 3	124					chromatin modification (GO:0016568)|embryonic cleavage (GO:0040016)|negative regulation of DNA demethylation (GO:1901536)|protection of DNA demethylation of female pronucleus (GO:0044726)|regulation of genetic imprinting (GO:2000653)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)	p.K124K(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)	8				Kidney(36;0.0887)		TTTTTCAGAAGGAATCAAGAC	0.378																																																	1	Substitution - coding silent(1)	lung(1)											78.0	84.0	82.0					12																	7869565		2203	4300	6503	SO:0001819	synonymous_variant	0			AY317075	CCDS8582.1	12p13.31	2012-10-02			ENSG00000187569	ENSG00000187569			19199	protein-coding gene	gene with protein product		608408					Standard	NM_199286		Approved	Stella	uc001qtf.3	Q6W0C5	OTTHUMG00000168434	ENST00000345088.2:c.372G>A	12.37:g.7869565G>A			Q0P5U3|Q6JZS6	Silent	SNP	NULL	p.K124	ENST00000345088.2	37	c.372	CCDS8582.1	12																																																																																			DPPA3	-	NULL	ENSG00000187569		0.378	DPPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPPA3	HGNC	protein_coding	OTTHUMT00000399718.1	-	0.00	31	0	G	NM_199286		7869565	+1	tier1	-	no_errors	ENST00000345088	ensembl	human	known	74_37	silent	12.07	51	7	SNP	0.001	A
ELMO1	9844	genome.wustl.edu	37	7	37264526	37264526	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr7:37264526G>A	ENST00000310758.4	-	9	1306	c.659C>T	c.(658-660)gCg>gTg	p.A220V	ELMO1_ENST00000442504.1_Missense_Mutation_p.A220V|ELMO1_ENST00000448602.1_Missense_Mutation_p.A220V	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	220					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GATCTCCTGCGCCACTTTCTG	0.527																																																	0													131.0	111.0	118.0					7																	37264526		2203	4300	6503	SO:0001583	missense	0			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.659C>T	7.37:g.37264526G>A	ENSP00000312185:p.Ala220Val		A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	pfam_DUF3361,pfam_Engulfment_cell_motility_ELMO,superfamily_ARM-type_fold	p.A220V	ENST00000310758.4	37	c.659	CCDS5449.1	7	.	.	.	.	.	.	.	.	.	.	G	35	5.557403	0.96514	.	.	ENSG00000155849	ENST00000310758;ENST00000361912;ENST00000442504;ENST00000448602	T;T;T	0.45276	0.9;0.9;0.9	5.4	5.4	0.78164	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.61426	0.2346	L	0.59436	1.845	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	T	0.54715	-0.8252	10	0.31617	T	0.26	.	19.5556	0.95345	0.0:0.0:1.0:0.0	.	220	Q92556	ELMO1_HUMAN	V	220;124;220;220	ENSP00000312185:A220V;ENSP00000406952:A220V;ENSP00000394458:A220V	ENSP00000312185:A220V	A	-	2	0	ELMO1	37231051	1.000000	0.71417	0.963000	0.40424	0.901000	0.52897	9.864000	0.99589	2.693000	0.91896	0.655000	0.94253	GCG	ELMO1	-	pfam_DUF3361,superfamily_ARM-type_fold	ENSG00000155849		0.527	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMO1	HGNC	protein_coding	OTTHUMT00000219830.4	-	0.00	60	0	G	NM_130442		37264526	-1	tier1	-	no_errors	ENST00000310758	ensembl	human	known	74_37	missense	23.08	40	12	SNP	1.000	A
LAMB4	22798	genome.wustl.edu	37	7	107677352	107677352	+	Intron	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr7:107677352G>A	ENST00000388781.3	-	30	4763				LAMB4_ENST00000388780.3_Intron|LAMB4_ENST00000483484.1_Intron|AC005048.1_ENST00000401266.1_RNA|LAMB4_ENST00000205386.4_Intron	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4						cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						ggcaaaaaccgcaattccttt	0.353																																																	0																																										SO:0001627	intron_variant	0			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.4679+480C>T	7.37:g.107677352G>A			A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	RNA	SNP	-	NULL	ENST00000388781.3	37	NULL	CCDS34732.1	7																																																																																			AC005048.1	-	-	ENSG00000216085		0.353	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216085	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000337442.1	-	0.00	19	0	G	XM_209857		107677352	-1	tier1	-	no_errors	ENST00000401266	ensembl	human	novel	74_37	rna	25.93	20	7	SNP	0.001	A
RP11-764K9.1	0	genome.wustl.edu	37	9	68400246	68400246	+	lincRNA	SNP	C	C	T	rs74763289	byFrequency	TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr9:68400246C>T	ENST00000417843.2	-	0	1573																											GCACCTGTTACGCCATGCTTG	0.498																																																	0																																												0																															9.37:g.68400246C>T				RNA	SNP	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-	ENSG00000225411		0.498	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2	-	0.00	14	0	C			68400246	-1	tier1	rs74763289	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	55.56	4	5	SNP	0.004	T
EPHB2	2048	genome.wustl.edu	37	1	23189635	23189635	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:23189635G>A	ENST00000400191.3	+	4	935	c.917G>A	c.(916-918)cGc>cAc	p.R306H	EPHB2_ENST00000374630.3_Missense_Mutation_p.R306H|EPHB2_ENST00000465676.1_3'UTR|MIR4253_ENST00000581187.1_RNA|EPHB2_ENST00000374632.3_Missense_Mutation_p.R306H|EPHB2_ENST00000544305.1_Missense_Mutation_p.R306H|EPHB2_ENST00000374627.1_Missense_Mutation_p.R300H	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	306	Cys-rich.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		TGTGTCTGCCGCAATGGCTAC	0.602																																																	0													98.0	90.0	93.0					1																	23189635		2203	4300	6503	SO:0001583	missense	0			AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.917G>A	1.37:g.23189635G>A	ENSP00000383053:p.Arg306His		O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R306H	ENST00000400191.3	37	c.917		1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663021	0.67700	.	.	ENSG00000133216	ENST00000374625;ENST00000544305;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	D;D;D;D;D	0.97455	-4.37;-4.35;-4.35;-4.35;-4.39	4.97	4.97	0.65823	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.95519	0.8544	L	0.61387	1.9	0.58432	D	0.999997	B;B;B;B	0.28850	0.225;0.051;0.051;0.085	B;B;B;B	0.25614	0.001;0.035;0.035;0.062	D	0.94145	0.7400	10	0.36615	T	0.2	.	16.9656	0.86285	0.0:0.0:1.0:0.0	.	306;306;324;306	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	H	306;306;306;306;306;300	ENSP00000444174:R306H;ENSP00000363761:R306H;ENSP00000383053:R306H;ENSP00000363763:R306H;ENSP00000363758:R300H	ENSP00000363755:R306H	R	+	2	0	EPHB2	23062222	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.657000	0.98554	2.582000	0.87167	0.561000	0.74099	CGC	EPHB2	-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_Growth_fac_rcpt_N_dom	ENSG00000133216		0.602	EPHB2-001	KNOWN	basic	protein_coding	EPHB2	HGNC	protein_coding	OTTHUMT00000008060.2	-	0.00	59	0	G	NM_017449		23189635	+1	tier1	-	no_errors	ENST00000400191	ensembl	human	known	74_37	missense	20.48	66	17	SNP	1.000	A
ERBB4	2066	genome.wustl.edu	37	2	212288964	212288964	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:212288964C>A	ENST00000342788.4	-	23	3092	c.2782G>T	c.(2782-2784)Gaa>Taa	p.E928*	ERBB4_ENST00000436443.1_Nonsense_Mutation_p.E928*|ERBB4_ENST00000402597.1_Nonsense_Mutation_p.E918*	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	928	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.E928*(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	TCAGGGATTTCTCGCGTTGGA	0.383										TSP Lung(8;0.080)																																							1	Substitution - Nonsense(1)	large_intestine(1)											109.0	107.0	108.0					2																	212288964		2203	4300	6503	SO:0001587	stop_gained	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.2782G>T	2.37:g.212288964C>A	ENSP00000342235:p.Glu928*		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Nonsense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E928*	ENST00000342788.4	37	c.2782	CCDS2394.1	2	.	.	.	.	.	.	.	.	.	.	C	40	8.496525	0.98836	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	.	.	.	6.16	6.16	0.99307	.	0.093035	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	.	.	.	X	928;928;918	.	ENSP00000342235:E928X	E	-	1	0	ERBB4	211997209	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	GAA	ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000178568		0.383	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1	-	0.00	52	0	C	NM_001042599		212288964	-1	tier1	-	no_errors	ENST00000342788	ensembl	human	known	74_37	nonsense	5.41	70	4	SNP	1.000	A
ESPL1	9700	genome.wustl.edu	37	12	53685797	53685797	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr12:53685797G>A	ENST00000257934.4	+	27	5812	c.5721G>A	c.(5719-5721)atG>atA	p.M1907I	ESPL1_ENST00000552462.1_Missense_Mutation_p.M1907I	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1907					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						GGGAAAGCATGCCCAGCCTCC	0.572																																					Colon(53;1069 1201 2587 5382)												0													77.0	74.0	75.0					12																	53685797		2203	4300	6503	SO:0001583	missense	0			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.5721G>A	12.37:g.53685797G>A	ENSP00000257934:p.Met1907Ile			Missense_Mutation	SNP	pfam_Peptidase_C50,superfamily_DsrEFH-like	p.M1907I	ENST00000257934.4	37	c.5721	CCDS8852.1	12	.	.	.	.	.	.	.	.	.	.	G	1.078	-0.667785	0.03428	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.09630	2.96;2.96	4.55	-0.809	0.10864	.	0.303319	0.39909	N	0.001229	T	0.02494	0.0076	N	0.03930	-0.32	0.22389	N	0.999141	B	0.02656	0.0	B	0.04013	0.001	T	0.39165	-0.9627	10	0.02654	T	1	.	1.8186	0.03105	0.2537:0.3545:0.2661:0.1257	.	1907	Q14674	ESPL1_HUMAN	I	1907;1582;1907	ENSP00000257934:M1907I;ENSP00000449831:M1907I	ENSP00000257934:M1907I	M	+	3	0	ESPL1	51972064	0.629000	0.27146	0.997000	0.53966	0.997000	0.91878	-0.250000	0.08830	0.018000	0.15052	0.650000	0.86243	ATG	ESPL1	-	pfam_Peptidase_C50	ENSG00000135476		0.572	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPL1	HGNC	protein_coding	OTTHUMT00000406899.2	-	0.00	30	0	G	NM_012291		53685797	+1	tier1	-	no_errors	ENST00000257934	ensembl	human	known	74_37	missense	10.00	45	5	SNP	0.952	A
FAM138B	654412	genome.wustl.edu	37	2	114335612	114335612	+	lincRNA	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:114335612G>A	ENST00000432583.2	+	0	415									family with sequence similarity 138, member B																		ggcctcaagcgatcctcccac	0.438																																																	0																																												0					2q13	2013-01-30			ENSG00000226516	ENSG00000226516		"""Long non-coding RNAs"""	33582	non-coding RNA	RNA, long non-coding						11779631, 15233989	Standard	NR_026821		Approved	F379	uc002tjz.3		OTTHUMG00000047820		2.37:g.114335612G>A				RNA	SNP	-	NULL	ENST00000432583.2	37	NULL		2																																																																																			FAM138B	-	-	ENSG00000226516		0.438	FAM138B-002	KNOWN	basic	lincRNA	FAM138B	HGNC	lincRNA	OTTHUMT00000109027.3	-	0.00	47	0	G	NR_026821		114335612	+1	tier1	-	no_errors	ENST00000432583	ensembl	human	known	74_37	rna	18.00	41	9	SNP	0.017	A
FAM166B	730112	genome.wustl.edu	37	9	35562675	35562677	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	TCA	TCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr9:35562675_35562677delTCA	ENST00000399742.2	-	4	583_585	c.513_515delTGA	c.(511-516)gatgac>gac	p.171_172DD>D	FAM166B_ENST00000492890.1_5'UTR	NM_001099951.2|NM_001164310.1	NP_001093421.1|NP_001157782.1	A8MTA8	F166B_HUMAN	family with sequence similarity 166, member B	171										kidney(3)|large_intestine(1)|lung(4)|ovary(1)	9						AGGGTCCCTGTCATCCATGGAGT	0.586																																																	0																																										SO:0001651	inframe_deletion	0			BC129999	CCDS47963.1, CCDS56572.1	9p13.3	2008-06-10			ENSG00000215187	ENSG00000215187			34242	protein-coding gene	gene with protein product							Standard	NM_001099951		Approved		uc010mkr.3	A8MTA8	OTTHUMG00000019858	ENST00000399742.2:c.513_515delTGA	9.37:g.35562675_35562677delTCA	ENSP00000382646:p.Asp172del		A1L3B2|B7ZBJ0	In_Frame_Del	DEL	pfam_UPF0573/UPF0605	p.D172in_frame_del	ENST00000399742.2	37	c.515_513	CCDS56572.1	9																																																																																			FAM166B	-	NULL	ENSG00000215187		0.586	FAM166B-005	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM166B	HGNC	protein_coding	OTTHUMT00000336563.1		0.00	30	0	TCA	NM_001099951		35562677	-1	tier1		no_errors	ENST00000447837	ensembl	human	known	74_37	in_frame_del	6.06	31	2	DEL	0.999:1.000:1.000	-
FAM26D	221301	genome.wustl.edu	37	6	116875427	116875427	+	Silent	SNP	G	G	A	rs7762318	byFrequency	TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr6:116875427G>A	ENST00000368596.3	+	1	515	c.471G>A	c.(469-471)ctG>ctA	p.L157L	FAM26D_ENST00000368597.2_Intron|FAM26D_ENST00000416171.2_Intron|FAM26D_ENST00000405399.1_Silent_p.L14L			Q5JW98	FA26D_HUMAN	family with sequence similarity 26, member D	157					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				endometrium(1)|lung(5)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0458)|OV - Ovarian serous cystadenocarcinoma(136;0.0694)|Epithelial(106;0.222)		AAGAGATCCTGGCTGGGTTTC	0.438													A|||	3218	0.642572	0.4198	0.7349	5008	,	,		21800	0.8978		0.6123	False		,,,				2504	0.6462																0																																										SO:0001819	synonymous_variant	0			AK056801	CCDS5109.1, CCDS59032.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000164451	ENSG00000164451			21094	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 78"""	C6orf78			Standard	NM_153036		Approved	FLJ32239	uc010ked.4	Q5JW98	OTTHUMG00000015443	ENST00000368596.3:c.471G>A	6.37:g.116875427G>A			B0QZ25|B0QZ27|B4DTQ0|Q96MK0	Silent	SNP	NULL	p.L157	ENST00000368596.3	37	c.471		6																																																																																			FAM26D	-	NULL	ENSG00000164451		0.438	FAM26D-002	KNOWN	basic|appris_principal	protein_coding	FAM26D	HGNC	protein_coding	OTTHUMT00000041958.1		0.00	30	0	G	NM_153036		116875427	+1			no_errors	ENST00000368596	ensembl	human	known	74_37	silent	6.52	43	3	SNP	0.783	A
FBN1	2200	genome.wustl.edu	37	15	48712961	48712961	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr15:48712961C>A	ENST00000316623.5	-	63	8197	c.7742G>T	c.(7741-7743)tGc>tTc	p.C2581F		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2581	EGF-like 45; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.		C -> F (in MFS). {ECO:0000269|PubMed:11700157}.		extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GATGTTCTGGCAGCCATGCTG	0.547																																																	0			GRCh37	CM013942|CM077269	FBN1	M							87.0	75.0	79.0					15																	48712961		2198	4296	6494	SO:0001583	missense	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.7742G>T	15.37:g.48712961C>A	ENSP00000325527:p.Cys2581Phe		B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.C2581F	ENST00000316623.5	37	c.7742	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	C	32	5.175632	0.94807	.	.	ENSG00000166147	ENST00000316623	D	0.99445	-5.91	5.99	5.99	0.97316	EGF-like calcium-binding, conserved site (1);Growth factor, receptor (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99768	0.9905	H	0.97265	3.97	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	D	0.97346	0.9960	10	0.87932	D	0	.	20.0728	0.97731	0.0:1.0:0.0:0.0	.	2581	P35555	FBN1_HUMAN	F	2581	ENSP00000325527:C2581F	ENSP00000325527:C2581F	C	-	2	0	FBN1	46500253	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.840000	0.97914	0.655000	0.94253	TGC	FBN1	-	pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom	ENSG00000166147		0.547	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	-	0.00	15	0	C			48712961	-1	tier1	-	no_errors	ENST00000316623	ensembl	human	known	74_37	missense	17.39	19	4	SNP	1.000	A
FCRL3	115352	genome.wustl.edu	37	1	157665905	157665905	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:157665905C>T	ENST00000368184.3	-	7	1348	c.1057G>A	c.(1057-1059)Gca>Aca	p.A353T	RP11-367J7.3_ENST00000453692.1_RNA|FCRL3_ENST00000473231.1_5'UTR|FCRL3_ENST00000368186.5_Missense_Mutation_p.A353T	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	353	Ig-like C2-type 4.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					TATCTCCCTGCATCACTCTCC	0.512																																																	0													140.0	121.0	127.0					1																	157665905		2203	4300	6503	SO:0001583	missense	0			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.1057G>A	1.37:g.157665905C>T	ENSP00000357167:p.Ala353Thr		A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A353T	ENST00000368184.3	37	c.1057	CCDS1167.1	1	.	.	.	.	.	.	.	.	.	.	C	18.88	3.717504	0.68844	.	.	ENSG00000160856	ENST00000368186;ENST00000368184;ENST00000292392	T;T	0.14766	2.48;2.48	5.44	0.33	0.15929	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.610818	0.14415	N	0.321037	T	0.14442	0.0349	M	0.81112	2.525	0.09310	N	1	D;P;D	0.59767	0.986;0.786;0.958	P;P;P	0.62014	0.897;0.874;0.835	T	0.04885	-1.0920	10	0.41790	T	0.15	.	4.1764	0.10353	0.1506:0.5182:0.0:0.3311	.	353;258;353	Q96P31;D3DVD1;Q96P31-6	FCRL3_HUMAN;.;.	T	353	ENSP00000357169:A353T;ENSP00000357167:A353T	ENSP00000292392:A353T	A	-	1	0	FCRL3	155932529	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	-0.010000	0.12743	-0.188000	0.10499	-0.311000	0.09066	GCA	FCRL3	-	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000160856		0.512	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	FCRL3	HGNC	protein_coding	OTTHUMT00000051419.2	-	0.00	36	0	C	NM_052939		157665905	-1	tier1	-	no_errors	ENST00000492769	ensembl	human	known	74_37	missense	34.15	27	14	SNP	0.000	T
FIZ1	84922	genome.wustl.edu	37	19	56104860	56104860	+	Silent	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:56104860C>T	ENST00000221665.3	-	3	536	c.447G>A	c.(445-447)gcG>gcA	p.A149A	FIZ1_ENST00000592585.1_3'UTR	NM_032836.2	NP_116225.2	Q96SL8	FIZ1_HUMAN	FLT3-interacting zinc finger 1	149					positive regulation of protein phosphorylation (GO:0001934)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		CGGAGCAGGGCGCACTCAAGG	0.756																																																	0													5.0	8.0	7.0					19																	56104860		1805	3420	5225	SO:0001819	synonymous_variant	0			AK027674	CCDS12928.1	19q13.42	2013-01-08				ENSG00000179943		"""Zinc fingers, C2H2-type"""	25917	protein-coding gene	gene with protein product		609133				12566383	Standard	NM_032836		Approved	FLJ14768, ZNF798	uc002qli.4	Q96SL8		ENST00000221665.3:c.447G>A	19.37:g.56104860C>T			A2RU72|Q6ZMJ7	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A149	ENST00000221665.3	37	c.447	CCDS12928.1	19																																																																																			FIZ1	-	NULL	ENSG00000179943		0.756	FIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIZ1	HGNC	protein_coding	OTTHUMT00000453350.1	-	0.00	47	0	C	NM_032836		56104860	-1	tier1	-	no_errors	ENST00000221665	ensembl	human	known	74_37	silent	23.64	42	13	SNP	0.071	T
FLYWCH1	84256	genome.wustl.edu	37	16	2998732	2998732	+	3'UTR	SNP	G	G	A	rs557198078		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr16:2998732G>A	ENST00000253928.9	+	0	2560				FLYWCH1_ENST00000570752.1_3'UTR|FLYWCH1_ENST00000399667.2_3'UTR|LA16c-321D4.2_ENST00000573260.1_RNA|FLYWCH1_ENST00000416288.2_3'UTR			Q4VC44	FWCH1_HUMAN	FLYWCH-type zinc finger 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|lung(3)	4						CCAGTGAGGCGATGTGGGCAG	0.502																																																	0													63.0	73.0	70.0					16																	2998732		2077	4215	6292	SO:0001624	3_prime_UTR_variant	0			AL136585	CCDS45390.1	16p13.3	2013-01-10	2007-06-21	2007-06-21	ENSG00000059122	ENSG00000059122		"""Zinc fingers"""	25404	protein-coding gene	gene with protein product						11230166, 10997877	Standard	XM_006720959		Approved	DKFZp761A132	uc002csc.3	Q4VC44		ENST00000253928.9:c.*4G>A	16.37:g.2998732G>A			D3DUA1|Q6ZSQ1|Q8WV62|Q9BQG6|Q9BUS5|Q9HCM0	RNA	SNP	-	NULL	ENST00000253928.9	37	NULL		16																																																																																			FLYWCH1	-	-	ENSG00000059122		0.502	FLYWCH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	FLYWCH1	HGNC	protein_coding	OTTHUMT00000436479.1	-	0.00	49	0	G	NM_032296		2998732	+1	tier1	-	no_errors	ENST00000570752	ensembl	human	known	74_37	rna	25.97	57	20	SNP	0.000	A
FOPNL	123811	genome.wustl.edu	37	16	15961369	15961369	+	Missense_Mutation	SNP	G	G	T	rs60244915	byFrequency	TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr16:15961369G>T	ENST00000255759.6	-	5	482	c.453C>A	c.(451-453)gaC>gaA	p.D151E	FOPNL_ENST00000575073.1_3'UTR|FOPNL_ENST00000573429.1_Missense_Mutation_p.D175E|FOPNL_ENST00000575744.1_Missense_Mutation_p.D85E|FOPNL_ENST00000573396.1_3'UTR|FOPNL_ENST00000573968.1_Missense_Mutation_p.D77E	NM_144600.2	NP_653201.1	Q96NB1	FOPNL_HUMAN	FGFR1OP N-terminal like	151					cilium assembly (GO:0042384)|microtubule anchoring (GO:0034453)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.D151D(1)		breast(1)|large_intestine(1)|lung(5)|stomach(4)	11						TTCTTAGGTGGTCATCTGAAA	0.348																																																	1	Substitution - coding silent(1)	stomach(1)											121.0	98.0	106.0					16																	15961369		2197	4300	6497	SO:0001583	missense	0			AL832498	CCDS10567.1	16p13.11	2011-03-18	2011-03-18	2011-03-18	ENSG00000133393	ENSG00000133393			26435	protein-coding gene	gene with protein product	"""pluripotent embryonic stem cell-related protein"", ""FOP-related protein of 20 kDa"""		"""chromosome 16 open reading frame 63"""	C16orf63		12477932	Standard	NM_144600		Approved	DKFZp686N1651, FLJ31153, PHSECRG2, FOR20	uc002dec.1	Q96NB1	OTTHUMG00000129923	ENST00000255759.6:c.453C>A	16.37:g.15961369G>T	ENSP00000255759:p.Asp151Glu		B3KPU9	Missense_Mutation	SNP	pfam_FOP_dimerisation-dom_N,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.D151E	ENST00000255759.6	37	c.453	CCDS10567.1	16	.	.	.	.	.	.	.	.	.	.	G	10.78	1.446928	0.25987	.	.	ENSG00000133393	ENST00000255759	.	.	.	4.93	-9.86	0.00473	.	1.257920	0.05225	N	0.509218	T	0.13372	0.0324	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.19289	-1.0310	9	0.02654	T	1	-33.874	5.8307	0.18579	0.0869:0.1725:0.4837:0.2569	.	77;151	B3KPU9;Q96NB1	.;FOPNL_HUMAN	E	151	.	ENSP00000255759:D151E	D	-	3	2	FOPNL	15868870	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.722000	0.01868	-2.361000	0.00609	-4.005000	0.00013	GAC	FOPNL	-	NULL	ENSG00000133393		0.348	FOPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOPNL	HGNC	protein_coding	OTTHUMT00000252177.2		0.00	27	0	G	NM_144600		15961369	-1			no_errors	ENST00000255759	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.000	T
FRMD6	122786	genome.wustl.edu	37	14	52194517	52194517	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr14:52194517G>T	ENST00000344768.5	+	14	1835	c.1639G>T	c.(1639-1641)Gac>Tac	p.D547Y	FRMD6_ENST00000553556.1_Missense_Mutation_p.D189Y|FRMD6_ENST00000554167.1_Missense_Mutation_p.D470Y|FRMD6_ENST00000395718.2_Missense_Mutation_p.D539Y|FRMD6_ENST00000356218.4_Missense_Mutation_p.D539Y			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	547					apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					GAGCCTCGATGACATCAGACT	0.463																																																	0													164.0	138.0	147.0					14																	52194517		2203	4300	6503	SO:0001583	missense	0			BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.1639G>T	14.37:g.52194517G>T	ENSP00000343899:p.Asp547Tyr		D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.D547Y	ENST00000344768.5	37	c.1639	CCDS58318.1	14	.	.	.	.	.	.	.	.	.	.	G	26.4	4.736432	0.89482	.	.	ENSG00000139926	ENST00000356218;ENST00000395718;ENST00000344768;ENST00000554167;ENST00000553556	D;D;D;D	0.88354	-2.37;-2.37;-2.14;-1.97	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.93572	0.7948	L	0.55481	1.735	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.992;0.996	D	0.93456	0.6806	10	0.87932	D	0	.	20.017	0.97481	0.0:0.0:1.0:0.0	.	470;547;539	G3V4T7;Q96NE9;Q96NE9-2	.;FRMD6_HUMAN;.	Y	539;539;547;470;189	ENSP00000348550:D539Y;ENSP00000379068:D539Y;ENSP00000343899:D547Y;ENSP00000451977:D470Y	ENSP00000343899:D547Y	D	+	1	0	FRMD6	51264267	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	9.869000	0.99810	2.832000	0.97577	0.655000	0.94253	GAC	FRMD6	-	NULL	ENSG00000139926		0.463	FRMD6-002	KNOWN	basic|CCDS	protein_coding	FRMD6	HGNC	protein_coding	OTTHUMT00000276881.1	-	0.00	40	0	G	NM_152330		52194517	+1	tier1	-	no_errors	ENST00000344768	ensembl	human	known	74_37	missense	9.84	55	6	SNP	1.000	T
FSIP1	161835	genome.wustl.edu	37	15	40057884	40057884	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr15:40057884A>G	ENST00000350221.3	-	4	583	c.374T>C	c.(373-375)cTt>cCt	p.L125P		NM_152597.4	NP_689810.3	Q8NA03	FSIP1_HUMAN	fibrous sheath interacting protein 1	125										NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	23		all_cancers(109;2.66e-19)|all_epithelial(112;2.66e-16)|Lung NSC(122;1.5e-11)|all_lung(180;4.03e-10)|Melanoma(134;0.0575)|Ovarian(310;0.0827)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;8.22e-06)|BRCA - Breast invasive adenocarcinoma(123;0.142)		TATTTTATCAAGTTTTTTCAT	0.289																																																	0													95.0	96.0	96.0					15																	40057884		2201	4298	6499	SO:0001583	missense	0			BC045191	CCDS10050.1	15q14	2012-11-19			ENSG00000150667	ENSG00000150667			21674	protein-coding gene	gene with protein product		615795				14702039	Standard	NM_152597		Approved	FLJ35989	uc001zki.3	Q8NA03	OTTHUMG00000172456	ENST00000350221.3:c.374T>C	15.37:g.40057884A>G	ENSP00000280236:p.Leu125Pro		Q6X2C8|Q86Y89	Missense_Mutation	SNP	NULL	p.L125P	ENST00000350221.3	37	c.374	CCDS10050.1	15	.	.	.	.	.	.	.	.	.	.	A	18.43	3.621421	0.66787	.	.	ENSG00000150667	ENST00000350221	T	0.67865	-0.29	5.66	5.66	0.87406	.	0.000000	0.56097	D	0.000036	T	0.81173	0.4767	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82287	-0.0532	9	.	.	.	-10.372	13.4127	0.60952	1.0:0.0:0.0:0.0	.	125	Q8NA03	FSIP1_HUMAN	P	125	ENSP00000280236:L125P	.	L	-	2	0	FSIP1	37845176	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	6.006000	0.70724	2.153000	0.67306	0.459000	0.35465	CTT	FSIP1	-	NULL	ENSG00000150667		0.289	FSIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSIP1	HGNC	protein_coding	OTTHUMT00000252118.2	-	0.00	86	0	A	NM_152597		40057884	-1	tier1	-	no_errors	ENST00000350221	ensembl	human	known	74_37	missense	21.88	125	35	SNP	1.000	G
FZD2	2535	genome.wustl.edu	37	17	42635995	42635995	+	Silent	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr17:42635995C>T	ENST00000315323.3	+	1	1071	c.939C>T	c.(937-939)gaC>gaT	p.D313D		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	313					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TCTCCGAGGACGGTTACCGCA	0.597																																																	0													71.0	66.0	67.0					17																	42635995		2203	4300	6503	SO:0001819	synonymous_variant	0			L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.939C>T	17.37:g.42635995C>T			Q0VG82	Silent	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.D313	ENST00000315323.3	37	c.939	CCDS11484.1	17																																																																																			FZD2	-	pfam_Frizzled,pfscan_GPCR_2-like	ENSG00000180340		0.597	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD2	HGNC	protein_coding	OTTHUMT00000457806.1	-	0.00	51	0	C	NM_001466		42635995	+1	tier1	-	no_errors	ENST00000315323	ensembl	human	known	74_37	silent	17.57	61	13	SNP	1.000	T
GALNT10	55568	genome.wustl.edu	37	5	153674404	153674404	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr5:153674404T>G	ENST00000297107.6	+	2	325	c.188T>G	c.(187-189)tTt>tGt	p.F63C	GALNT10_ENST00000377661.2_Missense_Mutation_p.F63C|GALNT10_ENST00000425427.2_Missense_Mutation_p.F63C	NM_198321.3	NP_938080.1	Q86SR1	GLT10_HUMAN	polypeptide N-acetylgalactosaminyltransferase 10	63					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	32	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			AAGAAAACGTTTTTCTTGGGA	0.498																																																	0													88.0	84.0	85.0					5																	153674404		2203	4300	6503	SO:0001583	missense	0			AK023782	CCDS4325.1	5q34	2014-03-13	2014-03-13		ENSG00000164574	ENSG00000164574	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19873	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 10"""	608043	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)"""			12417297	Standard	NM_198321		Approved	GalNAc-T10	uc003lvh.3	Q86SR1	OTTHUMG00000130145	ENST00000297107.6:c.188T>G	5.37:g.153674404T>G	ENSP00000297107:p.Phe63Cys		B3KXC9|Q6IN56|Q86VP8|Q8IXJ2|Q8TEJ2|Q96IV2|Q9H8E1|Q9Y4M4	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.F63C	ENST00000297107.6	37	c.188	CCDS4325.1	5	.	.	.	.	.	.	.	.	.	.	T	14.00	2.405020	0.42613	.	.	ENSG00000164574	ENST00000425427;ENST00000297107;ENST00000377661	T;T;T	0.56611	0.67;0.45;0.53	5.32	2.92	0.33932	.	0.541572	0.15568	U	0.255619	T	0.46814	0.1412	M	0.62088	1.915	0.09310	N	1	B;P	0.38711	0.291;0.643	B;B	0.37346	0.125;0.247	T	0.33394	-0.9870	10	0.38643	T	0.18	.	8.0849	0.30767	0.0:0.2706:0.0:0.7294	.	63;63	Q86SR1;Q86SR1-3	GLT10_HUMAN;.	C	63	ENSP00000415210:F63C;ENSP00000297107:F63C;ENSP00000366889:F63C	ENSP00000297107:F63C	F	+	2	0	GALNT10	153654597	0.089000	0.21612	0.028000	0.17463	0.556000	0.35491	0.658000	0.24979	0.978000	0.38470	0.528000	0.53228	TTT	GALNT10	-	NULL	ENSG00000164574		0.498	GALNT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT10	HGNC	protein_coding	OTTHUMT00000252453.1	-	0.00	38	0	T	NM_198321		153674404	+1	tier1	-	no_errors	ENST00000297107	ensembl	human	known	74_37	missense	8.33	66	6	SNP	0.002	G
GABRA1	2554	genome.wustl.edu	37	5	161292738	161292738	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr5:161292738G>A	ENST00000428797.2	+	5	554	c.199G>A	c.(199-201)Gaa>Aaa	p.E67K	GABRA1_ENST00000393943.4_Missense_Mutation_p.E67K|GABRA1_ENST00000444819.1_Missense_Mutation_p.E67K|GABRA1_ENST00000437025.2_Missense_Mutation_p.E67K|GABRA1_ENST00000420560.1_Missense_Mutation_p.E67K|GABRA1_ENST00000023897.6_Missense_Mutation_p.E67K	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	67					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	GCGTGTAACCGAAGTGAAGAC	0.423																																																	0													197.0	175.0	183.0					5																	161292738		2203	4300	6503	SO:0001583	missense	0				CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.199G>A	5.37:g.161292738G>A	ENSP00000393097:p.Glu67Lys		D3DQK6|Q8N629	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa1_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.E67K	ENST00000428797.2	37	c.199	CCDS4357.1	5	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349975	0.61183	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000521339;ENST00000420560;ENST00000522651;ENST00000444819;ENST00000519621	T;T;T;T;T;T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2;-1.12;-1.2;-1.12;-1.2;-1.2	5.33	5.33	0.75918	Neurotransmitter-gated ion-channel ligand-binding (3);	0.129460	0.52532	D	0.000077	T	0.72914	0.3520	L	0.48935	1.535	0.80722	D	1	B	0.18310	0.027	B	0.21708	0.036	T	0.67488	-0.5658	10	0.14656	T	0.56	.	19.0266	0.92934	0.0:0.0:1.0:0.0	.	67	P14867	GBRA1_HUMAN	K	67;67;67;67;73;67;67;67;67	ENSP00000023897:E67K;ENSP00000393097:E67K;ENSP00000377517:E67K;ENSP00000415441:E67K;ENSP00000430895:E73K;ENSP00000408041:E67K;ENSP00000430507:E67K;ENSP00000414232:E67K;ENSP00000430435:E67K	ENSP00000023897:E67K	E	+	1	0	GABRA1	161225316	1.000000	0.71417	0.984000	0.44739	0.820000	0.46376	7.890000	0.87313	2.487000	0.83934	0.557000	0.71058	GAA	GABRA1	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,prints_GABBAg_rcpt,tigrfam_Neur_channel	ENSG00000022355		0.423	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA1	HGNC	protein_coding	OTTHUMT00000252702.2	-	0.00	20	0	G	NM_000806.5		161292738	+1	tier1	-	no_errors	ENST00000023897	ensembl	human	known	74_37	missense	34.21	25	13	SNP	1.000	A
GOLGA8DP	100132979	genome.wustl.edu	37	15	22709212	22709212	+	RNA	SNP	G	G	C			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr15:22709212G>C	ENST00000314246.8	-	0	1184				RN7SL545P_ENST00000495815.2_RNA			Q0D2H9	GOG8D_HUMAN	golgin A8 family, member D, pseudogene							Golgi apparatus (GO:0005794)											AGAGGGCACTGCTGGGGGCTC	0.517																																																	0																																												0					15q11.2	2014-04-10	2011-04-15	2010-02-12	ENSG00000185182	ENSG00000185182			32376	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8D"""	GOLGA8D		12477932	Standard	NR_027407		Approved		uc010axw.2	Q0D2H9	OTTHUMG00000171882		15.37:g.22709212G>C				RNA	SNP	-	NULL	ENST00000314246.8	37	NULL		15	.	.	.	.	.	.	.	.	.	.	G	2.702	-0.270807	0.05716	.	.	ENSG00000185182	ENST00000341390;ENST00000314246;ENST00000317692	.	.	.	0.887	-0.111	0.13576	.	.	.	.	.	T	0.55226	0.1907	.	.	.	0.30915	N	0.728604	D	0.71674	0.998	D	0.63488	0.915	T	0.58352	-0.7651	6	0.40728	T	0.16	.	5.1161	0.14834	0.2413:0.0:0.7587:0.0	.	96	F8WBT8	.	G	96;96;314	.	ENSP00000327024:A96G	A	-	2	0	AC116165.1	20260576	0.026000	0.19158	0.001000	0.08648	0.016000	0.09150	0.857000	0.27831	-0.042000	0.13535	0.162000	0.16502	GCA	GOLGA8DP	-	-	ENSG00000185182		0.517	GOLGA8DP-002	KNOWN	basic	processed_transcript	GOLGA8DP	HGNC	pseudogene	OTTHUMT00000415613.1	-	0.00	110	0	G	NR_027407		22709212	-1	tier1	-	no_errors	ENST00000314246	ensembl	human	known	74_37	rna	21.68	112	31	SNP	0.425	C
GOLGA8T	653075	genome.wustl.edu	37	15	30433079	30433079	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr15:30433079A>C	ENST00000569052.1	+	9	626	c.626A>C	c.(625-627)aAg>aCg	p.K209T	RN7SL469P_ENST00000491512.2_RNA					golgin A8 family, member T																		ACGGAGTGGAAGTTAGAGCAG	0.527																																																	0																																										SO:0001583	missense	0					15q13.2	2013-01-17			ENSG00000261247	ENSG00000261247			44410	other	unknown							Standard	NR_033933		Approved		uc021sha.1		OTTHUMG00000175638	ENST00000569052.1:c.626A>C	15.37:g.30433079A>C	ENSP00000455826:p.Lys209Thr			Missense_Mutation	SNP	NULL	p.K209T	ENST00000569052.1	37	c.626		15																																																																																			GOLGA8T	-	NULL	ENSG00000261247		0.527	GOLGA8T-001	NOVEL	basic|appris_principal	protein_coding	GOLGA8T	HGNC	protein_coding	OTTHUMT00000430690.1	-	0.00	100	0	A	NR_033933		30433079	+1	tier1	-	no_errors	ENST00000569052	ensembl	human	novel	74_37	missense	22.49	162	47	SNP	0.003	C
GORASP1	64689	genome.wustl.edu	37	3	39140516	39140516	+	Intron	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr3:39140516C>T	ENST00000319283.3	-	8	1738				GORASP1_ENST00000476334.1_5'UTR|GORASP1_ENST00000479927.1_Intron|GORASP1_ENST00000422110.2_Intron	NM_031899.2	NP_114105.1	Q9BQQ3	GORS1_HUMAN	golgi reassembly stacking protein 1, 65kDa						Golgi organization (GO:0007030)|mitotic cell cycle (GO:0000278)|negative regulation of dendrite morphogenesis (GO:0050774)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(1)|ovary(3)|urinary_tract(1)	14				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		CTGGTGATACCCCTCACCCAA	0.552																																																	0																																										SO:0001627	intron_variant	0			AJ409349	CCDS2681.1, CCDS63596.1, CCDS63597.1	3p22-p21.33	2008-04-23	2002-08-29	2002-05-24	ENSG00000114745	ENSG00000114745			16769	protein-coding gene	gene with protein product		606867	"""golgi phosphoprotein 5"""	GOLPH5			Standard	NM_001278789		Approved	GRASP65, P65, FLJ23443	uc003ciw.1	Q9BQQ3	OTTHUMG00000131292	ENST00000319283.3:c.917-132G>A	3.37:g.39140516C>T			B3KWC8|Q3SYG7|Q8N272|Q96H42	RNA	SNP	-	NULL	ENST00000319283.3	37	NULL	CCDS2681.1	3																																																																																			GORASP1	-	-	ENSG00000114745		0.552	GORASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GORASP1	HGNC	protein_coding	OTTHUMT00000254060.1	-	0.00	19	0	C			39140516	-1	tier1	-	no_errors	ENST00000476334	ensembl	human	putative	74_37	rna	18.18	27	6	SNP	0.000	T
GPAT2	150763	genome.wustl.edu	37	2	96689748	96689748	+	Splice_Site	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:96689748G>A	ENST00000434632.1	-	18	2278	c.1819C>T	c.(1819-1821)Ccc>Tcc	p.P607S	FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000453542.1_Splice_Site_p.P536S|GPAT2_ENST00000359548.4_Splice_Site_p.P607S|GPAT2_ENST00000377137.3_Splice_Site_p.P607S			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	607					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						GACTGGCAGGGCTGGGAGAAA	0.612																																																	0													17.0	18.0	18.0					2																	96689748		1902	4102	6004	SO:0001630	splice_region_variant	0			BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.1819-1C>T	2.37:g.96689748G>A			Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Missense_Mutation	SNP	smart_Plipid/glycerol_acylTrfase	p.P607S	ENST00000434632.1	37	c.1819	CCDS42714.1	2	.	.	.	.	.	.	.	.	.	.	g	20.2	3.945175	0.73672	.	.	ENSG00000186281	ENST00000359548;ENST00000434632;ENST00000453542;ENST00000377137	D;D;T;D	0.87334	-2.24;-2.24;-1.42;-2.19	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	D	0.92140	0.7508	M	0.65975	2.015	0.50467	D	0.999878	D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;0.996	D;D;D;D;D	0.97110	0.994;0.999;1.0;0.999;0.985	D	0.92843	0.6290	10	0.87932	D	0	.	13.7077	0.62651	0.0:0.0:1.0:0.0	.	536;607;613;607;536	E9PE95;Q6NUI2-3;Q6NUI2-4;Q6NUI2;B4DNZ9	.;.;.;GPAT2_HUMAN;.	S	607;607;536;607	ENSP00000352547:P607S;ENSP00000389395:P607S;ENSP00000393770:P536S;ENSP00000366341:P607S	ENSP00000352547:P607S	P	-	1	0	GPAT2	96053475	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	6.752000	0.74898	2.316000	0.78162	0.637000	0.83480	CCC	GPAT2	-	NULL	ENSG00000186281		0.612	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAT2	HGNC	protein_coding	OTTHUMT00000338786.1	-	0.00	52	0	G	NM_207328	Missense_Mutation	96689748	-1	tier1	-	no_errors	ENST00000359548	ensembl	human	known	74_37	missense	22.00	39	11	SNP	1.000	A
GPR139	124274	genome.wustl.edu	37	16	20043988	20043988	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr16:20043988T>G	ENST00000570682.1	-	2	431	c.131A>C	c.(130-132)aAt>aCt	p.N44T		NM_001002911.2	NP_001002911.1	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	44					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	30						TGTCAAGATATTTGCTGTGGA	0.488																																																	0													41.0	42.0	42.0					16																	20043988		2203	4300	6503	SO:0001583	missense	0			AY255545	CCDS32398.1	16p13.11	2012-08-21						"""GPCR / Class A : Orphans"""	19995	protein-coding gene	gene with protein product						12679517	Standard	XM_005255114		Approved	PGR3	uc002dgu.1	Q6DWJ6		ENST00000570682.1:c.131A>C	16.37:g.20043988T>G	ENSP00000458791:p.Asn44Thr		A8K5R9|Q86SP2|Q8TDU8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.N44T	ENST00000570682.1	37	c.131	CCDS32398.1	16	.	.	.	.	.	.	.	.	.	.	T	18.49	3.634367	0.67130	.	.	ENSG00000180269	ENST00000326571	.	.	.	5.3	5.3	0.74995	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.77738	0.4175	M	0.69523	2.12	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.80625	-0.1299	9	0.87932	D	0	-28.7629	14.7183	0.69286	0.0:0.0:0.0:1.0	.	44	Q6DWJ6	GP139_HUMAN	T	44	.	ENSP00000370779:N44T	N	-	2	0	GPR139	19951489	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.655000	0.83696	2.132000	0.65825	0.460000	0.39030	AAT	GPR139	-	prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000180269		0.488	GPR139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR139	HGNC	protein_coding	OTTHUMT00000438522.1		0.00	21	0	T	NM_001002911		20043988	-1			no_errors	ENST00000570682	ensembl	human	known	74_37	missense	11.11	24	3	SNP	1.000	G
GPR158	57512	genome.wustl.edu	37	10	25890514	25890514	+	3'UTR	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr10:25890514C>T	ENST00000376351.3	+	0	6318				GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158						protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TATATCTTAGCGACATTCTAT	0.368																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.*2311C>T	10.37:g.25890514C>T			Q6QR81|Q9ULT3	RNA	SNP	-	NULL	ENST00000376351.3	37	NULL	CCDS31166.1	10																																																																																			GPR158	-	-	ENSG00000151025		0.368	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	HGNC	protein_coding	OTTHUMT00000047248.2	-	0.00	21	0	C	XM_166110		25890514	+1	tier1	-	no_errors	ENST00000490549	ensembl	human	known	74_37	rna	20.51	31	8	SNP	0.989	T
GRIK2	2898	genome.wustl.edu	37	6	102376297	102376297	+	Silent	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr6:102376297G>A	ENST00000421544.1	+	13	2365	c.1875G>A	c.(1873-1875)gaG>gaA	p.E625E	GRIK2_ENST00000369138.1_Silent_p.E625E|GRIK2_ENST00000369134.4_Silent_p.E576E|GRIK2_ENST00000318991.6_Silent_p.E625E|GRIK2_ENST00000369137.3_Silent_p.E549E|GRIK2_ENST00000413795.1_Silent_p.E625E	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	625					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TAGGTTCTGAGCTCATGCCCA	0.438																																																	0													127.0	111.0	116.0					6																	102376297		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.1875G>A	6.37:g.102376297G>A			A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E625	ENST00000421544.1	37	c.1875	CCDS5048.1	6																																																																																			GRIK2	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000164418		0.438	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK2	HGNC	protein_coding	OTTHUMT00000043718.1	-	0.00	66	0	G			102376297	+1	tier1	-	no_errors	ENST00000421544	ensembl	human	known	74_37	silent	10.94	56	7	SNP	1.000	A
HAUS5	23354	genome.wustl.edu	37	19	36110964	36110964	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:36110964C>T	ENST00000203166.5	+	16	1482	c.1457C>T	c.(1456-1458)gCg>gTg	p.A486V	HAUS5_ENST00000379045.2_3'UTR	NM_015302.1	NP_056117.1	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5	486					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				NS(1)|breast(2)|cervix(3)|endometrium(1)|large_intestine(2)|lung(5)|skin(2)	16						CTGCACCCCGCGTCCCCAAGG	0.667																																																	0													75.0	88.0	84.0					19																	36110964		2019	4171	6190	SO:0001583	missense	0			AB020648	CCDS42550.1	19q13.12	2012-02-22	2009-04-20	2009-04-20	ENSG00000249115	ENSG00000249115		"""HAUS augmin-like complex subunits"""	29130	protein-coding gene	gene with protein product		613432	"""KIAA0841"""	KIAA0841		10048485, 19427217	Standard	NM_015302		Approved	dgt5	uc002oam.1	O94927	OTTHUMG00000048110	ENST00000203166.5:c.1457C>T	19.37:g.36110964C>T	ENSP00000439056:p.Ala486Val		B2RXK1|Q6P2P7|Q7L3D5|Q96CT8	Missense_Mutation	SNP	NULL	p.A486V	ENST00000203166.5	37	c.1457	CCDS42550.1	19	.	.	.	.	.	.	.	.	.	.	C	10.75	1.439574	0.25900	.	.	ENSG00000249115	ENST00000203166	T	0.35973	1.28	4.81	0.324	0.15898	.	1.401800	0.04720	N	0.419097	T	0.28300	0.0699	L	0.50333	1.59	0.09310	N	1	B	0.21520	0.057	B	0.17433	0.018	T	0.23833	-1.0177	10	0.02654	T	1	-1.9637	7.4042	0.26981	0.0:0.5468:0.0:0.4532	.	486	O94927	HAUS5_HUMAN	V	486	ENSP00000439056:A486V	ENSP00000439056:A486V	A	+	2	0	HAUS5	40802804	0.004000	0.15560	0.000000	0.03702	0.004000	0.04260	1.954000	0.40362	0.014000	0.14944	-0.150000	0.13652	GCG	HAUS5	-	NULL	ENSG00000249115		0.667	HAUS5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS5	HGNC	protein_coding	OTTHUMT00000459055.2	-	0.00	59	0	C			36110964	+1	tier1	-	no_errors	ENST00000203166	ensembl	human	known	74_37	missense	13.58	70	11	SNP	0.000	T
GRIK5	2901	genome.wustl.edu	37	19	42507533	42507533	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:42507533G>A	ENST00000262895.3	-	18	2464	c.2465C>T	c.(2464-2466)gCg>gTg	p.A822V	GRIK5_ENST00000301218.4_Missense_Mutation_p.A822V|GRIK5_ENST00000593562.1_Missense_Mutation_p.A822V	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	822					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				TTCCATGACCGCCACGAAGAC	0.597																																																	0													91.0	78.0	82.0					19																	42507533		2203	4300	6503	SO:0001583	missense	0				CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.2465C>T	19.37:g.42507533G>A	ENSP00000262895:p.Ala822Val		Q8WWG8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A822V	ENST00000262895.3	37	c.2465	CCDS12595.1	19	.	.	.	.	.	.	.	.	.	.	G	27.4	4.831420	0.91036	.	.	ENSG00000105737	ENST00000262895;ENST00000301218	T;T	0.15139	2.49;2.45	4.31	4.31	0.51392	.	0.000000	0.64402	D	0.000002	T	0.28532	0.0706	M	0.69823	2.125	0.58432	D	0.999998	D	0.53745	0.962	P	0.47376	0.545	T	0.18209	-1.0344	10	0.87932	D	0	.	15.696	0.77499	0.0:0.0:1.0:0.0	.	822	Q16478	GRIK5_HUMAN	V	822	ENSP00000262895:A822V;ENSP00000301218:A822V	ENSP00000262895:A822V	A	-	2	0	GRIK5	47199373	1.000000	0.71417	0.991000	0.47740	0.972000	0.66771	9.344000	0.97050	2.218000	0.71995	0.561000	0.74099	GCG	GRIK5	-	prints_NMDA_rcpt	ENSG00000105737		0.597	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK5	HGNC	protein_coding	OTTHUMT00000463453.1	-	0.00	40	0	G			42507533	-1	tier1	-	no_errors	ENST00000301218	ensembl	human	known	74_37	missense	25.00	45	15	SNP	1.000	A
HECW2	57520	genome.wustl.edu	37	2	197080605	197080605	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:197080605delT	ENST00000260983.3	-	28	4773	c.4591delA	c.(4591-4593)atcfs	p.I1531fs	snoU13_ENST00000459047.1_RNA|HECW2_ENST00000409111.1_Frame_Shift_Del_p.I1175fs	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1531	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						AGAGCAGTGATTTTCCCCCAT	0.383																																																	0													76.0	76.0	76.0					2																	197080605		2203	4300	6503	SO:0001589	frameshift_variant	0			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.4591delA	2.37:g.197080605delT	ENSP00000260983:p.Ile1531fs		B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Frame_Shift_Del	DEL	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_WW_dom,superfamily_C2_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.I1531fs	ENST00000260983.3	37	c.4591	CCDS33354.1	2																																																																																			HECW2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000138411		0.383	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW2	HGNC	protein_coding	OTTHUMT00000335199.3		0.00	23	0	T	NM_020760		197080605	-1	tier1		no_errors	ENST00000260983	ensembl	human	known	74_37	frame_shift_del	18.37	40	9	DEL	1.000	-
HGFAC	3083	genome.wustl.edu	37	4	3446081	3446081	+	Silent	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr4:3446081C>T	ENST00000382774.3	+	6	757	c.642C>T	c.(640-642)ggC>ggT	p.G214G	HGFAC_ENST00000511533.1_Silent_p.G214G	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	214	Fibronectin type-I. {ECO:0000255|PROSITE- ProRule:PRU00478}.				proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		TGGAGGGGGGCGACCGCTGGG	0.682																																																	0													13.0	16.0	15.0					4																	3446081		2174	4279	6453	SO:0001819	synonymous_variant	0			D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.642C>T	4.37:g.3446081C>T			Q14726|Q2M1W7|Q53X47	Silent	SNP	pirsf_Coagulation_fac_XIIa/HGFA,pfam_Peptidase_S1,pfam_Kringle,pfam_FN_type2_col-bd,pfam_Fibronectin_type1,pfam_EG-like_dom,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,smart_EG-like_dom,smart_Fibronectin_type1,smart_Kringle,smart_Peptidase_S1,pfscan_EG-like_dom,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Kringle,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.G214	ENST00000382774.3	37	c.642	CCDS3369.1	4																																																																																			HGFAC	-	pirsf_Coagulation_fac_XIIa/HGFA,pfam_Fibronectin_type1,smart_Fibronectin_type1,pfscan_Fibronectin_type1	ENSG00000109758		0.682	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGFAC	HGNC	protein_coding	OTTHUMT00000206607.3	-	0.00	34	0	C			3446081	+1	tier1	-	no_errors	ENST00000382774	ensembl	human	known	74_37	silent	20.00	16	4	SNP	0.342	T
HSPG2	3339	genome.wustl.edu	37	1	22155399	22155399	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:22155399C>G	ENST00000374695.3	-	88	12245	c.12166G>C	c.(12166-12168)Ggt>Cgt	p.G4056R	HSPG2_ENST00000486901.1_5'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	4056	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GGCTCCACACCCCCCAGGTAG	0.682																																																	0													34.0	35.0	35.0					1																	22155399		2187	4280	6467	SO:0001583	missense	0			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.12166G>C	1.37:g.22155399C>G	ENSP00000363827:p.Gly4056Arg		Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA_dom,pfscan_Ig-like_dom,prints_LDrepeatLR_classA_rpt	p.G4056R	ENST00000374695.3	37	c.12166	CCDS30625.1	1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.692758	0.88735	.	.	ENSG00000142798	ENST00000374695	D	0.88431	-2.38	5.09	5.09	0.68999	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.000000	0.40222	N	0.001148	D	0.96393	0.8823	H	0.96460	3.825	0.50171	D	0.999857	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97769	1.0225	10	0.87932	D	0	.	17.0573	0.86537	0.0:1.0:0.0:0.0	.	1996;4056	Q59EG0;P98160	.;PGBM_HUMAN	R	4056	ENSP00000363827:G4056R	ENSP00000363827:G4056R	G	-	1	0	HSPG2	22027986	1.000000	0.71417	0.686000	0.30086	0.869000	0.49853	7.279000	0.78599	2.365000	0.80145	0.462000	0.41574	GGT	HSPG2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000142798		0.682	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1	-	0.00	55	0	C	NM_005529		22155399	-1	tier1	-	no_errors	ENST00000374695	ensembl	human	known	74_37	missense	9.38	58	6	SNP	1.000	G
HTR4	3360	genome.wustl.edu	37	5	147863838	147863838	+	Intron	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr5:147863838C>T	ENST00000377888.3	-	7	1215				HTR4_ENST00000521530.1_Intron|HTR4_ENST00000360693.3_Missense_Mutation_p.R394K|HTR4_ENST00000314512.6_Intron|HTR4_ENST00000520514.1_Intron|HTR4_ENST00000362016.2_Intron|HTR4_ENST00000354217.2_Intron|HTR4_ENST00000517929.1_Intron|HTR4_ENST00000521735.1_Intron	NM_000870.5	NP_000861.1	Q13639	5HT4R_HUMAN	5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled						G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|regulation of appetite (GO:0032098)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cinitapride(DB08810)|Cisapride(DB00604)|Ergoloid mesylate(DB01049)|Metoclopramide(DB01233)|Ondansetron(DB00904)	gacaggcttccttgcagtcaa	0.403																																					GBM(120;370 1604 14007 17804 41573)												0													90.0	89.0	89.0					5																	147863838		2203	4300	6503	SO:0001627	intron_variant	0			Y08756	CCDS4291.1, CCDS34270.1, CCDS34271.1, CCDS34272.1, CCDS34273.1, CCDS34273.2, CCDS75353.1	5q31-q33	2012-08-08	2012-02-03		ENSG00000164270	ENSG00000164270		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5299	protein-coding gene	gene with protein product		602164	"""5-hydroxytryptamine (serotonin) receptor 4"""			9371406, 9276448	Standard	NM_199453		Approved	5-HT4	uc021yfj.1	Q13639	OTTHUMG00000129931	ENST00000377888.3:c.1077-982G>A	5.37:g.147863838C>T			C4WYH4|Q546Q1|Q684M0|Q712M9|Q96KH9|Q96KI0|Q9H199|Q9NY73|Q9UBM6|Q9UBT4|Q9UE22|Q9UE23|Q9UQR6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_5HT4_rcpt,prints_GPCR_Rhodpsn	p.R394K	ENST00000377888.3	37	c.1181	CCDS4291.1	5	.	.	.	.	.	.	.	.	.	.	C	11.27	1.588783	0.28357	.	.	ENSG00000164270	ENST00000360693	T	0.70986	-0.53	3.32	3.32	0.38043	.	6.289490	0.00166	N	0.000008	T	0.49966	0.1588	.	.	.	0.31233	N	0.696049	B	0.19200	0.034	B	0.15484	0.013	T	0.47995	-0.9073	9	0.06236	T	0.91	.	10.4094	0.44282	0.0:1.0:0.0:0.0	.	394	Q712M9	.	K	394	ENSP00000353915:R394K	ENSP00000353915:R394K	R	-	2	0	HTR4	147844031	0.002000	0.14202	0.006000	0.13384	0.004000	0.04260	1.291000	0.33330	2.161000	0.67846	0.650000	0.86243	AGG	HTR4	-	NULL	ENSG00000164270		0.403	HTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR4	HGNC	protein_coding	OTTHUMT00000252187.2		0.00	17	0	C	NM_000870		147863838	-1			no_errors	ENST00000360693	ensembl	human	known	74_37	missense	14.29	30	5	SNP	0.007	T
IDH2	3418	genome.wustl.edu	37	15	90631934	90631934	+	Missense_Mutation	SNP	C	C	T	rs121913502		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr15:90631934C>T	ENST00000330062.3	-	4	532	c.419G>A	c.(418-420)cGg>cAg	p.R140Q	IDH2_ENST00000559482.1_Intron|IDH2_ENST00000539790.1_Missense_Mutation_p.R10Q|IDH2_ENST00000540499.2_Missense_Mutation_p.R88Q	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	140	Substrate binding. {ECO:0000250}.		R -> G (in D2HGA2). {ECO:0000269|PubMed:20847235}.|R -> Q (in D2HGA2). {ECO:0000269|PubMed:20847235}.		2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)	p.R140Q(292)|p.R140L(8)		biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			CAGGATGTTCCGGATAGTTCC	0.537			M		GBM																																			Dom	yes		15	15q26.1	3418	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """		M	300	Substitution - Missense(300)	haematopoietic_and_lymphoid_tissue(300)											103.0	103.0	103.0					15																	90631934		2200	4298	6498	SO:0001583	missense	0				CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.419G>A	15.37:g.90631934C>T	ENSP00000331897:p.Arg140Gln		B2R6L6|B4DFL2|Q96GT3	Missense_Mutation	SNP	pfam_IsoPropMal-DH-like_dom,pirsf_Isocitrate_DH_NADP,tigrfam_Isocitrate_DH_NADP	p.R140Q	ENST00000330062.3	37	c.419	CCDS10359.1	15	.	.	.	.	.	.	.	.	.	.	C	18.35	3.604397	0.66445	.	.	ENSG00000182054	ENST00000330062;ENST00000539790;ENST00000540499	D;D;D	0.87179	-2.22;-2.22;-2.22	5.67	4.75	0.60458	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.95449	0.8522	H	0.96833	3.89	0.48185	D	0.999601	D	0.89917	1.0	D	0.87578	0.998	D	0.96254	0.9185	10	0.87932	D	0	.	12.4459	0.55651	0.0:0.9189:0.0:0.0811	.	140	P48735	IDHP_HUMAN	Q	140;10;88	ENSP00000331897:R140Q;ENSP00000438457:R10Q;ENSP00000446147:R88Q	ENSP00000331897:R140Q	R	-	2	0	IDH2	88432938	1.000000	0.71417	1.000000	0.80357	0.051000	0.14879	7.797000	0.85911	1.397000	0.46682	-0.258000	0.10820	CGG	IDH2	-	pfam_IsoPropMal-DH-like_dom,pirsf_Isocitrate_DH_NADP,tigrfam_Isocitrate_DH_NADP	ENSG00000182054		0.537	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDH2	HGNC	protein_coding	OTTHUMT00000313426.1	-	0.00	35	0	C			90631934	-1	tier1	rs121913502	no_errors	ENST00000330062	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
ING2	3622	genome.wustl.edu	37	4	184431438	184431438	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr4:184431438C>T	ENST00000302327.3	+	2	378	c.176C>T	c.(175-177)aCg>aTg	p.T59M	ING2_ENST00000434682.2_Missense_Mutation_p.T19M	NM_001564.2	NP_001555.1	Q9H160	ING2_HUMAN	inhibitor of growth family, member 2	59					chromatin modification (GO:0016568)|male germ-line stem cell asymmetric division (GO:0048133)|male meiosis I (GO:0007141)|negative regulation of cell proliferation (GO:0008285)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cellular senescence (GO:2000772)|regulation of growth (GO:0040008)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|seminiferous tubule development (GO:0072520)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleus (GO:0005634)|Sin3 complex (GO:0016580)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)	7		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00139)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|all_hematologic(60;0.0207)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		TTTTTAGAAACGTTAAAGGAA	0.308																																																	0													61.0	71.0	68.0					4																	184431438		2139	4263	6402	SO:0001583	missense	0			AB012853	CCDS3833.1	4q35.1	2013-01-28	2005-02-10	2005-02-11	ENSG00000168556	ENSG00000168556		"""Zinc fingers, PHD-type"""	6063	protein-coding gene	gene with protein product		604215	"""inhibitor of growth family, member 1-like"""	ING1L		10072587	Standard	XM_005262982		Approved	p33ING2	uc003ivs.1	Q9H160	OTTHUMG00000150502	ENST00000302327.3:c.176C>T	4.37:g.184431438C>T	ENSP00000307183:p.Thr59Met		B6ZDS1|O95698	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.T59M	ENST00000302327.3	37	c.176	CCDS3833.1	4	.	.	.	.	.	.	.	.	.	.	C	12.73	2.024553	0.35701	.	.	ENSG00000168556	ENST00000302327;ENST00000412117;ENST00000434682	.	.	.	5.54	5.54	0.83059	Double Clp-N motif (1);Inhibitor of growth protein, N-terminal (1);	0.107276	0.64402	D	0.000005	T	0.41858	0.1177	N	0.08118	0	0.38151	D	0.938752	P;P	0.46656	0.882;0.478	P;B	0.45971	0.499;0.148	T	0.43278	-0.9401	9	0.33141	T	0.24	-9.2718	19.6745	0.95926	0.0:1.0:0.0:0.0	.	19;59	B6ZDS1;Q9H160	.;ING2_HUMAN	M	59;19;19	.	ENSP00000307183:T59M	T	+	2	0	ING2	184668432	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.202000	0.65169	2.880000	0.98712	0.650000	0.86243	ACG	ING2	-	NULL	ENSG00000168556		0.308	ING2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ING2	HGNC	protein_coding	OTTHUMT00000318652.1	-	0.00	9	0	C	NM_001564		184431438	+1	tier1	-	no_errors	ENST00000302327	ensembl	human	known	74_37	missense	21.05	15	4	SNP	1.000	T
INTS10	55174	genome.wustl.edu	37	8	19701701	19701701	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr8:19701701T>A	ENST00000397977.3	+	15	2232	c.1834T>A	c.(1834-1836)Tgc>Agc	p.C612S		NM_018142.2	NP_060612.2	Q9NVR2	INT10_HUMAN	integrator complex subunit 10	612					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	20				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		CAATAAAATTTGCCAACAAGG	0.373																																																	0													63.0	62.0	62.0					8																	19701701		1835	4098	5933	SO:0001583	missense	0			AK001431	CCDS6011.2	8p21.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000104613	ENSG00000104613			25548	protein-coding gene	gene with protein product		611353	"""chromosome 8 open reading frame 35"""	C8orf35		16239144	Standard	XM_005273558		Approved	FLJ10569, INT10	uc003wzj.3	Q9NVR2	OTTHUMG00000131065	ENST00000397977.3:c.1834T>A	8.37:g.19701701T>A	ENSP00000381064:p.Cys612Ser		Q6IA93|Q7L538|Q7L8C8|Q9H3W8	Missense_Mutation	SNP	NULL	p.C612S	ENST00000397977.3	37	c.1834	CCDS6011.2	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.42|18.42	3.619967|3.619967	0.66787|0.66787	.|.	.|.	ENSG00000104613|ENSG00000104613	ENST00000397977|ENST00000523772	T|.	0.40756|.	1.02|.	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	0.039864|.	0.85682|.	D|.	0.000000|.	T|T	0.63165|0.63165	0.2488|0.2488	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	P|.	0.50819|.	0.939|.	P|.	0.48627|.	0.584|.	T|T	0.59873|0.59873	-0.7372|-0.7372	9|5	.|.	.|.	.|.	-17.047|-17.047	15.4367|15.4367	0.75152|0.75152	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	612|.	Q9NVR2|.	INT10_HUMAN|.	S|L	612|48	ENSP00000381064:C612S|.	.|.	C|F	+|+	1|3	0|2	INTS10|INTS10	19745981|19745981	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	5.874000|5.874000	0.69652|0.69652	2.322000|2.322000	0.78497|0.78497	0.528000|0.528000	0.53228|0.53228	TGC|TTT	INTS10	-	NULL	ENSG00000104613		0.373	INTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS10	HGNC	protein_coding	OTTHUMT00000253724.2		0.00	29	0	T	NM_018142		19701701	+1			no_errors	ENST00000397977	ensembl	human	known	74_37	missense	17.14	29	6	SNP	1.000	A
IRAK2	3656	genome.wustl.edu	37	3	10255052	10255052	+	Silent	SNP	C	C	T	rs372180328		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr3:10255052C>T	ENST00000256458.4	+	5	780	c.690C>T	c.(688-690)caC>caT	p.H230H		NM_001570.3	NP_001561.3	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	230	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			breast(4)|large_intestine(8)|lung(11)|prostate(1)|stomach(1)	25						GGCACAGGCACGGGAAGCCAT	0.557																																																	0								C		1,4405	2.1+/-5.4	0,1,2202	64.0	62.0	63.0		690	-11.0	0.0	3		63	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	IRAK2	NM_001570.3		0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154		230/626	10255052	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AF026273	CCDS33697.1	3p25.2	2008-08-18			ENSG00000134070	ENSG00000134070			6113	protein-coding gene	gene with protein product		603304				9374458	Standard	XR_245126		Approved		uc003bve.1	O43187	OTTHUMG00000155358	ENST00000256458.4:c.690C>T	3.37:g.10255052C>T			B4DQZ6|Q08AG6|Q5K546	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,superfamily_Kinase-like_dom,superfamily_DEATH-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.H230	ENST00000256458.4	37	c.690	CCDS33697.1	3																																																																																			IRAK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000134070		0.557	IRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK2	HGNC	protein_coding	OTTHUMT00000339623.1	-	0.00	26	0	C			10255052	+1	tier1	-	no_errors	ENST00000256458	ensembl	human	known	74_37	silent	17.07	34	7	SNP	0.000	T
IQCF3	401067	genome.wustl.edu	37	3	51863720	51863720	+	Missense_Mutation	SNP	C	C	T	rs572500189		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr3:51863720C>T	ENST00000456080.1	+	7	1223	c.58C>T	c.(58-60)Cgg>Tgg	p.R20W	IQCF3_ENST00000444293.1_Missense_Mutation_p.R20W|IQCF3_ENST00000446775.1_Missense_Mutation_p.R20W|IQCF3_ENST00000440739.2_Missense_Mutation_p.R20W|IQCF3_ENST00000437810.2_Missense_Mutation_p.R20W			P0C7M6	IQCF3_HUMAN	IQ motif containing F3	20										endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AAGACAGAGGCGGCAGAAGGT	0.527													C|||	1	0.000199681	0.0	0.0	5008	,	,		21073	0.001		0.0	False		,,,				2504	0.0																0													98.0	121.0	114.0					3																	51863720		2015	4170	6185	SO:0001583	missense	0			AK057432	CCDS46837.1	3p21.31	2008-06-12			ENSG00000229972	ENSG00000229972			31816	protein-coding gene	gene with protein product							Standard	NM_001085479		Approved		uc021wyz.1	P0C7M6	OTTHUMG00000156910	ENST00000456080.1:c.58C>T	3.37:g.51863720C>T	ENSP00000415609:p.Arg20Trp		B2RUV0	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.R20W	ENST00000456080.1	37	c.58	CCDS46837.1	3	.	.	.	.	.	.	.	.	.	.	C	6.474	0.455670	0.12283	.	.	ENSG00000229972	ENST00000456080;ENST00000437810;ENST00000446775;ENST00000440739;ENST00000444293	T;T;T;T	0.35236	1.32;1.32;1.32;1.32	3.59	-3.27	0.05048	.	.	.	.	.	T	0.13756	0.0333	N	0.08118	0	0.09310	N	1	B	0.33904	0.431	B	0.26969	0.075	T	0.10660	-1.0620	9	0.62326	D	0.03	.	4.0869	0.09951	0.4786:0.3212:0.1159:0.0843	.	20	P0C7M6	IQCF3_HUMAN	W	20	ENSP00000415609:R20W;ENSP00000409373:R20W;ENSP00000401767:R20W;ENSP00000402012:R20W	ENSP00000409373:R20W	R	+	1	2	IQCF3	51838760	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.390000	0.01057	-1.198000	0.02669	-2.726000	0.00130	CGG	IQCF3	-	superfamily_P-loop_NTPase	ENSG00000229972		0.527	IQCF3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCF3	HGNC	protein_coding	OTTHUMT00000346579.2	-	0.00	30	0	C	NM_001085479		51863720	+1	tier1	-	no_errors	ENST00000437810	ensembl	human	known	74_37	missense	18.18	18	4	SNP	0.000	T
IRGC	56269	genome.wustl.edu	37	19	44223001	44223001	+	Silent	SNP	G	G	A	rs11555892		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:44223001G>A	ENST00000244314.5	+	2	490	c.291G>A	c.(289-291)tcG>tcA	p.S97S		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	97	IRG-type G.					membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				TGCAACCGTCGCCCTATCCAC	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		14509	0.0		0.0	False		,,,				2504	0.001				Colon(189;350 2037 11447 13433 38914)												0								G		0,4406		0,0,2203	35.0	32.0	33.0		291	-7.6	0.1	19	dbSNP_120	33	2,8596		0,2,4297	no	coding-synonymous	IRGC	NM_019612.3		0,2,6500	AA,AG,GG		0.0233,0.0,0.0154		97/464	44223001	2,13002	2203	4299	6502	SO:0001819	synonymous_variant	0			BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.291G>A	19.37:g.44223001G>A			Q05BR8	Silent	SNP	pfam_Interferon-induced_GTPase,superfamily_P-loop_NTPase	p.S97	ENST00000244314.5	37	c.291	CCDS12629.1	19																																																																																			IRGC	-	pfam_Interferon-induced_GTPase,superfamily_P-loop_NTPase	ENSG00000124449		0.657	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRGC	HGNC	protein_coding	OTTHUMT00000336191.1	-	0.00	75	0	G	NM_019612		44223001	+1	tier1	rs11555892	no_errors	ENST00000244314	ensembl	human	known	74_37	silent	14.29	90	15	SNP	0.000	A
JARID2	3720	genome.wustl.edu	37	6	15513155	15513155	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr6:15513155C>T	ENST00000341776.2	+	15	3389	c.3145C>T	c.(3145-3147)Cgt>Tgt	p.R1049C	JARID2_ENST00000397311.3_Missense_Mutation_p.R877C	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	1049					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				GGAAATGAAGCGTCGCCATAT	0.478																																																	0													173.0	185.0	181.0					6																	15513155		2203	4300	6503	SO:0001583	missense	0			U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.3145C>T	6.37:g.15513155C>T	ENSP00000341280:p.Arg1049Cys		A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_TF_JmjN,pfam_Znf_C5HC2,superfamily_ARID/BRIGHT_DNA-bd,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_ARID/BRIGHT_DNA-bd	p.R1049C	ENST00000341776.2	37	c.3145	CCDS4533.1	6	.	.	.	.	.	.	.	.	.	.	C	11.52	1.662257	0.29515	.	.	ENSG00000008083	ENST00000341776;ENST00000397311	T;T	0.72282	-0.64;-0.64	4.14	3.26	0.37387	.	0.048145	0.85682	D	0.000000	T	0.31040	0.0784	N	0.11560	0.145	0.53688	D	0.999979	B	0.15719	0.014	B	0.08055	0.003	T	0.19353	-1.0308	10	0.41790	T	0.15	-8.014	8.7386	0.34543	0.1491:0.7688:0.0:0.0821	.	1049	Q92833	JARD2_HUMAN	C	1049;877	ENSP00000341280:R1049C;ENSP00000380478:R877C	ENSP00000341280:R1049C	R	+	1	0	JARID2	15621134	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.438000	0.52871	1.088000	0.41272	0.609000	0.83330	CGT	JARID2	-	NULL	ENSG00000008083		0.478	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JARID2	HGNC	protein_coding	OTTHUMT00000039926.1	-	0.00	14	0	C	NM_004973		15513155	+1	tier1	-	no_errors	ENST00000341776	ensembl	human	known	74_37	missense	20.00	28	7	SNP	1.000	T
KCNC3	3748	genome.wustl.edu	37	19	50826653	50826653	+	Silent	SNP	G	G	A	rs200349179		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:50826653G>A	ENST00000477616.1	-	2	1851	c.1557C>T	c.(1555-1557)gtC>gtT	p.V519V	KCNC3_ENST00000391818.2_Intron|KCNC3_ENST00000474951.1_Intron|KCNC3_ENST00000376959.2_Silent_p.V519V	NM_004977.2	NP_004968.2	Q14003	KCNC3_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 3	519					cell death (GO:0008219)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axolemma (GO:0030673)|axon terminus (GO:0043679)|dendrite membrane (GO:0032590)|neuromuscular junction (GO:0031594)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)	13		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)	Dalfampridine(DB06637)	ACAGCGCCCCGACCAGCATCC	0.597																																					Melanoma(91;1496 2324 50908)												0								G		0,4406		0,0,2203	83.0	84.0	84.0		1557	-6.5	0.9	19		84	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KCNC3	NM_004977.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		519/758	50826653	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AB208930	CCDS12793.1	19q13.33	2014-09-17			ENSG00000131398	ENSG00000131398		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6235	protein-coding gene	gene with protein product		176264	"""spinocerebellar ataxia 13"""	SCA13		1740329, 8111118, 16382104	Standard	NM_004977		Approved	Kv3.3	uc002pru.1	Q14003	OTTHUMG00000044580	ENST00000477616.1:c.1557C>T	19.37:g.50826653G>A				Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_K_chnl_volt-dep_Kv3_ID,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3.3,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv	p.V519	ENST00000477616.1	37	c.1557	CCDS12793.1	19																																																																																			KCNC3	-	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl	ENSG00000131398		0.597	KCNC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNC3	HGNC	protein_coding	OTTHUMT00000314288.2	-	0.00	61	0	G	NM_004977		50826653	-1	tier1	rs200349179	no_errors	ENST00000477616	ensembl	human	known	74_37	silent	25.00	51	17	SNP	0.943	A
KCTD16	57528	genome.wustl.edu	37	5	143853531	143853531	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr5:143853531delA	ENST00000507359.3	+	3	2232	c.1141delA	c.(1141-1143)aaafs	p.K383fs	KCTD16_ENST00000512467.1_Frame_Shift_Del_p.K383fs	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	383					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			CATGAGCAGCAAAAAAAAAGC	0.468																																																	0										51,4211		5,41,2085	53.0	63.0	59.0			4.8	1.0	5		61	75,8177		18,39,4069	no	frameshift	KCTD16	NM_020768.3		23,80,6154	A1A1,A1R,RR		0.9089,1.1966,1.0069			143853531	126,12388	2203	4300	6503	SO:0001589	frameshift_variant	0			AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.1141delA	5.37:g.143853531delA	ENSP00000426548:p.Lys383fs		Q9P2M9	Frame_Shift_Del	DEL	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.A384fs	ENST00000507359.3	37	c.1141	CCDS34260.1	5																																																																																			KCTD16	-	NULL	ENSG00000183775		0.468	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCTD16	HGNC	protein_coding	OTTHUMT00000371898.3		0.00	13	0	A	XM_098368		143853531	+1	tier1		no_errors	ENST00000507359	ensembl	human	known	74_37	frame_shift_del	19.05	17	4	DEL	1.000	-
KDM2B	84678	genome.wustl.edu	37	12	121951164	121951164	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr12:121951164G>T	ENST00000377071.4	-	10	1161	c.1089C>A	c.(1087-1089)tgC>tgA	p.C363*	KDM2B_ENST00000538046.2_Nonsense_Mutation_p.C273*|KDM2B_ENST00000377069.4_Nonsense_Mutation_p.C332*|KDM2B_ENST00000536437.1_Nonsense_Mutation_p.C246*	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	363					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						GGACATACCAGCACATCTCAT	0.547																																																	0													89.0	90.0	89.0					12																	121951164		2048	4190	6238	SO:0001587	stop_gained	0			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.1089C>A	12.37:g.121951164G>T	ENSP00000366271:p.Cys363*		A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Nonsense_Mutation	SNP	pfam_Znf_CXXC,pfam_F-box_dom,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.C363*	ENST00000377071.4	37	c.1089	CCDS41850.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.0|21.0	4.089338|4.089338	0.76756|0.76756	.|.	.|.	ENSG00000089094|ENSG00000089094	ENST00000541318|ENST00000397480;ENST00000377069;ENST00000377071;ENST00000536437;ENST00000397478;ENST00000261824;ENST00000446152;ENST00000542030;ENST00000538379;ENST00000545022	.|.	.|.	.|.	5.82|5.82	4.75|4.75	0.60458|0.60458	.|.	.|0.000000	.|0.64402	.|D	.|0.000009	T|.	0.24890|.	0.0604|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.25641|.	-1.0126|.	4|.	0.87932|0.02654	D|T	0|1	-28.1661|-28.1661	10.4618|10.4618	0.44583|0.44583	0.1979:0.0:0.8021:0.0|0.1979:0.0:0.8021:0.0	.|.	.|.	.|.	.|.	D|X	31|363;332;363;246;363;363;326;65;132;132	.|.	ENSP00000443052:A31D|ENSP00000261824:C363X	A|C	-|-	2|3	0|2	KDM2B|KDM2B	120435547|120435547	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.321000|5.321000	0.65846|0.65846	2.751000|2.751000	0.94390|0.94390	0.650000|0.650000	0.86243|0.86243	GCT|TGC	KDM2B	-	NULL	ENSG00000089094		0.547	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KDM2B	HGNC	protein_coding	OTTHUMT00000402132.2		0.00	47	0	G	NM_032590		121951164	-1			no_errors	ENST00000377071	ensembl	human	known	74_37	nonsense	5.63	67	4	SNP	1.000	T
KDR	3791	genome.wustl.edu	37	4	55971000	55971000	+	Silent	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr4:55971000G>T	ENST00000263923.4	-	13	2092	c.1797C>A	c.(1795-1797)ccC>ccA	p.P599P		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	599	Ig-like C2-type 6.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)	p.P599P(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AAACAGGTGTGGGCAACTCTC	0.458			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																														Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	1	Substitution - coding silent(1)	lung(1)											130.0	120.0	123.0					4																	55971000		2203	4300	6503	SO:0001819	synonymous_variant	0			AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.1797C>A	4.37:g.55971000G>T			A2RRS0|B5A925|C5IFA0|O60723|Q14178	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR2_rcpt	p.P599	ENST00000263923.4	37	c.1797	CCDS3497.1	4																																																																																			KDR	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000128052		0.458	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDR	HGNC	protein_coding	OTTHUMT00000250645.1		0.00	26	0	G			55971000	-1			no_errors	ENST00000263923	ensembl	human	known	74_37	silent	6.67	42	3	SNP	0.541	T
KIAA1755	85449	genome.wustl.edu	37	20	36841848	36841848	+	Missense_Mutation	SNP	G	G	A	rs375138370		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr20:36841848G>A	ENST00000279024.4	-	14	3470	c.3199C>T	c.(3199-3201)Cgc>Tgc	p.R1067C		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	1067										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				CGTTCTGGGCGCGCTGAGTGA	0.622																																																	0								G	CYS/ARG	0,4406		0,0,2203	35.0	28.0	30.0		3199	-0.7	0.0	20		30	1,8599		0,1,4299	no	missense	KIAA1755	NM_001029864.1	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	1067/1201	36841848	1,13005	2203	4300	6503	SO:0001583	missense	0			AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.3199C>T	20.37:g.36841848G>A	ENSP00000279024:p.Arg1067Cys		Q9C0A8	Missense_Mutation	SNP	superfamily_CRAL-TRIO_dom	p.R1067C	ENST00000279024.4	37	c.3199	CCDS33467.1	20	.	.	.	.	.	.	.	.	.	.	G	10.34	1.322385	0.23994	0.0	1.16E-4	ENSG00000149633	ENST00000279024	T	0.06218	3.33	4.96	-0.66	0.11421	.	1.851070	0.02493	N	0.089661	T	0.04363	0.0120	N	0.16478	0.41	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41142	-0.9525	10	0.52906	T	0.07	.	1.328	0.02129	0.2579:0.1468:0.4442:0.1511	.	1067	Q5JYT7	K1755_HUMAN	C	1067	ENSP00000279024:R1067C	ENSP00000279024:R1067C	R	-	1	0	KIAA1755	36275262	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.036000	0.13819	0.044000	0.15775	-0.224000	0.12420	CGC	KIAA1755	-	NULL	ENSG00000149633		0.622	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1755	HGNC	protein_coding	OTTHUMT00000079144.3	-	0.00	79	0	G	NM_001029864		36841848	-1	tier1	-	no_errors	ENST00000279024	ensembl	human	known	74_37	missense	20.69	67	18	SNP	0.000	A
KLF7	8609	genome.wustl.edu	37	2	207988664	207988664	+	Silent	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:207988664C>T	ENST00000309446.6	-	2	943	c.567G>A	c.(565-567)acG>acA	p.T189T	KLF7_ENST00000458272.1_Intron|KLF7_ENST00000412414.2_Silent_p.T161T|KLF7_ENST00000423015.1_Intron|KLF7_ENST00000467833.1_Intron|KLF7_ENST00000421199.1_Silent_p.T156T|KLF7-IT1_ENST00000428777.1_RNA	NM_003709.3	NP_003700.1	O75840	KLF7_HUMAN	Kruppel-like factor 7 (ubiquitous)	189					axon guidance (GO:0007411)|dendrite morphogenesis (GO:0048813)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|large_intestine(3)|liver(1)|lung(4)|skin(1)	11				LUSC - Lung squamous cell carcinoma(261;0.0856)|Lung(261;0.166)|Epithelial(149;0.173)		CCCCCGCAGCCGTCACGGCTG	0.612																																																	0													49.0	54.0	52.0					2																	207988664		2203	4300	6503	SO:0001819	synonymous_variant	0			AB015132	CCDS2373.1, CCDS59438.1, CCDS59439.1, CCDS59440.1	2q32	2013-01-08			ENSG00000118263	ENSG00000118263		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6350	protein-coding gene	gene with protein product		604865				9774444	Standard	NM_003709		Approved	UKLF	uc010zix.2	O75840	OTTHUMG00000132935	ENST00000309446.6:c.567G>A	2.37:g.207988664C>T			B2RB03|B7Z4F7|C9JF04|E7EWH1|L0R4P2|Q7Z3H8|Q96E51	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T189	ENST00000309446.6	37	c.567	CCDS2373.1	2																																																																																			KLF7	-	NULL	ENSG00000118263		0.612	KLF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF7	HGNC	protein_coding	OTTHUMT00000256466.2	-	0.00	38	0	C	NM_003709		207988664	-1	tier1	-	no_errors	ENST00000309446	ensembl	human	known	74_37	silent	21.57	40	11	SNP	0.001	T
KMT2C	58508	genome.wustl.edu	37	7	151884535	151884536	+	Frame_Shift_Ins	INS	-	-	TT	rs145959904		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr7:151884535_151884536insTT	ENST00000262189.6	-	33	5037_5038	c.4819_4820insAA	c.(4819-4821)atgfs	p.M1607fs	KMT2C_ENST00000355193.2_Frame_Shift_Ins_p.M1607fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1607					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										ATCACTTGCCATTGGATTAAAG	0.361																																																	0																																										SO:0001589	frameshift_variant	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.4818_4819dupAA	7.37:g.151884536_151884537dupTT	ENSP00000262189:p.Met1607fs		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Ins	INS	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.M1607fs	ENST00000262189.6	37	c.4820_4819	CCDS5931.1	7																																																																																			KMT2C	-	NULL	ENSG00000055609		0.361	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	HGNC	protein_coding	OTTHUMT00000318887.3		0.00	97	0	-			151884536	-1	tier1		no_errors	ENST00000355193	ensembl	human	known	74_37	frame_shift_ins	26.76	104	38	INS	0.421:0.324	TT
KRT25	147183	genome.wustl.edu	37	17	38906735	38906735	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr17:38906735C>T	ENST00000312150.4	-	6	1132	c.1072G>A	c.(1072-1074)Gag>Aag	p.E358K		NM_181534.3	NP_853512.1			keratin 25											endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(4)	16		Breast(137;0.00526)				CCCTCGGTCTCGGTTCTGACC	0.567																																																	0													141.0	142.0	142.0					17																	38906735		2203	4300	6503	SO:0001583	missense	0			AK129503	CCDS11373.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000204897	ENSG00000204897		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30839	protein-coding gene	gene with protein product			"""keratin 25A"""	KRT25A		16831889	Standard	NM_181534		Approved		uc002hve.3	Q7Z3Z0	OTTHUMG00000133373	ENST00000312150.4:c.1072G>A	17.37:g.38906735C>T	ENSP00000310573:p.Glu358Lys			Missense_Mutation	SNP	pfam_IF,prints_Keratin_I	p.E358K	ENST00000312150.4	37	c.1072	CCDS11373.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.710162	0.96821	.	.	ENSG00000204897	ENST00000394042;ENST00000312150	D	0.90133	-2.62	5.52	5.52	0.82312	Filament (1);	0.096119	0.45606	D	0.000356	D	0.93943	0.8061	M	0.87547	2.89	0.52099	D	0.999942	P	0.39862	0.692	P	0.45343	0.477	D	0.94615	0.7808	10	0.87932	D	0	.	19.4386	0.94807	0.0:1.0:0.0:0.0	.	358	Q7Z3Z0	K1C25_HUMAN	K	287;358	ENSP00000310573:E358K	ENSP00000310573:E358K	E	-	1	0	KRT25	36160261	0.992000	0.36948	0.989000	0.46669	0.995000	0.86356	3.062000	0.49971	2.566000	0.86566	0.655000	0.94253	GAG	KRT25	-	pfam_IF,prints_Keratin_I	ENSG00000204897		0.567	KRT25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT25	HGNC	protein_coding	OTTHUMT00000257218.1	-	0.00	62	0	C	NM_181534		38906735	-1	tier1	-	no_errors	ENST00000312150	ensembl	human	known	74_37	missense	5.94	94	6	SNP	1.000	T
KSR2	283455	genome.wustl.edu	37	12	118293271	118293271	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr12:118293271T>C	ENST00000339824.5	-	3	1161	c.434A>G	c.(433-435)aAc>aGc	p.N145S	KSR2_ENST00000425217.1_Missense_Mutation_p.N116S			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	145					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GAGGGAGGCGTTGAGGCGGGC	0.637																																																	0													82.0	96.0	91.0					12																	118293271		2081	4207	6288	SO:0001583	missense	0			AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.434A>G	12.37:g.118293271T>C	ENSP00000339952:p.Asn145Ser		A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.N145S	ENST00000339824.5	37	c.434		12	.	.	.	.	.	.	.	.	.	.	T	11.27	1.588935	0.28357	.	.	ENSG00000171435	ENST00000425217;ENST00000339824	T;T	0.78003	-1.13;-1.14	4.49	4.49	0.54785	.	0.000000	0.85682	D	0.000000	T	0.64627	0.2615	L	0.27053	0.805	0.34654	D	0.721913	B	0.19706	0.038	B	0.19946	0.027	T	0.65973	-0.6038	10	0.17369	T	0.5	.	13.2489	0.60039	0.0:0.0:0.0:1.0	.	145	Q6VAB6	KSR2_HUMAN	S	116;145	ENSP00000389715:N116S;ENSP00000339952:N145S	ENSP00000339952:N145S	N	-	2	0	KSR2	116777654	1.000000	0.71417	0.997000	0.53966	0.942000	0.58702	5.802000	0.69122	2.034000	0.60081	0.374000	0.22700	AAC	KSR2	-	NULL	ENSG00000171435		0.637	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	KSR2	HGNC	protein_coding	OTTHUMT00000401987.2	-	0.00	38	0	T	NM_173598		118293271	-1	tier1	-	no_errors	ENST00000339824	ensembl	human	known	74_37	missense	16.67	40	8	SNP	1.000	C
LAMA1	284217	genome.wustl.edu	37	18	7043225	7043225	+	Splice_Site	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr18:7043225C>T	ENST00000389658.3	-	8	1249		c.e8+1			NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1						axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				AATACTCTTACTTTGTGTGGT	0.398																																																	0													209.0	195.0	199.0					18																	7043225		2203	4300	6503	SO:0001630	splice_region_variant	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.1155+1G>A	18.37:g.7043225C>T				Splice_Site	SNP	-	e8+1	ENST00000389658.3	37	c.1155+1	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	C	26.6	4.752024	0.89753	.	.	ENSG00000101680	ENST00000389658	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3277	0.98707	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LAMA1	7033225	0.998000	0.40836	0.914000	0.36105	0.950000	0.60333	3.841000	0.55850	2.879000	0.98667	0.650000	0.86243	.	LAMA1	-	-	ENSG00000101680		0.398	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	-	0.00	42	0	C	NM_005559	Intron	7043225	-1	tier1	-	no_errors	ENST00000389658	ensembl	human	known	74_37	splice_site	18.07	68	15	SNP	1.000	T
LAMA3	3909	genome.wustl.edu	37	18	21399944	21399944	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr18:21399944C>A	ENST00000313654.9	+	19	2528	c.2287C>A	c.(2287-2289)Caa>Aaa	p.Q763K	LAMA3_ENST00000399516.3_Missense_Mutation_p.Q763K	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	763					cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					AGGATATGCCCAAATGACCTC	0.512																																																	0													100.0	97.0	98.0					18																	21399944		1969	4150	6119	SO:0001583	missense	0			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.2287C>A	18.37:g.21399944C>A	ENSP00000324532:p.Gln763Lys		B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Growth_fac_rcpt_N_dom,superfamily_Galactose-bd-like,superfamily_STAT_TF_coiled-coil,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.Q763K	ENST00000313654.9	37	c.2287	CCDS42419.1	18	.	.	.	.	.	.	.	.	.	.	C	9.100	1.003923	0.19199	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	T;T	0.18502	2.23;2.21	5.71	5.71	0.89125	.	.	.	.	.	T	0.17746	0.0426	L	0.55834	1.745	0.80722	D	1	P;P	0.39282	0.544;0.666	B;B	0.33339	0.162;0.137	T	0.06734	-1.0810	9	0.12766	T	0.61	.	19.8533	0.96747	0.0:1.0:0.0:0.0	.	763;763	Q6VU67;Q16787	.;LAMA3_HUMAN	K	763;763;761	ENSP00000324532:Q763K;ENSP00000382432:Q763K	ENSP00000324532:Q763K	Q	+	1	0	LAMA3	19653942	0.084000	0.21492	1.000000	0.80357	0.949000	0.60115	1.298000	0.33412	2.695000	0.91970	0.555000	0.69702	CAA	LAMA3	-	NULL	ENSG00000053747		0.512	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	HGNC	protein_coding	OTTHUMT00000254824.3	-	0.00	22	0	C	NM_000227, NM_198129		21399944	+1	tier1	-	no_errors	ENST00000313654	ensembl	human	known	74_37	missense	25.00	42	14	SNP	1.000	A
LGR6	59352	genome.wustl.edu	37	1	202245467	202245467	+	Silent	SNP	G	G	A	rs201050220		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:202245467G>A	ENST00000367278.3	+	5	551	c.462G>A	c.(460-462)ccG>ccA	p.P154P	LGR6_ENST00000255432.7_Silent_p.P102P|LGR6_ENST00000308543.3_3'UTR|LGR6_ENST00000439764.2_Intron	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	154					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						CCCTGGTCCCGGAGAGGAGCT	0.617													G|||	1	0.000199681	0.0	0.0	5008	,	,		18987	0.001		0.0	False		,,,				2504	0.0																0								G	,,	1,4405	2.1+/-5.4	0,1,2202	69.0	64.0	66.0		462,,306	0.6	1.0	1		66	0,8600		0,0,4300	no	coding-synonymous,intron,coding-synonymous	LGR6	NM_001017403.1,NM_001017404.1,NM_021636.2	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	154/968,,102/916	202245467	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.462G>A	1.37:g.202245467G>A			Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Silent	SNP	pfam_Leu-rich_rpt,pfam_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn	p.P154	ENST00000367278.3	37	c.462	CCDS30971.1	1																																																																																			LGR6	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000133067		0.617	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR6	HGNC	protein_coding	OTTHUMT00000099143.1		0.00	26	0	G	NM_021636		202245467	+1			no_errors	ENST00000367278	ensembl	human	known	74_37	silent	5.13	37	2	SNP	0.959	A
LOC399715	399715	genome.wustl.edu	37	10	6371111	6371111	+	lincRNA	SNP	T	T	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr10:6371111T>G	ENST00000399868.2	+	0	1436					NR_040079.1																						TTCCCTTAACTTATCAGGCTG	0.423																																																	0																																												0																															10.37:g.6371111T>G				RNA	SNP	-	NULL	ENST00000399868.2	37	NULL		10																																																																																			RP11-563J2.2	-	-	ENSG00000215244		0.423	RP11-563J2.2-001	KNOWN	basic	lincRNA	LOC399715	Clone_based_vega_gene	lincRNA	OTTHUMT00000472270.1	-	0.00	12	0	T			6371111	+1	tier1	-	no_errors	ENST00000399868	ensembl	human	known	74_37	rna	25.00	12	4	SNP	0.001	G
LRIT1	26103	genome.wustl.edu	37	10	85991794	85991794	+	Silent	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr10:85991794C>A	ENST00000372105.3	-	4	1782	c.1761G>T	c.(1759-1761)ctG>ctT	p.L587L		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	587						integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						TGTGCCGGGACAGCTCCTCCA	0.567																																																	0													89.0	72.0	78.0					10																	85991794		2203	4300	6503	SO:0001819	synonymous_variant	0			AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.1761G>T	10.37:g.85991794C>A			Q0QD41|Q9Y4N7	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L587	ENST00000372105.3	37	c.1761	CCDS7373.1	10																																																																																			LRIT1	-	NULL	ENSG00000148602		0.567	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT1	HGNC	protein_coding	OTTHUMT00000049109.1	-	0.00	35	0	C	NM_015613		85991794	-1	tier1	-	no_errors	ENST00000372105	ensembl	human	known	74_37	silent	16.00	21	4	SNP	0.196	A
LRRC63	220416	genome.wustl.edu	37	13	46850816	46850816	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr13:46850816C>A	ENST00000595396.1	+	9	1642	c.1642C>A	c.(1642-1644)Cca>Aca	p.P548T				Q05C16	LRC63_HUMAN	leucine rich repeat containing 63	0										lung(1)|ovary(1)	2						ATCACAGCTTCCAGTTATGTT	0.403																																																	0																																										SO:0001583	missense	0				CCDS61325.1	13q14.12	2014-02-12			ENSG00000173988	ENSG00000173988			34296	protein-coding gene	gene with protein product							Standard	NM_001282460		Approved	RP11-139H14.4	uc001vbc.3	Q05C16	OTTHUMG00000016866	ENST00000595396.1:c.1642C>A	13.37:g.46850816C>A	ENSP00000469337:p.Pro548Thr		Q5TBN0	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.P548T	ENST00000595396.1	37	c.1642		13																																																																																			LRRC63	-	NULL	ENSG00000173988		0.403	LRRC63-002	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	LRRC63	HGNC	protein_coding	OTTHUMT00000463266.1	-	0.00	45	0	C	XM_001718341		46850816	+1	tier1	-	no_errors	ENST00000595396	ensembl	human	novel	74_37	missense	20.29	55	14	SNP	0.997	A
MAP1B	4131	genome.wustl.edu	37	5	71403400	71403400	+	Silent	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr5:71403400C>T	ENST00000296755.7	+	1	340	c.42C>T	c.(40-42)tcC>tcT	p.S14S	MAP1B_ENST00000504183.1_3'UTR	NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	14					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		CGGAGCCGTCCGGCAGCATCG	0.682																																					Melanoma(17;367 822 11631 31730 47712)												0													20.0	18.0	19.0					5																	71403400		2198	4294	6492	SO:0001819	synonymous_variant	0			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.42C>T	5.37:g.71403400C>T			A2BDK5	Silent	SNP	pfam_MAP1B_neuraxin	p.S14	ENST00000296755.7	37	c.42	CCDS4012.1	5																																																																																			MAP1B	-	NULL	ENSG00000131711		0.682	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6	-	0.00	29	0	C	NM_005909		71403400	+1	tier1	-	no_errors	ENST00000296755	ensembl	human	known	74_37	silent	20.69	23	6	SNP	0.987	T
MAPK6	5597	genome.wustl.edu	37	15	52342251	52342251	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr15:52342251C>T	ENST00000261845.5	+	3	1424	c.617C>T	c.(616-618)cCt>cTt	p.P206L		NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	206	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		TTACTTTCTCCTAATAATTAT	0.368																																																	0													87.0	91.0	90.0					15																	52342251		2195	4293	6488	SO:0001583	missense	0			L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.617C>T	15.37:g.52342251C>T	ENSP00000261845:p.Pro206Leu		B2R945|B5BU65|Q68DH4|Q8IYN8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_MAPK_ERK3/4	p.P206L	ENST00000261845.5	37	c.617	CCDS10147.1	15	.	.	.	.	.	.	.	.	.	.	C	33	5.259969	0.95368	.	.	ENSG00000069956	ENST00000261845	T	0.64991	-0.13	5.15	5.15	0.70609	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70509	0.3232	N	0.25647	0.755	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74176	-0.3750	10	0.62326	D	0.03	-16.1034	18.6908	0.91582	0.0:1.0:0.0:0.0	.	206	Q16659	MK06_HUMAN	L	206	ENSP00000261845:P206L	ENSP00000261845:P206L	P	+	2	0	MAPK6	50129543	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.815000	0.86186	2.417000	0.82017	0.650000	0.86243	CCT	MAPK6	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_MAPK_ERK3/4	ENSG00000069956		0.368	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK6	HGNC	protein_coding	OTTHUMT00000254841.2	-	0.00	37	0	C	NM_002748		52342251	+1	tier1	-	no_errors	ENST00000261845	ensembl	human	known	74_37	missense	14.47	65	11	SNP	1.000	T
MAST1	22983	genome.wustl.edu	37	19	12969475	12969475	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:12969475G>A	ENST00000251472.4	+	12	1327	c.1288G>A	c.(1288-1290)Gag>Aag	p.E430K	MAST1_ENST00000591495.1_Missense_Mutation_p.E426K	NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						CACCTTCGCCGAGAACCCGTT	0.572																																																	0													99.0	85.0	90.0					19																	12969475		2203	4300	6503	SO:0001583	missense	0			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.1288G>A	19.37:g.12969475G>A	ENSP00000251472:p.Glu430Lys			Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_dom	p.E430K	ENST00000251472.4	37	c.1288	CCDS32921.1	19	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604538	0.87157	.	.	ENSG00000105613	ENST00000251472;ENST00000542153	T	0.22743	1.94	4.6	4.6	0.57074	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.21307	0.0513	N	0.04116	-0.275	0.50467	D	0.999871	D;B	0.69078	0.997;0.194	D;B	0.64410	0.925;0.063	T	0.19910	-1.0291	10	0.87932	D	0	-32.6354	11.2321	0.48918	0.0:0.1859:0.814:0.0	.	430;430	Q9Y2H9;F5H2S9	MAST1_HUMAN;.	K	430	ENSP00000251472:E430K	ENSP00000251472:E430K	E	+	1	0	MAST1	12830475	1.000000	0.71417	0.989000	0.46669	0.980000	0.70556	6.611000	0.74183	2.292000	0.77174	0.561000	0.74099	GAG	MAST1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000105613		0.572	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST1	HGNC	protein_coding	OTTHUMT00000451733.2	-	0.00	68	0	G	NM_014975		12969475	+1	tier1	-	no_errors	ENST00000251472	ensembl	human	known	74_37	missense	12.64	76	11	SNP	0.998	A
MBTD1	54799	genome.wustl.edu	37	17	49270861	49270861	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr17:49270861T>G	ENST00000586178.1	-	14	1726	c.1383A>C	c.(1381-1383)aaA>aaC	p.K461N	MBTD1_ENST00000415868.1_Missense_Mutation_p.K461N|MBTD1_ENST00000376381.2_Missense_Mutation_p.N412T	NM_017643.2	NP_060113.2	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1	461					chromatin modification (GO:0016568)|embryonic skeletal system development (GO:0048706)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			TAAAAGGAAGTTTTGTGTAAC	0.299																																																	0													53.0	51.0	51.0					17																	49270861		2203	4299	6502	SO:0001583	missense	0			AK000062	CCDS11581.2	17q24.1	2003-01-15			ENSG00000011258	ENSG00000011258			19866	protein-coding gene	gene with protein product							Standard	NM_017643		Approved	SA49P01, FLJ20055	uc002itr.4	Q05BQ5	OTTHUMG00000150442	ENST00000586178.1:c.1383A>C	17.37:g.49270861T>G	ENSP00000468304:p.Lys461Asn		Q6ZVU7|Q9NXU1	Missense_Mutation	SNP	pfam_Mbt,smart_Mbt,pfscan_Mbt,pfscan_Znf_FCS	p.K461N	ENST00000586178.1	37	c.1383	CCDS11581.2	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.95|13.95	2.390157|2.390157	0.42410|0.42410	.|.	.|.	ENSG00000011258|ENSG00000011258	ENST00000405860;ENST00000415868|ENST00000376381	T|T	0.31769|0.28895	1.48|1.59	5.36|5.36	1.96|1.96	0.26148|0.26148	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.22399|0.22399	0.0540|0.0540	L|L	0.28014|0.28014	0.82|0.82	0.23568|0.23568	N|N	0.997394|0.997394	B;B|B	0.19445|0.32693	0.036;0.003|0.38	B;B|B	0.17979|0.36244	0.02;0.005|0.22	T|T	0.19516|0.19516	-1.0303|-1.0303	10|9	0.18710|0.37606	T|T	0.47|0.19	.|.	8.8569|8.8569	0.35234|0.35234	0.0:0.216:0.0:0.784|0.0:0.216:0.0:0.784	.|.	461;297|412	Q05BQ5;Q05BQ5-3|Q05BQ5-2	MBTD1_HUMAN;.|.	N|T	461|412	ENSP00000403946:K461N|ENSP00000365561:N412T	ENSP00000386072:K461N|ENSP00000365561:N412T	K|N	-|-	3|2	2|0	MBTD1|MBTD1	46625860|46625860	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	0.548000|0.548000	0.23314|0.23314	0.433000|0.433000	0.26313|0.26313	0.455000|0.455000	0.32223|0.32223	AAA|AAC	MBTD1	-	pfam_Mbt	ENSG00000011258		0.299	MBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTD1	HGNC	protein_coding	OTTHUMT00000318124.1	-	0.00	21	0	T			49270861	-1	tier1	-	no_errors	ENST00000415868	ensembl	human	known	74_37	missense	14.89	39	7	SNP	1.000	G
MCF2L	23263	genome.wustl.edu	37	13	113714953	113714953	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr13:113714953C>T	ENST00000375608.3	+	6	564	c.506C>T	c.(505-507)aCg>aTg	p.T169M	MCF2L_ENST00000434480.2_Missense_Mutation_p.T145M|MCF2L_ENST00000375601.3_Missense_Mutation_p.T143M|MCF2L_ENST00000421756.1_Missense_Mutation_p.T143M|MCF2L_ENST00000375604.2_Missense_Mutation_p.T196M|MCF2L_ENST00000535094.2_Missense_Mutation_p.T139M|MCF2L_ENST00000442652.2_Missense_Mutation_p.T169M|MCF2L_ENST00000423482.2_Missense_Mutation_p.T137M|MCF2L_ENST00000397030.1_Missense_Mutation_p.T172M|MCF2L_ENST00000375597.4_Missense_Mutation_p.T137M			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	169	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				CTTCGCCCGACGGGTTTTTTC	0.572																																																	0													67.0	64.0	65.0					13																	113714953		2203	4300	6503	SO:0001583	missense	0			AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.506C>T	13.37:g.113714953C>T	ENSP00000364758:p.Thr169Met		A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Missense_Mutation	SNP	pfam_DH-domain,pfam_Spectrin_repeat,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.T196M	ENST00000375608.3	37	c.587		13	.	.	.	.	.	.	.	.	.	.	C	18.96	3.733946	0.69189	.	.	ENSG00000126217	ENST00000375608;ENST00000442652;ENST00000375604;ENST00000397030;ENST00000430480;ENST00000535094;ENST00000421756;ENST00000375601;ENST00000434480;ENST00000409954;ENST00000423482;ENST00000375597;ENST00000423251	D;D;D;D;D;D;D;D;T;D;D;T	0.84370	-1.84;-1.84;-1.84;-1.84;-1.84;-1.84;-1.84;-1.84;-0.17;-1.84;-1.84;0.19	5.22	5.22	0.72569	Cellular retinaldehyde-binding/triple function, C-terminal (3);	0.114219	0.64402	D	0.000016	D	0.91696	0.7375	M	0.71581	2.175	0.50039	D	0.999846	D;D;D;D;D;D	0.76494	0.995;0.995;0.995;0.996;0.999;0.996	D;D;D;D;D;D	0.67900	0.923;0.923;0.923;0.932;0.954;0.954	D	0.92564	0.6060	10	0.87932	D	0	.	18.806	0.92037	0.0:1.0:0.0:0.0	.	137;139;196;101;137;169	E9PDN8;O15068-9;G5E9A1;E2QRA2;O15068-4;O15068	.;.;.;.;.;MCF2L_HUMAN	M	169;169;196;172;139;139;143;143;145;110;137;137;59	ENSP00000364758:T169M;ENSP00000401422:T169M;ENSP00000364754:T196M;ENSP00000380225:T172M;ENSP00000440374:T139M;ENSP00000397285:T143M;ENSP00000364751:T143M;ENSP00000407722:T145M;ENSP00000386551:T110M;ENSP00000405639:T137M;ENSP00000364747:T137M;ENSP00000405996:T59M	ENSP00000364747:T137M	T	+	2	0	MCF2L	112762954	0.992000	0.36948	0.039000	0.18376	0.379000	0.30106	5.518000	0.67068	2.427000	0.82271	0.655000	0.94253	ACG	MCF2L	-	superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000126217		0.572	MCF2L-001	KNOWN	basic	protein_coding	MCF2L	HGNC	protein_coding	OTTHUMT00000045849.4		0.00	15	0	C			113714953	+1			no_errors	ENST00000375604	ensembl	human	known	74_37	missense	14.81	23	4	SNP	0.967	T
MED1	5469	genome.wustl.edu	37	17	37566445	37566445	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr17:37566445G>A	ENST00000300651.6	-	17	2252	c.2029C>T	c.(2029-2031)Cgc>Tgc	p.R677C	MED1_ENST00000394287.3_Intron	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		ATTTCCATGCGGGGTGAGCCG	0.463										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)												0													93.0	96.0	95.0					17																	37566445		2203	4300	6503	SO:0001583	missense	0			L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.2029C>T	17.37:g.37566445G>A	ENSP00000300651:p.Arg677Cys		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	pfam_Mediator_Med1_met/fun	p.R677C	ENST00000300651.6	37	c.2029	CCDS11336.1	17	.	.	.	.	.	.	.	.	.	.	G	13.90	2.374152	0.42105	.	.	ENSG00000125686	ENST00000300651	T	0.56275	0.47	5.59	5.59	0.84812	.	.	.	.	.	T	0.59487	0.2197	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.69654	0.965	T	0.62215	-0.6901	9	0.66056	D	0.02	-6.1628	14.336	0.66589	0.0:0.0:0.8157:0.1843	.	677	Q15648	MED1_HUMAN	C	677	ENSP00000300651:R677C	ENSP00000300651:R677C	R	-	1	0	MED1	34819971	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.884000	0.48562	2.629000	0.89072	0.561000	0.74099	CGC	MED1	-	NULL	ENSG00000125686		0.463	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED1	HGNC	protein_coding	OTTHUMT00000256943.3	-	0.00	26	0	G	NM_004774		37566445	-1	tier1	-	no_errors	ENST00000300651	ensembl	human	known	74_37	missense	22.86	27	8	SNP	1.000	A
CHM	1121	genome.wustl.edu	37	X	85158642	85158642	+	Intron	SNP	A	A	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chrX:85158642A>G	ENST00000357749.2	-	10	1274				MIR361_ENST00000362181.1_RNA|CHM_ENST00000537751.1_Intron|CHM_ENST00000467744.2_Intron	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)						blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				GAGGAAAAGGAAGCAAatcag	0.423																																																	0													117.0	108.0	111.0					X																	85158642		1568	3582	5150	SO:0001627	intron_variant	0			X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.1245-2449T>C	X.37:g.85158642A>G			A1L4D2|O43732	RNA	SNP	-	NULL	ENST00000357749.2	37	NULL	CCDS14454.1	X																																																																																			MIR361	-	-	ENSG00000199051		0.423	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR361	HGNC	protein_coding	OTTHUMT00000057396.3	-	0.00	33	0	A	NM_000390		85158642	-1	tier1	-	no_errors	ENST00000362181	ensembl	human	known	74_37	rna	33.93	37	19	SNP	1.000	G
MIR548A3	693127	genome.wustl.edu	37	8	105496666	105496666	+	RNA	SNP	T	T	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr8:105496666T>G	ENST00000385297.1	-	0	27					NR_030330.1				microRNA 548a-3																		tcgcaattacttttgcaccga	0.413																																																	0													54.0	48.0	50.0					8																	105496666		1568	3582	5150			0					8q22.3	2011-09-12		2008-12-18	ENSG00000208032	ENSG00000208032		"""ncRNAs / Micro RNAs"""	32798	non-coding RNA	RNA, micro				MIRN548A3			Standard	NR_030330		Approved	hsa-mir-548a-3	uc021xbz.1				8.37:g.105496666T>G				RNA	SNP	-	NULL	ENST00000385297.1	37	NULL		8																																																																																			MIR548A3	-	-	ENSG00000208032		0.413	MIR548A3-201	KNOWN	basic	miRNA	MIR548A3	HGNC	miRNA		-	0.00	22	0	T	NR_030330		105496666	-1	tier1	-	no_errors	ENST00000385297	ensembl	human	known	74_37	rna	14.71	29	5	SNP	0.311	G
MIR548I4	100302191	genome.wustl.edu	37	X	83480784	83480784	+	RNA	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chrX:83480784G>A	ENST00000408567.1	-	0	52					NR_031690.1				microRNA 548i-4																		taatatttgtggtttttgccg	0.443																																																	0													94.0	92.0	93.0					X																	83480784		957	2069	3026			0					Xq21.1	2011-09-12		2008-12-18	ENSG00000221494	ENSG00000221494		"""ncRNAs / Micro RNAs"""	35355	non-coding RNA	RNA, micro				MIRN548I4			Standard	NR_031690		Approved	hsa-mir-548i-4	uc022aoo.1				X.37:g.83480784G>A				RNA	SNP	-	NULL	ENST00000408567.1	37	NULL		X																																																																																			MIR548I4	-	-	ENSG00000221494		0.443	MIR548I4-201	KNOWN	basic	miRNA	MIR548I4	HGNC	miRNA		-	0.00	19	0	G	NR_031690		83480784	-1	tier1	-	no_errors	ENST00000408567	ensembl	human	known	74_37	rna	41.67	21	15	SNP	0.001	A
MS4A7	58475	genome.wustl.edu	37	11	60152619	60152619	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr11:60152619C>A	ENST00000300184.3	+	3	402	c.206C>A	c.(205-207)gCt>gAt	p.A69D	MS4A14_ENST00000531787.1_Intron|MS4A7_ENST00000534016.1_Intron|MS4A7_ENST00000358246.1_Intron|MS4A7_ENST00000530234.2_Missense_Mutation_p.A69D	NM_021201.4|NM_206939.1	NP_067024.1|NP_996822.1	Q9GZW8	MS4A7_HUMAN	membrane-spanning 4-domains, subfamily A, member 7	69						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(8)|ovary(1)|skin(1)	20						TTGGTTTTTGCTCCCTACCCC	0.468																																																	0													205.0	203.0	204.0					11																	60152619		2203	4300	6503	SO:0001583	missense	0			AB026043	CCDS7985.1, CCDS7986.1	11q12	2008-03-25				ENSG00000166927			13378	protein-coding gene	gene with protein product		606502				11245982, 11401424	Standard	NM_021201		Approved	CD20L4, CFFM4, MS4A8	uc001npf.3	Q9GZW8		ENST00000300184.3:c.206C>A	11.37:g.60152619C>A	ENSP00000300184:p.Ala69Asp		A6NP53|Q6IAG8	Missense_Mutation	SNP	pfam_CD20-like	p.A69D	ENST00000300184.3	37	c.206	CCDS7985.1	11	.	.	.	.	.	.	.	.	.	.	C	11.14	1.552202	0.27739	.	.	ENSG00000166927	ENST00000300184;ENST00000530234	T;T	0.02280	4.36;4.36	3.91	2.0	0.26442	.	1.744500	0.03551	N	0.225419	T	0.07234	0.0183	M	0.70275	2.135	0.09310	N	0.999999	P	0.49307	0.922	P	0.51742	0.678	T	0.26538	-1.0100	10	0.35671	T	0.21	-0.0298	5.4214	0.16402	0.0:0.6829:0.2055:0.1116	.	69	Q9GZW8	MS4A7_HUMAN	D	69	ENSP00000300184:A69D;ENSP00000433184:A69D	ENSP00000300184:A69D	A	+	2	0	MS4A7	59909195	0.067000	0.21026	0.014000	0.15608	0.093000	0.18481	0.980000	0.29513	0.604000	0.29930	0.563000	0.77884	GCT	MS4A7	-	pfam_CD20-like	ENSG00000166927		0.468	MS4A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A7	HGNC	protein_coding	OTTHUMT00000394299.1		0.00	62	0	C			60152619	+1			no_errors	ENST00000300184	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.018	A
MSTN	2660	genome.wustl.edu	37	2	190922360	190922360	+	Missense_Mutation	SNP	G	G	T	rs567560486		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:190922360G>T	ENST00000260950.4	-	3	884	c.752C>A	c.(751-753)cCg>cAg	p.P251Q	C2orf88_ENST00000478197.1_Intron	NM_005259.2	NP_005250.1	O14793	GDF8_HUMAN	myostatin	251					cellular response to dexamethasone stimulus (GO:0071549)|muscle organ development (GO:0007517)|negative regulation of muscle hypertrophy (GO:0014741)|negative regulation of skeletal muscle tissue growth (GO:0048632)|ovulation cycle process (GO:0022602)|positive regulation of transcription, DNA-templated (GO:0045893)|response to electrical stimulus (GO:0051602)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gravity (GO:0009629)|response to heat (GO:0009408)|response to muscle activity (GO:0014850)|response to testosterone (GO:0033574)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue regeneration (GO:0043403)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)	12			OV - Ovarian serous cystadenocarcinoma(117;0.000742)|Epithelial(96;0.0121)|all cancers(119;0.0395)			CTCTAAAAACGGATTCTGTTT	0.368																																																	0													64.0	59.0	61.0					2																	190922360		2203	4299	6502	SO:0001583	missense	0			AF019627	CCDS2303.1	2q32.1	2014-09-17	2007-06-21	2007-06-21	ENSG00000138379	ENSG00000138379			4223	protein-coding gene	gene with protein product		601788	"""growth differentiation factor 8"""	GDF8		9288100, 10610713, 17003236	Standard	NM_005259		Approved		uc002urp.3	O14793	OTTHUMG00000132663	ENST00000260950.4:c.752C>A	2.37:g.190922360G>T	ENSP00000260950:p.Pro251Gln		A1C2J7|A1C2K0|Q6B0H2	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.P251Q	ENST00000260950.4	37	c.752	CCDS2303.1	2	.	.	.	.	.	.	.	.	.	.	G	18.92	3.724970	0.68959	.	.	ENSG00000138379	ENST00000260950	T	0.77358	-1.09	5.5	5.5	0.81552	Transforming growth factor-beta, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.88179	0.6367	M	0.69523	2.12	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88658	0.3187	10	0.87932	D	0	-7.5107	19.7537	0.96281	0.0:0.0:1.0:0.0	.	251	O14793	GDF8_HUMAN	Q	251	ENSP00000260950:P251Q	ENSP00000260950:P251Q	P	-	2	0	MSTN	190630605	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.813000	0.99286	2.736000	0.93811	0.591000	0.81541	CCG	MSTN	-	pfam_TGF-b_N	ENSG00000138379		0.368	MSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSTN	HGNC	protein_coding	OTTHUMT00000255917.2		0.00	21	0	G	NM_005259		190922360	-1			no_errors	ENST00000260950	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	T
MT-ND5	4540	genome.wustl.edu	37	M	12801	12801	+	Silent	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chrM:12801C>A	ENST00000361567.2	+	1	465	c.465C>A	c.(463-465)atC>atA	p.I155I	MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TG_ENST00000387429.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	155					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TTCTTGCTCATCAGTTGATGA	0.453																																																	0																																										SO:0001819	synonymous_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.465C>A	M.37:g.12801C>A			Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.I155M	ENST00000361567.2	37	c.465		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.453	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	248	0	C	YP_003024036		12801	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	18.18	9	2	SNP	NULL	A
MTO1	25821	genome.wustl.edu	37	6	74190435	74190435	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr6:74190435G>T	ENST00000370300.4	+	8	1332	c.1242G>T	c.(1240-1242)caG>caT	p.Q414H	MTO1_ENST00000498286.1_Missense_Mutation_p.Q389H|MTO1_ENST00000415954.2_Missense_Mutation_p.Q389H|MTO1_ENST00000370305.1_Missense_Mutation_p.Q340H	NM_012123.3|NM_133645.2	NP_036255.2|NP_598400.1	Q9Y2Z2	MTO1_HUMAN	mitochondrial tRNA translation optimization 1	414					mitochondrial tRNA wobble uridine modification (GO:0070899)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)	27						ATCCCCGTCAGATCACCCCTT	0.433																																																	0													200.0	180.0	187.0					6																	74190435		2203	4300	6503	SO:0001583	missense	0			AF132937	CCDS4979.1, CCDS34485.1, CCDS47452.1	6q14.1	2013-05-07	2013-05-07		ENSG00000135297	ENSG00000135297			19261	protein-coding gene	gene with protein product		614667	"""mitochondrial translation optimization 1 homolog (S. cerevisiae)"""			12011058, 22608499	Standard	NM_012123		Approved		uc003pgy.4	Q9Y2Z2	OTTHUMG00000015032	ENST00000370300.4:c.1242G>T	6.37:g.74190435G>T	ENSP00000359323:p.Gln414His		B3KQB5|Q5SWL2|Q5SWL3|Q5SWL4|Q8NDN7|Q8WZ57|Q96FE6|Q9BS06	Missense_Mutation	SNP	pfam_GIDA-rel,pfam_FAD_bind_dom,prints_FAD_pyr_nucl-diS_OxRdtase,tigrfam_GidA	p.Q389H	ENST00000370300.4	37	c.1167	CCDS4979.1	6	.	.	.	.	.	.	.	.	.	.	G	17.01	3.279751	0.59758	.	.	ENSG00000135297	ENST00000415954;ENST00000498286;ENST00000357845;ENST00000370305;ENST00000370300	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.15	3.34	0.38264	.	0.056533	0.64402	N	0.000001	D	0.83686	0.5308	M	0.84082	2.675	0.53005	D	0.999967	D;P;D;D	0.89917	1.0;0.687;1.0;1.0	D;B;D;D	0.85130	0.996;0.259;0.996;0.997	D	0.85075	0.0942	10	0.72032	D	0.01	-5.5524	10.6946	0.45892	0.0725:0.1322:0.7953:0.0	.	389;292;389;414	Q9Y2Z2-6;Q9Y2Z2-2;Q9Y2Z2-4;Q9Y2Z2	.;.;.;MTO1_HUMAN	H	389;389;292;340;414	ENSP00000402038:Q389H;ENSP00000419561:Q389H;ENSP00000359328:Q340H;ENSP00000359323:Q414H	ENSP00000350506:Q292H	Q	+	3	2	MTO1	74247156	1.000000	0.71417	1.000000	0.80357	0.745000	0.42441	2.953000	0.49105	0.542000	0.28846	-0.282000	0.10007	CAG	MTO1	-	pfam_GIDA-rel,tigrfam_GidA	ENSG00000135297		0.433	MTO1-003	KNOWN	basic|CCDS	protein_coding	MTO1	HGNC	protein_coding	OTTHUMT00000041215.2		0.00	92	0	G	NM_012123		74190435	+1			no_errors	ENST00000415954	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
MUC17	140453	genome.wustl.edu	37	7	100693828	100693828	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr7:100693828G>T	ENST00000306151.4	+	7	12850	c.12786G>T	c.(12784-12786)aaG>aaT	p.K4262N		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4262	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAGAATACAAGACAGTATTGG	0.453																																																	0													166.0	144.0	152.0					7																	100693828		2203	4300	6503	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.12786G>T	7.37:g.100693828G>T	ENSP00000302716:p.Lys4262Asn		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.K4262N	ENST00000306151.4	37	c.12786	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	G	5.520	0.280823	0.10458	.	.	ENSG00000169876	ENST00000306151	T	0.38560	1.13	4.52	1.65	0.23941	SEA (2);	.	.	.	.	T	0.41650	0.1168	N	0.19112	0.55	0.09310	N	1	D	0.67145	0.996	D	0.63703	0.917	T	0.16897	-1.0387	9	0.54805	T	0.06	.	6.3288	0.21259	0.3263:0.0:0.6737:0.0	.	4262	Q685J3	MUC17_HUMAN	N	4262	ENSP00000302716:K4262N	ENSP00000302716:K4262N	K	+	3	2	MUC17	100480548	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.004000	0.12878	0.536000	0.28733	0.655000	0.94253	AAG	MUC17	-	pfam_SEA_dom,smart_SEA_dom	ENSG00000169876		0.453	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1		0.00	22	0	G	NM_001040105		100693828	+1			no_errors	ENST00000306151	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.000	T
MYO6	4646	genome.wustl.edu	37	6	76599857	76599858	+	Frame_Shift_Ins	INS	-	-	A	rs551348450	byFrequency	TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr6:76599857_76599858insA	ENST00000369977.3	+	26	2881_2882	c.2742_2743insA	c.(2743-2745)aaafs	p.K915fs	MYO6_ENST00000369981.3_Frame_Shift_Ins_p.K915fs|MYO6_ENST00000369975.1_Frame_Shift_Ins_p.K915fs|MYO6_ENST00000369985.4_Frame_Shift_Ins_p.K915fs	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	915					actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)	p.K917fs*10(1)		breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		GTGCATTACAGAAAAAAAAACA	0.381													AAAAAAAAA|AAAAAAAAA|AAAAAAAAAA|insertion	18	0.00359425	0.0083	0.0014	5008	,	,		16538	0.0		0.0	False		,,,				2504	0.0061																1	Deletion - Frameshift(1)	large_intestine(1)								9,4255		0,9,2123						5.8	1.0			86	31,8223		0,31,4096	no	frameshift	MYO6	NM_004999.3		0,40,6219	A1A1,A1R,RR		0.3756,0.2111,0.3195				40,12478				SO:0001589	frameshift_variant	0			U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2751dupA	6.37:g.76599866_76599866dupA	ENSP00000358994:p.Lys915fs		A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Frame_Shift_Ins	INS	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.Q917fs	ENST00000369977.3	37	c.2742_2743	CCDS34487.1	6																																																																																			MYO6	-	NULL	ENSG00000196586		0.381	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO6	HGNC	protein_coding	OTTHUMT00000041279.2		0.00	10	0	-	NM_004999		76599858	+1	tier1		no_errors	ENST00000369981	ensembl	human	known	74_37	frame_shift_ins	13.33	13	2	INS	1.000:1.000	A
MYOF	26509	genome.wustl.edu	37	10	95097551	95097551	+	Intron	SNP	T	T	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr10:95097551T>A	ENST00000359263.4	-	40	4437				MYOF_ENST00000358334.5_Intron|MYOF_ENST00000371501.4_Intron|MYOF_ENST00000371502.4_Intron	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin						blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TCTCCACCCATAGCAGCATAG	0.473																																																	0													120.0	112.0	115.0					10																	95097551		1957	4169	6126	SO:0001627	intron_variant	0			AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.4437+20A>T	10.37:g.95097551T>A			B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	RNA	SNP	-	NULL	ENST00000359263.4	37	NULL	CCDS41551.1	10																																																																																			MYOF	-	-	ENSG00000138119		0.473	MYOF-005	KNOWN	basic|CCDS	protein_coding	MYOF	HGNC	protein_coding	OTTHUMT00000049423.2	-	0.00	49	0	T	NM_013451		95097551	-1	tier1	-	no_errors	ENST00000475358	ensembl	human	known	74_37	rna	10.29	61	7	SNP	0.096	A
NBEAL2	23218	genome.wustl.edu	37	3	47037271	47037271	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr3:47037271G>T	ENST00000450053.3	+	14	2145	c.1966G>T	c.(1966-1968)Gtg>Ttg	p.V656L	NBEAL2_ENST00000292309.5_Missense_Mutation_p.V656L|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	656					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		GGTGGTGGCTGTGTGCACACG	0.587																																																	0													82.0	96.0	92.0					3																	47037271		2055	4188	6243	SO:0001583	missense	0			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.1966G>T	3.37:g.47037271G>T	ENSP00000415034:p.Val656Leu		O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V656L	ENST00000450053.3	37	c.1966	CCDS46817.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.138517	0.94560	.	.	ENSG00000160796	ENST00000292309;ENST00000450053	T;T	0.58358	0.34;0.34	4.72	4.72	0.59763	Concanavalin A-like lectin/glucanase (1);	0.000000	0.85682	D	0.000000	T	0.69682	0.3138	L	0.61387	1.9	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.69760	-0.5058	10	0.44086	T	0.13	.	16.8458	0.85980	0.0:0.0:1.0:0.0	.	656	Q6ZNJ1	NBEL2_HUMAN	L	656	ENSP00000292309:V656L;ENSP00000415034:V656L	ENSP00000292309:V656L	V	+	1	0	NBEAL2	47012275	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.470000	0.97683	2.459000	0.83118	0.655000	0.94253	GTG	NBEAL2	-	superfamily_ConA-like_lec_gl_sf	ENSG00000160796		0.587	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	HGNC	protein_coding	OTTHUMT00000344363.3	-	0.00	50	0	G	XM_291064		47037271	+1	tier1	-	no_errors	ENST00000450053	ensembl	human	known	74_37	missense	7.41	75	6	SNP	1.000	T
NFKBID	84807	genome.wustl.edu	37	19	36387329	36387329	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:36387329C>T	ENST00000396901.1	-	7	943	c.370G>A	c.(370-372)Gtg>Atg	p.V124M	NFKBID_ENST00000606253.1_Missense_Mutation_p.V124M|NFKBID_ENST00000352614.2_Missense_Mutation_p.V276M|NFKBID_ENST00000585544.1_5'Flank	NM_139239.1	NP_640332.1	Q8NI38	IKBD_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta	124					inflammatory response (GO:0006954)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|positive regulation of thymocyte apoptotic process (GO:0070245)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	14						GTAGCGGCCACGTGCAAGACC	0.617																																																	0													67.0	78.0	75.0					19																	36387329		2008	4165	6173	SO:0001583	missense	0			AF385434	CCDS42552.1	19q13.12	2013-01-10				ENSG00000167604		"""Ankyrin repeat domain containing"""	15671	protein-coding gene	gene with protein product						12477932	Standard	NM_139239		Approved	TA-NFKBH, IkappaBNS	uc002oci.1	Q8NI38		ENST00000396901.1:c.370G>A	19.37:g.36387329C>T	ENSP00000380109:p.Val124Met		Q8NI39|Q9BRG9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V276M	ENST00000396901.1	37	c.826	CCDS42552.1	19	.	.	.	.	.	.	.	.	.	.	C	15.72	2.918193	0.52546	.	.	ENSG00000167604	ENST00000352614;ENST00000396901	T;T	0.65916	-0.18;-0.18	4.81	1.09	0.20402	Ankyrin repeat-containing domain (4);	0.243720	0.34580	N	0.003849	T	0.40909	0.1136	L	0.35644	1.08	0.80722	D	1	P;B	0.42961	0.795;0.3	B;B	0.34452	0.183;0.098	T	0.32955	-0.9887	10	0.62326	D	0.03	.	4.1462	0.10217	0.152:0.5803:0.1693:0.0984	.	276;124	Q8NI38-2;Q8NI38	.;IKBD_HUMAN	M	276;124	ENSP00000252985:V276M;ENSP00000380109:V124M	ENSP00000252985:V276M	V	-	1	0	NFKBID	41079169	0.581000	0.26741	0.929000	0.37066	0.914000	0.54420	0.804000	0.27098	0.958000	0.37956	0.561000	0.74099	GTG	NFKBID	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000167604		0.617	NFKBID-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NFKBID	HGNC	protein_coding	OTTHUMT00000452927.3	-	0.00	51	0	C	NM_032721		36387329	-1	tier1	-	no_errors	ENST00000352614	ensembl	human	known	74_37	missense	25.81	69	24	SNP	0.708	T
NLGN1	22871	genome.wustl.edu	37	3	173996722	173996722	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr3:173996722A>C	ENST00000457714.1	+	6	1360	c.931A>C	c.(931-933)Aaa>Caa	p.K311Q	NLGN1_ENST00000401917.3_Missense_Mutation_p.K351Q|NLGN1_ENST00000361589.4_Missense_Mutation_p.K311Q|NLGN1_ENST00000545397.1_Missense_Mutation_p.K311Q|NLGN1_ENST00000466350.1_3'UTR	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	328					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			TCAACCTGCAAAATATGCTAG	0.393																																																	0													93.0	92.0	92.0					3																	173996722		2203	4300	6503	SO:0001583	missense	0			AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.931A>C	3.37:g.173996722A>C	ENSP00000392500:p.Lys311Gln		Q9UPT2	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.K351Q	ENST00000457714.1	37	c.1051	CCDS3222.1	3	.	.	.	.	.	.	.	.	.	.	A	17.45	3.393064	0.62066	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000415045;ENST00000545397;ENST00000401917	T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.62696	0.2449	N	0.20530	0.585	0.80722	D	1	P;B	0.38148	0.62;0.123	P;B	0.46718	0.525;0.038	T	0.64846	-0.6311	10	0.45353	T	0.12	.	16.065	0.80865	1.0:0.0:0.0:0.0	.	351;311	D2X2H5;Q8N2Q7-2	.;.	Q	311;311;351;311;351	ENSP00000392500:K311Q;ENSP00000354541:K311Q;ENSP00000410374:K351Q;ENSP00000441108:K311Q;ENSP00000385750:K351Q	ENSP00000354541:K311Q	K	+	1	0	NLGN1	175479416	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.287000	0.95975	2.257000	0.74773	0.460000	0.39030	AAA	NLGN1	-	pfam_CarbesteraseB	ENSG00000169760		0.393	NLGN1-001	KNOWN	basic|CCDS	protein_coding	NLGN1	HGNC	protein_coding	OTTHUMT00000347054.3	-	0.00	31	0	A	NM_014932		173996722	+1	tier1	-	no_errors	ENST00000401917	ensembl	human	known	74_37	missense	25.81	23	8	SNP	1.000	C
NMUR2	56923	genome.wustl.edu	37	5	151775087	151775087	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr5:151775087G>T	ENST00000255262.3	-	3	1035	c.870C>A	c.(868-870)ttC>ttA	p.F290L	NMUR2_ENST00000518933.1_5'UTR	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	290					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)			breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			CAAAGCTGAAGAAGAGTCGGT	0.483																																																	0													156.0	136.0	143.0					5																	151775087		2203	4300	6503	SO:0001583	missense	0			AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.870C>A	5.37:g.151775087G>T	ENSP00000255262:p.Phe290Leu		Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NeuromedU_rcpt_2,prints_NeuromedU_rcpt,prints_GPCR_Rhodpsn	p.F290L	ENST00000255262.3	37	c.870	CCDS4321.1	5	.	.	.	.	.	.	.	.	.	.	G	14.52	2.559023	0.45590	.	.	ENSG00000132911	ENST00000255262	T	0.34072	1.38	5.8	5.8	0.92144	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.23249	0.0562	N	0.02665	-0.54	0.53688	D	0.999977	P	0.48503	0.911	P	0.49752	0.621	T	0.11717	-1.0576	10	0.06494	T	0.89	-40.6947	19.0512	0.93046	0.0:0.0:1.0:0.0	.	290	Q9GZQ4	NMUR2_HUMAN	L	290	ENSP00000255262:F290L	ENSP00000255262:F290L	F	-	3	2	NMUR2	151755280	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.420000	0.59841	2.735000	0.93741	0.655000	0.94253	TTC	NMUR2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NeuromedU_rcpt_2,prints_NeuromedU_rcpt,prints_GPCR_Rhodpsn	ENSG00000132911		0.483	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMUR2	HGNC	protein_coding	OTTHUMT00000252439.1	-	0.00	32	0	G	NM_020167		151775087	-1	tier1	-	no_errors	ENST00000255262	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
NOC4L	79050	genome.wustl.edu	37	12	132632280	132632280	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr12:132632280C>A	ENST00000330579.1	+	5	597	c.556C>A	c.(556-558)Cag>Aag	p.Q186K	NOC4L_ENST00000535343.1_3'UTR	NM_024078.1	NP_076983.1	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog (S. cerevisiae)	186					rRNA processing (GO:0006364)	integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|skin(2)	14	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		CCACACCATGCAGGCAGCCGT	0.667																																																	0													66.0	68.0	67.0					12																	132632280		2202	4298	6500	SO:0001583	missense	0				CCDS9277.1	12q24.33	2011-08-12			ENSG00000184967	ENSG00000184967			28461	protein-coding gene	gene with protein product		612819				12446671	Standard	NM_024078		Approved	MGC3162, NET49, UTP19	uc001ujz.1	Q9BVI4	OTTHUMG00000168260	ENST00000330579.1:c.556C>A	12.37:g.132632280C>A	ENSP00000328854:p.Gln186Lys		Q8N2S5|Q96I14	Missense_Mutation	SNP	pfam_CCAAT-binding_factor,superfamily_ARM-type_fold	p.Q186K	ENST00000330579.1	37	c.556	CCDS9277.1	12	.	.	.	.	.	.	.	.	.	.	C	0.602	-0.828460	0.02734	.	.	ENSG00000184967	ENST00000330579;ENST00000541954	T;T	0.33654	1.4;1.4	4.98	4.98	0.66077	Armadillo-like helical (1);	0.269284	0.39985	N	0.001208	T	0.28599	0.0708	L	0.53249	1.67	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.10382	-1.0632	10	0.02654	T	1	-23.7486	11.4624	0.50219	0.3067:0.6933:0.0:0.0	.	186	Q9BVI4	NOC4L_HUMAN	K	186;153	ENSP00000328854:Q186K;ENSP00000438255:Q153K	ENSP00000328854:Q186K	Q	+	1	0	NOC4L	131198233	1.000000	0.71417	0.829000	0.32907	0.092000	0.18411	1.574000	0.36482	2.291000	0.77112	0.655000	0.94253	CAG	NOC4L	-	superfamily_ARM-type_fold	ENSG00000184967		0.667	NOC4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOC4L	HGNC	protein_coding	OTTHUMT00000398999.1		0.00	47	0	C	NM_024078		132632280	+1			no_errors	ENST00000330579	ensembl	human	known	74_37	missense	5.08	56	3	SNP	0.999	A
NPBWR1	2831	genome.wustl.edu	37	8	53852892	53852892	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr8:53852892C>T	ENST00000331251.3	+	1	1902	c.425C>T	c.(424-426)gCg>gTg	p.A142V		NM_005285.3	NP_005276.2	P48145	NPBW1_HUMAN	neuropeptides B/W receptor 1	142					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)|regulation of metabolic process (GO:0019222)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)	17		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				TTGGCCACTGCGGAGTCGCGC	0.667																																																	0													21.0	23.0	22.0					8																	53852892		2199	4288	6487	SO:0001583	missense	0			BC033145	CCDS6151.1	8p22-q21.13	2012-08-08	2006-02-15	2006-02-15		ENSG00000183729		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4522	protein-coding gene	gene with protein product		600730	"""G protein-coupled receptor 7"""	GPR7		7590751, 12401809	Standard	NM_005285		Approved		uc011ldu.2	P48145		ENST00000331251.3:c.425C>T	8.37:g.53852892C>T	ENSP00000330284:p.Ala142Val		Q6NTC7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Neuropept_B/W_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_Opioid_rcpt	p.A142V	ENST00000331251.3	37	c.425	CCDS6151.1	8	.	.	.	.	.	.	.	.	.	.	C	5.068	0.198162	0.09652	.	.	ENSG00000183729	ENST00000331251	T	0.36157	1.27	5.06	4.1	0.47936	GPCR, rhodopsin-like superfamily (1);	0.511994	0.17463	N	0.173368	T	0.08802	0.0218	N	0.00742	-1.23	0.34296	D	0.683829	B	0.25904	0.137	B	0.17722	0.019	T	0.29610	-1.0006	10	0.05351	T	0.99	.	8.1352	0.31050	0.0:0.7771:0.0:0.2229	.	142	P48145	NPBW1_HUMAN	V	142	ENSP00000330284:A142V	ENSP00000330284:A142V	A	+	2	0	NPBWR1	54015445	1.000000	0.71417	0.801000	0.32222	0.479000	0.33129	3.843000	0.55865	2.623000	0.88846	0.655000	0.94253	GCG	NPBWR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Neuropept_B/W_rcpt	ENSG00000183729		0.667	NPBWR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPBWR1	HGNC	protein_coding	OTTHUMT00000378047.1	-	0.00	60	0	C	NM_005285		53852892	+1	tier1	-	no_errors	ENST00000331251	ensembl	human	known	74_37	missense	17.12	92	19	SNP	0.930	T
NR2C1	7181	genome.wustl.edu	37	12	95434294	95434294	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr12:95434294G>T	ENST00000333003.5	-	10	1541	c.1211C>A	c.(1210-1212)tCa>tAa	p.S404*	NR2C1_ENST00000545833.1_5'UTR|NR2C1_ENST00000330677.7_Nonsense_Mutation_p.S404*|NR2C1_ENST00000393101.3_Nonsense_Mutation_p.S404*	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	404					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						CCAGTGCATTGATAAGAACAG	0.423																																																	0													119.0	99.0	106.0					12																	95434294		2203	4300	6503	SO:0001587	stop_gained	0			M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.1211C>A	12.37:g.95434294G>T	ENSP00000333275:p.Ser404*		A8K5K4|Q15625|Q15626	Nonsense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	p.S404*	ENST00000333003.5	37	c.1211	CCDS9051.1	12	.	.	.	.	.	.	.	.	.	.	G	36	5.673873	0.96764	.	.	ENSG00000120798	ENST00000333003;ENST00000393101;ENST00000330677	.	.	.	6.06	6.06	0.98353	.	0.052397	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	.	.	.	X	404	.	ENSP00000328843:S404X	S	-	2	0	NR2C1	93958425	1.000000	0.71417	0.998000	0.56505	0.649000	0.38597	9.835000	0.99442	2.882000	0.98803	0.655000	0.94253	TCA	NR2C1	-	superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	ENSG00000120798		0.423	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2C1	HGNC	protein_coding	OTTHUMT00000407565.2		0.00	40	0	G	NM_003297		95434294	-1			no_errors	ENST00000333003	ensembl	human	known	74_37	nonsense	6.56	57	4	SNP	1.000	T
NUP160	23279	genome.wustl.edu	37	11	47869783	47869783	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr11:47869783C>T	ENST00000378460.2	-	1	236	c.190G>A	c.(190-192)Gtc>Atc	p.V64I	NUP160_ENST00000532747.1_Missense_Mutation_p.V30I|NUP160_ENST00000526870.1_Missense_Mutation_p.V64I|NUP160_ENST00000530326.1_5'UTR	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	64					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						ATGCTGCAGACTGTGAATTCC	0.642																																																	0													76.0	78.0	77.0					11																	47869783		2201	4298	6499	SO:0001583	missense	0			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.190G>A	11.37:g.47869783C>T	ENSP00000367721:p.Val64Ile		B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	pfam_Nucleoporin_Nup160	p.V64I	ENST00000378460.2	37	c.190	CCDS31484.1	11	.	.	.	.	.	.	.	.	.	.	C	17.94	3.512077	0.64522	.	.	ENSG00000030066	ENST00000378460;ENST00000532747;ENST00000526870	T;T;T	0.50548	0.74;0.74;0.74	5.01	3.09	0.35607	.	0.212897	0.29799	N	0.011166	T	0.21145	0.0509	N	0.04508	-0.205	0.09310	N	1	B;B	0.21147	0.052;0.001	B;B	0.21151	0.033;0.003	T	0.19386	-1.0307	10	0.09338	T	0.73	.	9.6243	0.39741	0.0:0.8196:0.0:0.1804	.	64;64	Q12769-2;Q12769	.;NU160_HUMAN	I	64;30;64	ENSP00000367721:V64I;ENSP00000432437:V30I;ENSP00000431495:V64I	ENSP00000367721:V64I	V	-	1	0	NUP160	47826359	0.055000	0.20627	0.301000	0.25044	0.748000	0.42578	0.650000	0.24858	1.235000	0.43724	0.491000	0.48974	GTC	NUP160	-	pfam_Nucleoporin_Nup160	ENSG00000030066		0.642	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP160	HGNC	protein_coding	OTTHUMT00000390239.2	-	0.00	46	0	C	NM_015231		47869783	-1	tier1	-	no_errors	ENST00000378460	ensembl	human	known	74_37	missense	13.43	58	9	SNP	0.154	T
OBSL1	23363	genome.wustl.edu	37	2	220432177	220432177	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:220432177C>T	ENST00000404537.1	-	4	1711	c.1655G>A	c.(1654-1656)cGg>cAg	p.R552Q	OBSL1_ENST00000603926.1_Missense_Mutation_p.R552Q|OBSL1_ENST00000373873.4_Missense_Mutation_p.R552Q|OBSL1_ENST00000289656.3_Missense_Mutation_p.R139Q|OBSL1_ENST00000373876.1_Missense_Mutation_p.R552Q|OBSL1_ENST00000265318.4_Missense_Mutation_p.R552Q	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	552	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CCGCTCCAGCCGGTAGATGAA	0.617																																																	0													21.0	27.0	25.0					2																	220432177		2019	4172	6191	SO:0001583	missense	0			BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.1655G>A	2.37:g.220432177C>T	ENSP00000385636:p.Arg552Gln		A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R552Q	ENST00000404537.1	37	c.1655	CCDS46520.1	2	.	.	.	.	.	.	.	.	.	.	C	21.5	4.162877	0.78226	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000373873;ENST00000289656	T;T;T;T;T	0.58652	0.54;0.48;0.44;0.32;0.86	4.92	4.92	0.64577	Fibronectin, type III (3);Immunoglobulin-like fold (1);	.	.	.	.	T	0.66056	0.2751	L	0.43152	1.355	0.27927	N	0.938036	D;D;D;D	0.76494	0.999;0.998;0.998;0.99	D;D;P;P	0.79108	0.99;0.992;0.743;0.731	T	0.55995	-0.8052	9	0.28530	T	0.3	.	10.938	0.47257	0.2387:0.7613:0.0:0.0	.	553;552;139;552	A4KVA4;O75147;A8MSZ8;O75147-2	.;OBSL1_HUMAN;.;.	Q	552;552;552;552;139	ENSP00000265318:R552Q;ENSP00000385636:R552Q;ENSP00000362983:R552Q;ENSP00000362980:R552Q;ENSP00000289656:R139Q	ENSP00000265318:R552Q	R	-	2	0	OBSL1	220140421	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.291000	0.65667	2.569000	0.86673	0.561000	0.74099	CGG	OBSL1	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000124006		0.617	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	OBSL1	HGNC	protein_coding	OTTHUMT00000322012.1	-	0.00	64	0	C			220432177	-1	tier1	-	no_errors	ENST00000404537	ensembl	human	known	74_37	missense	14.49	59	10	SNP	0.991	T
CENPP	401541	genome.wustl.edu	37	9	95152121	95152121	+	Intron	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr9:95152121C>T	ENST00000375587.3	+	5	1079				OGN_ENST00000468743.1_5'UTR|OGN_ENST00000375561.5_Intron|OGN_ENST00000262551.4_Intron	NM_001012267.1	NP_001012267.1	Q6IPU0	CENPP_HUMAN	centromere protein P						CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(1)	16						CTTAGTTTTACTATAAAATAC	0.279																																																	0													70.0	70.0	70.0					9																	95152121		2203	4297	6500	SO:0001627	intron_variant	0			AK091247	CCDS35063.1, CCDS69618.1	9q22.31	2013-11-05			ENSG00000188312	ENSG00000188312			32933	protein-coding gene	gene with protein product		611505				16622419, 16622420	Standard	NM_001286969		Approved	RP11-19J3.3, CENP-P	uc004arz.3	Q6IPU0	OTTHUMG00000020228	ENST00000375587.3:c.564+9980C>T	9.37:g.95152121C>T			B3KRA5|B3KS17|Q5T9F8|Q5T9F9	RNA	SNP	-	NULL	ENST00000375587.3	37	NULL	CCDS35063.1	9																																																																																			OGN	-	-	ENSG00000106809		0.279	CENPP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	OGN	HGNC	protein_coding	OTTHUMT00000053098.1	-	0.00	43	0	C	NM_001012267		95152121	-1	tier1	-	no_errors	ENST00000468743	ensembl	human	known	74_37	rna	8.43	76	7	SNP	0.000	T
OR10H5	284433	genome.wustl.edu	37	19	15904866	15904866	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:15904866G>A	ENST00000308940.8	+	1	106	c.8G>A	c.(7-9)gGg>gAg	p.G3E		NM_001004466.1	NP_001004466.1	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H, member 5	3						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(9)|ovary(1)	20						GCCATGCAGGGGCTAAACCAC	0.572																																																	0													170.0	144.0	153.0					19																	15904866		2203	4300	6503	SO:0001583	missense	0			AC011537	CCDS32940.1	19p13.12	2013-09-24			ENSG00000172519	ENSG00000172519		"""GPCR / Class A : Olfactory receptors"""	15389	protein-coding gene	gene with protein product							Standard	NM_001004466		Approved		uc010xos.2	Q8NGA6	OTTHUMG00000182284	ENST00000308940.8:c.8G>A	19.37:g.15904866G>A	ENSP00000310704:p.Gly3Glu		Q6IFJ0|Q96R60	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G3E	ENST00000308940.8	37	c.8	CCDS32940.1	19	.	.	.	.	.	.	.	.	.	.	.	3.352	-0.132342	0.06753	.	.	ENSG00000172519	ENST00000308940	T	0.02916	4.11	3.48	1.27	0.21489	.	0.361669	0.20115	N	0.098937	T	0.01523	0.0049	N	0.13168	0.305	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.49224	-0.8962	10	0.05351	T	0.99	.	7.3401	0.26632	0.2301:0.0:0.7699:0.0	.	3	Q8NGA6	O10H5_HUMAN	E	3	ENSP00000310704:G3E	ENSP00000310704:G3E	G	+	2	0	OR10H5	15765866	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.110000	0.10824	0.121000	0.18284	0.591000	0.81541	GGG	OR10H5	-	NULL	ENSG00000172519		0.572	OR10H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H5	HGNC	protein_coding	OTTHUMT00000460363.1	-	0.00	76	0	G			15904866	+1	tier1	-	no_errors	ENST00000308940	ensembl	human	known	74_37	missense	5.77	98	6	SNP	0.001	A
OR10Z1	128368	genome.wustl.edu	37	1	158576428	158576428	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:158576428C>T	ENST00000361284.1	+	1	200	c.200C>T	c.(199-201)tCc>tTc	p.S67F		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S67F(1)		endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					TCCTTCCTATCCTTCTCTGAG	0.532																																																	1	Substitution - Missense(1)	large_intestine(1)											249.0	244.0	246.0					1																	158576428		2203	4300	6503	SO:0001583	missense	0			AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.200C>T	1.37:g.158576428C>T	ENSP00000354707:p.Ser67Phe		Q5VYL0|Q6IFR7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S67F	ENST00000361284.1	37	c.200	CCDS30901.1	1	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641731	0.29157	.	.	ENSG00000198967	ENST00000361284	T	0.12361	2.69	5.36	5.36	0.76844	GPCR, rhodopsin-like superfamily (1);	0.184684	0.26800	N	0.022426	T	0.42381	0.1200	H	0.95402	3.665	0.19300	N	0.999971	D	0.76494	0.999	D	0.70716	0.97	T	0.52026	-0.8630	10	0.87932	D	0	.	18.0328	0.89290	0.0:1.0:0.0:0.0	.	67	Q8NGY1	O10Z1_HUMAN	F	67	ENSP00000354707:S67F	ENSP00000354707:S67F	S	+	2	0	OR10Z1	156843052	0.064000	0.20934	0.281000	0.24762	0.012000	0.07955	2.453000	0.44970	2.783000	0.95769	0.655000	0.94253	TCC	OR10Z1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000198967		0.532	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Z1	HGNC	protein_coding	OTTHUMT00000051853.1	-	0.00	81	0	C	NM_001004478		158576428	+1	tier1	-	no_errors	ENST00000361284	ensembl	human	known	74_37	missense	8.05	137	12	SNP	0.233	T
OR2AJ1	127608	genome.wustl.edu	37	1	248097435	248097435	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:248097435G>T	ENST00000318244.3	+	1	365	c.365G>T	c.(364-366)cGc>cTc	p.R122L				Q8NGZ0	O2AJ1_HUMAN	olfactory receptor, family 2, subfamily AJ, member 1	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(1)|pancreas(1)	2						TCCTGTGATCGCTATGTGGCT	0.532																																																	0																																										SO:0001583	missense	0					1q44	2013-03-27	2004-03-04	2004-03-05	ENSG00000177275	ENSG00000177275		"""GPCR / Class A : Olfactory receptors"""	15001	other	unknown			"""olfactory receptor, family 2, subfamily AJ, member 1 pseudogene"""	OR2AJ1P			Standard	NG_004652		Approved	OR2AJ1Q		Q8NGZ0	OTTHUMG00000040206	ENST00000318244.3:c.365G>T	1.37:g.248097435G>T	ENSP00000325078:p.Arg122Leu			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R122L	ENST00000318244.3	37	c.365		1	.	.	.	.	.	.	.	.	.	.	G	17.77	3.471108	0.63625	.	.	ENSG00000177275	ENST00000318244	T	0.77358	-1.09	4.03	3.12	0.35913	.	0.000000	0.35378	U	0.003247	T	0.81322	0.4798	.	.	.	0.33168	D	0.547871	.	.	.	.	.	.	D	0.86406	0.1745	7	0.87932	D	0	.	11.3813	0.49759	0.0907:0.0:0.9093:0.0	.	.	.	.	L	122	ENSP00000325078:R122L	ENSP00000325078:R122L	R	+	2	0	OR2AJ1	246164058	0.411000	0.25384	0.573000	0.28510	0.984000	0.73092	3.700000	0.54786	0.899000	0.36444	0.585000	0.79938	CGC	OR2AJ1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000177275		0.532	OR2AJ1-001	KNOWN	basic|appris_principal	protein_coding	OR2AJ1	HGNC	protein_coding	OTTHUMT00000096863.1	-	0.00	76	0	G	NG_004652		248097435	+1	tier1	-	no_errors	ENST00000318244	ensembl	human	known	74_37	missense	16.49	81	16	SNP	1.000	T
OR51M1	390059	genome.wustl.edu	37	11	5411391	5411391	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr11:5411391G>A	ENST00000328611.3	+	1	785	c.763G>A	c.(763-765)Gct>Act	p.A255T	AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron	NM_001004756.2	NP_001004756.2	Q9H341	O51M1_HUMAN	olfactory receptor, family 51, subfamily M, member 1	255					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|upper_aerodigestive_tract(1)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GACATGCACCGCTCCTCTCTG	0.567																																																	0													104.0	96.0	99.0					11																	5411391		2062	4202	6264	SO:0001583	missense	0			BK004382	CCDS53596.1	11p15.4	2012-08-09			ENSG00000184698	ENSG00000184698		"""GPCR / Class A : Olfactory receptors"""	14847	protein-coding gene	gene with protein product							Standard	NM_001004756		Approved		uc010qzc.2	Q9H341	OTTHUMG00000066680	ENST00000328611.3:c.763G>A	11.37:g.5411391G>A	ENSP00000333196:p.Ala255Thr		Q6IF80	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A255T	ENST00000328611.3	37	c.763	CCDS53596.1	11	.	.	.	.	.	.	.	.	.	.	G	6.143	0.394572	0.11638	.	.	ENSG00000184698	ENST00000328611	T	0.37235	1.21	5.24	2.94	0.34122	GPCR, rhodopsin-like superfamily (1);	0.293778	0.18430	U	0.141472	T	0.28764	0.0713	L	0.41236	1.265	0.09310	N	1	B	0.27286	0.174	B	0.29785	0.107	T	0.26430	-1.0103	10	0.87932	D	0	.	6.9868	0.24733	0.1373:0.0:0.3092:0.5535	.	244	Q9H341	O51M1_HUMAN	T	255	ENSP00000333196:A255T	ENSP00000333196:A255T	A	+	1	0	OR51M1	5367967	0.000000	0.05858	0.318000	0.25279	0.038000	0.13279	0.108000	0.15396	0.468000	0.27243	-1.070000	0.02257	GCT	OR51M1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000184698		0.567	OR51M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51M1	HGNC	protein_coding	OTTHUMT00000142981.1	-	0.00	64	0	G	NM_001004756		5411391	+1	tier1	-	no_errors	ENST00000328611	ensembl	human	known	74_37	missense	18.57	57	13	SNP	0.028	A
OR4A16	81327	genome.wustl.edu	37	11	55110724	55110724	+	Silent	SNP	T	T	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr11:55110724T>A	ENST00000314721.2	+	1	98	c.48T>A	c.(46-48)acT>acA	p.T16T		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	16						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						TGGGCCTCACTCAAGATCCTG	0.398																																																	0													61.0	56.0	58.0					11																	55110724		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.48T>A	11.37:g.55110724T>A			Q6IFL3	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T16	ENST00000314721.2	37	c.48	CCDS31499.1	11																																																																																			OR4A16	-	NULL	ENSG00000181961		0.398	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A16	HGNC	protein_coding	OTTHUMT00000391160.1		0.00	29	0	T	NM_001005274		55110724	+1			no_errors	ENST00000314721	ensembl	human	known	74_37	silent	6.82	41	3	SNP	0.011	A
OR4A16	81327	genome.wustl.edu	37	11	55110731	55110731	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr11:55110731C>A	ENST00000314721.2	+	1	105	c.55C>A	c.(55-57)Cct>Act	p.P19T		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	19						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						CACTCAAGATCCTGATGTGAA	0.408																																																	0													67.0	61.0	63.0					11																	55110731		2201	4296	6497	SO:0001583	missense	0			AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.55C>A	11.37:g.55110731C>A	ENSP00000325128:p.Pro19Thr		Q6IFL3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P19T	ENST00000314721.2	37	c.55	CCDS31499.1	11	.	.	.	.	.	.	.	.	.	.	C	4.172	0.030456	0.08101	.	.	ENSG00000181961	ENST00000314721	T	0.00428	7.44	2.41	2.41	0.29592	.	.	.	.	.	T	0.00496	0.0016	M	0.78456	2.415	0.09310	N	1	B	0.27416	0.178	B	0.34093	0.175	T	0.37430	-0.9706	9	0.72032	D	0.01	.	5.122	0.14865	0.0:0.8262:0.0:0.1738	.	19	Q8NH70	O4A16_HUMAN	T	19	ENSP00000325128:P19T	ENSP00000325128:P19T	P	+	1	0	OR4A16	54867307	0.000000	0.05858	0.779000	0.31741	0.009000	0.06853	0.125000	0.15749	1.353000	0.45828	0.185000	0.17295	CCT	OR4A16	-	NULL	ENSG00000181961		0.408	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A16	HGNC	protein_coding	OTTHUMT00000391160.1	-	0.00	31	0	C	NM_001005274		55110731	+1	tier1	-	no_errors	ENST00000314721	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.001	A
OR6N2	81442	genome.wustl.edu	37	1	158746862	158746862	+	Silent	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:158746862G>T	ENST00000339258.1	-	1	563	c.564C>A	c.(562-564)gcC>gcA	p.A188A		NM_001005278.1	NP_001005278.1	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N, member 2	188						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(6)|lung(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(112;0.0378)					TGTCCTTGCAGGCCAAGCTCA	0.413																																																	0													46.0	45.0	45.0					1																	158746862		2203	4300	6503	SO:0001819	synonymous_variant	0			BK004200	CCDS30906.1	1q23.1	2012-08-09			ENSG00000188340	ENSG00000188340		"""GPCR / Class A : Olfactory receptors"""	15035	protein-coding gene	gene with protein product							Standard	NM_001005278		Approved		uc010pir.2	Q8NGY6	OTTHUMG00000022775	ENST00000339258.1:c.564C>A	1.37:g.158746862G>T			Q6IFR2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A188	ENST00000339258.1	37	c.564	CCDS30906.1	1																																																																																			OR6N2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000188340		0.413	OR6N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6N2	HGNC	protein_coding	OTTHUMT00000059068.1	-	0.00	13	0	G			158746862	-1	tier1	-	no_errors	ENST00000339258	ensembl	human	known	74_37	silent	21.62	29	8	SNP	0.753	T
PCDH11X	27328	genome.wustl.edu	37	X	91134272	91134272	+	Splice_Site	SNP	G	G	A	rs138111592	byFrequency	TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chrX:91134272G>A	ENST00000373094.1	+	2	3878	c.3033G>A	c.(3031-3033)ccG>ccA	p.P1011P	PCDH11X_ENST00000373088.1_Splice_Site_p.P1011P|PCDH11X_ENST00000504220.2_Splice_Site_p.P1011P|PCDH11X_ENST00000373097.1_Splice_Site_p.P1011P|PCDH11X_ENST00000361724.1_Silent_p.P1011P|PCDH11X_ENST00000298274.8_Splice_Site_p.P1011P|PCDH11X_ENST00000361655.2_Splice_Site_p.P1011P|PCDH11X_ENST00000406881.1_Splice_Site_p.P1011P|PCDH11X_ENST00000395337.2_Splice_Site_p.P1011P	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1011					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						ACACCAGACCGGTAGGTATCC	0.403													G|||	3	0.000794702	0.0023	0.0	3775	,	,		14242	0.0		0.0	False		,,,				2504	0.0				NSCLC(38;925 1092 2571 38200 45895)												0								G	,,,,,,,	8,3827		0,5,3,1627,568	107.0	92.0	97.0		3033,3033,3033,3033,3033,3033,3033,3033	4.3	1.0	X	dbSNP_134	97	0,6728		0,0,0,2428,1872	no	coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous,coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice	PCDH11X	NM_001168360.1,NM_001168361.1,NM_001168362.1,NM_001168363.1,NM_014522.1,NM_032967.2,NM_032968.3,NM_032969.3	,,,,,,,	0,5,3,4055,2440	AA,AG,A,GG,G		0.0,0.2086,0.0757	,,,,,,,	1011/1340,1011/1066,1011/1311,1011/1330,1011/1022,1011/1026,1011/1348,1011/1338	91134272	8,10555	2203	4300	6503	SO:0001630	splice_region_variant	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3033+1G>A	X.37:g.91134272G>A			A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Silent	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P1011	ENST00000373094.1	37	c.3033	CCDS14461.1	X																																																																																			PCDH11X	-	NULL	ENSG00000102290		0.403	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	-	0.00	29	0	G	NM_032969	Silent	91134272	+1	tier1	rs138111592	no_errors	ENST00000373094	ensembl	human	known	74_37	silent	35.71	36	20	SNP	1.000	A
PASD1	139135	genome.wustl.edu	37	X	150840900	150840900	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chrX:150840900G>T	ENST00000370357.4	+	14	1928	c.1683G>T	c.(1681-1683)gaG>gaT	p.E561D		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	561						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					cagaggaggagcagcagaagc	0.537																																																	0													88.0	70.0	76.0					X																	150840900		2203	4300	6503	SO:0001583	missense	0			AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1683G>T	X.37:g.150840900G>T	ENSP00000359382:p.Glu561Asp		Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	superfamily_PAS,smart_PAS,pfscan_PAS	p.E561D	ENST00000370357.4	37	c.1683	CCDS35431.1	X	.	.	.	.	.	.	.	.	.	.	G	0.036	-1.305309	0.01353	.	.	ENSG00000166049	ENST00000370357	T	0.68025	-0.3	0.569	-1.14	0.09741	.	.	.	.	.	T	0.39436	0.1078	N	0.08118	0	0.09310	N	1	B	0.20988	0.05	B	0.12156	0.007	T	0.16188	-1.0411	8	0.54805	T	0.06	.	.	.	.	.	561	Q8IV76	PASD1_HUMAN	D	561	ENSP00000359382:E561D	ENSP00000359382:E561D	E	+	3	2	PASD1	150591556	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.700000	0.05081	-0.729000	0.04875	-0.796000	0.03273	GAG	PASD1	-	NULL	ENSG00000166049		0.537	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PASD1	HGNC	protein_coding	OTTHUMT00000060879.2		0.00	8	0	G	NM_173493		150840900	+1			no_errors	ENST00000370357	ensembl	human	known	74_37	missense	19.05	17	4	SNP	0.000	T
PCDH17	27253	genome.wustl.edu	37	13	58207464	58207464	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr13:58207464G>A	ENST00000377918.3	+	1	810	c.784G>A	c.(784-786)Gtc>Atc	p.V262I		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	262	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		GGGTACAGTGGTCATCGATCT	0.582																																					Melanoma(72;952 1291 1619 12849 33676)												0													74.0	63.0	67.0					13																	58207464		2203	4300	6503	SO:0001583	missense	0			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.784G>A	13.37:g.58207464G>A	ENSP00000367151:p.Val262Ile		A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V262I	ENST00000377918.3	37	c.784	CCDS31986.1	13	.	.	.	.	.	.	.	.	.	.	G	8.908	0.957969	0.18507	.	.	ENSG00000118946	ENST00000377918	T	0.63417	-0.04	4.73	4.73	0.59995	Cadherin (4);Cadherin-like (1);	0.129140	0.53938	D	0.000049	T	0.50463	0.1617	N	0.25031	0.7	0.38858	D	0.956416	B;B	0.20052	0.033;0.041	B;B	0.26864	0.044;0.074	T	0.46527	-0.9185	9	.	.	.	.	17.8954	0.88886	0.0:0.0:1.0:0.0	.	262;262	O14917-2;O14917	.;PCD17_HUMAN	I	262	ENSP00000367151:V262I	.	V	+	1	0	PCDH17	57105465	0.994000	0.37717	1.000000	0.80357	0.442000	0.32017	2.218000	0.42889	2.470000	0.83445	0.650000	0.86243	GTC	PCDH17	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000118946		0.582	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH17	HGNC	protein_coding	OTTHUMT00000045139.1	-	0.00	35	0	G	NM_001040429		58207464	+1	tier1	-	no_errors	ENST00000377918	ensembl	human	known	74_37	missense	21.57	39	11	SNP	0.975	A
PCDHA8	56140	genome.wustl.edu	37	5	140220914	140220914	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr5:140220914A>G	ENST00000531613.1	+	1	8	c.8A>G	c.(7-9)tAt>tGt	p.Y3C	PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.Y3C|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	3					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACATGGATTATCACTGGCGA	0.473																																																	0													75.0	80.0	78.0					5																	140220914		2203	4299	6502	SO:0001583	missense	0			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.8A>G	5.37:g.140220914A>G	ENSP00000434655:p.Tyr3Cys		B9EGT7|O75281	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.Y3C	ENST00000531613.1	37	c.8	CCDS54919.1	5	.	.	.	.	.	.	.	.	.	.	A	5.712	0.315874	0.10789	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.51325	0.76;0.71	3.42	-2.83	0.05769	.	0.760740	0.10645	U	0.650541	T	0.20251	0.0487	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.12156	0.001;0.007	T	0.10382	-1.0632	10	0.35671	T	0.21	.	1.586	0.02644	0.301:0.1641:0.3852:0.1497	.	3;3	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	C	3	ENSP00000434655:Y3C;ENSP00000367363:Y3C	ENSP00000367363:Y3C	Y	+	2	0	PCDHA8	140201098	0.089000	0.21612	0.003000	0.11579	0.005000	0.04900	-0.077000	0.11394	-1.144000	0.02862	-1.811000	0.00612	TAT	PCDHA8	-	NULL	ENSG00000204962		0.473	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	HGNC	protein_coding	OTTHUMT00000372830.2	-	0.00	53	0	A	NM_018911		140220914	+1	tier1	-	no_errors	ENST00000531613	ensembl	human	known	74_37	missense	14.06	55	9	SNP	0.001	G
PCDHA9	9752	genome.wustl.edu	37	5	140229147	140229147	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr5:140229147C>T	ENST00000532602.1	+	1	2100	c.1067C>T	c.(1066-1068)tCg>tTg	p.S356L	PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.S356L|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	356	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAAACGCTCTCGGTTCCTGTA	0.502																																					Melanoma(55;1800 1972 14909)												0													133.0	121.0	125.0					5																	140229147		2196	4274	6470	SO:0001583	missense	0			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1067C>T	5.37:g.140229147C>T	ENSP00000436042:p.Ser356Leu		O15053|Q2M3S5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S356L	ENST00000532602.1	37	c.1067	CCDS54920.1	5	.	.	.	.	.	.	.	.	.	.	C	12.69	2.013604	0.35511	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.60040	0.22;0.22	3.79	-4.5	0.03493	Cadherin (2);Cadherin-like (1);	0.327925	0.16309	U	0.220089	T	0.52354	0.1729	L	0.60904	1.88	0.09310	N	1	P;B	0.35656	0.514;0.016	B;B	0.31245	0.126;0.006	T	0.51458	-0.8703	10	0.66056	D	0.02	.	21.9528	0.99964	0.0:0.8658:0.1342:0.0	.	356;356	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	L	356	ENSP00000436042:S356L;ENSP00000367362:S356L	ENSP00000367362:S356L	S	+	2	0	PCDHA9	140209331	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.835000	0.04386	-0.779000	0.04560	0.313000	0.20887	TCG	PCDHA9	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000204961		0.502	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA9	HGNC	protein_coding	OTTHUMT00000372896.2	-	0.00	51	0	C	NM_031857		140229147	+1	tier1	-	no_errors	ENST00000532602	ensembl	human	known	74_37	missense	21.84	68	19	SNP	0.000	T
PCDHA12	56137	genome.wustl.edu	37	5	140255185	140255185	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr5:140255185C>T	ENST00000398631.2	+	1	128	c.128C>T	c.(127-129)aCc>aTc	p.T43I	PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	43	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAACACGGCACCTTCGTGGGC	0.672																																					Pancreas(113;759 1672 13322 24104 50104)												0													43.0	50.0	48.0					5																	140255185		2203	4300	6503	SO:0001583	missense	0			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.128C>T	5.37:g.140255185C>T	ENSP00000381628:p.Thr43Ile		O75278|Q2M1N8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.T43I	ENST00000398631.2	37	c.128	CCDS47285.1	5	.	.	.	.	.	.	.	.	.	.	C	15.36	2.811341	0.50527	.	.	ENSG00000251664	ENST00000398631	T	0.45276	0.9	4.96	4.09	0.47781	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.75737	0.3890	H	0.97611	4.04	0.34988	D	0.754719	D;D	0.76494	0.997;0.999	D;D	0.70935	0.914;0.971	D	0.88976	0.3404	9	0.87932	D	0	.	15.0643	0.71980	0.0:0.8572:0.1428:0.0	.	43;43	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	I	43	ENSP00000381628:T43I	ENSP00000381628:T43I	T	+	2	0	PCDHA12	140235369	0.954000	0.32549	0.953000	0.39169	0.215000	0.24574	7.652000	0.83633	1.086000	0.41228	0.591000	0.81541	ACC	PCDHA12	-	pfam_Cadherin_N,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000251664		0.672	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA12	HGNC	protein_coding	OTTHUMT00000372882.2	-	0.00	80	0	C	NM_018903		140255185	+1	tier1	-	no_errors	ENST00000398631	ensembl	human	known	74_37	missense	14.44	77	13	SNP	0.998	T
PCNXL3	399909	genome.wustl.edu	37	11	65402568	65402568	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr11:65402568C>T	ENST00000355703.3	+	30	5469	c.4930C>T	c.(4930-4932)Cgc>Tgc	p.R1644C	SIPA1_ENST00000534313.1_5'Flank|MIR4690_ENST00000578459.1_RNA	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1644						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						GCCTGGGGTTCGCATGGCCCT	0.647																																																	0													46.0	49.0	48.0					11																	65402568		2110	4226	6336	SO:0001583	missense	0			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.4930C>T	11.37:g.65402568C>T	ENSP00000347931:p.Arg1644Cys		Q6MZN8	Missense_Mutation	SNP	pfam_Pecanex	p.R1644C	ENST00000355703.3	37	c.4930	CCDS44650.1	11	.	.	.	.	.	.	.	.	.	.	C	20.8	4.052860	0.75960	.	.	ENSG00000197136	ENST00000355703	T	0.59364	0.27	4.28	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.80633	0.4660	M	0.92268	3.29	0.54753	D	0.999985	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	D	0.85594	0.1248	10	0.72032	D	0.01	.	14.2725	0.66159	0.0:1.0:0.0:0.0	.	531;1644	Q9H6A9-3;Q9H6A9	.;PCX3_HUMAN	C	1644	ENSP00000347931:R1644C	ENSP00000347931:R1644C	R	+	1	0	PCNXL3	65159144	0.996000	0.38824	1.000000	0.80357	0.936000	0.57629	3.373000	0.52394	2.234000	0.73211	0.563000	0.77884	CGC	PCNXL3	-	pfam_Pecanex	ENSG00000197136		0.647	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL3	HGNC	protein_coding	OTTHUMT00000390321.1	-	0.00	47	0	C	NM_032223		65402568	+1	tier1	-	no_errors	ENST00000355703	ensembl	human	known	74_37	missense	21.74	54	15	SNP	1.000	T
PDCD11	22984	genome.wustl.edu	37	10	105178266	105178266	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr10:105178266C>T	ENST00000369797.3	+	15	2075	c.1981C>T	c.(1981-1983)Cgt>Tgt	p.R661C		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	661	S1 motif 7. {ECO:0000255|PROSITE- ProRule:PRU00180}.				mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CCACAACATCCGTGCTTTCCT	0.522																																																	0													195.0	148.0	164.0					10																	105178266		2203	4300	6503	SO:0001583	missense	0			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.1981C>T	10.37:g.105178266C>T	ENSP00000358812:p.Arg661Cys		Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Suf,superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,smart_HAT,pfscan_TPR-contain_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,prints_Ribosomal_S1	p.R661C	ENST00000369797.3	37	c.1981	CCDS31276.1	10	.	.	.	.	.	.	.	.	.	.	C	12.77	2.037773	0.35989	.	.	ENSG00000148843	ENST00000369797;ENST00000543503	T	0.12361	2.69	5.8	3.87	0.44632	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (1);	0.528828	0.22864	N	0.054717	T	0.08223	0.0205	N	0.14661	0.345	0.09310	N	1	P	0.45396	0.857	B	0.42653	0.394	T	0.15925	-1.0420	10	0.62326	D	0.03	-1.9144	6.2675	0.20936	0.1922:0.5534:0.186:0.0684	.	661	Q14690	RRP5_HUMAN	C	661	ENSP00000358812:R661C	ENSP00000358812:R661C	R	+	1	0	PDCD11	105168256	0.000000	0.05858	0.839000	0.33178	0.041000	0.13682	0.218000	0.17622	2.747000	0.94245	0.462000	0.41574	CGT	PDCD11	-	superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	ENSG00000148843		0.522	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD11	HGNC	protein_coding	OTTHUMT00000050151.1	-	0.00	73	0	C			105178266	+1	tier1	-	no_errors	ENST00000369797	ensembl	human	known	74_37	missense	19.32	71	17	SNP	0.004	T
PDE4DIP	9659	genome.wustl.edu	37	1	144930990	144930990	+	Intron	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:144930990G>A	ENST00000369354.3	-	6	826				PDE4DIP_ENST00000369356.4_Intron|PDE4DIP_ENST00000313382.9_Intron|PDE4DIP_ENST00000369349.3_Intron|PDE4DIP_ENST00000369359.4_Intron|PDE4DIP_ENST00000530740.1_Intron|PDE4DIP_ENST00000369351.3_Intron|PDE4DIP_ENST00000479408.2_Intron|PDE4DIP_ENST00000529945.1_Missense_Mutation_p.S240F|PDE4DIP_ENST00000313431.9_Missense_Mutation_p.S240F			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TTCCACAGAGGAACCAGGCGT	0.522			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													133.0	133.0	133.0					1																	144930990		2203	4300	6503	SO:0001627	intron_variant	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.637-7169C>T	1.37:g.144930990G>A			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S240F	ENST00000369354.3	37	c.719	CCDS30824.1	1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.924041	0.52653	.	.	ENSG00000178104	ENST00000369353;ENST00000313431;ENST00000529945	T;T	0.18016	2.24;2.25	5.39	5.39	0.77823	.	.	.	.	.	T	0.31327	0.0793	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.70016	0.967	T	0.03060	-1.1077	9	0.87932	D	0	.	16.6447	0.85173	0.0:0.0:1.0:0.0	.	240	Q5VU43-2	.	F	240	ENSP00000316434:S240F;ENSP00000433392:S240F	ENSP00000316434:S240F	S	-	2	0	PDE4DIP	143642347	1.000000	0.71417	0.938000	0.37757	0.114000	0.19823	8.466000	0.90387	2.529000	0.85273	0.491000	0.48974	TCC	PDE4DIP	-	NULL	ENSG00000178104		0.522	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	-	0.00	55	0	G	NM_022359		144930990	-1	tier1	-	no_errors	ENST00000313431	ensembl	human	known	74_37	missense	12.22	79	11	SNP	1.000	A
PKD1L2	114780	genome.wustl.edu	37	16	81208261	81208261	+	RNA	SNP	G	G	A	rs200844830	byFrequency	TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr16:81208261G>A	ENST00000527937.1	-	0	723				PKD1L2_ENST00000531391.1_RNA|PKD1L2_ENST00000337114.4_RNA|PKD1L2_ENST00000525539.1_RNA|PKD1L2_ENST00000533478.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CCAAATGGCCGCACGCAGACC	0.592																																																	0																																												0			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81208261G>A			Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	superfamily_Coatomer/clathrin_app_Ig-like,pfscan_REJ-like	p.R204W	ENST00000527937.1	37	c.610		16	.	.	.	.	.	.	.	.	.	.	G	9.600	1.128471	0.21041	.	.	ENSG00000166473	ENST00000527937	T	0.23754	1.89	2.64	-2.18	0.07037	.	.	.	.	.	T	0.16214	0.0390	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25779	-1.0122	8	0.87932	D	0	.	4.5974	0.12336	0.3758:0.1693:0.455:0.0	.	204	Q7Z442-6	.	W	204	ENSP00000432818:R204W	ENSP00000432818:R204W	R	-	1	2	PKD1L2	79765762	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.610000	0.05629	-0.779000	0.04560	-1.164000	0.01763	CGG	PKD1L2	-	pfscan_REJ-like	ENSG00000166473		0.592	PKD1L2-007	KNOWN	basic|exp_conf	protein_coding	PKD1L2	HGNC	polymorphic_pseudogene	OTTHUMT00000387978.1	-	0.00	29	0	G			81208261	-1	tier1	rs200844830	no_errors	ENST00000527937	ensembl	human	known	74_37	missense	18.18	36	8	SNP	0.000	A
PKDREJ	10343	genome.wustl.edu	37	22	46653522	46653522	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr22:46653522C>A	ENST00000253255.5	-	1	5697	c.5698G>T	c.(5698-5700)Gaa>Taa	p.E1900*		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	1900					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		TCTTGAAGTTCTTTGAGCCTC	0.388																																																	0													105.0	113.0	110.0					22																	46653522		2203	4300	6503	SO:0001587	stop_gained	0			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.5698G>T	22.37:g.46653522C>A	ENSP00000253255:p.Glu1900*		B1AJY3|O95850	Nonsense_Mutation	SNP	pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_PLAT/LH2_dom,pfam_Ion_trans_dom,superfamily_Lipase_LipOase,smart_GPS_dom,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,pfscan_REJ-like,prints_PKD_2	p.E1900*	ENST00000253255.5	37	c.5698	CCDS14073.1	22	.	.	.	.	.	.	.	.	.	.	C	42	9.235987	0.99110	.	.	ENSG00000130943	ENST00000253255	.	.	.	5.55	3.47	0.39725	.	0.572720	0.16487	N	0.212262	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-5.695	5.3888	0.16231	0.1604:0.6712:0.0:0.1684	.	.	.	.	X	1900	.	ENSP00000253255:E1900X	E	-	1	0	PKDREJ	45032186	0.000000	0.05858	0.001000	0.08648	0.251000	0.25915	0.228000	0.17814	0.719000	0.32188	0.455000	0.32223	GAA	PKDREJ	-	pfam_PKD1_2_channel	ENSG00000130943		0.388	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKDREJ	HGNC	protein_coding	OTTHUMT00000318466.1	-	0.00	39	0	C	NM_006071		46653522	-1	tier1	-	no_errors	ENST00000253255	ensembl	human	known	74_37	nonsense	9.68	56	6	SNP	0.000	A
PLCE1	51196	genome.wustl.edu	37	10	96033382	96033382	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr10:96033382A>G	ENST00000371380.3	+	18	4805	c.4570A>G	c.(4570-4572)Atg>Gtg	p.M1524V	PLCE1_ENST00000371375.1_Missense_Mutation_p.M1216V|PLCE1_ENST00000260766.3_Missense_Mutation_p.M1524V|PLCE1_ENST00000371385.3_Missense_Mutation_p.M1216V			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	1524	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				AGATGATCCAATGCTTCCTTC	0.368																																																	0													87.0	83.0	84.0					10																	96033382		1834	4093	5927	SO:0001583	missense	0				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.4570A>G	10.37:g.96033382A>G	ENSP00000360431:p.Met1524Val		A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_Ras-assoc,pfam_RasGRF_CDC25,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Ras_GEF_dom,superfamily_C2_dom,smart_RasGRF_CDC25,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,smart_Ras-assoc,pfscan_C2_dom,pfscan_Ras-assoc,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,pfscan_RasGRF_CDC25,prints_Pinositol_PLipase_C	p.M1524V	ENST00000371380.3	37	c.4570	CCDS41552.1	10	.	.	.	.	.	.	.	.	.	.	A	16.46	3.129153	0.56721	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.62364	0.03;0.03;0.03;0.03	6.17	6.17	0.99709	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.160581	0.64402	D	0.000020	T	0.46464	0.1394	N	0.03115	-0.41	0.32549	N	0.532643	P;P;B	0.45348	0.856;0.519;0.078	P;B;B	0.46718	0.525;0.084;0.18	T	0.55648	-0.8108	10	0.20519	T	0.43	.	16.4957	0.84242	1.0:0.0:0.0:0.0	.	1508;1216;1524	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	V	1524;1524;1216;1216	ENSP00000260766:M1524V;ENSP00000360431:M1524V;ENSP00000360438:M1216V;ENSP00000360426:M1216V	ENSP00000260766:M1524V	M	+	1	0	PLCE1	96023372	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.387000	0.66243	2.371000	0.80710	0.533000	0.62120	ATG	PLCE1	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom,prints_Pinositol_PLipase_C	ENSG00000138193		0.368	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCE1	HGNC	protein_coding	OTTHUMT00000049469.3	-	0.00	32	0	A	NM_016341		96033382	+1	tier1	-	no_errors	ENST00000260766	ensembl	human	known	74_37	missense	24.39	31	10	SNP	1.000	G
POLRMT	5442	genome.wustl.edu	37	19	621120	621120	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:621120G>A	ENST00000588649.2	-	10	2662	c.2578C>T	c.(2578-2580)Cgc>Tgc	p.R860C	LLNLR-299G3.1_ENST00000607288.1_RNA	NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	860	Mediates interaction with TEFM.				gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGGCCAGGCGCTTCCGCAGC	0.692																																																	0													28.0	33.0	31.0					19																	621120		2203	4299	6502	SO:0001583	missense	0				CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.2578C>T	19.37:g.621120G>A	ENSP00000465759:p.Arg860Cys		O60370	Missense_Mutation	SNP	pfam_DNA-dir_Rpol_phage-type	p.R860C	ENST00000588649.2	37	c.2578	CCDS12036.1	19	.	.	.	.	.	.	.	.	.	.	.	13.47	2.247739	0.39697	.	.	ENSG00000099821	ENST00000215591	T	0.61274	0.12	4.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	T	0.78489	0.4291	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.71870	0.975	T	0.82918	-0.0219	10	0.87932	D	0	-39.4919	11.4198	0.49974	0.0:0.0:0.8195:0.1805	.	860	O00411	RPOM_HUMAN	C	860	ENSP00000215591:R860C	ENSP00000215591:R860C	R	-	1	0	POLRMT	572120	1.000000	0.71417	0.400000	0.26346	0.003000	0.03518	3.477000	0.53151	2.283000	0.76528	0.455000	0.32223	CGC	POLRMT	-	pfam_DNA-dir_Rpol_phage-type	ENSG00000099821		0.692	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	POLRMT	HGNC	protein_coding	OTTHUMT00000452172.3	-	0.00	56	0	G	NM_005035		621120	-1	tier1	-	no_errors	ENST00000588649	ensembl	human	known	74_37	missense	31.67	40	19	SNP	0.981	A
POLD1	5424	genome.wustl.edu	37	19	50912814	50912814	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:50912814G>A	ENST00000440232.2	+	17	2098	c.2045G>A	c.(2044-2046)cGg>cAg	p.R682Q	POLD1_ENST00000599857.1_Missense_Mutation_p.R682Q|POLD1_ENST00000595904.1_Missense_Mutation_p.R708Q	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	682					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		GACCCCCTCCGGCGCCAGGTC	0.667								DNA polymerases (catalytic subunits)																																									0													55.0	63.0	60.0					19																	50912814		2203	4299	6502	SO:0001583	missense	0				CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.2045G>A	19.37:g.50912814G>A	ENSP00000406046:p.Arg682Gln		Q8NER3|Q96H98	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	p.R682Q	ENST00000440232.2	37	c.2045	CCDS12795.1	19	.	.	.	.	.	.	.	.	.	.	G	18.69	3.678519	0.68042	.	.	ENSG00000062822	ENST00000440232;ENST00000376930	T	0.15952	2.38	4.38	4.38	0.52667	DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.065701	0.64402	D	0.000014	T	0.14700	0.0355	L	0.46157	1.445	0.40437	D	0.980004	B;B	0.30686	0.29;0.15	B;B	0.29862	0.108;0.041	T	0.05419	-1.0886	10	0.56958	D	0.05	-25.082	7.1744	0.25736	0.1968:0.0:0.8032:0.0	.	708;682	E7EVW0;P28340	.;DPOD1_HUMAN	Q	682;683	ENSP00000406046:R682Q	ENSP00000366129:R683Q	R	+	2	0	POLD1	55604626	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.329000	0.59260	2.190000	0.69967	0.561000	0.74099	CGG	POLD1	-	pfam_DNA-dir_DNA_pol_B_multi_dom,smart_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	ENSG00000062822		0.667	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	POLD1	HGNC	protein_coding	OTTHUMT00000464732.1	-	0.00	43	0	G			50912814	+1	tier1	-	no_errors	ENST00000440232	ensembl	human	known	74_37	missense	10.77	58	7	SNP	1.000	A
PRKCB	5579	genome.wustl.edu	37	16	24192246	24192246	+	Silent	SNP	C	C	A	rs367690547		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr16:24192246C>A	ENST00000321728.7	+	13	1705	c.1530C>A	c.(1528-1530)ccC>ccA	p.P510P	PRKCB_ENST00000303531.7_Silent_p.P510P	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	510	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	ACATCGCCCCCGAGGTGAGAG	0.547																																																	0													127.0	116.0	120.0					16																	24192246		2197	4300	6497	SO:0001819	synonymous_variant	0			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.1530C>A	16.37:g.24192246C>A			C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd,prints_C2_dom	p.P510	ENST00000321728.7	37	c.1530	CCDS10618.1	16																																																																																			PRKCB	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Protein_kinase_C_a/b/g,pfscan_Prot_kinase_dom	ENSG00000166501		0.547	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	HGNC	protein_coding	OTTHUMT00000254504.2	-	0.00	56	0	C	NM_212535		24192246	+1	tier1	-	no_errors	ENST00000303531	ensembl	human	known	74_37	silent	17.72	65	14	SNP	0.009	A
PSG8	440533	genome.wustl.edu	37	19	43257451	43257451	+	IGR	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:43257451G>T	ENST00000306511.4	-	0	1441				PSG8_ENST00000600709.1_5'UTR|PSG8_ENST00000401467.2_3'UTR|PSG8_ENST00000404209.4_3'UTR|PSG8_ENST00000406636.3_3'UTR	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8							extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				ttctggaacagagtgggtctt	0.418																																																	0													70.0	60.0	63.0					19																	43257451		692	1590	2282	SO:0001628	intergenic_variant	0			M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118		19.37:g.43257451G>T			A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	RNA	SNP	-	NULL	ENST00000306511.4	37	NULL	CCDS33037.1	19																																																																																			PSG8	-	-	ENSG00000124467		0.418	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSG8	HGNC	protein_coding	OTTHUMT00000464526.1	-	0.00	55	0	G			43257451	-1	tier1	-	no_errors	ENST00000600709	ensembl	human	known	74_37	rna	20.65	73	19	SNP	0.049	T
PTCHD3	374308	genome.wustl.edu	37	10	27687303	27687303	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr10:27687303T>C	ENST00000438700.3	-	4	2341	c.2224A>G	c.(2224-2226)Aat>Gat	p.N742D		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	742					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						ATGATTTCATTTGATGAAGAA	0.318																																																	0													30.0	32.0	32.0					10																	27687303		2201	4297	6498	SO:0001583	missense	0			AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.2224A>G	10.37:g.27687303T>C	ENSP00000417658:p.Asn742Asp		I3L499|Q6ZU28	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.N742D	ENST00000438700.3	37	c.2224	CCDS31173.1	10	.	.	.	.	.	.	.	.	.	.	T	6.664	0.491095	0.12702	.	.	ENSG00000182077	ENST00000438700	D	0.87809	-2.3	4.55	-0.668	0.11392	.	1.524650	0.03251	N	0.181885	T	0.80691	0.4671	L	0.29908	0.895	0.09310	N	1	B	0.22746	0.074	B	0.30316	0.114	T	0.63310	-0.6666	10	0.12766	T	0.61	-5.8811	9.1921	0.37207	0.0:0.0829:0.414:0.5031	.	742	Q3KNS1	PTHD3_HUMAN	D	742	ENSP00000417658:N742D	ENSP00000417658:N742D	N	-	1	0	PTCHD3	27727309	0.000000	0.05858	0.838000	0.33150	0.811000	0.45836	0.358000	0.20216	0.040000	0.15660	-0.533000	0.04299	AAT	PTCHD3	-	NULL	ENSG00000182077		0.318	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD3	HGNC	protein_coding	OTTHUMT00000047325.3		0.00	24	0	T	XM_370541		27687303	-1			no_errors	ENST00000438700	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.000	C
PTCHD3	374308	genome.wustl.edu	37	10	27702951	27702951	+	Missense_Mutation	SNP	G	G	C	rs570928509	byFrequency	TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr10:27702951G>C	ENST00000438700.3	-	1	346	c.229C>G	c.(229-231)Cgg>Ggg	p.R77G		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	77					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						ATCGACGGCCGGGGGGGTGCA	0.716																																																	0													23.0	30.0	28.0					10																	27702951		2191	4279	6470	SO:0001583	missense	0			AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.229C>G	10.37:g.27702951G>C	ENSP00000417658:p.Arg77Gly		I3L499|Q6ZU28	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.R77G	ENST00000438700.3	37	c.229	CCDS31173.1	10	.	.	.	.	.	.	.	.	.	.	G	1.788	-0.480149	0.04383	.	.	ENSG00000182077	ENST00000438700	D	0.88586	-2.4	2.27	-4.54	0.03452	.	.	.	.	.	T	0.75339	0.3836	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.59757	-0.7394	9	0.54805	T	0.06	.	1.1961	0.01875	0.1401:0.1712:0.345:0.3436	.	77	Q3KNS1	PTHD3_HUMAN	G	77	ENSP00000417658:R77G	ENSP00000417658:R77G	R	-	1	2	PTCHD3	27742957	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.204000	0.09425	-0.802000	0.04421	0.505000	0.49811	CGG	PTCHD3	-	NULL	ENSG00000182077		0.716	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD3	HGNC	protein_coding	OTTHUMT00000047325.3		0.00	15	0	G	XM_370541		27702951	-1			no_errors	ENST00000438700	ensembl	human	known	74_37	missense	7.84	31	4	SNP	0.000	C
PXDN	7837	genome.wustl.edu	37	2	1652754	1652754	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:1652754C>T	ENST00000252804.4	-	17	2848	c.2798G>A	c.(2797-2799)cGc>cAc	p.R933H		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	933					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CAGCAGGCCGCGGTGGCTGGC	0.692																																																	0													16.0	17.0	16.0					2																	1652754		1758	3768	5526	SO:0001583	missense	0			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.2798G>A	2.37:g.1652754C>T	ENSP00000252804:p.Arg933His		A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.R933H	ENST00000252804.4	37	c.2798	CCDS46221.1	2	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631184	0.87660	.	.	ENSG00000130508	ENST00000252804	T	0.69175	-0.38	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.79082	0.4386	L	0.60067	1.865	0.53005	D	0.999968	D	0.69078	0.997	D	0.65140	0.932	T	0.77070	-0.2724	10	0.42905	T	0.14	-44.0952	19.8119	0.96549	0.0:1.0:0.0:0.0	.	933	Q92626	PXDN_HUMAN	H	933	ENSP00000252804:R933H	ENSP00000252804:R933H	R	-	2	0	PXDN	1631761	0.990000	0.36364	0.666000	0.29783	0.991000	0.79684	6.011000	0.70760	2.683000	0.91414	0.558000	0.71614	CGC	PXDN	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000130508		0.692	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDN	HGNC	protein_coding	OTTHUMT00000322505.1	-	0.00	53	0	C	XM_056455		1652754	-1	tier1	-	no_errors	ENST00000252804	ensembl	human	known	74_37	missense	21.57	40	11	SNP	0.813	T
RETSAT	54884	genome.wustl.edu	37	2	85578038	85578038	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:85578038G>T	ENST00000295802.4	-	3	574	c.462C>A	c.(460-462)gaC>gaA	p.D154E	RETSAT_ENST00000263854.6_Missense_Mutation_p.D154E|RETSAT_ENST00000457495.2_Missense_Mutation_p.D93E	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)	154					oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	GTACCATGATGTCAAAAGGAG	0.532																																																	0													79.0	73.0	75.0					2																	85578038		2203	4300	6503	SO:0001583	missense	0			AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.462C>A	2.37:g.85578038G>T	ENSP00000295802:p.Asp154Glu		A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Missense_Mutation	SNP	pfam_Amino_oxidase,pfam_FAD_bind_dom,pfam_FAD-dep_OxRdtase,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_mOase_FAD-bd	p.D154E	ENST00000295802.4	37	c.462	CCDS1972.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.3|23.3	4.401560|4.401560	0.83120|0.83120	.|.	.|.	ENSG00000042445|ENSG00000042445	ENST00000295802;ENST00000263854;ENST00000457495|ENST00000409984	T;T;T|.	0.61627|.	0.09;0.09;0.09|.	5.92|5.92	4.99|4.99	0.66335|0.66335	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74397|0.74397	0.3711|0.3711	M|M	0.85710|0.85710	2.77|2.77	0.49389|0.49389	D|D	0.999781|0.999781	D;D|.	0.69078|.	0.997;0.995|.	D;D|.	0.72075|.	0.976;0.922|.	T|T	0.76130|0.76130	-0.3072|-0.3072	9|5	.|.	.|.	.|.	-29.5616|-29.5616	8.3065|8.3065	0.32045|0.32045	0.1904:0.0:0.8096:0.0|0.1904:0.0:0.8096:0.0	.|.	93;154|.	G5E9N3;Q6NUM9|.	.;RETST_HUMAN|.	E|K	154;154;93|93	ENSP00000295802:D154E;ENSP00000263854:D154E;ENSP00000405040:D93E|.	.|.	D|T	-|-	3|2	2|0	RETSAT|RETSAT	85431549|85431549	0.643000|0.643000	0.27269|0.27269	0.940000|0.940000	0.37924|0.37924	0.989000|0.989000	0.77384|0.77384	0.927000|0.927000	0.28818|0.28818	1.386000|1.386000	0.46466|0.46466	0.655000|0.655000	0.94253|0.94253	GAC|ACA	RETSAT	-	pfam_Amino_oxidase,pfam_FAD-dep_OxRdtase	ENSG00000042445		0.532	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RETSAT	HGNC	protein_coding	OTTHUMT00000252489.1	-	0.00	42	0	G	NM_017750		85578038	-1	tier1	-	no_errors	ENST00000295802	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.995	T
RGPD3	653489	genome.wustl.edu	37	2	107084742	107084742	+	Start_Codon_SNP	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:107084742C>A	ENST00000409886.3	-	1	90	c.3G>T	c.(1-3)atG>atT	p.M1I	RGPD3_ENST00000304514.7_Start_Codon_SNP_p.M1I	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	1					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TGCTGCAACTCATCGCGCCAC	0.657																																																	0													63.0	90.0	82.0					2																	107084742		692	1591	2283	SO:0001582	initiator_codon_variant	0				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.3G>T	2.37:g.107084742C>A	ENSP00000386588:p.Met1Ile		B8ZZM4	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.M1I	ENST00000409886.3	37	c.3	CCDS46379.1	2	.	.	.	.	.	.	.	.	.	.	.	7.422	0.636938	0.14386	.	.	ENSG00000153165	ENST00000409886;ENST00000304514	T;T	0.37058	1.22;1.22	1.8	1.8	0.24995	.	.	.	.	.	T	0.27798	0.0684	.	.	.	0.80722	D	1	B	0.30211	0.273	B	0.29785	0.107	T	0.14924	-1.0455	8	0.62326	D	0.03	-14.634	7.0248	0.24934	0.0:1.0:0.0:0.0	.	1	A6NKT7	RGPD3_HUMAN	I	1	ENSP00000386588:M1I;ENSP00000303659:M1I	ENSP00000303659:M1I	M	-	3	0	RGPD3	106451174	1.000000	0.71417	0.939000	0.37840	0.030000	0.12068	3.375000	0.52410	0.984000	0.38629	0.186000	0.17326	ATG	RGPD3	-	NULL	ENSG00000153165		0.657	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	-	0.00	137	0	C	XM_929931	Missense_Mutation	107084742	-1	tier1	-	no_errors	ENST00000304514	ensembl	human	known	74_37	missense	6.12	138	9	SNP	0.996	A
RAPH1	65059	genome.wustl.edu	37	2	204354324	204354324	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:204354324C>A	ENST00000319170.5	-	4	1014	c.715G>T	c.(715-717)Ggg>Tgg	p.G239W	RAPH1_ENST00000308091.4_Missense_Mutation_p.G239W|RAPH1_ENST00000457812.1_Missense_Mutation_p.G239W|RAPH1_ENST00000418114.1_Missense_Mutation_p.G239W|RAPH1_ENST00000374489.2_Missense_Mutation_p.G239W|RAPH1_ENST00000374493.3_Missense_Mutation_p.G239W|RAPH1_ENST00000419464.1_Missense_Mutation_p.G239W|RAPH1_ENST00000453034.1_Missense_Mutation_p.G239W|RAPH1_ENST00000374488.2_Missense_Mutation_p.G239W|RAPH1_ENST00000423104.1_Missense_Mutation_p.G239W|RAPH1_ENST00000439222.1_Missense_Mutation_p.G239W	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	239					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						ATTGGCTGCCCTTGATGTGTC	0.353																																																	0													127.0	127.0	127.0					2																	204354324		2203	4300	6503	SO:0001583	missense	0			AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.715G>T	2.37:g.204354324C>A	ENSP00000316543:p.Gly239Trp		Q96Q37|Q9C0I2	Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Ras-assoc,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,prints_Paxillin	p.G239W	ENST00000319170.5	37	c.715	CCDS2359.1	2	.	.	.	.	.	.	.	.	.	.	C	18.64	3.667209	0.67814	.	.	ENSG00000173166	ENST00000457812;ENST00000319170;ENST00000374493;ENST00000374489;ENST00000374488;ENST00000308091;ENST00000439222;ENST00000419464;ENST00000423104;ENST00000453034;ENST00000432342;ENST00000418114;ENST00000413201	T;T;T;T;T;T;T;T;T;T;T	0.52983	0.84;0.84;0.67;0.74;0.82;0.64;0.82;0.84;0.74;0.65;0.83	5.78	5.78	0.91487	.	0.000000	0.49305	D	0.000151	T	0.62962	0.2471	L	0.43152	1.355	0.51482	D	0.999926	D;D;P	0.71674	0.975;0.998;0.95	P;D;P	0.66084	0.708;0.941;0.621	T	0.63332	-0.6661	10	0.72032	D	0.01	-14.3768	20.0044	0.97430	0.0:1.0:0.0:0.0	.	239;239;239	Q70E73-6;C9K0J5;Q70E73	.;.;RAPH1_HUMAN	W	239	ENSP00000392854:G239W;ENSP00000316543:G239W;ENSP00000363617:G239W;ENSP00000363613:G239W;ENSP00000363612:G239W;ENSP00000311293:G239W;ENSP00000411138:G239W;ENSP00000390578:G239W;ENSP00000397751:G239W;ENSP00000406662:G239W;ENSP00000396711:G239W	ENSP00000311293:G239W	G	-	1	0	RAPH1	204062569	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.771000	0.62318	2.714000	0.92807	0.650000	0.86243	GGG	RAPH1	-	NULL	ENSG00000173166		0.353	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPH1	HGNC	protein_coding	OTTHUMT00000256363.2		0.00	30	0	C	NM_025252		204354324	-1			no_errors	ENST00000374493	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	A
RIMS2	9699	genome.wustl.edu	37	8	105235993	105235993	+	Silent	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr8:105235993C>T	ENST00000339750.2	+	1	114	c.114C>T	c.(112-114)tgC>tgT	p.C38C	RIMS2_ENST00000436393.2_Intron|RIMS2_ENST00000507740.1_Intron|RIMS2_ENST00000262231.10_Intron|RIMS2_ENST00000406091.3_Intron			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	0	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ACTTTCCCTGCATGAACTCCC	0.637										HNSCC(12;0.0054)																																							0													23.0	22.0	22.0					8																	105235993		876	1991	2867	SO:0001819	synonymous_variant	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000339750.2:c.114C>T	8.37:g.105235993C>T			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.C38	ENST00000339750.2	37	c.114		8																																																																																			RIMS2	-	NULL	ENSG00000176406		0.637	RIMS2-201	KNOWN	basic	protein_coding	RIMS2	HGNC	protein_coding		-	0.00	60	0	C	NM_001100117		105235993	+1	tier1	-	no_errors	ENST00000339750	ensembl	human	known	74_37	silent	17.82	83	18	SNP	1.000	T
AVL9	23080	genome.wustl.edu	37	7	32961042	32961042	+	Intron	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr7:32961042C>T	ENST00000404479.1	+	11	1215				RP9P_ENST00000381639.3_RNA			Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)						cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						GCAATGCCAACCTAAAAGCAA	0.323																																																	0																																										SO:0001627	intron_variant	0			D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000404479.1:c.1216-108180C>T	7.37:g.32961042C>T			Q92573	RNA	SNP	-	NULL	ENST00000404479.1	37	NULL		7																																																																																			RP9P	-	-	ENSG00000205763		0.323	AVL9-201	KNOWN	basic	protein_coding	RP9P	HGNC	protein_coding		-	0.00	54	0	C	NM_015060		32961042	-1	tier1	-	no_errors	ENST00000381639	ensembl	human	known	74_37	rna	18.31	58	13	SNP	1.000	T
RPL29	6159	genome.wustl.edu	37	3	52027882	52027882	+	Silent	SNP	T	T	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr3:52027882T>G	ENST00000466397.1	-	4	503	c.363A>C	c.(361-363)ccA>ccC	p.P121P	RPL29_ENST00000475248.1_Silent_p.P121P|RPL29_ENST00000479017.1_Silent_p.P121P|RPL29_ENST00000495383.1_Silent_p.P121P|RPL29_ENST00000294189.6_Silent_p.P121P			P47914	RL29_HUMAN	ribosomal protein L29	121					cellular protein metabolic process (GO:0044267)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)	heparin binding (GO:0008201)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ccttggcctttggccGGCACA	0.627																																																	0													26.0	31.0	29.0					3																	52027882		1795	3479	5274	SO:0001819	synonymous_variant	0			U10248	CCDS2845.1	3p21.3-p21.2	2013-03-11			ENSG00000162244	ENSG00000162244		"""L ribosomal proteins"""	10331	protein-coding gene	gene with protein product	"""60S ribosomal protein L29"", ""heparin/heparan sulfate-interacting protein"", ""HP/HS-interacting protein"", ""heparin/heparan sulfate-binding protein"", ""cell surface heparin-binding protein HIP"""	601832	"""ribosomal protein L29 pseudogene 10"""	RPL29P10		8597591	Standard	NM_000992		Approved	HIP, HUMRPL29, L29	uc003dcs.3	P47914	OTTHUMG00000155262	ENST00000466397.1:c.363A>C	3.37:g.52027882T>G			A8K0H3|B2R4M8|Q6IPY3	Silent	SNP	pfam_Ribosomal_L29e	p.P121	ENST00000466397.1	37	c.363	CCDS2845.1	3																																																																																			RPL29	-	NULL	ENSG00000162244		0.627	RPL29-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPL29	HGNC	protein_coding	OTTHUMT00000349680.2		0.00	46	0	T	NM_000992		52027882	-1			no_errors	ENST00000294189	ensembl	human	known	74_37	silent	13.04	60	9	SNP	0.998	G
RPS26	6231	genome.wustl.edu	37	12	56436329	56436329	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr12:56436329C>T	ENST00000356464.5	+	2	438	c.124C>T	c.(124-126)Cga>Tga	p.R42*	RPS26_ENST00000552361.1_Nonsense_Mutation_p.R42*|RP11-603J24.4_ENST00000551846.1_RNA			P62854	RS26_HUMAN	ribosomal protein S26	42					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of RNA splicing (GO:0033119)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|small ribosomal subunit (GO:0015935)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	7			OV - Ovarian serous cystadenocarcinoma(18;0.123)			ATTCGTCATTCGAAACATAGT	0.562																																																	0													34.0	37.0	36.0					12																	56436329		2181	4259	6440	SO:0001587	stop_gained	0			AB007160	CCDS31832.1	12q13	2011-04-06				ENSG00000197728		"""S ribosomal proteins"""	10414	protein-coding gene	gene with protein product	"""40S ribosomal protein S26"""	603701				9582194, 8670309	Standard	NM_001029		Approved	S26	uc001sjf.3	P62854	OTTHUMG00000170139	ENST00000356464.5:c.124C>T	12.37:g.56436329C>T	ENSP00000348849:p.Arg42*		P02383|P70394|Q06722|Q3MHD8|Q6IRY4	Nonsense_Mutation	SNP	pfam_Ribosomal_S26e	p.R42*	ENST00000356464.5	37	c.124	CCDS31832.1	12	.	.	.	.	.	.	.	.	.	.	C	37	6.168041	0.97343	.	.	ENSG00000197728	ENST00000356464;ENST00000552361	.	.	.	4.43	2.54	0.30619	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	2.4263	6.272	0.20959	0.3255:0.5857:0.0:0.0888	.	.	.	.	X	42	.	ENSP00000348849:R42X	R	+	1	2	RPS26	54722596	1.000000	0.71417	0.928000	0.36995	0.822000	0.46500	1.396000	0.34531	0.567000	0.29293	-0.251000	0.11542	CGA	RPS26	-	pfam_Ribosomal_S26e	ENSG00000197728		0.562	RPS26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS26	HGNC	protein_coding	OTTHUMT00000407616.1		0.00	61	0	C	NM_001029		56436329	+1			no_errors	ENST00000356464	ensembl	human	known	74_37	nonsense	10.10	89	10	SNP	1.000	T
RPS6KA6	27330	genome.wustl.edu	37	X	83352797	83352797	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chrX:83352797A>C	ENST00000262752.2	-	19	1843	c.1836T>G	c.(1834-1836)ttT>ttG	p.F612L	RPS6KA6_ENST00000543399.1_Missense_Mutation_p.F612L|RPS6KA6_ENST00000495332.1_5'UTR	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	612	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						ACATTGTGTAAAAAAGGACTC	0.303																																																	0													128.0	124.0	125.0					X																	83352797		2203	4293	6496	SO:0001583	missense	0			AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.1836T>G	X.37:g.83352797A>C	ENSP00000262752:p.Phe612Leu		B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_dom	p.F612L	ENST00000262752.2	37	c.1836	CCDS14451.1	X	.	.	.	.	.	.	.	.	.	.	A	3.259	-0.151532	0.06585	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	T;T	0.58652	0.32;0.32	5.46	2.89	0.33648	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.165634	0.48767	N	0.000169	T	0.17408	0.0418	N	0.00275	-1.725	0.26309	N	0.977854	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.34229	-0.9837	10	0.02654	T	1	.	11.4405	0.50094	0.5546:0.4454:0.0:0.0	.	612;612	B7ZL90;Q9UK32	.;KS6A6_HUMAN	L	612	ENSP00000262752:F612L;ENSP00000440830:F612L	ENSP00000262752:F612L	F	-	3	2	RPS6KA6	83239453	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.644000	0.24766	0.698000	0.31739	0.486000	0.48141	TTT	RPS6KA6	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_dom	ENSG00000072133		0.303	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA6	HGNC	protein_coding	OTTHUMT00000057372.1	-	0.00	36	0	A	NM_014496		83352797	-1	tier1	-	no_errors	ENST00000262752	ensembl	human	known	74_37	missense	22.64	41	12	SNP	0.999	C
RTN1	6252	genome.wustl.edu	37	14	60194227	60194227	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr14:60194227G>T	ENST00000267484.5	-	3	1510	c.1175C>A	c.(1174-1176)cCg>cAg	p.P392Q		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	392					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)		p.P392L(1)		central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		GATGGTTGGCGGTCCGGACCT	0.672																																																	1	Substitution - Missense(1)	large_intestine(1)											16.0	16.0	16.0					14																	60194227		2197	4292	6489	SO:0001583	missense	0			L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.1175C>A	14.37:g.60194227G>T	ENSP00000267484:p.Pro392Gln		Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.P392Q	ENST00000267484.5	37	c.1175	CCDS9740.1	14	.	.	.	.	.	.	.	.	.	.	G	3.409	-0.120549	0.06838	.	.	ENSG00000139970	ENST00000267484;ENST00000433623	T	0.22945	1.93	5.49	-0.677	0.11357	.	1.223610	0.05794	N	0.610853	T	0.16854	0.0405	L	0.29908	0.895	0.20975	N	0.999819	B	0.25743	0.133	B	0.22880	0.042	T	0.31081	-0.9956	10	0.19147	T	0.46	.	6.9424	0.24500	0.3684:0.4399:0.1917:0.0	.	392	Q16799	RTN1_HUMAN	Q	392;318	ENSP00000267484:P392Q	ENSP00000267484:P392Q	P	-	2	0	RTN1	59263980	0.022000	0.18835	0.967000	0.41034	0.084000	0.17831	0.028000	0.13644	-0.016000	0.14127	-0.878000	0.02970	CCG	RTN1	-	NULL	ENSG00000139970		0.672	RTN1-001	KNOWN	basic|CCDS	protein_coding	RTN1	HGNC	protein_coding	OTTHUMT00000072278.2		0.00	30	0	G			60194227	-1			no_errors	ENST00000267484	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.487	T
RTN3	10313	genome.wustl.edu	37	11	63487933	63487933	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr11:63487933C>A	ENST00000377819.5	+	3	2113	c.1959C>A	c.(1957-1959)gaC>gaA	p.D653E	RTN3_ENST00000354497.4_Intron|RTN3_ENST00000537981.1_Intron|RTN3_ENST00000341307.2_Intron|RTN3_ENST00000339997.4_Missense_Mutation_p.D634E|RTN3_ENST00000540798.1_Missense_Mutation_p.D541E|RTN3_ENST00000356000.3_Intron	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3	653					apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						CCCCAGAGGACCTGATAGCAG	0.343																																																	0													47.0	49.0	48.0					11																	63487933		2201	4298	6499	SO:0001583	missense	0			AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.1959C>A	11.37:g.63487933C>A	ENSP00000367050:p.Asp653Glu		B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.D653E	ENST00000377819.5	37	c.1959	CCDS58141.1	11	.	.	.	.	.	.	.	.	.	.	C	15.23	2.770772	0.49680	.	.	ENSG00000133318	ENST00000377819;ENST00000339997;ENST00000540798	T;T;T	0.29917	1.55;1.56;1.59	5.77	3.83	0.44106	.	0.240712	0.29838	N	0.011075	T	0.33177	0.0854	N	0.17082	0.46	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.996;0.991;0.996	T	0.07558	-1.0766	10	0.30078	T	0.28	-8.4701	7.3066	0.26451	0.0:0.7359:0.168:0.0961	.	541;653;634	F5H774;O95197;O95197-2	.;RTN3_HUMAN;.	E	653;634;541	ENSP00000367050:D653E;ENSP00000344106:D634E;ENSP00000442733:D541E	ENSP00000344106:D634E	D	+	3	2	RTN3	63244509	0.998000	0.40836	0.986000	0.45419	0.379000	0.30106	1.216000	0.32443	0.825000	0.34637	0.655000	0.94253	GAC	RTN3	-	NULL	ENSG00000133318		0.343	RTN3-002	KNOWN	basic|CCDS	protein_coding	RTN3	HGNC	protein_coding	OTTHUMT00000397846.1		0.00	22	0	C	NM_006054		63487933	+1			no_errors	ENST00000377819	ensembl	human	known	74_37	missense	8.82	31	3	SNP	0.997	A
SCNN1A	6337	genome.wustl.edu	37	12	6457259	6457259	+	Missense_Mutation	SNP	C	C	T	rs202038572		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr12:6457259C>T	ENST00000228916.2	-	13	1888	c.1790G>A	c.(1789-1791)cGa>cAa	p.R597Q	SCNN1A_ENST00000358945.3_Missense_Mutation_p.R619Q|SCNN1A_ENST00000540037.1_Missense_Mutation_p.R297Q|SCNN1A_ENST00000360168.3_Missense_Mutation_p.R656Q|SCNN1A_ENST00000396966.2_3'UTR|SCNN1A_ENST00000543768.1_Missense_Mutation_p.R620Q	NM_001038.5	NP_001029.1	P37088	SCNNA_HUMAN	sodium channel, non-voltage-gated 1 alpha subunit	597					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ciliary membrane (GO:0060170)|cortical actin cytoskeleton (GO:0030864)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(2)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Amiloride(DB00594)|Triamterene(DB00384)	CCTGCCCCCTCGGCCTGGAGA	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		18193	0.001		0.0	False		,,,				2504	0.0																0													44.0	43.0	43.0					12																	6457259		2203	4300	6503	SO:0001583	missense	0			Z92978	CCDS8543.1, CCDS53738.1, CCDS53739.1	12p13	2012-02-28	2012-02-28		ENSG00000111319	ENSG00000111319		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10599	protein-coding gene	gene with protein product		600228	"""sodium channel, nonvoltage-gated 1 alpha"", ""sodium channel, non-voltage-gated 1 alpha"""	SCNN1		7896277	Standard	NM_001038		Approved	ENaCalpha	uc001qnw.3	P37088	OTTHUMG00000168268	ENST00000228916.2:c.1790G>A	12.37:g.6457259C>T	ENSP00000228916:p.Arg597Gln		A5X2U9|B4E2Q5|C5HTZ0|O43271|Q6GSQ6|Q9UM64	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.R619Q	ENST00000228916.2	37	c.1856	CCDS8543.1	12	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	15.03	2.713566	0.48517	.	.	ENSG00000111319	ENST00000360168;ENST00000358945;ENST00000540037;ENST00000228916;ENST00000543768	T;T;T;T;T	0.70749	-0.42;-0.51;-0.24;-0.4;-0.41	4.39	3.25	0.37280	.	0.347163	0.19982	N	0.101752	T	0.59609	0.2206	M	0.72118	2.19	0.24203	N	0.995504	B;B;P	0.44006	0.287;0.287;0.824	B;B;B	0.28139	0.024;0.014;0.086	T	0.61549	-0.7040	10	0.52906	T	0.07	-6.5239	8.1748	0.31275	0.0:0.8653:0.0:0.1347	.	620;597;656	B4E2Q5;P37088;P37088-2	.;SCNNA_HUMAN;.	Q	656;619;297;597;620	ENSP00000353292:R656Q;ENSP00000351825:R619Q;ENSP00000440876:R297Q;ENSP00000228916:R597Q;ENSP00000438739:R620Q	ENSP00000228916:R597Q	R	-	2	0	SCNN1A	6327520	0.882000	0.30256	1.000000	0.80357	0.984000	0.73092	1.263000	0.33004	2.008000	0.58898	0.561000	0.74099	CGA	SCNN1A	-	NULL	ENSG00000111319		0.617	SCNN1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SCNN1A	HGNC	protein_coding	OTTHUMT00000399055.1		0.00	28	0	C			6457259	-1			no_errors	ENST00000358945	ensembl	human	known	74_37	missense	9.68	28	3	SNP	0.659	T
SDK1	221935	genome.wustl.edu	37	7	4051852	4051852	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr7:4051852G>A	ENST00000404826.2	+	16	2544	c.2405G>A	c.(2404-2406)cGt>cAt	p.R802H	SDK1_ENST00000389531.3_Missense_Mutation_p.R802H	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	802	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GGGGTGTTGCGTGGATACATC	0.527																																																	0													105.0	104.0	104.0					7																	4051852		2203	4300	6503	SO:0001583	missense	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2405G>A	7.37:g.4051852G>A	ENSP00000385899:p.Arg802His		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R802H	ENST00000404826.2	37	c.2405	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	G	7.207	0.594688	0.13875	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.57752	0.38;0.38	5.15	1.93	0.25924	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.307383	0.28482	N	0.015195	T	0.41581	0.1165	L	0.52823	1.66	0.09310	N	0.999999	B;B	0.18310	0.027;0.024	B;B	0.14023	0.008;0.01	T	0.30851	-0.9964	10	0.42905	T	0.14	.	5.352	0.16040	0.6128:0.0:0.3872:0.0	.	802;802	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	H	802	ENSP00000385899:R802H;ENSP00000374182:R802H	ENSP00000374182:R802H	R	+	2	0	SDK1	4018378	0.028000	0.19301	0.370000	0.25965	0.175000	0.22909	1.586000	0.36611	0.580000	0.29522	0.563000	0.77884	CGT	SDK1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000146555		0.527	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	-	0.00	24	0	G	NM_152744		4051852	+1	tier1	-	no_errors	ENST00000404826	ensembl	human	known	74_37	missense	15.09	45	8	SNP	0.079	A
SETD1A	9739	genome.wustl.edu	37	16	30976498	30976498	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr16:30976498A>T	ENST00000262519.8	+	7	2121	c.1435A>T	c.(1435-1437)Agt>Tgt	p.S479C		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	479	Pro-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						CACCAATGAGAGTGTGCCCTT	0.637																																																	0													38.0	39.0	39.0					16																	30976498		2197	4300	6497	SO:0001583	missense	0			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.1435A>T	16.37:g.30976498A>T	ENSP00000262519:p.Ser479Cys		A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.S479C	ENST00000262519.8	37	c.1435	CCDS32435.1	16	.	.	.	.	.	.	.	.	.	.	A	16.08	3.020740	0.54576	.	.	ENSG00000099381	ENST00000262519	D	0.95518	-3.73	5.55	5.55	0.83447	.	0.050145	0.85682	D	0.000000	D	0.95906	0.8667	L	0.34521	1.04	0.43936	D	0.996598	D	0.89917	1.0	D	0.73380	0.98	D	0.96597	0.9442	10	0.72032	D	0.01	.	14.6663	0.68910	1.0:0.0:0.0:0.0	.	479	O15047	SET1A_HUMAN	C	479	ENSP00000262519:S479C	ENSP00000262519:S479C	S	+	1	0	SETD1A	30883999	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	4.877000	0.63086	2.102000	0.63906	0.459000	0.35465	AGT	SETD1A	-	NULL	ENSG00000099381		0.637	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD1A	HGNC	protein_coding	OTTHUMT00000318244.2	-	0.00	24	0	A	NM_014712		30976498	+1	tier1	-	no_errors	ENST00000262519	ensembl	human	known	74_37	missense	29.73	26	11	SNP	1.000	T
SGTA	6449	genome.wustl.edu	37	19	2763650	2763650	+	Splice_Site	SNP	C	C	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:2763650C>G	ENST00000221566.2	-	6	659		c.e6+1			NM_003021.3	NP_003012.1	O43765	SGTA_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha						viral process (GO:0016032)	cytoplasm (GO:0005737)				endometrium(2)|large_intestine(2)|lung(2)|ovary(1)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGGCACTCACCCCATCCTGC	0.622																																																	0													52.0	45.0	47.0					19																	2763650		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ223828	CCDS12094.1	19p13	2013-01-10	2003-11-24	2003-11-26		ENSG00000104969		"""Tetratricopeptide (TTC) repeat domain containing"""	10819	protein-coding gene	gene with protein product		603419	"""small glutamine-rich tetratricopeptide repeat (TPR)-containing"""	SGT		9740675, 12735788	Standard	NM_003021		Approved		uc002lwi.1	O43765		ENST00000221566.2:c.497+1G>C	19.37:g.2763650C>G			D6W610|Q6FIA9|Q9BTZ9	Splice_Site	SNP	-	e5+1	ENST00000221566.2	37	c.497+1	CCDS12094.1	19	.	.	.	.	.	.	.	.	.	.	C	20.8	4.050905	0.75960	.	.	ENSG00000104969	ENST00000221566	.	.	.	3.49	3.49	0.39957	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9419	0.64059	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SGTA	2714650	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.393000	0.79851	1.666000	0.50821	0.462000	0.41574	.	SGTA	-	-	ENSG00000104969		0.622	SGTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGTA	HGNC	protein_coding	OTTHUMT00000451448.2	-	0.00	53	0	C	NM_003021	Intron	2763650	-1	tier1	-	no_errors	ENST00000221566	ensembl	human	known	74_37	splice_site	14.89	40	7	SNP	1.000	G
SIDT2	51092	genome.wustl.edu	37	11	117066610	117066610	+	Silent	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr11:117066610C>T	ENST00000324225.4	+	25	2946	c.2415C>T	c.(2413-2415)atC>atT	p.I805I	SIDT2_ENST00000532062.1_Silent_p.I97I|SIDT2_ENST00000431081.2_Silent_p.I802I	NM_001040455.1	NP_001035545.1	Q8NBJ9	SIDT2_HUMAN	SID1 transmembrane family, member 2	805					cell morphogenesis (GO:0000902)|dsRNA transport (GO:0033227)|glucose homeostasis (GO:0042593)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to glucose (GO:0009749)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell proliferation (GO:0044342)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	RNA transmembrane transporter activity (GO:0051033)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	36	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000219)|all cancers(92;0.00144)		TCTCCTCCATCGCCATGTTCG	0.617																																																	0													198.0	183.0	189.0					11																	117066610		2201	4296	6497	SO:0001819	synonymous_variant	0			AF151799	CCDS31682.1	11q23.3	2008-02-05			ENSG00000149577	ENSG00000149577			24272	protein-coding gene	gene with protein product						10810093, 12975309	Standard	NM_001040455		Approved	CGI-40	uc001pqh.1	Q8NBJ9	OTTHUMG00000167065	ENST00000324225.4:c.2415C>T	11.37:g.117066610C>T			Q8NBY7|Q9Y357	Silent	SNP	NULL	p.I826	ENST00000324225.4	37	c.2478	CCDS31682.1	11																																																																																			SIDT2	-	NULL	ENSG00000149577		0.617	SIDT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT2	HGNC	protein_coding	OTTHUMT00000392836.1	-	0.00	60	0	C	NM_015996		117066610	+1	tier1	-	no_errors	ENST00000278951	ensembl	human	known	74_37	silent	8.33	66	6	SNP	1.000	T
SIRPB2	284759	genome.wustl.edu	37	20	1460678	1460678	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr20:1460678G>T	ENST00000359801.3	-	2	154	c.118C>A	c.(118-120)Cag>Aag	p.Q40K	SIRPB2_ENST00000537284.1_5'UTR|SIRPB2_ENST00000608747.1_5'UTR|SIRPB2_ENST00000444444.2_Missense_Mutation_p.Q40K	NM_001122962.1	NP_001116434.1	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein beta 2	33	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TGTAGCACCTGCCAGTCATTC	0.527																																																	0													42.0	40.0	41.0					20																	1460678		1568	3580	5148	SO:0001583	missense	0			AL109658	CCDS42849.1, CCDS46570.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000196209	ENSG00000196209		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16247	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type 1-like"", ""protein tyrosine phosphatase, non-receptor type substrate 1-like 3"""	PTPN1L, PTPNS1L3		16339511	Standard	NM_001122962		Approved	dJ776F14.2	uc002wfg.2	Q5JXA9	OTTHUMG00000031670	ENST00000359801.3:c.118C>A	20.37:g.1460678G>T	ENSP00000352849:p.Gln40Lys		B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Q40K	ENST00000359801.3	37	c.118	CCDS42849.1	20	.	.	.	.	.	.	.	.	.	.	G	5.366	0.252793	0.10185	.	.	ENSG00000196209	ENST00000359801;ENST00000444444;ENST00000381630;ENST00000381628	T;T;T	0.65732	-0.17;4.29;4.27	4.68	3.7	0.42460	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.545035	0.16626	N	0.206270	T	0.67002	0.2847	L	0.45137	1.4	0.58432	D	0.999995	P;D	0.53885	0.888;0.963	B;D	0.71414	0.3;0.973	T	0.59958	-0.7356	10	0.10111	T	0.7	-10.2843	10.7667	0.46297	0.0:0.1925:0.8075:0.0	.	40;40	E9PCW6;Q5JXA9	.;SIRB2_HUMAN	K	40	ENSP00000352849:Q40K;ENSP00000402438:Q40K;ENSP00000371043:Q40K	ENSP00000352849:Q40K	Q	-	1	0	SIRPB2	1408678	0.990000	0.36364	0.133000	0.22050	0.005000	0.04900	3.310000	0.51911	1.288000	0.44600	0.655000	0.94253	CAG	SIRPB2	-	pfam_Ig_V-set,pfscan_Ig-like_dom	ENSG00000196209		0.527	SIRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRPB2	HGNC	protein_coding	OTTHUMT00000077544.1	-	0.00	38	0	G	NM_178459		1460678	-1	tier1	-	no_errors	ENST00000359801	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.535	T
SKOR1	390598	genome.wustl.edu	37	15	68119146	68119146	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr15:68119146G>A	ENST00000380035.2	+	2	1038	c.980G>A	c.(979-981)cGc>cAc	p.R327H	SKOR1_ENST00000341418.5_Intron|SKOR1_ENST00000554240.1_Missense_Mutation_p.R288H|SKOR1_ENST00000554054.1_Missense_Mutation_p.R299H|SKOR1_ENST00000389002.1_Missense_Mutation_p.R283H			P84550	SKOR1_HUMAN	SKI family transcriptional corepressor 1	327					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(7)|urinary_tract(1)	23						AAAAGCCTGCGCTGTGGCGAA	0.756																																																	0													2.0	3.0	3.0					15																	68119146		1493	3242	4735	SO:0001583	missense	0				CCDS58374.1	15q23	2011-08-04	2010-06-23	2010-06-23	ENSG00000188779	ENSG00000188779		"""SKI transcriptional corepressors"""	21326	protein-coding gene	gene with protein product	"""transcriptional corepressor CORL1"", ""functional smad suppressing element 15"", ""corepressor for LBX1"""	611273	"""Lbxcor1 homolog (mouse)"""	LBXCOR1		15528197	Standard	NM_001258024		Approved	CORL1, FUSSEL15	uc031qsn.1	P84550		ENST00000380035.2:c.980G>A	15.37:g.68119146G>A	ENSP00000369374:p.Arg327His		A6NIP4|A6NJY0|Q2VWA5	Missense_Mutation	SNP	pfam_Transform_Ski,pfam_c-SKI_SMAD4-bd_dom,superfamily_DNA-bd_dom_put,superfamily_SAND_dom-like	p.R327H	ENST00000380035.2	37	c.980		15	.	.	.	.	.	.	.	.	.	.	G	15.84	2.951620	0.53186	.	.	ENSG00000188779	ENST00000554240;ENST00000554054;ENST00000380035;ENST00000389002	T;T;T;T	0.74106	-0.79;-0.8;-0.81;-0.71	3.66	2.72	0.32119	.	0.146846	0.43919	D	0.000501	T	0.77082	0.4078	L	0.38175	1.15	0.28059	N	0.93306	D	0.76494	0.999	D	0.72075	0.976	T	0.68988	-0.5264	10	0.87932	D	0	-23.3305	9.182	0.37148	0.0:0.2231:0.7769:0.0	.	283	P84550-3	.	H	288;299;327;283	ENSP00000451193:R288H;ENSP00000452361:R299H;ENSP00000369374:R327H;ENSP00000373654:R283H	ENSP00000369374:R327H	R	+	2	0	SKOR1	65906200	0.997000	0.39634	0.949000	0.38748	0.700000	0.40528	3.233000	0.51311	0.859000	0.35456	0.456000	0.33151	CGC	SKOR1	-	NULL	ENSG00000188779		0.756	SKOR1-003	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	SKOR1	HGNC	protein_coding	OTTHUMT00000410832.1	-	0.00	21	0	G	NM_001031807		68119146	+1	tier1	-	no_errors	ENST00000380035	ensembl	human	known	74_37	missense	45.45	6	5	SNP	0.870	A
RAI1	10743	genome.wustl.edu	37	17	17682235	17682235	+	Intron	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr17:17682235G>T	ENST00000353383.1	+	3	453				SMCR5_ENST00000543475.1_RNA|RP1-253P7.1_ENST00000583598.1_RNA	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1						circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		TGAGGGGGCTGGGGCGGGGCC	0.557																																																	0																																										SO:0001627	intron_variant	0			AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.-16-14012G>T	17.37:g.17682235G>T			Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	RNA	SNP	-	NULL	ENST00000353383.1	37	NULL	CCDS11188.1	17	.	.	.	.	.	.	.	.	.	.	G	3.846	-0.032889	0.07543	.	.	ENSG00000226746	ENST00000543475	.	.	.	2.67	0.239	0.15484	.	.	.	.	.	T	0.27731	0.0682	.	.	.	0.09310	N	0.999999	B	0.23185	0.081	B	0.15052	0.012	T	0.23940	-1.0174	7	0.87932	D	0	.	4.6975	0.12811	0.0:0.2448:0.505:0.2502	.	53	Q8TEV8	SMCR5_HUMAN	K	53	.	ENSP00000438627:Q53K	Q	-	1	0	SMCR5	17622960	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.363000	0.20301	-0.035000	0.13691	0.313000	0.20887	CAG	SMCR5	-	-	ENSG00000226746		0.557	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR5	HGNC	protein_coding	OTTHUMT00000131775.1	-	0.00	31	0	G	NM_030665		17682235	-1	tier1	-	no_errors	ENST00000543475	ensembl	human	known	74_37	rna	8.89	41	4	SNP	0.000	T
SOX13	9580	genome.wustl.edu	37	1	204085774	204085774	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:204085774G>T	ENST00000367204.1	+	5	667	c.558G>T	c.(556-558)caG>caT	p.Q186H	SOX13_ENST00000367203.4_3'UTR	NM_005686.2	NP_005677.2	Q9UN79	SOX13_HUMAN	SRY (sex determining region Y)-box 13	186	Gln-rich.				anatomical structure morphogenesis (GO:0009653)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	13	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			AGCAGCAGCAGCAGATGGAGC	0.577																																																	0													53.0	59.0	57.0					1																	204085774		2077	4225	6302	SO:0001583	missense	0				CCDS44299.1	1q32	2008-07-18			ENSG00000143842	ENSG00000143842		"""SRY (sex determining region Y)-boxes"""	11192	protein-coding gene	gene with protein product	"""islet cell antibody 12"", ""SRY-related HMG-box gene 13"", ""type 1 diabetes autoantigen"", ""SRY-box 13"""	604748				10198172	Standard	NM_005686		Approved	Sox-13, ICA12, MGC117216	uc001ham.3	Q9UN79	OTTHUMG00000036050	ENST00000367204.1:c.558G>T	1.37:g.204085774G>T	ENSP00000356172:p.Gln186His		B4E2B0|O95275|O95826|Q3KQV7|Q5SXX1|Q9UHW7	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.Q186H	ENST00000367204.1	37	c.558	CCDS44299.1	1	.	.	.	.	.	.	.	.	.	.	g	17.61	3.433539	0.62955	.	.	ENSG00000143842	ENST00000367204	D	0.98550	-4.99	5.21	2.25	0.28309	.	0.054484	0.85682	D	0.000000	D	0.98560	0.9519	M	0.81341	2.54	0.39690	D	0.971031	D;D;D;D	0.76494	0.998;0.998;0.998;0.999	D;D;D;D	0.85130	0.993;0.993;0.993;0.997	D	0.98886	1.0771	10	0.87932	D	0	.	9.553	0.39321	0.302:0.0:0.698:0.0	.	53;54;186;168	B4DX26;B4E3N9;Q9UN79;Q5SXX2	.;.;SOX13_HUMAN;.	H	186	ENSP00000356172:Q186H	ENSP00000356172:Q186H	Q	+	3	2	SOX13	202352397	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.062000	0.30555	0.569000	0.29329	-0.119000	0.15052	CAG	SOX13	-	NULL	ENSG00000143842		0.577	SOX13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX13	HGNC	protein_coding	OTTHUMT00000087881.2		0.00	33	0	G	NM_005686		204085774	+1			no_errors	ENST00000367204	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
SPANXN3	139067	genome.wustl.edu	37	X	142605168	142605168	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chrX:142605168C>T	ENST00000370503.2	-	1	135	c.52G>A	c.(52-54)Gaa>Aaa	p.E18K	GS1-256O22.5_ENST00000431432.1_RNA	NM_001009609.2	NP_001009609.1	Q5MJ09	SPXN3_HUMAN	SPANX family, member N3	18										endometrium(1)|large_intestine(1)|lung(9)|ovary(2)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;6.56e-05)					TTATTGGATTCACAGGGGCTC	0.463																																																	0													248.0	216.0	227.0					X																	142605168		2203	4300	6503	SO:0001583	missense	0				CCDS35418.1	Xq27.3	2012-06-12			ENSG00000189252	ENSG00000189252			33176	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 8"""	300666				14973187, 17012309	Standard	NM_001009609		Approved	SPANX-N3, CT11.8	uc004fbw.3	Q5MJ09	OTTHUMG00000022582	ENST00000370503.2:c.52G>A	X.37:g.142605168C>T	ENSP00000359534:p.Glu18Lys		Q0ZNK4	Missense_Mutation	SNP	pfam_SPANX_prot	p.E18K	ENST00000370503.2	37	c.52	CCDS35418.1	X	.	.	.	.	.	.	.	.	.	.	c	5.603	0.296067	0.10622	.	.	ENSG00000189252	ENST00000370503	T	0.09350	2.99	2.03	-4.05	0.03998	.	.	.	.	.	T	0.10121	0.0248	M	0.70275	2.135	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.38156	-0.9674	9	0.48119	T	0.1	.	1.2874	0.02053	0.1335:0.3407:0.2039:0.3219	.	18	Q5MJ09	SPXN3_HUMAN	K	18	ENSP00000359534:E18K	ENSP00000359534:E18K	E	-	1	0	SPANXN3	142432834	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.681000	0.05191	-1.569000	0.01668	-1.856000	0.00563	GAA	SPANXN3	-	pfam_SPANX_prot	ENSG00000189252		0.463	SPANXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXN3	HGNC	protein_coding	OTTHUMT00000058620.2	-	0.00	49	0	C	NM_001009609		142605168	-1	tier1	-	no_errors	ENST00000370503	ensembl	human	known	74_37	missense	45.21	40	33	SNP	0.000	T
SPATA5	166378	genome.wustl.edu	37	4	124235172	124235172	+	Missense_Mutation	SNP	C	C	A	rs28716389		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr4:124235172C>A	ENST00000274008.4	+	16	2704	c.2635C>A	c.(2635-2637)Cgt>Agt	p.R879S		NM_145207.2	NP_660208.2	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	879					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)	p.R879C(1)		endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24						GTCATTGAGACGTTTTTATGA	0.383																																																	1	Substitution - Missense(1)	endometrium(1)											94.0	85.0	88.0					4																	124235172		2203	4300	6503	SO:0001583	missense	0			AF361489	CCDS3730.1	4q28.1	2010-04-21			ENSG00000145375	ENSG00000145375		"""ATPases / AAA-type"""	18119	protein-coding gene	gene with protein product	"""ATPase family gene 2 homolog (S. cerevisiae)"""	613940				16465403	Standard	NM_145207		Approved	SPAF, AFG2	uc003iez.4	Q8NB90	OTTHUMG00000133074	ENST00000274008.4:c.2635C>A	4.37:g.124235172C>A	ENSP00000274008:p.Arg879Ser		C9JT97|Q86XW1|Q8NI20|Q8TDL7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,superfamily_Asp_de-COase-like_dom,smart_AAA+_ATPase	p.R879S	ENST00000274008.4	37	c.2635	CCDS3730.1	4	.	.	.	.	.	.	.	.	.	.	C	10.92	1.487050	0.26686	.	.	ENSG00000145375	ENST00000274008	D	0.94650	-3.48	5.5	5.5	0.81552	.	0.151045	0.46145	D	0.000309	D	0.88948	0.6576	N	0.13352	0.335	0.33733	D	0.61844	B	0.21309	0.054	B	0.21360	0.034	D	0.88742	0.3244	10	0.46703	T	0.11	-15.9782	15.0728	0.72053	0.1423:0.8577:0.0:0.0	.	879	Q8NB90	SPAT5_HUMAN	S	879	ENSP00000274008:R879S	ENSP00000274008:R879S	R	+	1	0	SPATA5	124454622	0.997000	0.39634	0.992000	0.48379	0.417000	0.31264	2.526000	0.45607	2.584000	0.87258	0.563000	0.77884	CGT	SPATA5	-	superfamily_P-loop_NTPase	ENSG00000145375		0.383	SPATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA5	HGNC	protein_coding	OTTHUMT00000256714.2		0.00	25	0	C	NM_145207		124235172	+1			no_errors	ENST00000274008	ensembl	human	known	74_37	missense	8.70	21	2	SNP	0.996	A
SPEM1	374768	genome.wustl.edu	37	17	7324809	7324809	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr17:7324809G>A	ENST00000323675.3	+	3	840	c.815G>A	c.(814-816)cGg>cAg	p.R272Q	RP11-104H15.7_ENST00000575310.1_RNA	NM_199339.2	NP_955371.2	Q8N4L4	SPEM1_HUMAN	spermatid maturation 1	272					sperm individualization (GO:0007291)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	12		Prostate(122;0.173)				CGGCGGCTTCGGGAACTGACC	0.632																																																	0													26.0	30.0	29.0					17																	7324809		1939	4125	6064	SO:0001583	missense	0			AK097400	CCDS42254.1	17p13.1	2011-12-12	2008-02-04	2008-02-04	ENSG00000181323	ENSG00000181323			32429	protein-coding gene	gene with protein product		615116	"""chromosome 17 open reading frame 83"""	C17orf83		17426145, 20558241, 21184802	Standard	NM_199339		Approved	FLJ40081	uc002ggv.3	Q8N4L4		ENST00000323675.3:c.815G>A	17.37:g.7324809G>A	ENSP00000315554:p.Arg272Gln			Missense_Mutation	SNP	NULL	p.R272Q	ENST00000323675.3	37	c.815	CCDS42254.1	17	.	.	.	.	.	.	.	.	.	.	G	11.46	1.645279	0.29246	.	.	ENSG00000181323	ENST00000323675	.	.	.	5.65	4.68	0.58851	.	0.155671	0.29646	N	0.011566	T	0.21509	0.0518	N	0.20986	0.625	0.09310	N	0.999999	P	0.35714	0.517	B	0.27170	0.077	T	0.11542	-1.0583	9	0.40728	T	0.16	-10.0643	10.6916	0.45875	0.0883:0.0:0.9117:0.0	.	272	Q8N4L4	SPEM1_HUMAN	Q	272	.	ENSP00000315554:R272Q	R	+	2	0	SPEM1	7265533	0.994000	0.37717	0.610000	0.28997	0.090000	0.18270	2.339000	0.43965	1.376000	0.46267	0.655000	0.94253	CGG	SPEM1	-	NULL	ENSG00000181323		0.632	SPEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEM1	HGNC	protein_coding	OTTHUMT00000440932.1	-	0.00	28	0	G	NM_199339		7324809	+1	tier1	-	no_errors	ENST00000323675	ensembl	human	known	74_37	missense	24.53	40	13	SNP	0.292	A
SRBD1	55133	genome.wustl.edu	37	2	45807093	45807093	+	Silent	SNP	G	G	T	rs377242238		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:45807093G>T	ENST00000263736.4	-	7	1055	c.993C>A	c.(991-993)ggC>ggA	p.G331G		NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	331					nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			CTCCTTCTAAGCCCAACTGTC	0.428																																																	0													156.0	148.0	151.0					2																	45807093		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.993C>A	2.37:g.45807093G>T			Q53T56|Q96TA4|Q9NW11	Silent	SNP	pfam_Tex-like_N,pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_NA-bd_OB-fold,superfamily_RuvA_2-like,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.G331	ENST00000263736.4	37	c.993	CCDS1823.1	2																																																																																			SRBD1	-	pfam_Tex-like_N	ENSG00000068784		0.428	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRBD1	HGNC	protein_coding	OTTHUMT00000250747.3	-	0.00	35	0	G	NM_018079		45807093	-1	tier1	-	no_errors	ENST00000263736	ensembl	human	known	74_37	silent	12.90	27	4	SNP	1.000	T
SRP54	6729	genome.wustl.edu	37	14	35482573	35482573	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr14:35482573G>T	ENST00000556994.1	+	10	1055	c.658G>T	c.(658-660)Gtg>Ttg	p.V220L	SRP54_ENST00000546080.1_Missense_Mutation_p.V171L|SRP54_ENST00000216774.6_Missense_Mutation_p.V220L|SRP54_ENST00000555557.1_Missense_Mutation_p.V156L			P61011	SRP54_HUMAN	signal recognition particle 54kDa	220	G-domain.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|protein targeting to ER (GO:0045047)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition (GO:0006617)|SRP-dependent cotranslational protein targeting to membrane, translocation (GO:0006616)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|drug binding (GO:0008144)|endoplasmic reticulum signal peptide binding (GO:0030942)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;2.48e-05)|Lung(238;3.13e-05)|Epithelial(34;0.0314)|all cancers(34;0.0797)|BRCA - Breast invasive adenocarcinoma(188;0.243)	GBM - Glioblastoma multiforme(112;0.0396)		CATTGTTTATGTGATGGATGC	0.353																																																	0													77.0	75.0	76.0					14																	35482573		2203	4300	6503	SO:0001583	missense	0			X86373	CCDS9652.1, CCDS53893.1	14q13.2	2014-06-02	2002-08-29		ENSG00000100883	ENSG00000100883			11301	protein-coding gene	gene with protein product		604857	"""signal recognition particle 54kD"""			8722571	Standard	NM_003136		Approved		uc001wso.3	P61011	OTTHUMG00000140214	ENST00000556994.1:c.658G>T	14.37:g.35482573G>T	ENSP00000451818:p.Val220Leu		B2R759|B4DUW6|P13624	Missense_Mutation	SNP	pfam_SRP54_GTPase_dom,pfam_Signal_recog_particle_SRP54_M,pfam_Signal_recog_particl_SRP54_hlx,pfam_CobW/HypB/UreG_dom,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP54_M,superfamily_Signal_recog_particl_SRP54_hlx,smart_Signal_recog_particl_SRP54_hlx,smart_AAA+_ATPase,smart_SRP54_GTPase_dom,tigrfam_SRP54_euk	p.V220L	ENST00000556994.1	37	c.658	CCDS9652.1	14	.	.	.	.	.	.	.	.	.	.	G	34	5.412580	0.96072	.	.	ENSG00000100883	ENST00000556994;ENST00000216774;ENST00000546080;ENST00000555557	.	.	.	5.5	5.5	0.81552	ATPase, AAA+ type, core (1);Signal recognition particle, SRP54 subunit, GTPase (2);	0.120365	0.56097	D	0.000021	D	0.87067	0.6085	H	0.99475	4.585	0.80722	D	1	D;D	0.57571	0.98;0.964	P;P	0.52217	0.693;0.605	D	0.92776	0.6236	9	0.87932	D	0	-20.3308	17.5804	0.87966	0.0:0.0:1.0:0.0	.	171;220	B4DUW6;P61011	.;SRP54_HUMAN	L	220;220;171;156	.	ENSP00000216774:V220L	V	+	1	0	SRP54	34552324	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.586000	0.87340	0.655000	0.94253	GTG	SRP54	-	pfam_SRP54_GTPase_dom,pfam_CobW/HypB/UreG_dom,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_SRP54_GTPase_dom,tigrfam_SRP54_euk	ENSG00000100883		0.353	SRP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP54	HGNC	protein_coding	OTTHUMT00000276643.2		0.00	43	0	G	NM_003136		35482573	+1			no_errors	ENST00000216774	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
SRSF2	6427	genome.wustl.edu	37	17	74732959	74732959	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr17:74732959G>A	ENST00000392485.2	-	1	456	c.284C>T	c.(283-285)cCc>cTc	p.P95L	MFSD11_ENST00000586622.1_5'UTR|SRSF2_ENST00000359995.5_Missense_Mutation_p.P95L|SRSF2_ENST00000508921.3_Missense_Mutation_p.P95L|MFSD11_ENST00000590514.1_5'Flank|MFSD11_ENST00000336509.4_5'Flank|MFSD11_ENST00000591864.1_5'UTR|MIR636_ENST00000384825.1_RNA|MFSD11_ENST00000588460.1_5'UTR|MFSD11_ENST00000355954.3_5'Flank|MFSD11_ENST00000590393.1_5'Flank|MFSD11_ENST00000593181.1_5'Flank|RP11-318A15.7_ENST00000587459.1_Intron	NM_003016.4	NP_003007.2	Q01130	SRSF2_HUMAN	serine/arginine-rich splicing factor 2	95					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA biosynthetic process (GO:2001141)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription corepressor activity (GO:0003714)	p.P95H(75)|p.P95L(48)|p.P95R(29)|p.P95_R102del(21)|p.?(6)|p.P95?(4)|p.P95_D97del(2)		haematopoietic_and_lymphoid_tissue(320)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)	329						TGAGTCCGGGGGGCGGCCGTA	0.726			Mis		"""MDS, CLL"""																																			Dom	yes		17	17q25	6427	serine/arginine-rich splicing factor 2		L	185	Substitution - Missense(156)|Deletion - In frame(23)|Unknown(6)	haematopoietic_and_lymphoid_tissue(185)																																								SO:0001583	missense	0			M90104	CCDS11749.1	17q25.2	2014-09-17	2010-06-22	2010-06-22	ENSG00000161547	ENSG00000161547		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10783	protein-coding gene	gene with protein product	"""SR splicing factor 2"""	600813	"""splicing factor, arginine/serine-rich 2"""	SFRS2		8530103, 20516191	Standard	NM_003016		Approved	SC-35, SC35, PR264, SFRS2A	uc002jsv.3	Q01130		ENST00000392485.2:c.284C>T	17.37:g.74732959G>A	ENSP00000376276:p.Pro95Leu		B3KWD5|B4DN89|H0YG49	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.P95L	ENST00000392485.2	37	c.284	CCDS11749.1	17	.	.	.	.	.	.	.	.	.	.	G	14.16	2.451489	0.43531	.	.	ENSG00000161547	ENST00000392485;ENST00000508921;ENST00000358156	T	0.75050	-0.9	4.85	2.76	0.32466	.	0.063967	0.64402	N	0.000006	T	0.73753	0.3627	M	0.72894	2.215	0.80722	D	1	P;P	0.41524	0.753;0.753	P;P	0.44860	0.462;0.462	T	0.70547	-0.4842	10	0.48119	T	0.1	.	8.6596	0.34084	0.0814:0.0:0.7667:0.1519	.	95;95	B4DN89;Q01130	.;SRSF2_HUMAN	L	95;122;83	ENSP00000376276:P95L	ENSP00000350877:P83L	P	-	2	0	SRSF2	72244554	1.000000	0.71417	0.019000	0.16419	0.541000	0.35023	8.573000	0.90759	0.413000	0.25759	0.557000	0.71058	CCC	SRSF2	-	NULL	ENSG00000161547		0.726	SRSF2-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	SRSF2	HGNC	protein_coding	OTTHUMT00000437489.1		0.00	25	0	G	NM_003016		74732959	-1			no_errors	ENST00000359995	ensembl	human	known	74_37	missense	17.24	24	5	SNP	0.989	A
STMND1	401236	genome.wustl.edu	37	6	17115350	17115350	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr6:17115350delG	ENST00000536551.1	+	2	239	c.239delG	c.(238-240)agafs	p.R80fs		NM_001190766.1	NP_001177695.1	H3BQB6	STMD1_HUMAN	stathmin domain containing 1	80					regulation of microtubule polymerization or depolymerization (GO:0031110)												CCTAGTGAAAGAAACAGACGA	0.428																																																	0																																										SO:0001589	frameshift_variant	0			AK026805	CCDS58997.1	6p22.3	2012-12-11			ENSG00000230873	ENSG00000230873			44668	protein-coding gene	gene with protein product							Standard	NM_001190766		Approved	FLJ23152	uc021ymc.1	H3BQB6	OTTHUMG00000014304	ENST00000536551.1:c.239delG	6.37:g.17115350delG	ENSP00000455698:p.Arg80fs			Frame_Shift_Del	DEL	pfam_Stathmin_fam,superfamily_Stathmin_fam	p.R80fs	ENST00000536551.1	37	c.239	CCDS58997.1	6																																																																																			STMND1	-	NULL	ENSG00000230873		0.428	STMND1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	STMND1	HGNC	protein_coding			0.00	33	0	G	NM_001190766		17115350	+1	tier1		no_errors	ENST00000536551	ensembl	human	known	74_37	frame_shift_del	16.13	26	5	DEL	0.171	-
STK38	11329	genome.wustl.edu	37	6	36483172	36483172	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr6:36483172G>T	ENST00000229812.7	-	7	897	c.612C>A	c.(610-612)caC>caA	p.H204Q		NM_007271.2	NP_009202.1			serine/threonine kinase 38											NS(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ATCCAAGTTGGTGAATAGAGT	0.428																																					Colon(180;997 3561 16158)												0													245.0	210.0	222.0					6																	36483172		2203	4300	6503	SO:0001583	missense	0				CCDS4822.1	6p21	2006-10-06			ENSG00000112079	ENSG00000112079			17847	protein-coding gene	gene with protein product		606964				7761441	Standard	NM_007271		Approved	NDR	uc003omh.3	Q15208	OTTHUMG00000014598	ENST00000229812.7:c.612C>A	6.37:g.36483172G>T	ENSP00000229812:p.His204Gln			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom	p.H204Q	ENST00000229812.7	37	c.612	CCDS4822.1	6	.	.	.	.	.	.	.	.	.	.	G	18.44	3.625275	0.66901	.	.	ENSG00000112079	ENST00000229812	D	0.84516	-1.86	5.78	3.77	0.43336	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.89938	0.6860	M	0.87547	2.89	0.80722	D	1	D	0.63046	0.992	D	0.70227	0.968	D	0.90875	0.4749	10	0.87932	D	0	.	9.054	0.36394	0.314:0.0:0.686:0.0	.	204	Q15208	STK38_HUMAN	Q	204	ENSP00000229812:H204Q	ENSP00000229812:H204Q	H	-	3	2	STK38	36591150	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.961000	0.29267	1.450000	0.47717	0.655000	0.94253	CAC	STK38	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000112079		0.428	STK38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK38	HGNC	protein_coding	OTTHUMT00000040346.1		0.00	44	0	G	NM_007271		36483172	-1			no_errors	ENST00000229812	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
SULF1	23213	genome.wustl.edu	37	8	70501314	70501314	+	Silent	SNP	C	C	T	rs368146472		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr8:70501314C>T	ENST00000260128.4	+	8	1389	c.672C>T	c.(670-672)ccC>ccT	p.P224P	SULF1_ENST00000402687.4_Silent_p.P224P|SULF1_ENST00000458141.2_Silent_p.P224P|SULF1_ENST00000419716.3_Silent_p.P224P	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	224					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			ACGCTGCGCCCCACGGCCCCG	0.483													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19697	0.0		0.0	False		,,,				2504	0.0																0								C	,,,	5,4401	9.9+/-24.2	0,5,2198	78.0	70.0	73.0		672,672,672,672	3.7	1.0	8		73	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SULF1	NM_001128204.1,NM_001128205.1,NM_001128206.1,NM_015170.2	,,,	0,5,6498	TT,TC,CC		0.0,0.1135,0.0384	,,,	224/872,224/872,224/872,224/872	70501314	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	0			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.672C>T	8.37:g.70501314C>T			Q86YV8|Q8NCA2|Q9UPS5	Silent	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.P224	ENST00000260128.4	37	c.672	CCDS6204.1	8																																																																																			SULF1	-	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	ENSG00000137573		0.483	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	HGNC	protein_coding	OTTHUMT00000378885.2	-	0.00	28	0	C	NM_015170		70501314	+1	tier1	-	no_errors	ENST00000260128	ensembl	human	known	74_37	silent	19.64	45	11	SNP	1.000	T
SYCE1	93426	genome.wustl.edu	37	10	135369520	135369520	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr10:135369520G>A	ENST00000343131.5	-	9	664	c.560C>T	c.(559-561)gCc>gTc	p.A187V	SPRN_ENST00000541506.1_Intron|SYCE1_ENST00000432597.2_Missense_Mutation_p.A151V|SYCE1_ENST00000368517.3_Missense_Mutation_p.A151V	NM_001143764.1	NP_001137236.1	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1	187					synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|stomach(3)|urinary_tract(1)	19		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		GCTGTCCAGGGCACAAATCTC	0.582																																																	0													117.0	100.0	106.0					10																	135369520		2203	4300	6503	SO:0001583	missense	0			AY027808	CCDS7687.1, CCDS44500.1, CCDS44501.1	10q26.3	2009-03-12	2005-09-27	2005-09-27	ENSG00000171772	ENSG00000171772			28852	protein-coding gene	gene with protein product	"""cancer/testis antigen 76"""	611486	"""chromosome 10 open reading frame 94"""	C10orf94		11829491	Standard	NM_130784		Approved	bA108K14.6, CT76	uc001lno.2	Q8N0S2	OTTHUMG00000019321	ENST00000343131.5:c.560C>T	10.37:g.135369520G>A	ENSP00000341282:p.Ala187Val		B2RC80|Q9BWU3|Q9BWU4	Missense_Mutation	SNP	NULL	p.A187V	ENST00000343131.5	37	c.560	CCDS44501.1	10	.	.	.	.	.	.	.	.	.	.	G	6.495	0.459587	0.12342	.	.	ENSG00000171772	ENST00000303903;ENST00000432597;ENST00000368517;ENST00000343131	T;T;T;T	0.34072	1.38;3.12;3.12;3.12	4.38	3.47	0.39725	.	1.081010	0.07035	N	0.829173	T	0.25232	0.0613	N	0.25890	0.77	0.09310	N	1	B;B;B	0.23377	0.004;0.084;0.004	B;B;B	0.16289	0.004;0.015;0.006	T	0.17745	-1.0359	10	0.23302	T	0.38	-16.0628	7.5945	0.28039	0.1162:0.0:0.8838:0.0	.	59;187;151	Q8N0S2-3;Q8N0S2;Q8N0S2-2	.;SYCE1_HUMAN;.	V	187;151;151;187	ENSP00000303978:A187V;ENSP00000411779:A151V;ENSP00000357503:A151V;ENSP00000341282:A187V	ENSP00000303978:A187V	A	-	2	0	SYCE1	135219510	0.521000	0.26258	0.162000	0.22713	0.011000	0.07611	0.649000	0.24843	1.413000	0.46997	0.655000	0.94253	GCC	SYCE1	-	NULL	ENSG00000171772		0.582	SYCE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYCE1	HGNC	protein_coding			0.00	63	0	G	NM_201564		135369520	-1			no_errors	ENST00000343131	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.163	A
TBX21	30009	genome.wustl.edu	37	17	45819977	45819977	+	Splice_Site	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr17:45819977C>T	ENST00000177694.1	+	2	704	c.493C>T	c.(493-495)Cgg>Tgg	p.R165W		NM_013351.1	NP_037483.1	Q9UL17	TBX21_HUMAN	T-box 21	165					cellular response to organic substance (GO:0071310)|lymphocyte migration (GO:0072676)|multicellular organismal development (GO:0007275)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(1)|large_intestine(3)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	22						TCTCTCCAGGCGGATGTTCCC	0.607																																																	0													63.0	52.0	56.0					17																	45819977		2203	4299	6502	SO:0001630	splice_region_variant	0			AF093098	CCDS11514.1	17q21.2	2008-06-23				ENSG00000073861		"""T-boxes"""	11599	protein-coding gene	gene with protein product		604895					Standard	NM_013351		Approved	TBLYM, T-bet	uc002ilv.1	Q9UL17		ENST00000177694.1:c.492-1C>T	17.37:g.45819977C>T				Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.R165W	ENST00000177694.1	37	c.493	CCDS11514.1	17	.	.	.	.	.	.	.	.	.	.	C	16.90	3.249756	0.59212	.	.	ENSG00000073861	ENST00000177694	D	0.91351	-2.83	5.33	0.72	0.18214	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.384948	0.23840	N	0.044057	D	0.96119	0.8735	M	0.93550	3.43	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.96213	0.9154	10	0.87932	D	0	.	15.2609	0.73621	0.6949:0.3051:0.0:0.0	.	165	Q9UL17	TBX21_HUMAN	W	165	ENSP00000177694:R165W	ENSP00000177694:R165W	R	+	1	2	TBX21	43174976	1.000000	0.71417	0.998000	0.56505	0.939000	0.58152	0.892000	0.28322	-0.026000	0.13895	0.561000	0.74099	CGG	TBX21	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	ENSG00000073861		0.607	TBX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX21	HGNC	protein_coding	OTTHUMT00000441365.1	-	0.00	66	0	C	NM_013351	Missense_Mutation	45819977	+1	tier1	-	no_errors	ENST00000177694	ensembl	human	known	74_37	missense	26.03	54	19	SNP	1.000	T
TCEAL4	79921	genome.wustl.edu	37	X	102842229	102842229	+	Missense_Mutation	SNP	T	T	C	rs201993261		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chrX:102842229T>C	ENST00000472745.1	+	3	1178	c.626T>C	c.(625-627)aTt>aCt	p.I209T	TCEAL4_ENST00000494801.1_Missense_Mutation_p.I209T|TCEAL4_ENST00000372629.4_Missense_Mutation_p.I352T|TCEAL4_ENST00000468024.1_Missense_Mutation_p.I209T|TCEAL4_ENST00000472484.1_Missense_Mutation_p.I209T|TCEAL4_ENST00000415568.2_Missense_Mutation_p.I209T			Q96EI5	TCAL4_HUMAN	transcription elongation factor A (SII)-like 4	209					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.I352T(1)		endometrium(1)|kidney(1)|large_intestine(2)|skin(2)	6						CGAAGGGACATTGAAGACATT	0.498																																																	1	Substitution - Missense(1)	skin(1)																																								SO:0001583	missense	0			AF314542	CCDS14510.2, CCDS76004.1	Xq22.2	2014-03-21			ENSG00000133142	ENSG00000133142			26121	protein-coding gene	gene with protein product						14702039, 16221301	Standard	XM_005262192		Approved	FLJ21174, WEX7	uc004ekn.3	Q96EI5	OTTHUMG00000022103	ENST00000472745.1:c.626T>C	X.37:g.102842229T>C	ENSP00000424314:p.Ile209Thr		Q8WY12|Q9H2H1|Q9H775	Missense_Mutation	SNP	pfam_TF_A-like/BEX-like	p.I352T	ENST00000472745.1	37	c.1055	CCDS14510.2	X	.	.	.	.	.	.	.	.	.	.	T	9.922	1.212528	0.22289	.	.	ENSG00000133142	ENST00000372629;ENST00000468024;ENST00000472484;ENST00000415568;ENST00000414064;ENST00000472745;ENST00000494801	T;T;T;T;T;T	0.26660	1.72;1.82;1.82;1.82;1.82;1.82	3.73	-0.255	0.12988	.	1.237680	0.05849	N	0.620821	T	0.11410	0.0278	N	0.08118	0	0.21499	N	0.999669	B	0.02656	0.0	B	0.04013	0.001	T	0.28364	-1.0046	10	0.45353	T	0.12	.	0.6663	0.00851	0.2069:0.1222:0.2101:0.4607	.	209	Q96EI5	TCAL4_HUMAN	T	352;209;209;209;180;209;209	ENSP00000361712:I352T;ENSP00000421857:I209T;ENSP00000421156:I209T;ENSP00000415564:I209T;ENSP00000424314:I209T;ENSP00000427494:I209T	ENSP00000361712:I352T	I	+	2	0	TCEAL4	102728885	0.901000	0.30685	0.921000	0.36526	0.996000	0.88848	0.097000	0.15168	-0.120000	0.11809	0.425000	0.28330	ATT	TCEAL4	-	NULL	ENSG00000133142		0.498	TCEAL4-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCEAL4	HGNC	protein_coding	OTTHUMT00000252339.2		0.00	16	0	T	NM_024863		102842229	+1			no_errors	ENST00000372629	ensembl	human	known	74_37	missense	10.17	53	6	SNP	0.919	C
TDRD15	100129278	genome.wustl.edu	37	2	21360430	21360430	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:21360430T>C	ENST00000405799.1	+	4	421	c.91T>C	c.(91-93)Ttt>Ctt	p.F31L				B5MCY1	TDR15_HUMAN	tudor domain containing 15	31							hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)										TCTGGTGAAATTTCAAGGCAT	0.308																																																	0																																										SO:0001583	missense	0					2p24.1	2013-01-23	2013-01-23	2013-01-23	ENSG00000218819	ENSG00000218819		"""Tudor domain containing"""	45037	protein-coding gene	gene with protein product							Standard	XR_425376		Approved			B5MCY1	OTTHUMG00000151795	ENST00000405799.1:c.91T>C	2.37:g.21360430T>C	ENSP00000384376:p.Phe31Leu			Missense_Mutation	SNP	pfam_Tudor,superfamily_Staphylococal_nuclease_OB-fold,smart_Tudor,pfscan_Tudor	p.F31L	ENST00000405799.1	37	c.91		2	.	.	.	.	.	.	.	.	.	.	T	14.95	2.688183	0.48097	.	.	ENSG00000218819	ENST00000405799	T	0.19806	2.12	5.24	5.24	0.73138	.	.	.	.	.	T	0.17365	0.0417	.	.	.	.	.	.	.	.	.	.	.	.	T	0.07673	-1.0760	5	0.07482	T	0.82	-0.7271	15.1488	0.72681	0.0:0.0:0.0:1.0	.	.	.	.	L	31	ENSP00000384376:F31L	ENSP00000384376:F31L	F	+	1	0	AC010872.2	21213935	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	7.423000	0.80229	1.978000	0.57642	0.445000	0.29226	TTT	TDRD15	-	pfam_Tudor	ENSG00000218819		0.308	TDRD15-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	TDRD15	HGNC	protein_coding	OTTHUMT00000323948.1	-	0.00	25	0	T			21360430	+1	tier1	-	no_errors	ENST00000405799	ensembl	human	novel	74_37	missense	12.82	34	5	SNP	1.000	C
TGS1	96764	genome.wustl.edu	37	8	56699011	56699011	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr8:56699011delA	ENST00000260129.5	+	4	1031	c.554delA	c.(553-555)gaafs	p.E185fs		NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	185					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			CCTCCAGTTGAAAACACATTA	0.358																																					Esophageal Squamous(34;275 823 4842 34837 48447)												0													72.0	75.0	74.0					8																	56699011		2203	4300	6503	SO:0001589	frameshift_variant	0			AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.554delA	8.37:g.56699011delA	ENSP00000260129:p.Glu185fs		A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Frame_Shift_Del	DEL	pfam_RNA_cap_Gua-N2-MeTrfase,pfam_RNA_methylase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.N186fs	ENST00000260129.5	37	c.554	CCDS34894.1	8																																																																																			TGS1	-	NULL	ENSG00000137574		0.358	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGS1	HGNC	protein_coding	OTTHUMT00000378152.1		0.00	26	0	A	NM_024831		56699011	+1	tier1		no_errors	ENST00000260129	ensembl	human	known	74_37	frame_shift_del	5.56	34	2	DEL	1.000	-
DCANP1	140947	genome.wustl.edu	37	5	134785568	134785568	+	5'Flank	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr5:134785568G>A	ENST00000503143.2	-	0	0				CTB-138E5.1_ENST00000510230.1_RNA|TIFAB_ENST00000537858.1_Missense_Mutation_p.A21V	NM_130848.2	NP_570900.1	Q8TF63	DCNP1_HUMAN								nucleus (GO:0005634)				endometrium(1)|lung(1)|prostate(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ATTGGCAAAGGCAGATGGGCC	0.632																																																	0													74.0	84.0	81.0					5																	134785568		2143	4225	6368	SO:0001631	upstream_gene_variant	0																															5.37:g.134785568G>A	Exception_encountered			Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain	p.A21V	ENST00000503143.2	37	c.62	CCDS4186.1	5	.	.	.	.	.	.	.	.	.	.	G	6.008	0.369805	0.11352	.	.	ENSG00000255833	ENST00000537858	T	0.39229	1.09	4.91	2.5	0.30297	SMAD/FHA domain (1);	0.409504	0.22004	U	0.065965	T	0.20333	0.0489	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.11616	-1.0580	10	0.21014	T	0.42	.	5.1082	0.14794	0.3424:0.0:0.6576:0.0	.	21	Q6ZNK6	TIFAB_HUMAN	V	21	ENSP00000440509:A21V	ENSP00000440509:A21V	A	-	2	0	TIFAB	134813467	0.600000	0.26899	0.010000	0.14722	0.243000	0.25628	0.889000	0.28282	1.057000	0.40506	0.563000	0.77884	GCC	TIFAB	-	superfamily_SMAD_FHA_domain	ENSG00000255833		0.632	C5orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIFAB	HGNC	protein_coding	OTTHUMT00000372531.1	-	0.00	42	0	G			134785568	-1	tier1	-	no_errors	ENST00000537858	ensembl	human	known	74_37	missense	23.64	42	13	SNP	0.028	A
TLN1	7094	genome.wustl.edu	37	9	35725661	35725661	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr9:35725661C>T	ENST00000314888.9	-	2	384	c.31G>A	c.(31-33)Ggg>Agg	p.G11R	TLN1_ENST00000540444.1_Missense_Mutation_p.G11R	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	11					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			ACCACATTCCCAATGCTGATC	0.542																																																	0													233.0	205.0	215.0					9																	35725661		2203	4300	6503	SO:0001583	missense	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.31G>A	9.37:g.35725661C>T	ENSP00000316029:p.Gly11Arg		A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.G11R	ENST00000314888.9	37	c.31	CCDS35009.1	9	.	.	.	.	.	.	.	.	.	.	C	10.43	1.348410	0.24426	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.67865	-0.28;-0.29	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.61311	0.2337	L	0.60455	1.87	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.56208	-0.8017	10	0.14252	T	0.57	-18.664	15.0167	0.71591	0.0:0.8581:0.1419:0.0	.	11;11	Q5TCU5;Q9Y490	.;TLN1_HUMAN	R	11	ENSP00000316029:G11R;ENSP00000442981:G11R	ENSP00000316029:G11R	G	-	1	0	TLN1	35715661	0.988000	0.35896	1.000000	0.80357	0.997000	0.91878	1.550000	0.36223	2.606000	0.88127	0.655000	0.94253	GGG	TLN1	-	NULL	ENSG00000137076		0.542	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2		0.00	20	0	C	NM_006289		35725661	-1			no_errors	ENST00000314888	ensembl	human	known	74_37	missense	11.54	23	3	SNP	1.000	T
TMTC1	83857	genome.wustl.edu	37	12	29936515	29936515	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr12:29936515A>G	ENST00000539277.1	-	1	228	c.170T>C	c.(169-171)aTc>aCc	p.I57T	TMTC1_ENST00000552618.1_Missense_Mutation_p.I57T|TMTC1_ENST00000551659.1_Missense_Mutation_p.I57T|TMTC1_ENST00000381224.2_Intron|TMTC1_ENST00000256062.5_Intron	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	57						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GTTGTTCACGATCGCCCACAC	0.716																																																	0																																										SO:0001583	missense	0				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.170T>C	12.37:g.29936515A>G	ENSP00000442046:p.Ile57Thr		D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,pfam_DUF1736,pfam_PIK-rel_kinase_FAT,pfam_TPR-3,smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I57T	ENST00000539277.1	37	c.170	CCDS53772.1	12	.	.	.	.	.	.	.	.	.	.	A	20.8	4.049086	0.75846	.	.	ENSG00000133687	ENST00000551659;ENST00000552618;ENST00000539277	D;D;D	0.93712	-3.27;-3.27;-3.27	3.12	3.12	0.35913	.	.	.	.	.	D	0.96169	0.8751	M	0.90650	3.135	0.80722	D	1	.	.	.	.	.	.	D	0.95955	0.8957	6	.	.	.	.	10.3706	0.44051	1.0:0.0:0.0:0.0	.	.	.	.	T	57	ENSP00000448112:I57T;ENSP00000449043:I57T;ENSP00000442046:I57T	.	I	-	2	0	TMTC1	29827782	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	6.127000	0.71642	1.306000	0.44926	0.392000	0.25879	ATC	TMTC1	-	NULL	ENSG00000133687		0.716	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	TMTC1	HGNC	protein_coding	OTTHUMT00000403509.1	-	0.00	59	0	A	NM_031920		29936515	-1	tier1	-	no_errors	ENST00000539277	ensembl	human	putative	74_37	missense	14.44	77	13	SNP	1.000	G
TOX2	84969	genome.wustl.edu	37	20	42695425	42695425	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr20:42695425C>T	ENST00000358131.5	+	7	1566	c.1358C>T	c.(1357-1359)cCa>cTa	p.P453L	TOX2_ENST00000341197.4_Missense_Mutation_p.P471L|TOX2_ENST00000372999.1_Missense_Mutation_p.P429L|TOX2_ENST00000423191.2_Missense_Mutation_p.P429L|TOX2_ENST00000435864.2_3'UTR	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	453	Pro-rich.				female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			TCACCTGGCCCATCCAACCCC	0.627																																																	0													131.0	123.0	126.0					20																	42695425		2203	4300	6503	SO:0001583	missense	0			BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.1358C>T	20.37:g.42695425C>T	ENSP00000350849:p.Pro453Leu		A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.P471L	ENST00000358131.5	37	c.1412	CCDS42875.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.513|9.513	1.106209|1.106209	0.20632|0.20632	.|.	.|.	ENSG00000124191|ENSG00000124191	ENST00000372992;ENST00000413823|ENST00000341197;ENST00000423191;ENST00000372999;ENST00000358131;ENST00000435864	.|T;T;T;T;T	.|0.15256	.|2.66;2.67;2.67;2.5;2.44	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|0.477843	.|0.19660	.|N	.|0.108991	T|T	0.15782|0.15782	0.0380|0.0380	L|L	0.29908|0.29908	0.895|0.895	0.38034|0.38034	D|D	0.935257|0.935257	.|B;B;B;B	.|0.22480	.|0.07;0.002;0.001;0.001	.|B;B;B;B	.|0.13407	.|0.009;0.004;0.002;0.002	T|T	0.04454|0.04454	-1.0950|-1.0950	6|10	0.87932|0.48119	D|T	0|0.1	.|.	17.1679|17.1679	0.86821|0.86821	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|349;471;453;429	.|B4DQV8;G3XAC7;Q96NM4;E1P5X0	.|.;.;TOX2_HUMAN;.	Y|L	78|471;429;429;453;349	.|ENSP00000344724:P471L;ENSP00000390278:P429L;ENSP00000362090:P429L;ENSP00000350849:P453L;ENSP00000396777:P349L	ENSP00000362083:H78Y|ENSP00000344724:P471L	H|P	+|+	1|2	0|0	TOX2|TOX2	42128839|42128839	0.999000|0.999000	0.42202|0.42202	0.961000|0.961000	0.40146|0.40146	0.072000|0.072000	0.16883|0.16883	5.286000|5.286000	0.65639|0.65639	2.706000|2.706000	0.92434|0.92434	0.655000|0.655000	0.94253|0.94253	CAT|CCA	TOX2	-	NULL	ENSG00000124191		0.627	TOX2-001	KNOWN	basic|CCDS	protein_coding	TOX2	HGNC	protein_coding	OTTHUMT00000079329.2	-	0.00	60	0	C			42695425	+1	tier1	-	no_errors	ENST00000341197	ensembl	human	known	74_37	missense	23.19	53	16	SNP	0.927	T
TP53	7157	genome.wustl.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	C	T	rs28934575|rs397516437		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr17:7577548C>T	ENST00000269305.4	-	7	922	c.733G>A	c.(733-735)Ggc>Agc	p.G245S	TP53_ENST00000445888.2_Missense_Mutation_p.G245S|TP53_ENST00000420246.2_Missense_Mutation_p.G245S|TP53_ENST00000455263.2_Missense_Mutation_p.G245S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.G245S|TP53_ENST00000413465.2_Missense_Mutation_p.G245S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGTTCATGCCGCCCATGCAG	0.577	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	420	Substitution - Missense(390)|Deletion - Frameshift(8)|Whole gene deletion(8)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)|Insertion - Frameshift(1)	large_intestine(119)|lung(51)|breast(38)|ovary(29)|central_nervous_system(27)|upper_aerodigestive_tract(25)|stomach(25)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(22)|urinary_tract(14)|skin(9)|liver(7)|prostate(7)|biliary_tract(5)|bone(5)|pancreas(4)|soft_tissue(3)|vulva(2)|endometrium(2)|kidney(1)|cervix(1)|salivary_gland(1)	GRCh37	CM010463|CM900210|CM920674	TP53	M	rs28934575	C	SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY	0,4406		0,0,2203	149.0	112.0	125.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	733,733,733,733,337,337,337	4.6	1.0	17	dbSNP_125	125	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	56,56,56,56,56,56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	245/394,245/394,245/347,245/342,113/262,113/210,113/215	7577548	1,13005	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.733G>A	17.37:g.7577548C>T	ENSP00000269305:p.Gly245Ser		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.G245S	ENST00000269305.4	37	c.733	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.259904	0.95368	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99894	-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99878	0.9942	M	0.84585	2.705	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.976;0.992;0.999;0.999;1.0	D	0.96039	0.9023	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	rs28934575	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245S;ENSP00000352610:G245S;ENSP00000269305:G245S;ENSP00000398846:G245S;ENSP00000391127:G245S;ENSP00000391478:G245S;ENSP00000425104:G113S;ENSP00000423862:G152S	ENSP00000269305:G245S	G	-	1	0	TP53	7518273	1.000000	0.71417	0.965000	0.40720	0.974000	0.67602	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	61	0	C	NM_000546		7577548	-1	tier1	rs28934575	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	23.91	70	22	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	27	0	C	NM_000546		7578406	-1	tier1	rs28934578	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	23.53	26	8	SNP	1.000	T
TRIP4	9325	genome.wustl.edu	37	15	64687622	64687622	+	Silent	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr15:64687622C>T	ENST00000261884.3	+	3	357	c.297C>T	c.(295-297)ggC>ggT	p.G99G	TRIP4_ENST00000559565.1_3'UTR	NM_016213.4	NP_057297.2	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4	99					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21						AGAAATCAGGCGACCATCTAA	0.383																																																	0													63.0	60.0	61.0					15																	64687622		2203	4300	6503	SO:0001819	synonymous_variant	0			L40371	CCDS10194.1	15q22.1	2014-02-17			ENSG00000103671	ENSG00000103671		"""-"""	12310	protein-coding gene	gene with protein product	"""zinc finger, C2HC5-type"""	604501				7776974	Standard	NM_016213		Approved	HsT17391, ZC2HC5	uc002anm.3	Q15650	OTTHUMG00000133033	ENST00000261884.3:c.297C>T	15.37:g.64687622C>T			B2RAS0|Q96ED7|Q9UKH0	Silent	SNP	pfam_ASCH_domain,pfam_Znf_C2HC5,superfamily_PUA-like_domain	p.G99	ENST00000261884.3	37	c.297	CCDS10194.1	15																																																																																			TRIP4	-	NULL	ENSG00000103671		0.383	TRIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP4	HGNC	protein_coding	OTTHUMT00000256635.2		0.00	23	0	C	NM_016213		64687622	+1			no_errors	ENST00000261884	ensembl	human	known	74_37	silent	7.69	36	3	SNP	0.973	T
TRPV1	7442	genome.wustl.edu	37	17	3493244	3493244	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr17:3493244C>T	ENST00000571088.1	-	6	1114	c.901G>A	c.(901-903)Gac>Aac	p.D301N	TRPV1_ENST00000310522.5_Missense_Mutation_p.D301N|TRPV1_ENST00000399756.4_Missense_Mutation_p.D301N|SHPK_ENST00000572705.1_Missense_Mutation_p.D301N|TRPV1_ENST00000174621.6_Missense_Mutation_p.D299N|TRPV1_ENST00000399759.3_Missense_Mutation_p.D301N|TRPV1_ENST00000576351.1_Missense_Mutation_p.D301N|TRPV1_ENST00000425167.2_Missense_Mutation_p.D301N	NM_018727.5	NP_061197.4	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel, subfamily V, member 1	301					calcium ion transmembrane transport (GO:0070588)|cell surface receptor signaling pathway (GO:0007166)|cellular response to alkaloid (GO:0071312)|cellular response to ATP (GO:0071318)|chemosensory behavior (GO:0007635)|ion transmembrane transport (GO:0034220)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|calcium-release channel activity (GO:0015278)|excitatory extracellular ligand-gated ion channel activity (GO:0005231)|phosphoprotein binding (GO:0051219)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	17				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	TTcgtgttgtcggccgtgttg	0.612																																					Melanoma(38;962 1762 15789)												0													35.0	42.0	40.0					17																	3493244		2145	4235	6380	SO:0001583	missense	0			AJ272063	CCDS45576.1	17p13.2	2014-08-12	2002-01-29	2002-02-01	ENSG00000196689	ENSG00000262304		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12716	protein-coding gene	gene with protein product		602076	"""vanilloid receptor subtype 1"""	VR1		9349813, 11549313, 16382100	Standard	NM_018727		Approved		uc010vrt.2	Q8NER1	OTTHUMG00000177649	ENST00000571088.1:c.901G>A	17.37:g.3493244C>T	ENSP00000461007:p.Asp301Asn		A2RUA9|Q3LU47|Q9H0G9|Q9H303|Q9H304|Q9NQ74|Q9NY22	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel,tigrfam_TRP_channel	p.D301N	ENST00000571088.1	37	c.901	CCDS45576.1	17	.	.	.	.	.	.	.	.	.	.	C	18.92	3.726323	0.69074	.	.	ENSG00000196689	ENST00000399759;ENST00000399756;ENST00000174621;ENST00000425167;ENST00000310522	T;T;T;T;T	0.56444	0.46;0.46;0.46;0.46;0.46	4.88	4.88	0.63580	Ankyrin repeat-containing domain (3);	0.144771	0.64402	D	0.000009	T	0.54127	0.1839	L	0.50333	1.59	0.53688	D	0.999972	P;D;P;D	0.63880	0.796;0.983;0.885;0.993	B;P;B;P	0.46237	0.229;0.508;0.219;0.485	T	0.60115	-0.7326	10	0.56958	D	0.05	-27.0035	17.4129	0.87492	0.0:1.0:0.0:0.0	.	301;299;301;301	Q8NER1;E7EQ80;E7ESJ2;E7EQ78	TRPV1_HUMAN;.;.;.	N	301;301;299;301;301	ENSP00000382661:D301N;ENSP00000382659:D301N;ENSP00000174621:D299N;ENSP00000409627:D301N;ENSP00000311692:D301N	ENSP00000174621:D299N	D	-	1	0	TRPV1	3439993	1.000000	0.71417	0.944000	0.38274	0.639000	0.38242	5.625000	0.67770	2.439000	0.82584	0.467000	0.42956	GAC	TRPV1	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel,tigrfam_TRP_channel	ENSG00000196689		0.612	TRPV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV1	HGNC	protein_coding	OTTHUMT00000438254.1	-	0.00	52	0	C	NM_018727		3493244	-1	tier1	-	no_errors	ENST00000399756	ensembl	human	known	74_37	missense	24.19	47	15	SNP	1.000	T
TSSC1	7260	genome.wustl.edu	37	2	3358353	3358353	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:3358353C>A	ENST00000382125.4	-	2	286	c.94G>T	c.(94-96)Gtt>Ttt	p.V32F	TSSC1_ENST00000398659.4_Missense_Mutation_p.V32F|TSSC1_ENST00000443925.2_Missense_Mutation_p.V32F	NM_003310.2	NP_003301.1	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1	32										breast(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	18	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		TGCGTCCCAACCAAAAACCGA	0.353																																					Colon(140;1261 1762 4183 34270 49743)												0													91.0	89.0	90.0					2																	3358353		2203	4300	6503	SO:0001583	missense	0			AF019952	CCDS1651.1	2p25.3	2013-01-10			ENSG00000032389	ENSG00000032389		"""WD repeat domain containing"""	12383	protein-coding gene	gene with protein product		608998				9403053, 9925925	Standard	NM_003310		Approved		uc002qxj.2	Q53HC9	OTTHUMG00000090329	ENST00000382125.4:c.94G>T	2.37:g.3358353C>A	ENSP00000371559:p.Val32Phe		D6W4Y1|O43179|Q53S19|Q53SG2	Missense_Mutation	SNP	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V32F	ENST00000382125.4	37	c.94	CCDS1651.1	2	.	.	.	.	.	.	.	.	.	.	c	20.9	4.064892	0.76187	.	.	ENSG00000032389	ENST00000382125;ENST00000398659;ENST00000443925;ENST00000444776	D;D	0.87334	-2.21;-2.24	4.45	4.45	0.53987	WD40/YVTN repeat-like-containing domain (1);	0.133807	0.49916	D	0.000136	D	0.91991	0.7463	M	0.75777	2.31	0.80722	D	1	D	0.65815	0.995	P	0.62298	0.9	D	0.92948	0.6378	10	0.87932	D	0	-0.0278	15.0171	0.71594	0.0:1.0:0.0:0.0	.	32	Q53HC9	TSSC1_HUMAN	F	32	ENSP00000371559:V32F;ENSP00000381652:V32F	ENSP00000371559:V32F	V	-	1	0	TSSC1	3337360	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.132000	0.71676	2.478000	0.83669	0.558000	0.71614	GTT	TSSC1	-	NULL	ENSG00000032389		0.353	TSSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSC1	HGNC	protein_coding	OTTHUMT00000206694.2	-	0.00	42	0	C	NM_003310		3358353	-1	tier1	-	no_errors	ENST00000382125	ensembl	human	known	74_37	missense	25.58	64	22	SNP	1.000	A
TTC13	79573	genome.wustl.edu	37	1	231076236	231076237	+	Missense_Mutation	DNP	GC	GC	AT	rs375164285		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr1:231076236_231076237GC>AT	ENST00000366661.4	-	7	745_746	c.738_739GC>AT	c.(736-741)caGCcc>caATcc	p.P247S	TTC13_ENST00000366662.4_Missense_Mutation_p.P194S|TTC13_ENST00000414259.1_Missense_Mutation_p.P194S	NM_024525.4	NP_078801.3	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13	247										central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	39	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		CGTGCTGAGGGCTGCAGTTGGA	0.421																																																	0																																										SO:0001583	missense	0				CCDS1588.1, CCDS44332.1, CCDS44332.2	1q42.2	2013-01-10			ENSG00000143643	ENSG00000143643		"""Tetratricopeptide (TTC) repeat domain containing"""	26204	protein-coding gene	gene with protein product							Standard	NM_024525		Approved	FLJ22584	uc001huf.4	Q8NBP0	OTTHUMG00000037788	ENST00000366661.4:c.738_739delinsAT	1.37:g.231076236_231076237delinsAT	ENSP00000355621:p.Pro247Ser		B1AQI1|B1AQI2|Q8IVP8|Q8NBI0|Q8ND20	Missense_Mutation|Silent	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.P247S|p.Q246	ENST00000366661.4	37	c.739|c.738	CCDS1588.1	1																																																																																			TTC13	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000143643		0.421	TTC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC13	HGNC	protein_coding	OTTHUMT00000092229.2	-	0.00	38	0	G|C	NM_024525		231076236|231076237	-1	tier1	-	no_errors	ENST00000366661	ensembl	human	known	74_37	missense|silent	21.82|20.00	43|44	12|11	SNP	1.000	A|T
TTLL4	9654	genome.wustl.edu	37	2	219603750	219603750	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr2:219603750G>A	ENST00000392102.1	+	3	1691	c.1351G>A	c.(1351-1353)Gct>Act	p.A451T	TTLL4_ENST00000442769.1_Missense_Mutation_p.A451T|TTLL4_ENST00000457313.1_Missense_Mutation_p.A286T|TTLL4_ENST00000258398.4_Missense_Mutation_p.A451T	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	451					protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		AGAAGGCAAAGCTCCAGGTCC	0.547																																					GBM(172;1818 2053 15407 20943 49753)												0													92.0	88.0	89.0					2																	219603750		2203	4300	6503	SO:0001583	missense	0				CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.1351G>A	2.37:g.219603750G>A	ENSP00000375951:p.Ala451Thr		A8K6V5|Q8WW29	Missense_Mutation	SNP	pfam_TTL/TTLL_fam	p.A451T	ENST00000392102.1	37	c.1351	CCDS2422.1	2	.	.	.	.	.	.	.	.	.	.	G	1.078	-0.667861	0.03428	.	.	ENSG00000135912	ENST00000457313;ENST00000392102;ENST00000442769;ENST00000258398	T;T;T;T	0.04194	3.91;4.13;3.68;4.13	4.37	-3.87	0.04218	.	1.207790	0.05983	N	0.644638	T	0.01661	0.0053	N	0.02916	-0.46	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.46789	-0.9166	10	0.15066	T	0.55	.	1.4818	0.02438	0.2593:0.259:0.3525:0.1292	.	286;451;451	E9PH58;E7EX20;Q14679	.;.;TTLL4_HUMAN	T	286;451;451;451	ENSP00000393332:A286T;ENSP00000375951:A451T;ENSP00000396555:A451T;ENSP00000258398:A451T	ENSP00000258398:A451T	A	+	1	0	TTLL4	219311994	0.000000	0.05858	0.136000	0.22124	0.293000	0.27360	-0.373000	0.07494	-0.455000	0.07054	0.561000	0.74099	GCT	TTLL4	-	NULL	ENSG00000135912		0.547	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL4	HGNC	protein_coding	OTTHUMT00000256726.1	-	0.00	37	0	G	NM_014640		219603750	+1	tier1	-	no_errors	ENST00000258398	ensembl	human	known	74_37	missense	8.70	63	6	SNP	0.018	A
TTYH1	57348	genome.wustl.edu	37	19	54942051	54942051	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:54942051C>T	ENST00000376530.3	+	9	1103	c.1000C>T	c.(1000-1002)Cga>Tga	p.R334*	AC008746.3_ENST00000457113.1_RNA|TTYH1_ENST00000301194.4_Nonsense_Mutation_p.R334*|TTYH1_ENST00000376531.3_Nonsense_Mutation_p.R334*|TTYH1_ENST00000391739.3_Missense_Mutation_p.A364V|TTYH1_ENST00000489425.1_3'UTR	NM_001201461.1|NM_020659.3	NP_001188390.1|NP_065710.1	Q9H313	TTYH1_HUMAN	tweety family member 1	334					cell-substrate adhesion (GO:0031589)|chloride transport (GO:0006821)|filopodium assembly (GO:0046847)|ion transmembrane transport (GO:0034220)|iron ion transmembrane transport (GO:0034755)|iron ion transport (GO:0006826)|mitotic nuclear division (GO:0007067)|regulation of anion transport (GO:0044070)|single organismal cell-cell adhesion (GO:0016337)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|filopodium membrane (GO:0031527)|filopodium tip (GO:0032433)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum membrane (GO:0030868)	calcium ion binding (GO:0005509)|iron ion transmembrane transporter activity (GO:0005381)|volume-sensitive chloride channel activity (GO:0072320)			endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		GGGCCTGGAGCGAGAAGCTGT	0.662																																																	0													40.0	38.0	39.0					19																	54942051		2203	4300	6503	SO:0001587	stop_gained	0			AF177909	CCDS12893.1, CCDS33106.1, CCDS56102.1	19q13.4	2013-09-02	2013-09-02		ENSG00000167614	ENSG00000167614			13476	protein-coding gene	gene with protein product		605784	"""tweety (Drosophila) homolog 1"", ""tweety homolog 1 (Drosophila)"""			10950931	Standard	NM_020659		Approved		uc002qfr.3	Q9H313	OTTHUMG00000065544	ENST00000376530.3:c.1000C>T	19.37:g.54942051C>T	ENSP00000365713:p.Arg334*		B0VJY3|B0VJY4|B0VJY5|B2VAL9|Q5U682|Q68A17|Q6L750|Q6ZTE5|Q8WUU2	Nonsense_Mutation	SNP	pfam_Tweety	p.R334*	ENST00000376530.3	37	c.1000	CCDS12893.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.0|24.0	4.486322|4.486322	0.84854|0.84854	.|.	.|.	ENSG00000167614|ENSG00000167614	ENST00000391739|ENST00000301194;ENST00000376530;ENST00000376531	T|.	0.24538|.	1.85|.	4.16|4.16	1.95|1.95	0.26073|0.26073	.|.	.|0.064020	.|0.64402	.|D	.|0.000013	T|.	0.14787|.	0.0357|.	.|.	.|.	.|.	0.22389|0.22389	N|N	0.999146|0.999146	P|.	0.36438|.	0.553|.	B|.	0.28305|.	0.088|.	T|.	0.33214|.	-0.9877|.	8|.	0.48119|0.02654	T|T	0.1|1	-4.5071|-4.5071	11.9336|11.9336	0.52860|0.52860	0.4671:0.5329:0.0:0.0|0.4671:0.5329:0.0:0.0	.|.	364|.	B7Z1H9|.	.|.	V|X	364|334	ENSP00000375619:A364V|.	ENSP00000375619:A364V|ENSP00000301194:R334X	A|R	+|+	2|1	0|2	TTYH1|TTYH1	59633863|59633863	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.418000|0.418000	0.31294|0.31294	0.942000|0.942000	0.29017|0.29017	-0.012000|-0.012000	0.14223|0.14223	-2.014000|-2.014000	0.00435|0.00435	GCG|CGA	TTYH1	-	pfam_Tweety	ENSG00000167614		0.662	TTYH1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TTYH1	HGNC	protein_coding	OTTHUMT00000140498.1	-	0.00	83	0	C			54942051	+1	tier1	-	no_errors	ENST00000376531	ensembl	human	known	74_37	nonsense	23.58	81	25	SNP	0.999	T
TUBBP5	643224	genome.wustl.edu	37	9	141069223	141069223	+	RNA	SNP	T	T	C			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr9:141069223T>C	ENST00000503395.1	+	0	922									tubulin, beta pseudogene 5																		actaaagacgtgggaggaagt	0.512																																																	0																																												0			AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141069223T>C				RNA	SNP	-	NULL	ENST00000503395.1	37	NULL		9																																																																																			TUBBP5	-	-	ENSG00000159247		0.512	TUBBP5-003	KNOWN	basic	processed_transcript	TUBBP5	HGNC	pseudogene	OTTHUMT00000373087.1		0.00	28	0	T	NR_027156		141069223	+1			no_errors	ENST00000503395	ensembl	human	known	74_37	rna	11.11	32	4	SNP	0.013	C
TWISTNB	221830	genome.wustl.edu	37	7	19739848	19739848	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr7:19739848A>T	ENST00000222567.5	-	3	522	c.452T>A	c.(451-453)tTc>tAc	p.F151Y		NM_001002926.1	NP_001002926.1	Q3B726	RPA43_HUMAN	TWIST neighbor	151					transcription from RNA polymerase I promoter (GO:0006360)	DNA-directed RNA polymerase I complex (GO:0005736)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	20						GGAGGCATTGAAACACCCATG	0.408																																																	0													96.0	87.0	90.0					7																	19739848		2203	4300	6503	SO:0001583	missense	0			AK090846	CCDS34606.1	7p21.1	2010-08-05			ENSG00000105849	ENSG00000105849			18027	protein-coding gene	gene with protein product		608312				12438708	Standard	NM_001002926		Approved		uc003sup.1	Q3B726	OTTHUMG00000152497	ENST00000222567.5:c.452T>A	7.37:g.19739848A>T	ENSP00000222567:p.Phe151Tyr		A0PJ45|B7Z724	Missense_Mutation	SNP	pfam_RNA_pol_Rpb7_N	p.F151Y	ENST00000222567.5	37	c.452	CCDS34606.1	7	.	.	.	.	.	.	.	.	.	.	A	29.0	4.970262	0.92855	.	.	ENSG00000105849	ENST00000222567	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.78298	0.4261	M	0.69248	2.105	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80327	-0.1429	9	0.87932	D	0	-16.9254	16.4461	0.83932	1.0:0.0:0.0:0.0	.	151	Q3B726	RPA43_HUMAN	Y	151	.	ENSP00000222567:F151Y	F	-	2	0	TWISTNB	19706373	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	8.531000	0.90610	2.285000	0.76669	0.528000	0.53228	TTC	TWISTNB	-	NULL	ENSG00000105849		0.408	TWISTNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TWISTNB	HGNC	protein_coding	OTTHUMT00000326463.1		0.00	38	0	A			19739848	-1			no_errors	ENST00000222567	ensembl	human	known	74_37	missense	6.38	44	3	SNP	1.000	T
UBA5	79876	genome.wustl.edu	37	3	132395299	132395299	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr3:132395299G>T	ENST00000356232.4	+	12	2216	c.1144G>T	c.(1144-1146)Gtc>Ttc	p.V382F	UBA5_ENST00000493720.2_Intron|UBA5_ENST00000494238.2_Missense_Mutation_p.V326F|UBA5_ENST00000473651.1_Missense_Mutation_p.C346F|UBA5_ENST00000264991.4_Missense_Mutation_p.V326F	NM_024818.3	NP_079094.1	Q9GZZ9	UBA5_HUMAN	ubiquitin-like modifier activating enzyme 5	382					protein ufmylation (GO:0071569)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|UFM1 activating enzyme activity (GO:0071566)			breast(2)|endometrium(4)|kidney(4)|large_intestine(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						AGAAGATTCTGTCACTGAGTT	0.343																																																	0													101.0	100.0	100.0					3																	132395299		2203	4300	6503	SO:0001583	missense	0			AY253672	CCDS3076.1, CCDS3077.1	3q22	2007-11-30	2007-11-30	2007-11-30	ENSG00000081307	ENSG00000081307		"""Ubiquitin-like modifier activating enzymes"""	23230	protein-coding gene	gene with protein product	"""UBA5, ubiquitin-activating enzyme E1 homolog (yeast)"""	610552	"""ubiquitin-activating enzyme E1-domain containing 1"""	UBE1DC1		11230166, 15071506	Standard	NM_198329		Approved	FLJ23251	uc003epa.4	Q9GZZ9	OTTHUMG00000159759	ENST00000356232.4:c.1144G>T	3.37:g.132395299G>T	ENSP00000348565:p.Val382Phe		A6NJL3|D3DNC8|Q96ST1	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,superfamily_Molybdenum_cofac_synth_MoeB	p.V382F	ENST00000356232.4	37	c.1144	CCDS3076.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.386|6.386	0.439245|0.439245	0.12104|0.12104	.|.	.|.	ENSG00000081307|ENSG00000081307	ENST00000473651|ENST00000264991;ENST00000356232;ENST00000494238	D|D;D;D	0.82344|0.82711	-1.6|-1.64;-1.64;-1.64	5.87|5.87	3.0|3.0	0.34707|0.34707	.|Molybdenum cofactor biosynthesis, MoeB (1);	.|0.889079	.|0.10014	.|N	.|0.726831	T|T	0.74336|0.74336	0.3703|0.3703	L|L	0.39898|0.39898	1.24|1.24	0.09310|0.09310	N|N	1|1	B|B	0.15141|0.22746	0.012|0.074	B|B	0.09377|0.20955	0.004|0.032	T|T	0.64011|0.64011	-0.6507|-0.6507	8|10	.|0.56958	.|D	.|0.05	-4.7668|-4.7668	4.8441|4.8441	0.13505|0.13505	0.3399:0.1526:0.5075:0.0|0.3399:0.1526:0.5075:0.0	.|.	346|382	E7EWE1|Q9GZZ9	.|UBA5_HUMAN	F|F	346|326;382;326	ENSP00000424984:C346F|ENSP00000264991:V326F;ENSP00000348565:V382F;ENSP00000418807:V326F	.|ENSP00000264991:V326F	C|V	+|+	2|1	0|0	UBA5|UBA5	133877989|133877989	0.005000|0.005000	0.15991|0.15991	0.793000|0.793000	0.32043|0.32043	0.752000|0.752000	0.42762|0.42762	0.986000|0.986000	0.29590|0.29590	0.953000|0.953000	0.37825|0.37825	-0.140000|-0.140000	0.14226|0.14226	TGT|GTC	UBA5	-	superfamily_Molybdenum_cofac_synth_MoeB	ENSG00000081307		0.343	UBA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA5	HGNC	protein_coding	OTTHUMT00000357187.2	-	0.00	27	0	G	NM_024818		132395299	+1	tier1	-	no_errors	ENST00000356232	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.033	T
UNC93B1	81622	genome.wustl.edu	37	11	67759287	67759287	+	Silent	SNP	C	C	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr11:67759287C>A	ENST00000227471.2	-	12	1600	c.1521G>T	c.(1519-1521)gcG>gcT	p.A507A	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	508					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.A507A(1)									GGTAGGAGACCGCGGCCGCCA	0.741																																																	1	Substitution - coding silent(1)	prostate(1)											2.0	2.0	2.0					11																	67759287		721	1664	2385	SO:0001819	synonymous_variant	0			AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.1521G>T	11.37:g.67759287C>A			O95764|Q569H6|Q710D4	Silent	SNP	pfam_Ion_channel_UNC-93,superfamily_MFS_dom_general_subst_transpt	p.A507	ENST00000227471.2	37	c.1521		11																																																																																			UNC93B1	-	NULL	ENSG00000110057		0.741	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	UNC93B1	HGNC	protein_coding		-	0.00	20	0	C	NM_030930		67759287	-1	tier1	-	no_errors	ENST00000227471	ensembl	human	known	74_37	silent	17.86	23	5	SNP	0.000	A
UNKL	64718	genome.wustl.edu	37	16	1416329	1416329	+	Missense_Mutation	SNP	C	C	T	rs570694066	byFrequency	TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr16:1416329C>T	ENST00000389221.4	-	15	1954	c.1955G>A	c.(1954-1956)cGg>cAg	p.R652Q	UNKL_ENST00000248104.7_Missense_Mutation_p.R201Q|UNKL_ENST00000397464.1_Missense_Mutation_p.R154Q|UNKL_ENST00000508903.2_Missense_Mutation_p.R705Q|UNKL_ENST00000391893.2_Missense_Mutation_p.R201Q|UNKL_ENST00000403703.1_Missense_Mutation_p.R204Q|UNKL_ENST00000402641.2_Missense_Mutation_p.R204Q	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like	652					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				CTGACAGGGCCGCAGGACAGC	0.682																																																	0													17.0	18.0	18.0					16																	1416329		2189	4292	6481	SO:0001583	missense	0			BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.1955G>A	16.37:g.1416329C>T	ENSP00000373873:p.Arg652Gln		B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH,pfscan_Znf_RING	p.R652Q	ENST00000389221.4	37	c.1955	CCDS53981.1	16	.	.	.	.	.	.	.	.	.	.	C	0.227	-1.023826	0.02061	.	.	ENSG00000059145	ENST00000248104;ENST00000389221;ENST00000403703;ENST00000391893;ENST00000397464;ENST00000402641;ENST00000508903	T;T;T;T;T;T;T	0.78003	-0.27;-1.14;-0.27;-0.27;-1.14;-0.27;-1.14	4.48	-8.45	0.00946	Zinc finger, RING-type (2);	.	.	.	.	T	0.55986	0.1955	N	0.20766	0.605	0.80722	D	1	B;B;B	0.19935	0.022;0.04;0.017	B;B;B	0.12156	0.006;0.007;0.004	T	0.05733	-1.0867	9	0.23302	T	0.38	.	11.5188	0.50539	0.1065:0.1274:0.0:0.7661	.	652;201;705	Q9H9P5;Q9H9P5-3;E9PDK2	UNKL_HUMAN;.;.	Q	201;652;204;201;154;204;705	ENSP00000248104:R201Q;ENSP00000373873:R652Q;ENSP00000385895:R204Q;ENSP00000375763:R201Q;ENSP00000380606:R154Q;ENSP00000384850:R204Q;ENSP00000422852:R705Q	ENSP00000248104:R201Q	R	-	2	0	UNKL	1356330	0.876000	0.30132	0.001000	0.08648	0.016000	0.09150	-0.049000	0.11924	-1.777000	0.01283	-1.156000	0.01807	CGG	UNKL	-	pfscan_Znf_RING	ENSG00000059145		0.682	UNKL-201	KNOWN	basic|CCDS	protein_coding	UNKL	HGNC	protein_coding			0.00	41	0	C	NM_001037125		1416329	-1			no_errors	ENST00000389221	ensembl	human	known	74_37	missense	12.50	21	3	SNP	0.779	T
USP28	57646	genome.wustl.edu	37	11	113698017	113698017	+	Silent	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr11:113698017G>A	ENST00000003302.4	-	11	1193	c.1125C>T	c.(1123-1125)tcC>tcT	p.S375S	USP28_ENST00000537706.1_Silent_p.S375S|USP28_ENST00000545540.1_Silent_p.S250S|USP28_ENST00000260188.5_Silent_p.S375S|USP28_ENST00000544967.1_Silent_p.S83S	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	375	USP.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.S375S(1)		breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		GCTGCCCAAGGGACTGATTAA	0.378																																					Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)												1	Substitution - coding silent(1)	skin(1)											77.0	78.0	77.0					11																	113698017		2201	4296	6497	SO:0001819	synonymous_variant	0			AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.1125C>T	11.37:g.113698017G>A			B0YJC0|B0YJC1|Q9P213	Silent	SNP	pfam_Peptidase_C19/C67,superfamily_UBA-like,pfscan_Peptidase_C19/C67	p.S375	ENST00000003302.4	37	c.1125	CCDS31680.1	11																																																																																			USP28	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000048028		0.378	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP28	HGNC	protein_coding	OTTHUMT00000398789.1		0.00	24	0	G			113698017	-1			no_errors	ENST00000003302	ensembl	human	known	74_37	silent	6.25	30	2	SNP	0.997	A
VCAN	1462	genome.wustl.edu	37	5	82837981	82837981	+	Silent	SNP	T	T	C			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr5:82837981T>C	ENST00000265077.3	+	8	9724	c.9159T>C	c.(9157-9159)acT>acC	p.T3053T	VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000502527.2_Intron|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000343200.5_Silent_p.T2066T	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	3053	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AATTTAATACTGAGGTTGCAA	0.443																																																	0													107.0	112.0	110.0					5																	82837981		2203	4300	6503	SO:0001819	synonymous_variant	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.9159T>C	5.37:g.82837981T>C			P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EG-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Link,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.T3053	ENST00000265077.3	37	c.9159	CCDS4060.1	5																																																																																			VCAN	-	NULL	ENSG00000038427		0.443	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	-	0.00	21	0	T	NM_004385		82837981	+1	tier1	-	no_errors	ENST00000265077	ensembl	human	known	74_37	silent	17.02	39	8	SNP	0.002	C
VTI1A	143187	genome.wustl.edu	37	10	114207157	114207157	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr10:114207157A>G	ENST00000393077.2	+	1	142	c.26A>G	c.(25-27)gAg>gGg	p.E9G	ZDHHC6_ENST00000369404.3_5'Flank|ZDHHC6_ENST00000369405.3_5'Flank|VTI1A_ENST00000483122.1_3'UTR|VTI1A_ENST00000432306.1_Missense_Mutation_p.E9G	NM_145206.2	NP_660207.2	Q96AJ9	VTI1A_HUMAN	vesicle transport through interaction with t-SNAREs 1A	9					intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|neuron projection terminus (GO:0044306)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	SNAP receptor activity (GO:0005484)		VTI1A/TCF7L2(8)	breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)		GAAGGTTACGAGCAGGACTTC	0.657			T	TCF7L2	colorectal																																			Dom	yes		10	10q25.2	143187	vesicle transport through interaction with t-SNAREs homolog 1A		E	0													53.0	43.0	46.0					10																	114207157		2203	4300	6503	SO:0001583	missense	0			BC017052	CCDS7575.2	10q25.2	2012-12-10	2012-12-10		ENSG00000151532	ENSG00000151532			17792	protein-coding gene	gene with protein product		614316	"""vesicle transport through interaction with t-SNAREs homolog 1A (yeast)"""			9446565	Standard	NM_145206		Approved	MVti1, Vti1a, Vti1-rp2	uc001kzz.3	Q96AJ9	OTTHUMG00000019063	ENST00000393077.2:c.26A>G	10.37:g.114207157A>G	ENSP00000376792:p.Glu9Gly		A2A307|B4E137|Q5W0D7	Missense_Mutation	SNP	pfam_Vesicle_trsprt_v-SNARE_N,superfamily_t-SNARE,smart_T_SNARE_dom	p.E9G	ENST00000393077.2	37	c.26	CCDS7575.2	10	.	.	.	.	.	.	.	.	.	.	A	32	5.147355	0.94603	.	.	ENSG00000151532	ENST00000393077;ENST00000432306	.	.	.	4.73	4.73	0.59995	t-SNARE (1);	0.000000	0.85682	D	0.000000	T	0.80154	0.4571	M	0.85710	2.77	0.58432	D	0.99999	D;D	0.89917	0.998;1.0	D;D	0.85130	0.935;0.997	D	0.83643	0.0151	9	0.87932	D	0	-31.4134	12.9425	0.58352	1.0:0.0:0.0:0.0	.	9;9	Q5W0D7;Q96AJ9	.;VTI1A_HUMAN	G	9	.	ENSP00000376792:E9G	E	+	2	0	VTI1A	114197147	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.700000	0.84556	1.972000	0.57404	0.533000	0.62120	GAG	VTI1A	-	superfamily_t-SNARE	ENSG00000151532		0.657	VTI1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VTI1A	HGNC	protein_coding	OTTHUMT00000050397.2	-	0.00	41	0	A			114207157	+1	tier1	-	no_errors	ENST00000393077	ensembl	human	known	74_37	missense	35.71	27	15	SNP	1.000	G
ZFYVE16	9765	genome.wustl.edu	37	5	79747495	79747495	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr5:79747495C>T	ENST00000338008.5	+	10	3754	c.3574C>T	c.(3574-3576)Cgt>Tgt	p.R1192C	ZFYVE16_ENST00000510158.1_Missense_Mutation_p.R1192C|ZFYVE16_ENST00000505560.1_Missense_Mutation_p.R1192C	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	1192					BMP signaling pathway (GO:0030509)|endosomal transport (GO:0016197)|protein targeting to lysosome (GO:0006622)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|intracellular membrane-bounded organelle (GO:0043231)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein transporter activity (GO:0008565)			breast(4)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|liver(1)|lung(6)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		TTTTCCTATGCGTTTAATGTT	0.328																																					Melanoma(150;1452 1854 16018 17851 37292)												0													121.0	122.0	122.0					5																	79747495		2203	4300	6503	SO:0001583	missense	0			AB002303	CCDS4050.1	5q14.1	2012-09-20			ENSG00000039319	ENSG00000039319		"""Zinc fingers, FYVE domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20756	protein-coding gene	gene with protein product	"""endofin"", ""protein phosphatase 1, regulatory subunit 69"""	608880				11546807	Standard	NM_014733		Approved	KIAA0305, PPP1R69	uc003kgq.4	Q7Z3T8	OTTHUMG00000108178	ENST00000338008.5:c.3574C>T	5.37:g.79747495C>T	ENSP00000337159:p.Arg1192Cys		O15023|Q5H9U2|Q7LAU7|Q86T69|Q8N5L3|Q8NEK3	Missense_Mutation	SNP	pfam_DUF3480,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pirsf_Znf_FYVE_SARA/endofin,pfscan_Znf_FYVE-rel	p.R1192C	ENST00000338008.5	37	c.3574	CCDS4050.1	5	.	.	.	.	.	.	.	.	.	.	C	22.2	4.257149	0.80246	.	.	ENSG00000039319	ENST00000338008;ENST00000510158;ENST00000505560	T;T;T	0.74421	-0.84;-0.84;-0.84	5.7	5.7	0.88788	Domain of unknown function DUF3480 (1);	0.000000	0.56097	D	0.000035	D	0.87410	0.6170	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.979	D	0.88443	0.3043	10	0.87932	D	0	-16.5702	18.6024	0.91253	0.0:1.0:0.0:0.0	.	2;1192	B3KXA7;Q7Z3T8	.;ZFY16_HUMAN	C	1192	ENSP00000337159:R1192C;ENSP00000423663:R1192C;ENSP00000426848:R1192C	ENSP00000337159:R1192C	R	+	1	0	ZFYVE16	79783251	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.853000	0.62911	2.684000	0.91462	0.650000	0.86243	CGT	ZFYVE16	-	pfam_DUF3480,pirsf_Znf_FYVE_SARA/endofin	ENSG00000039319		0.328	ZFYVE16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE16	HGNC	protein_coding	OTTHUMT00000226982.2	-	0.00	35	0	C	NM_014733		79747495	+1	tier1	-	no_errors	ENST00000338008	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
ZNF132	7691	genome.wustl.edu	37	19	58945571	58945571	+	Nonsense_Mutation	SNP	G	G	A	rs370706847		TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:58945571G>A	ENST00000254166.3	-	3	1640	c.1240C>T	c.(1240-1242)Cga>Tga	p.R414*		NM_003433.3	NP_003424.3	P52740	ZN132_HUMAN	zinc finger protein 132	414					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(1)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0171)|Lung(386;0.182)		GCAGAGCTTCGGCTGAAGGAT	0.458																																																	0								G	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	116.0	110.0	112.0		1240	0.1	0.0	19		112	0,8600		0,0,4300	no	stop-gained	ZNF132	NM_003433.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		414/707	58945571	1,13005	2203	4300	6503	SO:0001587	stop_gained	0			U09411	CCDS12980.1	19q13.4	2013-01-08	2006-06-13			ENSG00000131849		"""Zinc fingers, C2H2-type"", ""-"""	12916	protein-coding gene	gene with protein product		604074	"""zinc finger protein 132 (clone pHZ-12)"""			7557990	Standard	NM_003433		Approved	pHZ-12	uc002qst.4	P52740		ENST00000254166.3:c.1240C>T	19.37:g.58945571G>A	ENSP00000254166:p.Arg414*		Q32MI9	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R414*	ENST00000254166.3	37	c.1240	CCDS12980.1	19	.	.	.	.	.	.	.	.	.	.	G	37	6.325801	0.97476	2.27E-4	0.0	ENSG00000131849	ENST00000254166;ENST00000391695	.	.	.	3.63	0.0762	0.14402	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	3.7741	0.08653	0.1947:0.0:0.4751:0.3302	.	.	.	.	X	414;241	.	ENSP00000254166:R414X	R	-	1	2	ZNF132	63637383	0.000000	0.05858	0.001000	0.08648	0.619000	0.37552	-1.226000	0.02953	-0.115000	0.11915	-0.140000	0.14226	CGA	ZNF132	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000131849		0.458	ZNF132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF132	HGNC	protein_coding	OTTHUMT00000467035.1	-	0.00	59	0	G	NM_003433		58945571	-1	tier1	-	no_errors	ENST00000254166	ensembl	human	known	74_37	nonsense	23.08	50	15	SNP	0.001	A
ZNF385D	79750	genome.wustl.edu	37	3	21478515	21478515	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr3:21478515G>A	ENST00000281523.2	-	5	1138	c.620C>T	c.(619-621)tCg>tTg	p.S207L	ZNF385D_ENST00000494118.1_5'UTR	NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	207						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.S207L(1)		NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						CTTGCATAGCGAACAGTAAAG	0.478																																																	1	Substitution - Missense(1)	large_intestine(1)											178.0	147.0	158.0					3																	21478515		2203	4300	6503	SO:0001583	missense	0			BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.620C>T	3.37:g.21478515G>A	ENSP00000281523:p.Ser207Leu			Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.S207L	ENST00000281523.2	37	c.620	CCDS2636.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.702821	0.96812	.	.	ENSG00000151789	ENST00000281523	T	0.24151	1.87	6.09	6.09	0.99107	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.51941	0.1704	M	0.63428	1.95	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.31724	-0.9933	10	0.45353	T	0.12	-7.6409	20.6789	0.99705	0.0:0.0:1.0:0.0	.	207	Q9H6B1	Z385D_HUMAN	L	207	ENSP00000281523:S207L	ENSP00000281523:S207L	S	-	2	0	ZNF385D	21453519	1.000000	0.71417	0.979000	0.43373	0.999000	0.98932	9.769000	0.98969	2.891000	0.99171	0.655000	0.94253	TCG	ZNF385D	-	smart_Znf_U1,smart_Znf_C2H2-like	ENSG00000151789		0.478	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385D	HGNC	protein_coding	OTTHUMT00000252884.1	-	0.00	100	0	G	NM_024697		21478515	-1	tier1	-	no_errors	ENST00000281523	ensembl	human	known	74_37	missense	13.19	125	19	SNP	1.000	A
ZNF558	148156	genome.wustl.edu	37	19	8922177	8922177	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:8922177C>T	ENST00000601372.1	-	10	1700	c.989G>A	c.(988-990)aGc>aAc	p.S330N	ZNF558_ENST00000301475.1_Missense_Mutation_p.S330N|ZNF558_ENST00000444186.2_Missense_Mutation_p.S259N			Q96NG5	ZN558_HUMAN	zinc finger protein 558	330					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	15						AAAGCTACTGCTGAAGGATTT	0.443																																																	0													85.0	83.0	84.0					19																	8922177		2203	4300	6503	SO:0001583	missense	0			AK055494	CCDS12208.1	19p13.2	2013-09-20			ENSG00000167785	ENSG00000167785		"""Zinc fingers, C2H2-type"", ""-"""	26422	protein-coding gene	gene with protein product							Standard	NM_144693		Approved	FLJ30932	uc002mkn.1	Q96NG5	OTTHUMG00000182196	ENST00000601372.1:c.989G>A	19.37:g.8922177C>T	ENSP00000471277:p.Ser330Asn		A8K5F0|B7Z798	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S330N	ENST00000601372.1	37	c.989	CCDS12208.1	19	.	.	.	.	.	.	.	.	.	.	C	15.69	2.907447	0.52333	.	.	ENSG00000167785	ENST00000301475;ENST00000444186	T;T	0.07567	3.18;3.18	4.8	4.8	0.61643	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.52532	D	0.000075	T	0.09202	0.0227	L	0.33093	0.98	0.25021	N	0.991335	P	0.49090	0.919	P	0.46850	0.529	T	0.24261	-1.0165	10	0.27785	T	0.31	.	11.1132	0.48246	0.0:0.8128:0.1872:0.0	.	330	Q96NG5	ZN558_HUMAN	N	330;259	ENSP00000301475:S330N;ENSP00000410703:S259N	ENSP00000301475:S330N	S	-	2	0	ZNF558	8783177	0.000000	0.05858	1.000000	0.80357	0.940000	0.58332	-0.752000	0.04797	2.483000	0.83821	0.591000	0.81541	AGC	ZNF558	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167785		0.443	ZNF558-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF558	HGNC	protein_coding	OTTHUMT00000459955.2	-	0.00	36	0	C	NM_144693		8922177	-1	tier1	-	no_errors	ENST00000301475	ensembl	human	known	74_37	missense	17.11	63	13	SNP	0.723	T
ZNF528	84436	genome.wustl.edu	37	19	52919182	52919182	+	Silent	SNP	C	C	T			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:52919182C>T	ENST00000360465.3	+	7	1503	c.1077C>T	c.(1075-1077)ggC>ggT	p.G359G	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	359					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		AAGAATGTGGCAAAGCATTTT	0.408																																																	0													74.0	72.0	72.0					19																	52919182		2203	4300	6503	SO:0001819	synonymous_variant	0			AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.1077C>T	19.37:g.52919182C>T			B3KPN4|Q86T88|Q96JK0	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G359	ENST00000360465.3	37	c.1077	CCDS33091.1	19																																																																																			ZNF528	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167555		0.408	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF528	HGNC	protein_coding	OTTHUMT00000344336.1		0.00	25	0	C	NM_032423		52919182	+1			no_errors	ENST00000360465	ensembl	human	known	74_37	silent	11.11	24	3	SNP	0.885	T
ZNF835	90485	genome.wustl.edu	37	19	57175634	57175634	+	Silent	SNP	G	G	A			TCGA-L5-A43C-01A-11D-A247-09	TCGA-L5-A43C-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eb19b408-d32e-4659-80ad-9fc2efa25260	455d8943-a709-4328-ac50-72df33b3ab0e	g.chr19:57175634G>A	ENST00000537055.2	-	2	1164	c.933C>T	c.(931-933)tgC>tgT	p.C311C		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	311					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						AGAGCGCGCCGCAGTCCTGGC	0.711																																																	0													17.0	17.0	17.0					19																	57175634		2197	4297	6494	SO:0001819	synonymous_variant	0			AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.933C>T	19.37:g.57175634G>A			B7Z5Y0|G3V1S0	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C311	ENST00000537055.2	37	c.933	CCDS56105.1	19																																																																																			ZNF835	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000127903		0.711	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF835	HGNC	protein_coding	OTTHUMT00000459800.1	-	0.00	76	0	G	NM_001005850		57175634	-1	tier1	-	no_errors	ENST00000537055	ensembl	human	known	74_37	silent	17.43	90	19	SNP	0.935	A
