#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AAR2	25980	genome.wustl.edu	37	20	34828331	34828331	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr20:34828331T>C	ENST00000373932.3	+	2	887	c.541T>C	c.(541-543)Tgt>Cgt	p.C181R	AAR2_ENST00000397286.3_Missense_Mutation_p.C181R|AAR2_ENST00000320849.4_Missense_Mutation_p.C181R	NM_015511.3	NP_056326.2	Q9Y312	AAR2_HUMAN	AAR2 splicing factor homolog (S. cerevisiae)	181																	TCTACCCCGCTGTGGCATTGA	0.592																																																	0													79.0	81.0	80.0					20																	34828331		2203	4300	6503	SO:0001583	missense	0				CCDS13273.1	20q11.23	2012-07-20	2012-07-20	2012-07-20	ENSG00000131043	ENSG00000131043			15886	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 4"""	C20orf4			Standard	NM_015511		Approved	bA234K24.2	uc002xfc.3	Q9Y312	OTTHUMG00000032380	ENST00000373932.3:c.541T>C	20.37:g.34828331T>C	ENSP00000363043:p.Cys181Arg		E1P5S7|Q9H4F9|Q9P1P3|Q9UFK9	Missense_Mutation	SNP	pfam_AAR2	p.C181R	ENST00000373932.3	37	c.541	CCDS13273.1	20	.	.	.	.	.	.	.	.	.	.	T	7.501	0.652625	0.14580	.	.	ENSG00000131043	ENST00000397286;ENST00000320849;ENST00000373932	T;T;T	0.39229	1.66;1.09;1.09	4.91	4.91	0.64330	.	0.196261	0.56097	D	0.000040	T	0.25005	0.0607	N	0.10782	0.045	0.21386	N	0.99971	B;B	0.22604	0.072;0.03	B;B	0.30401	0.115;0.035	T	0.18618	-1.0331	10	0.22706	T	0.39	.	10.2451	0.43336	0.0:0.0805:0.0:0.9195	.	181;181	A2A2Q9;Q9Y312	.;CT004_HUMAN	R	181	ENSP00000380455:C181R;ENSP00000313674:C181R;ENSP00000363043:C181R	ENSP00000313674:C181R	C	+	1	0	C20orf4	34291745	0.961000	0.32948	0.309000	0.25155	0.954000	0.61252	2.891000	0.48617	2.189000	0.69895	0.528000	0.53228	TGT	AAR2	-	pfam_AAR2	ENSG00000131043		0.592	AAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AAR2	HGNC	protein_coding	OTTHUMT00000079001.2	-	0.00	36	0	T	NM_015511		34828331	+1	tier1	-	no_errors	ENST00000320849	ensembl	human	known	74_37	missense	13.04	40	6	SNP	0.072	C
ABCA13	154664	genome.wustl.edu	37	7	48315394	48315394	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr7:48315394G>T	ENST00000435803.1	+	17	6155	c.6131G>T	c.(6130-6132)aGt>aTt	p.S2044I		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2044					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.S2044I(1)|p.S1989I(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GCATTATCAAGTTTTATTGAA	0.358																																																	2	Substitution - Missense(2)	large_intestine(2)											32.0	30.0	31.0					7																	48315394		1829	4082	5911	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.6131G>T	7.37:g.48315394G>T	ENSP00000411096:p.Ser2044Ile		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S2044I	ENST00000435803.1	37	c.6131	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	G	8.186	0.794944	0.16327	.	.	ENSG00000179869	ENST00000435803	T	0.15603	2.41	4.65	-2.5	0.06384	.	0.883493	0.09483	N	0.796038	T	0.12263	0.0298	L	0.44542	1.39	0.09310	N	1	B	0.22003	0.063	B	0.21360	0.034	T	0.36089	-0.9762	9	.	.	.	.	6.2943	0.21077	0.4705:0.2465:0.283:0.0	.	2044	Q86UQ4	ABCAD_HUMAN	I	2044	ENSP00000411096:S2044I	.	S	+	2	0	ABCA13	48285940	0.001000	0.12720	0.000000	0.03702	0.042000	0.13812	-0.664000	0.05292	-0.586000	0.05898	-2.630000	0.00154	AGT	ABCA13	-	NULL	ENSG00000179869		0.358	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2		0.00	15	0	G	NM_152701		48315394	+1			no_errors	ENST00000435803	ensembl	human	known	74_37	missense	11.11	16	2	SNP	0.000	T
ACAD10	80724	genome.wustl.edu	37	12	112153654	112153654	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr12:112153654G>A	ENST00000313698.4	+	7	1035	c.880G>A	c.(880-882)Ggg>Agg	p.G294R	ACAD10_ENST00000549590.1_Missense_Mutation_p.G294R|ACAD10_ENST00000392636.2_5'UTR|ACAD10_ENST00000455480.2_Missense_Mutation_p.G325R|ACAD10_ENST00000413681.3_3'UTR	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	294						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						GTTTGATCACGGGCAGTCAAA	0.473																																																	0													154.0	148.0	150.0					12																	112153654		2203	4300	6503	SO:0001583	missense	0			AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.880G>A	12.37:g.112153654G>A	ENSP00000325137:p.Gly294Arg		G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Missense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,pfam_AcylCo_DH/oxidase_C,pfam_Acyl-CoA_DH_2_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_HAD-like_dom,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_Kinase-like_dom,superfamily_AcylCo_DH/oxidase_C,superfamily_HAD-like_dom,prints_HAD-SF_hydro_IA,tigrfam_HAD-SF_ppase_IA/epoxid_hydro_N,tigrfam_HAD-SF_hydro_IA	p.G325R	ENST00000313698.4	37	c.973	CCDS31903.1	12	.	.	.	.	.	.	.	.	.	.	G	21.6	4.175239	0.78564	.	.	ENSG00000111271	ENST00000413681;ENST00000549590;ENST00000455480;ENST00000313698;ENST00000552706;ENST00000507683	T;T;T	0.74106	-0.81;-0.81;-0.81	5.24	4.35	0.52113	Aminoglycoside phosphotransferase (1);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.91516	0.7321	H	0.98965	4.385	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.933;1.0;1.0;1.0	D	0.94356	0.7583	10	0.87932	D	0	.	13.8813	0.63684	0.0753:0.0:0.9247:0.0	.	325;32;294;294	G3XAJ0;F8W0Q4;Q6JQN1;Q6JQN1-2	.;.;ACD10_HUMAN;.	R	294;294;325;294;32;32	ENSP00000446959:G294R;ENSP00000389813:G325R;ENSP00000325137:G294R	ENSP00000325137:G294R	G	+	1	0	ACAD10	110638037	1.000000	0.71417	0.949000	0.38748	0.923000	0.55619	4.774000	0.62339	1.331000	0.45412	0.655000	0.94253	GGG	ACAD10	-	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom	ENSG00000111271		0.473	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD10	HGNC	protein_coding	OTTHUMT00000368307.1	-	0.00	48	0	G	NM_025247		112153654	+1	tier1	-	no_errors	ENST00000455480	ensembl	human	known	74_37	missense	8.06	57	5	SNP	0.998	A
ACKR4	51554	genome.wustl.edu	37	3	132320087	132320087	+	Silent	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr3:132320087C>T	ENST00000249887.2	+	2	942	c.846C>T	c.(844-846)gaC>gaT	p.D282D	ACAD11_ENST00000355458.3_Intron|ACAD11_ENST00000264990.6_Intron|ACAD11_ENST00000545291.1_Intron	NM_016557.2|NM_178445.2	NP_057641.1|NP_848540.1	Q9NPB9	ACKR4_HUMAN	atypical chemokine receptor 4	282					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)										AACGCATGGACATCGCCATCC	0.443																																																	0													160.0	156.0	157.0					3																	132320087		2202	4298	6500	SO:0001819	synonymous_variant	0			AF110640	CCDS3075.1	3q22	2013-07-17	2013-07-16	2013-07-16	ENSG00000129048	ENSG00000129048		"""GPCR / Class A : Chemokine receptors : Atypical"""	1611	protein-coding gene	gene with protein product		606065	"""chemokine (C-C motif) receptor-like 1"""	CCRL1		10767544, 16148	Standard	NM_016557		Approved	CCR11, CCBP2, VSHK1, CCX-CKR, PPR1	uc003eow.3	Q9NPB9	OTTHUMG00000159768	ENST00000249887.2:c.846C>T	3.37:g.132320087C>T			B2R9U7	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CCRL1,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CXCR4	p.D282	ENST00000249887.2	37	c.846	CCDS3075.1	3																																																																																			ACKR4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_rcpt	ENSG00000129048		0.443	ACKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACKR4	HGNC	protein_coding	OTTHUMT00000357238.2	-	0.00	54	0	C	NM_016557		132320087	+1	tier1	-	no_errors	ENST00000249887	ensembl	human	known	74_37	silent	5.38	88	5	SNP	0.989	T
AFF3	3899	genome.wustl.edu	37	2	100182070	100182070	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr2:100182070T>C	ENST00000409236.2	-	18	3110	c.2998A>G	c.(2998-3000)Aag>Gag	p.K1000E	AFF3_ENST00000356421.2_Missense_Mutation_p.K1025E|AFF3_ENST00000317233.4_Missense_Mutation_p.K1000E|AFF3_ENST00000409579.1_Missense_Mutation_p.K1025E			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	1000					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						TTCAAAGCCTTTCCAAACTTT	0.368																																																	0													135.0	124.0	128.0					2																	100182070		2203	4300	6503	SO:0001583	missense	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.2998A>G	2.37:g.100182070T>C	ENSP00000387207:p.Lys1000Glu		B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.K1025E	ENST00000409236.2	37	c.3073	CCDS42723.1	2	.	.	.	.	.	.	.	.	.	.	T	29.4	5.001177	0.93227	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000445815	T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0	5.67	5.67	0.87782	.	0.050245	0.85682	D	0.000000	D	0.88047	0.6332	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.994;0.997	D	0.90072	0.4164	10	0.87932	D	0	.	16.2014	0.82084	0.0:0.0:0.0:1.0	.	1000;1025	P51826;P51826-2	AFF3_HUMAN;.	E	1000;1025;1025;1000;42	ENSP00000317421:K1000E;ENSP00000348793:K1025E;ENSP00000386834:K1025E;ENSP00000387207:K1000E;ENSP00000416685:K42E	ENSP00000317421:K1000E	K	-	1	0	AFF3	99548502	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	7.965000	0.87945	2.281000	0.76405	0.533000	0.62120	AAG	AFF3	-	pfam_TF_AF4/FMR2	ENSG00000144218		0.368	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3		0.00	42	0	T	NM_002285		100182070	-1			no_errors	ENST00000356421	ensembl	human	known	74_37	missense	6.00	47	3	SNP	1.000	C
AKTIP	64400	genome.wustl.edu	37	16	53526624	53526624	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr16:53526624T>A	ENST00000394657.7	-	9	926	c.752A>T	c.(751-753)gAa>gTa	p.E251V	AKTIP_ENST00000570004.1_Missense_Mutation_p.E251V|AKTIP_ENST00000300245.4_Missense_Mutation_p.E251V	NM_001012398.1|NM_022476.2	NP_001012398.1|NP_071921.1	Q9H8T0	AKTIP_HUMAN	AKT interacting protein	251					apoptotic process (GO:0006915)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|protein transport (GO:0015031)	FHF complex (GO:0070695)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)			large_intestine(1)|lung(2)|prostate(2)	5		all_cancers(37;0.14)				CAGCATCTTTTCTCTGGCTTC	0.328																																																	0													118.0	119.0	119.0					16																	53526624		2198	4300	6498	SO:0001583	missense	0			AK023320	CCDS10749.1	16q12.2	2010-01-14	2007-01-16	2007-01-16	ENSG00000166971	ENSG00000166971		"""Ubiquitin-conjugating enzymes E2"""	16710	protein-coding gene	gene with protein product		608483	"""fused toes (mouse) homolog"", ""fused toes homolog (mouse)"""	FTS		7818539, 8626685	Standard	XM_005256094		Approved	FLJ13258	uc002ehl.3	Q9H8T0	OTTHUMG00000133199	ENST00000394657.7:c.752A>T	16.37:g.53526624T>A	ENSP00000378152:p.Glu251Val		Q503B1|Q53H38	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.E251V	ENST00000394657.7	37	c.752	CCDS10749.1	16	.	.	.	.	.	.	.	.	.	.	T	19.58	3.854691	0.71719	.	.	ENSG00000166971	ENST00000394657;ENST00000300245	D;D	0.84800	-1.9;-1.89	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.86033	0.5836	M	0.77103	2.36	0.80722	D	1	B;P	0.41041	0.078;0.736	B;B	0.38106	0.06;0.265	D	0.87388	0.2361	10	0.59425	D	0.04	-16.0404	16.6512	0.85203	0.0:0.0:0.0:1.0	.	251;251	Q9H8T0-2;Q9H8T0	.;AKTIP_HUMAN	V	251	ENSP00000378152:E251V;ENSP00000300245:E251V	ENSP00000300245:E251V	E	-	2	0	AKTIP	52084125	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.203000	0.72137	2.333000	0.79357	0.482000	0.46254	GAA	AKTIP	-	NULL	ENSG00000166971		0.328	AKTIP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKTIP	HGNC	protein_coding	OTTHUMT00000256909.4		0.00	23	0	T	NM_022476		53526624	-1			no_errors	ENST00000300245	ensembl	human	known	74_37	missense	12.50	21	3	SNP	1.000	A
ANKMY2	57037	genome.wustl.edu	37	7	16655488	16655488	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr7:16655488G>A	ENST00000306999.2	-	5	655	c.412C>T	c.(412-414)Cga>Tga	p.R138*		NM_020319.2	NP_064715.1	Q8IV38	ANKY2_HUMAN	ankyrin repeat and MYND domain containing 2	138						cilium (GO:0005929)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	23	Lung NSC(10;0.103)|all_lung(11;0.204)			UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		AGTCTCTCTCGAGGAAAGAAA	0.388																																																	0													87.0	85.0	85.0					7																	16655488		2203	4300	6503	SO:0001587	stop_gained	0			AK001740	CCDS5361.1	7p21	2013-01-10			ENSG00000106524	ENSG00000106524		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	25370	protein-coding gene	gene with protein product						12477932	Standard	NM_020319		Approved	DKFZP564O043, ZMYND20	uc003sti.3	Q8IV38	OTTHUMG00000090806	ENST00000306999.2:c.412C>T	7.37:g.16655488G>A	ENSP00000303570:p.Arg138*		A4D124|Q659G1|Q96BL3	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Znf_MYND,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_MYND	p.R138*	ENST00000306999.2	37	c.412	CCDS5361.1	7	.	.	.	.	.	.	.	.	.	.	G	39	7.630127	0.98399	.	.	ENSG00000106524	ENST00000306999	.	.	.	5.85	5.85	0.93711	.	0.055252	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.8287	20.5471	0.99284	0.0:0.0:1.0:0.0	.	.	.	.	X	138	.	ENSP00000303570:R138X	R	-	1	2	ANKMY2	16622013	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	7.452000	0.80683	2.941000	0.99782	0.655000	0.94253	CGA	ANKMY2	-	smart_Ankyrin_rpt	ENSG00000106524		0.388	ANKMY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKMY2	HGNC	protein_coding	OTTHUMT00000207600.2	-	0.00	30	0	G	NM_020319		16655488	-1	tier1	-	no_errors	ENST00000306999	ensembl	human	known	74_37	nonsense	44.44	20	16	SNP	1.000	A
ARF3	377	genome.wustl.edu	37	12	49332344	49332345	+	3'UTR	INS	-	-	C			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr12:49332344_49332345insC	ENST00000256682.4	-	0	1265_1266				ARF3_ENST00000447318.2_3'UTR|ARF3_ENST00000541967.1_5'Flank|AC073610.5_ENST00000537495.1_Intron|RP11-302B13.5_ENST00000398092.4_Intron	NM_001659.2	NP_001650.1	P61204	ARF3_HUMAN	ADP-ribosylation factor 3						GTP catabolic process (GO:0006184)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|lung(2)|skin(1)	4						AGGCAAACAGGGAGTAGAAGGG	0.515																																					Pancreas(189;1862 2134 4419 30933 49364)												0																																										SO:0001624	3_prime_UTR_variant	0			M74491	CCDS8774.1	12q13.12	2013-01-22			ENSG00000134287	ENSG00000134287		"""ADP-ribosylation factors"""	654	protein-coding gene	gene with protein product	"""small GTP binding protein"""	103190				8661066	Standard	NM_001659		Approved		uc001rsr.2	P61204	OTTHUMG00000168080	ENST00000256682.4:c.*386->G	12.37:g.49332344_49332345insC			A8K6G8|B7ZB63|P16587	RNA	INS	-	NULL	ENST00000256682.4	37	NULL	CCDS8774.1	12																																																																																			ARF3	-	-	ENSG00000134287		0.515	ARF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARF3	HGNC	protein_coding	OTTHUMT00000258242.2		0.00	10	0	-	NM_001659		49332345	-1	tier1		no_errors	ENST00000485410	ensembl	human	known	74_37	rna	63.64	4	7	INS	0.597:0.582	C
ARHGAP5	394	genome.wustl.edu	37	14	32560528	32560528	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr14:32560528A>G	ENST00000345122.3	+	2	968	c.653A>G	c.(652-654)aAt>aGt	p.N218S	ARHGAP5_ENST00000539826.2_Missense_Mutation_p.N218S|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.N218S|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.N218S|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000396582.2_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	218					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		TTTGCTTCAAATAAAAAGAAC	0.343																																					NSCLC(9;77 350 3443 29227 41353)												0													74.0	80.0	78.0					14																	32560528		2202	4298	6500	SO:0001583	missense	0			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.653A>G	14.37:g.32560528A>G	ENSP00000371897:p.Asn218Ser		A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.N218S	ENST00000345122.3	37	c.653	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.773771	0.00640	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94	5.78	5.78	0.91487	.	0.182527	0.64402	D	0.000020	T	0.50000	0.1590	N	0.03177	-0.4	0.36340	D	0.859426	B;B	0.10296	0.002;0.003	B;B	0.16289	0.009;0.015	T	0.54476	-0.8288	10	0.02654	T	1	.	16.1081	0.81237	1.0:0.0:0.0:0.0	.	218;218	Q13017-2;Q13017	.;RHG05_HUMAN	S	218	ENSP00000452222:N218S;ENSP00000441692:N218S;ENSP00000371897:N218S;ENSP00000393307:N218S	ENSP00000371897:N218S	N	+	2	0	ARHGAP5	31630279	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.129000	0.64739	2.194000	0.70268	0.533000	0.62120	AAT	ARHGAP5	-	pfam_Small_GTPase,superfamily_P-loop_NTPase	ENSG00000100852		0.343	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	HGNC	protein_coding	OTTHUMT00000409735.1	-	0.00	29	0	A	NM_001030055		32560528	+1	tier1	-	no_errors	ENST00000345122	ensembl	human	known	74_37	missense	21.43	22	6	SNP	1.000	G
ARHGEF2	9181	genome.wustl.edu	37	1	155922445	155922445	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr1:155922445C>T	ENST00000361247.4	-	15	2057	c.1958G>A	c.(1957-1959)cGg>cAg	p.R653Q	ARHGEF2_ENST00000313695.7_Missense_Mutation_p.R625Q|ARHGEF2_ENST00000462460.2_Missense_Mutation_p.R698Q|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.R652Q|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.R654Q|ARHGEF2_ENST00000368316.1_Missense_Mutation_p.R625Q|ARHGEF2_ENST00000477754.2_Intron	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	653					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					CTGCAGCAGCCGCTCGCCACG	0.622																																					Melanoma(178;35 2768 6610 28839)												0													49.0	50.0	50.0					1																	155922445		2203	4300	6503	SO:0001583	missense	0			AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.1958G>A	1.37:g.155922445C>T	ENSP00000354837:p.Arg653Gln		D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.R654Q	ENST00000361247.4	37	c.1961	CCDS53376.1	1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.011785	0.54468	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000313667	T;T;T;T;T	0.63096	-0.02;0.11;0.1;-0.02;-0.02	5.14	5.14	0.70334	.	0.000000	0.42548	D	0.000691	T	0.18923	0.0454	N	0.24115	0.695	0.28440	N	0.916861	B;P;B	0.35628	0.085;0.513;0.138	B;B;B	0.21360	0.015;0.019;0.034	T	0.08310	-1.0728	10	0.08599	T	0.76	-26.8618	9.7911	0.40706	0.0:0.9084:0.0:0.0916	.	697;653;652	D3DVA5;Q92974;Q92974-2	.;ARHG2_HUMAN;.	Q	625;653;654;625;652	ENSP00000315325:R625Q;ENSP00000354837:R653Q;ENSP00000357298:R654Q;ENSP00000357299:R625Q;ENSP00000314787:R652Q	ENSP00000314787:R652Q	R	-	2	0	ARHGEF2	154189069	0.147000	0.22687	1.000000	0.80357	0.997000	0.91878	0.561000	0.23515	2.828000	0.97474	0.655000	0.94253	CGG	ARHGEF2	-	NULL	ENSG00000116584		0.622	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF2	HGNC	protein_coding	OTTHUMT00000046204.2	-	0.00	38	0	C	NM_004723		155922445	-1	tier1	-	no_errors	ENST00000368315	ensembl	human	known	74_37	missense	36.17	30	17	SNP	1.000	T
ARRB1	408	genome.wustl.edu	37	11	74995295	74995295	+	Nonsense_Mutation	SNP	A	A	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr11:74995295A>T	ENST00000420843.2	-	4	238	c.141T>A	c.(139-141)taT>taA	p.Y47*	ARRB1_ENST00000360025.3_Nonsense_Mutation_p.Y47*|ARRB1_ENST00000393505.4_Nonsense_Mutation_p.Y47*	NM_004041.4	NP_004032.2	P49407	ARRB1_HUMAN	arrestin, beta 1	47	Interaction with CHRM2. {ECO:0000250}.|Interaction with SRC. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|apoptotic DNA fragmentation (GO:0006309)|blood coagulation (GO:0007596)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor internalization (GO:0002031)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of GTPase activity (GO:0034260)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein ubiquitination (GO:0031397)|Notch signaling pathway (GO:0007219)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of GTPase activity (GO:0043547)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H4 acetylation (GO:0090240)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-Golgi vesicle-mediated transport (GO:0006892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)|transcription from RNA polymerase II promoter (GO:0006366)	basolateral plasma membrane (GO:0016323)|chromatin (GO:0000785)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|pseudopodium (GO:0031143)	angiotensin receptor binding (GO:0031701)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|enzyme inhibitor activity (GO:0004857)|GTPase activator activity (GO:0005096)|insulin-like growth factor receptor binding (GO:0005159)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|large_intestine(2)|lung(4)|prostate(1)	11						GCTCTTTGAGATACTCAGGAT	0.612																																																	0													63.0	58.0	60.0					11																	74995295		2200	4293	6493	SO:0001587	stop_gained	0			BC003636	CCDS31640.1, CCDS44684.1	11q13	2008-12-11			ENSG00000137486	ENSG00000137486			711	protein-coding gene	gene with protein product	"""arrestin 2"""	107940		ARR1		8486659	Standard	NM_004041		Approved		uc001owe.2	P49407	OTTHUMG00000165444	ENST00000420843.2:c.141T>A	11.37:g.74995295A>T	ENSP00000409581:p.Tyr47*		B6V9G8|O75625|O75630|Q2PP20|Q9BTK8	Nonsense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set,prints_Arrestin	p.Y47*	ENST00000420843.2	37	c.141	CCDS44684.1	11	.	.	.	.	.	.	.	.	.	.	A	37	6.531211	0.97641	.	.	ENSG00000137486	ENST00000420843;ENST00000393505;ENST00000360025;ENST00000532525	.	.	.	5.2	-1.28	0.09318	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.5173	9.9708	0.41752	0.4535:0.0:0.5465:0.0	.	.	.	.	X	47;47;47;42	.	ENSP00000353124:Y47X	Y	-	3	2	ARRB1	74672943	0.980000	0.34600	0.996000	0.52242	0.984000	0.73092	0.213000	0.17521	-0.194000	0.10399	0.379000	0.24179	TAT	ARRB1	-	pfam_Arrestin-like_N,superfamily_Ig_E-set	ENSG00000137486		0.612	ARRB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARRB1	HGNC	protein_coding	OTTHUMT00000384092.3	-	0.00	48	0	A	NM_004041		74995295	-1	tier1	-	no_errors	ENST00000393505	ensembl	human	known	74_37	nonsense	38.18	34	21	SNP	0.990	T
ASAP2	8853	genome.wustl.edu	37	2	9437480	9437480	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr2:9437480G>T	ENST00000281419.3	+	3	591	c.251G>T	c.(250-252)gGc>gTc	p.G84V	ASAP2_ENST00000315273.4_Missense_Mutation_p.G84V	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	84					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						AAGTTTGGCGGCAACTGTGTA	0.493																																																	0													118.0	104.0	109.0					2																	9437480		2203	4300	6503	SO:0001583	missense	0			AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.251G>T	2.37:g.9437480G>T	ENSP00000281419:p.Gly84Val		D6W4Y8	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP	p.G84V	ENST00000281419.3	37	c.251	CCDS1661.1	2	.	.	.	.	.	.	.	.	.	.	G	17.15	3.315043	0.60524	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.04156	3.69;3.69	5.3	4.42	0.53409	.	0.156649	0.56097	D	0.000025	T	0.02727	0.0082	N	0.04508	-0.205	0.80722	D	1	B;P	0.42409	0.435;0.779	B;B	0.36885	0.219;0.235	T	0.61729	-0.7003	10	0.38643	T	0.18	.	13.8482	0.63481	0.074:0.0:0.926:0.0	.	84;84	O43150-2;O43150	.;ASAP2_HUMAN	V	84	ENSP00000281419:G84V;ENSP00000316404:G84V	ENSP00000281419:G84V	G	+	2	0	ASAP2	9354931	1.000000	0.71417	0.993000	0.49108	0.865000	0.49528	4.557000	0.60782	1.229000	0.43630	0.650000	0.86243	GGC	ASAP2	-	NULL	ENSG00000151693		0.493	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASAP2	HGNC	protein_coding	OTTHUMT00000237522.1		0.00	56	0	G	NM_003887		9437480	+1			no_errors	ENST00000281419	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
ASXL1	171023	genome.wustl.edu	37	20	30956919	30956919	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr20:30956919C>T	ENST00000375687.4	+	4	669	c.245C>T	c.(244-246)aCg>aTg	p.T82M	ASXL1_ENST00000306058.5_Missense_Mutation_p.T77M|ASXL1_ENST00000542461.1_Missense_Mutation_p.T81M|ASXL1_ENST00000375689.1_Missense_Mutation_p.T78M|ASXL1_ENST00000470145.1_3'UTR	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	82					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						AGCCTTTTCACGCTCAAGGTA	0.453			"""F, N, Mis"""		"""MDS, CMML"""																																			Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	0													150.0	130.0	137.0					20																	30956919		2203	4300	6503	SO:0001583	missense	0			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.245C>T	20.37:g.30956919C>T	ENSP00000364839:p.Thr82Met		B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	NULL	p.T82M	ENST00000375687.4	37	c.245	CCDS13201.1	20	.	.	.	.	.	.	.	.	.	.	C	23.0	4.363973	0.82353	.	.	ENSG00000171456	ENST00000358956;ENST00000542189;ENST00000375687;ENST00000542461;ENST00000421155;ENST00000412498;ENST00000375689;ENST00000306058	T;T	0.25749	1.8;1.78	5.22	5.22	0.72569	.	0.109069	0.64402	D	0.000007	T	0.47801	0.1465	L	0.56769	1.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	T	0.42085	-0.9472	10	0.72032	D	0.01	-3.4035	15.8163	0.78604	0.0:1.0:0.0:0.0	.	77;82	A6NIZ6;Q8IXJ9	.;ASXL1_HUMAN	M	82;82;82;81;82;72;78;77	ENSP00000364839:T82M;ENSP00000305119:T77M	ENSP00000305119:T77M	T	+	2	0	ASXL1	30420580	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.327000	0.72910	2.706000	0.92434	0.643000	0.83706	ACG	ASXL1	-	NULL	ENSG00000171456		0.453	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASXL1	HGNC	protein_coding	OTTHUMT00000078624.2	-	0.00	53	0	C	NM_015338		30956919	+1	tier1	-	no_errors	ENST00000375687	ensembl	human	known	74_37	missense	8.00	69	6	SNP	1.000	T
ATP10D	57205	genome.wustl.edu	37	4	47517556	47517556	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr4:47517556C>G	ENST00000273859.3	+	3	623	c.354C>G	c.(352-354)ttC>ttG	p.F118L	ATP10D_ENST00000504445.1_Missense_Mutation_p.F118L	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	118					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						TAGAAGCCTTCCAAAAGGAAA	0.418																																																	0													162.0	154.0	157.0					4																	47517556		2203	4300	6503	SO:0001583	missense	0			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.354C>G	4.37:g.47517556C>G	ENSP00000273859:p.Phe118Leu		A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.F118L	ENST00000273859.3	37	c.354	CCDS3476.1	4	.	.	.	.	.	.	.	.	.	.	C	22.6	4.314013	0.81358	.	.	ENSG00000145246	ENST00000273859;ENST00000504445	D;D	0.82984	-1.67;-1.67	5.38	4.54	0.55810	ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.85314	0.5668	L	0.46157	1.445	0.48762	D	0.999705	P;D	0.65815	0.778;0.995	B;P	0.58013	0.358;0.831	D	0.85000	0.0899	10	0.45353	T	0.12	-22.8695	13.4261	0.61026	0.0:0.924:0.0:0.076	.	118;118	Q9P241;Q6PEW3	AT10D_HUMAN;.	L	118	ENSP00000273859:F118L;ENSP00000420909:F118L	ENSP00000273859:F118L	F	+	3	2	ATP10D	47212313	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.724000	0.25954	1.266000	0.44231	0.655000	0.94253	TTC	ATP10D	-	tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000145246		0.418	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	HGNC	protein_coding	OTTHUMT00000216900.1	-	0.00	47	0	C	NM_020453		47517556	+1	tier1	-	no_errors	ENST00000273859	ensembl	human	known	74_37	missense	24.49	37	12	SNP	1.000	G
AWAT2	158835	genome.wustl.edu	37	X	69262136	69262136	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chrX:69262136G>A	ENST00000276101.3	-	6	753	c.748C>T	c.(748-750)Cag>Tag	p.Q250*		NM_001002254.1	NP_001002254.1	Q6E213	AWAT2_HUMAN	acyl-CoA wax alcohol acyltransferase 2	250					wax biosynthetic process (GO:0010025)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)|retinol O-fatty-acyltransferase activity (GO:0050252)			endometrium(3)|large_intestine(3)|lung(2)|ovary(1)	9						ACCATGCTCTGGAACCACTTC	0.532																																					NSCLC(80;1334 1436 9350 24214 26427)												0													112.0	89.0	97.0					X																	69262136		2203	4300	6503	SO:0001587	stop_gained	0			BC063698	CCDS35320.1	Xq13.1	2009-02-23	2009-02-23	2009-02-23	ENSG00000147160	ENSG00000147160			23251	protein-coding gene	gene with protein product	"""multifunctional O-acyltransferase"""	300925	"""diacylglycerol O-acyltransferase 2-like 4"""	DGAT2L4		14970677, 16106050, 15671038	Standard	NM_001002254		Approved	MFAT	uc004dxt.1	Q6E213	OTTHUMG00000021763	ENST00000276101.3:c.748C>T	X.37:g.69262136G>A	ENSP00000421172:p.Gln250*		Q6IEE3|Q6P437	Nonsense_Mutation	SNP	pfam_DAGAT	p.Q250*	ENST00000276101.3	37	c.748	CCDS35320.1	X	.	.	.	.	.	.	.	.	.	.	G	15.97	2.990896	0.54041	.	.	ENSG00000147160	ENST00000276101	.	.	.	5.04	4.16	0.48862	.	0.273852	0.31246	N	0.007987	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.4212	0.49982	0.0:0.0:0.8185:0.1815	.	.	.	.	X	250	.	ENSP00000421172:Q250X	Q	-	1	0	AWAT2	69178861	1.000000	0.71417	0.631000	0.29282	0.123000	0.20343	6.434000	0.73408	1.087000	0.41251	0.600000	0.82982	CAG	AWAT2	-	pfam_DAGAT	ENSG00000147160		0.532	AWAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AWAT2	HGNC	protein_coding	OTTHUMT00000358738.1	-	0.00	29	0	G	NM_001002254		69262136	-1	tier1	-	no_errors	ENST00000276101	ensembl	human	known	74_37	nonsense	13.79	24	4	SNP	0.998	A
C10orf76	79591	genome.wustl.edu	37	10	103771512	103771512	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr10:103771512G>T	ENST00000370033.4	-	11	918	c.799C>A	c.(799-801)Caa>Aaa	p.Q267K		NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	267						integral component of membrane (GO:0016021)		p.Q267K(1)		autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		AAACCACTTTGGTGTTCTTCT	0.343																																																	1	Substitution - Missense(1)	endometrium(1)											125.0	124.0	124.0					10																	103771512		1823	4079	5902	SO:0001583	missense	0			AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.799C>A	10.37:g.103771512G>T	ENSP00000359050:p.Gln267Lys		Q2TB87|Q9H8Z9	Missense_Mutation	SNP	pfam_DUF1741,superfamily_ARM-type_fold	p.Q267K	ENST00000370033.4	37	c.799	CCDS41563.1	10	.	.	.	.	.	.	.	.	.	.	G	16.93	3.258640	0.59321	.	.	ENSG00000120029	ENST00000370033	T	0.65364	-0.15	6.17	6.17	0.99709	.	0.051755	0.85682	D	0.000000	T	0.56202	0.1969	L	0.46157	1.445	0.80722	D	1	B	0.26258	0.145	B	0.24974	0.057	T	0.54456	-0.8291	10	0.06494	T	0.89	-12.8406	20.8794	0.99867	0.0:0.0:1.0:0.0	.	267	Q5T2E6	CJ076_HUMAN	K	267	ENSP00000359050:Q267K	ENSP00000359050:Q267K	Q	-	1	0	C10orf76	103761502	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.097000	0.89539	2.941000	0.99782	0.655000	0.94253	CAA	C10orf76	-	superfamily_ARM-type_fold	ENSG00000120029		0.343	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf76	HGNC	protein_coding	OTTHUMT00000050007.1	-	0.00	53	0	G	NM_024541		103771512	-1	tier1	-	no_errors	ENST00000370033	ensembl	human	known	74_37	missense	23.53	13	4	SNP	1.000	T
C6orf136	221545	genome.wustl.edu	37	6	30615096	30615096	+	Intron	SNP	G	G	C	rs551438712		TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr6:30615096G>C	ENST00000376473.5	+	1	231				AL662800.2_ENST00000583820.1_RNA|C6orf136_ENST00000293604.6_Missense_Mutation_p.E30Q|C6orf136_ENST00000376471.4_Intron|C6orf136_ENST00000528347.2_5'Flank|C6orf136_ENST00000493705.1_Intron	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136							mitochondrion (GO:0005739)				endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						CGGAGGAGAAGAGGGAGGGAG	0.736																																																	0																																										SO:0001627	intron_variant	0			BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.72+16G>C	6.37:g.30615096G>C			A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Missense_Mutation	SNP	pfam_DUF2358	p.E30Q	ENST00000376473.5	37	c.88	CCDS43443.1	6	.	.	.	.	.	.	.	.	.	.	G	12.49	1.954779	0.34471	.	.	ENSG00000204564	ENST00000293604	.	.	.	4.94	2.15	0.27550	.	.	.	.	.	T	0.06005	0.0156	N	0.08118	0	0.18873	N	0.999987	B	0.22683	0.073	B	0.23150	0.044	T	0.42616	-0.9441	7	.	.	.	.	8.2587	0.31771	0.2646:0.0:0.7354:0.0	.	30	F8VX15	.	Q	30	.	.	E	+	1	0	C6orf136	30723075	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.012000	0.13287	0.506000	0.28125	0.655000	0.94253	GAG	C6orf136	-	NULL	ENSG00000204564		0.736	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf136	HGNC	protein_coding	OTTHUMT00000076457.4	-	0.00	57	0	G	NM_145029		30615096	+1	tier1	-	no_errors	ENST00000293604	ensembl	human	known	74_37	missense	52.50	19	21	SNP	0.000	C
CALR	811	genome.wustl.edu	37	19	13054411	13054411	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr19:13054411G>A	ENST00000316448.5	+	8	1094	c.1021G>A	c.(1021-1023)Gag>Aag	p.E341K	RAD23A_ENST00000541222.1_5'Flank|RAD23A_ENST00000586534.1_5'Flank|RAD23A_ENST00000316856.3_5'Flank|RAD23A_ENST00000592268.1_5'Flank|CTC-425F1.4_ENST00000589120.1_RNA	NM_004343.3	NP_004334.1	P27797	CALR_HUMAN	calreticulin	341	C-domain.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|cellular response to lithium ion (GO:0071285)|cellular senescence (GO:0090398)|chaperone-mediated protein folding (GO:0061077)|cortical actin cytoskeleton organization (GO:0030866)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucocorticoid receptor signaling pathway (GO:0042921)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|peptide antigen assembly with MHC class I protein complex (GO:0002502)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of phagocytosis (GO:0050766)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein localization to nucleus (GO:0034504)|protein maturation by protein folding (GO:0022417)|protein N-linked glycosylation via asparagine (GO:0018279)|protein stabilization (GO:0050821)|regulation of apoptotic process (GO:0042981)|regulation of meiosis (GO:0040020)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to testosterone (GO:0033574)|sequestering of calcium ion (GO:0051208)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|intracellular (GO:0005622)|membrane (GO:0016020)|MHC class I peptide loading complex (GO:0042824)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasmic reticulum (GO:0016529)	androgen receptor binding (GO:0050681)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|chaperone binding (GO:0051087)|complement component C1q binding (GO:0001849)|DNA binding (GO:0003677)|glycoprotein binding (GO:0001948)|hormone binding (GO:0042562)|integrin binding (GO:0005178)|iron ion binding (GO:0005506)|mRNA binding (GO:0003729)|peptide binding (GO:0042277)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)	10					Antihemophilic Factor(DB00025)|Melatonin(DB01065)|Tenecteplase(DB00031)	ATACGCTGAGGAGTTTGGCAA	0.592																																																	0													155.0	121.0	132.0					19																	13054411		2203	4300	6503	SO:0001583	missense	0			M84739	CCDS12288.1	19p13.3-p13.2	2014-09-17				ENSG00000179218			1455	protein-coding gene	gene with protein product	"""Sicca syndrome antigen A (autoantigen Ro; calreticulin)"", ""autoantigen Ro"""	109091				2365822	Standard	NM_004343		Approved	RO, SSA, cC1qR, CRT, FLJ26680	uc002mvu.2	P27797		ENST00000316448.5:c.1021G>A	19.37:g.13054411G>A	ENSP00000320866:p.Glu341Lys		Q6IAT4|Q9UDG2	Missense_Mutation	SNP	pirsf_Calreticulin,pfam_Calret/calnex,superfamily_ConA-like_lec_gl_sf,prints_Calret/calnex	p.E341K	ENST00000316448.5	37	c.1021	CCDS12288.1	19	.	.	.	.	.	.	.	.	.	.	G	6.659	0.490114	0.12702	.	.	ENSG00000179218	ENST00000316448;ENST00000539083	T	0.48201	0.82	5.27	4.22	0.49857	Concanavalin A-like lectin/glucanase (1);	0.103112	0.64402	D	0.000005	T	0.23014	0.0556	N	0.04116	-0.275	0.80722	D	1	B	0.17268	0.021	B	0.12156	0.007	T	0.16424	-1.0403	10	0.02654	T	1	-31.1888	14.747	0.69496	0.0:0.146:0.854:0.0	.	341	P27797	CALR_HUMAN	K	341;220	ENSP00000320866:E341K	ENSP00000320866:E341K	E	+	1	0	CALR	12915411	1.000000	0.71417	0.992000	0.48379	0.784000	0.44337	5.570000	0.67398	1.195000	0.43115	0.561000	0.74099	GAG	CALR	-	pirsf_Calreticulin,superfamily_ConA-like_lec_gl_sf	ENSG00000179218		0.592	CALR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALR	HGNC	protein_coding	OTTHUMT00000451952.1		0.00	61	0	G	NM_004343		13054411	+1			no_errors	ENST00000316448	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
CARF	79800	genome.wustl.edu	37	2	203847041	203847041	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr2:203847041G>T	ENST00000402905.3	+	15	2257	c.1936G>T	c.(1936-1938)Gac>Tac	p.D646Y	CARF_ENST00000545262.1_Missense_Mutation_p.D570Y|CARF_ENST00000320443.8_Missense_Mutation_p.D646Y|CARF_ENST00000545253.1_Missense_Mutation_p.D558Y|CARF_ENST00000414439.1_Missense_Mutation_p.D544Y|WDR12_ENST00000477723.1_Intron|CARF_ENST00000438828.2_Missense_Mutation_p.D646Y|CARF_ENST00000428585.1_Missense_Mutation_p.D570Y	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	646					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AGTTGCAATGGACGAGCTGGT	0.433																																																	0													89.0	85.0	86.0					2																	203847041		1920	4145	6065	SO:0001583	missense	0			AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.1936G>T	2.37:g.203847041G>T	ENSP00000384006:p.Asp646Tyr		B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Missense_Mutation	SNP	NULL	p.D646Y	ENST00000402905.3	37	c.1936	CCDS42801.1	2	.	.	.	.	.	.	.	.	.	.	G	21.5	4.165261	0.78339	.	.	ENSG00000138380	ENST00000402905;ENST00000414439;ENST00000428585;ENST00000545253;ENST00000545262;ENST00000320443;ENST00000438828	.	.	.	5.83	5.83	0.93111	.	0.207204	0.41938	D	0.000787	T	0.73916	0.3648	L	0.56769	1.78	0.38709	D	0.953175	D;D;D	0.61080	0.989;0.989;0.989	P;P;P	0.59546	0.859;0.859;0.8	T	0.76645	-0.2883	9	0.62326	D	0.03	-12.3804	17.2744	0.87111	0.0:0.0:1.0:0.0	.	558;570;646	B4DIA7;G3V1K7;Q8N187	.;.;AL2S8_HUMAN	Y	646;544;570;558;570;646;646	.	ENSP00000316224:D646Y	D	+	1	0	ALS2CR8	203555286	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	3.977000	0.56874	2.769000	0.95229	0.655000	0.94253	GAC	CARF	-	NULL	ENSG00000138380		0.433	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARF	HGNC	protein_coding	OTTHUMT00000335768.5	-	0.00	37	0	G	NM_001104586		203847041	+1	tier1	-	no_errors	ENST00000320443	ensembl	human	known	74_37	missense	40.00	15	10	SNP	1.000	T
CCDC14	64770	genome.wustl.edu	37	3	123634433	123634433	+	Silent	SNP	A	A	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr3:123634433A>G	ENST00000488653.2	-	13	2145	c.2055T>C	c.(2053-2055)ccT>ccC	p.P685P	CCDC14_ENST00000483247.1_Intron|CCDC14_ENST00000433542.2_Silent_p.P644P|CCDC14_ENST00000485727.1_Silent_p.P485P|CCDC14_ENST00000489746.1_Silent_p.P485P|CCDC14_ENST00000310351.4_Silent_p.P525P			Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	685					substantia nigra development (GO:0021762)	centrosome (GO:0005813)				NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)	21		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		AAGTGTGAGCAGGAGCTGGGT	0.388																																																	0													95.0	102.0	100.0					3																	123634433		2203	4300	6503	SO:0001819	synonymous_variant	0			AL122079	CCDS3025.2	3q21.1	2014-03-20			ENSG00000175455	ENSG00000175455			25766	protein-coding gene	gene with protein product						12477932	Standard	NM_022757		Approved	FLJ12892, DKFZp434L1050	uc010hrt.3	Q49A88	OTTHUMG00000153005	ENST00000488653.2:c.2055T>C	3.37:g.123634433A>G			B7Z2T2|B8ZZ41|B8ZZ58|D3DN98|Q7Z3N3|Q86T30|Q8IWF8|Q8WUJ8|Q96K47|Q9H9A3|Q9UFH0	Silent	SNP	NULL	p.P685	ENST00000488653.2	37	c.2055		3																																																																																			CCDC14	-	NULL	ENSG00000175455		0.388	CCDC14-202	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC14	HGNC	protein_coding			0.00	50	0	A	NM_022757		123634433	-1			no_errors	ENST00000488653	ensembl	human	known	74_37	silent	5.10	93	5	SNP	0.004	G
CCNC	892	genome.wustl.edu	37	6	100006296	100006296	+	Intron	DEL	A	A	-			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr6:100006296delA	ENST00000520429.1	-	5	792				CCNC_ENST00000482541.2_Frame_Shift_Del_p.F141fs|CCNC_ENST00000518714.1_Intron|CCNC_ENST00000521017.1_Intron|CCNC_ENST00000369220.4_Intron|CCNC_ENST00000523799.1_Intron|CCNC_ENST00000523985.1_Intron|CCNC_ENST00000520371.1_Intron	NM_001013399.1|NM_005190.3	NP_001013417.1|NP_005181.2	P24863	CCNC_HUMAN	cyclin C						gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|mediator complex (GO:0016592)|nucleoplasm (GO:0005654)							all_cancers(76;8.46e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.064)		CTCATAAACTAAAAAAAAAAA	0.299																																					GBM(57;273 1020 40094 44454 49348)												0																																										SO:0001627	intron_variant	0				CCDS34502.1, CCDS47461.1	6q21	2008-02-05			ENSG00000112237	ENSG00000112237			1581	protein-coding gene	gene with protein product		123838				1833066	Standard	XM_005267202		Approved	CycC	uc003pqe.3	P24863	OTTHUMG00000015268	ENST00000520429.1:c.346+76T>-	6.37:g.100006296delA			B4DPZ1|Q9H543	Frame_Shift_Del	DEL	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.F141fs	ENST00000520429.1	37	c.423	CCDS34502.1	6																																																																																			CCNC	-	superfamily_Cyclin-like	ENSG00000112237		0.299	CCNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCNC	HGNC	protein_coding	OTTHUMT00000041613.2		0.00	19	0	A	NM_005190		100006296	-1	tier1		no_errors	ENST00000482541	ensembl	human	putative	74_37	frame_shift_del	18.75	13	3	DEL	0.007	-
CD207	50489	genome.wustl.edu	37	2	71062833	71062833	+	Splice_Site	SNP	G	G	C	rs397692276|rs11450450		TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr2:71062833G>C	ENST00000410009.3	-	1	119		c.e1+1			NM_015717.3	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 molecule, langerin						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|defense response to virus (GO:0051607)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)			endometrium(1)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|stomach(1)	20						GATGTGGCTTGCTCGGGGCCA	0.547																																																	0													71.0	84.0	80.0					2																	71062833		2133	4253	6386	SO:0001630	splice_region_variant	0			AJ242859	CCDS74520.1	2p13	2011-08-30	2006-03-28		ENSG00000116031	ENSG00000116031		"""C-type lectin domain containing"", ""CD molecules"""	17935	protein-coding gene	gene with protein product		604862	"""CD207 antigen, langerin"""			10661407, 9847074	Standard	NM_015717		Approved	Langerin, CLEC4K	uc002shg.3	Q9UJ71	OTTHUMG00000153176	ENST00000410009.3:c.73+1C>G	2.37:g.71062833G>C				Splice_Site	SNP	-	e1+1	ENST00000410009.3	37	c.73+1		2	.	.	.	.	.	.	.	.	.	.	G	8.781	0.928326	0.18131	.	.	ENSG00000116031	ENST00000410009	.	.	.	3.98	3.98	0.46160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8493	0.52401	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CD207	70916341	1.000000	0.71417	1.000000	0.80357	0.180000	0.23129	2.092000	0.41700	2.482000	0.83794	0.655000	0.94253	.	CD207	-	-	ENSG00000116031		0.547	CD207-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	CD207	HGNC	protein_coding	OTTHUMT00000329959.4		0.00	43	0	G	NM_015717	Intron	71062833	-1			no_errors	ENST00000410009	ensembl	human	known	74_37	splice_site	8.33	33	3	SNP	1.000	C
CD68	968	genome.wustl.edu	37	17	7483026	7483026	+	Silent	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr17:7483026C>T	ENST00000250092.6	+	1	242	c.31C>T	c.(31-33)Ctg>Ttg	p.L11L	AC113189.5_ENST00000572046.1_RNA|SENP3-EIF4A1_ENST00000579777.1_RNA|AC113189.5_ENST00000415124.1_RNA|SNORD10_ENST00000459579.1_RNA|AC113189.5_ENST00000417897.1_RNA|CD68_ENST00000380498.6_Silent_p.L11L|SNORA67_ENST00000384423.1_RNA|AC113189.5_ENST00000573187.1_RNA	NM_001251.2	NP_001242.2	P34810	CD68_HUMAN	CD68 molecule	11					cellular response to organic substance (GO:0071310)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(1)|lung(1)|skin(1)	3						CTCGGGGGCCCTGCTGGGGCT	0.637																																																	0													30.0	30.0	30.0					17																	7483026		2203	4299	6502	SO:0001819	synonymous_variant	0			S57235	CCDS11114.1, CCDS58512.1	17p13	2011-11-24	2006-03-28		ENSG00000129226	ENSG00000129226		"""CD molecules"""	1693	protein-coding gene	gene with protein product	"""scavenger receptor class D, member 1"", ""CD68 antigen"", ""macrophage antigen CD68"""	153634	"""CD68 antigen"""			9790779	Standard	NM_001251		Approved	SCARD1, macrosialin, GP110, DKFZp686M18236, LAMP4	uc002ghv.3	P34810	OTTHUMG00000108146	ENST00000250092.6:c.31C>T	17.37:g.7483026C>T			B4DVT4|Q53HR6|Q53XI3|Q96BI7	Silent	SNP	pfam_Lysosome-assoc_membr_glycop,prints_Lysosome-assoc_membr_glycop	p.L11	ENST00000250092.6	37	c.31	CCDS11114.1	17																																																																																			CD68	-	NULL	ENSG00000129226		0.637	CD68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD68	HGNC	protein_coding	OTTHUMT00000226949.3	-	0.00	78	0	C	NM_001251		7483026	+1	tier1	-	no_errors	ENST00000250092	ensembl	human	known	74_37	silent	31.11	31	14	SNP	0.092	T
CHD1	1105	genome.wustl.edu	37	5	98232051	98232051	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr5:98232051T>C	ENST00000284049.3	-	11	1738	c.1589A>G	c.(1588-1590)tAt>tGt	p.Y530C		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	530	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	AAAAGGTCCATATAATTGATG	0.378																																																	0													98.0	101.0	100.0					5																	98232051		2203	4300	6503	SO:0001583	missense	0			AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.1589A>G	5.37:g.98232051T>C	ENSP00000284049:p.Tyr530Cys		Q17RZ3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.Y530C	ENST00000284049.3	37	c.1589	CCDS34204.1	5	.	.	.	.	.	.	.	.	.	.	T	18.78	3.696763	0.68386	.	.	ENSG00000153922	ENST00000284049	D	0.92911	-3.13	5.12	5.12	0.69794	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.31246	U	0.007998	D	0.91543	0.7329	L	0.53561	1.675	0.80722	D	1	B	0.33171	0.4	B	0.40101	0.319	D	0.91814	0.5462	10	0.72032	D	0.01	.	15.2078	0.73192	0.0:0.0:0.0:1.0	.	530	O14646	CHD1_HUMAN	C	530	ENSP00000284049:Y530C	ENSP00000284049:Y530C	Y	-	2	0	CHD1	98259951	1.000000	0.71417	0.999000	0.59377	0.754000	0.42855	7.970000	0.88000	2.052000	0.61016	0.477000	0.44152	TAT	CHD1	-	pfam_SNF2_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000153922		0.378	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1	HGNC	protein_coding	OTTHUMT00000370295.1	-	0.00	26	0	T	NM_001270		98232051	-1	tier1	-	no_errors	ENST00000284049	ensembl	human	known	74_37	missense	13.64	38	6	SNP	1.000	C
CLK4	57396	genome.wustl.edu	37	5	178040553	178040553	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr5:178040553G>T	ENST00000316308.4	-	7	915	c.747C>A	c.(745-747)ttC>ttA	p.F249L		NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	249	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		TTTCTTTAATGAAATCGTAAG	0.378																																																	0													86.0	85.0	86.0					5																	178040553		2203	4300	6503	SO:0001583	missense	0			AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.747C>A	5.37:g.178040553G>T	ENSP00000316948:p.Phe249Leu			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.F249L	ENST00000316308.4	37	c.747	CCDS4437.1	5	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111060	0.77210	.	.	ENSG00000113240	ENST00000316308;ENST00000536763	T	0.17370	2.28	5.33	2.1	0.27182	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.23171	0.0560	L	0.37561	1.115	0.80722	D	1	D;D;D	0.61080	0.984;0.989;0.989	D;P;P	0.63033	0.91;0.878;0.878	T	0.02098	-1.1214	10	0.87932	D	0	.	5.4936	0.16789	0.5073:0.0:0.4927:0.0	.	249;249;249	B7ZL31;B9EG64;Q9HAZ1	.;.;CLK4_HUMAN	L	249	ENSP00000316948:F249L	ENSP00000316948:F249L	F	-	3	2	CLK4	177973159	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.755000	0.38379	0.602000	0.29896	-0.216000	0.12614	TTC	CLK4	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000113240		0.378	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLK4	HGNC	protein_coding	OTTHUMT00000253479.2	-	0.00	42	0	G			178040553	-1	tier1	-	no_errors	ENST00000316308	ensembl	human	known	74_37	missense	19.51	33	8	SNP	1.000	T
CNTN1	1272	genome.wustl.edu	37	12	41323615	41323615	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr12:41323615T>C	ENST00000551295.2	+	7	631	c.514T>C	c.(514-516)Tgg>Cgg	p.W172R	CNTN1_ENST00000348761.2_Missense_Mutation_p.W161R|CNTN1_ENST00000347616.1_Missense_Mutation_p.W172R|CNTN1_ENST00000360099.3_Missense_Mutation_p.W172R|CNTN1_ENST00000547849.1_Missense_Mutation_p.W172R|CNTN1_ENST00000547702.1_Missense_Mutation_p.W172R	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	172	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TAGCTATCGCTGGCTTCTAAA	0.358																																																	0													75.0	74.0	74.0					12																	41323615		2203	4299	6502	SO:0001583	missense	0			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.514T>C	12.37:g.41323615T>C	ENSP00000447006:p.Trp172Arg		A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.W172R	ENST00000551295.2	37	c.514	CCDS8737.1	12	.	.	.	.	.	.	.	.	.	.	T	20.7	4.034503	0.75617	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	D;D;D;D;D;D	0.97404	-4.37;-4.37;-4.37;-4.37;-4.37;-4.37	5.48	5.48	0.80851	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.98972	0.9650	H	0.96547	3.84	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99552	1.0966	10	0.87932	D	0	.	15.8965	0.79338	0.0:0.0:0.0:1.0	.	172;161;172	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	R	172;172;172;172;172;161	ENSP00000448004:W172R;ENSP00000447006:W172R;ENSP00000448653:W172R;ENSP00000325660:W172R;ENSP00000353213:W172R;ENSP00000261160:W161R	ENSP00000325660:W172R	W	+	1	0	CNTN1	39609882	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.698000	0.84413	2.225000	0.72522	0.533000	0.62120	TGG	CNTN1	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000018236		0.358	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	HGNC	protein_coding	OTTHUMT00000403692.2	-	0.00	40	0	T	NM_001843		41323615	+1	tier1	-	no_errors	ENST00000347616	ensembl	human	known	74_37	missense	19.15	38	9	SNP	1.000	C
COL26A1	136227	genome.wustl.edu	37	7	101063356	101063356	+	RNA	SNP	C	C	T	rs79106047	byFrequency	TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr7:101063356C>T	ENST00000397927.3	+	0	470				COL26A1_ENST00000528707.1_RNA|COL26A1_ENST00000313669.7_RNA	NM_001278563.1	NP_001265492.1	Q96A83	COQA1_HUMAN	collagen, type XXVI, alpha 1						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)											TGCCGGTGGCCGGGGCCCTGC	0.647													C|||	13	0.00259585	0.0	0.0014	5008	,	,		16743	0.0		0.004	False		,,,				2504	0.0082																0								C	LEU/PRO	1,4031		0,1,2015	30.0	40.0	36.0		257	4.9	1.0	7	dbSNP_131	36	21,8301		0,21,4140	yes	missense	EMID2	NM_133457.2	98	0,22,6155	TT,TC,CC		0.2523,0.0248,0.1781	probably-damaging	86/440	101063356	22,12332	2016	4161	6177			0			AJ416091	CCDS64739.1	7q22.1	2013-01-16	2013-01-16	2013-01-16	ENSG00000160963	ENSG00000160963		"""Collagens"", ""EMI domain containing"""	18038	protein-coding gene	gene with protein product	"""Emu2 gene"""	608927	"""EMI domain containing 2"""	EMID2		12221002, 12145293	Standard	NM_001278563		Approved	Emu2, EMI6	uc003uyo.1	Q96A83	OTTHUMG00000150033		7.37:g.101063356C>T			Q32M90	Missense_Mutation	SNP	pfam_EMI_domain,pfam_Collagen,pfscan_EMI_domain	p.P86L	ENST00000397927.3	37	c.257		7	4	0.0018315018315018315	0	0.0	1	0.0027624309392265192	0	0.0	3	0.00395778364116095	C	29.2	4.983927	0.93044	2.48E-4	0.002523	ENSG00000160963	ENST00000313669	T	0.46451	0.87	4.95	4.95	0.65309	EMI domain (2);	0.000000	0.36893	U	0.002352	T	0.62913	0.2467	M	0.66939	2.045	0.46954	D	0.999269	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	T	0.66968	-0.5789	10	0.87932	D	0	.	15.7219	0.77718	0.0:1.0:0.0:0.0	.	86;86	Q96A83;C9JPW4	EMID2_HUMAN;.	L	86	ENSP00000318234:P86L	ENSP00000318234:P86L	P	+	2	0	EMID2	100850076	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	7.166000	0.77553	2.310000	0.77875	0.558000	0.71614	CCG	COL26A1	-	pfam_EMI_domain,pfscan_EMI_domain	ENSG00000160963		0.647	COL26A1-002	KNOWN	basic	polymorphic_pseudogene	COL26A1	HGNC	polymorphic_pseudogene	OTTHUMT00000315898.2		0.00	34	0	C	NM_133457		101063356	+1			no_errors	ENST00000313669	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	T
CREBBP	1387	genome.wustl.edu	37	16	3786138	3786138	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr16:3786138C>G	ENST00000262367.5	-	28	5436	c.4627G>C	c.(4627-4629)Gat>Cat	p.D1543H	CREBBP_ENST00000382070.3_Missense_Mutation_p.D1505H	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1543	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Interaction with TRERF1.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.D1543H(1)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GGCCAGAAATCACCTTCAAAA	0.463			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																	Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	1	Substitution - Missense(1)	cervix(1)	GRCh37	CM065107	CREBBP	M							250.0	204.0	220.0					16																	3786138		2197	4300	6497	SO:0001583	missense	0			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4627G>C	16.37:g.3786138C>G	ENSP00000262367:p.Asp1543His		D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.D1543H	ENST00000262367.5	37	c.4627	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	c	19.87	3.907032	0.72868	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.98249	-4.82;-4.82	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.99315	0.9760	H	0.95712	3.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98863	1.0763	10	0.87932	D	0	-21.1644	18.4344	0.90640	0.0:1.0:0.0:0.0	.	1573;1543	Q4LE28;Q92793	.;CBP_HUMAN	H	1543;1573;1505;132	ENSP00000262367:D1543H;ENSP00000371502:D1505H	ENSP00000262367:D1543H	D	-	1	0	CREBBP	3726139	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.755000	0.85180	2.662000	0.90505	0.555000	0.69702	GAT	CREBBP	-	pfam_Histone_H3-K56_AcTrfase_RTT109	ENSG00000005339		0.463	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	-	0.00	91	0	C	NM_004380		3786138	-1	tier1	-	no_errors	ENST00000262367	ensembl	human	known	74_37	missense	25.32	59	20	SNP	1.000	G
CSGALNACT2	55454	genome.wustl.edu	37	10	43659419	43659419	+	Missense_Mutation	SNP	G	G	T	rs79064394		TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr10:43659419G>T	ENST00000374466.3	+	5	1421	c.1086G>T	c.(1084-1086)ttG>ttT	p.L362F		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	362					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.L362F(5)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GAGAGGTCTTGATGTTTTTCT	0.433																																																	5	Substitution - Missense(5)	endometrium(4)|kidney(1)											223.0	221.0	222.0					10																	43659419		2203	4300	6503	SO:0001583	missense	0			AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1086G>T	10.37:g.43659419G>T	ENSP00000363590:p.Leu362Phe		B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	pfam_Chond_GalNAc	p.L362F	ENST00000374466.3	37	c.1086	CCDS7201.1	10	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499782	0.85176	.	.	ENSG00000169826	ENST00000374466	T	0.27256	1.68	6.08	5.17	0.71159	.	0.064535	0.64402	D	0.000004	T	0.57359	0.2048	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63721	-0.6573	10	0.87932	D	0	-11.7375	14.8306	0.70146	0.0683:0.0:0.9317:0.0	.	362	Q8N6G5	CGAT2_HUMAN	F	362	ENSP00000363590:L362F	ENSP00000363590:L362F	L	+	3	2	CSGALNACT2	42979425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.683000	0.37638	2.894000	0.99253	0.591000	0.81541	TTG	CSGALNACT2	-	pfam_Chond_GalNAc	ENSG00000169826		0.433	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSGALNACT2	HGNC	protein_coding	OTTHUMT00000047693.1		0.00	88	0	G	NM_018590		43659419	+1			no_errors	ENST00000374466	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
CSMD1	64478	genome.wustl.edu	37	8	3015451	3015451	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr8:3015451C>A	ENST00000520002.1	-	40	6440	c.5885G>T	c.(5884-5886)cGc>cTc	p.R1962L	CSMD1_ENST00000537824.1_Missense_Mutation_p.R1961L|CSMD1_ENST00000602723.1_Missense_Mutation_p.R1962L|CSMD1_ENST00000400186.3_Missense_Mutation_p.R1962L|CSMD1_ENST00000542608.1_Missense_Mutation_p.R1961L|CSMD1_ENST00000602557.1_Missense_Mutation_p.R1962L|CSMD1_ENST00000539096.1_Missense_Mutation_p.R1961L|CSMD1_ENST00000523387.1_5'UTR			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1962	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GTTCCAACGGCGAACGGTCCC	0.443																																																	0													53.0	51.0	52.0					8																	3015451		1957	4100	6057	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.5885G>T	8.37:g.3015451C>A	ENSP00000430733:p.Arg1962Leu		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.R1962L	ENST00000520002.1	37	c.5885		8	.	.	.	.	.	.	.	.	.	.	C	16.73	3.203513	0.58234	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04	5.45	4.58	0.56647	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.78027	0.4219	M	0.75085	2.285	0.53688	D	0.999975	D;D;D;D	0.89917	0.999;1.0;0.999;0.998	D;D;D;D	0.97110	0.996;1.0;0.998;0.983	T	0.80674	-0.1277	10	0.72032	D	0.01	.	13.7826	0.63091	0.0:0.9253:0.0:0.0747	.	1962;1962;1961;1962	E5RIG2;Q96PZ7;F5H2I8;Q96PZ7-4	.;CSMD1_HUMAN;.;.	L	1962;1962;1823;1961;1961;1961	ENSP00000383047:R1962L;ENSP00000430733:R1962L;ENSP00000441462:R1961L;ENSP00000446243:R1961L;ENSP00000441675:R1961L	ENSP00000320445:R1823L	R	-	2	0	CSMD1	3002858	1.000000	0.71417	0.031000	0.17742	0.023000	0.10783	7.311000	0.78958	1.289000	0.44618	0.655000	0.94253	CGC	CSMD1	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000183117		0.443	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	-	0.00	21	0	C	NM_033225		3015451	-1	tier1	-	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	17.39	19	4	SNP	0.938	A
DAAM1	23002	genome.wustl.edu	37	14	59792408	59792408	+	Missense_Mutation	SNP	G	G	T	rs61755339		TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr14:59792408G>T	ENST00000395125.1	+	8	1039	c.1016G>T	c.(1015-1017)cGa>cTa	p.R339L	DAAM1_ENST00000360909.3_Missense_Mutation_p.R339L|DAAM1_ENST00000351081.1_Missense_Mutation_p.R339L	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	339	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)	p.R339L(1)		breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		GAAATGCTCCGAAATGAAGAT	0.313																																																	1	Substitution - Missense(1)	kidney(1)											120.0	118.0	119.0					14																	59792408		2203	4300	6503	SO:0001583	missense	0			AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.1016G>T	14.37:g.59792408G>T	ENSP00000378557:p.Arg339Leu		Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,superfamily_tRNA-bd_arm,smart_FH2_Formin	p.R339L	ENST00000395125.1	37	c.1016	CCDS9737.1	14	.	.	.	.	.	.	.	.	.	.	G	23.4	4.416946	0.83449	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000358498;ENST00000395125	D;D;D	0.84223	-1.82;-1.82;-1.82	5.35	5.35	0.76521	GTPase-binding/formin homology 3 (1);Diaphanous FH3 (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.93298	0.7864	M	0.86953	2.85	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.81914	0.992;0.995	D	0.91844	0.5486	10	0.36615	T	0.2	.	19.6142	0.95626	0.0:0.0:1.0:0.0	.	339;339	Q9Y4D1-2;Q9Y4D1	.;DAAM1_HUMAN	L	339	ENSP00000354162:R339L;ENSP00000247170:R339L;ENSP00000378557:R339L	ENSP00000247170:R339L	R	+	2	0	DAAM1	58862161	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.601000	0.98297	2.941000	0.99782	0.655000	0.94253	CGA	DAAM1	-	pfam_FH3_dom,superfamily_ARM-type_fold	ENSG00000100592		0.313	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DAAM1	HGNC	protein_coding	OTTHUMT00000276942.2		0.00	30	0	G	NM_014992		59792408	+1			no_errors	ENST00000351081	ensembl	human	known	74_37	missense	8.33	22	2	SNP	1.000	T
DCAF13	25879	genome.wustl.edu	37	8	104438329	104438329	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr8:104438329G>T	ENST00000297579.5	+	4	1157	c.880G>T	c.(880-882)Ggc>Tgc	p.G294C	DCAF13_ENST00000521971.1_Missense_Mutation_p.G102C|DCAF13_ENST00000521999.1_3'UTR|DCAF13_ENST00000519682.1_Missense_Mutation_p.G138C	NM_015420.6	NP_056235.4	Q9NV06	DCA13_HUMAN	DDB1 and CUL4 associated factor 13	142					protein ubiquitination (GO:0016567)|rRNA processing (GO:0006364)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						GGATGGGCCAGGCTATGGAGA	0.318																																																	0													75.0	78.0	77.0					8																	104438329		2203	4300	6503	SO:0001583	missense	0			AK074725	CCDS34934.1	8q22.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000164934	ENSG00000164934		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24535	protein-coding gene	gene with protein product			"""WD repeats and SOF1 domain containing"""	WDSOF1		11042152	Standard	NM_015420		Approved	DKFZP564O0463, Gm83, HSPC064	uc003yln.3	Q9NV06	OTTHUMG00000164888	ENST00000297579.5:c.880G>T	8.37:g.104438329G>T	ENSP00000297579:p.Gly294Cys		Q3MII9|Q8NCH8|Q8TC51|Q96JY7|Q9NZX3	Missense_Mutation	SNP	pfam_Sof1,pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G294C	ENST00000297579.5	37	c.880	CCDS34934.1	8	.	.	.	.	.	.	.	.	.	.	G	17.13	3.310056	0.60414	.	.	ENSG00000164934	ENST00000297579;ENST00000521971;ENST00000519682	T;T;T	0.01446	4.88;4.88;4.88	5.75	0.66	0.17868	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.356607	0.35436	N	0.003201	T	0.03390	0.0098	M	0.74258	2.255	0.44562	D	0.997524	P;B	0.46706	0.883;0.384	B;B	0.42692	0.395;0.345	T	0.45614	-0.9249	10	0.66056	D	0.02	-2.2955	10.2066	0.43116	0.3372:0.0:0.6628:0.0	.	142;142	B3KME9;Q9NV06	.;DCA13_HUMAN	C	294;102;138	ENSP00000297579:G294C;ENSP00000430883:G102C;ENSP00000430411:G138C	ENSP00000297579:G294C	G	+	1	0	DCAF13	104507505	0.223000	0.23663	0.598000	0.28837	0.841000	0.47740	1.833000	0.39161	-0.167000	0.10871	0.655000	0.94253	GGC	DCAF13	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000164934		0.318	DCAF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF13	HGNC	protein_coding	OTTHUMT00000380797.2		0.00	25	0	G	NM_015420		104438329	+1			no_errors	ENST00000297579	ensembl	human	known	74_37	missense	10.00	18	2	SNP	0.783	T
DCLRE1C	64421	genome.wustl.edu	37	10	14995953	14995953	+	Silent	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr10:14995953G>A	ENST00000378278.2	-	1	94	c.57C>T	c.(55-57)ttC>ttT	p.F19F	DCLRE1C_ENST00000378289.4_Silent_p.F19F|DCLRE1C_ENST00000396817.2_5'UTR|DCLRE1C_ENST00000378255.1_5'UTR|DCLRE1C_ENST00000378254.1_5'UTR|DCLRE1C_ENST00000378246.2_5'UTR|DCLRE1C_ENST00000357717.2_5'UTR|DCLRE1C_ENST00000453695.2_5'UTR|DCLRE1C_ENST00000378258.1_5'UTR|DCLRE1C_ENST00000378249.1_5'UTR			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	19					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						TCTCCCTATCGAAGCGGTCTA	0.642								Non-homologous end-joining																																									0													67.0	71.0	69.0					10																	14995953		2203	4300	6503	SO:0001819	synonymous_variant	0			BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.57C>T	10.37:g.14995953G>A			D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Silent	SNP	pfam_DRMBL	p.F19	ENST00000378278.2	37	c.57	CCDS31149.1	10																																																																																			DCLRE1C	-	NULL	ENSG00000152457		0.642	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1C	HGNC	protein_coding	OTTHUMT00000046934.1	-	0.00	147	0	G	NM_022487		14995953	-1	tier1	-	no_errors	ENST00000378278	ensembl	human	known	74_37	silent	5.62	84	5	SNP	1.000	A
DLG1	1739	genome.wustl.edu	37	3	196863514	196863514	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr3:196863514G>C	ENST00000419354.1	-	11	1304	c.1018C>G	c.(1018-1020)Cag>Gag	p.Q340E	DLG1_ENST00000392382.2_Missense_Mutation_p.Q307E|DLG1_ENST00000448528.2_Missense_Mutation_p.Q340E|DLG1_ENST00000357674.4_Missense_Mutation_p.Q307E|DLG1_ENST00000443183.1_Missense_Mutation_p.Q224E|DLG1_ENST00000346964.2_Missense_Mutation_p.Q340E|DLG1_ENST00000450955.1_Missense_Mutation_p.Q307E|DLG1_ENST00000452595.1_Missense_Mutation_p.Q224E|DLG1_ENST00000314062.3_Missense_Mutation_p.Q289E|DLG1_ENST00000422288.1_Missense_Mutation_p.Q289E			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	340	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		GGAATATGCTGATTTCCAACA	0.383																																																	0													149.0	136.0	140.0					3																	196863514		2203	4300	6503	SO:0001583	missense	0			U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.1018C>G	3.37:g.196863514G>C	ENSP00000407531:p.Gln340Glu		A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Missense_Mutation	SNP	pfam_GK/Ca_channel_bsu,pfam_PDZ,pfam_MAGUK_PEST_N,pfam_L27_1,pfam_PDZ_assoc,pfam_SH3_2,pfam_SH3_domain,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pirsf_M-assoc_guanylate_kinase,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.Q340E	ENST00000419354.1	37	c.1018	CCDS43194.1	3	.	.	.	.	.	.	.	.	.	.	G	16.71	3.197581	0.58126	.	.	ENSG00000075711	ENST00000346964;ENST00000359922;ENST00000357674;ENST00000381807;ENST00000314062;ENST00000419354;ENST00000452595;ENST00000422288;ENST00000448528;ENST00000443183;ENST00000392382;ENST00000450955;ENST00000447466	T;T;T;T;T;T;T;T;T;T;T	0.26660	1.72;1.72;1.72;1.72;1.72;1.72;1.72;1.72;1.72;1.72;1.72	5.41	5.41	0.78517	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.21509	0.0518	N	0.20986	0.625	0.80722	D	1	B;P;P;P;B;P;B	0.35944	0.188;0.529;0.518;0.518;0.288;0.474;0.288	B;B;B;B;B;B;B	0.37091	0.087;0.07;0.198;0.198;0.142;0.241;0.142	T	0.02698	-1.1122	10	0.29301	T	0.29	.	18.5365	0.91013	0.0:0.0:1.0:0.0	.	307;224;224;224;307;340;340	Q12959-4;E9PG21;E7EWL7;B4DGU1;Q12959-3;Q12959;Q12959-2	.;.;.;.;.;DLG1_HUMAN;.	E	340;340;307;340;289;340;224;289;340;224;307;307;149	ENSP00000345731:Q340E;ENSP00000350303:Q307E;ENSP00000321087:Q289E;ENSP00000407531:Q340E;ENSP00000398939:Q224E;ENSP00000413238:Q289E;ENSP00000391732:Q340E;ENSP00000396658:Q224E;ENSP00000376187:Q307E;ENSP00000411278:Q307E;ENSP00000398702:Q149E	ENSP00000321087:Q289E	Q	-	1	0	DLG1	198347911	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.394000	0.97261	2.695000	0.91970	0.655000	0.94253	CAG	DLG1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_M-assoc_guanylate_kinase,pfscan_PDZ	ENSG00000075711		0.383	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DLG1	HGNC	protein_coding	OTTHUMT00000258170.2	-	0.00	32	0	G	NM_004087		196863514	-1	tier1	-	no_errors	ENST00000346964	ensembl	human	known	74_37	missense	57.50	17	23	SNP	1.000	C
DNAJC1	64215	genome.wustl.edu	37	10	22209877	22209877	+	Silent	SNP	C	C	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr10:22209877C>A	ENST00000376980.3	-	4	677	c.387G>T	c.(385-387)ctG>ctT	p.L129L	DNAJC1_ENST00000376946.1_3'UTR	NM_022365.3	NP_071760.2	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	129	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				negative regulation of proteolysis (GO:0045861)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)|regulation of protein secretion (GO:0050708)|regulation of translation (GO:0006417)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.L129L(1)		cervix(1)|endometrium(1)|large_intestine(2)|lung(13)|skin(2)|upper_aerodigestive_tract(2)	21		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				GTCCATTGATCAGAATATCAT	0.353																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											74.0	76.0	75.0					10																	22209877		2203	4300	6503	SO:0001819	synonymous_variant	0			AK026062	CCDS7136.1	10p11.23	2011-09-02			ENSG00000136770	ENSG00000136770		"""Heat shock proteins / DNAJ (HSP40)"""	20090	protein-coding gene	gene with protein product		611207					Standard	NM_022365		Approved	DNAJL1, ERdj1, MTJ1	uc001irc.3	Q96KC8	OTTHUMG00000017800	ENST00000376980.3:c.387G>T	10.37:g.22209877C>A			B0YIZ8|Q5VX89|Q9H6B8	Silent	SNP	pfam_DnaJ_domain,pfam_SANT/Myb,superfamily_DnaJ_domain,superfamily_Homeodomain-like,smart_DnaJ_domain,smart_SANT/Myb,pfscan_Myb-like_dom,pfscan_DnaJ_domain,prints_DnaJ_domain	p.L129	ENST00000376980.3	37	c.387	CCDS7136.1	10																																																																																			DNAJC1	-	superfamily_DnaJ_domain,pfscan_DnaJ_domain	ENSG00000136770		0.353	DNAJC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC1	HGNC	protein_coding	OTTHUMT00000047149.1		0.00	35	0	C	NM_022365		22209877	-1			no_errors	ENST00000376980	ensembl	human	known	74_37	silent	6.90	27	2	SNP	1.000	A
EIF5B	9669	genome.wustl.edu	37	2	100006805	100006805	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr2:100006805C>G	ENST00000289371.6	+	16	2729	c.2527C>G	c.(2527-2529)Cag>Gag	p.Q843E		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	843	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AGAGTTAACTCAGACCATGTT	0.408																																					Colon(162;2388 2567 2705 3444)												0													146.0	135.0	138.0					2																	100006805		1951	4160	6111	SO:0001583	missense	0			AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.2527C>G	2.37:g.100006805C>G	ENSP00000289371:p.Gln843Glu		O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_TIF_IF2_dom3,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Transl_B-barrel,superfamily_TIF_IF2_dom3,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.Q843E	ENST00000289371.6	37	c.2527	CCDS42721.1	2	.	.	.	.	.	.	.	.	.	.	C	28.6	4.932854	0.92458	.	.	ENSG00000158417	ENST00000289371	T	0.76709	-1.04	5.64	5.64	0.86602	.	.	.	.	.	D	0.84279	0.5437	M	0.84156	2.68	0.80722	D	1	P	0.41366	0.747	P	0.45610	0.487	D	0.84072	0.0380	8	.	.	.	-19.5356	20.0625	0.97681	0.0:1.0:0.0:0.0	.	843	O60841	IF2P_HUMAN	E	843	ENSP00000289371:Q843E	.	Q	+	1	0	EIF5B	99373237	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.692000	0.84203	2.816000	0.96949	0.561000	0.74099	CAG	EIF5B	-	superfamily_P-loop_NTPase	ENSG00000158417		0.408	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF5B	HGNC	protein_coding	OTTHUMT00000330364.2	-	0.00	35	0	C	NM_015904		100006805	+1	tier1	-	no_errors	ENST00000289371	ensembl	human	known	74_37	missense	35.90	25	14	SNP	1.000	G
ENPP5	59084	genome.wustl.edu	37	6	46129397	46129397	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr6:46129397G>T	ENST00000371383.2	-	5	1360	c.1100C>A	c.(1099-1101)gCc>gAc	p.A367D	ENPP5_ENST00000230565.3_Missense_Mutation_p.A367D					ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative)											endometrium(3)|kidney(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	12						GGAGTTCATGGCTTCTTTTGA	0.438																																																	0													269.0	280.0	276.0					6																	46129397		2203	4300	6503	SO:0001583	missense	0			AL035701	CCDS4915.1	6p21.1-p11.2	2010-06-24	2010-06-24		ENSG00000112796	ENSG00000112796			13717	protein-coding gene	gene with protein product						11027689	Standard	XM_005249259		Approved		uc003oxz.1	Q9UJA9	OTTHUMG00000014781	ENST00000371383.2:c.1100C>A	6.37:g.46129397G>T	ENSP00000360436:p.Ala367Asp			Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.A367D	ENST00000371383.2	37	c.1100	CCDS4915.1	6	.	.	.	.	.	.	.	.	.	.	G	13.83	2.354582	0.41700	.	.	ENSG00000112796	ENST00000371383;ENST00000230565	T;T	0.75367	-0.93;-0.93	5.63	5.63	0.86233	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.329333	0.32736	N	0.005704	T	0.49762	0.1576	L	0.42245	1.32	0.34238	D	0.677273	B	0.16396	0.017	B	0.20184	0.028	T	0.55866	-0.8073	10	0.59425	D	0.04	-3.4327	5.1284	0.14897	0.0781:0.1447:0.6269:0.1503	.	367	Q9UJA9	ENPP5_HUMAN	D	367	ENSP00000360436:A367D;ENSP00000230565:A367D	ENSP00000230565:A367D	A	-	2	0	ENPP5	46237356	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	2.658000	0.46733	2.656000	0.90262	0.655000	0.94253	GCC	ENPP5	-	superfamily_Alkaline_phosphatase_core	ENSG00000112796		0.438	ENPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP5	HGNC	protein_coding	OTTHUMT00000040779.2		0.00	74	0	G			46129397	-1			no_errors	ENST00000230565	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
ZNF540	163255	genome.wustl.edu	37	19	38039758	38039758	+	5'Flank	SNP	G	G	A	rs563496614		TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr19:38039758G>A	ENST00000592533.1	+	0	0				ZNF571-AS1_ENST00000592575.1_RNA|ZNF571-AS1_ENST00000586013.1_RNA|ZNF571-AS1_ENST00000587121.1_RNA|ZNF571-AS1_ENST00000589802.1_RNA|CTD-3064H18.4_ENST00000316807.2_RNA|ZNF571-AS1_ENST00000589750.1_RNA|ZNF571-AS1_ENST00000591430.1_RNA|ZNF571-AS1_ENST00000592392.1_RNA|ZNF571-AS1_ENST00000586139.1_RNA|ZNF571-AS1_ENST00000585578.1_RNA|ZNF571-AS1_ENST00000590838.1_RNA|ZNF571-AS1_ENST00000588382.1_RNA	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540						negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TACCAGGCGCGATCACCAGGC	0.672																																																	0																																										SO:0001631	upstream_gene_variant	0			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6			19.37:g.38039758G>A	Exception_encountered		A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	RNA	SNP	-	NULL	ENST00000592533.1	37	NULL	CCDS12506.1	19	.	.	.	.	.	.	.	.	.	.	G	1.089	-0.664692	0.03428	.	.	ENSG00000180458	ENST00000316807	.	.	.	0.158	0.158	0.14942	.	.	.	.	.	T	0.53029	0.1771	.	.	.	.	.	.	.	.	.	.	.	.	T	0.62364	-0.6870	3	0.87932	D	0	.	.	.	.	.	.	.	.	C	82	.	ENSP00000324876:R82C	R	-	1	0	AC022148.1	42731598	0.024000	0.19004	0.032000	0.17829	0.033000	0.12548	0.228000	0.17814	0.202000	0.20498	0.205000	0.17691	CGC	CTD-3064H18.4	-	-	ENSG00000180458		0.672	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000180458	Clone_based_vega_gene	protein_coding	OTTHUMT00000459481.1	-	0.00	57	0	G	NM_152606		38039758	-1	tier1	-	no_errors	ENST00000316807	ensembl	human	known	74_37	rna	10.87	41	5	SNP	0.035	A
AP001482.1	0	genome.wustl.edu	37	11	88845967	88845970	+	RNA	DEL	ATAT	ATAT	-	rs10609035|rs376991850|rs7113863|rs371137229		TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	ATAT	ATAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr11:88845967_88845970delATAT	ENST00000408203.1	+	0	90_93																											acatacatacatatatatatatat	0.225																																																	0																																												0																															11.37:g.88845975_88845978delATAT				RNA	DEL	-	NULL	ENST00000408203.1	37	NULL		11																																																																																			AP001482.1	-	-	ENSG00000221130		0.225	AP001482.1-201	NOVEL	basic	miRNA	ENSG00000221130	Clone_based_ensembl_gene	miRNA			0.00	8	0	ATAT			88845970	+1	tier1		no_errors	ENST00000408203	ensembl	human	novel	74_37	rna	42.86	4	3	DEL	0.024:0.026:0.027:0.034	-
EPHB1	2047	genome.wustl.edu	37	3	134967332	134967332	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr3:134967332G>T	ENST00000398015.3	+	14	3041	c.2671G>T	c.(2671-2673)Gtg>Ttg	p.V891L	EPHB1_ENST00000493838.1_Missense_Mutation_p.V452L	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	891					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						TCTCAAGACTGTGGCAACCAT	0.552																																																	0													19.0	23.0	22.0					3																	134967332		2155	4287	6442	SO:0001583	missense	0			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.2671G>T	3.37:g.134967332G>T	ENSP00000381097:p.Val891Leu		A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.V891L	ENST00000398015.3	37	c.2671	CCDS46921.1	3	.	.	.	.	.	.	.	.	.	.	G	10.22	1.291259	0.23564	.	.	ENSG00000154928	ENST00000398015;ENST00000493838	T;T	0.61392	0.11;0.11	5.65	2.83	0.33086	Protein kinase-like domain (1);	0.283956	0.32578	N	0.005916	T	0.33731	0.0873	N	0.20445	0.575	0.58432	D	0.999999	B	0.17038	0.02	B	0.12156	0.007	T	0.18085	-1.0348	10	0.02654	T	1	.	9.2402	0.37491	0.1343:0.1287:0.737:0.0	.	891	P54762	EPHB1_HUMAN	L	891;452	ENSP00000381097:V891L;ENSP00000419574:V452L	ENSP00000381097:V891L	V	+	1	0	EPHB1	136450022	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.300000	0.51834	0.919000	0.36945	-0.140000	0.14226	GTG	EPHB1	-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_Kinase-like_dom	ENSG00000154928		0.552	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB1	HGNC	protein_coding	OTTHUMT00000357671.1	-	0.00	57	0	G	NM_004441		134967332	+1	tier1	-	no_errors	ENST00000398015	ensembl	human	known	74_37	missense	6.10	77	5	SNP	1.000	T
ESPL1	9700	genome.wustl.edu	37	12	53663505	53663505	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr12:53663505G>A	ENST00000257934.4	+	3	870	c.779G>A	c.(778-780)cGt>cAt	p.R260H	ESPL1_ENST00000552462.1_Missense_Mutation_p.R260H	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	260					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						GAACACTGCCGTCGCTTTTGC	0.572																																					Colon(53;1069 1201 2587 5382)												0													67.0	67.0	67.0					12																	53663505		2203	4300	6503	SO:0001583	missense	0			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.779G>A	12.37:g.53663505G>A	ENSP00000257934:p.Arg260His			Missense_Mutation	SNP	pfam_Peptidase_C50,superfamily_DsrEFH-like	p.R260H	ENST00000257934.4	37	c.779	CCDS8852.1	12	.	.	.	.	.	.	.	.	.	.	G	23.5	4.429533	0.83776	.	.	ENSG00000135476	ENST00000257934;ENST00000552462	T;T	0.15256	2.44;2.44	5.41	4.5	0.54988	.	0.131175	0.50627	D	0.000102	T	0.36663	0.0975	M	0.72118	2.19	0.37632	D	0.921717	D	0.89917	1.0	D	0.63283	0.913	T	0.18116	-1.0347	9	.	.	.	.	13.5552	0.61756	0.0776:0.0:0.9224:0.0	.	260	Q14674	ESPL1_HUMAN	H	260	ENSP00000257934:R260H;ENSP00000449831:R260H	.	R	+	2	0	ESPL1	51949772	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	4.064000	0.57506	2.815000	0.96918	0.561000	0.74099	CGT	ESPL1	-	NULL	ENSG00000135476		0.572	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPL1	HGNC	protein_coding	OTTHUMT00000406899.2	-	0.00	36	0	G	NM_012291		53663505	+1	tier1	-	no_errors	ENST00000257934	ensembl	human	known	74_37	missense	17.24	24	5	SNP	0.997	A
FAM167B	84734	genome.wustl.edu	37	1	32713177	32713177	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr1:32713177G>T	ENST00000373582.3	+	1	344	c.155G>T	c.(154-156)aGc>aTc	p.S52I		NM_032648.2	NP_116037.2	Q9BTA0	F167B_HUMAN	family with sequence similarity 167, member B	52										endometrium(1)|large_intestine(1)|lung(1)|ovary(2)	5						CAGGTCCAGAGCCAGGCCTGG	0.647																																																	0													33.0	41.0	39.0					1																	32713177		1944	4123	6067	SO:0001583	missense	0			BC004269	CCDS358.2	1p35.1	2010-08-27	2008-06-11	2008-06-11	ENSG00000183615	ENSG00000183615			28133	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 90"""	C1orf90		12477932	Standard	NM_032648		Approved	MGC10820	uc001buw.3	Q9BTA0	OTTHUMG00000007462	ENST00000373582.3:c.155G>T	1.37:g.32713177G>T	ENSP00000362684:p.Ser52Ile		Q5TDH6	Missense_Mutation	SNP	pfam_FAM167	p.S52I	ENST00000373582.3	37	c.155	CCDS358.2	1	.	.	.	.	.	.	.	.	.	.	g	15.65	2.896882	0.52121	.	.	ENSG00000183615	ENST00000373582	T	0.61627	0.09	5.32	4.41	0.53225	.	0.592403	0.15527	U	0.257740	T	0.58509	0.2127	L	0.54323	1.7	0.38323	D	0.943598	P	0.39216	0.664	B	0.42462	0.388	T	0.63189	-0.6693	10	0.49607	T	0.09	-12.4534	13.9856	0.64334	0.0744:0.0:0.9256:0.0	.	52	Q9BTA0	F167B_HUMAN	I	52	ENSP00000362684:S52I	ENSP00000362684:S52I	S	+	2	0	FAM167B	32485764	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	3.548000	0.53670	1.391000	0.46566	-0.258000	0.10820	AGC	FAM167B	-	NULL	ENSG00000183615		0.647	FAM167B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM167B	HGNC	protein_coding	OTTHUMT00000019615.2		0.00	49	0	G	NM_032648		32713177	+1			no_errors	ENST00000373582	ensembl	human	known	74_37	missense	7.89	35	3	SNP	1.000	T
FBXL20	84961	genome.wustl.edu	37	17	37437666	37437666	+	Silent	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr17:37437666C>T	ENST00000264658.6	-	9	932	c.672G>A	c.(670-672)gtG>gtA	p.V224V	FBXL20_ENST00000394294.3_Silent_p.V192V|FBXL20_ENST00000577399.1_Silent_p.V226V|FBXL20_ENST00000583610.1_Silent_p.V224V	NM_032875.2	NP_116264.2	Q96IG2	FXL20_HUMAN	F-box and leucine-rich repeat protein 20	224					behavioral fear response (GO:0001662)	cytoplasm (GO:0005737)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22			LUAD - Lung adenocarcinoma(14;0.146)			AGTTCAAAGTCACCAGTTCAG	0.333																																																	0													98.0	96.0	97.0					17																	37437666		2203	4300	6503	SO:0001819	synonymous_variant	0			BC007557	CCDS32640.1, CCDS54116.1	17q21.2	2011-06-09				ENSG00000108306		"""F-boxes / Leucine-rich repeats"""	24679	protein-coding gene	gene with protein product		609086				12477932	Standard	NM_032875		Approved	MGC15482, Fbl2, Fbl20	uc002hrt.3	Q96IG2		ENST00000264658.6:c.672G>A	17.37:g.37437666C>T			A8K729|Q38J52	Silent	SNP	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom	p.V224	ENST00000264658.6	37	c.672	CCDS32640.1	17																																																																																			FBXL20	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000108306		0.333	FBXL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL20	HGNC	protein_coding	OTTHUMT00000444315.2	-	0.00	20	0	C	NM_032875		37437666	-1	tier1	-	no_errors	ENST00000264658	ensembl	human	known	74_37	silent	27.27	16	6	SNP	1.000	T
FBXL8	55336	genome.wustl.edu	37	16	67197703	67197703	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr16:67197703A>G	ENST00000258200.3	+	3	1282	c.1105A>G	c.(1105-1107)Agg>Ggg	p.R369G	HSF4_ENST00000584272.1_5'Flank|RP11-5A19.5_ENST00000518227.1_Silent_p.G31G|HSF4_ENST00000421453.1_5'UTR|FBXL8_ENST00000519917.1_Missense_Mutation_p.R369G|HSF4_ENST00000264009.8_5'UTR|HSF4_ENST00000521374.1_5'Flank			Q96CD0	FBXL8_HUMAN	F-box and leucine-rich repeat protein 8	369										endometrium(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0144)|Epithelial(162;0.0338)|all cancers(182;0.185)		GCATCCCTGGAGGCCTACGCT	0.697																																																	0													23.0	26.0	25.0					16																	67197703		2185	4283	6468	SO:0001583	missense	0			AK002140	CCDS10831.1	16q22.1-q22.3	2013-01-22			ENSG00000135722	ENSG00000135722		"""F-boxes / Leucine-rich repeats"""	17875	protein-coding gene	gene with protein product		609077					Standard	NM_018378		Approved	Fbl8	uc002erk.1	Q96CD0	OTTHUMG00000137514	ENST00000258200.3:c.1105A>G	16.37:g.67197703A>G	ENSP00000258200:p.Arg369Gly		Q9NUM0	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.R369G	ENST00000258200.3	37	c.1105	CCDS10831.1	16	.	.	.	.	.	.	.	.	.	.	A	8.307	0.821294	0.16678	.	.	ENSG00000135722	ENST00000258200;ENST00000519917	.	.	.	4.23	0.917	0.19380	.	0.362265	0.19065	N	0.123679	T	0.48333	0.1494	L	0.50333	1.59	0.80722	D	1	B	0.31100	0.308	B	0.26517	0.07	T	0.51872	-0.8650	9	0.59425	D	0.04	-7.9042	12.4222	0.55525	0.6502:0.3497:0.0:0.0	.	369	Q96CD0	FBXL8_HUMAN	G	369	.	ENSP00000258200:R369G	R	+	1	2	FBXL8	65755204	0.995000	0.38212	1.000000	0.80357	0.149000	0.21700	0.706000	0.25690	0.416000	0.25844	-0.384000	0.06662	AGG	FBXL8	-	NULL	ENSG00000135722		0.697	FBXL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL8	HGNC	protein_coding	OTTHUMT00000268834.2		0.00	30	0	A			67197703	+1			no_errors	ENST00000258200	ensembl	human	known	74_37	missense	9.09	20	2	SNP	0.995	G
FCGR2B	2213	genome.wustl.edu	37	1	161641285	161641285	+	Silent	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr1:161641285C>T	ENST00000358671.5	+	3	318	c.237C>T	c.(235-237)agC>agT	p.S79S	FCGR2B_ENST00000367962.4_Silent_p.S79S|FCGR2B_ENST00000428605.2_Silent_p.S79S|FCGR2B_ENST00000367960.5_Silent_p.S72S|RP11-25K21.1_ENST00000453111.1_RNA|FCGR2B_ENST00000403078.3_Silent_p.S79S|FCGR2B_ENST00000367961.4_Silent_p.S72S|FCGR2B_ENST00000236937.9_Silent_p.S79S	NM_001002275.2|NM_004001.4	NP_001002275.1|NP_003992.3	P31994	FCG2B_HUMAN	Fc fragment of IgG, low affinity IIb, receptor (CD32)	79	Ig-like C2-type 1.				immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)						all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Antithymocyte globulin(DB00098)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	GCCCTGAGAGCGACTCCATTC	0.577			T	?	ALL																																			Dom	yes		1	1q23	2213	"""Fc fragment of IgG, low affinity IIb, receptor for (CD32)"""		L	0													110.0	109.0	110.0					1																	161641285		2203	4300	6503	SO:0001819	synonymous_variant	0			BC031992	CCDS30924.1, CCDS30925.1, CCDS53414.1	1q23	2013-01-11	2005-02-02		ENSG00000072694	ENSG00000072694		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3618	protein-coding gene	gene with protein product		604590	"""Fc fragment of IgG, low affinity IIb, receptor for (CD32)"""	FCG2, FCGR2		2139735	Standard	NM_004001		Approved	CD32, CD32B	uc001gaz.2	P31994	OTTHUMG00000034470	ENST00000358671.5:c.237C>T	1.37:g.161641285C>T			A6H8N3|O95649|Q53X85|Q5VXA9|Q8NIA1	Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S79	ENST00000358671.5	37	c.237	CCDS30924.1	1																																																																																			FCGR2B	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000072694		0.577	FCGR2B-002	KNOWN	basic|CCDS	protein_coding	FCGR2B	HGNC	protein_coding	OTTHUMT00000083337.4	-	0.00	140	0	C	NM_004001		161641285	+1	tier1	-	no_errors	ENST00000358671	ensembl	human	known	74_37	silent	17.95	95	21	SNP	0.000	T
FMO1	2326	genome.wustl.edu	37	1	171252321	171252321	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr1:171252321G>T	ENST00000354841.4	+	7	1353	c.1222G>T	c.(1222-1224)Gaa>Taa	p.E408*	FMO1_ENST00000367750.3_Nonsense_Mutation_p.E408*|FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000402921.2_Nonsense_Mutation_p.E345*	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	408					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	CATGATAGAGGAAATTAATGC	0.303																																																	0													123.0	121.0	122.0					1																	171252321		2203	4300	6503	SO:0001587	stop_gained	0			M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.1222G>T	1.37:g.171252321G>T	ENSP00000346901:p.Glu408*		A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Nonsense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.E408*	ENST00000354841.4	37	c.1222	CCDS1294.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.139273	0.97320	.	.	ENSG00000010932	ENST00000367750;ENST00000402921;ENST00000354841	.	.	.	5.5	5.5	0.81552	.	0.055507	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-11.2566	18.1965	0.89823	0.0:0.0:1.0:0.0	.	.	.	.	X	408;345;408	.	ENSP00000346901:E408X	E	+	1	0	FMO1	169518945	1.000000	0.71417	0.906000	0.35671	0.913000	0.54294	5.773000	0.68898	2.584000	0.87258	0.563000	0.77884	GAA	FMO1	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase_2	ENSG00000010932		0.303	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO1	HGNC	protein_coding	OTTHUMT00000086212.1		0.00	48	0	G	NM_002021		171252321	+1			no_errors	ENST00000354841	ensembl	human	known	74_37	nonsense	5.45	52	3	SNP	0.991	T
FOXD4L5	653427	genome.wustl.edu	37	9	70177178	70177178	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr9:70177178C>T	ENST00000377420.1	-	1	1637	c.806G>A	c.(805-807)cGc>cAc	p.R269H		NM_001126334.1	NP_001119806.1	Q5VV16	FX4L5_HUMAN	forkhead box D4-like 5	269					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|lung(2)	7						CAGTAGGTAGCGAAGAGGATG	0.711																																																	0													1.0	2.0	2.0					9																	70177178		129	489	618	SO:0001583	missense	0				CCDS47977.1	9q13	2008-07-21			ENSG00000204779	ENSG00000204779			18522	protein-coding gene	gene with protein product						12234674	Standard	NM_001126334		Approved	bA15J10.2, OTTHUMG00000013332	uc010moc.3	Q5VV16	OTTHUMG00000013332	ENST00000377420.1:c.806G>A	9.37:g.70177178C>T	ENSP00000366637:p.Arg269His			Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.R269H	ENST00000377420.1	37	c.806	CCDS47977.1	9	.	.	.	.	.	.	.	.	.	.	c	15.32	2.800106	0.50208	.	.	ENSG00000204779	ENST00000377420	D	0.94280	-3.39	1.07	1.07	0.20283	.	0.187499	0.25475	U	0.030414	D	0.91841	0.7418	L	0.36672	1.1	0.23943	N	0.9964	D	0.65815	0.995	P	0.58520	0.84	D	0.84445	0.0585	10	0.59425	D	0.04	.	7.6881	0.28552	0.0:1.0:0.0:0.0	.	269	Q5VV16	FX4L5_HUMAN	H	269	ENSP00000366637:R269H	ENSP00000366637:R269H	R	-	2	0	FOXD4L5	69466998	0.000000	0.05858	0.869000	0.34112	0.265000	0.26407	-0.814000	0.04486	0.534000	0.28695	0.074000	0.15403	CGC	FOXD4L5	-	NULL	ENSG00000204779		0.711	FOXD4L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD4L5	HGNC	protein_coding	OTTHUMT00000037122.1	-	0.00	81	0	C	NM_001126334		70177178	-1	tier1	-	no_errors	ENST00000377420	ensembl	human	known	74_37	missense	11.36	39	5	SNP	0.974	T
FUT10	84750	genome.wustl.edu	37	8	33318933	33318933	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr8:33318933C>T	ENST00000327671.5	-	2	669	c.38G>A	c.(37-39)tGc>tAc	p.C13Y	FUT10_ENST00000518672.1_Intron|FUT10_ENST00000524021.1_5'UTR|FUT10_ENST00000335589.3_5'UTR	NM_032664.3	NP_116053.3	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10 (alpha (1,3) fucosyltransferase)	13					embryo development (GO:0009790)|fertilization (GO:0009566)|fucosylation (GO:0036065)|hemopoiesis (GO:0030097)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein folding (GO:0006457)|protein glycosylation (GO:0006486)|protein targeting (GO:0006605)|wound healing (GO:0042060)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)			cervix(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	29				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		GACGCACAGGCAAGATGCCAA	0.557																																																	0													199.0	142.0	161.0					8																	33318933		2203	4300	6503	SO:0001583	missense	0			AJ512465	CCDS6088.1	8p12	2013-02-26			ENSG00000172728	ENSG00000172728		"""Fucosyltransferases"""	19234	protein-coding gene	gene with protein product							Standard	NM_032664		Approved		uc003xje.3	Q6P4F1	OTTHUMG00000163954	ENST00000327671.5:c.38G>A	8.37:g.33318933C>T	ENSP00000332757:p.Cys13Tyr		A8KAC8|Q70GG3|Q8IVI6|Q8IVI7|Q8IVJ3|Q8TE43|Q9BSR3	Missense_Mutation	SNP	pfam_Glyco_trans_10,pirsf_Alpha-1_3-FUT_met	p.C13Y	ENST00000327671.5	37	c.38	CCDS6088.1	8	.	.	.	.	.	.	.	.	.	.	C	19.05	3.750931	0.69533	.	.	ENSG00000172728	ENST00000327671;ENST00000380081	T	0.23147	1.92	5.79	4.89	0.63831	.	2.451770	0.01201	N	0.007599	T	0.44726	0.1307	M	0.69823	2.125	0.80722	D	1	P;P;P	0.46277	0.875;0.785;0.82	B;B;P	0.48425	0.274;0.441;0.577	T	0.35425	-0.9789	10	0.51188	T	0.08	0.1845	12.413	0.55478	0.1664:0.8336:0.0:0.0	.	13;13;13	B4DLS4;Q6P4F1-5;Q6P4F1	.;.;FUT10_HUMAN	Y	13	ENSP00000332757:C13Y	ENSP00000332757:C13Y	C	-	2	0	FUT10	33438475	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	1.515000	0.35845	2.771000	0.95319	0.644000	0.83932	TGC	FUT10	-	pfam_Glyco_trans_10,pirsf_Alpha-1_3-FUT_met	ENSG00000172728		0.557	FUT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT10	HGNC	protein_coding	OTTHUMT00000376540.1		0.00	23	0	C	NM_032664		33318933	-1			no_errors	ENST00000327671	ensembl	human	known	74_37	missense	8.33	22	2	SNP	1.000	T
FZD1	8321	genome.wustl.edu	37	7	90895458	90895459	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr7:90895458_90895459insA	ENST00000287934.2	+	1	1676_1677	c.1263_1264insA	c.(1264-1266)atcfs	p.I422fs		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	422					autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			TCTGGTGGGTGATCCTGTCGCT	0.614																																																	0																																										SO:0001589	frameshift_variant	0			AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.1264dupA	7.37:g.90895459_90895459dupA	ENSP00000287934:p.Ile422fs		A4D1E8|O94815|Q549T8	Frame_Shift_Ins	INS	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.I421fs	ENST00000287934.2	37	c.1263_1264	CCDS5620.1	7																																																																																			FZD1	-	pfam_Frizzled,pfscan_GPCR_2-like,prints_Frizzled	ENSG00000157240		0.614	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD1	HGNC	protein_coding	OTTHUMT00000059367.2		0.00	82	0	-	NM_003505		90895459	+1	tier1		no_errors	ENST00000287934	ensembl	human	known	74_37	frame_shift_ins	31.75	43	20	INS	1.000:1.000	A
FZD7	8324	genome.wustl.edu	37	2	202900692	202900692	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr2:202900692T>A	ENST00000286201.1	+	1	1383	c.1322T>A	c.(1321-1323)cTg>cAg	p.L441Q	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	441					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						TCCTTCTTGCTGGCCGGCTTC	0.612											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													109.0	87.0	94.0					2																	202900692		2203	4300	6503	SO:0001583	missense	0			AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.1322T>A	2.37:g.202900692T>A	ENSP00000286201:p.Leu441Gln	2133	O94816|Q53S59|Q96B74	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.L441Q	ENST00000286201.1	37	c.1322	CCDS2351.1	2	.	.	.	.	.	.	.	.	.	.	T	21.3	4.132423	0.77662	.	.	ENSG00000155760	ENST00000286201	D	0.84800	-1.9	5.53	5.53	0.82687	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000003	D	0.94228	0.8147	M	0.93720	3.45	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	D	0.95609	0.8670	10	0.87932	D	0	.	15.6714	0.77279	0.0:0.0:0.0:1.0	.	441	O75084	FZD7_HUMAN	Q	441	ENSP00000286201:L441Q	ENSP00000286201:L441Q	L	+	2	0	FZD7	202608937	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.029000	0.88807	2.116000	0.64780	0.459000	0.35465	CTG	FZD7	-	pfam_Frizzled,pfscan_GPCR_2-like,prints_Frizzled	ENSG00000155760		0.612	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD7	HGNC	protein_coding	OTTHUMT00000256314.1	-	0.00	81	0	T	NM_003507		202900692	+1	tier1	-	no_errors	ENST00000286201	ensembl	human	known	74_37	missense	15.15	56	10	SNP	1.000	A
GALNT2	2590	genome.wustl.edu	37	1	230410227	230410227	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr1:230410227A>T	ENST00000366672.4	+	15	1549	c.1477A>T	c.(1477-1479)Atg>Ttg	p.M493L	GALNT2_ENST00000543760.1_Missense_Mutation_p.M455L|GALNT2_ENST00000541865.1_3'UTR|GALNT2_ENST00000485438.1_3'UTR	NM_004481.3	NP_004472.1	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	493	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|immunoglobulin biosynthetic process (GO:0002378)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(5)|skin(2)	32	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				GGTGAAGCACATGGATTTGTG	0.557																																																	0													104.0	104.0	104.0					1																	230410227		2203	4300	6503	SO:0001583	missense	0			BC041120	CCDS1582.1	1q41-q42	2014-03-13	2014-03-13		ENSG00000143641	ENSG00000143641	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4124	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 2"""	602274	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)"""			9592121, 7592619	Standard	NM_004481		Approved	GalNAc-T2	uc010pwa.1	Q10471	OTTHUMG00000037771	ENST00000366672.4:c.1477A>T	1.37:g.230410227A>T	ENSP00000355632:p.Met493Leu		A8K1Y3|B7Z8V8|C5HU00|Q9NPY4	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.M493L	ENST00000366672.4	37	c.1477	CCDS1582.1	1	.	.	.	.	.	.	.	.	.	.	A	5.085	0.201352	0.09652	.	.	ENSG00000143641	ENST00000543760;ENST00000366672	T;T	0.25749	1.78;1.78	5.63	4.47	0.54385	Ricin B-related lectin (1);Ricin B lectin (3);	0.141320	0.85682	N	0.000000	T	0.09423	0.0232	N	0.00873	-1.125	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.10042	-1.0647	10	0.46703	T	0.11	.	12.7308	0.57197	0.8626:0.1374:0.0:0.0	.	493;455	Q10471;G3V1S6	GALT2_HUMAN;.	L	455;493	ENSP00000445017:M455L;ENSP00000355632:M493L	ENSP00000355632:M493L	M	+	1	0	GALNT2	228476850	1.000000	0.71417	1.000000	0.80357	0.008000	0.06430	9.216000	0.95154	0.934000	0.37316	0.454000	0.30748	ATG	GALNT2	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000143641		0.557	GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT2	HGNC	protein_coding	OTTHUMT00000092158.1	-	0.00	74	0	A	NM_004481		230410227	+1	tier1	-	no_errors	ENST00000366672	ensembl	human	known	74_37	missense	15.19	67	12	SNP	1.000	T
GOLGA8T	653075	genome.wustl.edu	37	15	30437064	30437064	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr15:30437064G>A	ENST00000569052.1	+	16	1451	c.1451G>A	c.(1450-1452)cGa>cAa	p.R484Q	AC120045.2_ENST00000408858.1_RNA|RN7SL469P_ENST00000491512.2_RNA					golgin A8 family, member T																		CACCACTGGCGAGACAGACGC	0.602																																																	0																																										SO:0001583	missense	0					15q13.2	2013-01-17			ENSG00000261247	ENSG00000261247			44410	other	unknown							Standard	NR_033933		Approved		uc021sha.1		OTTHUMG00000175638	ENST00000569052.1:c.1451G>A	15.37:g.30437064G>A	ENSP00000455826:p.Arg484Gln			Missense_Mutation	SNP	NULL	p.R484Q	ENST00000569052.1	37	c.1451		15																																																																																			GOLGA8T	-	NULL	ENSG00000261247		0.602	GOLGA8T-001	NOVEL	basic|appris_principal	protein_coding	GOLGA8T	HGNC	protein_coding	OTTHUMT00000430690.1	-	0.00	140	0	G	NR_033933		30437064	+1	tier1	-	no_errors	ENST00000569052	ensembl	human	novel	74_37	missense	20.00	60	15	SNP	1.000	A
GOLPH3	64083	genome.wustl.edu	37	5	32143866	32143866	+	Silent	SNP	A	A	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr5:32143866A>G	ENST00000265070.6	-	2	661	c.346T>C	c.(346-348)Tta>Cta	p.L116L	GOLPH3_ENST00000512668.1_Intron	NM_022130.3	NP_071413.1	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3 (coat-protein)	116					cell adhesion molecule production (GO:0060352)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|gene expression (GO:0010467)|glycoprotein biosynthetic process (GO:0009101)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|Golgi vesicle budding (GO:0048194)|lamellipodium assembly (GO:0030032)|leukocyte tethering or rolling (GO:0050901)|positive regulation of protein secretion (GO:0050714)|positive regulation of TOR signaling (GO:0032008)|protein retention in Golgi apparatus (GO:0045053)|protein secretion (GO:0009306)|regulation of mitochondrion organization (GO:0010821)	cytosol (GO:0005829)|endosome (GO:0005768)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|phosphatidylinositol-4-phosphate binding (GO:0070273)			kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11						TTTCTTGTTAATAGACTTTTA	0.343																																																	0													138.0	147.0	144.0					5																	32143866		2203	4300	6503	SO:0001819	synonymous_variant	0			AK075156	CCDS3896.1	5p13.2	2008-07-18			ENSG00000113384	ENSG00000113384			15452	protein-coding gene	gene with protein product	"""golgi peripheral membrane protein 1, 34 kDa"", ""golgi protein"", ""coat-protein"", ""golgi-associated protein"""	612207				11042173, 16263763	Standard	NM_022130		Approved	GPP34, GOPP1, MIDAS	uc003jhp.1	Q9H4A6	OTTHUMG00000090679	ENST00000265070.6:c.346T>C	5.37:g.32143866A>G			Q9UIW5	Silent	SNP	pfam_GPP34	p.L116	ENST00000265070.6	37	c.346	CCDS3896.1	5																																																																																			GOLPH3	-	pfam_GPP34	ENSG00000113384		0.343	GOLPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLPH3	HGNC	protein_coding	OTTHUMT00000207363.2	-	0.00	38	0	A	NM_022130		32143866	-1	tier1	-	no_errors	ENST00000265070	ensembl	human	known	74_37	silent	12.50	42	6	SNP	0.990	G
GPATCH8	23131	genome.wustl.edu	37	17	42552208	42552208	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr17:42552208G>T	ENST00000591680.1	-	2	139	c.109C>A	c.(109-111)Cct>Act	p.P37T	GPATCH8_ENST00000592154.1_Missense_Mutation_p.P37T|GPATCH8_ENST00000434000.1_5'UTR|GPATCH8_ENST00000588554.1_Missense_Mutation_p.P37T	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	37							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		GATTCTATAGGCTTGTCAAGT	0.363																																																	0													107.0	85.0	92.0					17																	42552208		2202	4299	6501	SO:0001583	missense	0			AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.109C>A	17.37:g.42552208G>T	ENSP00000467556:p.Pro37Thr		B9EGP9|O60300|Q8TB99	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_Znf_C2H2_jaz,smart_G_patch_dom,pfscan_Znf_C2H2,pfscan_G_patch_dom	p.P37T	ENST00000591680.1	37	c.109	CCDS32666.1	17	.	.	.	.	.	.	.	.	.	.	G	21.2	4.120918	0.77436	.	.	ENSG00000186566	ENST00000335500;ENST00000541307	.	.	.	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000005	T	0.68035	0.2957	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.69537	-0.5119	9	0.72032	D	0.01	-14.575	20.193	0.98233	0.0:0.0:1.0:0.0	.	37	Q9UKJ3	GPTC8_HUMAN	T	37	.	ENSP00000335486:P37T	P	-	1	0	GPATCH8	39907734	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.706000	0.98722	2.941000	0.99782	0.655000	0.94253	CCT	GPATCH8	-	NULL	ENSG00000186566		0.363	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH8	HGNC	protein_coding	OTTHUMT00000457797.1	-	0.00	54	0	G	NM_001002909		42552208	-1	tier1	-	no_errors	ENST00000591680	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
GPI	2821	genome.wustl.edu	37	19	34890655	34890655	+	Silent	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr19:34890655C>T	ENST00000356487.5	+	17	1747	c.1506C>T	c.(1504-1506)ggC>ggT	p.G502G	RP11-618P17.4_ENST00000606020.1_5'Flank|GPI_ENST00000415930.3_Silent_p.G513G|GPI_ENST00000586425.1_Intron	NM_000175.3	NP_000166.2	P06744	G6PI_HUMAN	glucose-6-phosphate isomerase	502					aldehyde catabolic process (GO:0046185)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|hemostasis (GO:0007599)|humoral immune response (GO:0006959)|learning or memory (GO:0007611)|methylglyoxal biosynthetic process (GO:0019242)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucose-6-phosphate isomerase activity (GO:0004347)|intramolecular transferase activity (GO:0016866)|monosaccharide binding (GO:0048029)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	25	Esophageal squamous(110;0.162)					TCGTTCAGGGCATCATCTGGG	0.547																																																	0													113.0	105.0	107.0					19																	34890655		2203	4300	6503	SO:0001819	synonymous_variant	0			M61214	CCDS12437.1, CCDS54246.1	19q13.1	2012-10-02	2010-05-11			ENSG00000105220	5.3.1.9		4458	protein-coding gene	gene with protein product		172400	"""glucose phosphate isomerase"""			2387591, 8575767	Standard	NM_001184722		Approved	AMF, NLK	uc002nvg.2	P06744		ENST00000356487.5:c.1506C>T	19.37:g.34890655C>T			B4DG39|Q9BRD3|Q9BSK5|Q9UHE6	Silent	SNP	pfam_G6P_Isomerase,prints_G6P_Isomerase	p.G513	ENST00000356487.5	37	c.1539	CCDS12437.1	19																																																																																			GPI	-	pfam_G6P_Isomerase,prints_G6P_Isomerase	ENSG00000105220		0.547	GPI-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPI	HGNC	protein_coding	OTTHUMT00000451693.3	-	0.00	85	0	C			34890655	+1	tier1	-	no_errors	ENST00000415930	ensembl	human	known	74_37	silent	29.76	59	25	SNP	0.900	T
IGLL5	100423062	genome.wustl.edu	37	22	23235889	23235889	+	Silent	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr22:23235889C>T	ENST00000526893.1	+	2	490	c.216C>T	c.(214-216)ctC>ctT	p.L72L	IGLL5_ENST00000531372.1_Intron|IGLL5_ENST00000532223.2_Silent_p.L73L|IGLC1_ENST00000390321.2_RNA|IGLJ1_ENST00000390320.2_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	72						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GGCTCCTGCTCCAGCCCAGCC	0.657																																																	0													38.0	43.0	42.0					22																	23235889		691	1590	2281	SO:0001819	synonymous_variant	0			M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.216C>T	22.37:g.23235889C>T				Silent	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like_dom	p.L73	ENST00000526893.1	37	c.219	CCDS54506.1	22																																																																																			IGLL5	-	NULL	ENSG00000254709		0.657	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	IGLL5	HGNC	protein_coding	OTTHUMT00000385699.1	-	0.00	50	0	C	NM_001178126		23235889	+1	tier1	-	no_errors	ENST00000532223	ensembl	human	known	74_37	silent	14.81	46	8	SNP	0.000	T
IQCE	23288	genome.wustl.edu	37	7	2645633	2645633	+	Splice_Site	SNP	T	T	C			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr7:2645633T>C	ENST00000402050.2	+	20	2049		c.e20+2		IQCE_ENST00000438376.2_Splice_Site|IQCE_ENST00000325979.7_Splice_Site|IQCE_ENST00000404984.1_Splice_Site	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E							mitochondrion (GO:0005739)		p.?(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		CAGGCACAGGTGAGTCAGGGT	0.697																																																	1	Unknown(1)	kidney(1)											27.0	33.0	31.0					7																	2645633		2119	4241	6360	SO:0001630	splice_region_variant	0			AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.1865+2T>C	7.37:g.2645633T>C			Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Splice_Site	SNP	-	e20+2	ENST00000402050.2	37	c.1865+2	CCDS43542.1	7	.	.	.	.	.	.	.	.	.	.	T	13.83	2.354582	0.41700	.	.	ENSG00000106012	ENST00000402050;ENST00000404984;ENST00000438376;ENST00000325979;ENST00000423196	.	.	.	4.52	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5193	0.44910	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	IQCE	2612159	1.000000	0.71417	0.822000	0.32727	0.440000	0.31957	3.588000	0.53964	1.805000	0.52779	0.459000	0.35465	.	IQCE	-	-	ENSG00000106012		0.697	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IQCE	HGNC	protein_coding	OTTHUMT00000325063.2	-	0.00	143	0	T	NM_152558	Intron	2645633	+1	tier1	-	no_errors	ENST00000402050	ensembl	human	known	74_37	splice_site	13.89	93	15	SNP	0.672	C
IRGQ	126298	genome.wustl.edu	37	19	44097061	44097061	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr19:44097061C>T	ENST00000602269.1	-	2	1174	c.989G>A	c.(988-990)cGc>cAc	p.R330H	L34079.2_ENST00000594374.1_Missense_Mutation_p.R43H|IRGQ_ENST00000601520.1_5'UTR|IRGQ_ENST00000422989.1_Missense_Mutation_p.R330H			Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	330	IRG-type G.									endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(3)	18		Prostate(69;0.0199)				GCCGTCTGTGCGCACGCAGAC	0.632																																																	0													128.0	124.0	125.0					19																	44097061		2203	4300	6503	SO:0001583	missense	0			AF322648	CCDS33040.1	19q13.31	2013-07-03	2005-10-31	2005-10-31		ENSG00000167378			24868	protein-coding gene	gene with protein product			"""immunity-related GTPase family, Q1"""	IRGQ1		16277747	Standard	NM_001007561		Approved	FKSG27	uc010eiv.2	Q8WZA9		ENST00000602269.1:c.989G>A	19.37:g.44097061C>T	ENSP00000472250:p.Arg330His		B2RNP3	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.R330H	ENST00000602269.1	37	c.989	CCDS33040.1	19	.	.	.	.	.	.	.	.	.	.	C	19.12	3.765253	0.69878	.	.	ENSG00000167378	ENST00000422989	T	0.58358	0.34	4.26	4.26	0.50523	.	0.353444	0.19631	N	0.109661	T	0.67515	0.2901	M	0.68952	2.095	0.29488	N	0.855838	D	0.89917	1.0	D	0.79108	0.992	T	0.63260	-0.6677	10	0.72032	D	0.01	-25.8297	10.4901	0.44746	0.0:0.8034:0.1966:0.0	.	330	Q8WZA9	IRGQ_HUMAN	H	330	ENSP00000387535:R330H	ENSP00000387535:R330H	R	-	2	0	IRGQ	48788901	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	2.964000	0.49192	2.667000	0.90743	0.655000	0.94253	CGC	IRGQ	-	NULL	ENSG00000167378		0.632	IRGQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRGQ	HGNC	protein_coding	OTTHUMT00000463205.1	-	0.00	58	0	C	NM_001007561		44097061	-1	tier1	-	no_errors	ENST00000422989	ensembl	human	known	74_37	missense	25.00	36	12	SNP	1.000	T
ITFG1	81533	genome.wustl.edu	37	16	47345168	47345168	+	Silent	SNP	T	T	C	rs370897829		TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr16:47345168T>C	ENST00000320640.6	-	10	1281	c.1053A>G	c.(1051-1053)ctA>ctG	p.L351L	Y_RNA_ENST00000410835.1_RNA|ITFG1_ENST00000544001.2_Silent_p.L238L|RP11-474B12.1_ENST00000564739.1_RNA|ITFG1_ENST00000568047.1_5'UTR	NM_030790.3	NP_110417.2	Q8TB96	TIP_HUMAN	integrin alpha FG-GAP repeat containing 1	351						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	19		all_cancers(37;0.0613)|all_lung(18;0.0543)|Lung NSC(13;0.227)				ATGTGTTCTTTAGTATGACCA	0.358																																																	0								T		0,4404		0,0,2202	94.0	80.0	85.0		1053	0.1	1.0	16		85	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ITFG1	NM_030790.3		0,1,6501	CC,CT,TT		0.0116,0.0,0.0077		351/613	47345168	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	0			AF503339	CCDS10728.1	16q12.1	2008-02-05			ENSG00000129636	ENSG00000129636			30697	protein-coding gene	gene with protein product	"""T cell immunomodulatory protein"""	611803				12598909	Standard	NM_030790		Approved	CDA08, TIP	uc002eet.3	Q8TB96	OTTHUMG00000133103	ENST00000320640.6:c.1053A>G	16.37:g.47345168T>C			Q96SR4|Q9BRE2|Q9H2V9	Silent	SNP	NULL	p.L351	ENST00000320640.6	37	c.1053	CCDS10728.1	16																																																																																			ITFG1	-	NULL	ENSG00000129636		0.358	ITFG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITFG1	HGNC	protein_coding	OTTHUMT00000256768.3	-	0.00	44	0	T	NM_030790		47345168	-1	tier1	-	no_errors	ENST00000320640	ensembl	human	known	74_37	silent	47.73	23	21	SNP	0.988	C
KDM1B	221656	genome.wustl.edu	37	6	18215356	18215357	+	Frame_Shift_Ins	INS	-	-	GC			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr6:18215356_18215357insGC	ENST00000297792.5	+	16	1709_1710	c.1532_1533insGC	c.(1531-1536)gagcagfs	p.Q512fs	KDM1B_ENST00000397244.1_Frame_Shift_Ins_p.Q513fs|KDM1B_ENST00000546309.2_Frame_Shift_Ins_p.Q35fs|KDM1B_ENST00000388870.2_Frame_Shift_Ins_p.Q745fs			Q8NB78	KDM1B_HUMAN	lysine (K)-specific demethylase 1B	744					DNA methylation involved in gamete generation (GO:0043046)|histone H3-K4 demethylation (GO:0034720)|multicellular organismal development (GO:0007275)|regulation of DNA methylation (GO:0044030)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-monomethyl-K4 specific) (GO:0034649)|oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|large_intestine(6)|lung(8)|skin(3)|upper_aerodigestive_tract(1)	25						CTGTTCAAGGAGCAGGTGAGAG	0.594																																																	0																																										SO:0001589	frameshift_variant	0			AK125318	CCDS34343.1	6p22.3	2011-07-01	2009-09-29	2009-09-29	ENSG00000165097	ENSG00000165097		"""Chromatin-modifying enzymes / K-demethylases"""	21577	protein-coding gene	gene with protein product		613081	"""amine oxidase, flavin containing 1"", ""chromosome 6 open reading frame 193"", ""amine oxidase (flavin containing) domain 1"""	C6orf193, AOF1		19407342, 19727073	Standard	NM_153042		Approved	FLJ34109, FLJ33898, dJ298J15.2, bA204B7.3, FLJ43328, LSD2	uc003ncn.1	Q8NB78	OTTHUMG00000014316	ENST00000297792.5:c.1533_1534dupGC	6.37:g.18215357_18215358dupGC	ENSP00000297792:p.Gln512fs		A2A2C5|A2A2C6|Q5TGV3|Q6AI15|Q6ZUU4|Q8N258|Q96EL7	Frame_Shift_Ins	INS	pfam_Amino_oxidase,pfam_Znf_CW,pfam_FAD-dep_OxRdtase,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_SWIRM,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_mOase_FAD-bd,pfam_CHP00275_HI0933-like,pfam_FAD_bind_dom,superfamily_Homeodomain-like,pfscan_SWIRM,pfscan_Znf_CW	p.Q745fs	ENST00000297792.5	37	c.2231_2232	CCDS34343.1	6																																																																																			KDM1B	-	pfam_Amino_oxidase	ENSG00000165097		0.594	KDM1B-002	KNOWN	basic|CCDS	protein_coding	KDM1B	HGNC	protein_coding	OTTHUMT00000277080.1		0.00	41	0	-	NM_153042		18215357	+1	tier1		no_errors	ENST00000388870	ensembl	human	known	74_37	frame_shift_ins	38.71	19	12	INS	1.000:1.000	GC
KIDINS220	57498	genome.wustl.edu	37	2	8946498	8946498	+	Splice_Site	SNP	T	T	C			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr2:8946498T>C	ENST00000256707.3	-	7	687	c.506A>G	c.(505-507)tAt>tGt	p.Y169C	KIDINS220_ENST00000427284.1_Splice_Site_p.Y169C|KIDINS220_ENST00000418530.1_Splice_Site_p.Y127C|KIDINS220_ENST00000319688.5_Splice_Site_p.Y170C|KIDINS220_ENST00000473731.1_Splice_Site_p.Y169C	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	169					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GGTGGTTCCATACTATTAAAA	0.313																																																	0													108.0	102.0	104.0					2																	8946498		1793	4070	5863	SO:0001630	splice_region_variant	0			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.505-1A>G	2.37:g.8946498T>C			A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Missense_Mutation	SNP	pfam_KAP_NTPase,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Y169C	ENST00000256707.3	37	c.506	CCDS42650.1	2	.	.	.	.	.	.	.	.	.	.	T	16.22	3.061063	0.55432	.	.	ENSG00000134313	ENST00000256707;ENST00000427284;ENST00000418530;ENST00000473731;ENST00000489024;ENST00000319688	T;T;T;T;T;T	0.15834	2.39;2.39;2.39;2.39;2.39;2.39	5.09	3.86	0.44501	Ankyrin repeat-containing domain (4);	0.115111	0.64402	D	0.000009	T	0.26919	0.0659	L	0.35542	1.07	0.58432	D	0.999992	D;D;D	0.69078	0.97;0.984;0.997	P;P;D	0.70487	0.797;0.873;0.969	T	0.01545	-1.1328	10	0.66056	D	0.02	.	9.9186	0.41450	0.2571:0.0:0.0:0.7429	.	170;127;169	B4DK94;Q9ULH0-2;Q9ULH0	.;.;KDIS_HUMAN	C	169;169;127;169;170;170	ENSP00000256707:Y169C;ENSP00000411849:Y169C;ENSP00000414923:Y127C;ENSP00000418974:Y169C;ENSP00000419964:Y170C;ENSP00000319947:Y170C	ENSP00000256707:Y169C	Y	-	2	0	KIDINS220	8863949	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	4.612000	0.61169	2.061000	0.61500	0.397000	0.26171	TAT	KIDINS220	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000134313		0.313	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIDINS220	HGNC	protein_coding	OTTHUMT00000323408.2		0.00	38	0	T	NM_020738	Missense_Mutation	8946498	-1			no_errors	ENST00000256707	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	C
KIF2A	3796	genome.wustl.edu	37	5	61661149	61661149	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr5:61661149C>G	ENST00000401507.3	+	15	1858	c.1547C>G	c.(1546-1548)tCt>tGt	p.S516C	KIF2A_ENST00000381103.2_Missense_Mutation_p.S496C|KIF2A_ENST00000506857.1_Missense_Mutation_p.S470C|KIF2A_ENST00000407818.3_Missense_Mutation_p.S516C|KIF2A_ENST00000509663.2_Intron	NM_001243953.1|NM_004520.4	NP_001230882.1|NP_004511.2	O00139	KIF2A_HUMAN	kinesin heavy chain member 2A	516	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|nervous system development (GO:0007399)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	15		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		TTAAGAGATTCTTTCATAGGT	0.328																																																	0													79.0	81.0	80.0					5																	61661149		2203	4300	6503	SO:0001583	missense	0			BC031828	CCDS3980.2, CCDS47216.1, CCDS58949.1	5q12-q13	2008-02-05	2006-09-26	2006-09-26	ENSG00000068796	ENSG00000068796		"""Kinesins"""	6318	protein-coding gene	gene with protein product		602591	"""kinesin heavy chain member 2"""	KIF2		9177777	Standard	NM_001098511		Approved	HK2	uc003jsz.4	O00139	OTTHUMG00000097755	ENST00000401507.3:c.1547C>G	5.37:g.61661149C>G	ENSP00000385622:p.Ser516Cys		A5YM42|A5YM54|B4DY54|D3DW97|E9PB70|Q7Z5I3|Q8N5Q7	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S516C	ENST00000401507.3	37	c.1547	CCDS3980.2	5	.	.	.	.	.	.	.	.	.	.	C	21.6	4.179143	0.78564	.	.	ENSG00000068796	ENST00000401507;ENST00000381103;ENST00000407818;ENST00000506857	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	5.56	4.69	0.59074	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	T	0.45856	0.1363	M	0.78049	2.395	0.80722	D	1	D;D;P;D	0.59357	0.985;0.981;0.931;0.958	D;P;P;P	0.63957	0.92;0.869;0.798;0.908	T	0.51293	-0.8724	10	0.87932	D	0	.	14.5117	0.67791	0.0:0.9292:0.0:0.0708	.	516;516;516;496	B4DM85;O00139-4;O00139;E9PB70	.;.;KIF2A_HUMAN;.	C	516;496;516;470	ENSP00000385622:S516C;ENSP00000370493:S496C;ENSP00000385000:S516C;ENSP00000423772:S470C	ENSP00000370493:S496C	S	+	2	0	KIF2A	61696906	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.815000	0.86186	1.351000	0.45789	0.563000	0.77884	TCT	KIF2A	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom	ENSG00000068796		0.328	KIF2A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2A	HGNC	protein_coding	OTTHUMT00000317989.1	-	0.00	31	0	C	NM_004520		61661149	+1	tier1	-	no_errors	ENST00000407818	ensembl	human	known	74_37	missense	7.14	78	6	SNP	1.000	G
KLRK1	22914	genome.wustl.edu	37	12	10530782	10530782	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr12:10530782G>T	ENST00000240618.6	-	7	622	c.482C>A	c.(481-483)cCa>cAa	p.P161Q	RP11-277P12.20_ENST00000500682.1_RNA|KLRC4-KLRK1_ENST00000539300.1_3'UTR|KLRK1_ENST00000540818.1_Missense_Mutation_p.P161Q	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	161	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						TCCATTTGTTGGAATGTGTAC	0.363																																																	0													201.0	177.0	185.0					12																	10530782		2203	4300	6503	SO:0001583	missense	0			AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.482C>A	12.37:g.10530782G>T	ENSP00000240618:p.Pro161Gln		A8K7K5|A8K7P4|Q9NR41	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.P161Q	ENST00000240618.6	37	c.482	CCDS8623.1	12	.	.	.	.	.	.	.	.	.	.	G	3.924	-0.017504	0.07681	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	T;T	0.18174	2.23;2.23	5.59	4.69	0.59074	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	1.523560	0.03740	N	0.254794	T	0.13500	0.0327	N	0.16098	0.37	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.23084	-1.0198	10	0.33141	T	0.24	.	10.1811	0.42968	0.0913:0.0:0.9087:0.0	.	161	P26718	NKG2D_HUMAN	Q	161	ENSP00000240618:P161Q;ENSP00000446003:P161Q	ENSP00000240618:P161Q	P	-	2	0	KLRK1	10422049	0.003000	0.15002	0.002000	0.10522	0.379000	0.30106	1.167000	0.31847	1.357000	0.45904	0.655000	0.94253	CCA	KLRK1	-	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	ENSG00000213809		0.363	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRK1	HGNC	protein_coding	OTTHUMT00000400269.1	-	0.00	50	0	G	NM_007360		10530782	-1	tier1	-	no_errors	ENST00000240618	ensembl	human	known	74_37	missense	52.46	29	32	SNP	0.006	T
KPNB1	3837	genome.wustl.edu	37	17	45750492	45750492	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr17:45750492G>T	ENST00000290158.4	+	13	2063	c.1656G>T	c.(1654-1656)ttG>ttT	p.L552F	KPNB1_ENST00000537679.1_Missense_Mutation_p.L336F|KPNB1_ENST00000540627.1_Missense_Mutation_p.L407F|KPNB1_ENST00000535458.2_Missense_Mutation_p.L407F	NM_001276453.1|NM_002265.4	NP_001263382.1|NP_002256.2	Q14974	IMB1_HUMAN	karyopherin (importin) beta 1	552					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|protein import into nucleus (GO:0006606)|protein import into nucleus, translocation (GO:0000060)|ribosomal protein import into nucleus (GO:0006610)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)	p.L552F(1)		breast(1)|ovary(1)|pancreas(1)|skin(1)	4						AAACGACTTTGGTCATCATGG	0.463																																																	1	Substitution - Missense(1)	endometrium(1)											125.0	119.0	121.0					17																	45750492		2203	4300	6503	SO:0001583	missense	0			L39793	CCDS11513.1, CCDS62228.1	17q21.32	2013-02-14			ENSG00000108424	ENSG00000108424		"""Importins"", ""Armadillo repeat containing"""	6400	protein-coding gene	gene with protein product	"""importin 1"""	602738				7615630, 7627554	Standard	NM_002265		Approved	NTF97, IPOB, MGC2155, MGC2156, MGC2157, IMB1, Impnb, IPO1	uc002ilt.2	Q14974	OTTHUMG00000036957	ENST00000290158.4:c.1656G>T	17.37:g.45750492G>T	ENSP00000290158:p.Leu552Phe		B7ZAV6|D3DTT3|Q14637|Q53XN2|Q96J27	Missense_Mutation	SNP	pfam_HEAT,pfam_Importin-beta_N,pfam_Armadillo,superfamily_ARM-type_fold,smart_Importin-beta_N,smart_Armadillo,pfscan_HEAT_type_2,pfscan_Importin-beta_N	p.L552F	ENST00000290158.4	37	c.1656	CCDS11513.1	17	.	.	.	.	.	.	.	.	.	.	G	12.93	2.085870	0.36758	.	.	ENSG00000108424	ENST00000535458;ENST00000290158;ENST00000540627;ENST00000537679	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	5.52	-2.18	0.07037	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.52805	0.1757	L	0.50333	1.59	0.38797	D	0.955109	P;P	0.46784	0.884;0.776	B;B	0.40782	0.34;0.198	T	0.60301	-0.7290	9	0.56958	D	0.05	-16.5928	7.3697	0.26794	0.4933:0.1129:0.3938:0.0	.	336;552	F5H4R7;Q14974	.;IMB1_HUMAN	F	407;552;407;336	ENSP00000438253:L407F;ENSP00000290158:L552F;ENSP00000438964:L407F;ENSP00000445006:L336F	ENSP00000290158:L552F	L	+	3	2	KPNB1	43105491	1.000000	0.71417	0.930000	0.37139	0.990000	0.78478	1.490000	0.35573	-0.010000	0.14271	0.655000	0.94253	TTG	KPNB1	-	superfamily_ARM-type_fold	ENSG00000108424		0.463	KPNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNB1	HGNC	protein_coding	OTTHUMT00000089755.2	-	0.00	57	0	G	NM_002265		45750492	+1	tier1	-	no_errors	ENST00000290158	ensembl	human	known	74_37	missense	8.33	55	5	SNP	0.952	T
KRTAP5-3	387266	genome.wustl.edu	37	11	1628947	1628948	+	Missense_Mutation	DNP	GG	GG	AC	rs117085626|rs544320132	byFrequency	TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr11:1628947_1628948GG>AC	ENST00000399685.1	-	1	745_746	c.668_669CC>GT	c.(667-669)tCC>tGT	p.S223C		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	223	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		TGGACTGGGAGGAGCAGGGCTT	0.599																																																	0																																										SO:0001583	missense	0			AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.668_669delinsAC	11.37:g.1628947_1628948delinsAC	ENSP00000382592:p.Ser223Cys		Q6PL44|Q701N3	Silent|Missense_Mutation	SNP	NULL	p.S223|p.S223C	ENST00000399685.1	37	c.669|c.668	CCDS41591.1	11																																																																																			KRTAP5-3	-	NULL	ENSG00000196224		0.599	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-3	HGNC	protein_coding	OTTHUMT00000127924.1	-	0.00	231|230	0	G			1628947|1628948	-1	tier1	-	no_errors	ENST00000399685	ensembl	human	known	74_37	silent|missense	18.52	66	15	SNP	0.962|1.000	A|C
KRTAP5-3	387266	genome.wustl.edu	37	11	1628956	1628956	+	Silent	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr11:1628956C>T	ENST00000399685.1	-	1	737	c.660G>A	c.(658-660)aaG>aaA	p.K220K		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	220	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		AGGAGCAGGGCTTgcagcagc	0.612																																																	0													155.0	161.0	159.0					11																	1628956		2202	4299	6501	SO:0001819	synonymous_variant	0			AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.660G>A	11.37:g.1628956C>T			Q6PL44|Q701N3	Silent	SNP	NULL	p.K220	ENST00000399685.1	37	c.660	CCDS41591.1	11																																																																																			KRTAP5-3	-	NULL	ENSG00000196224		0.612	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-3	HGNC	protein_coding	OTTHUMT00000127924.1		0.00	250	0	C			1628956	-1			no_errors	ENST00000399685	ensembl	human	known	74_37	silent	17.50	66	14	SNP	0.815	T
LAPTM4B	55353	genome.wustl.edu	37	8	98837299	98837299	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr8:98837299G>A	ENST00000521545.2	+	6	755	c.521G>A	c.(520-522)aGc>aAc	p.S174N	LAPTM4B_ENST00000445593.2_Missense_Mutation_p.S265N			Q86VI4	LAP4B_HUMAN	lysosomal protein transmembrane 4 beta	318					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	10	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			TACTTGATTAGCTGTGTTTGG	0.368																																																	0													199.0	169.0	179.0					8																	98837299		2203	4300	6503	SO:0001583	missense	0			AF317417	CCDS6275.1	8q22.1	2008-08-11	2008-08-11		ENSG00000104341	ENSG00000104341			13646	protein-coding gene	gene with protein product		613296					Standard	NM_018407		Approved	LC27	uc003yia.3	Q86VI4	OTTHUMG00000164740	ENST00000521545.2:c.521G>A	8.37:g.98837299G>A	ENSP00000428409:p.Ser174Asn		Q3ZCV5|Q7L909|Q86VH8|Q9H060	Missense_Mutation	SNP	pfam_LAPTM4/5	p.S265N	ENST00000521545.2	37	c.794		8	.	.	.	.	.	.	.	.	.	.	G	12.89	2.072308	0.36566	.	.	ENSG00000104341	ENST00000445593;ENST00000378722;ENST00000521545	T;T	0.38887	1.11;1.11	5.28	5.28	0.74379	.	0.204004	0.52532	D	0.000069	T	0.47801	0.1465	L	0.32530	0.975	0.32065	N	0.595178	D	0.58970	0.984	P	0.57846	0.828	T	0.50759	-0.8790	10	0.27082	T	0.32	-30.3508	15.8482	0.78907	0.0:0.0:1.0:0.0	.	318	Q86VI4	LAP4B_HUMAN	N	265;311;174	ENSP00000402301:S265N;ENSP00000428409:S174N	ENSP00000367995:S311N	S	+	2	0	LAPTM4B	98906475	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.999000	0.49473	2.463000	0.83235	0.650000	0.86243	AGC	LAPTM4B	-	pfam_LAPTM4/5	ENSG00000104341		0.368	LAPTM4B-002	KNOWN	basic|appris_principal	protein_coding	LAPTM4B	HGNC	protein_coding	OTTHUMT00000380016.2	-	0.00	55	0	G			98837299	+1	tier1	-	no_errors	ENST00000445593	ensembl	human	known	74_37	missense	28.00	36	14	SNP	1.000	A
LCA5	167691	genome.wustl.edu	37	6	80196741	80196741	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr6:80196741C>T	ENST00000392959.1	-	9	2685	c.2074G>A	c.(2074-2076)Gaa>Aaa	p.E692K	LCA5_ENST00000369846.4_Missense_Mutation_p.E692K	NM_181714.3	NP_859065.2	Q86VQ0	LCA5_HUMAN	Leber congenital amaurosis 5	692					intraciliary transport (GO:0042073)|photoreceptor cell maintenance (GO:0045494)|protein transport (GO:0015031)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein complex binding (GO:0032403)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	32		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)		BRCA - Breast invasive adenocarcinoma(397;0.0657)		GCTACTTCTTCAATTTCATCT	0.303																																																	0													43.0	47.0	46.0					6																	80196741		2203	4300	6503	SO:0001583	missense	0				CCDS4990.1	6q14	2014-01-28			ENSG00000135338	ENSG00000135338			31923	protein-coding gene	gene with protein product	"""lebercilin"""	611408	"""chromosome 6 open reading frame 152"""	C6orf152		10631161, 17546029	Standard	NM_181714		Approved		uc003pix.3	Q86VQ0	OTTHUMG00000015080	ENST00000392959.1:c.2074G>A	6.37:g.80196741C>T	ENSP00000376686:p.Glu692Lys		E1P542|Q9BWX7	Missense_Mutation	SNP	NULL	p.E692K	ENST00000392959.1	37	c.2074	CCDS4990.1	6	.	.	.	.	.	.	.	.	.	.	C	24.7	4.564586	0.86439	.	.	ENSG00000135338	ENST00000369846;ENST00000392959	T;T	0.66099	-0.19;-0.19	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.74974	0.3787	M	0.66939	2.045	0.50467	D	0.999874	D	0.89917	1.0	D	0.87578	0.998	T	0.77143	-0.2696	10	0.87932	D	0	-23.0548	18.5368	0.91013	0.0:1.0:0.0:0.0	.	692	Q86VQ0	LCA5_HUMAN	K	692	ENSP00000358861:E692K;ENSP00000376686:E692K	ENSP00000358861:E692K	E	-	1	0	LCA5	80253460	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	5.677000	0.68142	2.609000	0.88269	0.591000	0.81541	GAA	LCA5	-	NULL	ENSG00000135338		0.303	LCA5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LCA5	HGNC	protein_coding	OTTHUMT00000259269.1	-	0.00	57	0	C	NM_181714		80196741	-1	tier1	-	no_errors	ENST00000369846	ensembl	human	known	74_37	missense	40.00	36	24	SNP	1.000	T
LILRA3	11026	genome.wustl.edu	37	19	54802107	54802107	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr19:54802107C>A	ENST00000251390.3	-	6	1172	c.1081G>T	c.(1081-1083)Ggg>Tgg	p.G361W	LILRA3_ENST00000391744.3_Missense_Mutation_p.G297W|LILRA3_ENST00000391745.1_Missense_Mutation_p.G378W	NM_006865.3	NP_006856.3	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3	361	Ig-like C2-type 4.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			NS(3)|breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TCAGCTGCCCCCTCCTTGGTC	0.602																																																	0													104.0	92.0	96.0					19																	54802107		2194	4160	6354	SO:0001583	missense	0			U91926		19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6604	protein-coding gene	gene with protein product		604818				9278324, 9548455	Standard	XM_006710242		Approved	LIR-4, HM43, ILT6, HM31, LIR4, CD85e		Q8N6C8		ENST00000251390.3:c.1081G>T	19.37:g.54802107C>A	ENSP00000251390:p.Gly361Trp		J3KPM2|O15469|O15470|O75016|Q8N151|Q8N154|Q8NHJ1|Q8NHJ2|Q8NHJ3|Q8NHJ4	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like_dom	p.G361W	ENST00000251390.3	37	c.1081	CCDS12887.1	19	.	.	.	.	.	.	.	.	.	.	C	11.27	1.590441	0.28357	.	.	ENSG00000170866	ENST00000251390;ENST00000391744;ENST00000391745	T;T;T	0.01252	5.1;5.1;5.1	2.4	0.183	0.15082	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.639938	0.13182	N	0.407402	T	0.12860	0.0312	H	0.98936	4.375	0.09310	N	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.999	T	0.06807	-1.0806	10	0.87932	D	0	.	4.5772	0.12240	0.0:0.6667:0.0:0.3333	.	361;361	E7EU74;Q8N6C8	.;LIRA3_HUMAN	W	361;297;378	ENSP00000251390:G361W;ENSP00000375624:G297W;ENSP00000375625:G378W	ENSP00000251390:G361W	G	-	1	0	LILRA3	59493919	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	0.479000	0.22228	0.136000	0.18733	0.586000	0.80456	GGG	LILRA3	-	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like_dom	ENSG00000170866		0.602	LILRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA3	HGNC	protein_coding	OTTHUMT00000140236.1	-	0.00	153	0	C			54802107	-1	tier1	-	no_errors	ENST00000251390	ensembl	human	known	74_37	missense	8.33	77	7	SNP	0.002	A
MYOCD	93649	genome.wustl.edu	37	17	12663922	12663922	+	Intron	SNP	A	A	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr17:12663922A>G	ENST00000343344.4	+	12	2187				RP11-1090M7.1_ENST00000584772.1_RNA|MYOCD_ENST00000425538.1_Intron			Q8IZQ8	MYCD_HUMAN	myocardin						cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		TACGGAGATAACCACCTTCTA	0.393																																																	0													68.0	65.0	66.0					17																	12663922		2203	4300	6503	SO:0001627	intron_variant	0			AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.2188-45A>G	17.37:g.12663922A>G			Q5UBU5|Q8N7Q1	RNA	SNP	-	NULL	ENST00000343344.4	37	NULL	CCDS11163.1	17																																																																																			RP11-1090M7.1	-	-	ENSG00000265489		0.393	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100128006	Clone_based_vega_gene	protein_coding	OTTHUMT00000129950.1	-	0.00	63	0	A	NM_153604		12663922	-1	tier1	-	no_errors	ENST00000584772	ensembl	human	known	74_37	rna	60.98	16	25	SNP	0.000	G
TPTE2P2	644623	genome.wustl.edu	37	13	52864053	52864053	+	RNA	SNP	T	T	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr13:52864053T>A	ENST00000451298.1	-	0	116																											AACTTTGCTATCAGTGAAAAT	0.308																																																	0																																												0																															13.37:g.52864053T>A				RNA	SNP	-	NULL	ENST00000451298.1	37	NULL		13																																																																																			RP11-248G5.8	-	-	ENSG00000217576		0.308	RP11-248G5.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	LOC101930578	Clone_based_vega_gene	processed_transcript	OTTHUMT00000471093.1	-	0.00	69	0	T			52864053	-1	tier1	-	no_errors	ENST00000451298	ensembl	human	known	74_37	rna	6.86	95	7	SNP	0.088	A
LRIT1	26103	genome.wustl.edu	37	10	85992483	85992483	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr10:85992483G>T	ENST00000372105.3	-	4	1093	c.1072C>A	c.(1072-1074)Cca>Aca	p.P358T		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	358						integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						AGTGCTCCTGGGCTCCCACTG	0.557																																																	0													58.0	47.0	50.0					10																	85992483		2203	4300	6503	SO:0001583	missense	0			AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.1072C>A	10.37:g.85992483G>T	ENSP00000361177:p.Pro358Thr		Q0QD41|Q9Y4N7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P358T	ENST00000372105.3	37	c.1072	CCDS7373.1	10	.	.	.	.	.	.	.	.	.	.	G	3.503	-0.101363	0.06967	.	.	ENSG00000148602	ENST00000372105	T	0.38077	1.16	5.8	4.82	0.62117	.	0.384460	0.30781	N	0.008882	T	0.21227	0.0511	N	0.19112	0.55	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.06588	-1.0818	10	0.29301	T	0.29	.	8.2867	0.31932	0.086:0.0:0.7467:0.1673	.	358	Q9P2V4	LRIT1_HUMAN	T	358	ENSP00000361177:P358T	ENSP00000361177:P358T	P	-	1	0	LRIT1	85982463	0.001000	0.12720	0.109000	0.21407	0.178000	0.23041	0.340000	0.19892	2.749000	0.94314	0.655000	0.94253	CCA	LRIT1	-	NULL	ENSG00000148602		0.557	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT1	HGNC	protein_coding	OTTHUMT00000049109.1	-	0.00	29	0	G	NM_015613		85992483	-1	tier1	-	no_errors	ENST00000372105	ensembl	human	known	74_37	missense	18.75	13	3	SNP	0.091	T
LRPPRC	10128	genome.wustl.edu	37	2	44177716	44177716	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr2:44177716C>T	ENST00000260665.7	-	15	1730	c.1673G>A	c.(1672-1674)aGc>aAc	p.S558N		NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	558					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ACTTACCTCGCTCCAAAGATT	0.328																																																	0													56.0	60.0	59.0					2																	44177716		2203	4299	6502	SO:0001583	missense	0			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.1673G>A	2.37:g.44177716C>T	ENSP00000260665:p.Ser558Asn		A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	pfam_Pentatricopeptide_repeat,tigrfam_Pentatricopeptide_repeat	p.S558N	ENST00000260665.7	37	c.1673	CCDS33189.1	2	.	.	.	.	.	.	.	.	.	.	C	15.75	2.925012	0.52759	.	.	ENSG00000138095	ENST00000465633;ENST00000260665	T	0.56275	0.47	5.25	5.25	0.73442	.	0.402241	0.30392	N	0.009732	T	0.59609	0.2206	M	0.76574	2.34	0.80722	D	1	P;P	0.51351	0.944;0.931	P;P	0.48400	0.576;0.522	T	0.58940	-0.7547	10	0.25751	T	0.34	-8.1111	14.4536	0.67401	0.0:0.8529:0.1471:0.0	.	458;558	F5H4J6;P42704	.;LPPRC_HUMAN	N	458;558	ENSP00000260665:S558N	ENSP00000260665:S558N	S	-	2	0	LRPPRC	44031220	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	2.365000	0.44196	2.443000	0.82685	0.549000	0.68633	AGC	LRPPRC	-	NULL	ENSG00000138095		0.328	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRPPRC	HGNC	protein_coding	OTTHUMT00000327823.1		0.00	62	0	C	NM_133259		44177716	-1			no_errors	ENST00000260665	ensembl	human	known	74_37	missense	6.10	77	5	SNP	1.000	T
LUM	4060	genome.wustl.edu	37	12	91502642	91502642	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr12:91502642G>T	ENST00000266718.4	-	2	569	c.115C>A	c.(115-117)Cca>Aca	p.P39T	LUM_ENST00000548071.1_Intron	NM_002345.3	NP_002336.1	P51884	LUM_HUMAN	lumican	39	Cys-rich.|LRRNT.				carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrillar collagen trimer (GO:0005583)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24						TTACATTCTGGTGCACAGTTT	0.423																																																	0													108.0	101.0	103.0					12																	91502642		2203	4300	6503	SO:0001583	missense	0			BT006707	CCDS9038.1	12q21.33	2014-06-13			ENSG00000139329			"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6724	protein-coding gene	gene with protein product	"""lumican proteoglycan"""	600616		LDC		7558030	Standard	NM_002345		Approved	SLRR2D	uc001tbm.3	P51884	OTTHUMG00000170074	ENST00000266718.4:c.115C>A	12.37:g.91502642G>T	ENSP00000266718:p.Pro39Thr		B2R6R5|Q96QM7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.P39T	ENST00000266718.4	37	c.115	CCDS9038.1	12	.	.	.	.	.	.	.	.	.	.	G	16.95	3.264399	0.59431	.	.	ENSG00000139329	ENST00000266718	D	0.96491	-4.03	5.66	5.66	0.87406	Leucine-rich repeat-containing N-terminal (2);	0.107611	0.64402	D	0.000004	D	0.95648	0.8585	L	0.36672	1.1	0.50632	D	0.999889	D	0.55385	0.971	P	0.52710	0.707	D	0.93632	0.6957	10	0.21014	T	0.42	-5.1665	20.1225	0.97967	0.0:0.0:1.0:0.0	.	39	P51884	LUM_HUMAN	T	39	ENSP00000266718:P39T	ENSP00000266718:P39T	P	-	1	0	LUM	90026773	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.260000	0.58835	2.831000	0.97527	0.650000	0.86243	CCA	LUM	-	pfam_LRR-contain_N,smart_LRR-contain_N	ENSG00000139329		0.423	LUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LUM	HGNC	protein_coding	OTTHUMT00000407150.2		0.00	58	0	G	NM_002345		91502642	-1			no_errors	ENST00000266718	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
LYPD6	130574	genome.wustl.edu	37	2	150325190	150325190	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr2:150325190G>A	ENST00000334166.4	+	4	506	c.249G>A	c.(247-249)atG>atA	p.M83I	LYPD6_ENST00000409381.1_Missense_Mutation_p.M83I	NM_194317.3	NP_919298.1	Q86Y78	LYPD6_HUMAN	LY6/PLAUR domain containing 6	83	UPAR/Ly6.					extracellular region (GO:0005576)				large_intestine(1)|lung(4)	5				BRCA - Breast invasive adenocarcinoma(221;0.0667)		AGCACACAATGGAAGTCACAG	0.463																																																	0													223.0	199.0	208.0					2																	150325190		2203	4300	6503	SO:0001583	missense	0			BC047013	CCDS2188.1	2q23.2	2008-02-05			ENSG00000187123	ENSG00000187123			28751	protein-coding gene	gene with protein product		613359				12477932	Standard	NM_001195685		Approved	MGC52057	uc021vqt.1	Q86Y78	OTTHUMG00000131852	ENST00000334166.4:c.249G>A	2.37:g.150325190G>A	ENSP00000334463:p.Met83Ile		B3KWC0|Q4G121|Q53TR3|Q659B1	Missense_Mutation	SNP	pfam_LY6_UPAR	p.M83I	ENST00000334166.4	37	c.249	CCDS2188.1	2	.	.	.	.	.	.	.	.	.	.	G	18.82	3.704156	0.68615	.	.	ENSG00000187123	ENST00000409381;ENST00000334166	T;T	0.08984	3.03;3.03	5.39	5.39	0.77823	Ly-6 antigen / uPA receptor -like (1);	0.000000	0.85682	D	0.000000	T	0.15132	0.0365	M	0.71581	2.175	0.58432	D	0.999999	P	0.41420	0.749	B	0.40825	0.341	T	0.00822	-1.1552	10	0.51188	T	0.08	-13.9246	16.6417	0.85128	0.0:0.0:1.0:0.0	.	83	Q86Y78	LYPD6_HUMAN	I	83	ENSP00000386413:M83I;ENSP00000334463:M83I	ENSP00000334463:M83I	M	+	3	0	LYPD6	150033436	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.214000	0.89760	2.526000	0.85167	0.555000	0.69702	ATG	LYPD6	-	pfam_LY6_UPAR	ENSG00000187123		0.463	LYPD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYPD6	HGNC	protein_coding	OTTHUMT00000254800.2	-	0.00	37	0	G	NM_194317		150325190	+1	tier1	-	no_errors	ENST00000334166	ensembl	human	known	74_37	missense	36.36	21	12	SNP	1.000	A
MAN2C1	4123	genome.wustl.edu	37	15	75656447	75656447	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr15:75656447G>A	ENST00000267978.5	-	6	729	c.683C>T	c.(682-684)cCc>cTc	p.P228L	MAN2C1_ENST00000569482.1_Missense_Mutation_p.P228L|MAN2C1_ENST00000563622.1_Intron|MAN2C1_ENST00000563539.1_Intron|MAN2C1_ENST00000565683.1_Missense_Mutation_p.P228L	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	228					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						GAAGGTCTCGGGCTGGGCAGG	0.617																																																	0													98.0	85.0	89.0					15																	75656447		2197	4294	6491	SO:0001583	missense	0			AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.683C>T	15.37:g.75656447G>A	ENSP00000267978:p.Pro228Leu		H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Missense_Mutation	SNP	pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.P228L	ENST00000267978.5	37	c.683	CCDS32298.1	15	.	.	.	.	.	.	.	.	.	.	g	21.7	4.184034	0.78677	.	.	ENSG00000140400	ENST00000267978	T	0.17054	2.3	5.47	5.47	0.80525	Glycoside hydrolase, family 38, core (1);	0.000000	0.85682	D	0.000000	T	0.15825	0.0381	L	0.45137	1.4	0.80722	D	1	B;B;P	0.42785	0.23;0.091;0.79	B;B;B	0.39339	0.119;0.053;0.297	T	0.03483	-1.1032	10	0.06891	T	0.86	-16.3588	18.2886	0.90122	0.0:0.0:1.0:0.0	.	10;228;228	B4DVP6;Q68EM8;Q9NTJ4	.;.;MA2C1_HUMAN	L	228	ENSP00000267978:P228L	ENSP00000267978:P228L	P	-	2	0	MAN2C1	73443500	1.000000	0.71417	0.871000	0.34182	0.767000	0.43475	7.364000	0.79526	2.576000	0.86940	0.486000	0.48141	CCC	MAN2C1	-	NULL	ENSG00000140400		0.617	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2C1	HGNC	protein_coding	OTTHUMT00000419965.1	-	0.00	66	0	G			75656447	-1	tier1	-	no_errors	ENST00000267978	ensembl	human	known	74_37	missense	15.69	43	8	SNP	0.999	A
MAP1B	4131	genome.wustl.edu	37	5	71492144	71492144	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr5:71492144G>A	ENST00000296755.7	+	5	3260	c.2962G>A	c.(2962-2964)Gag>Aag	p.E988K		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	988					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		ATACATCAGGGAGAAGAGGGA	0.557																																					Melanoma(17;367 822 11631 31730 47712)												0													72.0	73.0	73.0					5																	71492144		2203	4300	6503	SO:0001583	missense	0			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.2962G>A	5.37:g.71492144G>A	ENSP00000296755:p.Glu988Lys		A2BDK5	Missense_Mutation	SNP	pfam_MAP1B_neuraxin	p.E988K	ENST00000296755.7	37	c.2962	CCDS4012.1	5	.	.	.	.	.	.	.	.	.	.	G	11.56	1.674157	0.29693	.	.	ENSG00000131711	ENST00000296755	T	0.05258	3.47	6.08	4.3	0.51218	.	0.170737	0.41396	N	0.000886	T	0.03739	0.0106	N	0.08118	0	0.32507	N	0.53813	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.20338	-1.0278	10	0.22706	T	0.39	-10.9549	12.2817	0.54767	0.1373:0.0:0.8627:0.0	.	862;988	A2BDK6;P46821	.;MAP1B_HUMAN	K	988	ENSP00000296755:E988K	ENSP00000296755:E988K	E	+	1	0	MAP1B	71527900	1.000000	0.71417	0.975000	0.42487	0.262000	0.26303	4.746000	0.62133	0.904000	0.36572	0.655000	0.94253	GAG	MAP1B	-	NULL	ENSG00000131711		0.557	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6		0.00	25	0	G	NM_005909		71492144	+1			no_errors	ENST00000296755	ensembl	human	known	74_37	missense	8.33	22	2	SNP	0.613	A
MED12L	116931	genome.wustl.edu	37	3	151102876	151102876	+	Missense_Mutation	SNP	T	T	C	rs61740424	byFrequency	TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr3:151102876T>C	ENST00000474524.1	+	34	4918	c.4880T>C	c.(4879-4881)tTg>tCg	p.L1627S	MED12L_ENST00000273432.4_Missense_Mutation_p.L1487S|P2RY12_ENST00000302632.3_5'Flank	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1627						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTACTACCTTTGCCGAAACAG	0.388																																																	0													136.0	133.0	134.0					3																	151102876		2203	4300	6503	SO:0001583	missense	0			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.4880T>C	3.37:g.151102876T>C	ENSP00000417235:p.Leu1627Ser		Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.L1627S	ENST00000474524.1	37	c.4880	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	T	24.4	4.522610	0.85600	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.70631	-0.35;-0.5	5.63	5.63	0.86233	.	0.077718	0.53938	D	0.000050	D	0.82797	0.5115	M	0.65975	2.015	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.87578	0.998;0.994;0.991	D	0.84783	0.0774	10	0.87932	D	0	-15.3728	15.5314	0.75964	0.0:0.0:0.0:1.0	.	1487;1626;1627	F8WAE6;Q86YW9-4;Q86YW9	.;.;MD12L_HUMAN	S	1627;1487	ENSP00000417235:L1627S;ENSP00000273432:L1487S	ENSP00000273432:L1487S	L	+	2	0	MED12L	152585566	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.277000	0.72608	2.145000	0.66743	0.533000	0.62120	TTG	MED12L	-	NULL	ENSG00000144893		0.388	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2	-	0.00	44	0	T	NM_053002		151102876	+1	tier1	-	no_errors	ENST00000474524	ensembl	human	known	74_37	missense	12.00	44	6	SNP	1.000	C
MED15	51586	genome.wustl.edu	37	22	20909285	20909285	+	Missense_Mutation	SNP	A	A	G	rs148919404	byFrequency	TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr22:20909285A>G	ENST00000263205.7	+	5	370	c.301A>G	c.(301-303)Atg>Gtg	p.M101V	MED15_ENST00000425759.2_Intron|MED15_ENST00000406969.1_Missense_Mutation_p.M75V|MED15_ENST00000382974.2_Intron|MED15_ENST00000542773.1_Intron|MED15_ENST00000292733.7_Missense_Mutation_p.M101V|MED15_ENST00000541476.1_Missense_Mutation_p.M75V	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	101					gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			TGGAATTGGCATGCCTCCTCG	0.637																																																	0													45.0	47.0	47.0					22																	20909285		2203	4300	6503	SO:0001583	missense	0			AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.301A>G	22.37:g.20909285A>G	ENSP00000263205:p.Met101Val		D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Missense_Mutation	SNP	pfam_Mediator_Med15_met	p.M101V	ENST00000263205.7	37	c.301	CCDS33602.1	22	.	.	.	.	.	.	.	.	.	.	A	11.60	1.687635	0.29962	.	.	ENSG00000099917	ENST00000445987;ENST00000414658;ENST00000292733;ENST00000263205;ENST00000406969;ENST00000541476;ENST00000445189;ENST00000542312;ENST00000451058;ENST00000457322;ENST00000424287	T;D	0.85013	-0.88;-1.93	5.59	2.28	0.28536	Mediator complex, subunit Med15, metazoa (1);	0.338735	0.37095	N	0.002255	T	0.70806	0.3266	N	0.17474	0.49	0.80722	D	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.001;0.0;0.001;0.002	T	0.61108	-0.7129	10	0.48119	T	0.1	.	7.104	0.25353	0.4239:0.493:0.0831:0.0	.	120;75;101;101	Q6PKB8;G3V1P5;Q96RN5-2;Q96RN5	.;.;.;MED15_HUMAN	V	75;75;101;101;75;75;75;75;75;62;54	ENSP00000263205:M101V;ENSP00000396461:M54V	ENSP00000263205:M101V	M	+	1	0	MED15	19239285	1.000000	0.71417	1.000000	0.80357	0.413000	0.31143	2.048000	0.41278	0.401000	0.25424	-0.313000	0.08912	ATG	MED15	-	pfam_Mediator_Med15_met	ENSG00000099917		0.637	MED15-004	KNOWN	basic|CCDS	protein_coding	MED15	HGNC	protein_coding	OTTHUMT00000320177.2		0.00	82	0	A	NM_015889		20909285	+1			no_errors	ENST00000263205	ensembl	human	known	74_37	missense	7.94	58	5	SNP	0.995	G
MEF2C	4208	genome.wustl.edu	37	5	88027681	88027681	+	Silent	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr5:88027681C>T	ENST00000437473.2	-	7	1092	c.675G>A	c.(673-675)ctG>ctA	p.L225L	MEF2C_ENST00000514028.1_Silent_p.L225L|MEF2C_ENST00000340208.5_Silent_p.L243L|MEF2C_ENST00000504921.2_Silent_p.L225L|MEF2C_ENST00000506554.1_Silent_p.L225L|MEF2C_ENST00000503554.1_5'Flank|MEF2C_ENST00000514015.1_Silent_p.L225L|MEF2C_ENST00000424173.2_Silent_p.L223L|MEF2C_ENST00000508569.1_Silent_p.L225L|MEF2C_ENST00000510942.1_Silent_p.L225L|MEF2C_ENST00000539796.1_Silent_p.L177L	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	225					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		GTGAGACCAGCAGACCTGGTG	0.408										HNSCC(66;0.2)																																							0													83.0	80.0	81.0					5																	88027681		1856	4087	5943	SO:0001819	synonymous_variant	0			AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.675G>A	5.37:g.88027681C>T			C9JMZ0|D7F7N5|F8W7V7	Silent	SNP	pfam_TF_MADSbox,pfam_HJURP_C,superfamily_TF_MADSbox,smart_TF_MADSbox,prints_TF_MADSbox,pfscan_TF_MADSbox	p.L225	ENST00000437473.2	37	c.675	CCDS47245.1	5																																																																																			MEF2C	-	NULL	ENSG00000081189		0.408	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	MEF2C	HGNC	protein_coding	OTTHUMT00000369817.1	-	0.00	62	0	C	NM_002397		88027681	-1	tier1	-	no_errors	ENST00000437473	ensembl	human	known	74_37	silent	18.18	54	12	SNP	1.000	T
MEF2D	4209	genome.wustl.edu	37	1	156438655	156438655	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr1:156438655C>A	ENST00000348159.4	-	10	1644	c.1164G>T	c.(1162-1164)caG>caT	p.Q388H	MEF2D_ENST00000368240.2_Missense_Mutation_p.Q381H|MEF2D_ENST00000353795.3_Missense_Mutation_p.Q342H|MEF2D_ENST00000340875.5_Missense_Mutation_p.Q387H|MEF2D_ENST00000360595.3_Missense_Mutation_p.Q381H|MEF2D_ENST00000464356.2_Missense_Mutation_p.Q380H	NM_005920.2	NP_005911.1	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	388	Gln/Pro-rich.				adult heart development (GO:0007512)|apoptotic process (GO:0006915)|chondrocyte differentiation (GO:0002062)|endochondral ossification (GO:0001958)|muscle organ development (GO:0007517)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|histone deacetylase binding (GO:0042826)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	15	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					gtggctgtggctgctgtggct	0.642																																																	0													60.0	50.0	54.0					1																	156438655		2203	4300	6503	SO:0001583	missense	0			BC054520	CCDS1143.1, CCDS60304.1	1q12-q23	2008-02-05	2007-04-24		ENSG00000116604	ENSG00000116604		"""Myocyte enhancer factors"""	6997	protein-coding gene	gene with protein product		600663				8269842	Standard	NM_005920		Approved		uc001fpb.4	Q14814	OTTHUMG00000033095	ENST00000348159.4:c.1164G>T	1.37:g.156438655C>A	ENSP00000271555:p.Gln388His		D3DVC0|Q14815|Q5T9U5|Q5T9U6	Missense_Mutation	SNP	pfam_TF_MADSbox,pfam_HJURP_C,superfamily_TF_MADSbox,smart_TF_MADSbox,pfscan_TF_MADSbox,prints_TF_MADSbox	p.Q388H	ENST00000348159.4	37	c.1164	CCDS1143.1	1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.885573	0.51908	.	.	ENSG00000116604	ENST00000348159;ENST00000340875;ENST00000368240;ENST00000353795;ENST00000360595;ENST00000454816	T;T;T;T;T;T	0.60299	0.76;0.2;0.76;0.56;0.76;0.2	3.85	2.87	0.33458	.	0.967339	0.08409	N	0.950250	T	0.31136	0.0787	N	0.08118	0	0.32200	N	0.577926	B;D;B	0.57571	0.41;0.98;0.277	B;P;B	0.50440	0.135;0.641;0.189	T	0.09015	-1.0694	10	0.59425	D	0.04	10.7435	9.2621	0.37619	0.0:0.7799:0.2201:0.0	.	393;388;381	Q4LE66;Q14814;Q14814-4	.;MEF2D_HUMAN;.	H	388;387;381;342;381;380	ENSP00000271555:Q388H;ENSP00000343159:Q387H;ENSP00000357223:Q381H;ENSP00000344705:Q342H;ENSP00000353803:Q381H;ENSP00000388505:Q380H	ENSP00000343159:Q387H	Q	-	3	2	MEF2D	154705279	0.993000	0.37304	0.995000	0.50966	0.983000	0.72400	1.175000	0.31944	1.977000	0.57605	0.462000	0.41574	CAG	MEF2D	-	NULL	ENSG00000116604		0.642	MEF2D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MEF2D	HGNC	protein_coding	OTTHUMT00000080562.2	-	0.00	173	0	C	NM_005920		156438655	-1	tier1	-	no_errors	ENST00000348159	ensembl	human	known	74_37	missense	9.76	111	12	SNP	1.000	A
STRN3	29966	genome.wustl.edu	37	14	31483858	31483858	+	Intron	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr14:31483858G>T	ENST00000357479.5	-	1	479				STRN3_ENST00000355683.5_Intron|MIR624_ENST00000385217.1_RNA	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3						negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		AAACCACTTAGGTGTAATGCT	0.313																																																	0													47.0	42.0	43.0					14																	31483858		1502	3414	4916	SO:0001627	intron_variant	0				CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.282+11251C>A	14.37:g.31483858G>T			A2RTX7|A6NHZ7|Q9NRA5	RNA	SNP	-	NULL	ENST00000357479.5	37	NULL	CCDS41938.1	14																																																																																			MIR624	-	-	ENSG00000207952		0.313	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MIR624	HGNC	protein_coding	OTTHUMT00000409713.1	-	0.00	98	0	G	NM_014574		31483858	-1	tier1	-	no_errors	ENST00000385217	ensembl	human	known	74_37	rna	6.67	56	4	SNP	0.001	T
MT-CO1	4512	genome.wustl.edu	37	M	6292	6292	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chrM:6292C>A	ENST00000361624.2	+	1	389	c.389C>A	c.(388-390)cCt>cAt	p.P130H	MT-TN_ENST00000387400.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TY_ENST00000387409.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	130					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						AACAGTCTACCCTCCCTTAGC	0.522																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.389C>A	M.37:g.6292C>A	ENSP00000354499:p.Pro130His		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.P130H	ENST00000361624.2	37	c.389		MT																																																																																			MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	ENSG00000198804		0.522	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		-	0.00	154	0	C	YP_003024028		6292	+1	tier1	-	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	16.67	10	2	SNP	NULL	A
MT-ND5	4540	genome.wustl.edu	37	M	13937	13937	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chrM:13937A>T	ENST00000361567.2	+	1	1601	c.1601A>T	c.(1600-1602)cAc>cTc	p.H534L	MT-TL2_ENST00000387456.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	534					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TAGCATCACACACCGCACAAT	0.428																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1601A>T	M.37:g.13937A>T	ENSP00000354813:p.His534Leu		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.H534L	ENST00000361567.2	37	c.1601		MT																																																																																			MT-ND5	-	pfam_NADH_DH_su5_C	ENSG00000198786		0.428	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	187	0	A	YP_003024036		13937	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	16.67	10	2	SNP	NULL	T
NAA30	122830	genome.wustl.edu	37	14	57866569	57866569	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr14:57866569A>G	ENST00000556492.1	+	4	1073	c.919A>G	c.(919-921)Ata>Gta	p.I307V	NAA30_ENST00000554703.1_Intron|NAA30_ENST00000555166.1_Missense_Mutation_p.I49V	NM_001011713.2	NP_001011713.2	Q147X3	NAA30_HUMAN	N(alpha)-acetyltransferase 30, NatC catalytic subunit	307	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				metabolic process (GO:0008152)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)	peptide alpha-N-acetyltransferase activity (GO:0004596)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	13						TAAGAAAGCTATATATGCCAT	0.274																																																	0													138.0	156.0	150.0					14																	57866569		2203	4298	6501	SO:0001583	missense	0			AK092674	CCDS32088.1	14q22.2	2010-05-07	2010-01-14	2010-01-14		ENSG00000139977	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	19844	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 35"", ""N-acetyltransferase 12"", ""N-acetyltransferase 12 (GCN5-related, putative)"""	C14orf35, NAT12		19660095	Standard	NM_001011713		Approved	FLJ35355, MAK3, Mak3p	uc001xcx.4	Q147X3		ENST00000556492.1:c.919A>G	14.37:g.57866569A>G	ENSP00000452521:p.Ile307Val		Q0IIN2	Missense_Mutation	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.I307V	ENST00000556492.1	37	c.919	CCDS32088.1	14	.	.	.	.	.	.	.	.	.	.	A	18.87	3.714957	0.68844	.	.	ENSG00000139977	ENST00000555166;ENST00000556492;ENST00000395257	T;T	0.22945	1.93;1.93	5.64	4.49	0.54785	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.38506	0.1043	L	0.48877	1.53	0.80722	D	1	B	0.32781	0.384	P	0.49953	0.627	T	0.23762	-1.0179	10	0.56958	D	0.05	-7.4041	12.1342	0.53961	0.8716:0.0:0.0:0.1284	.	307	Q147X3	NAA30_HUMAN	V	49;307;270	ENSP00000450939:I49V;ENSP00000452521:I307V	ENSP00000298406:I307V	I	+	1	0	NAA30	56936322	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.313000	0.96297	0.947000	0.37659	0.533000	0.62120	ATA	NAA30	-	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000139977		0.274	NAA30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA30	HGNC	protein_coding	OTTHUMT00000412925.1	-	0.00	52	0	A	NM_001011713		57866569	+1	tier1	-	no_errors	ENST00000556492	ensembl	human	known	74_37	missense	32.43	25	12	SNP	1.000	G
NBEAL1	65065	genome.wustl.edu	37	2	204016238	204016238	+	Missense_Mutation	SNP	G	G	T	rs372102920		TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr2:204016238G>T	ENST00000449802.1	+	34	5759	c.5426G>T	c.(5425-5427)cGc>cTc	p.R1809L		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1809								p.R1809H(1)|p.R519H(1)		NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						AATTATTCCCGCATGAGACTT	0.343																																																	2	Substitution - Missense(2)	large_intestine(2)											87.0	80.0	82.0					2																	204016238		1826	4078	5904	SO:0001583	missense	0			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.5426G>T	2.37:g.204016238G>T	ENSP00000399903:p.Arg1809Leu		A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R1809L	ENST00000449802.1	37	c.5426	CCDS46495.1	2	.	.	.	.	.	.	.	.	.	.	G	23.4	4.416860	0.83449	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.60424	0.19	4.86	4.86	0.63082	.	0.063928	0.64402	D	0.000007	T	0.68118	0.2966	M	0.86740	2.835	0.58432	D	0.999999	P;P	0.51653	0.947;0.947	P;P	0.48227	0.571;0.571	T	0.75866	-0.3166	10	0.87932	D	0	.	12.1816	0.54216	0.0846:0.0:0.9154:0.0	.	1809;1798	Q6ZS30;C9JGK5	NBEL1_HUMAN;.	L	1809	ENSP00000399903:R1809L	ENSP00000344985:R1809L	R	+	2	0	NBEAL1	203724483	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.453000	0.73488	2.233000	0.73108	0.460000	0.39030	CGC	NBEAL1	-	NULL	ENSG00000144426		0.343	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4		0.00	52	0	G			204016238	+1			no_errors	ENST00000449802	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
NCOA7	135112	genome.wustl.edu	37	6	126136442	126136442	+	5'UTR	SNP	C	C	A	rs10485125	byFrequency	TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr6:126136442C>A	ENST00000368357.3	+	0	294				NCOA7_ENST00000487635.1_3'UTR|NCOA7_ENST00000229634.9_5'UTR|NCOA7_ENST00000392477.2_5'UTR|NCOA7-AS1_ENST00000429007.1_RNA	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		TACAGGGTTACGACTCACTGA	0.328																																																	0													90.0	81.0	84.0					6																	126136442		692	1590	2282	SO:0001623	5_prime_UTR_variant	0			AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.-59C>A	6.37:g.126136442C>A			B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	RNA	SNP	-	NULL	ENST00000368357.3	37	NULL	CCDS5132.1	6																																																																																			NCOA7	-	-	ENSG00000111912		0.328	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA7	HGNC	protein_coding	OTTHUMT00000042083.4	-	0.00	49	0	C	XM_059748		126136442	+1	tier1	-	no_errors	ENST00000487635	ensembl	human	known	74_37	rna	7.84	47	4	SNP	1.000	A
NDFIP2	54602	genome.wustl.edu	37	13	80117762	80117762	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr13:80117762A>G	ENST00000218652.7	+	5	837	c.785A>G	c.(784-786)tAt>tGt	p.Y262C		NM_001161407.1|NM_019080.2	NP_001154879.1|NP_061953.2	Q9NV92	NFIP2_HUMAN	Nedd4 family interacting protein 2	262					negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of transporter activity (GO:0032410)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			NS(1)|breast(1)|endometrium(2)|kidney(3)|lung(3)|ovary(2)|prostate(1)|skin(1)	14		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0196)		GCTGGAAGGTATGGTGCTATC	0.378																																																	0													284.0	249.0	261.0					13																	80117762		2203	4300	6503	SO:0001583	missense	0			AB032991	CCDS31998.1	13q22.1	2011-05-18			ENSG00000102471	ENSG00000102471			18537	protein-coding gene	gene with protein product		610041				10574461, 12050153	Standard	NM_019080		Approved	KIAA1165, N4wbp5a	uc001vlf.3	Q9NV92	OTTHUMG00000017136	ENST00000218652.7:c.785A>G	13.37:g.80117762A>G	ENSP00000218652:p.Tyr262Cys		Q7Z2H3|Q7Z428|Q8TAR3|Q9ULQ5	Missense_Mutation	SNP	pfam_NEDD4/BSD2	p.Y262C	ENST00000218652.7	37	c.785	CCDS31998.1	13	.	.	.	.	.	.	.	.	.	.	A	24.3	4.520015	0.85495	.	.	ENSG00000102471	ENST00000218652;ENST00000487865	T;D	0.94376	0.84;-3.41	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.96583	0.8885	M	0.79258	2.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.97012	0.9737	10	0.72032	D	0.01	-23.9248	16.2311	0.82343	1.0:0.0:0.0:0.0	.	148;262	B4DGY6;Q9NV92	.;NFIP2_HUMAN	C	262;159	ENSP00000218652:Y262C;ENSP00000419200:Y159C	ENSP00000218652:Y262C	Y	+	2	0	NDFIP2	79015763	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.831000	0.92068	2.234000	0.73211	0.528000	0.53228	TAT	NDFIP2	-	pfam_NEDD4/BSD2	ENSG00000102471		0.378	NDFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDFIP2	HGNC	protein_coding	OTTHUMT00000045380.2	-	0.00	79	0	A			80117762	+1	tier1	-	no_errors	ENST00000218652	ensembl	human	known	74_37	missense	27.06	62	23	SNP	1.000	G
NGF	4803	genome.wustl.edu	37	1	115828865	115828865	+	Silent	SNP	G	G	A	rs532714783		TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr1:115828865G>A	ENST00000369512.2	-	3	720	c.552C>T	c.(550-552)ccC>ccT	p.P184P	RP4-663N10.1_ENST00000425449.1_RNA	NM_002506.2	NP_002497.2	P01138	NGF_HUMAN	nerve growth factor (beta polypeptide)	184					activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|adult locomotory behavior (GO:0008344)|apoptotic signaling pathway (GO:0097190)|circadian rhythm (GO:0007623)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|nerve growth factor processing (GO:0032455)|neuron apoptotic process (GO:0051402)|neuron projection morphogenesis (GO:0048812)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axon extension (GO:0045773)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotrophin TRK receptor signaling pathway (GO:0051388)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|Ras protein signal transduction (GO:0007265)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of neurotransmitter secretion (GO:0046928)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to peptide hormone (GO:0043434)|response to radiation (GO:0009314)|sensory perception of pain (GO:0019233)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)	nerve growth factor receptor binding (GO:0005163)|receptor signaling protein activity (GO:0005057)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	CGCTGTCAACGGGATTTGGGT	0.507																																																	0													96.0	93.0	94.0					1																	115828865		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS882.1	1p13.1	2014-09-17	2008-02-07	2008-02-07	ENSG00000134259	ENSG00000134259		"""Endogenous ligands"""	7808	protein-coding gene	gene with protein product		162030		NGFB			Standard	XM_006710663		Approved		uc001efu.1	P01138	OTTHUMG00000011880	ENST00000369512.2:c.552C>T	1.37:g.115828865G>A			A1A4E5|Q6FHA0|Q96P60|Q9P2Q8|Q9UKL8	Silent	SNP	pirsf_Nerve_growth_factor-like,pfam_Nerve_growth_factor-rel,smart_Nerve_growth_factor-rel,prints_Nerve_growth_factor-rel,prints_Nerve_growth_factor_bsu_mml,prints_Nerve_growth_factor_bsu,pfscan_Nerve_growth_factor-rel	p.P184	ENST00000369512.2	37	c.552	CCDS882.1	1																																																																																			NGF	-	pirsf_Nerve_growth_factor-like,pfam_Nerve_growth_factor-rel,smart_Nerve_growth_factor-rel,prints_Nerve_growth_factor_bsu,pfscan_Nerve_growth_factor-rel	ENSG00000134259		0.507	NGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NGF	HGNC	protein_coding	OTTHUMT00000032832.1	-	0.00	54	0	G	NM_002506		115828865	-1	tier1	-	no_errors	ENST00000369512	ensembl	human	known	74_37	silent	12.90	27	4	SNP	0.841	A
NOTCH3	4854	genome.wustl.edu	37	19	15292541	15292541	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr19:15292541C>T	ENST00000263388.2	-	17	2713	c.2638G>A	c.(2638-2640)Gcc>Acc	p.A880T		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	880	EGF-like 22; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CGTGGGCCGGCGAAACCAGGG	0.677																																																	0													33.0	28.0	30.0					19																	15292541		2184	4290	6474	SO:0001583	missense	0			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.2638G>A	19.37:g.15292541C>T	ENSP00000263388:p.Ala880Thr		Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.A880T	ENST00000263388.2	37	c.2638	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	C	7.937	0.741933	0.15642	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.91686	-2.89	5.45	-0.162	0.13367	EGF (1);EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.32190	N	0.006458	T	0.66257	0.2771	N	0.00754	-1.215	0.09310	N	0.999999	B;B	0.13594	0.003;0.008	B;B	0.14023	0.008;0.01	T	0.61845	-0.6979	10	0.11182	T	0.66	.	0.3536	0.00353	0.1908:0.3018:0.1881:0.3193	.	831;880	Q59FL3;Q9UM47	.;NOTC3_HUMAN	T	880;830	ENSP00000263388:A880T	ENSP00000263388:A880T	A	-	1	0	NOTCH3	15153541	0.000000	0.05858	0.118000	0.21660	0.462000	0.32619	0.009000	0.13219	0.609000	0.30018	0.561000	0.74099	GCC	NOTCH3	-	pirsf_Notch,pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000074181		0.677	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	-	0.00	166	0	C	NM_000435		15292541	-1	tier1	-	no_errors	ENST00000263388	ensembl	human	known	74_37	missense	7.14	117	9	SNP	0.203	T
OR10A5	144124	genome.wustl.edu	37	11	6867223	6867225	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	TTC	TTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr11:6867223_6867225delTTC	ENST00000299454.4	+	1	341_343	c.310_312delTTC	c.(310-312)ttcdel	p.F108del	OR10A5_ENST00000379831.2_In_Frame_Del_p.F112del			Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A, member 5	108					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	21		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TCAGATGTATTTCTTCTTCTTCT	0.517																																					Pancreas(44;21 1072 25662 28041 45559)												0																																										SO:0001651	inframe_deletion	0			AF324499	CCDS7773.1	11p15.4	2012-08-09			ENSG00000166363	ENSG00000166363		"""GPCR / Class A : Olfactory receptors"""	15131	protein-coding gene	gene with protein product		608493		OR10A1			Standard	NM_178168		Approved	OR11-403, JCG6	uc001met.1	Q9H207	OTTHUMG00000165738	ENST00000299454.4:c.310_312delTTC	11.37:g.6867232_6867234delTTC	ENSP00000299454:p.Phe108del		O95223|Q52M66|Q96R21|Q96R22	In_Frame_Del	DEL	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F111in_frame_del	ENST00000299454.4	37	c.322_324	CCDS7773.1	11																																																																																			OR10A5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000166363		0.517	OR10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10A5	HGNC	protein_coding	OTTHUMT00000385983.1		0.00	51	0	TTC	NM_178168		6867225	+1	tier1		no_errors	ENST00000379831	ensembl	human	known	74_37	in_frame_del	6.67	42	3	DEL	0.999:1.000:0.997	-
OR10Z1	128368	genome.wustl.edu	37	1	158577071	158577071	+	Silent	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr1:158577071G>A	ENST00000361284.1	+	1	843	c.843G>A	c.(841-843)gtG>gtA	p.V281V		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					ATACTGTAGTGACCCCCCTCC	0.453																																																	0													230.0	233.0	232.0					1																	158577071		2203	4300	6503	SO:0001819	synonymous_variant	0			AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.843G>A	1.37:g.158577071G>A			Q5VYL0|Q6IFR7	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V281	ENST00000361284.1	37	c.843	CCDS30901.1	1																																																																																			OR10Z1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000198967		0.453	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Z1	HGNC	protein_coding	OTTHUMT00000051853.1	-	0.00	55	0	G	NM_001004478		158577071	+1	tier1	-	no_errors	ENST00000361284	ensembl	human	known	74_37	silent	15.79	48	9	SNP	0.999	A
OSGIN1	29948	genome.wustl.edu	37	16	83992949	83992949	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr16:83992949C>A	ENST00000343939.2	+	4	784	c.401C>A	c.(400-402)cCc>cAc	p.P134H	OSGIN1_ENST00000393306.1_Missense_Mutation_p.P51H|OSGIN1_ENST00000361711.3_Missense_Mutation_p.P51H|OSGIN1_ENST00000565123.1_Missense_Mutation_p.P51H			Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	134					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)		growth factor activity (GO:0008083)			autonomic_ganglia(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12						CACCCACACCCCCTGCTGCAG	0.647																																																	0													100.0	88.0	92.0					16																	83992949		2200	4300	6500	SO:0001583	missense	0			AY258066	CCDS10939.1	16q23.3	2010-11-23			ENSG00000140961	ENSG00000140961			30093	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived growth inhibitor"", ""pregnancy induced growth inhibitor"""	607975				11459809, 14570898	Standard	NM_182981		Approved	BDGI, OKL38	uc002fhc.3	Q9UJX0	OTTHUMG00000137640	ENST00000343939.2:c.401C>A	16.37:g.83992949C>A	ENSP00000343376:p.Pro134His		Q52M33|Q86UQ1|Q96S88|Q9BZ70	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	p.P51H	ENST00000343939.2	37	c.152		16	.	.	.	.	.	.	.	.	.	.	C	15.39	2.818264	0.50633	.	.	ENSG00000140961	ENST00000343939;ENST00000361711;ENST00000393306	T;T;T	0.24908	2.78;1.83;1.83	4.66	4.66	0.58398	.	0.179120	0.49916	D	0.000133	T	0.20251	0.0487	L	0.34521	1.04	0.37412	D	0.913294	P	0.41313	0.745	B	0.35278	0.199	T	0.13899	-1.0492	10	0.39692	T	0.17	-5.5315	16.5258	0.84330	0.0:1.0:0.0:0.0	.	134	Q9UJX0	OSGI1_HUMAN	H	134;51;51	ENSP00000343376:P134H;ENSP00000355374:P51H;ENSP00000376983:P51H	ENSP00000343376:P134H	P	+	2	0	OSGIN1	82550450	0.997000	0.39634	0.975000	0.42487	0.438000	0.31896	3.772000	0.55325	2.147000	0.66899	0.205000	0.17691	CCC	OSGIN1	-	NULL	ENSG00000140961		0.647	OSGIN1-001	PUTATIVE	basic	protein_coding	OSGIN1	HGNC	protein_coding	OTTHUMT00000269081.1		0.00	18	0	C	NM_013370		83992949	+1			no_errors	ENST00000361711	ensembl	human	known	74_37	missense	16.00	21	4	SNP	0.986	A
OTUD6B	51633	genome.wustl.edu	37	8	92090650	92090650	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr8:92090650A>G	ENST00000285420.4	+	4	571	c.472A>G	c.(472-474)Aca>Gca	p.T158A	OTUD6B_ENST00000404789.3_Missense_Mutation_p.T27A	NM_016023.3	NP_057107.3	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	128	Cys-loop. {ECO:0000250}.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.						cysteine-type peptidase activity (GO:0008234)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11			BRCA - Breast invasive adenocarcinoma(11;0.0187)			TGAAAACTTAACAGGAGCCAG	0.373																																																	0													48.0	49.0	48.0					8																	92090650		2202	4296	6498	SO:0001583	missense	0				CCDS6253.2, CCDS69513.1	8q21.3	2013-01-21			ENSG00000155100	ENSG00000155100		"""OTU domain containing"""	24281	protein-coding gene	gene with protein product		612021					Standard	NM_016023		Approved	CGI-77, DUBA5	uc003yeu.4	Q8N6M0	OTTHUMG00000150758	ENST00000285420.4:c.472A>G	8.37:g.92090650A>G	ENSP00000285420:p.Thr158Ala		A8K6I1|B4DEY0|Q9NTA4|Q9Y387	Missense_Mutation	SNP	pfam_OTU,pfam_Peptidase_C65_otubain,pfscan_OTU	p.T158A	ENST00000285420.4	37	c.472	CCDS6253.2	8	.	.	.	.	.	.	.	.	.	.	A	3.447	-0.112870	0.06881	.	.	ENSG00000155100	ENST00000285420;ENST00000404789	T;T	0.43294	0.95;0.97	6.06	-5.61	0.02489	.	0.564000	0.21484	N	0.073782	T	0.20292	0.0488	L	0.28274	0.84	0.20489	N	0.999895	B;B	0.09022	0.002;0.0	B;B	0.06405	0.002;0.001	T	0.39210	-0.9625	10	0.02654	T	1	-6.066	12.6524	0.56768	0.6977:0.0:0.0812:0.2212	.	27;128	B4DEY0;Q8N6M0	.;OTU6B_HUMAN	A	158;27	ENSP00000285420:T158A;ENSP00000384190:T27A	ENSP00000285420:T158A	T	+	1	0	OTUD6B	92159826	0.964000	0.33143	0.569000	0.28460	0.917000	0.54804	0.097000	0.15168	-1.280000	0.02402	-1.329000	0.01275	ACA	OTUD6B	-	NULL	ENSG00000155100		0.373	OTUD6B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	OTUD6B	HGNC	protein_coding	OTTHUMT00000319968.1	-	0.00	37	0	A	NM_016023		92090650	+1	tier1	-	no_errors	ENST00000285420	ensembl	human	known	74_37	missense	30.43	16	7	SNP	0.575	G
PARP4	143	genome.wustl.edu	37	13	25023941	25023941	+	Missense_Mutation	SNP	C	C	A	rs371200121		TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr13:25023941C>A	ENST00000381989.3	-	25	3134	c.3029G>T	c.(3028-3030)cGt>cTt	p.R1010L		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1010	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TAAGACGTGACGATTTGCTGT	0.333																																																	0													69.0	70.0	70.0					13																	25023941		2203	4300	6503	SO:0001583	missense	0			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3029G>T	13.37:g.25023941C>A	ENSP00000371419:p.Arg1010Leu		O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_VIT,pfam_VWF_A,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_VIT,smart_VWF_A,pfscan_BRCT_dom,pfscan_VWF_A,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.R1010L	ENST00000381989.3	37	c.3029	CCDS9307.1	13	.	.	.	.	.	.	.	.	.	.	C	14.44	2.536467	0.45176	.	.	ENSG00000102699	ENST00000381989	T	0.08370	3.1	4.64	2.92	0.33932	von Willebrand factor, type A (3);	0.111378	0.64402	D	0.000006	T	0.14657	0.0354	M	0.80847	2.515	0.47214	D	0.999353	B	0.23058	0.079	B	0.32864	0.154	T	0.01839	-1.1263	10	0.66056	D	0.02	-7.1841	8.7825	0.34800	0.0:0.8151:0.0:0.1849	.	1010	Q9UKK3	PARP4_HUMAN	L	1010	ENSP00000371419:R1010L	ENSP00000371419:R1010L	R	-	2	0	PARP4	23921941	0.999000	0.42202	0.999000	0.59377	0.768000	0.43524	1.033000	0.30191	0.615000	0.30124	0.545000	0.68477	CGT	PARP4	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000102699		0.333	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP4	HGNC	protein_coding	OTTHUMT00000044189.1		0.00	37	0	C	NM_006437		25023941	-1			no_errors	ENST00000381989	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
PCDHA6	56142	genome.wustl.edu	37	5	140209869	140209869	+	Silent	SNP	G	G	A	rs536478075		TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr5:140209869G>A	ENST00000529310.1	+	1	2307	c.2193G>A	c.(2191-2193)gcG>gcA	p.A731A	PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	731					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A731A(5)		NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGAGGGCGCGTGCACGGCGG	0.687																																																	5	Substitution - coding silent(5)	haematopoietic_and_lymphoid_tissue(3)|lung(2)											46.0	45.0	45.0					5																	140209869		2203	4298	6501	SO:0001819	synonymous_variant	0			AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.2193G>A	5.37:g.140209869G>A			O75283|Q9NRT8	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A731	ENST00000529310.1	37	c.2193	CCDS47281.1	5																																																																																			PCDHA6	-	NULL	ENSG00000081842		0.687	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA6	HGNC	protein_coding	OTTHUMT00000372829.3	-	0.00	87	0	G	NM_018909		140209869	+1	tier1	-	no_errors	ENST00000529310	ensembl	human	known	74_37	silent	19.15	38	9	SNP	0.049	A
PDCD11	22984	genome.wustl.edu	37	10	105204417	105204417	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr10:105204417C>A	ENST00000369797.3	+	35	5516	c.5422C>A	c.(5422-5424)Cac>Aac	p.H1808N		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	1808					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GACCATCAAGCACGGCAGCCA	0.602																																																	0													107.0	96.0	100.0					10																	105204417		2203	4300	6503	SO:0001583	missense	0			D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.5422C>A	10.37:g.105204417C>A	ENSP00000358812:p.His1808Asn		Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Suf,superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,smart_HAT,pfscan_TPR-contain_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,prints_Ribosomal_S1	p.H1808N	ENST00000369797.3	37	c.5422	CCDS31276.1	10	.	.	.	.	.	.	.	.	.	.	C	22.0	4.223775	0.79576	.	.	ENSG00000148843	ENST00000369797	T	0.34072	1.38	5.57	3.39	0.38822	Tetratricopeptide-like helical (1);Suppressor of forked (1);	0.134456	0.64402	D	0.000002	T	0.41050	0.1142	L	0.35723	1.085	0.58432	D	0.999994	D	0.59767	0.986	P	0.57009	0.811	T	0.13124	-1.0521	10	0.28530	T	0.3	-5.737	13.0293	0.58833	0.0:0.8471:0.0:0.1529	.	1808	Q14690	RRP5_HUMAN	N	1808	ENSP00000358812:H1808N	ENSP00000358812:H1808N	H	+	1	0	PDCD11	105194407	1.000000	0.71417	0.997000	0.53966	0.964000	0.63967	3.354000	0.52254	1.358000	0.45922	0.561000	0.74099	CAC	PDCD11	-	pfam_Suf	ENSG00000148843		0.602	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD11	HGNC	protein_coding	OTTHUMT00000050151.1	-	0.00	36	0	C			105204417	+1	tier1	-	no_errors	ENST00000369797	ensembl	human	known	74_37	missense	40.00	18	12	SNP	1.000	A
PIGR	5284	genome.wustl.edu	37	1	207109009	207109009	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr1:207109009G>T	ENST00000356495.4	-	5	1383	c.1200C>A	c.(1198-1200)gaC>gaA	p.D400E		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	400	Ig-like V-type 4.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						ACCCCTCGCTGTCCACCAGCA	0.627											OREG0014186	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													23.0	28.0	26.0					1																	207109009		2203	4300	6503	SO:0001583	missense	0				CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.1200C>A	1.37:g.207109009G>T	ENSP00000348888:p.Asp400Glu	2165	Q68D81|Q8IZY7	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.D400E	ENST00000356495.4	37	c.1200	CCDS1474.1	1	.	.	.	.	.	.	.	.	.	.	C	1.915	-0.449798	0.04572	.	.	ENSG00000162896	ENST00000356495	T	0.64260	-0.09	5.28	-7.56	0.01322	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	2.810530	0.00897	N	0.002302	T	0.36054	0.0953	N	0.02379	-0.575	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.50783	-0.8787	10	0.07644	T	0.81	-23.5482	19.3309	0.94288	0.1581:0.1118:0.7301:0.0	.	400	P01833	PIGR_HUMAN	E	400	ENSP00000348888:D400E	ENSP00000348888:D400E	D	-	3	2	PIGR	205175632	0.000000	0.05858	0.000000	0.03702	0.575000	0.36095	-1.482000	0.02320	-1.325000	0.02269	-0.120000	0.15030	GAC	PIGR	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr	ENSG00000162896		0.627	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGR	HGNC	protein_coding	OTTHUMT00000088975.1	-	0.00	73	0	G	NM_002644		207109009	-1	tier1	-	no_errors	ENST00000356495	ensembl	human	known	74_37	missense	19.54	70	17	SNP	0.000	T
PISD	23761	genome.wustl.edu	37	22	32019717	32019717	+	Intron	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr22:32019717C>T	ENST00000439502.2	-	4	545				PISD_ENST00000336566.4_Intron|PISD_ENST00000382151.2_Missense_Mutation_p.G58S|PISD_ENST00000397500.1_Missense_Mutation_p.G58S|PISD_ENST00000478893.1_5'UTR|PISD_ENST00000266095.5_Missense_Mutation_p.G58S			Q9UG56	PISD_HUMAN	phosphatidylserine decarboxylase						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatidylserine decarboxylase activity (GO:0004609)			central_nervous_system(3)|endometrium(2)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12					Phosphatidylserine(DB00144)	CTGAGGGCGCCGAAGGGCAGG	0.682																																																	0													79.0	67.0	71.0					22																	32019717		2203	4300	6503	SO:0001627	intron_variant	0				CCDS13899.1	22q12.2	2011-01-25			ENSG00000241878	ENSG00000241878	4.1.1.65		8999	protein-coding gene	gene with protein product		612770				10591208	Standard	NM_014338		Approved	dJ858B16.2, PSDC	uc003alk.2	Q9UG56	OTTHUMG00000030252	ENST00000439502.2:c.322-1846G>A	22.37:g.32019717C>T			B1AKM7|O43207|O95535|Q6IC28|Q96GQ2|Q9UGA9	Missense_Mutation	SNP	pfam_PS_Dcarbxylase,tigrfam_PS_decarb	p.G58S	ENST00000439502.2	37	c.172		22	.	.	.	.	.	.	.	.	.	.	C	20.3	3.975261	0.74360	.	.	ENSG00000241878	ENST00000382151;ENST00000266095;ENST00000397500;ENST00000451635;ENST00000422020;ENST00000442379;ENST00000431201;ENST00000429683	.	.	.	5.61	4.59	0.56863	.	.	.	.	.	T	0.52008	0.1708	L	0.29908	0.895	0.40090	D	0.976246	B;B	0.16802	0.019;0.013	B;B	0.11329	0.004;0.006	T	0.48854	-0.8998	8	0.44086	T	0.13	.	15.8748	0.79154	0.0:0.8646:0.1354:0.0	.	58;58	B1AKM6;Q9UG56-2	.;.	S	58	.	ENSP00000266095:G58S	G	-	1	0	PISD	30349717	1.000000	0.71417	0.787000	0.31911	0.989000	0.77384	4.734000	0.62043	1.337000	0.45525	0.591000	0.81541	GGC	PISD	-	NULL	ENSG00000241878		0.682	PISD-001	KNOWN	basic	protein_coding	PISD	HGNC	protein_coding	OTTHUMT00000075106.4		0.00	75	0	C			32019717	-1			no_errors	ENST00000266095	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
PLG	5340	genome.wustl.edu	37	6	161134305	161134306	+	Intron	INS	-	-	T	rs113752311|rs140653624|rs528521448	byFrequency	TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr6:161134305_161134306insT	ENST00000308192.9	+	5	610				PLG_ENST00000462918.1_3'UTR	NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen						blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	ATTAACCTGAAttttttttttt	0.436																																																	0																																										SO:0001627	intron_variant	0			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.547+148->T	6.37:g.161134316_161134316dupT			Q15146|Q5TEH4|Q6PA00	RNA	INS	-	NULL	ENST00000308192.9	37	NULL	CCDS5279.1	6																																																																																			PLG	-	-	ENSG00000122194		0.436	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	HGNC	protein_coding	OTTHUMT00000042959.2		0.00	9	0	-	NM_000301		161134306	+1	tier1		no_errors	ENST00000462918	ensembl	human	known	74_37	rna	33.33	12	6	INS	0.002:0.003	T
PRLR	5618	genome.wustl.edu	37	5	35072680	35072680	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr5:35072680C>T	ENST00000382002.5	-	6	966	c.540G>A	c.(538-540)tgG>tgA	p.W180*	PRLR_ENST00000511486.1_Nonsense_Mutation_p.W79*|PRLR_ENST00000342362.5_Nonsense_Mutation_p.W79*|PRLR_ENST00000509934.1_5'UTR|PRLR_ENST00000348262.3_Nonsense_Mutation_p.W180*|PRLR_ENST00000513753.1_Nonsense_Mutation_p.W180*|PRLR_ENST00000231423.3_Nonsense_Mutation_p.W180*|PRLR_ENST00000542609.1_Nonsense_Mutation_p.W180*|PRLR_ENST00000397391.3_Nonsense_Mutation_p.W109*|PRLR_ENST00000310101.5_Nonsense_Mutation_p.W180*	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	180	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	CACTCACCTCCCACTCAGCTG	0.438																																																	0													122.0	119.0	120.0					5																	35072680		2203	4300	6503	SO:0001587	stop_gained	0				CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.540G>A	5.37:g.35072680C>T	ENSP00000371432:p.Trp180*		B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Nonsense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.W180*	ENST00000382002.5	37	c.540	CCDS3909.1	5	.	.	.	.	.	.	.	.	.	.	C	23.7	4.445153	0.83993	.	.	ENSG00000113494	ENST00000231423;ENST00000513753;ENST00000348262;ENST00000397391;ENST00000542609;ENST00000342362;ENST00000382002;ENST00000511486;ENST00000310101	.	.	.	5.68	5.68	0.88126	.	0.104277	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.6453	19.7781	0.96402	0.0:1.0:0.0:0.0	.	.	.	.	X	180;180;180;109;180;79;180;79;180	.	ENSP00000231423:W180X	W	-	3	0	PRLR	35108437	1.000000	0.71417	1.000000	0.80357	0.571000	0.35966	6.210000	0.72176	2.694000	0.91930	0.650000	0.86243	TGG	PRLR	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000113494		0.438	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLR	HGNC	protein_coding	OTTHUMT00000207575.2	-	0.00	32	0	C			35072680	-1	tier1	-	no_errors	ENST00000382002	ensembl	human	known	74_37	nonsense	29.09	39	16	SNP	1.000	T
PROKR2	128674	genome.wustl.edu	37	20	5282783	5282783	+	Missense_Mutation	SNP	C	C	T	rs576243101		TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr20:5282783C>T	ENST00000217270.3	-	2	1057	c.1058G>A	c.(1057-1059)cGt>cAt	p.R353H	PROKR2_ENST00000546004.1_Missense_Mutation_p.R353H	NM_144773.2	NP_658986.1	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	353					circadian rhythm (GO:0007623)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)	p.R353H(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(3)|lung(22)|ovary(5)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	53						CTGGGAGGGACGCCAGTGCAG	0.557										HNSCC(71;0.22)			C|||	1	0.000199681	0.0008	0.0	5008	,	,		24072	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	ovary(1)											206.0	166.0	179.0					20																	5282783		2203	4300	6503	SO:0001583	missense	0			AL121755	CCDS13089.1	20p12.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000101292	ENSG00000101292		"""GPCR / Class A : Prokineticin receptors"""	15836	protein-coding gene	gene with protein product		607123	"""G protein-coupled receptor 73-like 1"", ""Kallmann syndrome 3 (autosomal dominant)"""	GPR73L1, KAL3		11886876, 17054399	Standard	NM_144773		Approved	GPR73b, PKR2, GPRg2, dJ680N4.3	uc010zqw.2	Q8NFJ6	OTTHUMG00000031800	ENST00000217270.3:c.1058G>A	20.37:g.5282783C>T	ENSP00000217270:p.Arg353His		A5JUU1|Q2M3C0|Q5TDY1|Q9NTT0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.R353H	ENST00000217270.3	37	c.1058	CCDS13089.1	20	.	.	.	.	.	.	.	.	.	.	C	16.00	2.999680	0.54147	.	.	ENSG00000101292	ENST00000546004;ENST00000217270	T;T	0.38401	1.14;1.14	5.05	4.1	0.47936	.	0.060269	0.64402	D	0.000009	T	0.34048	0.0884	M	0.62723	1.935	0.49213	D	0.999764	P	0.49447	0.924	B	0.40038	0.317	T	0.23084	-1.0198	10	0.44086	T	0.13	.	11.623	0.51130	0.0:0.9101:0.0:0.0899	.	353	Q8NFJ6	PKR2_HUMAN	H	353	ENSP00000440790:R353H;ENSP00000217270:R353H	ENSP00000217270:R353H	R	-	2	0	PROKR2	5230783	0.141000	0.22595	0.989000	0.46669	0.516000	0.34256	0.683000	0.25349	2.370000	0.80446	0.655000	0.94253	CGT	PROKR2	-	NULL	ENSG00000101292		0.557	PROKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROKR2	HGNC	protein_coding	OTTHUMT00000077854.1	-	0.00	67	0	C	NM_144773		5282783	-1	tier1	-	no_errors	ENST00000217270	ensembl	human	known	74_37	missense	28.05	59	23	SNP	0.996	T
PROCR	10544	genome.wustl.edu	37	20	33764528	33764528	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr20:33764528C>T	ENST00000216968.4	+	4	711	c.629C>T	c.(628-630)tCg>tTg	p.S210L	EDEM2_ENST00000540582.1_Intron	NM_006404.3	NP_006395.2	Q9UNN8	EPCR_HUMAN	protein C receptor, endothelial	210					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|immune response (GO:0006955)|negative regulation of coagulation (GO:0050819)	cell surface (GO:0009986)|centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)	TCCTACACTTCGCTGGTCCTG	0.542																																																	0													89.0	70.0	76.0					20																	33764528		2203	4300	6503	SO:0001583	missense	0			L35545	CCDS13248.1	20q11.2	2010-05-04	2010-05-04		ENSG00000101000	ENSG00000101000		"""CD molecules"""	9452	protein-coding gene	gene with protein product		600646				7929370, 10518938	Standard	NM_006404		Approved	EPCR, CCD41, CD201	uc002xbt.3	Q9UNN8	OTTHUMG00000032323	ENST00000216968.4:c.629C>T	20.37:g.33764528C>T	ENSP00000216968:p.Ser210Leu		B2RC04|Q14218|Q6IB56|Q96CB3|Q9ULX1	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	p.S210L	ENST00000216968.4	37	c.629	CCDS13248.1	20	.	.	.	.	.	.	.	.	.	.	C	15.07	2.723607	0.48728	.	.	ENSG00000101000	ENST00000374477;ENST00000216968	T	0.05258	3.47	5.75	4.62	0.57501	.	0.465718	0.20052	N	0.100262	T	0.03220	0.0094	N	0.19112	0.55	0.26331	N	0.977513	P	0.44659	0.84	B	0.21708	0.036	T	0.44590	-0.9318	10	0.48119	T	0.1	-5.9852	10.5268	0.44954	0.0:0.8996:0.0:0.1004	.	210	Q9UNN8	EPCR_HUMAN	L	210	ENSP00000216968:S210L	ENSP00000216968:S210L	S	+	2	0	PROCR	33228189	0.028000	0.19301	0.989000	0.46669	0.832000	0.47134	2.529000	0.45632	2.725000	0.93324	0.655000	0.94253	TCG	PROCR	-	NULL	ENSG00000101000		0.542	PROCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROCR	HGNC	protein_coding	OTTHUMT00000078843.3		0.00	46	0	C			33764528	+1			no_errors	ENST00000216968	ensembl	human	known	74_37	missense	5.00	57	3	SNP	0.668	T
PRSS42	339906	genome.wustl.edu	37	3	46875457	46875457	+	Silent	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr3:46875457G>A	ENST00000429665.1	-	1	128	c.129C>T	c.(127-129)ggC>ggT	p.G43G	PRSS42_ENST00000447340.1_5'Flank	NM_182702.1	NP_874361.1	Q7Z5A4	PRS42_HUMAN	protease, serine, 42	43					germ cell development (GO:0007281)|spermatogenesis (GO:0007283)	anchored component of plasma membrane (GO:0046658)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)	8						CGGGGTTCTCGCCGCCCTCCT	0.692																																																	0													7.0	10.0	9.0					3																	46875457		1769	3930	5699	SO:0001819	synonymous_variant	0				CCDS46816.1	3p21.31	2010-05-07			ENSG00000178055	ENSG00000178055		"""Serine peptidases / Serine peptidases"""	30716	protein-coding gene	gene with protein product	"""testis serine protease 2"""					12838346	Standard	NM_182702		Approved	TESSP2	uc011bap.2	Q7Z5A4	OTTHUMG00000156496	ENST00000429665.1:c.129C>T	3.37:g.46875457G>A				Silent	SNP	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.G43	ENST00000429665.1	37	c.129	CCDS46816.1	3																																																																																			PRSS42	-	NULL	ENSG00000178055		0.692	PRSS42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS42	HGNC	protein_coding	OTTHUMT00000344347.1	-	0.00	80	0	G	NM_182702		46875457	-1	tier1	-	no_errors	ENST00000429665	ensembl	human	known	74_37	silent	7.69	60	5	SNP	0.000	A
PSMC4	5704	genome.wustl.edu	37	19	40480482	40480482	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr19:40480482A>T	ENST00000157812.2	+	5	719	c.521A>T	c.(520-522)aAg>aTg	p.K174M	PSMC4_ENST00000455878.2_Missense_Mutation_p.K143M	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	174					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					GACATCCAGAAGCAGGAGGTG	0.642																																					Colon(105;1478 1543 4034 6132 38638)												0													63.0	67.0	66.0					19																	40480482		2203	4300	6503	SO:0001583	missense	0			U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.521A>T	19.37:g.40480482A>T	ENSP00000157812:p.Lys174Met		Q96FV5|Q9UBM3|Q9UEX3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.K174M	ENST00000157812.2	37	c.521	CCDS12547.1	19	.	.	.	.	.	.	.	.	.	.	a	13.45	2.241619	0.39598	.	.	ENSG00000013275	ENST00000157812;ENST00000455878	D;D	0.95756	-3.8;-3.8	5.04	0.0891	0.14457	.	0.000000	0.85682	D	0.000000	D	0.96405	0.8827	M	0.70787	2.145	0.58432	D	0.999997	P;D	0.89917	0.929;1.0	P;D	0.79784	0.729;0.993	D	0.94289	0.7527	10	0.49607	T	0.09	-7.2275	9.9204	0.41462	0.4749:0.0:0.0:0.5251	.	143;174	P43686-2;P43686	.;PRS6B_HUMAN	M	174;143	ENSP00000157812:K174M;ENSP00000413869:K143M	ENSP00000157812:K174M	K	+	2	0	PSMC4	45172322	1.000000	0.71417	0.899000	0.35326	0.004000	0.04260	4.817000	0.62650	-0.054000	0.13266	-0.516000	0.04426	AAG	PSMC4	-	superfamily_P-loop_NTPase,tigrfam_26S_Psome_P45	ENSG00000013275		0.642	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMC4	HGNC	protein_coding	OTTHUMT00000462485.1	-	0.00	18	0	A	NM_006503		40480482	+1	tier1	-	no_errors	ENST00000157812	ensembl	human	known	74_37	missense	27.78	13	5	SNP	0.990	T
PTPRF	5792	genome.wustl.edu	37	1	44086782	44086782	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr1:44086782G>T	ENST00000359947.4	+	33	5874	c.5534G>T	c.(5533-5535)cGc>cTc	p.R1845L	PTPRF_ENST00000372413.3_Missense_Mutation_p.R1836L|PTPRF_ENST00000438120.1_Missense_Mutation_p.R1836L|PTPRF_ENST00000372414.3_Missense_Mutation_p.R1845L|PTPRF_ENST00000422171.2_Missense_Mutation_p.R1204L|PTPRF_ENST00000496447.1_3'UTR	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1845	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GGCGTGGGCCGCACCGGGGTG	0.627																																																	0													63.0	55.0	58.0					1																	44086782		2203	4300	6503	SO:0001583	missense	0			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.5534G>T	1.37:g.44086782G>T	ENSP00000353030:p.Arg1845Leu		D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt	p.R1845L	ENST00000359947.4	37	c.5534	CCDS489.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.266565|5.266565	0.95399|0.95399	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000429895|ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171;ENST00000372407	.|T;T;T;T;T;T	.|0.42900	.|0.96;0.96;0.96;0.96;0.96;0.96	4.92|4.92	4.92|4.92	0.64577|0.64577	.|Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	.|0.000000	.|0.34828	.|N	.|0.003651	T|T	0.77485|0.77485	0.4137|0.4137	H|H	0.96576|0.96576	3.845|3.845	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.999;1.0	.|D;D;D;D;D	.|0.97110	.|0.983;0.999;1.0;0.993;1.0	D|D	0.85624|0.85624	0.1266|0.1266	5|10	.|0.87932	.|D	.|0	.|.	19.0214|19.0214	0.92917|0.92917	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1490;1204;1422;1836;1845	.|Q59FI2;F2Z3B8;Q5W9G3;P10586-2;P10586	.|.;.;.;.;PTPRF_HUMAN	S|L	1491|1845;1836;1845;1836;1204;917	.|ENSP00000353030:R1845L;ENSP00000398822:R1836L;ENSP00000361491:R1845L;ENSP00000361490:R1836L;ENSP00000387885:R1204L;ENSP00000361484:R917L	.|ENSP00000353030:R1845L	A|R	+|+	1|2	0|0	PTPRF|PTPRF	43859369|43859369	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.801000|9.801000	0.99128|0.99128	2.664000|2.664000	0.90586|0.90586	0.650000|0.650000	0.86243|0.86243	GCA|CGC	PTPRF	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000142949		0.627	PTPRF-001	KNOWN	basic|CCDS	protein_coding	PTPRF	HGNC	protein_coding	OTTHUMT00000019710.1		0.00	73	0	G			44086782	+1			no_errors	ENST00000359947	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	T
RABL6	55684	genome.wustl.edu	37	9	139733890	139733891	+	Frame_Shift_Ins	INS	-	-	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr9:139733890_139733891insT	ENST00000311502.7	+	12	1946_1947	c.1710_1711insT	c.(1711-1713)gatfs	p.D571fs	RABL6_ENST00000371675.3_Frame_Shift_Ins_p.D456fs|RABL6_ENST00000357466.2_Intron|RABL6_ENST00000432842.2_3'UTR|RABL6_ENST00000371663.4_Frame_Shift_Ins_p.D572fs			Q3YEC7	RABL6_HUMAN	RAB, member RAS oncogene family-like 6	571					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										CCTTCGTCATGGATGACCCCGA	0.653																																																	0																																										SO:0001589	frameshift_variant	0			AK094382	CCDS48058.1, CCDS55352.1, CCDS55353.1	9q34.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000196642	ENSG00000196642			24703	protein-coding gene	gene with protein product	"""Rab-like protein 1"", ""partner of ARF"""	610615	"""chromosome 9 open reading frame 86"""	C9orf86		14702039, 16582619, 17962191, 19433581	Standard	NM_024718		Approved	FLJ10101, FLJ13045, pp8875, bA216L13.9, Parf, RBEL1	uc004cjj.1	Q3YEC7	OTTHUMG00000020947	Exception_encountered	9.37:g.139733890_139733891insT	ENSP00000311134:p.Asp571fs		A8QVZ7|A8QVZ8|C6K8I4|C6K8I5|Q4F968|Q5T5R7|Q8IWK1|Q8TCL4|Q8WU94|Q96SR8|Q9BU21|Q9H935	Frame_Shift_Ins	INS	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Rab_type,prints_Small_GTPase	p.D571fs	ENST00000311502.7	37	c.1713_1714	CCDS48058.1	9																																																																																			RABL6	-	NULL	ENSG00000196642		0.653	RABL6-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	RABL6	HGNC	protein_coding	OTTHUMT00000055141.4		0.00	105	0	-	NM_024718		139733891	+1	tier1		no_errors	ENST00000371663	ensembl	human	known	74_37	frame_shift_ins	15.69	43	8	INS	1.000:1.000	T
RADIL	55698	genome.wustl.edu	37	7	4917679	4917679	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr7:4917679G>A	ENST00000399583.3	-	2	279	c.92C>T	c.(91-93)aCg>aTg	p.T31M	RADIL_ENST00000536091.1_Missense_Mutation_p.T31M	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	31					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)		p.T31M(1)		NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		GTAGCTCAGCGTCCGGGACAG	0.627																																																	1	Substitution - Missense(1)	endometrium(1)											22.0	26.0	25.0					7																	4917679		2074	4203	6277	SO:0001583	missense	0			AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.92C>T	7.37:g.4917679G>A	ENSP00000382492:p.Thr31Met		A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Missense_Mutation	SNP	pfam_Dil_domain,pfam_Ras-assoc,pfam_PDZ,superfamily_PDZ,superfamily_SMAD_FHA_domain,smart_Ras-assoc,smart_PDZ,pfscan_Dilute,pfscan_PDZ,pfscan_Ras-assoc	p.T31M	ENST00000399583.3	37	c.92	CCDS43544.1	7	.	.	.	.	.	.	.	.	.	.	G	16.39	3.109413	0.56398	.	.	ENSG00000157927	ENST00000399583;ENST00000316919;ENST00000536091;ENST00000457174	T;T	0.29397	2.96;1.57	5.84	4.97	0.65823	.	0.072733	0.64402	D	0.000011	T	0.50394	0.1613	M	0.61703	1.905	0.39690	D	0.971032	D	0.89917	1.0	D	0.68621	0.959	T	0.56080	-0.8038	10	0.87932	D	0	-25.5285	12.316	0.54958	0.0777:0.0:0.9223:0.0	.	31	Q96JH8	RADIL_HUMAN	M	31;5;31;31	ENSP00000382492:T31M;ENSP00000442533:T31M	ENSP00000320946:T5M	T	-	2	0	RADIL	4884205	1.000000	0.71417	0.968000	0.41197	0.356000	0.29392	5.937000	0.70162	1.487000	0.48415	0.561000	0.74099	ACG	RADIL	-	NULL	ENSG00000157927		0.627	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RADIL	HGNC	protein_coding	OTTHUMT00000323769.2	-	0.00	51	0	G	NM_018059		4917679	-1	tier1	-	no_errors	ENST00000399583	ensembl	human	known	74_37	missense	26.32	27	10	SNP	0.965	A
REV1	51455	genome.wustl.edu	37	2	100019518	100019518	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr2:100019518C>G	ENST00000258428.3	-	20	3446	c.3218G>C	c.(3217-3219)aGa>aCa	p.R1073T	REV1_ENST00000393445.3_Missense_Mutation_p.R1072T|RP11-527J8.1_ENST00000608144.1_RNA|REV1_ENST00000465835.1_Intron	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	1073					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						cttcttgtttcttttcttttc	0.383								Direct reversal of damage																																									0													57.0	54.0	55.0					2																	100019518		2203	4300	6503	SO:0001583	missense	0			AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.3218G>C	2.37:g.100019518C>G	ENSP00000258428:p.Arg1073Thr		O95941|Q53SI7|Q9C0J4|Q9NUP2	Missense_Mutation	SNP	pfam_DNA_repair_prot_UmuC-like,pfam_DNA_pol_Y-fam_little_finger,pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_DNA_pol_Y-fam_little_finger,smart_BRCT_dom,pirsf_REV1,pfscan_BRCT_dom,pfscan_DNA_repair_prot_UmuC-like_N	p.R1073T	ENST00000258428.3	37	c.3218	CCDS2045.1	2	.	.	.	.	.	.	.	.	.	.	C	8.674	0.903581	0.17760	.	.	ENSG00000135945	ENST00000393445;ENST00000258428	T;T	0.35605	1.3;1.3	5.95	1.38	0.22167	.	0.232564	0.49305	D	0.000152	T	0.41396	0.1157	M	0.64997	1.995	0.22213	N	0.999284	B;P	0.45827	0.321;0.867	B;P	0.49332	0.101;0.607	T	0.27872	-1.0061	10	0.62326	D	0.03	.	9.279	0.37716	0.0:0.469:0.0:0.531	.	1073;1072	Q9UBZ9;Q9UBZ9-2	REV1_HUMAN;.	T	1072;1073	ENSP00000377091:R1072T;ENSP00000258428:R1073T	ENSP00000258428:R1073T	R	-	2	0	REV1	99385950	0.977000	0.34250	0.598000	0.28837	0.125000	0.20455	0.755000	0.26405	0.340000	0.23745	-0.137000	0.14449	AGA	REV1	-	pirsf_REV1	ENSG00000135945		0.383	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REV1	HGNC	protein_coding	OTTHUMT00000253123.2		0.00	31	0	C	NM_016316		100019518	-1			no_errors	ENST00000258428	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.311	G
RHBDD3	25807	genome.wustl.edu	37	22	29661510	29661510	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr22:29661510C>T	ENST00000216085.7	-	3	530	c.106G>A	c.(106-108)Ggc>Agc	p.G36S	EWSR1_ENST00000331029.7_5'Flank|EWSR1_ENST00000333395.6_5'Flank|EWSR1_ENST00000332050.6_5'Flank|EWSR1_ENST00000332035.6_5'Flank|EWSR1_ENST00000406548.1_5'Flank|EWSR1_ENST00000414183.2_5'Flank|EWSR1_ENST00000397938.2_5'Flank	NM_012265.1	NP_036397.1	Q9Y3P4	RHBD3_HUMAN	rhomboid domain containing 3	36					liver development (GO:0001889)|MAPK cascade (GO:0000165)|negative regulation of natural killer cell activation (GO:0032815)|positive regulation of protein catabolic process (GO:0045732)|regulation of acute inflammatory response (GO:0002673)|regulation of protein secretion (GO:0050708)|response to xenobiotic stimulus (GO:0009410)	integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			lung(1)|ovary(1)	2						AGGACCAGGCCGGGGCCGGCC	0.697																																																	0													16.0	19.0	18.0					22																	29661510		2200	4297	6497	SO:0001583	missense	0			AL050346	CCDS13850.1	22q12.2	2006-02-22	2006-02-22	2006-02-22	ENSG00000100263	ENSG00000100263			1308	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 3"""	C22orf3		10591208, 15105437	Standard	NM_012265		Approved	PTAG	uc003aeq.1	Q9Y3P4	OTTHUMG00000151032	ENST00000216085.7:c.106G>A	22.37:g.29661510C>T	ENSP00000216085:p.Gly36Ser		Q6I9X3|Q9UGQ7	Missense_Mutation	SNP	pfam_Peptidase_S54_rhomboid_dom,superfamily_UBA-like	p.G36S	ENST00000216085.7	37	c.106	CCDS13850.1	22	.	.	.	.	.	.	.	.	.	.	C	0.125	-1.121239	0.01785	.	.	ENSG00000100263	ENST00000216085;ENST00000414672;ENST00000406335	T;T;T	0.27557	1.66;1.66;1.66	4.18	3.14	0.36123	.	0.274297	0.33650	N	0.004693	T	0.08582	0.0213	N	0.01874	-0.695	0.20638	N	0.999878	B	0.02656	0.0	B	0.01281	0.0	T	0.37753	-0.9692	10	0.02654	T	1	-9.2713	5.9356	0.19163	0.0:0.2174:0.0:0.7826	.	36	Q9Y3P4	RHBD3_HUMAN	S	36	ENSP00000216085:G36S;ENSP00000413128:G36S;ENSP00000384113:G36S	ENSP00000216085:G36S	G	-	1	0	RHBDD3	27991510	1.000000	0.71417	1.000000	0.80357	0.266000	0.26442	1.993000	0.40747	0.598000	0.29829	-0.340000	0.08031	GGC	RHBDD3	-	NULL	ENSG00000100263		0.697	RHBDD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHBDD3	HGNC	protein_coding	OTTHUMT00000321085.1	-	0.00	51	0	C	NM_012265		29661510	-1	tier1	-	no_errors	ENST00000216085	ensembl	human	known	74_37	missense	13.46	45	7	SNP	1.000	T
RRP12	23223	genome.wustl.edu	37	10	99160097	99160097	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr10:99160097G>A	ENST00000370992.4	-	2	445	c.334C>T	c.(334-336)Cgc>Tgc	p.R112C	RP11-452K12.7_ENST00000422848.1_RNA|RRP12_ENST00000414986.1_Missense_Mutation_p.R112C|RRP12_ENST00000315563.6_Missense_Mutation_p.R112C	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	112						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		TCCCAGAAGCGCTGTACTTTG	0.577																																																	0													141.0	138.0	139.0					10																	99160097		2203	4300	6503	SO:0001583	missense	0				CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.334C>T	10.37:g.99160097G>A	ENSP00000360031:p.Arg112Cys		B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Missense_Mutation	SNP	pfam_Uncharacterised_NUC173,superfamily_ARM-type_fold	p.R112C	ENST00000370992.4	37	c.334	CCDS7457.1	10	.	.	.	.	.	.	.	.	.	.	G	29.5	5.013025	0.93346	.	.	ENSG00000052749	ENST00000370992;ENST00000315563;ENST00000414986	T;T;T	0.37411	1.27;1.2;1.23	5.7	5.7	0.88788	Armadillo-type fold (1);	0.050919	0.85682	N	0.000000	T	0.62624	0.2443	M	0.83953	2.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.87578	0.996;0.998;0.8	T	0.65788	-0.6083	10	0.59425	D	0.04	-7.8394	13.5515	0.61734	0.0:0.0:0.844:0.156	.	112;112;112	E9PCK7;Q5JTH9-2;Q5JTH9	.;.;RRP12_HUMAN	C	112	ENSP00000360031:R112C;ENSP00000324315:R112C;ENSP00000414863:R112C	ENSP00000324315:R112C	R	-	1	0	RRP12	99150087	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.274000	0.65569	2.693000	0.91896	0.462000	0.41574	CGC	RRP12	-	superfamily_ARM-type_fold	ENSG00000052749		0.577	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RRP12	HGNC	protein_coding	OTTHUMT00000049699.4	-	0.00	35	0	G	NM_015179		99160097	-1	tier1	-	no_errors	ENST00000370992	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	A
SBSN	374897	genome.wustl.edu	37	19	36018103	36018103	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr19:36018103A>C	ENST00000452271.2	-	1	1109	c.1081T>G	c.(1081-1083)Ttt>Gtt	p.F361V	SBSN_ENST00000518157.1_Intron	NM_001166034.1	NP_001159506.1	Q6UWP8	SBSN_HUMAN	suprabasin	361	Ala/Gly/His-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				large_intestine(5)|lung(6)|ovary(1)|prostate(2)	14	all_lung(56;1.62e-08)|Lung NSC(56;2.47e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			TCCTTCCCAAACTGACTGGCA	0.592																																																	0													48.0	48.0	48.0					19																	36018103		692	1591	2283	SO:0001583	missense	0			AY358701	CCDS12464.1, CCDS54253.1	19q13.13	2008-02-05							24950	protein-coding gene	gene with protein product		609969				12228223	Standard	NM_198538		Approved	UNQ698, HLAR698	uc002oad.2	Q6UWP8		ENST00000452271.2:c.1081T>G	19.37:g.36018103A>C	ENSP00000430242:p.Phe361Val		A8K5J0|E9PBV3	Missense_Mutation	SNP	NULL	p.F361V	ENST00000452271.2	37	c.1081	CCDS54253.1	19	.	.	.	.	.	.	.	.	.	.	a	0.098	-1.155852	0.01686	.	.	ENSG00000189001	ENST00000452271	T	0.39406	1.08	4.43	-3.48	0.04739	.	.	.	.	.	T	0.13372	0.0324	N	0.02011	-0.69	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.13953	-1.0490	9	0.52906	T	0.07	.	1.471	0.02416	0.1398:0.3796:0.1326:0.348	.	361	E9PBV3	.	V	361	ENSP00000430242:F361V	ENSP00000430242:F361V	F	-	1	0	SBSN	40709943	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-0.563000	0.05943	-0.646000	0.05452	-2.120000	0.00349	TTT	SBSN	-	NULL	ENSG00000189001		0.592	SBSN-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	SBSN	HGNC	protein_coding	OTTHUMT00000109463.3		0.00	113	0	A	NM_198538		36018103	-1			no_errors	ENST00000452271	ensembl	human	novel	74_37	missense	5.26	90	5	SNP	0.001	C
SDAD1	55153	genome.wustl.edu	37	4	76902592	76902592	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr4:76902592T>C	ENST00000356260.5	-	3	345	c.227A>G	c.(226-228)aAt>aGt	p.N76S	RP11-630D6.5_ENST00000501239.2_RNA|SDAD1_ENST00000395711.4_Missense_Mutation_p.N76S	NM_018115.2	NP_060585.2	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	76					actin cytoskeleton organization (GO:0030036)|protein transport (GO:0015031)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal large subunit export from nucleus (GO:0000055)	nucleolus (GO:0005730)				breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	19			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TTGAGGAAAATTACTTAGGTA	0.403																																																	0													128.0	122.0	124.0					4																	76902592		2203	4300	6503	SO:0001583	missense	0			AF132198	CCDS3573.2, CCDS75147.1	4q21.21	2010-11-24			ENSG00000198301	ENSG00000198301			25537	protein-coding gene	gene with protein product						11483580	Standard	NM_001288984		Approved	FLJ10498	uc003hje.4	Q9NVU7	OTTHUMG00000130111	ENST00000356260.5:c.227A>G	4.37:g.76902592T>C	ENSP00000348596:p.Asn76Ser		Q32Q11|Q68D52|Q7Z5U4|Q9H831|Q9H9P6	Missense_Mutation	SNP	pfam_SDA1_dom,pfam_Uncharacterised_NUC130/133_N,superfamily_ARM-type_fold	p.N76S	ENST00000356260.5	37	c.227	CCDS3573.2	4	.	.	.	.	.	.	.	.	.	.	T	8.850	0.944319	0.18356	.	.	ENSG00000198301	ENST00000356260;ENST00000395711	T;T	0.12774	2.68;2.65	5.18	4.0	0.46444	Uncharacterised domain NUC130/133, N-terminal (1);Armadillo-type fold (1);	0.470935	0.25854	N	0.027862	T	0.08044	0.0201	N	0.24115	0.695	0.28161	N	0.928997	B;B	0.09022	0.001;0.002	B;B	0.09377	0.004;0.004	T	0.35500	-0.9786	10	0.11182	T	0.66	-10.42	8.8751	0.35340	0.0:0.0895:0.0:0.9105	.	76;76	E7EW05;Q9NVU7	.;SDA1_HUMAN	S	76	ENSP00000348596:N76S;ENSP00000379061:N76S	ENSP00000348596:N76S	N	-	2	0	SDAD1	77121616	0.920000	0.31207	0.997000	0.53966	0.606000	0.37113	0.672000	0.25187	0.809000	0.34255	0.528000	0.53228	AAT	SDAD1	-	pfam_Uncharacterised_NUC130/133_N,superfamily_ARM-type_fold	ENSG00000198301		0.403	SDAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDAD1	HGNC	protein_coding	OTTHUMT00000252418.3	-	0.00	33	0	T	NM_018115		76902592	-1	tier1	-	no_errors	ENST00000356260	ensembl	human	known	74_37	missense	28.95	27	11	SNP	0.994	C
SDF2	6388	genome.wustl.edu	37	17	26976284	26976284	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr17:26976284G>A	ENST00000247020.4	-	3	657	c.359C>T	c.(358-360)gCt>gTt	p.A120V	SDF2_ENST00000592250.1_5'UTR	NM_006923.3	NP_008854.2	Q99470	SDF2_HUMAN	stromal cell-derived factor 2	120	MIR 2. {ECO:0000255|PROSITE- ProRule:PRU00131}.				protein glycosylation (GO:0006486)|protein O-linked mannosylation (GO:0035269)	extracellular space (GO:0005615)|membrane (GO:0016020)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)			endometrium(1)|large_intestine(2)|lung(2)|prostate(2)	7	Lung NSC(42;0.00431)					CTCACCAAAAGCACTCACTTC	0.483																																																	0													86.0	80.0	82.0					17																	26976284		2203	4300	6503	SO:0001583	missense	0			BC001406	CCDS11238.1	17q11.2	2004-02-16			ENSG00000132581	ENSG00000132581			10675	protein-coding gene	gene with protein product		602934				8918255	Standard	NR_045585		Approved		uc002hbw.3	Q99470	OTTHUMG00000132681	ENST00000247020.4:c.359C>T	17.37:g.26976284G>A	ENSP00000247020:p.Ala120Val		Q9BQ79	Missense_Mutation	SNP	pfam_MIR_motif,superfamily_MIR_motif,smart_MIR_motif,pfscan_MIR_motif	p.A120V	ENST00000247020.4	37	c.359	CCDS11238.1	17	.	.	.	.	.	.	.	.	.	.	G	34	5.325425	0.95708	.	.	ENSG00000132581	ENST00000247020	D	0.84516	-1.86	5.65	5.65	0.86999	MIR motif (2);MIR (2);	0.000000	0.85682	D	0.000000	D	0.93983	0.8073	M	0.89030	3	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.94184	0.7434	10	0.72032	D	0.01	-14.9382	20.1613	0.98135	0.0:0.0:1.0:0.0	.	120	Q99470	SDF2_HUMAN	V	120	ENSP00000247020:A120V	ENSP00000247020:A120V	A	-	2	0	SDF2	24000411	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.407000	0.97325	2.835000	0.97688	0.650000	0.86243	GCT	SDF2	-	pfam_MIR_motif,superfamily_MIR_motif,smart_MIR_motif,pfscan_MIR_motif	ENSG00000132581		0.483	SDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDF2	HGNC	protein_coding	OTTHUMT00000255965.2	-	0.00	53	0	G	NM_006923		26976284	-1	tier1	-	no_errors	ENST00000247020	ensembl	human	known	74_37	missense	8.93	51	5	SNP	1.000	A
SEH1L	81929	genome.wustl.edu	37	18	12955467	12955467	+	Silent	SNP	T	T	C			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr18:12955467T>C	ENST00000262124.11	+	3	295	c.168T>C	c.(166-168)caT>caC	p.H56H	SEH1L_ENST00000399892.2_Silent_p.H56H	NM_031216.3	NP_112493.2	Q96EE3	SEH1_HUMAN	SEH1-like (S. cerevisiae)	56					attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|carbohydrate metabolic process (GO:0005975)|cytokine production involved in inflammatory response (GO:0002534)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore organization (GO:0006999)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)		p.H56H(2)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	11						CCCAGACACATAGTGGATCTG	0.398																																																	2	Substitution - coding silent(2)	prostate(1)|central_nervous_system(1)											150.0	135.0	140.0					18																	12955467		2203	4300	6503	SO:0001819	synonymous_variant	0			BC012430	CCDS32791.1, CCDS45832.1	18p11.21	2013-01-10				ENSG00000085415		"""WD repeat domain containing"""	30379	protein-coding gene	gene with protein product	"""sec13 like protein"", ""nucleoporin Seh1"""	609263				12196509, 14517296	Standard	XM_005258152		Approved	SEH1A, SEH1B, Seh1, SEC13L	uc002krq.3	Q96EE3		ENST00000262124.11:c.168T>C	18.37:g.12955467T>C			A8K5B1|Q8NFU6|Q96MH3|Q9C069	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.H56	ENST00000262124.11	37	c.168	CCDS45832.1	18																																																																																			SEH1L	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000085415		0.398	SEH1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEH1L	HGNC	protein_coding	OTTHUMT00000458254.1	-	0.00	57	0	T	NM_031216		12955467	+1	tier1	rs144783239	no_errors	ENST00000399892	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.994	C
SEMA3A	10371	genome.wustl.edu	37	7	83675741	83675741	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr7:83675741C>A	ENST00000265362.4	-	6	880	c.566G>T	c.(565-567)gGa>gTa	p.G189V	SEMA3A_ENST00000436949.1_Missense_Mutation_p.G189V	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	189	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						AGCTGCAGTTCCAGAGTATAA	0.408																																																	0													181.0	165.0	170.0					7																	83675741		2203	4300	6503	SO:0001583	missense	0			L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.566G>T	7.37:g.83675741C>A	ENSP00000265362:p.Gly189Val			Missense_Mutation	SNP	pfam_Semap_dom,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,pfscan_Semap_dom,pfscan_Ig-like_dom	p.G189V	ENST00000265362.4	37	c.566	CCDS5599.1	7	.	.	.	.	.	.	.	.	.	.	C	27.4	4.832074	0.91036	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.18016	2.24;2.24	5.88	5.88	0.94601	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.55386	0.1917	M	0.92367	3.3	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.64774	-0.6328	10	0.87932	D	0	.	20.2381	0.98363	0.0:1.0:0.0:0.0	.	189	Q14563	SEM3A_HUMAN	V	189	ENSP00000265362:G189V;ENSP00000415260:G189V	ENSP00000265362:G189V	G	-	2	0	SEMA3A	83513677	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.433000	0.80362	2.779000	0.95612	0.650000	0.86243	GGA	SEMA3A	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000075213		0.408	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3A	HGNC	protein_coding	OTTHUMT00000253355.2	-	0.00	29	0	C	NM_006080		83675741	-1	tier1	-	no_errors	ENST00000265362	ensembl	human	known	74_37	missense	17.02	39	8	SNP	1.000	A
SENP2	59343	genome.wustl.edu	37	3	185347597	185347597	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr3:185347597A>T	ENST00000296257.5	+	17	1975	c.1735A>T	c.(1735-1737)Atg>Ttg	p.M579L	SENP2_ENST00000545472.1_Missense_Mutation_p.M569L|SENP2_ENST00000427465.2_Missense_Mutation_p.M403L	NM_021627.2	NP_067640.2	Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 2	579					cellular protein metabolic process (GO:0044267)|dorsal/ventral axis specification (GO:0009950)|heart development (GO:0007507)|labyrinthine layer development (GO:0060711)|mRNA transport (GO:0051028)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein binding (GO:0032091)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|protein transport (GO:0015031)|regulation of DNA endoreduplication (GO:0032875)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of Wnt signaling pathway (GO:0030111)|spongiotrophoblast layer development (GO:0060712)|trophoblast giant cell differentiation (GO:0060707)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	SUMO-specific protease activity (GO:0016929)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(3)	12	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			CCGGAAGAAGATGGTGTGGGA	0.473																																																	0													190.0	169.0	176.0					3																	185347597		2203	4300	6503	SO:0001583	missense	0			AF151697	CCDS33902.1	3q28	2005-08-17	2005-08-17		ENSG00000163904	ENSG00000163904			23116	protein-coding gene	gene with protein product		608261	"""SUMO1/sentrin/SMT3 specific protease 2"""			11896061, 11489887	Standard	XM_005247690		Approved	SMT3IP2, KIAA1331, DKFZp762A2316, AXAM2	uc003fpn.3	Q9HC62	OTTHUMG00000156658	ENST00000296257.5:c.1735A>T	3.37:g.185347597A>T	ENSP00000296257:p.Met579Leu		B4DQ42|Q8IW97|Q96SR2|Q9P2L5	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.M579L	ENST00000296257.5	37	c.1735	CCDS33902.1	3	.	.	.	.	.	.	.	.	.	.	A	26.2	4.716188	0.89205	.	.	ENSG00000163904	ENST00000545472;ENST00000296257;ENST00000437107;ENST00000427465	T;T;T	0.37915	1.17;1.17;1.17	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.62245	0.2412	M	0.80616	2.505	0.80722	D	1	D;D	0.55172	0.97;0.97	D;D	0.71184	0.972;0.972	T	0.66118	-0.6003	10	0.59425	D	0.04	-34.442	15.0454	0.71825	1.0:0.0:0.0:0.0	.	569;579	B4DQ42;Q9HC62	.;SENP2_HUMAN	L	569;579;450;403	ENSP00000439653:M569L;ENSP00000296257:M579L;ENSP00000394562:M403L	ENSP00000296257:M579L	M	+	1	0	SENP2	186830291	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.110000	0.89562	2.189000	0.69895	0.455000	0.32223	ATG	SENP2	-	pfam_Peptidase_C48	ENSG00000163904		0.473	SENP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SENP2	HGNC	protein_coding	OTTHUMT00000345159.1	-	0.00	34	0	A	NM_021627		185347597	+1	tier1	-	no_errors	ENST00000296257	ensembl	human	known	74_37	missense	14.67	64	11	SNP	1.000	T
SGK223	157285	genome.wustl.edu	37	8	8185259	8185259	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr8:8185259G>T	ENST00000520004.1	-	5	3297	c.3033C>A	c.(3031-3033)tgC>tgA	p.C1011*	SGK223_ENST00000330777.4_Nonsense_Mutation_p.C1011*			Q86YV5	SG223_HUMAN		1013	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										GGTCCTCAGAGCAGGTGGCAC	0.547																																					GBM(34;731 755 10259 33573 33867)												0													50.0	54.0	53.0					8																	8185259		2098	4228	6326	SO:0001587	stop_gained	0																														ENST00000520004.1:c.3033C>A	8.37:g.8185259G>T	ENSP00000428054:p.Cys1011*		Q8N3N5	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.C1011*	ENST00000520004.1	37	c.3033	CCDS43706.1	8	.	.	.	.	.	.	.	.	.	.	G	43	10.047602	0.99325	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	.	.	.	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.4447	0.87574	0.0:0.0:1.0:0.0	.	.	.	.	X	1011	.	ENSP00000330930:C1011X	C	-	3	2	AC068353.1	8222669	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.910000	0.39927	2.670000	0.90874	0.563000	0.77884	TGC	SGK223	-	smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000182319		0.547	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	Uniprot_gn	protein_coding	OTTHUMT00000374864.1	-	0.00	49	0	G			8185259	-1	tier1	-	no_errors	ENST00000330777	ensembl	human	known	74_37	nonsense	21.62	29	8	SNP	1.000	T
SH3RF1	57630	genome.wustl.edu	37	4	170077752	170077752	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr4:170077752C>A	ENST00000284637.9	-	3	813	c.472G>T	c.(472-474)Ggt>Tgt	p.G158C	SH3RF1_ENST00000508685.1_5'UTR	NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	158	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|protein ubiquitination (GO:0016567)|regulation of JNK cascade (GO:0046328)	cell projection (GO:0042995)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		ATGATGTCACCTTTGCTGAAT	0.398																																																	0													133.0	137.0	136.0					4																	170077752		2203	4300	6503	SO:0001583	missense	0			BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447		"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2		9482736	Standard	NM_020870		Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.472G>T	4.37:g.170077752C>A	ENSP00000284637:p.Gly158Cys		Q05BT2|Q8IW46|Q9HAM2|Q9P234	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Znf_C3HC4_RING-type,superfamily_SH3_domain,smart_Znf_RING,smart_SH3_domain,pfscan_SH3_domain,pfscan_Znf_RING,prints_p67phox,prints_SH3_domain	p.G158C	ENST00000284637.9	37	c.472	CCDS34099.1	4	.	.	.	.	.	.	.	.	.	.	C	24.3	4.516157	0.85495	.	.	ENSG00000154447	ENST00000284637	T	0.70045	-0.45	5.76	5.76	0.90799	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	D	0.89160	0.6636	H	0.97415	4	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	D	0.92069	0.5663	10	0.87932	D	0	-23.2237	20.3242	0.98691	0.0:1.0:0.0:0.0	.	158	Q7Z6J0	SH3R1_HUMAN	C	158	ENSP00000284637:G158C	ENSP00000284637:G158C	G	-	1	0	SH3RF1	170314327	1.000000	0.71417	0.999000	0.59377	0.889000	0.51656	7.445000	0.80570	2.882000	0.98803	0.655000	0.94253	GGT	SH3RF1	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_p67phox	ENSG00000154447		0.398	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3RF1	HGNC	protein_coding	OTTHUMT00000363382.3		0.00	45	0	C	NM_020870		170077752	-1			no_errors	ENST00000284637	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	A
SIGLEC10	89790	genome.wustl.edu	37	19	51918195	51918195	+	Missense_Mutation	SNP	C	C	T	rs554914804		TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr19:51918195C>T	ENST00000339313.5	-	8	1614	c.1498G>A	c.(1498-1500)Ggg>Agg	p.G500R	CTD-2616J11.2_ENST00000532688.1_RNA|SIGLEC10_ENST00000442846.3_Intron|SIGLEC10_ENST00000441969.3_Intron|SIGLEC10_ENST00000356298.5_Missense_Mutation_p.G500R|SIGLEC10_ENST00000439889.2_Missense_Mutation_p.G442R|SIGLEC10_ENST00000353836.5_Intron|CTD-2616J11.2_ENST00000526996.1_RNA|SIGLEC10_ENST00000436984.2_Intron|CTD-2616J11.3_ENST00000532473.1_RNA|SIGLEC10_ENST00000525998.1_Intron|SIGLEC10_ENST00000432469.2_Intron			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	500					cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		GCCCAGGGCCCGGCTGAGCTG	0.701													c|||	1	0.000199681	0.0	0.0	5008	,	,		15837	0.001		0.0	False		,,,				2504	0.0																0													30.0	34.0	33.0					19																	51918195		2203	4297	6500	SO:0001583	missense	0			AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.1498G>A	19.37:g.51918195C>T	ENSP00000345243:p.Gly500Arg		A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G500R	ENST00000339313.5	37	c.1498	CCDS12832.1	19	.	.	.	.	.	.	.	.	.	.	.	11.48	1.651053	0.29336	.	.	ENSG00000142512	ENST00000356298;ENST00000439889;ENST00000339313	D;D;D	0.86097	-2.07;-2.07;-2.07	4.83	3.79	0.43588	.	0.112809	0.40222	N	0.001143	D	0.92224	0.7534	M	0.90870	3.155	0.26172	N	0.979851	D;D	0.60160	0.985;0.987	P;P	0.60345	0.8;0.873	D	0.86550	0.1834	10	0.66056	D	0.02	.	12.1524	0.54057	0.0:0.9074:0.0:0.0926	.	442;500	Q96LC7-3;Q96LC7	.;SIG10_HUMAN	R	500;442;500	ENSP00000348646:G500R;ENSP00000389132:G442R;ENSP00000345243:G500R	ENSP00000345243:G500R	G	-	1	0	SIGLEC10	56610007	0.804000	0.28969	0.520000	0.27837	0.033000	0.12548	1.431000	0.34925	0.468000	0.27243	-1.134000	0.01955	GGG	SIGLEC10	-	NULL	ENSG00000142512		0.701	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC10	HGNC	protein_coding	OTTHUMT00000384620.2	-	0.00	109	0	C	NM_033130		51918195	-1	tier1	-	no_errors	ENST00000339313	ensembl	human	known	74_37	missense	18.52	43	10	SNP	0.728	T
SLC52A2	79581	genome.wustl.edu	37	8	145584272	145584272	+	Missense_Mutation	SNP	C	C	T	rs531845498	byFrequency	TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr8:145584272C>T	ENST00000532887.1	+	4	1607	c.1024C>T	c.(1024-1026)Ctc>Ttc	p.L342F	SLC52A2_ENST00000402965.1_Missense_Mutation_p.L342F|FBXL6_ENST00000455319.2_5'Flank|SLC52A2_ENST00000329994.2_Missense_Mutation_p.L342F|SLC52A2_ENST00000526752.1_Intron|SLC52A2_ENST00000540505.1_Missense_Mutation_p.L254F|SLC52A2_ENST00000527078.1_Missense_Mutation_p.L342F|FBXL6_ENST00000331890.5_5'Flank|SLC52A2_ENST00000530047.1_Missense_Mutation_p.L342F			Q9HAB3	S52A2_HUMAN	solute carrier family 52 (riboflavin transporter), member 2	342					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)									Gamma Hydroxybutyric Acid(DB01440)	GCTGGGCGGCCTCTCTCTGCT	0.701													C|||	2	0.000399361	0.0015	0.0	5008	,	,		15343	0.0		0.0	False		,,,				2504	0.0																0													54.0	61.0	59.0					8																	145584272		2203	4300	6503	SO:0001583	missense	0			AY070774	CCDS6423.1	8q24.3	2013-07-17	2013-07-17	2012-02-29		ENSG00000185803		"""Solute carriers"""	30224	protein-coding gene	gene with protein product		607882	"""G protein-coupled receptor 172A"""	GPR172A		12740431	Standard	NM_024531		Approved	FLJ11856, PAR1, GPCR41, D15Ertd747e, RFVT2, hRFT3	uc003zcd.2	Q9HAB3		ENST00000532887.1:c.1024C>T	8.37:g.145584272C>T	ENSP00000436768:p.Leu342Phe		A8K6B6|D3DWL8|G1UCY1|Q86UT1	Missense_Mutation	SNP	pfam_Endogenous_retrovirus_rcpt	p.L342F	ENST00000532887.1	37	c.1024	CCDS6423.1	8	.	.	.	.	.	.	.	.	.	.	C	12.27	1.887306	0.33348	.	.	ENSG00000185803	ENST00000530047;ENST00000527078;ENST00000402965;ENST00000532887;ENST00000329994;ENST00000540505	T;T;T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42;-1.42;-1.42	4.69	1.7	0.24286	.	0.266289	0.30483	N	0.009539	T	0.76026	0.3930	L	0.59436	1.845	0.19575	N	0.999961	P	0.37370	0.592	P	0.44447	0.45	T	0.65985	-0.6035	10	0.46703	T	0.11	.	3.1388	0.06448	0.1886:0.5074:0.0:0.304	.	342	Q9HAB3	RFT3_HUMAN	F	342;342;342;342;342;254	ENSP00000435820:L342F;ENSP00000434728:L342F;ENSP00000385961:L342F;ENSP00000436768:L342F;ENSP00000333638:L342F;ENSP00000440400:L254F	ENSP00000333638:L342F	L	+	1	0	GPR172A	145555080	0.001000	0.12720	0.003000	0.11579	0.317000	0.28152	-0.159000	0.10056	0.414000	0.25790	0.462000	0.41574	CTC	SLC52A2	-	pfam_Endogenous_retrovirus_rcpt	ENSG00000185803		0.701	SLC52A2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC52A2	HGNC	protein_coding	OTTHUMT00000382405.1	-	0.00	44	0	C	NM_024531		145584272	+1	tier1	-	no_errors	ENST00000329994	ensembl	human	known	74_37	missense	29.41	24	10	SNP	0.003	T
SNW1	22938	genome.wustl.edu	37	14	78198839	78198840	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr14:78198839_78198840insA	ENST00000261531.7	-	9	941_942	c.879_880insT	c.(877-882)attgctfs	p.A294fs	SLIRP_ENST00000557431.1_Intron|SNW1_ENST00000555761.1_Frame_Shift_Ins_p.A294fs|SNW1_ENST00000554775.1_Frame_Shift_Ins_p.A132fs	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	294	SNW.				cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)			NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		TTCCGATCAGCAATGTAGAGGG	0.361																																																	0																																										SO:0001589	frameshift_variant	0			AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.880dupT	14.37:g.78198841_78198841dupA	ENSP00000261531:p.Ala294fs		A8K8A9|Q13483|Q32N03|Q5D0D6	Frame_Shift_Ins	INS	pfam_SKI-int_prot_SKIP_SNW-dom,superfamily_Signal_recog_particl_SRP54_hlx	p.A293fs	ENST00000261531.7	37	c.880_879	CCDS9867.1	14																																																																																			SNW1	-	pfam_SKI-int_prot_SKIP_SNW-dom,superfamily_Signal_recog_particl_SRP54_hlx	ENSG00000100603		0.361	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNW1	HGNC	protein_coding	OTTHUMT00000413912.1		0.00	29	0	-	NM_012245		78198840	-1	tier1		no_errors	ENST00000261531	ensembl	human	known	74_37	frame_shift_ins	17.24	24	5	INS	1.000:0.998	A
SNX13	23161	genome.wustl.edu	37	7	17833516	17833516	+	3'UTR	SNP	G	G	C			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr7:17833516G>C	ENST00000409389.1	-	0	5765				SNX13_ENST00000428135.3_3'UTR|SNX13_ENST00000496855.1_5'UTR			Q9Y5W8	SNX13_HUMAN	sorting nexin 13						intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					AGATGAGAATGAGAAGAACCA	0.378																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.*2926C>G	7.37:g.17833516G>C			B2RCI9|O94821|Q8WVZ2|Q8WXH8	RNA	SNP	-	NULL	ENST00000409389.1	37	NULL		7																																																																																			SNX13	-	-	ENSG00000071189		0.378	SNX13-002	NOVEL	basic|exp_conf	protein_coding	SNX13	HGNC	protein_coding	OTTHUMT00000327608.1	-	0.00	12	0	G	NM_015132		17833516	-1	tier1	-	no_errors	ENST00000496855	ensembl	human	known	74_37	rna	41.67	7	5	SNP	1.000	C
SNX13	23161	genome.wustl.edu	37	7	17833695	17833695	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr7:17833695G>C	ENST00000428135.3	-	26	3046	c.2848C>G	c.(2848-2850)Caa>Gaa	p.Q950E	SNX13_ENST00000496855.1_5'UTR|SNX13_ENST00000409389.1_3'UTR	NM_015132.4	NP_055947.1	Q9Y5W8	SNX13_HUMAN	sorting nexin 13	961					intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					GAAGGCGCTTGAGTAGTTTGA	0.403																																																	0													120.0	114.0	116.0					7																	17833695		1850	4097	5947	SO:0001583	missense	0			AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000428135.3:c.2848C>G	7.37:g.17833695G>C	ENSP00000398789:p.Gln950Glu		B2RCI9|O94821|Q8WVZ2|Q8WXH8	Missense_Mutation	SNP	pfam_Phox_assoc,pfam_Sorting_nexin_C,pfam_Phox,pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_Phox,superfamily_Cyt_c_oxidase_su5A/6,smart_PX_assoc_Snx13,smart_Regulat_G_prot_signal_superfam,smart_Phox,pfscan_Phox,pfscan_Phox_assoc,pfscan_Regulat_G_prot_signal_superfam	p.Q950E	ENST00000428135.3	37	c.2848	CCDS47551.1	7	.	.	.	.	.	.	.	.	.	.	G	14.30	2.494289	0.44352	.	.	ENSG00000071189	ENST00000428135;ENST00000242044	T	0.13657	2.57	5.67	5.67	0.87782	.	0.171581	0.52532	D	0.000072	T	0.11281	0.0275	N	0.14661	0.345	0.80722	D	1	B;B	0.16802	0.019;0.003	B;B	0.15870	0.01;0.014	T	0.16630	-1.0396	10	0.40728	T	0.16	-12.635	20.1169	0.97940	0.0:0.0:1.0:0.0	.	747;950	B3KN60;Q9Y5W8-2	.;.	E	950;998	ENSP00000398789:Q950E	ENSP00000242044:Q998E	Q	-	1	0	SNX13	17800220	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.017000	0.76399	2.835000	0.97688	0.591000	0.81541	CAA	SNX13	-	NULL	ENSG00000071189		0.403	SNX13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX13	HGNC	protein_coding	OTTHUMT00000327607.2	-	0.00	47	0	G	NM_015132		17833695	-1	tier1	-	no_errors	ENST00000428135	ensembl	human	known	74_37	missense	30.95	29	13	SNP	1.000	C
SP110	3431	genome.wustl.edu	37	2	231065665	231065665	+	Silent	SNP	A	A	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr2:231065665A>G	ENST00000358662.4	-	10	1143	c.1065T>C	c.(1063-1065)acT>acC	p.T355T	SP110_ENST00000392048.3_Silent_p.T353T|SP110_ENST00000338556.3_Silent_p.T57T|SP110_ENST00000540870.1_Silent_p.T361T|SP110_ENST00000258381.6_Silent_p.T355T|SP110_ENST00000258382.5_Silent_p.T355T|SP110_ENST00000486146.2_5'Flank	NM_004509.3	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein	355					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(4)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		TCATTTCTGAAGTGCCATCAA	0.473																																																	0													191.0	173.0	179.0					2																	231065665		2203	4300	6503	SO:0001819	synonymous_variant	0			L22343	CCDS2474.1, CCDS2475.1, CCDS2476.1, CCDS54435.1	2q37.1	2014-09-17	2001-12-19	2001-12-20	ENSG00000135899	ENSG00000135899			5401	protein-coding gene	gene with protein product		604457	"""interferon-induced protein 41, 30kD"""	IFI41, IFI75		7693701, 10388521	Standard	NM_080424		Approved		uc002vqg.3	Q9HB58	OTTHUMG00000133204	ENST00000358662.4:c.1065T>C	2.37:g.231065665A>G			B4DVI4|F5H1M1|Q14976|Q14977|Q53TG2|Q8WUZ6|Q9HCT8	Silent	SNP	pfam_Sp100,pfam_SAND_dom,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom	p.T355	ENST00000358662.4	37	c.1065	CCDS2474.1	2																																																																																			SP110	-	NULL	ENSG00000135899		0.473	SP110-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SP110	HGNC	protein_coding	OTTHUMT00000332414.1	-	0.00	69	0	A	NM_080424		231065665	-1	tier1	-	no_errors	ENST00000258381	ensembl	human	known	74_37	silent	15.91	37	7	SNP	0.021	G
SQSTM1	8878	genome.wustl.edu	37	5	179260710	179260710	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr5:179260710A>T	ENST00000389805.4	+	7	1271	c.1093A>T	c.(1093-1095)Agc>Tgc	p.S365C	SQSTM1_ENST00000360718.5_Missense_Mutation_p.S281C|SQSTM1_ENST00000376929.3_Missense_Mutation_p.S281C|SQSTM1_ENST00000402874.3_Missense_Mutation_p.S281C|SQSTM1_ENST00000510187.1_Intron	NM_003900.4	NP_003891.1	Q13501	SQSTM_HUMAN	sequestosome 1	365	Interaction with NTRK1. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|autophagy (GO:0006914)|cell differentiation (GO:0030154)|endosomal transport (GO:0016197)|immune system process (GO:0002376)|intracellular signal transduction (GO:0035556)|macroautophagy (GO:0016236)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein heterooligomerization (GO:0051291)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of Ras protein signal transduction (GO:0046578)|response to stress (GO:0006950)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|lysosome (GO:0005764)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)		SQSTM1/ALK(2)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(5)|ovary(1)	13	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGAAGGGCCAAGCTCTCTGGA	0.547																																																	0													76.0	75.0	75.0					5																	179260710		2203	4300	6503	SO:0001583	missense	0			U46751	CCDS34317.1, CCDS47355.1	5q35	2008-02-05	2004-04-15		ENSG00000161011	ENSG00000161011			11280	protein-coding gene	gene with protein product		601530	"""Paget disease of bone 3"", ""oxidative stress induced like"""	PDB3, OSIL		8650207, 8551575	Standard	NM_003900		Approved	p62, p60, p62B, A170	uc003mkw.4	Q13501	OTTHUMG00000150643	ENST00000389805.4:c.1093A>T	5.37:g.179260710A>T	ENSP00000374455:p.Ser365Cys		A6NFN7|B2R661|B3KUW5|Q13446|Q9BUV7|Q9BVS6|Q9UEU1	Missense_Mutation	SNP	pfam_Znf_ZZ,pfam_OPR_PB1,superfamily_UBA-like,smart_OPR_PB1,smart_Znf_ZZ,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_ZZ	p.S365C	ENST00000389805.4	37	c.1093	CCDS34317.1	5	.	.	.	.	.	.	.	.	.	.	A	12.27	1.886665	0.33348	.	.	ENSG00000161011	ENST00000376929;ENST00000389805;ENST00000454378;ENST00000402874;ENST00000360718	D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67	5.16	2.36	0.29203	.	0.742696	0.13881	N	0.356314	T	0.69566	0.3125	L	0.29908	0.895	0.26118	N	0.980589	B	0.15719	0.014	B	0.10450	0.005	T	0.56878	-0.7906	10	0.38643	T	0.18	-10.7201	3.81	0.08793	0.5991:0.0:0.1055:0.2954	.	365	Q13501	SQSTM_HUMAN	C	281;365;221;281;281	ENSP00000366128:S281C;ENSP00000374455:S365C;ENSP00000385553:S281C;ENSP00000353944:S281C	ENSP00000353944:S281C	S	+	1	0	SQSTM1	179193316	0.698000	0.27777	0.838000	0.33150	0.976000	0.68499	1.277000	0.33167	0.653000	0.30826	0.459000	0.35465	AGC	SQSTM1	-	NULL	ENSG00000161011		0.547	SQSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SQSTM1	HGNC	protein_coding	OTTHUMT00000319344.1		0.00	23	0	A			179260710	+1			no_errors	ENST00000389805	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.898	T
SRGAP1	57522	genome.wustl.edu	37	12	64536104	64536104	+	Silent	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr12:64536104G>A	ENST00000355086.3	+	22	3434	c.2910G>A	c.(2908-2910)ttG>ttA	p.L970L	SRGAP1_ENST00000357825.3_Silent_p.L947L|SRGAP1_ENST00000543397.1_Silent_p.L907L	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	970					axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		ACACAGCTTTGAATGAACTCC	0.443																																																	0													68.0	66.0	67.0					12																	64536104		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.2910G>A	12.37:g.64536104G>A			Q9H8A3|Q9P2P2	Silent	SNP	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Fuc/Ara_isomerase_C,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.L970	ENST00000355086.3	37	c.2910	CCDS8967.1	12																																																																																			SRGAP1	-	NULL	ENSG00000196935		0.443	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRGAP1	HGNC	protein_coding	OTTHUMT00000400896.1	-	0.00	19	0	G			64536104	+1	tier1	-	no_errors	ENST00000355086	ensembl	human	known	74_37	silent	20.00	20	5	SNP	1.000	A
STAT4	6775	genome.wustl.edu	37	2	191919261	191919261	+	Splice_Site	SNP	C	C	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr2:191919261C>A	ENST00000392320.2	-	14	1521		c.e14-1		STAT4_ENST00000358470.4_Splice_Site	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4						cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			CCTTTGGTTGCTTTGTAAAAG	0.348																																																	0													96.0	105.0	102.0					2																	191919261		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.1207-1G>T	2.37:g.191919261C>A			Q96NZ6	Splice_Site	SNP	-	e13-1	ENST00000392320.2	37	c.1207-1	CCDS2310.1	2	.	.	.	.	.	.	.	.	.	.	C	22.6	4.310897	0.81358	.	.	ENSG00000138378	ENST00000358470;ENST00000392320	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7061	0.85372	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	STAT4	191627506	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	6.237000	0.72345	2.463000	0.83235	0.467000	0.42956	.	STAT4	-	-	ENSG00000138378		0.348	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STAT4	HGNC	protein_coding	OTTHUMT00000335586.1		0.00	35	0	C	NM_003151	Intron	191919261	-1			no_errors	ENST00000358470	ensembl	human	known	74_37	splice_site	5.71	33	2	SNP	1.000	A
SUFU	51684	genome.wustl.edu	37	10	104386980	104386980	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr10:104386980G>T	ENST00000369902.3	+	11	1511	c.1345G>T	c.(1345-1347)Gat>Tat	p.D449Y		NM_016169.3	NP_057253.2	Q9UMX1	SUFU_HUMAN	suppressor of fused homolog (Drosophila)	449					cytoplasmic sequestering of transcription factor (GO:0042994)|heart looping (GO:0001947)|multicellular organismal development (GO:0007275)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skin development (GO:0043588)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|primary cilium (GO:0072372)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(7)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	24		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		GGATTTAGAAGATTTGACTTC	0.423			"""D, F, S"""		medulloblastoma	medulloblastoma			Medulloblastoma, associated with Germline SUFU Mutation																														yes	Rec	yes	Medulloblastoma predisposition	10	10q24.32	51684	suppressor of fused homolog (Drosophila)		O	0													188.0	183.0	185.0					10																	104386980		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database		AF175770	CCDS7537.1, CCDS53571.1	10q24.32	2014-09-17			ENSG00000107882	ENSG00000107882			16466	protein-coding gene	gene with protein product		607035				15367681	Standard	NM_016169		Approved	SUFUH, SUFUXL, PRO1280	uc001kvy.2	Q9UMX1	OTTHUMG00000018966	ENST00000369902.3:c.1345G>T	10.37:g.104386980G>T	ENSP00000358918:p.Asp449Tyr		Q7LCP7|Q9NT90|Q9NZ07|Q9UHK2|Q9UHM8|Q9UMY0	Missense_Mutation	SNP	pfam_SUFU_C,pfam_SUFU-like_domain,pirsf_Suppressor_of_fused_euk	p.D449Y	ENST00000369902.3	37	c.1345	CCDS7537.1	10	.	.	.	.	.	.	.	.	.	.	G	16.74	3.205569	0.58234	.	.	ENSG00000107882	ENST00000369902	T	0.55760	0.5	4.72	4.72	0.59763	Suppressor of fused C-terminal (1);	0.104657	0.64402	D	0.000002	T	0.38772	0.1053	L	0.34521	1.04	0.80722	D	1	B	0.28713	0.22	B	0.28553	0.091	T	0.26430	-1.0103	10	0.02654	T	1	-6.9687	16.2192	0.82247	0.0:0.0:1.0:0.0	.	449	Q9UMX1	SUFU_HUMAN	Y	449	ENSP00000358918:D449Y	ENSP00000358918:D449Y	D	+	1	0	SUFU	104376970	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.970000	0.93415	2.344000	0.79699	0.561000	0.74099	GAT	SUFU	-	pfam_SUFU_C,pirsf_Suppressor_of_fused_euk	ENSG00000107882		0.423	SUFU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUFU	HGNC	protein_coding	OTTHUMT00000050089.1		0.00	20	0	G	NM_016169		104386980	+1			no_errors	ENST00000369902	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	T
SUPT5H	6829	genome.wustl.edu	37	19	39959492	39959492	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr19:39959492G>T	ENST00000599117.1	+	15	1501	c.1134G>T	c.(1132-1134)atG>atT	p.M378I	SUPT5H_ENST00000402194.2_Missense_Mutation_p.M374I|SUPT5H_ENST00000359191.6_Missense_Mutation_p.M374I|SUPT5H_ENST00000432763.2_Missense_Mutation_p.M378I|SUPT5H_ENST00000598725.1_Missense_Mutation_p.M378I			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	378	Interaction with RNA polymerase II.				7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GCTTCGCCATGTCTGCTGTGG	0.577																																																	0													82.0	79.0	80.0					19																	39959492		2203	4300	6503	SO:0001583	missense	0			U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.1134G>T	19.37:g.39959492G>T	ENSP00000470252:p.Met378Ile		O43279|Q59G52|Q99639	Missense_Mutation	SNP	pfam_TF_Spt5_NGN-domain,pfam_KOW,pfam_Spt5_N,superfamily_Translation_prot_SH3-like,smart_Transcrpt_antiterm_NusG_N_dom,smart_KOW,pirsf_TF_Spt5	p.M378I	ENST00000599117.1	37	c.1134	CCDS12536.1	19	.	.	.	.	.	.	.	.	.	.	G	13.99	2.400436	0.42613	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.40546	0.1121	N	0.11131	0.1	0.80722	D	1	B;B;B	0.19583	0.011;0.037;0.022	B;B;B	0.24155	0.014;0.051;0.023	T	0.25047	-1.0143	8	.	.	.	-27.9673	17.7775	0.88514	0.0:0.0:1.0:0.0	.	170;374;378	B4DJK4;O00267-2;O00267	.;.;SPT5H_HUMAN	I	378;374;356;378	.	.	M	+	3	0	SUPT5H	44651332	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.760000	0.85248	2.512000	0.84698	0.557000	0.71058	ATG	SUPT5H	-	pirsf_TF_Spt5	ENSG00000196235		0.577	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT5H	HGNC	protein_coding	OTTHUMT00000464918.1	-	0.00	24	0	G	NM_003169		39959492	+1	tier1	-	no_errors	ENST00000432763	ensembl	human	known	74_37	missense	33.33	10	5	SNP	1.000	T
SYNPO2L	79933	genome.wustl.edu	37	10	75413174	75413174	+	Silent	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr10:75413174G>A	ENST00000394810.2	-	3	644	c.495C>T	c.(493-495)ccC>ccT	p.P165P	RP11-464F9.21_ENST00000607450.1_RNA|SYNPO2L_ENST00000372873.4_5'Flank|RP11-464F9.21_ENST00000606726.1_RNA	NM_001114133.1	NP_001107605.1	Q9H987	SYP2L_HUMAN	synaptopodin 2-like	165	Pro-rich.					cytoskeleton (GO:0005856)|nucleus (GO:0005634)|Z disc (GO:0030018)				breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Prostate(51;0.0112)					CCGGAGGGGTGGGCCTTGTGG	0.652																																																	0													23.0	30.0	28.0					10																	75413174		692	1591	2283	SO:0001819	synonymous_variant	0			AK022983	CCDS7331.1, CCDS44438.1	10q22.3	2007-12-19			ENSG00000166317	ENSG00000166317			23532	protein-coding gene	gene with protein product							Standard	XM_005270158		Approved	FLJ12921	uc001jut.4	Q9H987	OTTHUMG00000018471	ENST00000394810.2:c.495C>T	10.37:g.75413174G>A			A5PKV9|Q68A20	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P165	ENST00000394810.2	37	c.495	CCDS44438.1	10																																																																																			SYNPO2L	-	NULL	ENSG00000166317		0.652	SYNPO2L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNPO2L	HGNC	protein_coding	OTTHUMT00000316562.2	-	0.00	57	0	G	NM_024875		75413174	-1	tier1	-	no_errors	ENST00000394810	ensembl	human	known	74_37	silent	38.78	30	19	SNP	0.103	A
SYTL2	54843	genome.wustl.edu	37	11	85406271	85406271	+	Silent	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr11:85406271G>T	ENST00000528231.1	-	18	3049	c.2772C>A	c.(2770-2772)ctC>ctA	p.L924L	SYTL2_ENST00000525702.1_Silent_p.L366L|SYTL2_ENST00000389958.3_Silent_p.L355L|SYTL2_ENST00000529581.1_Silent_p.L366L|SYTL2_ENST00000525423.1_Silent_p.L1246L|SYTL2_ENST00000524452.1_Silent_p.L900L|SYTL2_ENST00000389960.4_Silent_p.L900L|SYTL2_ENST00000316356.4_Silent_p.L925L|SYTL2_ENST00000359152.5_Silent_p.L1770L|SYTL2_ENST00000527523.1_Silent_p.L892L|SYTL2_ENST00000354566.3_Silent_p.L1262L|SYTL2_ENST00000533892.1_Silent_p.L326L	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	924					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		AAAGCATTCTGAGAGGCAGTG	0.453																																																	0													119.0	117.0	117.0					11																	85406271		2203	4299	6502	SO:0001819	synonymous_variant	0			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.2772C>A	11.37:g.85406271G>T			B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.L1770	ENST00000528231.1	37	c.5310	CCDS53688.1	11																																																																																			SYTL2	-	NULL	ENSG00000137501		0.453	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL2	HGNC	protein_coding	OTTHUMT00000392192.1		0.00	22	0	G	NM_206927		85406271	-1			no_errors	ENST00000359152	ensembl	human	known	74_37	silent	14.29	18	3	SNP	1.000	T
TCERG1	10915	genome.wustl.edu	37	5	145834757	145834757	+	Silent	SNP	C	C	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr5:145834757C>G	ENST00000296702.5	+	2	236	c.198C>G	c.(196-198)ccC>ccG	p.P66P	TCERG1_ENST00000394421.2_Silent_p.P66P	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	66	Pro-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACGGCCGCCCTTTGGACGTC	0.587																																																	0													120.0	122.0	121.0					5																	145834757		2203	4300	6503	SO:0001819	synonymous_variant	0			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.198C>G	5.37:g.145834757C>G			Q2NKN2|Q59EA1	Silent	SNP	pfam_FF_domain,pfam_WW_dom,superfamily_FF_domain,superfamily_WW_dom,smart_WW_dom,smart_FF_domain,pfscan_WW_dom	p.P66	ENST00000296702.5	37	c.198	CCDS4282.1	5																																																																																			TCERG1	-	NULL	ENSG00000113649		0.587	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCERG1	HGNC	protein_coding	OTTHUMT00000251886.1	-	0.00	58	0	C	NM_001040006		145834757	+1	tier1	-	no_errors	ENST00000296702	ensembl	human	known	74_37	silent	12.50	42	6	SNP	0.907	G
TEKT4P2	100132288	genome.wustl.edu	37	21	9907383	9907383	+	RNA	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr21:9907383C>T	ENST00000416067.1	-	0	1409					NR_037872.1|NR_038327.1				tektin 4 pseudogene 2																		CTTGAGGTTGCGCAGGGACTG	0.582																																																	0																																												0					21p11.2	2012-10-03	2011-06-14	2011-06-14	ENSG00000188681	ENSG00000188681			40046	pseudogene	pseudogene			"""MAFF interacting protein-like"""	MAFIPL			Standard	NR_038327		Approved		uc021wgx.1		OTTHUMG00000172149		21.37:g.9907383C>T				RNA	SNP	-	NULL	ENST00000416067.1	37	NULL		21	.	.	.	.	.	.	.	.	.	.	.	4.246	0.044611	0.08196	.	.	ENSG00000188681	ENST00000400754	.	.	.	0.109	0.109	0.14578	.	.	.	.	.	T	0.37128	0.0992	.	.	.	.	.	.	.	.	.	.	.	.	T	0.43734	-0.9373	3	.	.	.	.	5.9913	0.19465	0.0:0.9994:0.0:6.0E-4	.	.	.	.	H	80	.	.	R	-	2	0	CR392039.1	.	0.006000	0.16342	0.071000	0.20095	0.073000	0.16967	-0.338000	0.07842	0.181000	0.19994	0.184000	0.17185	CGC	TEKT4P2	-	-	ENSG00000188681		0.582	TEKT4P2-002	KNOWN	basic	processed_transcript	TEKT4P2	HGNC	pseudogene	OTTHUMT00000417115.1	-	0.00	187	0	C	NM_001033515		9907383	-1	tier1	-	no_errors	ENST00000416067	ensembl	human	known	74_37	rna	10.47	77	9	SNP	0.899	T
TFAP2A	7020	genome.wustl.edu	37	6	10402728	10402728	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr6:10402728C>A	ENST00000482890.1	-	6	1232	c.880G>T	c.(880-882)Gag>Tag	p.E294*	TFAP2A_ENST00000379604.2_Nonsense_Mutation_p.E294*|TFAP2A_ENST00000319516.4_Nonsense_Mutation_p.E290*|TFAP2A_ENST00000497266.1_5'UTR|TFAP2A_ENST00000379613.3_Nonsense_Mutation_p.E296*|TFAP2A_ENST00000379608.3_Nonsense_Mutation_p.E288*			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	294	H-S-H (helix-span-helix), dimerization.				anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				CGCTTACCCTCTACTAGTGAT	0.418																																																	0													159.0	136.0	144.0					6																	10402728		2203	4300	6503	SO:0001587	stop_gained	0			X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.880G>T	6.37:g.10402728C>A	ENSP00000418541:p.Glu294*		Q13777|Q5TAV5|Q8N1C6	Nonsense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_C,prints_TF_AP2_alpha_N	p.E294*	ENST00000482890.1	37	c.880	CCDS4510.1	6	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	21.0|21.0|21.0	4.078396|4.078396|4.078396	0.76528|0.76528|0.76528	.|.|.	.|.|.	ENSG00000137203|ENSG00000137203|ENSG00000137203	ENST00000379613;ENST00000379604;ENST00000319516;ENST00000379608;ENST00000482890;ENST00000466073|ENST00000461628|ENST00000475264	.|.|.	.|.|.	.|.|.	5.79|5.79|5.79	5.79|5.79|5.79	0.91817|0.91817|0.91817	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	.|T|.	.|0.75831|.	.|0.3903|.	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	A|A|A	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|T|.	.|0.73177|.	.|-0.4065|.	.|3|.	0.87932|.|.	D|.|.	0|.|.	.|.|.	20.0474|20.0474|20.0474	0.97616|0.97616|0.97616	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|.|.	.|.|.	.|.|.	X|I|Y	296;294;290;288;294;294|68|198	.|.|.	ENSP00000316516:E290X|.|.	E|R|X	-|-|-	1|2|3	0|0|2	TFAP2A|TFAP2A|TFAP2A	10510714|10510714|10510714	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.981000|0.981000|0.981000	0.71138|0.71138|0.71138	7.814000|7.814000|7.814000	0.86154|0.86154|0.86154	2.722000|2.722000|2.722000	0.93159|0.93159|0.93159	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAG|AGA|TAG	TFAP2A	-	pfam_TF_AP2_C,prints_TF_AP2_C	ENSG00000137203		0.418	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	TFAP2A	HGNC	protein_coding	OTTHUMT00000353619.2	-	0.00	42	0	C	NM_003220		10402728	-1	tier1	-	no_errors	ENST00000379604	ensembl	human	known	74_37	nonsense	43.48	26	20	SNP	1.000	A
THADA	63892	genome.wustl.edu	37	2	43818024	43818024	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr2:43818024T>C	ENST00000405006.4	-	4	592	c.241A>G	c.(241-243)Atc>Gtc	p.I81V	THADA_ENST00000403856.1_Missense_Mutation_p.I81V|THADA_ENST00000405975.2_Missense_Mutation_p.I81V|THADA_ENST00000402360.2_Missense_Mutation_p.I81V|THADA_ENST00000415080.2_De_novo_Start_OutOfFrame|THADA_ENST00000404790.1_Missense_Mutation_p.I81V	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	81										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				CCTGCTAAGATATCCAAACAA	0.338																																																	0													107.0	97.0	100.0					2																	43818024		1799	4076	5875	SO:0001583	missense	0			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.241A>G	2.37:g.43818024T>C	ENSP00000385995:p.Ile81Val		A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	pfam_DUF2428_death-receptor-like,superfamily_ARM-type_fold	p.I81V	ENST00000405006.4	37	c.241	CCDS46268.1	2	.	.	.	.	.	.	.	.	.	.	T	11.02	1.516688	0.27123	.	.	ENSG00000115970	ENST00000405975;ENST00000356975;ENST00000405006;ENST00000402360;ENST00000404790;ENST00000403856	T;T;T;T;T	0.64618	2.76;2.76;-0.11;-0.11;1.31	5.21	-0.0262	0.13931	.	0.271769	0.36167	N	0.002745	T	0.50120	0.1597	L	0.56769	1.78	0.80722	D	1	B;B;B;B	0.12630	0.006;0.0;0.0;0.0	B;B;B;B	0.15052	0.012;0.003;0.003;0.001	T	0.33163	-0.9879	10	0.15499	T	0.54	1.7861	8.9739	0.35924	0.0:0.2923:0.0:0.7077	.	81;81;81;81	B5MC89;Q8IY32;Q6YHU6-5;Q6YHU6	.;.;.;THADA_HUMAN	V	81	ENSP00000386088:I81V;ENSP00000385995:I81V;ENSP00000385441:I81V;ENSP00000384266:I81V;ENSP00000385469:I81V	ENSP00000349464:I81V	I	-	1	0	THADA	43671528	0.998000	0.40836	0.998000	0.56505	0.891000	0.51852	0.228000	0.17814	0.096000	0.17463	-0.274000	0.10170	ATC	THADA	-	NULL	ENSG00000115970		0.338	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THADA	HGNC	protein_coding	OTTHUMT00000326070.3	-	0.00	50	0	T	NM_022065		43818024	-1	tier1	-	no_errors	ENST00000405006	ensembl	human	known	74_37	missense	43.84	41	32	SNP	0.999	C
TP53	7157	genome.wustl.edu	37	17	7578526	7578527	+	Frame_Shift_Ins	INS	-	-	A	rs587781991		TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr17:7578526_7578527insA	ENST00000269305.4	-	5	592_593	c.403_404insT	c.(403-405)tgcfs	p.C135fs	TP53_ENST00000413465.2_Frame_Shift_Ins_p.C135fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Ins_p.C135fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.C135fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.C135fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.C135fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	135	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> T (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation; decreased E6-mediated binding to E6-AP).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C135Y(60)|p.C135F(43)|p.C135S(12)|p.C135R(11)|p.0?(8)|p.C135G(6)|p.C135fs*35(4)|p.C42Y(4)|p.C3Y(4)|p.C135fs*9(3)|p.C135fs*14(2)|p.N131fs*27(2)|p.C3F(2)|p.C42F(2)|p.F134_T140>S(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.C135T(1)|p.V73fs*9(1)|p.C135fs*36(1)|p.C135fs*15(1)|p.Y126fs*11(1)|p.C3fs*9(1)|p.C42fs*9(1)|p.C135_A138delCQLA(1)|p.C42S(1)|p.C42R(1)|p.M133fs*13(1)|p.C3S(1)|p.C3R(1)|p.F134fs*14(1)|p.C135_T140delCQLAKT(1)|p.Q136fs*13(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCCAGTTGGCAAAACATCTTG	0.569		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	182	Substitution - Missense(149)|Deletion - Frameshift(15)|Whole gene deletion(8)|Insertion - Frameshift(5)|Deletion - In frame(4)|Complex - deletion inframe(1)	large_intestine(22)|breast(20)|haematopoietic_and_lymphoid_tissue(19)|oesophagus(18)|upper_aerodigestive_tract(14)|urinary_tract(13)|lung(11)|prostate(11)|ovary(10)|central_nervous_system(7)|liver(7)|bone(6)|biliary_tract(5)|stomach(5)|pancreas(3)|skin(2)|autonomic_ganglia(2)|soft_tissue(2)|kidney(1)|eye(1)|NS(1)|penis(1)|pituitary(1)																																								SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.404dupT	17.37:g.7578530_7578530dupA	ENSP00000269305:p.Cys135fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C135fs	ENST00000269305.4	37	c.404_403	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.569	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1		0.00	40	0	-	NM_000546		7578527	-1	tier1		no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_ins	48.57	18	17	INS	1.000:1.000	A
TMIGD1	388364	genome.wustl.edu	37	17	28645840	28645840	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr17:28645840C>G	ENST00000328886.4	-	5	804	c.732G>C	c.(730-732)aaG>aaC	p.K244N	TMIGD1_ENST00000538566.2_Intron	NM_206832.1	NP_996663.1	Q6UXZ0	TMIG1_HUMAN	transmembrane and immunoglobulin domain containing 1	244						integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(1)|lung(5)|skin(2)	12						TCATTATTTTCTTTCTTCTAG	0.353																																																	0													123.0	116.0	118.0					17																	28645840		2203	4300	6503	SO:0001583	missense	0			AY358153	CCDS32605.1	17q11.2	2013-01-29	2006-07-05	2006-07-05		ENSG00000182271		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32431	protein-coding gene	gene with protein product				TMIGD		12975309	Standard	NM_206832		Approved	UNQ9372	uc002hfa.1	Q6UXZ0		ENST00000328886.4:c.732G>C	17.37:g.28645840C>G	ENSP00000332404:p.Lys244Asn		A8K2K1|Q6ZMC6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.K244N	ENST00000328886.4	37	c.732	CCDS32605.1	17	.	.	.	.	.	.	.	.	.	.	C	7.681	0.689088	0.14973	.	.	ENSG00000182271	ENST00000328886	T	0.65916	-0.18	5.25	-5.45	0.02616	.	1.181090	0.05817	N	0.615104	T	0.52645	0.1747	L	0.56769	1.78	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.43669	-0.9377	10	0.39692	T	0.17	0.1966	7.4145	0.27036	0.0:0.2534:0.4893:0.2573	.	244	Q6UXZ0	TMIG1_HUMAN	N	244	ENSP00000332404:K244N	ENSP00000332404:K244N	K	-	3	2	TMIGD1	25669966	0.020000	0.18652	0.049000	0.19019	0.852000	0.48524	-0.933000	0.03959	-1.027000	0.03325	-0.345000	0.07892	AAG	TMIGD1	-	NULL	ENSG00000182271		0.353	TMIGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMIGD1	HGNC	protein_coding	OTTHUMT00000447955.1		0.00	25	0	C	NM_206832		28645840	-1			no_errors	ENST00000328886	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.019	G
TRPM6	140803	genome.wustl.edu	37	9	77377816	77377816	+	Silent	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr9:77377816G>A	ENST00000360774.1	-	26	4008	c.3771C>T	c.(3769-3771)atC>atT	p.I1257I	TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000361255.3_Silent_p.I1252I|TRPM6_ENST00000449912.2_Silent_p.I1252I|TRPM6_ENST00000376864.4_Silent_p.I1257I|TRPM6_ENST00000451710.3_Silent_p.I1257I|TRPM6_ENST00000376871.3_Intron	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1257					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						CCTCTGCACAGATGACATTGC	0.507																																																	0													105.0	108.0	107.0					9																	77377816		2203	4300	6503	SO:0001819	synonymous_variant	0			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.3771C>T	9.37:g.77377816G>A			Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Silent	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.I1257	ENST00000360774.1	37	c.3771	CCDS6647.1	9																																																																																			TRPM6	-	NULL	ENSG00000119121		0.507	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1	-	0.00	42	0	G	NM_017662		77377816	-1	tier1	-	no_errors	ENST00000451710	ensembl	human	known	74_37	silent	37.50	20	12	SNP	0.024	A
TUSC5	286753	genome.wustl.edu	37	17	1198846	1198846	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr17:1198846G>A	ENST00000333813.3	+	2	788	c.449G>A	c.(448-450)cGg>cAg	p.R150Q		NM_172367.2	NP_758955.2	Q8IXB3	TUSC5_HUMAN	tumor suppressor candidate 5	150					response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|prostate(4)|skin(2)	15				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CGCCTGGCTCGGCTGCTCAGC	0.617																																																	0													83.0	100.0	94.0					17																	1198846		2118	4240	6358	SO:0001583	missense	0			AB090231	CCDS42225.1	17p13.3	2009-10-16			ENSG00000184811	ENSG00000184811			29592	protein-coding gene	gene with protein product	"""located at seventeen p thirteen point three 1"", ""interferon induced transmembrane protein domain containing 3"""	612211				12660825	Standard	NM_172367		Approved	LOST1, IFITMD3	uc002fsi.1	Q8IXB3	OTTHUMG00000132196	ENST00000333813.3:c.449G>A	17.37:g.1198846G>A	ENSP00000329548:p.Arg150Gln		A6NMK4	Missense_Mutation	SNP	pfam_CD225/Dispanin_fam	p.R150Q	ENST00000333813.3	37	c.449	CCDS42225.1	17	.	.	.	.	.	.	.	.	.	.	G	20.4	3.992625	0.74703	.	.	ENSG00000184811	ENST00000333813	D	0.86769	-2.17	5.56	5.56	0.83823	.	0.078682	0.46442	U	0.000291	D	0.92622	0.7656	M	0.80183	2.485	0.37960	D	0.932956	D	0.76494	0.999	P	0.60949	0.881	D	0.93941	0.7223	10	0.54805	T	0.06	-10.9276	16.2486	0.82467	0.0:0.0:1.0:0.0	.	150	Q8IXB3	TUSC5_HUMAN	Q	150	ENSP00000329548:R150Q	ENSP00000329548:R150Q	R	+	2	0	TUSC5	1145596	0.367000	0.25023	1.000000	0.80357	0.994000	0.84299	2.790000	0.47821	2.629000	0.89072	0.609000	0.83330	CGG	TUSC5	-	pfam_CD225/Dispanin_fam	ENSG00000184811		0.617	TUSC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUSC5	HGNC	protein_coding	OTTHUMT00000255249.1	-	0.00	57	0	G	NM_172367		1198846	+1	tier1	-	no_errors	ENST00000333813	ensembl	human	known	74_37	missense	12.90	53	8	SNP	0.924	A
ZNF177	7730	genome.wustl.edu	37	19	9492426	9492426	+	Silent	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr19:9492426C>T	ENST00000589262.1	+	6	1485	c.1419C>T	c.(1417-1419)atC>atT	p.I473I	ZNF177_ENST00000590616.1_Intron|ZNF177_ENST00000446085.4_3'UTR|ZNF177_ENST00000541595.2_Silent_p.I313I|ZNF177_ENST00000602856.1_3'UTR|ZNF177_ENST00000434737.2_Silent_p.I473I|ZNF177_ENST00000343499.4_Silent_p.I313I|ZNF177_ENST00000602738.1_Silent_p.I313I	NM_001172651.1	NP_001166122.1	Q13360	ZN177_HUMAN	zinc finger protein 177	473					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|stomach(2)	13						ACAAGCGAATCCACAATGGCC	0.433																																																	0													144.0	152.0	149.0					19																	9492426		2203	4299	6502	SO:0001819	synonymous_variant	0			U37263, BC012012	CCDS12212.1, CCDS54214.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	12966	protein-coding gene	gene with protein product		601276					Standard	NM_003451		Approved		uc021uon.1	Q13360		ENST00000589262.1:c.1419C>T	19.37:g.9492426C>T			B4DY57|E9PDG0|I3L0I4|Q96ER2	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I473	ENST00000589262.1	37	c.1419	CCDS54214.1	19																																																																																			ZNF177	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000188629		0.433	ZNF177-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF177	HGNC	protein_coding	OTTHUMT00000449028.1	-	0.00	12	0	C	NM_003451		9492426	+1	tier1	-	no_errors	ENST00000434737	ensembl	human	known	74_37	silent	26.67	11	4	SNP	0.039	T
ZNF185	7739	genome.wustl.edu	37	X	152101493	152101493	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chrX:152101493G>T	ENST00000370268.4	+	14	1133	c.1096G>T	c.(1096-1098)Gac>Tac	p.D366Y	ZNF185_ENST00000370270.2_Missense_Mutation_p.D366Y|ZNF185_ENST00000535861.1_Missense_Mutation_p.D366Y|ZNF185_ENST00000449285.2_Missense_Mutation_p.D367Y|ZNF185_ENST00000324823.6_Intron|ZNF185_ENST00000539731.1_Missense_Mutation_p.D337Y|ZNF185_ENST00000318504.7_Missense_Mutation_p.D307Y|ZNF185_ENST00000318529.8_Missense_Mutation_p.D145Y			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	366						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					GGCTGCAGTAGACATCGGCTC	0.602																																																	0													42.0	41.0	41.0					X																	152101493		1995	4131	6126	SO:0001583	missense	0			AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.1096G>T	X.37:g.152101493G>T	ENSP00000359291:p.Asp366Tyr		A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Missense_Mutation	SNP	smart_Znf_LIM,pfscan_Znf_LIM	p.D366Y	ENST00000370268.4	37	c.1096	CCDS48184.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.724|9.724	1.160453|1.160453	0.21454|0.21454	.|.	.|.	ENSG00000147394|ENSG00000147394	ENST00000535861;ENST00000539731;ENST00000449285;ENST00000318504;ENST00000535156;ENST00000433245;ENST00000370268;ENST00000318529;ENST00000436731|ENST00000426821;ENST00000447088	T;T;T;T;T|.	0.62364|.	0.13;0.5;0.1;0.03;0.1|.	3.19|3.19	3.19|3.19	0.36642|0.36642	.|.	0.368782|.	0.19030|.	U|.	0.124572|.	T|T	0.23886|0.23886	0.0578|0.0578	N|N	0.16478|0.16478	0.41|0.41	0.09310|0.09310	N|N	1|1	B;B;D;B;B;B;B|.	0.69078|.	0.005;0.005;0.997;0.019;0.023;0.005;0.019|.	B;B;P;B;B;B;B|.	0.60345|.	0.01;0.01;0.873;0.027;0.015;0.01;0.007|.	T|T	0.14309|0.14309	-1.0477|-1.0477	10|5	0.62326|.	D|.	0.03|.	-12.3538|-12.3538	9.0748|9.0748	0.36515|0.36515	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	367;307;337;337;366;366;145|.	O15231-3;B8K2L9;B8K2M0;F5GZL4;F5GXF7;O15231;F8W8V7|.	.;.;.;.;.;ZN185_HUMAN;.|.	Y|I	366;337;367;307;201;232;366;145;39|151;183	ENSP00000440847:D366Y;ENSP00000444367:D337Y;ENSP00000395228:D367Y;ENSP00000312782:D307Y;ENSP00000359291:D366Y|.	ENSP00000312782:D307Y|.	D|R	+|+	1|2	0|0	ZNF185|ZNF185	151852149|151852149	0.902000|0.902000	0.30710|0.30710	0.011000|0.011000	0.14972|0.14972	0.045000|0.045000	0.14185|0.14185	1.742000|1.742000	0.38248|0.38248	1.876000|1.876000	0.54355|0.54355	0.483000|0.483000	0.47432|0.47432	GAC|AGA	ZNF185	-	NULL	ENSG00000147394		0.602	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF185	HGNC	protein_coding	OTTHUMT00000377480.1	-	0.00	35	0	G	NM_007150		152101493	+1	tier1	-	no_errors	ENST00000370270	ensembl	human	known	74_37	missense	47.22	19	17	SNP	0.010	T
ZNF229	7772	genome.wustl.edu	37	19	44946800	44946800	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr19:44946800G>A	ENST00000588931.1	-	4	473	c.40C>T	c.(40-42)Cat>Tat	p.H14Y	ZNF229_ENST00000291187.4_Missense_Mutation_p.H14Y|ZNF229_ENST00000591289.1_5'UTR|CTC-512J12.4_ENST00000588655.1_RNA	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	14					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				GCTTGAGAATGAAGAGCTGTA	0.498																																																	0													106.0	103.0	104.0					19																	44946800		1906	4112	6018	SO:0001583	missense	0			AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.40C>T	19.37:g.44946800G>A	ENSP00000466519:p.His14Tyr		B2RWN3|Q59FV2|Q86WL9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H14Y	ENST00000588931.1	37	c.40	CCDS42574.1	19	.	.	.	.	.	.	.	.	.	.	G	6.017	0.371493	0.11409	.	.	ENSG00000167383	ENST00000291187	T	0.06687	3.27	2.99	0.847	0.18961	.	.	.	.	.	T	0.04137	0.0115	N	0.08118	0	0.09310	N	1	B	0.27594	0.182	B	0.28638	0.092	T	0.41734	-0.9492	9	0.49607	T	0.09	.	4.9178	0.13854	0.2917:0.0:0.7083:0.0	.	14	Q9UJW7	ZN229_HUMAN	Y	14	ENSP00000291187:H14Y	ENSP00000291187:H14Y	H	-	1	0	ZNF229	49638640	0.000000	0.05858	0.000000	0.03702	0.256000	0.26092	-0.131000	0.10482	0.300000	0.22699	0.609000	0.83330	CAT	ZNF229	-	NULL	ENSG00000167383		0.498	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF229	HGNC	protein_coding	OTTHUMT00000460833.1	-	0.00	75	0	G	NM_014518		44946800	-1	tier1	-	no_errors	ENST00000588931	ensembl	human	known	74_37	missense	23.44	49	15	SNP	0.000	A
ZNF354C	30832	genome.wustl.edu	37	5	178506536	178506536	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr5:178506536T>C	ENST00000315475.6	+	5	1409	c.1103T>C	c.(1102-1104)tTt>tCt	p.F368S		NM_014594.1	NP_055409.1	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	368					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|urinary_tract(3)	30	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		TACAGCCAGTTTACATCTCTA	0.423																																																	0													119.0	116.0	117.0					5																	178506536		2203	4300	6503	SO:0001583	missense	0				CCDS4443.1	5q35	2013-01-08			ENSG00000177932	ENSG00000177932		"""Zinc fingers, C2H2-type"", ""-"""	16736	protein-coding gene	gene with protein product						10786630	Standard	NM_014594		Approved	KID3	uc003mju.3	Q86Y25	OTTHUMG00000130888	ENST00000315475.6:c.1103T>C	5.37:g.178506536T>C	ENSP00000324064:p.Phe368Ser		Q6P4P9|Q8NFX1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F368S	ENST00000315475.6	37	c.1103	CCDS4443.1	5	.	.	.	.	.	.	.	.	.	.	T	0.025	-1.378807	0.01204	.	.	ENSG00000177932	ENST00000315475	T	0.04917	3.53	4.04	1.38	0.22167	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00998	0.0033	N	0.00096	-2.155	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.46133	-0.9213	9	0.02654	T	1	-2.2491	4.5826	0.12266	0.0:0.108:0.3993:0.4928	.	368	Q86Y25	Z354C_HUMAN	S	368	ENSP00000324064:F368S	ENSP00000324064:F368S	F	+	2	0	ZNF354C	178439142	0.000000	0.05858	0.498000	0.27564	0.434000	0.31775	-0.395000	0.07287	0.683000	0.31428	0.482000	0.46254	TTT	ZNF354C	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000177932		0.423	ZNF354C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF354C	HGNC	protein_coding	OTTHUMT00000253473.2		0.00	23	0	T			178506536	+1			no_errors	ENST00000315475	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.000	C
ZNF562	54811	genome.wustl.edu	37	19	9763776	9763776	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr19:9763776C>T	ENST00000448622.1	-	6	1292	c.1130G>A	c.(1129-1131)tGt>tAt	p.C377Y	ZNF562_ENST00000541032.1_Missense_Mutation_p.C340Y|ZNF562_ENST00000537617.1_Missense_Mutation_p.C261Y|ZNF562_ENST00000453792.2_Missense_Mutation_p.C308Y|ZNF562_ENST00000453372.2_Missense_Mutation_p.C377Y|ZNF562_ENST00000590155.1_Missense_Mutation_p.C376Y|ZNF562_ENST00000293648.4_Missense_Mutation_p.C305Y	NM_001130031.1|NM_001130032.1	NP_001123503.1|NP_001123504.1	Q6V9R5	ZN562_HUMAN	zinc finger protein 562	377					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	17						GGCTTTCCCACATTCCTTACA	0.423																																																	0													135.0	127.0	130.0					19																	9763776		2203	4300	6503	SO:0001583	missense	0			AK000086	CCDS12217.1, CCDS45956.1, CCDS74280.1	19p13.2	2013-09-20			ENSG00000171466	ENSG00000171466		"""Zinc fingers, C2H2-type"", ""-"""	25950	protein-coding gene	gene with protein product							Standard	NM_001130031		Approved	FLJ20079	uc010xks.2	Q6V9R5	OTTHUMG00000180205	ENST00000448622.1:c.1130G>A	19.37:g.9763776C>T	ENSP00000411784:p.Cys377Tyr		Q32MN2|Q9NXS5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C377Y	ENST00000448622.1	37	c.1130	CCDS45956.1	19	.	.	.	.	.	.	.	.	.	.	C	19.02	3.745737	0.69418	.	.	ENSG00000171466	ENST00000453372;ENST00000448622;ENST00000293648;ENST00000541032;ENST00000453792;ENST00000537617	D;D;D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04;-2.04;-2.04	1.67	0.601	0.17529	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93298	0.7864	H	0.97051	3.93	0.38169	D	0.939276	D;D;D;D;D	0.89917	0.995;0.996;1.0;0.999;0.999	D;D;D;D;D	0.87578	0.991;0.992;0.998;0.996;0.995	D	0.91009	0.4848	9	0.87932	D	0	.	6.1011	0.20047	0.0:0.8177:0.0:0.1823	.	261;376;340;377;305	F5H1B4;B4DMG0;B4DZP9;Q6V9R5;Q6V9R5-2	.;.;.;ZN562_HUMAN;.	Y	377;377;305;340;308;261	ENSP00000410734:C377Y;ENSP00000411784:C377Y;ENSP00000293648:C305Y;ENSP00000442614:C340Y;ENSP00000440451:C308Y;ENSP00000445816:C261Y	ENSP00000293648:C305Y	C	-	2	0	ZNF562	9624776	1.000000	0.71417	0.138000	0.22173	0.920000	0.55202	6.198000	0.72106	0.258000	0.21686	0.313000	0.20887	TGT	ZNF562	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171466		0.423	ZNF562-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF562	HGNC	protein_coding	OTTHUMT00000450239.1	-	0.00	75	0	C	NM_017656		9763776	-1	tier1	-	no_errors	ENST00000448622	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
ZNF606	80095	genome.wustl.edu	37	19	58491630	58491630	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr19:58491630C>A	ENST00000341164.4	-	7	1038	c.418G>T	c.(418-420)Gaa>Taa	p.E140*	ZNF606_ENST00000536132.1_Nonsense_Mutation_p.E50*	NM_025027.3	NP_079303.2	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	140					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		GCTTTGCTTTCAAGATTTCTC	0.388																																																	0													98.0	91.0	93.0					19																	58491630		2203	4300	6503	SO:0001587	stop_gained	0			AB058755	CCDS12968.1	19q13.43	2013-01-08			ENSG00000166704	ENSG00000166704		"""Zinc fingers, C2H2-type"", ""-"""	25879	protein-coding gene	gene with protein product		613905		ZNF328		11347906	Standard	XM_005259276		Approved	FLJ14260, KIAA1852	uc002qqw.3	Q8WXB4	OTTHUMG00000169804	ENST00000341164.4:c.418G>T	19.37:g.58491630C>A	ENSP00000343617:p.Glu140*		A8KAN2|Q8NE04|Q96JH5	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E140*	ENST00000341164.4	37	c.418	CCDS12968.1	19	.	.	.	.	.	.	.	.	.	.	C	32	5.189901	0.94923	.	.	ENSG00000166704	ENST00000341164;ENST00000536132;ENST00000551380	.	.	.	4.88	4.88	0.63580	.	0.000000	0.43579	D	0.000555	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	11.2726	0.49148	0.0:0.8156:0.1844:0.0	.	.	.	.	X	140;50;140	.	ENSP00000343617:E140X	E	-	1	0	ZNF606	63183442	0.199000	0.23386	0.979000	0.43373	0.954000	0.61252	0.447000	0.21710	2.519000	0.84933	0.655000	0.94253	GAA	ZNF606	-	NULL	ENSG00000166704		0.388	ZNF606-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF606	HGNC	protein_coding	OTTHUMT00000405961.1	-	0.00	40	0	C	NM_025027		58491630	-1	tier1	-	no_errors	ENST00000341164	ensembl	human	known	74_37	nonsense	14.55	47	8	SNP	0.956	A
ZNF638	27332	genome.wustl.edu	37	2	71653884	71653884	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr2:71653884G>A	ENST00000409544.1	+	24	5515	c.4885G>A	c.(4885-4887)Gaa>Aaa	p.E1629K	ZNF638_ENST00000264447.4_Missense_Mutation_p.E1629K|ZNF638_ENST00000409407.1_Missense_Mutation_p.E569K|ZNF638_ENST00000355812.3_3'UTR	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1629					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						TGATGAAGAAGAACTAAATAT	0.353																																																	0													65.0	63.0	64.0					2																	71653884		2203	4300	6503	SO:0001583	missense	0			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.4885G>A	2.37:g.71653884G>A	ENSP00000386433:p.Glu1629Lys		B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	pfam_RRM_dom,smart_Znf_U1,smart_Znf_C2H2-like,smart_RRM_dom,pfscan_Znf_C2H2_matrin,pfscan_RRM_dom	p.E1629K	ENST00000409544.1	37	c.4885	CCDS1917.1	2	.	.	.	.	.	.	.	.	.	.	G	24.7	4.559527	0.86335	.	.	ENSG00000075292	ENST00000264447;ENST00000409544;ENST00000409407;ENST00000462695	T;T;T	0.41400	1.0;1.0;1.37	5.57	5.57	0.84162	.	0.112679	0.39615	N	0.001312	T	0.40862	0.1134	N	0.24115	0.695	0.80722	D	1	P;P	0.48503	0.911;0.856	P;B	0.50192	0.634;0.43	T	0.10474	-1.0628	10	0.30854	T	0.27	-11.5347	17.0482	0.86510	0.0:0.0:1.0:0.0	.	1629;1629	Q14966-3;Q14966	.;ZN638_HUMAN	K	1629;1629;569;569	ENSP00000264447:E1629K;ENSP00000386433:E1629K;ENSP00000386813:E569K	ENSP00000264447:E1629K	E	+	1	0	ZNF638	71507392	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.204000	0.77872	2.623000	0.88846	0.591000	0.81541	GAA	ZNF638	-	NULL	ENSG00000075292		0.353	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF638	HGNC	protein_coding	OTTHUMT00000327431.1	-	0.00	18	0	G	NM_014497		71653884	+1	tier1	-	no_errors	ENST00000264447	ensembl	human	known	74_37	missense	40.91	13	9	SNP	1.000	A
ZNF710	374655	genome.wustl.edu	37	15	90623058	90623058	+	Silent	SNP	A	A	G			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr15:90623058A>G	ENST00000268154.4	+	5	2243	c.1992A>G	c.(1990-1992)ctA>ctG	p.L664L	RP11-617F23.1_ENST00000558334.1_RNA	NM_198526.2	NP_940928.2	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	664					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(1)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	19	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			ACAATGTGCTATAGCGCAAGC	0.627																																																	0													50.0	45.0	47.0					15																	90623058		2200	4298	6498	SO:0001819	synonymous_variant	0			AK094712	CCDS10358.1	15q26.1	2013-01-08			ENSG00000140548	ENSG00000140548		"""Zinc fingers, C2H2-type"""	25352	protein-coding gene	gene with protein product							Standard	XM_005254905		Approved	DKFZp547K1113, FLJ37393, FLJ00306	uc002bov.2	Q8N1W2	OTTHUMG00000149812	ENST00000268154.4:c.1992A>G	15.37:g.90623058A>G			A0AVS3|Q6ZMK9|Q8NDU0	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L664	ENST00000268154.4	37	c.1992	CCDS10358.1	15																																																																																			ZNF710	-	NULL	ENSG00000140548		0.627	ZNF710-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF710	HGNC	protein_coding	OTTHUMT00000313423.1		0.00	26	0	A	NM_198526		90623058	+1			no_errors	ENST00000268154	ensembl	human	known	74_37	silent	11.54	23	3	SNP	1.000	G
ZNF793	390927	genome.wustl.edu	37	19	38023343	38023343	+	Missense_Mutation	SNP	G	G	T	rs371262002	byFrequency	TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr19:38023343G>T	ENST00000587143.1	+	4	336	c.101G>T	c.(100-102)cGg>cTg	p.R34L	ZNF793_ENST00000542455.1_Missense_Mutation_p.R34L|ZNF793_ENST00000587986.1_Missense_Mutation_p.R34L|ZNF793_ENST00000589319.1_Missense_Mutation_p.R34L|ZNF793_ENST00000445217.1_Missense_Mutation_p.R34L|ZNF793_ENST00000588578.1_Missense_Mutation_p.R34L			Q6ZN11	ZN793_HUMAN	zinc finger protein 793	34	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(2)|lung(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GCCCTGTACCGGGATGTGATG	0.488													G|||	2	0.000399361	0.0015	0.0	5008	,	,		19529	0.0		0.0	False		,,,				2504	0.0				Melanoma(44;400 1431 1499 19093)												0													68.0	71.0	70.0					19																	38023343		2192	4300	6492	SO:0001583	missense	0			AK131417	CCDS46062.1	19q13.12	2013-01-08				ENSG00000188227		"""Zinc fingers, C2H2-type"", ""-"""	33115	protein-coding gene	gene with protein product							Standard	NM_001013659		Approved		uc010efm.3	Q6ZN11		ENST00000587143.1:c.101G>T	19.37:g.38023343G>T	ENSP00000468605:p.Arg34Leu		E9PGN4|Q7Z3Q9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R34L	ENST00000587143.1	37	c.101	CCDS46062.1	19	.	.	.	.	.	.	.	.	.	.	G	18.86	3.714199	0.68730	.	.	ENSG00000188227	ENST00000542455;ENST00000418827;ENST00000445217;ENST00000322299	T;T	0.02709	4.19;4.19	3.53	1.28	0.21552	Krueppel-associated box (4);	.	.	.	.	T	0.09512	0.0234	M	0.82923	2.615	0.25937	N	0.982926	D;D	0.57257	0.979;0.979	P;P	0.56563	0.801;0.801	T	0.13176	-1.0519	9	0.59425	D	0.04	.	4.2049	0.10485	0.1359:0.2442:0.62:0.0	.	34;34	Q6ZN11;E9PGN4	ZN793_HUMAN;.	L	34;34;34;33	ENSP00000444355:R34L;ENSP00000396402:R34L	ENSP00000318811:R33L	R	+	2	0	ZNF793	42715183	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	1.259000	0.32956	0.760000	0.33108	0.563000	0.77884	CGG	ZNF793	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000188227		0.488	ZNF793-006	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF793	HGNC	protein_coding	OTTHUMT00000458621.1	-	0.00	69	0	G	NM_001013659		38023343	+1	tier1	-	no_errors	ENST00000445217	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
ZNF766	90321	genome.wustl.edu	37	19	52794164	52794164	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr19:52794164C>T	ENST00000439461.1	+	4	1163	c.1120C>T	c.(1120-1122)Cag>Tag	p.Q374*	ZNF766_ENST00000593612.1_Nonsense_Mutation_p.Q389*|CTD-2525I3.5_ENST00000594865.1_RNA|ZNF766_ENST00000599581.1_3'UTR|ZNF766_ENST00000359102.4_Nonsense_Mutation_p.Q389*	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766	374					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		GACAGTTCATCAGAGAAATCA	0.398																																																	0													39.0	44.0	42.0					19																	52794164		2184	4289	6473	SO:0001587	stop_gained	0			AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.1120C>T	19.37:g.52794164C>T	ENSP00000409652:p.Gln374*		B2RNE0|Q7Z326	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q389*	ENST00000439461.1	37	c.1165	CCDS46163.1	19	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944644	0.73672	.	.	ENSG00000196214	ENST00000439461;ENST00000359102	.	.	.	2.24	-4.47	0.03525	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	0.3186	0.00300	0.2415:0.2092:0.291:0.2584	.	.	.	.	X	374;389	.	ENSP00000352005:Q389X	Q	+	1	0	ZNF766	57485976	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-0.692000	0.05127	-0.613000	0.05694	-0.157000	0.13467	CAG	ZNF766	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196214		0.398	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF766	HGNC	protein_coding	OTTHUMT00000462764.1	-	0.00	22	0	C	NM_001010851		52794164	+1	tier1	-	no_errors	ENST00000359102	ensembl	human	known	74_37	nonsense	14.81	23	4	SNP	0.007	T
ZNF831	128611	genome.wustl.edu	37	20	57768323	57768323	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43H-01A-11D-A247-09	TCGA-L5-A43H-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	67ae007e-a5ef-4d44-8c27-2a0991f44b4d	0af35cb6-de6b-423a-80b8-7e2d4c8bac64	g.chr20:57768323C>T	ENST00000371030.2	+	1	2249	c.2249C>T	c.(2248-2250)tCt>tTt	p.S750F		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	750							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CCCCTGGTCTCTCCAAATGGG	0.642																																																	0													18.0	21.0	20.0					20																	57768323		1935	4134	6069	SO:0001583	missense	0			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.2249C>T	20.37:g.57768323C>T	ENSP00000360069:p.Ser750Phe		Q5TDR4|Q8TCP0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S750F	ENST00000371030.2	37	c.2249	CCDS42894.1	20	.	.	.	.	.	.	.	.	.	.	C	14.25	2.478493	0.44044	.	.	ENSG00000124203	ENST00000371030	T	0.04917	3.53	4.95	4.0	0.46444	.	0.908741	0.09283	N	0.823498	T	0.06554	0.0168	L	0.27053	0.805	0.31373	N	0.679975	P	0.35982	0.531	B	0.35971	0.215	T	0.17992	-1.0351	10	0.66056	D	0.02	-0.1635	10.3465	0.43909	0.0:0.9089:0.0:0.0911	.	750	Q5JPB2	ZN831_HUMAN	F	750	ENSP00000360069:S750F	ENSP00000360069:S750F	S	+	2	0	ZNF831	57201718	0.147000	0.22687	0.154000	0.22540	0.031000	0.12232	1.418000	0.34782	1.064000	0.40671	0.551000	0.68910	TCT	ZNF831	-	NULL	ENSG00000124203		0.642	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	HGNC	protein_coding	OTTHUMT00000079916.2	-	0.00	61	0	C	NM_178457		57768323	+1	tier1	-	no_errors	ENST00000371030	ensembl	human	novel	74_37	missense	12.82	34	5	SNP	0.979	T
