#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AASS	10157	genome.wustl.edu	37	7	121773700	121773700	+	Silent	SNP	G	G	A	rs138449792		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:121773700G>A	ENST00000393376.1	-	1	176	c.81C>T	c.(79-81)gcC>gcT	p.A27A	AASS_ENST00000473553.1_Intron|AASS_ENST00000417368.2_Silent_p.A27A			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	27					cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						CCCTCCGGACGGCCAACACAG	0.567																																																	0								G		0,4406		0,0,2203	113.0	109.0	110.0		81	-5.7	0.1	7	dbSNP_134	110	2,8598		0,2,4298	no	coding-synonymous	AASS	NM_005763.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		27/927	121773700	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.81C>T	7.37:g.121773700G>A			O95462	Silent	SNP	pfam_Saccharopine_DH/HSpermid_syn,pfam_AlaDH/PNT_NAD(H)-bd,pfam_AlaDH/PNT_N	p.A27	ENST00000393376.1	37	c.81	CCDS5783.1	7																																																																																			AASS	-	NULL	ENSG00000008311		0.567	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AASS	HGNC	protein_coding	OTTHUMT00000347300.1	-	0.00	76	0	G	NM_005763		121773700	-1	tier1	rs138449792	no_errors	ENST00000393376	ensembl	human	known	74_37	silent	58.49	22	31	SNP	0.030	A
ABCA12	26154	genome.wustl.edu	37	2	215890486	215890486	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:215890486G>T	ENST00000272895.7	-	11	1417	c.1198C>A	c.(1198-1200)Cag>Aag	p.Q400K	AC072062.3_ENST00000595058.1_RNA|AC072062.3_ENST00000419251.1_RNA|ABCA12_ENST00000389661.4_Missense_Mutation_p.Q82K|AC072062.3_ENST00000602182.1_RNA|AC072062.3_ENST00000437897.3_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	400					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ATTGTGGACTGCAGGAGTCTT	0.373																																					Ovarian(66;664 1488 5121 34295)												0													72.0	74.0	73.0					2																	215890486		2203	4299	6502	SO:0001583	missense	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.1198C>A	2.37:g.215890486G>T	ENSP00000272895:p.Gln400Lys		Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.Q400K	ENST00000272895.7	37	c.1198	CCDS33372.1	2	.	.	.	.	.	.	.	.	.	.	G	11.85	1.760277	0.31137	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	T;T	0.54866	0.55;0.55	5.96	5.09	0.68999	.	0.320832	0.26470	N	0.024182	T	0.34366	0.0895	N	0.24115	0.695	0.80722	D	1	B;B	0.17465	0.013;0.022	B;B	0.17722	0.009;0.019	T	0.16541	-1.0399	10	0.02654	T	1	.	12.776	0.57448	0.0:0.0:0.8361:0.1639	.	400;82	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	K	400;82	ENSP00000272895:Q400K;ENSP00000374312:Q82K	ENSP00000272895:Q400K	Q	-	1	0	ABCA12	215598731	0.999000	0.42202	0.997000	0.53966	0.911000	0.54048	3.234000	0.51320	1.530000	0.49136	-0.127000	0.14921	CAG	ABCA12	-	NULL	ENSG00000144452		0.373	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	-	0.00	71	0	G	NM_173076		215890486	-1	tier1	-	no_errors	ENST00000272895	ensembl	human	known	74_37	missense	26.32	42	15	SNP	0.995	T
ABCC9	10060	genome.wustl.edu	37	12	21967598	21967598	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:21967598C>A	ENST00000261201.4	-	33	4081	c.4082G>T	c.(4081-4083)aGa>aTa	p.R1361I	ABCC9_ENST00000345162.2_Missense_Mutation_p.R1325I|ABCC9_ENST00000261200.4_Missense_Mutation_p.R1361I	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1361	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	ATCAACCATTCTGAAGAAAGC	0.398																																																	0													117.0	108.0	111.0					12																	21967598		2203	4300	6503	SO:0001583	missense	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.4082G>T	12.37:g.21967598C>A	ENSP00000261201:p.Arg1361Ile		O60707	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2	p.R1361I	ENST00000261201.4	37	c.4082	CCDS8694.1	12	.	.	.	.	.	.	.	.	.	.	C	20.4	3.978958	0.74360	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.92348	-3.02;-3.02;-3.02;-3.02	4.74	4.74	0.60224	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.109676	0.64402	D	0.000007	D	0.97720	0.9252	H	0.98155	4.16	0.58432	D	0.999994	D;D	0.76494	0.999;0.995	D;D	0.76071	0.987;0.938	D	0.99457	1.0942	10	0.87932	D	0	-15.7193	17.9259	0.88983	0.0:1.0:0.0:0.0	.	1361;1361	O60706;O60706-2	ABCC9_HUMAN;.	I	1361;988;1361;1325	ENSP00000261200:R1361I;ENSP00000440521:R988I;ENSP00000261201:R1361I;ENSP00000261202:R1325I	ENSP00000261200:R1361I	R	-	2	0	ABCC9	21858865	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.429000	0.59901	2.441000	0.82636	0.650000	0.86243	AGA	ABCC9	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000069431		0.398	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	-	0.00	30	0	C	NM_005691		21967598	-1	tier1	-	no_errors	ENST00000261200	ensembl	human	known	74_37	missense	20.00	16	4	SNP	1.000	A
ADAM7	8756	genome.wustl.edu	37	8	24356795	24356795	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr8:24356795C>A	ENST00000175238.6	+	17	1972	c.1889C>A	c.(1888-1890)tCa>tAa	p.S630*	RP11-624C23.1_ENST00000523578.1_RNA|RP11-561E1.1_ENST00000519364.1_RNA|ADAM7_ENST00000520720.1_Nonsense_Mutation_p.S402*|ADAM7_ENST00000380789.1_Nonsense_Mutation_p.S630*|RP11-624C23.1_ENST00000519689.1_RNA	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	630	Cys-rich.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		GTCTATATCTCAACCAATTGC	0.343																																																	0													148.0	135.0	139.0					8																	24356795		2203	4300	6503	SO:0001587	stop_gained	0			AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.1889C>A	8.37:g.24356795C>A	ENSP00000175238:p.Ser630*		A8K8X7|O75959|Q6PEJ6	Nonsense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.S630*	ENST00000175238.6	37	c.1889	CCDS6045.1	8	.	.	.	.	.	.	.	.	.	.	C	22.3	4.274171	0.80580	.	.	ENSG00000069206	ENST00000175238;ENST00000380789;ENST00000520720;ENST00000335595	.	.	.	4.92	4.04	0.47022	.	0.749130	0.11548	N	0.553098	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.0778	0.48043	0.0:0.9102:0.0:0.0898	.	.	.	.	X	630;630;402;445	.	ENSP00000175238:S630X	S	+	2	0	ADAM7	24412685	0.043000	0.20138	0.127000	0.21898	0.079000	0.17450	2.294000	0.43567	1.435000	0.47434	0.655000	0.94253	TCA	ADAM7	-	NULL	ENSG00000069206		0.343	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM7	HGNC	protein_coding	OTTHUMT00000215150.1	-	0.00	86	0	C	NM_003817		24356795	+1	tier1	-	no_errors	ENST00000175238	ensembl	human	known	74_37	nonsense	34.69	31	17	SNP	0.179	A
ADAMTS12	81792	genome.wustl.edu	37	5	33549398	33549398	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:33549398G>T	ENST00000504830.1	-	21	4551	c.4216C>A	c.(4216-4218)Cag>Aag	p.Q1406K	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.Q1321K	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1406	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GCCAGGAACTGGCAGTGAAAT	0.612										HNSCC(64;0.19)																																							0													78.0	82.0	81.0					5																	33549398		2203	4300	6503	SO:0001583	missense	0			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4216C>A	5.37:g.33549398G>T	ENSP00000422554:p.Gln1406Lys		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.Q1406K	ENST00000504830.1	37	c.4216	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	G	18.45	3.626948	0.66901	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.60672	0.17;0.17	5.16	5.16	0.70880	.	0.116434	0.64402	D	0.000014	T	0.60689	0.2288	M	0.81497	2.545	0.80722	D	1	B;B	0.22683	0.073;0.043	B;B	0.26770	0.073;0.033	T	0.58411	-0.7641	10	0.20519	T	0.43	.	15.5546	0.76184	0.0:0.0:1.0:0.0	.	1321;1406	P58397-3;P58397	.;ATS12_HUMAN	K	1406;1321	ENSP00000422554:Q1406K;ENSP00000344847:Q1321K	ENSP00000344847:Q1321K	Q	-	1	0	ADAMTS12	33585155	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.964000	0.76061	2.398000	0.81561	0.650000	0.86243	CAG	ADAMTS12	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt	ENSG00000151388		0.612	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	HGNC	protein_coding	OTTHUMT00000367164.2	-	0.00	53	0	G	NM_030955		33549398	-1	tier1	-	no_errors	ENST00000504830	ensembl	human	known	74_37	missense	24.44	34	11	SNP	1.000	T
ADAMTS12	81792	genome.wustl.edu	37	5	33751528	33751528	+	Missense_Mutation	SNP	C	C	A	rs372926192		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:33751528C>A	ENST00000504830.1	-	3	950	c.615G>T	c.(613-615)gaG>gaT	p.E205D	ADAMTS12_ENST00000515401.1_Missense_Mutation_p.E205D|ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.E205D	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	205					cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						CACAGGTTGGCTCCTTGGTTT	0.438										HNSCC(64;0.19)																																							0													139.0	138.0	138.0					5																	33751528		2203	4300	6503	SO:0001583	missense	0			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.615G>T	5.37:g.33751528C>A	ENSP00000422554:p.Glu205Asp		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.E205D	ENST00000504830.1	37	c.615	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	C	10.95	1.496810	0.26861	.	.	ENSG00000151388	ENST00000504830;ENST00000352040;ENST00000515401	T;T;T	0.59083	0.29;0.29;2.01	5.8	0.345	0.16011	.	0.371485	0.28736	N	0.014314	T	0.37293	0.0998	L	0.44542	1.39	0.23271	N	0.998009	B;B;B	0.15473	0.004;0.013;0.001	B;B;B	0.14578	0.011;0.008;0.001	T	0.06250	-1.0837	10	0.19590	T	0.45	.	0.8745	0.01221	0.1657:0.3967:0.1605:0.277	.	205;205;205	P58397-3;D6REX0;P58397	.;.;ATS12_HUMAN	D	205	ENSP00000422554:E205D;ENSP00000344847:E205D;ENSP00000421638:E205D	ENSP00000344847:E205D	E	-	3	2	ADAMTS12	33787285	0.049000	0.20398	0.748000	0.31131	0.516000	0.34256	-0.150000	0.10189	0.372000	0.24591	0.563000	0.77884	GAG	ADAMTS12	-	NULL	ENSG00000151388		0.438	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	HGNC	protein_coding	OTTHUMT00000367164.2	-	0.00	100	0	C	NM_030955		33751528	-1	tier1	-	no_errors	ENST00000504830	ensembl	human	known	74_37	missense	38.10	39	24	SNP	0.590	A
ADAMTS19	171019	genome.wustl.edu	37	5	128994320	128994320	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:128994320G>A	ENST00000274487.4	+	15	2442	c.2297G>A	c.(2296-2298)tGt>tAt	p.C766Y	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	766	Cys-rich.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AAAGTTGGCTGTGATGGTTTA	0.368																																																	0													174.0	170.0	171.0					5																	128994320		2203	4300	6503	SO:0001583	missense	0			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.2297G>A	5.37:g.128994320G>A	ENSP00000274487:p.Cys766Tyr			Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.C766Y	ENST00000274487.4	37	c.2297	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	G	19.11	3.763491	0.69763	.	.	ENSG00000145808	ENST00000274487	T	0.72725	-0.68	3.89	3.89	0.44902	.	0.000000	0.85682	D	0.000000	D	0.89001	0.6591	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92798	0.6254	9	.	.	.	.	17.1595	0.86800	0.0:0.0:1.0:0.0	.	766	Q8TE59	ATS19_HUMAN	Y	766	ENSP00000274487:C766Y	.	C	+	2	0	ADAMTS19	129022219	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.453000	0.90349	2.456000	0.83038	0.650000	0.86243	TGT	ADAMTS19	-	prints_Peptidase_M12B_ADAM-TS	ENSG00000145808		0.368	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	HGNC	protein_coding	OTTHUMT00000250979.2	-	0.00	103	0	G	NM_133638		128994320	+1	tier1	-	no_errors	ENST00000274487	ensembl	human	known	74_37	missense	16.18	57	11	SNP	1.000	A
ADAMTS2	9509	genome.wustl.edu	37	5	178771118	178771118	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:178771118C>T	ENST00000251582.7	-	2	285	c.184G>A	c.(184-186)Gtg>Atg	p.V62M	ADAMTS2_ENST00000274609.5_Missense_Mutation_p.V62M	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	62					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TCAGTGCGCACGGGCACCGCC	0.736																																																	0													10.0	11.0	11.0					5																	178771118		2117	4168	6285	SO:0001583	missense	0			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.184G>A	5.37:g.178771118C>T	ENSP00000251582:p.Val62Met			Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS2,prints_Peptidase_M12B_ADAM-TS	p.V62M	ENST00000251582.7	37	c.184	CCDS4444.1	5	.	.	.	.	.	.	.	.	.	.	C	19.71	3.878066	0.72294	.	.	ENSG00000087116	ENST00000251582;ENST00000274609	T;T	0.06768	3.26;3.26	5.19	4.19	0.49359	Peptidase M12B, propeptide (1);	0.376195	0.19440	N	0.114205	T	0.17746	0.0426	M	0.78916	2.43	0.34897	D	0.74616	D;D	0.64830	0.992;0.994	P;P	0.55667	0.674;0.781	T	0.23655	-1.0182	10	0.72032	D	0.01	.	2.6314	0.04946	0.2947:0.5248:0.0:0.1805	.	62;62	O95450-2;O95450	.;ATS2_HUMAN	M	62	ENSP00000251582:V62M;ENSP00000274609:V62M	ENSP00000251582:V62M	V	-	1	0	ADAMTS2	178703724	0.960000	0.32886	0.998000	0.56505	0.906000	0.53458	1.623000	0.37008	2.425000	0.82216	0.462000	0.41574	GTG	ADAMTS2	-	pfam_Peptidase_M12B_N	ENSG00000087116		0.736	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	HGNC	protein_coding	OTTHUMT00000253507.1	-	0.00	11	0	C	NM_014244		178771118	-1	tier1	-	no_errors	ENST00000251582	ensembl	human	known	74_37	missense	40.00	6	4	SNP	0.905	T
ADAMTS5	11096	genome.wustl.edu	37	21	28296469	28296469	+	Missense_Mutation	SNP	G	G	A	rs368781824		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr21:28296469G>A	ENST00000284987.5	-	8	2817	c.2696C>T	c.(2695-2697)aCg>aTg	p.T899M	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	899	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T899M(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						GCACTGCACCGTTCTGGTGTG	0.542																																					Esophageal Squamous(53;683 1080 10100 14424 45938)												1	Substitution - Missense(1)	pancreas(1)						G	MET/THR	0,4406		0,0,2203	92.0	79.0	83.0		2696	5.2	1.0	21		83	2,8598	2.2+/-6.3	0,2,4298	no	missense	ADAMTS5	NM_007038.3	81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	899/931	28296469	2,13004	2203	4300	6503	SO:0001583	missense	0			AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.2696C>T	21.37:g.28296469G>A	ENSP00000284987:p.Thr899Met		Q52LV4|Q9UKP2	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS5,prints_Peptidase_M12B_ADAM-TS	p.T899M	ENST00000284987.5	37	c.2696	CCDS13579.1	21	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483244	0.63962	0.0	2.33E-4	ENSG00000154736	ENST00000284987	T	0.54279	0.58	6.07	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.53334	0.1790	L	0.58428	1.81	0.58432	D	0.999998	P	0.44521	0.837	B	0.42593	0.392	T	0.56498	-0.7969	10	0.46703	T	0.11	.	15.649	0.77076	0.0654:0.0:0.9346:0.0	.	899	Q9UNA0	ATS5_HUMAN	M	899	ENSP00000284987:T899M	ENSP00000284987:T899M	T	-	2	0	ADAMTS5	27218340	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.398000	0.79919	1.595000	0.50050	-0.119000	0.15052	ACG	ADAMTS5	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000154736		0.542	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS5	HGNC	protein_coding	OTTHUMT00000171648.1	-	0.00	47	0	G			28296469	-1	tier1	-	no_errors	ENST00000284987	ensembl	human	known	74_37	missense	21.05	15	4	SNP	1.000	A
ADAP2	55803	genome.wustl.edu	37	17	29283354	29283354	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:29283354G>T	ENST00000330889.3	+	10	1313	c.978G>T	c.(976-978)tgG>tgT	p.W326C	AC091177.1_ENST00000442757.1_RNA|ADAP2_ENST00000580525.1_Missense_Mutation_p.W332C	NM_018404.2	NP_060874.1	Q9NPF8	ADAP2_HUMAN	ArfGAP with dual PH domains 2	326	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				heart development (GO:0007507)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|mitochondrial envelope (GO:0005740)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						GAAATCGCTGGAAAGCCGGAC	0.557																																																	1	Unknown(1)	central_nervous_system(1)											86.0	74.0	78.0					17																	29283354		2203	4300	6503	SO:0001583	missense	0			AJ238994	CCDS11261.1	17q11.2	2013-01-10	2008-09-22	2008-09-22	ENSG00000184060	ENSG00000184060		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16487	protein-coding gene	gene with protein product		608635	"""centaurin, alpha 2"""	CENTA2			Standard	XM_005258008		Approved		uc002hfx.3	Q9NPF8	OTTHUMG00000132868	ENST00000330889.3:c.978G>T	17.37:g.29283354G>T	ENSP00000329468:p.Trp326Cys		Q8N4Q6|Q96SD5	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,smart_ArfGAP,smart_Pleckstrin_homology,prints_ArfGAP,pfscan_Pleckstrin_homology,pfscan_ArfGAP	p.W326C	ENST00000330889.3	37	c.978	CCDS11261.1	17	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700929	0.48307	.	.	ENSG00000184060	ENST00000330889	T	0.24723	1.84	4.94	4.94	0.65067	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.053790	0.85682	D	0.000000	T	0.52853	0.1760	M	0.82323	2.585	0.80722	D	1	D;D;D	0.69078	0.997;0.994;0.995	D;D;D	0.67900	0.94;0.938;0.954	T	0.56926	-0.7898	10	0.52906	T	0.07	.	15.7019	0.77549	0.0:0.0:1.0:0.0	.	332;325;326	Q2V6Q1;Q9NPF8-2;Q9NPF8	.;.;ADAP2_HUMAN	C	326	ENSP00000329468:W326C	ENSP00000329468:W326C	W	+	3	0	ADAP2	26307480	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.595000	0.74109	2.568000	0.86640	0.462000	0.41574	TGG	ADAP2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000184060		0.557	ADAP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAP2	HGNC	protein_coding	OTTHUMT00000256346.1	-	0.00	45	0	G	NM_018404		29283354	+1	tier1	-	no_errors	ENST00000330889	ensembl	human	known	74_37	missense	14.71	29	5	SNP	1.000	T
ADCY3	109	genome.wustl.edu	37	2	25063423	25063423	+	Intron	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:25063423C>A	ENST00000260600.5	-	6	2048				ADCY3_ENST00000405392.1_Intron	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3						activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					CAAAGCCGCCCCCTCGGAGAA	0.572																																																	0																																										SO:0001627	intron_variant	0			AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.1197-523G>T	2.37:g.25063423C>A			B3KT86|Q53T54|Q9UDB1	RNA	SNP	-	NULL	ENST00000260600.5	37	NULL	CCDS1715.1	2																																																																																			ADCY3	-	-	ENSG00000138031		0.572	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY3	HGNC	protein_coding	OTTHUMT00000211574.2	-	0.00	32	0	C			25063423	-1	tier1	-	no_errors	ENST00000454027	ensembl	human	known	74_37	rna	42.86	12	9	SNP	0.000	A
ADORA2A	135	genome.wustl.edu	37	22	24829476	24829476	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr22:24829476G>T	ENST00000337539.7	+	2	563	c.104G>T	c.(103-105)aGc>aTc	p.S35I	ADORA2A-AS1_ENST00000326341.4_RNA|ADORA2A_ENST00000496497.1_Intron|ADORA2A-AS1_ENST00000543438.1_RNA|SPECC1L-ADORA2A_ENST00000358654.2_3'UTR	NM_000675.4|NM_001278497.1|NM_001278498.1|NM_001278499.1|NM_001278500.1	NP_000666.2|NP_001265426.1|NP_001265427.1|NP_001265428.1|NP_001265429.1	P29274	AA2AR_HUMAN	adenosine A2a receptor	35					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cAMP biosynthetic process (GO:0006171)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|central nervous system development (GO:0007417)|inflammatory response (GO:0006954)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phagocytosis (GO:0006909)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|sensory perception (GO:0007600)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|G-protein coupled adenosine receptor activity (GO:0001609)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|skin(1)	21	Colorectal(2;0.196)				Adenosine(DB00640)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Mefloquine(DB00358)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Regadenoson(DB06213)|Theobromine(DB01412)|Theophylline(DB00277)	TGGCTCAACAGCAACCTGCAG	0.612																																																	0													163.0	101.0	122.0					22																	24829476		2203	4300	6503	SO:0001583	missense	0			X68486	CCDS13826.1	22q11.23	2012-08-08			ENSG00000128271	ENSG00000128271		"""GPCR / Class A : Adenosine receptors"""	263	protein-coding gene	gene with protein product		102776		ADORA2		1662665, 2541503	Standard	NM_001278497		Approved	RDC8	uc002zzy.4	P29274	OTTHUMG00000150761	ENST00000337539.7:c.104G>T	22.37:g.24829476G>T	ENSP00000336630:p.Ser35Ile		B2R7E0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Adeno_A2A_rcpt,prints_GPCR_Rhodpsn,prints_Adenosn_rcpt	p.S35I	ENST00000337539.7	37	c.104	CCDS13826.1	22	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430732	0.62844	.	.	ENSG00000128271	ENST00000424232;ENST00000444262;ENST00000541988;ENST00000337539;ENST00000417596;ENST00000436735;ENST00000439591	T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09	4.53	3.46	0.39613	GPCR, rhodopsin-like superfamily (1);	0.038910	0.85682	D	0.000000	T	0.65112	0.2660	M	0.87180	2.865	0.50813	D	0.99989	D	0.57571	0.98	P	0.61275	0.886	T	0.73455	-0.3977	10	0.62326	D	0.03	-40.5979	14.9985	0.71451	0.0:0.1559:0.844:0.0	.	35	P29274	AA2AR_HUMAN	I	35	ENSP00000404497:S35I;ENSP00000414802:S35I;ENSP00000336630:S35I;ENSP00000397071:S35I;ENSP00000400190:S35I	ENSP00000336630:S35I	S	+	2	0	ADORA2A	23159476	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.462000	0.80851	2.350000	0.79820	0.561000	0.74099	AGC	ADORA2A	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Adeno_A2A_rcpt	ENSG00000128271		0.612	ADORA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA2A	HGNC	protein_coding	OTTHUMT00000319971.2	-	0.00	35	0	G	NM_000675		24829476	+1	tier1	-	no_errors	ENST00000337539	ensembl	human	known	74_37	missense	48.39	16	15	SNP	1.000	T
AHNAK2	113146	genome.wustl.edu	37	14	105418203	105418203	+	Silent	SNP	G	G	A	rs374514016	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr14:105418203G>A	ENST00000333244.5	-	7	3704	c.3585C>T	c.(3583-3585)gcC>gcT	p.A1195A	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1195						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GACTCACGTCGGCCTCCACTT	0.622													.|||	22	0.00439297	0.0144	0.0	5008	,	,		17512	0.001		0.001	False		,,,				2504	0.001																0								G		4,3904		0,4,1950	138.0	131.0	133.0		3585	-8.5	0.0	14		133	7,8217		1,5,4106	no	coding-synonymous	AHNAK2	NM_138420.2		1,9,6056	AA,AG,GG		0.0851,0.1024,0.0907		1195/5796	105418203	11,12121	1954	4112	6066	SO:0001819	synonymous_variant	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.3585C>T	14.37:g.105418203G>A			Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A1195	ENST00000333244.5	37	c.3585	CCDS45177.1	14																																																																																			AHNAK2	-	NULL	ENSG00000185567		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	-	0.00	107	0	G	NM_138420		105418203	-1	tier1	-	no_errors	ENST00000333244	ensembl	human	known	74_37	silent	22.78	61	18	SNP	0.000	A
AK9	221264	genome.wustl.edu	37	6	109814603	109814603	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:109814603G>C	ENST00000424296.2	-	41	5781	c.5705C>G	c.(5704-5706)tCt>tGt	p.S1902C	RP5-919F19.5_ENST00000423747.2_RNA	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	1902					ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										ATTTCTGAGAGAGAGAAAGGT	0.388																																																	0													180.0	182.0	181.0					6																	109814603		2203	4300	6503	SO:0001583	missense	0			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.5705C>G	6.37:g.109814603G>C	ENSP00000410186:p.Ser1902Cys		A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_YHS_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.S1902C	ENST00000424296.2	37	c.5705	CCDS55048.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.0|25.0	4.591322|4.591322	0.86851|0.86851	.|.	.|.	ENSG00000155085|ENSG00000155085	ENST00000470564|ENST00000424296	.|T	.|0.66815	.|-0.23	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	.|0.162598	.|0.56097	.|D	.|0.000034	T|T	0.73401|0.73401	0.3582|0.3582	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	.|D;D	.|0.71674	.|0.963;0.998	.|P;P	.|0.58013	.|0.694;0.831	T|T	0.72204|0.72204	-0.4361|-0.4361	5|9	.|.	.|.	.|.	.|.	19.5676|19.5676	0.95401|0.95401	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|287;1902	.|B7ZL24;Q5TCS8	.|.;AKD1_HUMAN	V|C	740|1902	.|ENSP00000410186:S1902C	.|.	L|S	-|-	1|2	0|0	AKD1|AKD1	109921296|109921296	0.992000|0.992000	0.36948|0.36948	0.857000|0.857000	0.33713|0.33713	0.893000|0.893000	0.52053|0.52053	5.506000|5.506000	0.66993|0.66993	2.623000|2.623000	0.88846|0.88846	0.591000|0.591000	0.81541|0.81541	CTC|TCT	AK9	-	NULL	ENSG00000155085		0.388	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AK9	HGNC	protein_coding		-	0.00	79	0	G	NM_001145128		109814603	-1	tier1	-	no_errors	ENST00000424296	ensembl	human	known	74_37	missense	30.19	37	16	SNP	0.969	C
AKR1C7P	648947	genome.wustl.edu	37	10	5319143	5319143	+	RNA	DEL	A	A	-	rs574713171|rs35054877|rs376430512	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr10:5319143delA	ENST00000432689.2	-	0	513									aldo-keto reductase family 1, member C7, pseudogene																		CAGGACCACCACCCCCCCGCT	0.532													?|A|-|unsure	28	0.00559105	0.0038	0.0058	5008	,	,		17874	0.005		0.0089	False		,,,				2504	0.0051																0																																												0					10p15.1	2012-12-04			ENSG00000215267	ENSG00000215267			44681	pseudogene	pseudogene							Standard	NG_023403		Approved				OTTHUMG00000017588		10.37:g.5319143delA				RNA	DEL	-	NULL	ENST00000432689.2	37	NULL		10																																																																																			AKR1C7P	-	-	ENSG00000215267		0.532	AKR1C7P-002	KNOWN	basic	processed_transcript	AKR1C7P	HGNC	pseudogene	OTTHUMT00000331591.2		0.00	23	0	A	NG_023403		5319143	-1	tier1		no_errors	ENST00000432689	ensembl	human	known	74_37	rna	21.43	11	3	DEL	0.997	-
ALG12	79087	genome.wustl.edu	37	22	50297536	50297536	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr22:50297536G>T	ENST00000330817.6	-	10	1690	c.1417C>A	c.(1417-1419)Cac>Aac	p.H473N	CITF22-1A6.3_ENST00000610245.1_lincRNA	NM_024105.3	NP_077010.1	Q9BV10	ALG12_HUMAN	ALG12, alpha-1,6-mannosyltransferase	473					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-1,6-mannosyltransferase activity (GO:0000009)|dol-P-Man:Man(7)GlcNAc(2)-PP-Dol alpha-1,6-mannosyltransferase activity (GO:0052917)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(3)	12		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		BRCA - Breast invasive adenocarcinoma(115;0.199)|LUAD - Lung adenocarcinoma(64;0.247)		GTCTGCAGGTGGACGTTGAAG	0.652																																																	0													66.0	73.0	70.0					22																	50297536		2203	4300	6503	SO:0001583	missense	0			AJ303120	CCDS14081.1	22q13.33	2013-02-26	2013-02-26		ENSG00000182858	ENSG00000182858	2.4.1.260	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19358	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(7)GlcNAc(2)-PP-dolichol alpha-1,6-mannosyltransferase"", ""dol-P-Man dependent alpha-1,6-mannosyltransferase"""	607144	"""asparagine-linked glycosylation 12 homolog (yeast, alpha-1,6-mannosyltransferase)"", ""asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)"""			11983712	Standard	NM_024105		Approved	ECM39	uc003biy.3	Q9BV10	OTTHUMG00000150289	ENST00000330817.6:c.1417C>A	22.37:g.50297536G>T	ENSP00000333813:p.His473Asn		A6PWM1|Q4KMH4|Q8NG10|Q96AA4	Missense_Mutation	SNP	pfam_GPI_mannosylTrfase	p.H473N	ENST00000330817.6	37	c.1417	CCDS14081.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.101|0.101	-1.151800|-1.151800	0.01700|0.01700	.|.	.|.	ENSG00000182858|ENSG00000182858	ENST00000330817|ENST00000332276	T|.	0.79352|.	-1.26|.	5.41|5.41	-4.69|-4.69	0.03299|0.03299	.|.	0.499875|.	0.23021|.	N|.	0.052854|.	T|T	0.12347|0.12347	0.0300|0.0300	N|N	0.01668|0.01668	-0.77|-0.77	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.31752|0.31752	-0.9932|-0.9932	10|6	0.14252|0.87932	T|D	0.57|0	-20.2851|-20.2851	6.95|6.95	0.24540|0.24540	0.0:0.2316:0.3064:0.462|0.0:0.2316:0.3064:0.462	.|.	473|.	Q9BV10|.	ALG12_HUMAN|.	N|Q	473|118	ENSP00000333813:H473N|.	ENSP00000333813:H473N|ENSP00000329560:P118Q	H|P	-|-	1|2	0|0	ALG12|ALG12	48683540|48683540	0.982000|0.982000	0.34865|0.34865	0.008000|0.008000	0.14137|0.14137	0.088000|0.088000	0.18126|0.18126	1.047000|1.047000	0.30367|0.30367	-0.978000|-0.978000	0.03533|0.03533	-0.867000|-0.867000	0.03001|0.03001	CAC|CCA	ALG12	-	NULL	ENSG00000182858		0.652	ALG12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG12	HGNC	protein_coding	OTTHUMT00000317405.2	-	0.00	79	0	G	NM_024105		50297536	-1	tier1	-	no_errors	ENST00000330817	ensembl	human	known	74_37	missense	60.00	14	21	SNP	0.016	T
ALOX12B	242	genome.wustl.edu	37	17	7976605	7976605	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:7976605G>T	ENST00000319144.4	-	14	2047	c.1787C>A	c.(1786-1788)cCa>cAa	p.P596Q	ALOX12B_ENST00000577351.1_5'UTR	NM_001139.2	NP_001130.1	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	596	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|protein lipidation (GO:0006497)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	arachidonate 12-lipoxygenase activity (GO:0004052)|iron ion binding (GO:0005506)|linoleate 9S-lipoxygenase activity (GO:1990136)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	16						CATGGACGCTGGGAAGTTGGG	0.587										Multiple Myeloma(8;0.094)																																							0													176.0	169.0	171.0					17																	7976605		2203	4300	6503	SO:0001583	missense	0			AF038461	CCDS11129.1	17p13.1	2008-03-18			ENSG00000179477	ENSG00000179477	1.13.11.-	"""Arachidonate lipoxygenases"""	430	protein-coding gene	gene with protein product		603741				9618483	Standard	NM_001139		Approved	12R-LOX	uc002gjy.1	O75342	OTTHUMG00000108180	ENST00000319144.4:c.1787C>A	17.37:g.7976605G>T	ENSP00000315167:p.Pro596Gln			Missense_Mutation	SNP	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,prints_LipOase_C,prints_LipOase_mml	p.P596Q	ENST00000319144.4	37	c.1787	CCDS11129.1	17	.	.	.	.	.	.	.	.	.	.	G	27.9	4.876619	0.91664	.	.	ENSG00000179477	ENST00000319144	D	0.97731	-4.51	5.09	5.09	0.68999	Lipoxygenase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99124	0.9698	H	0.95294	3.65	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.99293	1.0899	10	0.87932	D	0	-20.554	17.2725	0.87106	0.0:0.0:1.0:0.0	.	596	O75342	LX12B_HUMAN	Q	596	ENSP00000315167:P596Q	ENSP00000315167:P596Q	P	-	2	0	ALOX12B	7917330	1.000000	0.71417	0.930000	0.37139	0.929000	0.56500	8.830000	0.92063	2.380000	0.81148	0.557000	0.71058	CCA	ALOX12B	-	pfam_LipOase_C,superfamily_LipOase_C	ENSG00000179477		0.587	ALOX12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX12B	HGNC	protein_coding	OTTHUMT00000226984.3	-	0.00	57	0	G			7976605	-1	tier1	-	no_errors	ENST00000319144	ensembl	human	known	74_37	missense	48.65	19	18	SNP	1.000	T
AMBRA1	55626	genome.wustl.edu	37	11	46563773	46563773	+	Silent	SNP	G	G	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:46563773G>C	ENST00000458649.2	-	7	2212	c.1794C>G	c.(1792-1794)tcC>tcG	p.S598S	AMBRA1_ENST00000314845.3_Silent_p.S508S|AMBRA1_ENST00000533727.1_Silent_p.S508S|AMBRA1_ENST00000528950.1_Silent_p.S598S|AMBRA1_ENST00000298834.3_Silent_p.S598S|AMBRA1_ENST00000426438.1_Silent_p.S598S|AMBRA1_ENST00000534300.1_Silent_p.S598S			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	598	Ser-rich.				autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		CCTGCCAAGAGGAACTAGCCT	0.582																																																	0													56.0	47.0	50.0					11																	46563773		2201	4299	6500	SO:0001819	synonymous_variant	0			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.1794C>G	11.37:g.46563773G>C			A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S598	ENST00000458649.2	37	c.1794		11																																																																																			AMBRA1	-	NULL	ENSG00000110497		0.582	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1	-	0.00	46	0	G	NM_017749		46563773	-1	tier1	-	no_errors	ENST00000458649	ensembl	human	known	74_37	silent	17.14	29	6	SNP	0.981	C
ANK2	287	genome.wustl.edu	37	4	114276416	114276416	+	Silent	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr4:114276416G>A	ENST00000357077.4	+	38	6695	c.6642G>A	c.(6640-6642)ccG>ccA	p.P2214P	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000264366.6_Silent_p.P2181P	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2214					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CCGGCTCTCCGTGTGGCAGCC	0.507																																																	0													69.0	73.0	72.0					4																	114276416		2203	4299	6502	SO:0001819	synonymous_variant	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.6642G>A	4.37:g.114276416G>A			Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.P2214	ENST00000357077.4	37	c.6642	CCDS3702.1	4																																																																																			ANK2	-	NULL	ENSG00000145362		0.507	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2		0.00	18	0	G	NM_001148		114276416	+1			no_errors	ENST00000357077	ensembl	human	known	74_37	silent	33.33	10	5	SNP	0.041	A
ANKRD30A	91074	genome.wustl.edu	37	10	37419184	37419184	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr10:37419184G>A	ENST00000602533.1	+	3	319	c.220G>A	c.(220-222)Gcc>Acc	p.A74T	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.A74T|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.A74T			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	130					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						AGATTCTGGTGCCGATATAAA	0.388																																																	0													86.0	76.0	79.0					10																	37419184		1861	4109	5970	SO:0001583	missense	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.220G>A	10.37:g.37419184G>A	ENSP00000473551:p.Ala74Thr		Q5W025	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A74T	ENST00000602533.1	37	c.220		10	.	.	.	.	.	.	.	.	.	.	.	16.69	3.192967	0.58017	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.71341	-0.56;-0.56	2.0	2.0	0.26442	Ankyrin repeat-containing domain (3);	.	.	.	.	T	0.82226	0.4991	M	0.86178	2.8	0.34373	D	0.692268	D	0.69078	0.997	D	0.77004	0.989	D	0.84799	0.0783	9	0.62326	D	0.03	.	7.4605	0.27291	0.0:0.0:1.0:0.0	.	130	Q9BXX3	AN30A_HUMAN	T	74	ENSP00000354432:A74T;ENSP00000363792:A74T	ENSP00000354432:A74T	A	+	1	0	ANKRD30A	37459190	1.000000	0.71417	0.097000	0.21041	0.019000	0.09904	6.070000	0.71220	1.110000	0.41699	0.281000	0.19383	GCC	ANKRD30A	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000148513		0.388	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	-	0.00	94	0	G	NM_052997		37419184	+1	tier1	-	no_errors	ENST00000361713	ensembl	human	known	74_37	missense	34.88	27	15	SNP	0.977	A
AP4E1	23431	genome.wustl.edu	37	15	51289591	51289591	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr15:51289591C>T	ENST00000261842.5	+	18	2521	c.2415C>T	c.(2413-2415)ggC>ggT	p.G805G	AP4E1_ENST00000560508.1_Silent_p.G730G	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	805					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		CTAAAAGTGGCGAAACAACCA	0.333																																																	0													105.0	102.0	103.0					15																	51289591		2196	4294	6490	SO:0001819	synonymous_variant	0			AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.2415C>T	15.37:g.51289591C>T			A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Silent	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Coatomer_bsu_C,superfamily_ARM-type_fold,pirsf_AP4_complex_esu	p.G805	ENST00000261842.5	37	c.2415	CCDS32240.1	15																																																																																			AP4E1	-	pirsf_AP4_complex_esu	ENSG00000081014		0.333	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	AP4E1	HGNC	protein_coding	OTTHUMT00000418656.1	-	0.00	43	0	C			51289591	+1	tier1	-	no_errors	ENST00000261842	ensembl	human	known	74_37	silent	39.47	23	15	SNP	0.000	T
LVRN	206338	genome.wustl.edu	37	5	115298609	115298609	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:115298609C>A	ENST00000357872.4	+	1	419	c.295C>A	c.(295-297)Ccg>Acg	p.P99T	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		99						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										GCTACGCCTGCCGCCCTGGCT	0.706																																																	0													27.0	32.0	30.0					5																	115298609		2182	4273	6455	SO:0001583	missense	0																														ENST00000357872.4:c.295C>A	5.37:g.115298609C>A	ENSP00000350541:p.Pro99Thr		A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.P99T	ENST00000357872.4	37	c.295	CCDS4124.1	5	.	.	.	.	.	.	.	.	.	.	C	16.70	3.194732	0.58017	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.05447	3.44	4.18	4.18	0.49190	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.56097	D	0.000034	T	0.39279	0.1072	H	0.98577	4.27	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.59096	-0.7518	10	0.87932	D	0	.	11.891	0.52628	0.0:1.0:0.0:0.0	.	99	Q6Q4G3	AMPQ_HUMAN	T	99	ENSP00000350541:P99T	ENSP00000350541:P99T	P	+	1	0	AC010282.1	115326508	1.000000	0.71417	0.998000	0.56505	0.479000	0.33129	4.334000	0.59291	2.169000	0.68431	0.650000	0.86243	CCG	AQPEP	-	pfam_Peptidase_M1_N	ENSG00000172901		0.706	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQPEP	Uniprot_gn	protein_coding	OTTHUMT00000250852.1	-	0.00	19	0	C			115298609	+1	tier1	-	no_errors	ENST00000357872	ensembl	human	known	74_37	missense	18.18	18	4	SNP	0.998	A
ARFGEF2	10564	genome.wustl.edu	37	20	47538456	47538456	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr20:47538456C>A	ENST00000371917.4	+	1	30	c.30C>A	c.(28-30)ttC>ttA	p.F10L		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	10	DCB; DCB:DCB domain and DCB:HUS domain interaction.				endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AGAGCATGTTCGTGTCCCGGG	0.726																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)												0													33.0	37.0	35.0					20																	47538456		2111	4169	6280	SO:0001583	missense	0			AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.30C>A	20.37:g.47538456C>A	ENSP00000360985:p.Phe10Leu		Q5TFT9|Q9NTS1	Missense_Mutation	SNP	pfam_Sec7_dom,pfam_DUF1981_Sec7_assoc,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.F10L	ENST00000371917.4	37	c.30	CCDS13411.1	20	.	.	.	.	.	.	.	.	.	.	C	15.69	2.906855	0.52333	.	.	ENSG00000124198	ENST00000538445;ENST00000371917	T	0.26373	1.74	4.64	3.7	0.42460	.	0.063724	0.64402	D	0.000006	T	0.37679	0.1012	L	0.61387	1.9	0.58432	D	0.999996	D	0.53462	0.96	P	0.52758	0.708	T	0.19877	-1.0292	10	0.48119	T	0.1	.	12.8467	0.57833	0.0:0.9208:0.0:0.0792	.	10	Q9Y6D5	BIG2_HUMAN	L	10	ENSP00000360985:F10L	ENSP00000360985:F10L	F	+	3	2	ARFGEF2	46971863	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	0.951000	0.29135	1.169000	0.42739	0.591000	0.81541	TTC	ARFGEF2	-	NULL	ENSG00000124198		0.726	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF2	HGNC	protein_coding	OTTHUMT00000079627.1		0.00	33	0	C	NM_006420		47538456	+1			no_errors	ENST00000371917	ensembl	human	known	74_37	missense	6.52	43	3	SNP	1.000	A
ARID1A	8289	genome.wustl.edu	37	1	27057934	27057934	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:27057934C>T	ENST00000324856.7	+	3	2013	c.1642C>T	c.(1642-1644)Cag>Tag	p.Q548*	ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q165*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q548*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	548					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.Q548*(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CCCCCAGAGCCAGCCCCCCTA	0.642			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	1	Substitution - Nonsense(1)	ovary(1)											173.0	182.0	179.0					1																	27057934		2203	4300	6503	SO:0001587	stop_gained	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.1642C>T	1.37:g.27057934C>T	ENSP00000320485:p.Gln548*		D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q548*	ENST00000324856.7	37	c.1642	CCDS285.1	1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767717	0.69878	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	.	.	.	5.44	5.44	0.79542	.	0.145657	0.47093	D	0.000260	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-6.7819	14.9862	0.71351	0.0:0.858:0.142:0.0	.	.	.	.	X	548;548;165	.	ENSP00000320485:Q548X	Q	+	1	0	ARID1A	26930521	1.000000	0.71417	1.000000	0.80357	0.249000	0.25844	5.518000	0.67068	2.824000	0.97209	0.655000	0.94253	CAG	ARID1A	-	NULL	ENSG00000117713		0.642	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	-	0.00	65	0	C	NM_139135		27057934	+1	tier1	-	no_errors	ENST00000324856	ensembl	human	known	74_37	nonsense	61.54	15	24	SNP	1.000	T
ARPC4	10093	genome.wustl.edu	37	3	9843356	9843356	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:9843356C>A	ENST00000397261.3	+	4	810	c.246C>A	c.(244-246)atC>atA	p.I82I	ARPC4_ENST00000287613.7_5'UTR|ARPC4-TTLL3_ENST00000397256.1_Silent_p.I82I|ARPC4_ENST00000498623.2_5'UTR|ARPC4_ENST00000433034.1_Silent_p.I101I	NM_005718.4	NP_005709.1	P59998	ARPC4_HUMAN	actin related protein 2/3 complex, subunit 4, 20kDa	82					actin filament polymerization (GO:0030041)|actin nucleation (GO:0045010)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|lung(1)	2	Medulloblastoma(99;0.227)					CTGATGAGATCGAGAAGATTT	0.478																																																	0													73.0	69.0	70.0					3																	9843356		1961	4165	6126	SO:0001819	synonymous_variant	0			AF019888	CCDS43047.1, CCDS46743.1, CCDS56238.1	3p25	2011-07-06	2002-08-29		ENSG00000241553	ENSG00000241553		"""Actin related protein 2/3 complex subunits"""	707	protein-coding gene	gene with protein product	"""Arp2/3 protein complex subunit p20"", ""actin related protein 2/3 complex, subunit 4 (20 kD)"""	604226	"""actin related protein 2/3 complex, subunit 4 (20 kD)"""			9230079, 9359840	Standard	NM_005718		Approved	p20-Arc, ARC20		P59998	OTTHUMG00000133768	ENST00000397261.3:c.246C>A	3.37:g.9843356C>A			C9JWM7|E7ETI0|F6TTL5|O15509|Q6P0W5|Q96QJ3	Silent	SNP	pfam_TTL/TTLL_fam,pfam_ARPC4	p.I82	ENST00000397261.3	37	c.246	CCDS43047.1	3																																																																																			ARPC4-TTLL3	-	pfam_ARPC4	ENSG00000250151		0.478	ARPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPC4-TTLL3	HGNC	protein_coding	OTTHUMT00000258275.2	-	0.00	93	0	C	NM_001024959		9843356	+1	tier1	-	no_errors	ENST00000397256	ensembl	human	known	74_37	silent	36.92	41	24	SNP	0.520	A
ASIC2	40	genome.wustl.edu	37	17	31415904	31415904	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:31415904A>G	ENST00000359872.6	-	3	1572	c.811T>C	c.(811-813)Ttt>Ctt	p.F271L	ASIC2_ENST00000225823.2_Missense_Mutation_p.F322L|ASIC2_ENST00000448983.1_5'UTR	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2	271					central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	GTGGCCACAAAGGTCTGGAAC	0.567																																																	0													55.0	54.0	54.0					17																	31415904		2203	4300	6503	SO:0001583	missense	0			AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.811T>C	17.37:g.31415904A>G	ENSP00000352934:p.Phe271Leu		E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.F322L	ENST00000359872.6	37	c.964	CCDS42296.1	17	.	.	.	.	.	.	.	.	.	.	A	18.75	3.691349	0.68271	.	.	ENSG00000108684	ENST00000225823;ENST00000359872;ENST00000448983	T;T	0.64991	-0.13;-0.13	5.48	5.48	0.80851	.	0.056156	0.64402	D	0.000001	T	0.67316	0.2880	L	0.60012	1.86	0.58432	D	0.999999	P;P	0.51791	0.948;0.548	P;P	0.52481	0.618;0.7	T	0.61486	-0.7053	10	0.22706	T	0.39	-5.2457	13.501	0.61454	1.0:0.0:0.0:0.0	.	271;322	Q16515;E9PBX2	ACCN1_HUMAN;.	L	322;271;77	ENSP00000225823:F322L;ENSP00000352934:F271L	ENSP00000225823:F322L	F	-	1	0	ACCN1	28440017	1.000000	0.71417	1.000000	0.80357	0.243000	0.25628	9.277000	0.95755	0.569000	0.29329	-0.339000	0.08088	TTT	ASIC2	-	pfam_Na+channel_ASC,tigrfam_EnaC	ENSG00000108684		0.567	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC2	HGNC	protein_coding	OTTHUMT00000447552.1	-	0.00	39	0	A	NM_183377, NM_001094		31415904	-1	tier1	-	no_errors	ENST00000225823	ensembl	human	known	74_37	missense	35.71	18	10	SNP	1.000	G
ASIC4	55515	genome.wustl.edu	37	2	220396515	220396515	+	Silent	SNP	C	C	T	rs148269786		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:220396515C>T	ENST00000347842.3	+	2	1013	c.999C>T	c.(997-999)aaC>aaT	p.N333N	ASIC4_ENST00000473709.1_3'UTR|ASIC4_ENST00000358078.4_Silent_p.N333N	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	333					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)										ACACCTTCAACGCGGACCCGC	0.617																																																	0								C	,	2,4404	4.2+/-10.8	0,2,2201	62.0	67.0	65.0		999,999	-0.4	1.0	2	dbSNP_134	65	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ACCN4	NM_018674.4,NM_182847.2	,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,	333/667,333/648	220396515	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.999C>T	2.37:g.220396515C>T			Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Silent	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC	p.N333	ENST00000347842.3	37	c.999	CCDS2442.1	2																																																																																			ASIC4	-	pfam_Na+channel_ASC	ENSG00000072182		0.617	ASIC4-001	KNOWN	basic|CCDS	protein_coding	ASIC4	HGNC	protein_coding	OTTHUMT00000130263.1	-	0.00	29	0	C	NM_018674		220396515	+1	tier1	rs148269786	no_errors	ENST00000347842	ensembl	human	known	74_37	silent	50.00	17	17	SNP	0.998	T
ATP11A	23250	genome.wustl.edu	37	13	113487324	113487324	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr13:113487324G>A	ENST00000487903.1	+	14	1634	c.1546G>A	c.(1546-1548)Gaa>Aaa	p.E516K	ATP11A_ENST00000283558.8_Missense_Mutation_p.E516K|ATP11A_ENST00000375630.2_Missense_Mutation_p.E516K|ATP11A_ENST00000375645.3_Missense_Mutation_p.E516K			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	516					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				GGCGCTGGTCGAAGGTGTCCA	0.627																																																	0													107.0	116.0	113.0					13																	113487324		2203	4300	6503	SO:0001583	missense	0			AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.1546G>A	13.37:g.113487324G>A	ENSP00000420387:p.Glu516Lys		Q5VXT2	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.E516K	ENST00000487903.1	37	c.1546	CCDS32011.1	13	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793584	0.70452	.	.	ENSG00000068650	ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558	T;T;T;T	0.62498	0.02;0.02;0.02;0.02	5.71	5.71	0.89125	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	T	0.48892	0.1525	N	0.17631	0.505	0.80722	D	1	B;P;B	0.37708	0.206;0.606;0.103	B;B;B	0.38458	0.042;0.274;0.142	T	0.44452	-0.9327	10	0.07990	T	0.79	.	19.8575	0.96767	0.0:0.0:1.0:0.0	.	516;516;516	E9PCW5;E9PEJ6;P98196	.;.;AT11A_HUMAN	K	516	ENSP00000420387:E516K;ENSP00000364781:E516K;ENSP00000364796:E516K;ENSP00000283558:E516K	ENSP00000283558:E516K	E	+	1	0	ATP11A	112535325	1.000000	0.71417	0.609000	0.28983	0.729000	0.41735	7.598000	0.82745	2.698000	0.92095	0.561000	0.74099	GAA	ATP11A	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000068650		0.627	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP11A	HGNC	protein_coding	OTTHUMT00000045834.3	-	0.00	56	0	G	NM_015205		113487324	+1	tier1	-	no_errors	ENST00000375630	ensembl	human	known	74_37	missense	22.22	28	8	SNP	1.000	A
ATP5H	10476	genome.wustl.edu	37	17	73036203	73036203	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:73036203G>A	ENST00000301587.4	-	4	322	c.275C>T	c.(274-276)gCc>gTc	p.A92V	ATP5H_ENST00000344546.4_Intron|KCTD2_ENST00000584767.1_Intron|KCTD2_ENST00000581589.1_Intron|RN7SL573P_ENST00000485340.2_RNA	NM_006356.2	NP_006347.1	O75947	ATP5H_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d	92					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)|mitochondrion (GO:0005739)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			lung(1)|skin(1)	2	all_lung(278;0.226)					TTTTTCTTCGGCATCCACCTG	0.413																																																	0													213.0	220.0	217.0					17																	73036203		2203	4300	6503	SO:0001583	missense	0			AF087135	CCDS11712.1, CCDS32727.1	17q25	2014-01-24	2010-06-11		ENSG00000167863	ENSG00000167863		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	845	protein-coding gene	gene with protein product			"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d"""			11042152	Standard	NM_006356		Approved	ATPQ, ATP5JD	uc002jmn.1	O75947	OTTHUMG00000179219	ENST00000301587.4:c.275C>T	17.37:g.73036203G>A	ENSP00000301587:p.Ala92Val		B2R5L6|Q9H3J4	Missense_Mutation	SNP	pfam_ATPase_F0-cplx_dsu_mt,pirsf_ATPase_F0-cplx_dsu_mt	p.A92V	ENST00000301587.4	37	c.275	CCDS11712.1	17	.	.	.	.	.	.	.	.	.	.	G	15.69	2.909342	0.52439	.	.	ENSG00000167863	ENST00000538432;ENST00000301587	.	.	.	5.52	4.54	0.55810	.	0.221026	0.45606	D	0.000344	T	0.60261	0.2255	M	0.63843	1.955	0.80722	D	1	B	0.25272	0.122	B	0.17722	0.019	T	0.60505	-0.7250	9	0.54805	T	0.06	.	15.5832	0.76462	0.0:0.0:0.8614:0.1386	.	92	O75947	ATP5H_HUMAN	V	92	.	ENSP00000301587:A92V	A	-	2	0	ATP5H	70547798	1.000000	0.71417	0.996000	0.52242	0.720000	0.41350	2.161000	0.42358	1.304000	0.44892	0.563000	0.77884	GCC	ATP5H	-	pfam_ATPase_F0-cplx_dsu_mt,pirsf_ATPase_F0-cplx_dsu_mt	ENSG00000167863		0.413	ATP5H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5H	HGNC	protein_coding	OTTHUMT00000445318.1	-	0.00	41	0	G	NM_006356		73036203	-1	tier1	-	no_errors	ENST00000301587	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	A
ATP6AP1L	92270	genome.wustl.edu	37	5	81679584	81679585	+	Intron	INS	-	-	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:81679584_81679585insT	ENST00000508366.1	+	7	2002							Q52LC2	VAS1L_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1-like						ATP hydrolysis coupled proton transport (GO:0015991)	integral component of membrane (GO:0016021)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	12						TTGTCAACTCATTTTTTTTTTC	0.342																																																	0																																										SO:0001627	intron_variant	0			AK022625	CCDS34196.1	5q14.2	2010-03-10				ENSG00000205464			28091	protein-coding gene	gene with protein product							Standard	XR_112744		Approved		uc003khw.3	Q52LC2		ENST00000508366.1:c.2003-629->T	5.37:g.81679594_81679594dupT				RNA	INS	-	NULL	ENST00000508366.1	37	NULL		5																																																																																			ATP6AP1L	-	-	ENSG00000205464		0.342	ATP6AP1L-002	KNOWN	basic	processed_transcript	ATP6AP1L	HGNC	protein_coding	OTTHUMT00000369563.1		0.00	13	0	-	NM_001017971		81679585	+1	tier1		no_errors	ENST00000502523	ensembl	human	putative	74_37	rna	16.67	10	2	INS	0.000:0.002	T
BAG6	7917	genome.wustl.edu	37	6	31612087	31612087	+	Intron	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:31612087C>T	ENST00000375964.6	-	12	1779				BAG6_ENST00000439687.2_Intron|BAG6_ENST00000470875.1_5'UTR|BAG6_ENST00000404765.2_Missense_Mutation_p.A518T|BAG6_ENST00000211379.5_Intron|BAG6_ENST00000362049.6_Intron|BAG6_ENST00000375976.4_Intron	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6						brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						TCATTACCTGCGGCCGCGGAG	0.657																																																	0																																										SO:0001627	intron_variant	0			M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.1466-116G>A	6.37:g.31612087C>T			A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Missense_Mutation	SNP	pfam_DUF3538,pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.A518T	ENST00000375964.6	37	c.1552	CCDS47403.1	6	.	.	.	.	.	.	.	.	.	.	c	13.41	2.228271	0.39399	.	.	ENSG00000204463	ENST00000404765;ENST00000437771	T;T	0.41758	1.53;0.99	4.41	0.051	0.14296	.	0.512109	0.17973	N	0.155781	T	0.21509	0.0518	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.07481	-1.0770	7	0.25751	T	0.34	.	7.657	0.28381	0.0:0.5121:0.0:0.4879	.	.	.	.	T	518	ENSP00000384494:A518T;ENSP00000397978:A518T	ENSP00000384494:A518T	A	-	1	0	BAG6	31720066	0.007000	0.16637	0.999000	0.59377	0.999000	0.98932	-0.065000	0.11617	0.091000	0.17302	0.645000	0.84053	GCA	BAG6	-	NULL	ENSG00000204463		0.657	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAG6	HGNC	protein_coding		-	0.00	27	0	C	NM_080703		31612087	-1	tier1	-	no_errors	ENST00000404765	ensembl	human	known	74_37	missense	20.59	27	7	SNP	0.925	T
BAI3	577	genome.wustl.edu	37	6	69653794	69653794	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:69653794G>T	ENST00000370598.1	+	6	1924	c.1103G>T	c.(1102-1104)aGa>aTa	p.R368I		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	368	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CAAAGAACAAGAACAAGGTCA	0.453																																																	0													242.0	191.0	208.0					6																	69653794		2203	4300	6503	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1103G>T	6.37:g.69653794G>T	ENSP00000359630:p.Arg368Ile		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.R368I	ENST00000370598.1	37	c.1103	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	G	34	5.315458	0.95655	.	.	ENSG00000135298	ENST00000370598	T	0.80909	-1.43	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	D	0.93119	0.7809	H	0.97707	4.06	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	D	0.95093	0.8223	10	0.87932	D	0	.	18.8518	0.92235	0.0:0.0:1.0:0.0	.	368	O60242	BAI3_HUMAN	I	368	ENSP00000359630:R368I	ENSP00000359630:R368I	R	+	2	0	BAI3	69710515	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	9.657000	0.98554	2.678000	0.91216	0.655000	0.94253	AGA	BAI3	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000135298		0.453	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	-	0.00	151	0	G			69653794	+1	tier1	-	no_errors	ENST00000370598	ensembl	human	known	74_37	missense	29.36	77	32	SNP	1.000	T
BBS7	55212	genome.wustl.edu	37	4	122789146	122789146	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr4:122789146G>T	ENST00000264499.4	-	2	275	c.92C>A	c.(91-93)gCt>gAt	p.A31D	RP11-63B13.1_ENST00000567769.1_lincRNA|BBS7_ENST00000506636.1_Missense_Mutation_p.A31D	NM_176824.2	NP_789794.1	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7	31					brain development (GO:0007420)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|digestive tract morphogenesis (GO:0048546)|eye development (GO:0001654)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|limb development (GO:0060173)|melanosome transport (GO:0032402)|nonmotile primary cilium assembly (GO:0035058)|palate development (GO:0060021)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|visual perception (GO:0007601)	axoneme (GO:0005930)|BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						CTTTTGTGTAGCTCTGTGTCT	0.373									Bardet-Biedl syndrome																																								0													159.0	150.0	153.0					4																	122789146		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF521644	CCDS3724.1, CCDS54799.1	4q27	2013-01-08			ENSG00000138686	ENSG00000138686			18758	protein-coding gene	gene with protein product		607590					Standard	NM_176824		Approved	FLJ10715, BBS2L1	uc003ied.3	Q8IWZ6	OTTHUMG00000133076	ENST00000264499.4:c.92C>A	4.37:g.122789146G>T	ENSP00000264499:p.Ala31Asp		Q4W5P8|Q8N581|Q9NVI4	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,pirsf_Bardet-Biedl_syndrome_7_prot	p.A31D	ENST00000264499.4	37	c.92	CCDS3724.1	4	.	.	.	.	.	.	.	.	.	.	G	12.78	2.040473	0.35989	.	.	ENSG00000138686	ENST00000264499;ENST00000506636	D;D	0.93307	-3.2;-3.2	5.56	4.69	0.59074	.	0.112601	0.64402	D	0.000011	D	0.91267	0.7247	L	0.57536	1.79	0.58432	D	0.999999	B	0.28400	0.21	B	0.29942	0.109	D	0.88052	0.2788	10	0.18710	T	0.47	-9.7604	16.0604	0.80836	0.0:0.1345:0.8655:0.0	.	31	Q8IWZ6	BBS7_HUMAN	D	31	ENSP00000264499:A31D;ENSP00000423626:A31D	ENSP00000264499:A31D	A	-	2	0	BBS7	123008596	1.000000	0.71417	0.769000	0.31535	0.921000	0.55340	5.828000	0.69307	1.279000	0.44446	0.655000	0.94253	GCT	BBS7	-	pirsf_Bardet-Biedl_syndrome_7_prot	ENSG00000138686		0.373	BBS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS7	HGNC	protein_coding	OTTHUMT00000256716.1	-	0.00	93	0	G			122789146	-1	tier1	-	no_errors	ENST00000264499	ensembl	human	known	74_37	missense	13.56	51	8	SNP	1.000	T
BCKDHA	593	genome.wustl.edu	37	19	41928277	41928277	+	Splice_Site	SNP	T	T	C	rs558254502		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:41928277T>C	ENST00000269980.2	+	6	1221		c.e6+2		CTC-435M10.6_ENST00000598887.1_RNA|CTC-435M10.3_ENST00000540732.1_Splice_Site|BCKDHA_ENST00000595085.1_Splice_Site|BCKDHA_ENST00000457836.2_Splice_Site|BCKDHA_ENST00000535632.1_Splice_Site	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha polypeptide						branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	10						ATGGCATTGGTATGGGCTCTG	0.612													T|||	1	0.000199681	0.0	0.0014	5008	,	,		18776	0.0		0.0	False		,,,				2504	0.0																0													70.0	59.0	63.0					19																	41928277		2203	4300	6503	SO:0001630	splice_region_variant	0			J04474	CCDS12581.1	19q13.1-q13.2	2008-07-09	2005-11-29		ENSG00000248098	ENSG00000248098			986	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	608348	"""branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)"", ""2-oxoisovalerate dehydrogenase (lipoamide)"""	OVD1A			Standard	NM_000709		Approved	MSU	uc002oqq.3	P12694	OTTHUMG00000168128	ENST00000269980.2:c.853+2T>C	19.37:g.41928277T>C			B4DP47|E7EW46|Q16034|Q16472	Splice_Site	SNP	-	e6+2	ENST00000269980.2	37	c.955+2	CCDS12581.1	19	.	.	.	.	.	.	.	.	.	.	T	12.41	1.929628	0.34096	.	.	ENSG00000255730;ENSG00000248098;ENSG00000248098;ENSG00000248098;ENSG00000248098	ENST00000540732;ENST00000269980;ENST00000542943;ENST00000457836;ENST00000378196	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6592	0.62357	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	BCKDHA;CTC-435M10.3	46620117	1.000000	0.71417	0.884000	0.34674	0.126000	0.20510	6.863000	0.75489	2.078000	0.62432	0.460000	0.39030	.	BCKDHA	-	-	ENSG00000248098		0.612	BCKDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCKDHA	HGNC	protein_coding	OTTHUMT00000398313.3	-	0.00	49	0	T	NM_000709	Intron	41928277	+1	tier1	-	no_errors	ENST00000595085	ensembl	human	known	74_37	splice_site	51.35	18	19	SNP	1.000	C
BRD7	29117	genome.wustl.edu	37	16	50402113	50402113	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:50402113delA	ENST00000394688.3	-	2	305	c.146delT	c.(145-147)ttcfs	p.F49fs	BRD7_ENST00000401491.3_5'UTR|BRD7_ENST00000394689.2_Frame_Shift_Del_p.F49fs|RP11-21B23.1_ENST00000568427.1_RNA			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	49	Lys-rich.				cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				TTTGTCTTCGAAGAGGCTGGA	0.498																																																	0													140.0	148.0	145.0					16																	50402113		2198	4300	6498	SO:0001589	frameshift_variant	0			AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.146delT	16.37:g.50402113delA	ENSP00000378180:p.Phe49fs		Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Frame_Shift_Del	DEL	pfam_DUF3512,pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.F49fs	ENST00000394688.3	37	c.146	CCDS10742.1	16																																																																																			BRD7	-	NULL	ENSG00000166164		0.498	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BRD7	HGNC	protein_coding	OTTHUMT00000256874.3		0.00	63	0	A	NM_013263		50402113	-1	tier1		no_errors	ENST00000394689	ensembl	human	known	74_37	frame_shift_del	23.08	20	6	DEL	1.000	-
BRIP1	83990	genome.wustl.edu	37	17	59934422	59934422	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:59934422G>A	ENST00000259008.2	-	4	643	c.376C>T	c.(376-378)Caa>Taa	p.Q126*	BRIP1_ENST00000577598.1_Nonsense_Mutation_p.Q126*	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	126	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						AAATTACCTTGACAAGTTGAT	0.333			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																															yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	0													224.0	205.0	211.0					17																	59934422		2203	4300	6503	SO:0001587	stop_gained	0			AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.376C>T	17.37:g.59934422G>A	ENSP00000259008:p.Gln126*		Q3MJE2|Q8NCI5	Nonsense_Mutation	SNP	pfam_DEAD_2,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_TIL_dom,smart_Helicase-like_DEXD_c2,smart_Helicase_ATP-bd,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.Q126*	ENST00000259008.2	37	c.376	CCDS11631.1	17	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400831	0.62177	.	.	ENSG00000136492	ENST00000259008	.	.	.	5.24	4.26	0.50523	.	0.894273	0.09811	N	0.752798	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5852	0.50914	0.0:0.0:0.8215:0.1785	.	.	.	.	X	126	.	.	Q	-	1	0	BRIP1	57289204	1.000000	0.71417	0.988000	0.46212	0.136000	0.21042	3.227000	0.51262	1.324000	0.45282	-0.175000	0.13238	CAA	BRIP1	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase-like_DEXD_c2,smart_Helicase_ATP-bd,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3	ENSG00000136492		0.333	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRIP1	HGNC	protein_coding	OTTHUMT00000445362.1	-	0.00	108	0	G	NM_032043		59934422	-1	tier1	-	no_errors	ENST00000259008	ensembl	human	known	74_37	nonsense	36.36	42	24	SNP	0.986	A
C11orf63	79864	genome.wustl.edu	37	11	122756568	122756568	+	Missense_Mutation	SNP	G	G	T	rs200713502	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:122756568G>T	ENST00000531316.1	+	1	103	c.11G>T	c.(10-12)cGt>cTt	p.R4L	C11orf63_ENST00000307257.6_Missense_Mutation_p.R4L|C11orf63_ENST00000227349.2_Missense_Mutation_p.R4L			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	4					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)					breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		ATGAGTAAACGTAAACTAATT	0.398																																																	0													68.0	71.0	70.0					11																	122756568		2202	4299	6501	SO:0001583	missense	0			BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.11G>T	11.37:g.122756568G>T	ENSP00000431669:p.Arg4Leu		A8K6G0|Q96GB5|Q9H5D6	Missense_Mutation	SNP	NULL	p.R4L	ENST00000531316.1	37	c.11	CCDS8438.1	11	.	.	.	.	.	.	.	.	.	.	G	4.777	0.144420	0.09134	.	.	ENSG00000109944	ENST00000307257;ENST00000227349;ENST00000531316	T;T	0.41065	1.01;1.01	5.8	-1.46	0.08800	.	0.701774	0.13617	N	0.374669	T	0.15305	0.0369	N	0.08118	0	0.09310	N	1	B;B	0.17465	0.006;0.022	B;B	0.16289	0.015;0.015	T	0.16958	-1.0385	10	0.18710	T	0.47	0.1311	1.3035	0.02084	0.3528:0.1333:0.3639:0.15	.	4;4	Q6NUN7;Q6NUN7-2	CK063_HUMAN;.	L	4	ENSP00000227349:R4L;ENSP00000431669:R4L	ENSP00000227349:R4L	R	+	2	0	C11orf63	122261778	0.000000	0.05858	0.001000	0.08648	0.191000	0.23601	-0.198000	0.09505	0.011000	0.14865	0.655000	0.94253	CGT	C11orf63	-	NULL	ENSG00000109944		0.398	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf63	HGNC	protein_coding	OTTHUMT00000387511.1	-	0.00	47	0	G	NM_024806		122756568	+1	tier1	-	no_errors	ENST00000227349	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.001	T
C18orf25	147339	genome.wustl.edu	37	18	43796527	43796527	+	Silent	SNP	A	A	G			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr18:43796527A>G	ENST00000282059.6	+	2	1055	c.681A>G	c.(679-681)tcA>tcG	p.S227S	C18orf25_ENST00000321319.6_Silent_p.S227S	NM_145055.3	NP_659492	Q96B23	CR025_HUMAN	chromosome 18 open reading frame 25	227										central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	11						AAGAGGTTTCAGGGAGCAGCA	0.438																																																	0													41.0	39.0	40.0					18																	43796527		1974	4177	6151	SO:0001819	synonymous_variant	0			AL713661	CCDS42430.1, CCDS42431.1	18q21.1	2014-01-03			ENSG00000152242	ENSG00000152242			28172	protein-coding gene	gene with protein product	"""ARKadia-like 1"""					15722956	Standard	NM_001008239		Approved	MGC12909, ARKL1, RNF111L1	uc002lbw.3	Q96B23		ENST00000282059.6:c.681A>G	18.37:g.43796527A>G			A8K123|A8KAB6|Q5XG78|Q6N058|Q86TB5|Q8TCQ5	Silent	SNP	NULL	p.S227	ENST00000282059.6	37	c.681	CCDS42430.1	18																																																																																			C18orf25	-	NULL	ENSG00000152242		0.438	C18orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C18orf25	HGNC	protein_coding	OTTHUMT00000445242.1	-	0.00	57	0	A	NM_145055		43796527	+1	tier1	-	no_errors	ENST00000282059	ensembl	human	known	74_37	silent	10.71	25	3	SNP	1.000	G
C1orf177	163747	genome.wustl.edu	37	1	55273285	55273285	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:55273285C>A	ENST00000371273.3	+	3	294	c.279C>A	c.(277-279)gcC>gcA	p.A93A	C1orf177_ENST00000358193.3_Silent_p.A93A	NM_001110533.1	NP_001104003	Q3ZCV2	CA177_HUMAN	chromosome 1 open reading frame 177	93										breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(6)|prostate(2)	17						CAGGCTGGGCCAAGGCCCAGG	0.592																																																	0													29.0	31.0	30.0					1																	55273285		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097520	CCDS599.1, CCDS44153.1	1p32.3	2012-07-25			ENSG00000162398	ENSG00000162398			26854	protein-coding gene	gene with protein product							Standard	NM_152607		Approved	FLJ40201	uc001cyb.4	Q3ZCV2	OTTHUMG00000009986	ENST00000371273.3:c.279C>A	1.37:g.55273285C>A			B7WPL2|Q8N7Y9	Silent	SNP	NULL	p.A93	ENST00000371273.3	37	c.279	CCDS44153.1	1																																																																																			C1orf177	-	NULL	ENSG00000162398		0.592	C1orf177-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C1orf177	HGNC	protein_coding	OTTHUMT00000027674.1	-	0.00	59	0	C	NM_152607		55273285	+1	tier1	-	no_errors	ENST00000371273	ensembl	human	known	74_37	silent	25.00	30	10	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	22	49834849	49834849	+	IGR	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr22:49834849C>T								C22orf34 (15763 upstream) : MIR3667 (102191 downstream)																							GTGCTGTCTCCGACCCGTGGC	0.562																																																	0																																										SO:0001628	intergenic_variant	0																															22.37:g.49834849C>T				Missense_Mutation	SNP	NULL	p.R23Q		37	c.68		22																																																																																			C22orf34	-	NULL	ENSG00000188511	0	0.562					C22orf34	HGNC			-	0.00	30	0	C			49834849	-1	tier1	-	no_errors	ENST00000414287	ensembl	human	known	74_37	missense	40.91	13	9	SNP	0.000	T
C3orf30	152405	genome.wustl.edu	37	3	118865907	118865907	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:118865907G>T	ENST00000295622.1	+	1	911	c.871G>T	c.(871-873)Gac>Tac	p.D291Y	IGSF11_ENST00000441144.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank|IGSF11_ENST00000354673.2_5'Flank|IGSF11_ENST00000425327.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	291										NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		TGAGCAGACTGACCTCAGATT	0.493																																																	0													82.0	79.0	80.0					3																	118865907		2203	4300	6503	SO:0001583	missense	0			AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.871G>T	3.37:g.118865907G>T	ENSP00000295622:p.Asp291Tyr		A1L4B7	Missense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.D291Y	ENST00000295622.1	37	c.871	CCDS2984.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.88|13.88	2.368928|2.368928	0.42003|0.42003	.|.	.|.	ENSG00000163424|ENSG00000163424	ENST00000295622;ENST00000470341|ENST00000460150;ENST00000473121;ENST00000492792	T|.	0.32988|.	1.43|.	4.35|4.35	2.48|2.48	0.30137|0.30137	.|.	0.561275|.	0.16204|.	N|.	0.224781|.	T|.	0.41926|.	0.1180|.	L|L	0.50333|0.50333	1.59|1.59	0.09310|0.09310	N|N	1|1	P;D|.	0.89917|.	0.932;1.0|.	P;D|.	0.73380|.	0.52;0.98|.	T|.	0.25745|.	-1.0123|.	10|.	0.37606|.	T|.	0.19|.	-1.09|-1.09	9.1216|9.1216	0.36791|0.36791	0.0:0.1604:0.6736:0.166|0.0:0.1604:0.6736:0.166	.|.	291;291|.	E9PFE5;Q96M34|.	.;CC030_HUMAN|.	Y|L	291|254;83;25	ENSP00000295622:D291Y|.	ENSP00000295622:D291Y|.	D|X	+|+	1|2	0|2	C3orf30|C3orf30	120348597|120348597	0.310000|0.310000	0.24527|0.24527	0.002000|0.002000	0.10522|0.10522	0.006000|0.006000	0.05464|0.05464	2.606000|2.606000	0.46291|0.46291	0.717000|0.717000	0.32145|0.32145	0.591000|0.591000	0.81541|0.81541	GAC|TGA	C3orf30	-	NULL	ENSG00000163424		0.493	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf30	HGNC	protein_coding	OTTHUMT00000354838.1	-	0.00	40	0	G	NM_152539		118865907	+1	tier1	-	no_errors	ENST00000295622	ensembl	human	known	74_37	missense	26.47	25	9	SNP	0.008	T
C3orf33	285315	genome.wustl.edu	37	3	155493558	155493558	+	Missense_Mutation	SNP	C	C	T	rs547864770		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:155493558C>T	ENST00000340171.2	-	3	352	c.254G>A	c.(253-255)cGa>cAa	p.R85Q	C3orf33_ENST00000534941.1_Missense_Mutation_p.R42Q			Q6P1S2	CC033_HUMAN	chromosome 3 open reading frame 33	85					negative regulation of ERK1 and ERK2 cascade (GO:0070373)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)	p.R36Q(1)		breast(1)|kidney(1)|large_intestine(3)|lung(3)	8			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CTCAGTTATTCGGCGTAATCG	0.308													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14682	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	large_intestine(1)											103.0	103.0	103.0					3																	155493558		1811	4066	5877	SO:0001583	missense	0			AF115515	CCDS54659.1	3q25.31	2012-10-31			ENSG00000174928	ENSG00000174928			26434	protein-coding gene	gene with protein product						20680465	Standard	NM_173657		Approved	FLJ31139, AC3-33	uc003fal.1	Q6P1S2	OTTHUMG00000158496	ENST00000340171.2:c.254G>A	3.37:g.155493558C>T	ENSP00000342512:p.Arg85Gln		A8K1H5|Q86YE6|Q8IXA7|Q96NB5	Missense_Mutation	SNP	superfamily_Staphylococal_nuclease_OB-fold	p.R85Q	ENST00000340171.2	37	c.254		3	.	.	.	.	.	.	.	.	.	.	C	10.34	1.322119	0.23994	.	.	ENSG00000174928	ENST00000534941;ENST00000340171;ENST00000537385	T;T	0.46819	0.86;0.86	5.45	1.63	0.23807	.	0.528800	0.19690	N	0.108289	T	0.29355	0.0731	N	0.22421	0.69	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.16630	-1.0396	10	0.22706	T	0.39	-2.4076	9.1843	0.37160	0.0:0.6476:0.0:0.3524	.	85	Q6P1S2	CC033_HUMAN	Q	42;85;85	ENSP00000445446:R42Q;ENSP00000342512:R85Q	ENSP00000342512:R85Q	R	-	2	0	C3orf33	156976252	0.585000	0.26774	0.805000	0.32314	0.982000	0.71751	0.247000	0.18179	0.671000	0.31185	-0.137000	0.14449	CGA	C3orf33	-	superfamily_Staphylococal_nuclease_OB-fold	ENSG00000174928		0.308	C3orf33-001	KNOWN	basic	protein_coding	C3orf33	HGNC	protein_coding	OTTHUMT00000351167.1	-	0.00	109	0	C	NM_173657		155493558	-1	tier1	-	no_errors	ENST00000340171	ensembl	human	known	74_37	missense	21.62	87	24	SNP	0.142	T
C6orf132	647024	genome.wustl.edu	37	6	42074752	42074752	+	Frame_Shift_Del	DEL	G	G	-	rs145411737	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:42074752delG	ENST00000341865.4	-	4	897	c.898delC	c.(898-900)cgtfs	p.R300fs		NM_001164446.1	NP_001157918.1	Q5T0Z8	CF132_HUMAN	chromosome 6 open reading frame 132	300										breast(1)	1						TTGAAAGAACGGGGGAAGGTG	0.632																																																	0													15.0	18.0	17.0					6																	42074752		692	1591	2283	SO:0001589	frameshift_variant	0				CCDS47428.1	6p21.1	2012-02-06			ENSG00000188112	ENSG00000188112			21288	protein-coding gene	gene with protein product							Standard	NM_001164446		Approved	bA7K24.2	uc003orw.2	Q5T0Z8	OTTHUMG00000014695	ENST00000341865.4:c.898delC	6.37:g.42074752delG	ENSP00000341368:p.Arg300fs		A6NI05	Frame_Shift_Del	DEL	NULL	p.R300fs	ENST00000341865.4	37	c.898	CCDS47428.1	6																																																																																			C6orf132	-	NULL	ENSG00000188112		0.632	C6orf132-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	C6orf132	HGNC	protein_coding	OTTHUMT00000040548.2		0.00	24	0	G	NM_001164446		42074752	-1	tier1		no_errors	ENST00000341865	ensembl	human	putative	74_37	frame_shift_del	9.09	20	2	DEL	0.912	-
C6orf118	168090	genome.wustl.edu	37	6	165693524	165693524	+	3'UTR	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:165693524C>T	ENST00000230301.8	-	0	1452				C6orf118_ENST00000494696.2_5'UTR	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118											breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		TTCCACTGGCCATTTGTTCAG	0.333																																																	0													145.0	128.0	134.0					6																	165693524		2203	4299	6502	SO:0001624	3_prime_UTR_variant	0				CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.*22G>A	6.37:g.165693524C>T			Q8TC11	RNA	SNP	-	NULL	ENST00000230301.8	37	NULL	CCDS5288.1	6																																																																																			C6orf118	-	-	ENSG00000112539		0.333	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C6orf118	HGNC	protein_coding	OTTHUMT00000043026.1	-	0.00	62	0	C	NM_144980		165693524	-1	tier1	-	no_errors	ENST00000491176	ensembl	human	known	74_37	rna	11.90	37	5	SNP	0.000	T
CABIN1	23523	genome.wustl.edu	37	22	24451336	24451336	+	Splice_Site	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr22:24451336C>T	ENST00000398319.2	+	9	1192	c.807C>T	c.(805-807)acC>acT	p.T269T	CABIN1_ENST00000405822.2_Splice_Site_p.C219C|CABIN1_ENST00000263119.5_Splice_Site_p.T269T	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	269					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CTCCCTTTAGCTGGAAGTGCC	0.557																																																	0													117.0	104.0	109.0					22																	24451336		2203	4300	6503	SO:0001630	splice_region_variant	0			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.807-1C>T	22.37:g.24451336C>T			G5E9F3|Q6PHY0|Q9Y460	Silent	SNP	pfam_MEF2_binding,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.T269	ENST00000398319.2	37	c.807	CCDS13823.1	22																																																																																			CABIN1	-	NULL	ENSG00000099991		0.557	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABIN1	HGNC	protein_coding	OTTHUMT00000320161.2	-	0.00	38	0	C	NM_012295	Silent	24451336	+1	tier1	-	no_errors	ENST00000263119	ensembl	human	known	74_37	silent	18.75	13	3	SNP	0.987	T
CACNA2D1	781	genome.wustl.edu	37	7	81978910	81978910	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:81978910C>G	ENST00000356253.5	-	2	406	c.151G>C	c.(151-153)Gca>Cca	p.A51P	CACNA2D1_ENST00000423588.1_Missense_Mutation_p.A51P|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.A51P			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	51					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	ACTCCACTTGCTGTTTTTGCC	0.368																																																	0													210.0	194.0	199.0					7																	81978910		2203	4300	6503	SO:0001583	missense	0			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.151G>C	7.37:g.81978910C>G	ENSP00000348589:p.Ala51Pro		Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	pfam_VDCC_a2/dsu,pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.A51P	ENST00000356253.5	37	c.151		7	.	.	.	.	.	.	.	.	.	.	C	26.4	4.733893	0.89482	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000423588	T;T;T	0.24908	3.17;3.16;1.83	6.05	6.05	0.98169	.	0.000000	0.64402	D	0.000001	T	0.46678	0.1405	L	0.59436	1.845	0.80722	D	1	D	0.62365	0.991	P	0.59889	0.865	T	0.22487	-1.0215	10	0.62326	D	0.03	-19.6819	19.3727	0.94495	0.0:1.0:0.0:0.0	.	51	P54289-2	.	P	51	ENSP00000349320:A51P;ENSP00000348589:A51P;ENSP00000405395:A51P	ENSP00000284088:A51P	A	-	1	0	CACNA2D1	81816846	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.322000	0.65852	2.878000	0.98634	0.650000	0.86243	GCA	CACNA2D1	-	NULL	ENSG00000153956		0.368	CACNA2D1-201	KNOWN	basic	protein_coding	CACNA2D1	HGNC	protein_coding		-	0.00	43	0	C			81978910	-1	tier1	-	no_errors	ENST00000356253	ensembl	human	known	74_37	missense	20.00	40	10	SNP	1.000	G
CAPN3	825	genome.wustl.edu	37	15	42702844	42702844	+	Missense_Mutation	SNP	G	G	A	rs587780290		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr15:42702844G>A	ENST00000397163.3	+	21	2462	c.2243G>A	c.(2242-2244)cGa>cAa	p.R748Q	CAPN3_ENST00000337571.4_Missense_Mutation_p.R83Q|CAPN3_ENST00000562199.1_3'UTR|CAPN3_ENST00000569136.1_Missense_Mutation_p.R83Q|CAPN3_ENST00000397204.4_Missense_Mutation_p.R83Q|CAPN3_ENST00000349748.3_Missense_Mutation_p.R656Q|CAPN3_ENST00000561817.1_Missense_Mutation_p.R83Q|CAPN3_ENST00000397200.4_Missense_Mutation_p.R236Q|CAPN3_ENST00000318023.7_Missense_Mutation_p.R742Q|CAPN3_ENST00000357568.3_Missense_Mutation_p.R742Q|RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000356316.3_Missense_Mutation_p.R655Q	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	748	Domain IV.|EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.		R -> Q (in LGMD2A). {ECO:0000269|PubMed:9266733, ECO:0000269|PubMed:9762961}.		apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.R742Q(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		TACGAGATGCGAAATGCAGTC	0.527																																																	1	Substitution - Missense(1)	large_intestine(1)	GRCh37	CM970224	CAPN3	M							59.0	52.0	55.0					15																	42702844		2203	4299	6502	SO:0001583	missense	0			X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.2243G>A	15.37:g.42702844G>A	ENSP00000380349:p.Arg748Gln		A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.R748Q	ENST00000397163.3	37	c.2243	CCDS45245.1	15	.	.	.	.	.	.	.	.	.	.	G	36	5.670031	0.96754	.	.	ENSG00000092529	ENST00000356316;ENST00000337522;ENST00000397163;ENST00000357568;ENST00000349748;ENST00000318023;ENST00000397200;ENST00000337571;ENST00000397204	T;T;T;T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.1;-0.1	4.54	4.54	0.55810	EF-hand-like domain (1);	0.000000	0.85682	U	0.000000	T	0.80154	0.4571	M	0.64630	1.985	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;1.0;0.999;1.0;1.0;1.0;1.0	T	0.82798	-0.0279	10	0.87932	D	0	.	17.5035	0.87738	0.0:0.0:1.0:0.0	.	613;661;83;656;742;748;655	C6EVS4;C6EVS3;A4FTZ9;P20807-2;P20807-3;P20807;Q762C8	.;.;.;.;.;CAN3_HUMAN;.	Q	655;236;748;742;656;742;236;83;83	ENSP00000348667:R655Q;ENSP00000380349:R748Q;ENSP00000350181:R742Q;ENSP00000183936:R656Q;ENSP00000326281:R742Q;ENSP00000380384:R236Q;ENSP00000336840:R83Q;ENSP00000380387:R83Q	ENSP00000326281:R742Q	R	+	2	0	CAPN3	40490136	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.657000	0.98554	2.356000	0.79943	0.563000	0.77884	CGA	CAPN3	-	smart_EF_hand_dom,pfscan_EF_hand_dom	ENSG00000092529		0.527	CAPN3-009	KNOWN	basic|CCDS	protein_coding	CAPN3	HGNC	protein_coding	OTTHUMT00000421075.1		0.00	40	0	G			42702844	+1			no_errors	ENST00000397163	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	A
CAPRIN1	4076	genome.wustl.edu	37	11	34119305	34119305	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:34119305C>T	ENST00000341394.4	+	18	2251	c.2062C>T	c.(2062-2064)Cga>Tga	p.R688*	CAPRIN1_ENST00000532820.1_Nonsense_Mutation_p.R688*|CAPRIN1_ENST00000529307.1_Nonsense_Mutation_p.R607*|CAPRIN1_ENST00000530820.1_Nonsense_Mutation_p.R688*|CAPRIN1_ENST00000533657.1_3'UTR|CAPRIN1_ENST00000389645.3_Nonsense_Mutation_p.R688*	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	688					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				GGGAGCCCCACGAGGTAATAT	0.443																																																	0													94.0	95.0	94.0					11																	34119305		2202	4298	6500	SO:0001587	stop_gained	0			BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.2062C>T	11.37:g.34119305C>T	ENSP00000340329:p.Arg688*		A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Nonsense_Mutation	SNP	pfam_Caprin-1_C	p.R688*	ENST00000341394.4	37	c.2062	CCDS31453.1	11	.	.	.	.	.	.	.	.	.	.	C	39	7.667559	0.98422	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000532820;ENST00000530820;ENST00000529307	.	.	.	5.36	4.36	0.52297	.	0.566231	0.18527	N	0.138597	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3788	0.83431	0.2082:0.7918:0.0:0.0	.	.	.	.	X	688;688;688;688;607	.	ENSP00000340329:R688X	R	+	1	2	CAPRIN1	34075881	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.338000	0.43957	2.486000	0.83907	0.563000	0.77884	CGA	CAPRIN1	-	NULL	ENSG00000135387		0.443	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	CAPRIN1	HGNC	protein_coding	OTTHUMT00000388680.2	-	0.00	49	0	C	NM_005898		34119305	+1	tier1	-	no_errors	ENST00000341394	ensembl	human	known	74_37	nonsense	18.92	30	7	SNP	1.000	T
CASP7	840	genome.wustl.edu	37	10	115457341	115457341	+	Missense_Mutation	SNP	C	C	T	rs555949483		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr10:115457341C>T	ENST00000345633.4	+	3	473	c.89C>T	c.(88-90)tCg>tTg	p.S30L	CASP7_ENST00000369321.2_Missense_Mutation_p.S63L|CASP7_ENST00000369315.1_Missense_Mutation_p.S30L|CASP7_ENST00000369318.3_Missense_Mutation_p.S30L|CASP7_ENST00000369331.4_Missense_Mutation_p.S30L	NM_033339.4	NP_203125.1	P55210	CASP7_HUMAN	caspase 7, apoptosis-related cysteine peptidase	30					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway (GO:0097193)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			kidney(1)|large_intestine(1)|lung(5)|ovary(1)	8		Colorectal(252;0.0946)|Breast(234;0.188)		Epithelial(162;0.012)|all cancers(201;0.014)		GACCGGTCCTCGTTTGTACCG	0.552													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19602	0.0		0.0	False		,,,				2504	0.0																0													196.0	160.0	172.0					10																	115457341		2203	4300	6503	SO:0001583	missense	0			U37448	CCDS7580.1, CCDS7581.1, CCDS7582.1, CCDS58096.1, CCDS73200.1	10q25	2006-02-17	2005-08-17		ENSG00000165806	ENSG00000165806		"""Caspases"""	1508	protein-coding gene	gene with protein product		601761	"""caspase 7, apoptosis-related cysteine protease"""			8521391, 8576161	Standard	NM_033338		Approved	MCH3, CMH-1, ICE-LAP3	uc010qsa.3	P55210	OTTHUMG00000019076	ENST00000345633.4:c.89C>T	10.37:g.115457341C>T	ENSP00000298701:p.Ser30Leu		B4DQU7|B5BU45|D3DRB8|Q13364|Q53YD5|Q5SVL0|Q5SVL3|Q96BA0	Missense_Mutation	SNP	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.S63L	ENST00000345633.4	37	c.188	CCDS7581.1	10	.	.	.	.	.	.	.	.	.	.	C	9.884	1.202292	0.22121	.	.	ENSG00000165806	ENST00000429617;ENST00000369331;ENST00000369321;ENST00000345633;ENST00000369318;ENST00000442393;ENST00000369319;ENST00000369316;ENST00000369315	T;T;T;T;T;T	0.07444	3.85;3.19;4.44;4.47;4.47;4.47	4.49	4.49	0.54785	.	1.201650	0.05524	N	0.562667	T	0.10121	0.0248	L	0.57536	1.79	0.80722	D	1	P;B;P	0.48162	0.625;0.226;0.906	B;B;B	0.33454	0.034;0.028;0.164	T	0.47018	-0.9149	10	0.24483	T	0.36	.	12.8756	0.57988	0.0:1.0:0.0:0.0	.	63;30;30	P55210-3;P55210;P55210-2	.;CASP7_HUMAN;.	L	30;30;63;30;30;30;30;30;30	ENSP00000400094:S30L;ENSP00000358337:S30L;ENSP00000358327:S63L;ENSP00000298701:S30L;ENSP00000358324:S30L;ENSP00000358321:S30L	ENSP00000298701:S30L	S	+	2	0	CASP7	115447331	0.004000	0.15560	0.810000	0.32431	0.127000	0.20565	1.030000	0.30153	2.486000	0.83907	0.650000	0.86243	TCG	CASP7	-	NULL	ENSG00000165806		0.552	CASP7-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP7	HGNC	protein_coding	OTTHUMT00000050439.1	-	0.00	124	0	C	NM_033338		115457341	+1	tier1	-	no_errors	ENST00000369321	ensembl	human	known	74_37	missense	30.23	60	26	SNP	0.830	T
CBWD1	55871	genome.wustl.edu	37	9	146221	146222	+	Intron	INS	-	-	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr9:146221_146222insA	ENST00000356521.4	-	10	796				CBWD1_ENST00000377400.4_Intron|CBWD1_ENST00000382447.4_Intron|CBWD1_ENST00000314367.10_Intron|CBWD1_ENST00000475411.1_5'UTR	NM_018491.3	NP_060961.3	Q9BRT8	CBWD1_HUMAN	COBW domain containing 1								ATP binding (GO:0005524)			kidney(1)|lung(2)|ovary(1)|skin(1)	5	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		AGTTAATCAAGAAAAAAAACTC	0.292																																																	0																																										SO:0001627	intron_variant	0			AY343911	CCDS6438.1, CCDS47947.1, CCDS47948.1	9p24.3	2008-02-05			ENSG00000172785	ENSG00000172785			17134	protein-coding gene	gene with protein product		611078				15233989, 12421752	Standard	NM_018491		Approved		uc003zga.4	Q9BRT8	OTTHUMG00000019425	ENST00000356521.4:c.708-63->T	9.37:g.146229_146229dupA			A2RU55|A8K3N3|B0AZR4|Q49AJ1|Q5VVK2|Q6VBU6|Q7Z5Z0|Q7Z652|Q9BY38|Q9NYD0	RNA	INS	-	NULL	ENST00000356521.4	37	NULL	CCDS6438.1	9																																																																																			CBWD1	-	-	ENSG00000172785		0.292	CBWD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	CBWD1	HGNC	protein_coding	OTTHUMT00000051463.1		0.00	191	0	-	NM_018491		146222	-1	tier1		no_errors	ENST00000475411	ensembl	human	known	74_37	rna	26.99	119	44	INS	0.000:0.001	A
CCDC158	339965	genome.wustl.edu	37	4	77288833	77288833	+	Nonsense_Mutation	SNP	C	C	A	rs17001824	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr4:77288833C>A	ENST00000388914.3	-	11	1596	c.1444G>T	c.(1444-1446)Gaa>Taa	p.E482*		NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	482										breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						GTCAACTCTTCTACTACTTTG	0.453																																																	0													72.0	70.0	70.0					4																	77288833		1904	4120	6024	SO:0001587	stop_gained	0			BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.1444G>T	4.37:g.77288833C>A	ENSP00000373566:p.Glu482*		Q8IYQ1|Q8N7D4|Q8N7E3	Nonsense_Mutation	SNP	superfamily_Prefoldin	p.E482*	ENST00000388914.3	37	c.1444	CCDS43242.1	4	.	.	.	.	.	.	.	.	.	.	C	41	9.136071	0.99077	.	.	ENSG00000163749	ENST00000388914	.	.	.	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6416	0.88138	0.0:1.0:0.0:0.0	.	.	.	.	X	482	.	.	E	-	1	0	CCDC158	77507857	0.999000	0.42202	0.963000	0.40424	0.995000	0.86356	5.178000	0.65037	2.711000	0.92665	0.563000	0.77884	GAA	CCDC158	-	NULL	ENSG00000163749		0.453	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC158	HGNC	protein_coding	OTTHUMT00000362694.2	-	0.00	75	0	C	NM_001042784		77288833	-1	tier1	-	no_errors	ENST00000388914	ensembl	human	known	74_37	nonsense	11.32	47	6	SNP	0.993	A
CFAP45	25790	genome.wustl.edu	37	1	159862985	159862985	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:159862985G>T	ENST00000368099.4	-	2	178	c.114C>A	c.(112-114)ctC>ctA	p.L38L	CCDC19_ENST00000426543.2_5'UTR|CCDC19_ENST00000476696.1_5'UTR	NM_012337.2	NP_036469.2														endometrium(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	26	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			TATCTCCAAAGAGGCTCTCAT	0.522																																																	0													124.0	121.0	122.0					1																	159862985		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000368099.4:c.114C>A	1.37:g.159862985G>T				Silent	SNP	NULL	p.L38	ENST00000368099.4	37	c.114	CCDS30914.1	1																																																																																			CCDC19	-	NULL	ENSG00000213085		0.522	CCDC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC19	HGNC	protein_coding	OTTHUMT00000085979.1	-	0.00	59	0	G			159862985	-1	tier1	-	no_errors	ENST00000368099	ensembl	human	known	74_37	silent	8.89	41	4	SNP	1.000	T
CCDC40	55036	genome.wustl.edu	37	17	78058694	78058694	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:78058694C>A	ENST00000397545.4	+	13	2169	c.2142C>A	c.(2140-2142)agC>agA	p.S714R	CCDC40_ENST00000374877.3_Missense_Mutation_p.S714R	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	714					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			ACAGCCAGAGCGAGATCTCCC	0.592																																																	0													62.0	64.0	64.0					17																	78058694		2116	4232	6348	SO:0001583	missense	0			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.2142C>A	17.37:g.78058694C>A	ENSP00000380679:p.Ser714Arg		A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	pfam_E3_ubiquit_lig_BRE1	p.S714R	ENST00000397545.4	37	c.2142	CCDS42395.1	17	.	.	.	.	.	.	.	.	.	.	C	12.72	2.021185	0.35701	.	.	ENSG00000141519	ENST00000374877;ENST00000397545	T;T	0.46451	0.87;0.9	5.06	2.64	0.31445	.	.	.	.	.	T	0.30727	0.0774	L	0.43152	1.355	0.32858	D	0.507578	P;P	0.43973	0.729;0.823	B;B	0.40659	0.181;0.336	T	0.34104	-0.9842	9	0.22706	T	0.39	-31.1401	6.0124	0.19584	0.0:0.5599:0.0:0.4401	.	714;497	Q4G0X9;Q4G0X9-3	CCD40_HUMAN;.	R	714	ENSP00000364011:S714R;ENSP00000380679:S714R	ENSP00000364011:S714R	S	+	3	2	CCDC40	75673289	0.001000	0.12720	0.909000	0.35828	0.941000	0.58515	-0.233000	0.09041	1.077000	0.40990	0.655000	0.94253	AGC	CCDC40	-	NULL	ENSG00000141519		0.592	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC40	HGNC	protein_coding	OTTHUMT00000256005.2	-	0.00	23	0	C	XM_371082		78058694	+1	tier1	-	no_errors	ENST00000397545	ensembl	human	known	74_37	missense	22.22	14	4	SNP	0.553	A
CCDC8	83987	genome.wustl.edu	37	19	46914593	46914593	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:46914593C>T	ENST00000307522.3	-	1	2248	c.1475G>A	c.(1474-1476)cGc>cAc	p.R492H		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	492					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		GGCTCTCCGGCGCTTGCAAAA	0.647																																																	0													55.0	58.0	57.0					19																	46914593		2203	4300	6503	SO:0001583	missense	0			BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.1475G>A	19.37:g.46914593C>T	ENSP00000303158:p.Arg492His		Q8TB26	Missense_Mutation	SNP	NULL	p.R492H	ENST00000307522.3	37	c.1475	CCDS12685.1	19	.	.	.	.	.	.	.	.	.	.	C	5.995	0.367498	0.11352	.	.	ENSG00000169515	ENST00000307522	T	0.22134	1.97	4.05	-2.69	0.06022	.	0.426970	0.17404	N	0.175446	T	0.17238	0.0414	M	0.61703	1.905	0.09310	N	1	B	0.15719	0.014	B	0.12156	0.007	T	0.20107	-1.0285	10	0.51188	T	0.08	0.2069	5.964	0.19315	0.1151:0.5534:0.2481:0.0833	.	492	Q9H0W5	CCDC8_HUMAN	H	492	ENSP00000303158:R492H	ENSP00000303158:R492H	R	-	2	0	CCDC8	51606433	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.084000	0.11268	-0.266000	0.09339	-2.650000	0.00149	CGC	CCDC8	-	NULL	ENSG00000169515		0.647	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC8	HGNC	protein_coding	OTTHUMT00000368598.1	-	0.00	33	0	C	NM_032040		46914593	-1	tier1	-	no_errors	ENST00000307522	ensembl	human	known	74_37	missense	25.00	21	7	SNP	0.001	T
CCDC80	151887	genome.wustl.edu	37	3	112358493	112358493	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:112358493C>T	ENST00000206423.3	-	2	1213	c.260G>A	c.(259-261)cGc>cAc	p.R87H	CCDC80_ENST00000439685.2_Missense_Mutation_p.R87H|CCDC80_ENST00000475181.1_5'UTR	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	87					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						CTCTGTTGGGCGAGCTAGTCT	0.602																																																	0													72.0	68.0	70.0					3																	112358493		2203	4300	6503	SO:0001583	missense	0			AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.260G>A	3.37:g.112358493C>T	ENSP00000206423:p.Arg87His		D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	NULL	p.R87H	ENST00000206423.3	37	c.260	CCDS2968.1	3	.	.	.	.	.	.	.	.	.	.	C	8.000	0.755273	0.15846	.	.	ENSG00000091986	ENST00000206423;ENST00000439685;ENST00000444594	T;T	0.44881	0.91;0.91	5.35	-5.15	0.02866	.	1.257190	0.05262	N	0.515973	T	0.16514	0.0397	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.12016	-1.0564	10	0.15499	T	0.54	-0.0491	1.9051	0.03275	0.1164:0.2021:0.2475:0.434	.	98;87;87	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	H	87	ENSP00000206423:R87H;ENSP00000411814:R87H	ENSP00000206423:R87H	R	-	2	0	CCDC80	113841183	0.000000	0.05858	0.000000	0.03702	0.603000	0.37013	-1.306000	0.02735	-1.383000	0.02106	0.650000	0.86243	CGC	CCDC80	-	NULL	ENSG00000091986		0.602	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC80	HGNC	protein_coding	OTTHUMT00000354219.1	-	0.00	71	0	C	NM_199511		112358493	-1	tier1	-	no_errors	ENST00000206423	ensembl	human	known	74_37	missense	20.69	46	12	SNP	0.000	T
CCDC85A	114800	genome.wustl.edu	37	2	56570088	56570088	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:56570088C>T	ENST00000407595.2	+	3	1817	c.1315C>T	c.(1315-1317)Cag>Tag	p.Q439*	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	439										breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CATGCTGCCCCAGGTGGGTGA	0.393																																																	0													53.0	56.0	55.0					2																	56570088		1891	4109	6000	SO:0001587	stop_gained	0			AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.1315C>T	2.37:g.56570088C>T	ENSP00000384040:p.Gln439*			Nonsense_Mutation	SNP	pfam_DUF2216_coiled-coil	p.Q439*	ENST00000407595.2	37	c.1315	CCDS46290.1	2	.	.	.	.	.	.	.	.	.	.	C	40	7.968282	0.98588	.	.	ENSG00000055813	ENST00000407595;ENST00000407862	.	.	.	5.75	5.75	0.90469	.	0.269483	0.27327	N	0.019862	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-34.9482	17.7003	0.88292	0.0:1.0:0.0:0.0	.	.	.	.	X	439;28	.	ENSP00000384040:Q439X	Q	+	1	0	CCDC85A	56423592	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.964000	0.63701	2.718000	0.92993	0.591000	0.81541	CAG	CCDC85A	-	NULL	ENSG00000055813		0.393	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC85A	HGNC	protein_coding	OTTHUMT00000324993.1	-	0.00	46	0	C			56570088	+1	tier1	-	no_errors	ENST00000407595	ensembl	human	known	74_37	nonsense	37.93	18	11	SNP	1.000	T
CCT7	10574	genome.wustl.edu	37	2	73476151	73476151	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:73476151C>T	ENST00000258091.5	+	8	957	c.816C>T	c.(814-816)aaC>aaT	p.N272N	CCT7_ENST00000473786.1_3'UTR|CCT7_ENST00000537131.1_Silent_p.N172N|CCT7_ENST00000540468.1_Silent_p.N185N|CCT7_ENST00000538797.1_Silent_p.N144N|CCT7_ENST00000398422.2_Silent_p.N68N|CCT7_ENST00000539919.1_Silent_p.N228N	NM_006429.3	NP_006420.1	Q99832	TCPH_HUMAN	chaperonin containing TCP1, subunit 7 (eta)	272					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|cervix(1)|endometrium(1)|lung(3)|stomach(1)	7						CTGAGTGGAACATTCTCTATG	0.448																																																	0													103.0	95.0	98.0					2																	73476151		1924	4130	6054	SO:0001819	synonymous_variant	0			AF026292	CCDS42696.1, CCDS46336.1, CCDS54366.1, CCDS54367.1	2p13.2	2011-09-02			ENSG00000135624	ENSG00000135624		"""Heat Shock Proteins / Chaperonins"""	1622	protein-coding gene	gene with protein product		605140				9819444	Standard	NM_006429		Approved	Ccth, Nip7-1	uc002siz.3	Q99832	OTTHUMG00000152765	ENST00000258091.5:c.816C>T	2.37:g.73476151C>T			A8K7E6|A8MWI8|B7WNW9|B7Z4T9|B7Z4Z7|O14871|Q6FI26	Silent	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_eta	p.N272	ENST00000258091.5	37	c.816	CCDS46336.1	2																																																																																			CCT7	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,tigrfam_Chap_CCT_eta	ENSG00000135624		0.448	CCT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT7	HGNC	protein_coding	OTTHUMT00000327714.2	-	0.00	28	0	C			73476151	+1	tier1	-	no_errors	ENST00000258091	ensembl	human	known	74_37	silent	36.67	19	11	SNP	1.000	T
CD163	9332	genome.wustl.edu	37	12	7655084	7655084	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:7655084G>T	ENST00000359156.4	-	2	325	c.123C>A	c.(121-123)acC>acA	p.T41T	CD163_ENST00000432237.2_Silent_p.T41T|CD163_ENST00000541972.1_Silent_p.T29T|CD163_ENST00000396620.3_Silent_p.T41T	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	41					acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	CAAGAGAactggtgacaaaac	0.403																																																	0													79.0	71.0	74.0					12																	7655084		2202	4300	6502	SO:0001819	synonymous_variant	0			Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.123C>A	12.37:g.7655084G>T			C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Silent	SNP	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_SRCR,pfscan_SRCR	p.T41	ENST00000359156.4	37	c.123	CCDS8578.1	12																																																																																			CD163	-	NULL	ENSG00000177575		0.403	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD163	HGNC	protein_coding	OTTHUMT00000399396.2	-	0.00	26	0	G	NM_004244, NM_203416		7655084	-1	tier1	-	no_errors	ENST00000359156	ensembl	human	known	74_37	silent	19.23	20	5	SNP	0.001	T
CD86	942	genome.wustl.edu	37	3	121810570	121810570	+	Intron	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:121810570G>T	ENST00000330540.2	+	2	180				CD86_ENST00000493101.1_Intron|CD86_ENST00000469710.1_Intron|CD86_ENST00000393627.2_Intron|CD86_ENST00000264468.5_Intron|CD86_ENST00000483949.1_3'UTR	NM_175862.4	NP_787058	P42081	CD86_HUMAN	CD86 molecule						aging (GO:0007568)|B cell activation (GO:0042113)|cell-cell signaling (GO:0007267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to metal ion (GO:0071248)|defense response to virus (GO:0051607)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|immune response (GO:0006955)|innate immune response (GO:0045087)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of T cell anergy (GO:0002668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of lymphotoxin A biosynthetic process (GO:0043017)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|response to interferon-gamma (GO:0034341)|response to yeast (GO:0001878)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell proliferation involved in immune response (GO:0002309)|toll-like receptor signaling pathway (GO:0002224)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|receptor activity (GO:0004872)			breast(2)|endometrium(1)|kidney(1)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	23				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)|Antithymocyte globulin(DB00098)|Belatacept(DB06681)	AGCAAGCCCAGGCCTGAGACT	0.458																																					GBM(67;1379 1389 36064 39806)												0													116.0	88.0	97.0					3																	121810570		692	1591	2283	SO:0001627	intron_variant	0				CCDS3009.1, CCDS43138.1, CCDS56272.1, CCDS56273.1, CCDS74991.1	3q21	2013-01-29	2006-03-28		ENSG00000114013	ENSG00000114013		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1705	protein-coding gene	gene with protein product	"""B-lymphocyte antigen B7-2"""	601020	"""CD86 antigen (CD28 antigen ligand 2, B7-2 antigen)"""	CD28LG2		7513726	Standard	NM_006889		Approved	B7.2, B7-2	uc003eet.3	P42081	OTTHUMG00000159482	ENST00000330540.2:c.64+73G>T	3.37:g.121810570G>T			A0N0P0|B7Z2F3|B7Z702|E7ETN5|E9PC27|Q13655|Q6FHB1|Q6GTS4|Q7M4L5	RNA	SNP	-	NULL	ENST00000330540.2	37	NULL	CCDS3009.1	3																																																																																			CD86	-	-	ENSG00000114013		0.458	CD86-001	KNOWN	basic|CCDS	protein_coding	CD86	HGNC	protein_coding	OTTHUMT00000355671.1	-	0.00	86	0	G	NM_006889		121810570	+1	tier1	-	no_errors	ENST00000483949	ensembl	human	known	74_37	rna	30.51	41	18	SNP	0.000	T
CDH3	1001	genome.wustl.edu	37	16	68712425	68712425	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:68712425G>C	ENST00000264012.4	+	5	956	c.412G>C	c.(412-414)Gac>Cac	p.D138H	CDH3_ENST00000581171.1_Missense_Mutation_p.D83H|CDH3_ENST00000429102.2_Missense_Mutation_p.D138H	NM_001793.4	NP_001784.2	P22223	CADH3_HUMAN	cadherin 3, type 1, P-cadherin (placental)	138	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|hair cycle process (GO:0022405)|homophilic cell adhesion (GO:0007156)|keratinization (GO:0031424)|negative regulation of catagen (GO:0051796)|negative regulation of transforming growth factor beta2 production (GO:0032912)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanosome transport (GO:1902910)|positive regulation of monophenol monooxygenase activity (GO:0032773)|regulation of hair cycle by canonical Wnt signaling pathway (GO:0060901)|response to drug (GO:0042493)|retina homeostasis (GO:0001895)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)|wound healing (GO:0042060)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(2)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(3)|skin(1)|urinary_tract(1)	25		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		TAAAGATAGAGACACCAAGAT	0.488																																																	2	Unknown(2)	breast(2)											70.0	80.0	76.0					16																	68712425		2197	4299	6496	SO:0001583	missense	0			X63629	CCDS10868.1	16q22.1	2013-01-08	2001-12-04		ENSG00000062038	ENSG00000062038		"""Cadherins / Major cadherins"""	1762	protein-coding gene	gene with protein product		114021	"""cadherin 3, P-cadherin (placental)"""			1427864	Standard	NM_001793		Approved	CDHP, PCAD	uc002ewf.2	P22223	OTTHUMG00000137560	ENST00000264012.4:c.412G>C	16.37:g.68712425G>C	ENSP00000264012:p.Asp138His		B2R6F4|Q05DI6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D138H	ENST00000264012.4	37	c.412	CCDS10868.1	16	.	.	.	.	.	.	.	.	.	.	G	19.74	3.884245	0.72410	.	.	ENSG00000062038	ENST00000429102;ENST00000264012;ENST00000542274	T;T	0.49432	0.78;0.78	5.64	5.64	0.86602	Cadherin (4);Cadherin-like (1);	0.371565	0.19761	N	0.106673	T	0.49525	0.1562	N	0.25992	0.78	0.26403	N	0.976383	P	0.48911	0.917	P	0.52627	0.704	T	0.44283	-0.9338	10	0.46703	T	0.11	.	17.243	0.87019	0.0:0.0:1.0:0.0	.	138	P22223	CADH3_HUMAN	H	138;138;83	ENSP00000398485:D138H;ENSP00000264012:D138H	ENSP00000264012:D138H	D	+	1	0	CDH3	67269926	0.550000	0.26489	1.000000	0.80357	0.883000	0.51084	3.371000	0.52379	2.937000	0.99478	0.650000	0.86243	GAC	CDH3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000062038		0.488	CDH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH3	HGNC	protein_coding	OTTHUMT00000268896.2	-	0.00	61	0	G	NM_001793		68712425	+1	tier1	-	no_errors	ENST00000264012	ensembl	human	known	74_37	missense	54.84	14	17	SNP	1.000	C
CDH9	1007	genome.wustl.edu	37	5	26988397	26988397	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:26988397A>T	ENST00000231021.4	-	2	216	c.44T>A	c.(43-45)aTg>aAg	p.M15K		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	15					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TGTATGGAACATATAGGTCCA	0.343																																					Melanoma(8;187 585 15745 40864 52829)												0													141.0	145.0	143.0					5																	26988397		2203	4300	6503	SO:0001583	missense	0			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.44T>A	5.37:g.26988397A>T	ENSP00000231021:p.Met15Lys		Q3B7I5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.M15K	ENST00000231021.4	37	c.44	CCDS3893.1	5	.	.	.	.	.	.	.	.	.	.	A	6.297	0.422883	0.11928	.	.	ENSG00000113100	ENST00000231021;ENST00000513289;ENST00000511822	T;T;T	0.56275	0.58;0.47;2.01	5.64	4.48	0.54585	.	0.357740	0.32952	N	0.005446	T	0.36358	0.0964	N	0.22421	0.69	0.09310	N	1	B;B	0.18013	0.025;0.001	B;B	0.20184	0.028;0.007	T	0.18429	-1.0337	9	.	.	.	.	10.4753	0.44661	0.9229:0.0:0.0771:0.0	.	15;15	E7EPN0;Q9ULB4	.;CADH9_HUMAN	K	15	ENSP00000231021:M15K;ENSP00000426239:M15K;ENSP00000422538:M15K	.	M	-	2	0	CDH9	27024154	0.216000	0.23585	0.003000	0.11579	0.070000	0.16714	4.458000	0.60095	0.969000	0.38237	0.482000	0.46254	ATG	CDH9	-	NULL	ENSG00000113100		0.343	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	HGNC	protein_coding	OTTHUMT00000207352.1	-	0.00	56	0	A	NM_016279		26988397	-1	tier1	-	no_errors	ENST00000231021	ensembl	human	known	74_37	missense	43.40	30	23	SNP	0.019	T
CDHR3	222256	genome.wustl.edu	37	7	105621432	105621432	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:105621432G>T	ENST00000317716.9	+	3	348	c.268G>T	c.(268-270)Gaa>Taa	p.E90*	CDHR3_ENST00000343407.5_5'UTR|CDHR3_ENST00000470188.1_3'UTR|CDHR3_ENST00000478080.1_Nonsense_Mutation_p.E2*|CDHR3_ENST00000542731.1_Nonsense_Mutation_p.E90*|CDHR3_ENST00000541203.1_Nonsense_Mutation_p.E90*	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	90	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						CACTGGGATGGAACAACTAGA	0.398																																																	0													70.0	64.0	66.0					7																	105621432		1907	4138	6045	SO:0001587	stop_gained	0			AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.268G>T	7.37:g.105621432G>T	ENSP00000325954:p.Glu90*		Q8TCI7	Nonsense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E90*	ENST00000317716.9	37	c.268	CCDS47684.1	7	.	.	.	.	.	.	.	.	.	.	G	32	5.155803	0.94686	.	.	ENSG00000128536	ENST00000542731;ENST00000317716;ENST00000478080;ENST00000541203	.	.	.	5.02	3.04	0.35103	.	0.245131	0.34484	N	0.003922	.	.	.	.	.	.	0.54753	D	0.999985	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-14.9559	13.1166	0.59303	0.0:0.4998:0.5002:0.0	.	.	.	.	X	90;90;2;90	.	ENSP00000325954:E90X	E	+	1	0	CDHR3	105408668	0.998000	0.40836	0.990000	0.47175	0.698000	0.40448	3.134000	0.50538	1.443000	0.47586	0.561000	0.74099	GAA	CDHR3	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000128536		0.398	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDHR3	HGNC	protein_coding	OTTHUMT00000349025.2	-	0.00	58	0	G	NM_152750		105621432	+1	tier1	-	no_errors	ENST00000317716	ensembl	human	known	74_37	nonsense	9.26	49	5	SNP	0.662	T
CERS4	79603	genome.wustl.edu	37	19	8316045	8316045	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:8316045G>T	ENST00000251363.5	+	3	385	c.85G>T	c.(85-87)Gat>Tat	p.D29Y	CERS4_ENST00000559450.1_Missense_Mutation_p.D29Y|CERS4_ENST00000595722.1_Intron|CERS4_ENST00000559336.1_Missense_Mutation_p.D29Y|CERS4_ENST00000558331.1_5'UTR	NM_024552.2	NP_078828.2	Q9HA82	CERS4_HUMAN	ceramide synthase 4	29					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										AGAAGACCGGGATGGCCGTGT	0.592																																																	0													215.0	216.0	216.0					19																	8316045		2203	4300	6503	SO:0001583	missense	0				CCDS12197.1	19p13.2	2014-09-11	2011-07-08	2011-07-08	ENSG00000090661	ENSG00000090661		"""Homeoboxes / CERS class"""	23747	protein-coding gene	gene with protein product		615334	"""LAG1 longevity assurance homolog 4 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 4"""	LASS4			Standard	NM_024552		Approved	FLJ12089, Trh1	uc002mjg.3	Q9HA82	OTTHUMG00000172570	ENST00000251363.5:c.85G>T	19.37:g.8316045G>T	ENSP00000251363:p.Asp29Tyr		D6W665	Missense_Mutation	SNP	pfam_TLC-dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_TLC-dom,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_TLC-dom,pfscan_Homeobox_dom	p.D29Y	ENST00000251363.5	37	c.85	CCDS12197.1	19	.	.	.	.	.	.	.	.	.	.	G	14.38	2.519062	0.44866	.	.	ENSG00000090661	ENST00000251363	T	0.69561	-0.41	4.22	3.18	0.36537	.	0.577339	0.17511	N	0.171637	T	0.79522	0.4460	M	0.87097	2.86	0.45284	D	0.99828	D;D	0.71674	0.972;0.998	P;P	0.61201	0.784;0.885	T	0.79184	-0.1908	10	0.72032	D	0.01	-12.131	7.9794	0.30175	0.118:0.0:0.882:0.0	.	29;29	Q53HF9;Q9HA82	.;CERS4_HUMAN	Y	29	ENSP00000251363:D29Y	ENSP00000251363:D29Y	D	+	1	0	CERS4	8222045	1.000000	0.71417	0.504000	0.27639	0.120000	0.20174	3.852000	0.55934	0.780000	0.33566	0.460000	0.39030	GAT	CERS4	-	pirsf_Longevity_assurance_LAG1_LAC1	ENSG00000090661		0.592	CERS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CERS4	HGNC	protein_coding	OTTHUMT00000419200.1	-	0.00	47	0	G	NM_024552		8316045	+1	tier1	-	no_errors	ENST00000251363	ensembl	human	known	74_37	missense	23.33	23	7	SNP	0.982	T
CHM	1121	genome.wustl.edu	37	X	85218945	85218945	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:85218945C>A	ENST00000357749.2	-	5	456	c.427G>T	c.(427-429)Gat>Tat	p.D143Y	CHM_ENST00000467744.2_Intron|CHM_ENST00000537751.1_5'UTR	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)	143					blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				AATGACTCATCCTCCGTAGGC	0.473																																																	0													105.0	89.0	94.0					X																	85218945		2203	4300	6503	SO:0001583	missense	0			X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.427G>T	X.37:g.85218945C>A	ENSP00000350386:p.Asp143Tyr		A1L4D2|O43732	Missense_Mutation	SNP	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.D143Y	ENST00000357749.2	37	c.427	CCDS14454.1	X	.	.	.	.	.	.	.	.	.	.	C	7.455	0.643477	0.14451	.	.	ENSG00000188419	ENST00000357749	T	0.58652	0.32	4.72	3.86	0.44501	.	0.746362	0.12484	N	0.464829	T	0.48642	0.1511	L	0.44542	1.39	0.20074	N	0.999935	P	0.38148	0.62	B	0.37508	0.252	T	0.42666	-0.9438	10	0.66056	D	0.02	-2.1346	7.574	0.27924	0.162:0.7488:0.0:0.0892	.	143	P24386	RAE1_HUMAN	Y	143	ENSP00000350386:D143Y	ENSP00000350386:D143Y	D	-	1	0	CHM	85105601	0.003000	0.15002	0.006000	0.13384	0.287000	0.27160	0.616000	0.24344	0.914000	0.36822	0.284000	0.19432	GAT	CHM	-	pirsf_Rab_geranylTrfase_A_euk	ENSG00000188419		0.473	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHM	HGNC	protein_coding	OTTHUMT00000057396.3	-	0.00	30	0	C	NM_000390		85218945	-1	tier1	-	no_errors	ENST00000357749	ensembl	human	known	74_37	missense	56.67	13	17	SNP	0.004	A
CHST1	8534	genome.wustl.edu	37	11	45671280	45671280	+	Silent	SNP	C	C	T	rs549323787	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:45671280C>T	ENST00000308064.2	-	4	1864	c.1194G>A	c.(1192-1194)tcG>tcA	p.S398S	RP11-495O11.1_ENST00000525563.1_RNA|CHST1_ENST00000533673.1_5'Flank	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	398					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		CCAGGCTGACCGAGGGGTTCT	0.662													C|||	8	0.00159744	0.0	0.0	5008	,	,		14335	0.0		0.0	False		,,,				2504	0.0082																0													41.0	46.0	44.0					11																	45671280		2203	4295	6498	SO:0001819	synonymous_variant	0			U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.1194G>A	11.37:g.45671280C>T			D3DQP2	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	p.S398	ENST00000308064.2	37	c.1194	CCDS7913.1	11																																																																																			CHST1	-	pirsf_Carbohydrate_sulfotransferase	ENSG00000175264		0.662	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST1	HGNC	protein_coding	OTTHUMT00000390127.1	-	0.00	82	0	C	NM_003654		45671280	-1	tier1	-	no_errors	ENST00000308064	ensembl	human	known	74_37	silent	29.11	56	23	SNP	0.316	T
CMYA5	202333	genome.wustl.edu	37	5	79024983	79024983	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:79024983G>A	ENST00000446378.2	+	2	426	c.395G>A	c.(394-396)cGg>cAg	p.R132Q		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	132					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		AAAAAGGTTCGGAAAAGGACT	0.408																																																	0													133.0	130.0	131.0					5																	79024983		1857	4097	5954	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.395G>A	5.37:g.79024983G>A	ENSP00000394770:p.Arg132Gln		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.R132Q	ENST00000446378.2	37	c.395	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705355	0.48412	.	.	ENSG00000164309	ENST00000446378	T	0.57107	0.42	5.37	3.57	0.40892	.	0.470309	0.18113	N	0.151298	T	0.34687	0.0906	L	0.36672	1.1	0.23107	N	0.998284	P	0.52577	0.954	B	0.35899	0.213	T	0.32981	-0.9886	10	0.87932	D	0	.	5.7546	0.18166	0.222:0.143:0.6351:0.0	.	132	Q8N3K9	CMYA5_HUMAN	Q	132	ENSP00000394770:R132Q	ENSP00000394770:R132Q	R	+	2	0	CMYA5	79060739	0.991000	0.36638	0.690000	0.30148	0.895000	0.52256	2.194000	0.42668	0.620000	0.30215	-0.176000	0.13171	CGG	CMYA5	-	NULL	ENSG00000164309		0.408	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	-	0.00	32	0	G	NM_153610		79024983	+1	tier1	-	no_errors	ENST00000446378	ensembl	human	known	74_37	missense	29.17	17	7	SNP	0.994	A
CNOT4	4850	genome.wustl.edu	37	7	135069431	135069431	+	IGR	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:135069431C>A	ENST00000315544.5	-	0	4631				CNOT4_ENST00000541284.1_Intron|CNOT4_ENST00000414802.1_Missense_Mutation_p.R433I|CNOT4_ENST00000451834.1_Intron|CNOT4_ENST00000356162.4_Missense_Mutation_p.R433I|CNOT4_ENST00000473470.1_Intron|CNOT4_ENST00000361528.4_Intron|CNOT4_ENST00000423368.2_Intron	NM_001190848.1	NP_001177777.1	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4						gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|protein autoubiquitination (GO:0051865)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	22						atgagcctatcttctcttcag	0.448																																					Ovarian(51;766 1130 5502 35047 50875)												0													55.0	54.0	54.0					7																	135069431		876	1991	2867	SO:0001628	intergenic_variant	0			AF180475	CCDS43650.1, CCDS47719.1, CCDS55164.1, CCDS55165.1, CCDS55166.1, CCDS55167.1	7q33	2013-09-19			ENSG00000080802	ENSG00000080802		"""RNA binding motif (RRM) containing"""	7880	protein-coding gene	gene with protein product		604911		NOT4		10637334	Standard	NM_013316		Approved	CLONE243, NOT4H	uc011kpy.2	O95628	OTTHUMG00000155568		7.37:g.135069431C>A			B7Z6I4|E7ET38|F8VQP3|O95339|O95627|Q8IYM7|Q8NCL0|Q9NPQ1|Q9NZN6	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom_euk,pfscan_Znf_RING,pfscan_RRM_dom	p.R433I	ENST00000315544.5	37	c.1298	CCDS55166.1	7	.	.	.	.	.	.	.	.	.	.	C	12.80	2.047424	0.36085	.	.	ENSG00000080802	ENST00000414802;ENST00000356162	T;T	0.43688	0.94;0.94	2.94	2.94	0.34122	.	.	.	.	.	T	0.50701	0.1631	.	.	.	0.36573	D	0.873108	.	.	.	.	.	.	T	0.62263	-0.6891	6	0.87932	D	0	.	9.5804	0.39484	0.0:1.0:0.0:0.0	.	.	.	.	I	433	ENSP00000416532:R433I;ENSP00000348485:R433I	ENSP00000348485:R433I	R	-	2	0	CNOT4	134719971	0.000000	0.05858	0.084000	0.20598	0.015000	0.08874	-0.028000	0.12350	1.959000	0.56917	0.563000	0.77884	AGA	CNOT4	-	NULL	ENSG00000080802		0.448	CNOT4-201	KNOWN	basic|CCDS	protein_coding	CNOT4	HGNC	protein_coding		-	0.00	111	0	C	NM_013316		135069431	-1	tier1	-	no_errors	ENST00000356162	ensembl	human	known	74_37	missense	11.20	111	14	SNP	0.098	A
COL6A3	1293	genome.wustl.edu	37	2	238232882	238232882	+	3'UTR	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:238232882G>T	ENST00000295550.4	-	0	10521				COL6A3_ENST00000347401.3_3'UTR|COL6A3_ENST00000353578.4_3'UTR|COL6A3_ENST00000473258.1_5'UTR|COL6A3_ENST00000472056.1_3'UTR	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TTCTGAACTAGATCATTTGTT	0.363																																																	0																																										SO:0001624	3_prime_UTR_variant	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.*535C>A	2.37:g.238232882G>T			A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	RNA	SNP	-	NULL	ENST00000295550.4	37	NULL	CCDS33412.1	2																																																																																			COL6A3	-	-	ENSG00000163359		0.363	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	-	0.00	39	0	G	NM_004369		238232882	-1	tier1	-	no_errors	ENST00000473258	ensembl	human	known	74_37	rna	25.81	22	8	SNP	0.001	T
COL7A1	1294	genome.wustl.edu	37	3	48607184	48607184	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:48607184C>A	ENST00000328333.8	-	100	7638	c.7531G>T	c.(7531-7533)Ggg>Tgg	p.G2511W	COL7A1_ENST00000454817.1_Missense_Mutation_p.G2479W	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2511	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CCTGCACTCCCAACATCACCC	0.597																																																	0													69.0	68.0	68.0					3																	48607184		2203	4300	6503	SO:0001583	missense	0			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.7531G>T	3.37:g.48607184C>A	ENSP00000332371:p.Gly2511Trp		Q14054|Q16507	Missense_Mutation	SNP	pfam_Collagen,pfam_Fibronectin_type3,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.G2511W	ENST00000328333.8	37	c.7531	CCDS2773.1	3	.	.	.	.	.	.	.	.	.	.	C	12.15	1.852231	0.32699	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.99637	-6.29;-6.29	5.36	5.36	0.76844	.	0.000000	0.45361	D	0.000367	D	0.99846	0.9929	H	0.99573	4.635	0.41127	D	0.985859	D	0.89917	1.0	D	0.97110	1.0	D	0.96485	0.9359	10	0.87932	D	0	.	16.8772	0.86055	0.0:1.0:0.0:0.0	.	2511	Q02388	CO7A1_HUMAN	W	2511;2479	ENSP00000332371:G2511W;ENSP00000412569:G2479W	ENSP00000332371:G2511W	G	-	1	0	COL7A1	48582188	0.970000	0.33590	0.391000	0.26233	0.012000	0.07955	4.953000	0.63624	2.515000	0.84797	0.591000	0.81541	GGG	COL7A1	-	pfam_Collagen	ENSG00000114270		0.597	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	HGNC	protein_coding	OTTHUMT00000257519.1	-	0.00	29	0	C	NM_000094		48607184	-1	tier1	-	no_errors	ENST00000328333	ensembl	human	known	74_37	missense	19.23	21	5	SNP	0.750	A
COL8A1	1295	genome.wustl.edu	37	3	99514427	99514427	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:99514427C>A	ENST00000261037.3	+	5	2062	c.1682C>A	c.(1681-1683)cCc>cAc	p.P561H	COL8A1_ENST00000273342.4_Missense_Mutation_p.P561H	NM_001850.4	NP_001841.2	P27658	CO8A1_HUMAN	collagen, type VIII, alpha 1	561	Triple-helical region (COL1).				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen type VIII trimer (GO:0005591)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(15)|skin(5)|upper_aerodigestive_tract(1)	27						CTTccaggacccccaggccct	0.647																																																	0													24.0	28.0	26.0					3																	99514427		2203	4299	6502	SO:0001583	missense	0			AF170702	CCDS2934.1	3q11.1-q13.2	2013-01-16			ENSG00000144810	ENSG00000144810		"""Collagens"""	2215	protein-coding gene	gene with protein product		120251	"""chromosome 3 open reading frame 7"""	C3orf7		2029894	Standard	NM_001850		Approved	MGC9568	uc003dth.2	P27658	OTTHUMG00000148669	ENST00000261037.3:c.1682C>A	3.37:g.99514427C>A	ENSP00000261037:p.Pro561His		D3DN42|Q53XI6|Q96D07	Missense_Mutation	SNP	pfam_Collagen,pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.P561H	ENST00000261037.3	37	c.1682	CCDS2934.1	3	.	.	.	.	.	.	.	.	.	.	C	10.49	1.366123	0.24684	.	.	ENSG00000144810	ENST00000261037;ENST00000273342	D;D	0.95001	-3.58;-3.58	5.68	4.81	0.61882	.	0.168587	0.53938	D	0.000053	D	0.97213	0.9089	M	0.91818	3.245	0.58432	D	0.999994	D;D	0.67145	0.996;0.996	D;D	0.65323	0.934;0.934	D	0.96824	0.9606	10	0.38643	T	0.18	.	12.2022	0.54333	0.0:0.9174:0.0:0.0826	.	562;561	E7EPK9;P27658	.;CO8A1_HUMAN	H	561	ENSP00000261037:P561H;ENSP00000273342:P561H	ENSP00000261037:P561H	P	+	2	0	COL8A1	100997117	0.800000	0.28916	1.000000	0.80357	0.986000	0.74619	1.953000	0.40352	1.412000	0.46977	0.563000	0.77884	CCC	COL8A1	-	pfam_Collagen	ENSG00000144810		0.647	COL8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL8A1	HGNC	protein_coding	OTTHUMT00000309001.1	-	0.00	43	0	C	NM_001850		99514427	+1	tier1	-	no_errors	ENST00000261037	ensembl	human	known	74_37	missense	21.88	25	7	SNP	1.000	A
CPA5	93979	genome.wustl.edu	37	7	129989932	129989932	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:129989932C>A	ENST00000485477.1	+	4	1444	c.315C>A	c.(313-315)atC>atA	p.I105I	CPA5_ENST00000393213.3_Silent_p.I105I|CPA5_ENST00000474905.1_Silent_p.I105I|CPA5_ENST00000431780.2_Silent_p.I105I|CPA5_ENST00000355388.3_Silent_p.I105I|CPA5_ENST00000466363.2_Silent_p.I105I|CPA5_ENST00000461828.1_Silent_p.I105I			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	105						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					CTTACAGCATCATGATAAAGG	0.552																																																	0													106.0	103.0	104.0					7																	129989932		2203	4300	6503	SO:0001819	synonymous_variant	0			AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.315C>A	7.37:g.129989932C>A			G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Silent	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.I105	ENST00000485477.1	37	c.315	CCDS5819.1	7																																																																																			CPA5	-	pfam_Prot_inh_M14A,superfamily_Prot_inh_propept	ENSG00000158525		0.552	CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA5	HGNC	protein_coding	OTTHUMT00000349712.1		0.00	40	0	C	NM_001127441		129989932	+1			no_errors	ENST00000355388	ensembl	human	known	74_37	silent	15.79	32	6	SNP	0.981	A
CPNE6	9362	genome.wustl.edu	37	14	24542190	24542190	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr14:24542190G>A	ENST00000397016.2	+	3	356	c.45G>A	c.(43-45)atG>atA	p.M15I	CPNE6_ENST00000537691.1_Missense_Mutation_p.M70I|CPNE6_ENST00000216775.2_Missense_Mutation_p.M15I|CPNE6_ENST00000560092.1_Intron	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	15					lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		CCCCAACCATGACGCTGGGGG	0.652																																																	0													35.0	31.0	32.0					14																	24542190		2203	4300	6503	SO:0001583	missense	0			AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.45G>A	14.37:g.24542190G>A	ENSP00000380211:p.Met15Ile		B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Missense_Mutation	SNP	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom,pfscan_VWF_A	p.M70I	ENST00000397016.2	37	c.210	CCDS9607.1	14	.	.	.	.	.	.	.	.	.	.	G	12.31	1.898865	0.33535	.	.	ENSG00000100884	ENST00000537691;ENST00000397016;ENST00000216775	T;T;T	0.06371	3.31;3.33;3.33	4.58	4.58	0.56647	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.56097	D	0.000033	T	0.03390	0.0098	N	0.02539	-0.55	0.36890	D	0.889848	B;B	0.31859	0.343;0.066	B;B	0.34452	0.183;0.006	T	0.53322	-0.8455	10	0.45353	T	0.12	-7.4304	13.0802	0.59109	0.0:0.0:1.0:0.0	.	70;15	F5GXN1;O95741	.;CPNE6_HUMAN	I	70;15;15	ENSP00000440077:M70I;ENSP00000380211:M15I;ENSP00000216775:M15I	ENSP00000216775:M15I	M	+	3	0	CPNE6	23612030	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.404000	0.44539	2.543000	0.85770	0.563000	0.77884	ATG	CPNE6	-	superfamily_C2_dom	ENSG00000100884		0.652	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE6	HGNC	protein_coding	OTTHUMT00000071869.5	-	0.00	66	0	G			24542190	+1	tier1	-	no_errors	ENST00000537691	ensembl	human	known	74_37	missense	9.68	56	6	SNP	1.000	A
CPNE8	144402	genome.wustl.edu	37	12	39155952	39155952	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:39155952C>T	ENST00000331366.5	-	9	738	c.642G>A	c.(640-642)aaG>aaA	p.K214K	CPNE8_ENST00000360449.3_Silent_p.K202K	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII	214	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)		p.K214N(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				TGACTGAGATCTTGAATGCTT	0.308																																																	1	Substitution - Missense(1)	large_intestine(1)											114.0	107.0	109.0					12																	39155952		2203	4299	6502	SO:0001819	synonymous_variant	0			AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.642G>A	12.37:g.39155952C>T			Q2TB41|Q86VY2	Silent	SNP	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom,pfscan_VWF_A	p.K214	ENST00000331366.5	37	c.642	CCDS8733.1	12																																																																																			CPNE8	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000139117		0.308	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE8	HGNC	protein_coding	OTTHUMT00000403856.1		0.00	59	0	C	NM_153634		39155952	-1			no_errors	ENST00000331366	ensembl	human	known	74_37	silent	5.00	38	2	SNP	1.000	T
CSNK1A1L	122011	genome.wustl.edu	37	13	37679185	37679185	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr13:37679185C>A	ENST00000379800.3	-	1	618	c.209G>T	c.(208-210)gGg>gTg	p.G70V		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	70	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell morphogenesis (GO:0000902)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		GATGCCAACCCCACCTTGAAG	0.512																																																	0													141.0	122.0	129.0					13																	37679185		2203	4300	6503	SO:0001583	missense	0			BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138			20289	protein-coding gene	gene with protein product							Standard	NM_145203		Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.209G>T	13.37:g.37679185C>A	ENSP00000369126:p.Gly70Val		Q5T2N2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G70V	ENST00000379800.3	37	c.209	CCDS9363.1	13	.	.	.	.	.	.	.	.	.	.	C	10.47	1.357911	0.24598	.	.	ENSG00000180138	ENST00000379800	T	0.19250	2.16	0.778	0.778	0.18543	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.42200	0.1192	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.37663	-0.9696	10	0.87932	D	0	.	7.3576	0.26727	0.0:1.0:0.0:0.0	.	70	Q8N752	KC1AL_HUMAN	V	70	ENSP00000369126:G70V	ENSP00000369126:G70V	G	-	2	0	CSNK1A1L	36577185	1.000000	0.71417	0.342000	0.25602	0.093000	0.18481	5.293000	0.65680	0.686000	0.31488	0.561000	0.74099	GGG	CSNK1A1L	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000180138		0.512	CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSNK1A1L	HGNC	protein_coding	OTTHUMT00000044563.1	-	0.00	96	0	C	NM_145203		37679185	-1	tier1	-	no_errors	ENST00000379800	ensembl	human	known	74_37	missense	36.67	57	33	SNP	1.000	A
CXCR2	3579	genome.wustl.edu	37	2	218999903	218999903	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:218999903G>T	ENST00000318507.2	+	3	806	c.379G>T	c.(379-381)Gaa>Taa	p.E127*		NM_001557.3	NP_001548.1	P25025	CXCR2_HUMAN	chemokine (C-X-C motif) receptor 2	127					cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(11)|skin(1)|stomach(1)	22						ACTCCTGAAGGAAGTCAACTT	0.552																																																	0													125.0	112.0	117.0					2																	218999903		2203	4300	6503	SO:0001587	stop_gained	0			U11869	CCDS2408.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000180871	ENSG00000180871		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6027	protein-coding gene	gene with protein product		146928	"""interleukin 8 receptor, beta"""	IL8RB		1427896	Standard	NM_001557		Approved	CMKAR2, CD182	uc002vha.2	P25025	OTTHUMG00000133107	ENST00000318507.2:c.379G>T	2.37:g.218999903G>T	ENSP00000319635:p.Glu127*		Q8IUZ1|Q9P2T6|Q9P2T7	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR_1/2,prints_GPCR_Rhodpsn,prints_Chemokine_CXCR2,prints_Chemokine_rcpt,prints_Chemokine_CXCR4	p.E127*	ENST00000318507.2	37	c.379	CCDS2408.1	2	.	.	.	.	.	.	.	.	.	.	G	37	6.322515	0.97471	.	.	ENSG00000180871	ENST00000453237;ENST00000415392;ENST00000318507;ENST00000454148;ENST00000428565	.	.	.	4.91	4.91	0.64330	.	0.055157	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	10.9231	0.47176	0.089:0.0:0.911:0.0	.	.	.	.	X	127	.	ENSP00000319635:E127X	E	+	1	0	CXCR2	218708148	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.207000	0.72159	2.448000	0.82819	0.456000	0.33151	GAA	CXCR2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR_1/2,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt	ENSG00000180871		0.552	CXCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCR2	HGNC	protein_coding	OTTHUMT00000256772.2	-	0.00	94	0	G	NM_001557		218999903	+1	tier1	-	no_errors	ENST00000318507	ensembl	human	known	74_37	nonsense	35.29	44	24	SNP	0.998	T
CYP4F29P	54055	genome.wustl.edu	37	21	15218392	15218392	+	RNA	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr21:15218392C>A	ENST00000428301.1	-	0	536					NR_026755.1|NR_047508.1				cytochrome P450, family 4, subfamily F, polypeptide 29, pseudogene																		cctgcctgatctgcaagtgtc	0.542																																																	0																																												0					21q11	2011-07-29	2011-07-29	2011-07-29	ENSG00000228314	ENSG00000228314		"""Cytochrome P450s"""	2647	pseudogene	pseudogene			"""cytochrome P450, subfamily IVF, polypeptide 3-like pseudogene"", ""chromosome 21 open reading frame 15"", ""cytochrome P450, family 4, subfamily F, polypeptide 3-like pseudogene"""	C21orf15, CYP4F3LP			Standard	NR_026755		Approved	CYP4F-se4[6:7:8]			OTTHUMG00000074229		21.37:g.15218392C>A				RNA	SNP	-	NULL	ENST00000428301.1	37	NULL		21																																																																																			CYP4F29P	-	-	ENSG00000228314		0.542	CYP4F29P-003	KNOWN	basic	processed_transcript	CYP4F29P	HGNC	pseudogene	OTTHUMT00000157746.1	-	0.00	73	0	C	NG_000927		15218392	-1	tier1	-	no_errors	ENST00000428301	ensembl	human	known	74_37	rna	25.00	45	15	SNP	0.053	A
YY1AP1	55249	genome.wustl.edu	37	1	155657818	155657818	+	Intron	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:155657818G>T	ENST00000295566.4	-	2	202				YY1AP1_ENST00000361831.5_Intron|YY1AP1_ENST00000405763.3_Intron|DAP3_ENST00000471642.2_5'UTR|DAP3_ENST00000368336.5_5'Flank|YY1AP1_ENST00000311573.5_Intron|DAP3_ENST00000465375.1_5'Flank|DAP3_ENST00000421487.2_5'Flank|YY1AP1_ENST00000347088.5_Intron|DAP3_ENST00000535183.1_5'Flank|YY1AP1_ENST00000368340.5_Intron|MSTO1_ENST00000538143.1_Intron|MSTO1_ENST00000452804.2_Intron|YY1AP1_ENST00000407221.1_Intron|YY1AP1_ENST00000438245.2_Intron|YY1AP1_ENST00000368330.2_Intron|YY1AP1_ENST00000368339.5_Intron|YY1AP1_ENST00000355499.4_Intron|YY1AP1_ENST00000404643.1_Intron|YY1AP1_ENST00000476093.1_Intron|YY1AP1_ENST00000359205.5_Intron|DAP3_ENST00000343043.3_5'Flank	NM_001198906.1|NM_139118.2	NP_001185835.1|NP_620829.1	Q9H869	YYAP1_HUMAN	YY1 associated protein 1						regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(7)|ovary(2)|skin(2)|urinary_tract(2)	31	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					CAATCGCTGAGAGAGTGCTTA	0.612																																																	0													23.0	27.0	26.0					1																	155657818		2202	4295	6497	SO:0001627	intron_variant	0			BC008766	CCDS1115.1, CCDS1116.1, CCDS55643.1, CCDS55644.1, CCDS55645.1	1q22	2009-05-07			ENSG00000163374	ENSG00000163374			30935	protein-coding gene	gene with protein product		607860				11710830	Standard	NM_139119		Approved	YY1AP, HCCA2, YAP		Q9H869	OTTHUMG00000035437	ENST00000295566.4:c.178+43C>A	1.37:g.155657818G>T			B0QZ54|B4DMP2|B4E0I0|D3DV96|D3DV98|H7BY62|Q5VYZ1|Q5VYZ4|Q5VYZ7|Q7L4C3|Q7L5E2|Q8IXA6|Q8TEW5|Q8TF04|Q96HB6|Q9BQ64|Q9NV84	RNA	SNP	-	NULL	ENST00000295566.4	37	NULL	CCDS1115.1	1																																																																																			DAP3	-	-	ENSG00000132676		0.612	YY1AP1-043	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	DAP3	HGNC	protein_coding	OTTHUMT00000086027.1	-	0.00	58	0	G	NM_139118		155657818	+1	tier1	-	no_errors	ENST00000461479	ensembl	human	known	74_37	rna	8.70	42	4	SNP	0.001	T
DCBLD2	131566	genome.wustl.edu	37	3	98568374	98568374	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:98568374G>T	ENST00000326840.6	-	3	864	c.502C>A	c.(502-504)Ctg>Atg	p.L168M	DCBLD2_ENST00000326857.9_Missense_Mutation_p.L168M|DCBLD2_ENST00000469648.1_5'UTR	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	168	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						CTCATGAACAGCAATGTGATT	0.383																																																	0													124.0	117.0	119.0					3																	98568374		1882	4104	5986	SO:0001583	missense	0				CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.502C>A	3.37:g.98568374G>T	ENSP00000321573:p.Leu168Met		B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_CUB_dom,pfam_LCCL,superfamily_Galactose-bd-like,superfamily_CUB_dom,superfamily_LCCL,smart_CUB_dom,smart_LCCL,smart_Coagulation_fac_5/8-C_type_dom,pfscan_CUB_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_LCCL	p.L168M	ENST00000326840.6	37	c.502	CCDS46878.1	3	.	.	.	.	.	.	.	.	.	.	G	22.9	4.355319	0.82243	.	.	ENSG00000057019	ENST00000326840;ENST00000404023;ENST00000326857;ENST00000449482	T;T;T	0.35973	1.28;1.28;1.28	5.62	5.62	0.85841	CUB (5);	0.200441	0.44285	D	0.000464	T	0.51584	0.1683	L	0.50919	1.6	0.32644	N	0.520353	D;D	0.67145	0.996;0.986	P;P	0.59424	0.8;0.857	T	0.60875	-0.7176	10	0.59425	D	0.04	-11.913	17.1542	0.86785	0.0:0.0:1.0:0.0	.	168;168	Q96PD2-2;Q96PD2	.;DCBD2_HUMAN	M	168;122;168;62	ENSP00000321573:L168M;ENSP00000321646:L168M;ENSP00000396803:L62M	ENSP00000321573:L168M	L	-	1	2	DCBLD2	100051064	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.570000	0.73996	2.648000	0.89879	0.655000	0.94253	CTG	DCBLD2	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000057019		0.383	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCBLD2	HGNC	protein_coding	OTTHUMT00000324675.2	-	0.00	52	0	G	NM_080927		98568374	-1	tier1	-	no_errors	ENST00000326857	ensembl	human	known	74_37	missense	35.90	25	14	SNP	1.000	T
DDX28	55794	genome.wustl.edu	37	16	68055808	68055808	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:68055808G>T	ENST00000332395.5	-	1	1962	c.1298C>A	c.(1297-1299)gCc>gAc	p.A433D	DUS2_ENST00000358896.6_5'Flank|DUS2_ENST00000565263.1_5'Flank|DUS2_ENST00000432752.1_5'Flank	NM_018380.3	NP_060850.2	Q9NUL7	DDX28_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 28	433	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	13		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0116)|Epithelial(162;0.0474)|all cancers(182;0.233)		CCTCATCAAGGCTGGCATTTG	0.517																																																	0													101.0	94.0	96.0					16																	68055808		2198	4300	6498	SO:0001583	missense	0			AF329821	CCDS10858.1	16q22.1-q22.3	2008-02-05	2003-06-13		ENSG00000182810	ENSG00000182810		"""DEAD-boxes"""	17330	protein-coding gene	gene with protein product		607618	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 28"""			10493829, 11350955	Standard	NM_018380		Approved	MDDX28, FLJ11282	uc002evh.2	Q9NUL7	OTTHUMG00000137549	ENST00000332395.5:c.1298C>A	16.37:g.68055808G>T	ENSP00000332340:p.Ala433Asp			Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.A433D	ENST00000332395.5	37	c.1298	CCDS10858.1	16	.	.	.	.	.	.	.	.	.	.	G	21.9	4.215337	0.79352	.	.	ENSG00000182810	ENST00000332395	T	0.76186	-1.0	5.66	5.66	0.87406	Helicase, C-terminal (3);	0.054874	0.64402	D	0.000001	T	0.78710	0.4326	N	0.25201	0.72	0.58432	D	0.999999	D	0.63046	0.992	D	0.65140	0.932	T	0.80736	-0.1249	10	0.62326	D	0.03	-15.6995	19.3607	0.94436	0.0:0.0:1.0:0.0	.	433	Q9NUL7	DDX28_HUMAN	D	433	ENSP00000332340:A433D	ENSP00000332340:A433D	A	-	2	0	DDX28	66613309	1.000000	0.71417	0.997000	0.53966	0.620000	0.37586	7.438000	0.80431	2.675000	0.91044	0.557000	0.71058	GCC	DDX28	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	ENSG00000182810		0.517	DDX28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX28	HGNC	protein_coding	OTTHUMT00000268883.1		0.00	46	0	G	NM_018380		68055808	-1			no_errors	ENST00000332395	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	T
DEGS2	123099	genome.wustl.edu	37	14	100615693	100615693	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr14:100615693G>A	ENST00000305631.5	-	2	1012	c.437C>T	c.(436-438)aCg>aTg	p.T146M	DEGS2_ENST00000553834.1_Intron|DEGS2_ENST00000557117.1_5'UTR	NM_206918.2	NP_996801.2			delta(4)-desaturase, sphingolipid 2											breast(1)|lung(6)|skin(1)	8		Melanoma(154;0.212)				CTCCAGACGCGTGGGCACGTC	0.672																																																	0													30.0	30.0	30.0					14																	100615693		2202	4297	6499	SO:0001583	missense	0				CCDS9956.1	14q32.2	2013-09-02	2011-12-09	2004-12-14	ENSG00000168350	ENSG00000168350		"""Fatty acid desaturases"""	20113	protein-coding gene	gene with protein product	"""sphingolipid delta(4)-desaturase 2"", ""dihydroceramide desaturase 2"""	610862	"""chromosome 14 open reading frame 66"", ""degenerative spermatocyte homolog 2, lipid desaturase (Drosophila)"""	C14orf66			Standard	NM_206918		Approved	DES2, FADS8	uc001ygx.2	Q6QHC5	OTTHUMG00000171537	ENST00000305631.5:c.437C>T	14.37:g.100615693G>A	ENSP00000307126:p.Thr146Met			Missense_Mutation	SNP	pfam_Fatty_acid_desaturase-1,pfam_Sphingolipid_d4-desaturase_N,pirsf_Sphingolipid_d4-desaturase	p.T146M	ENST00000305631.5	37	c.437	CCDS9956.1	14	.	.	.	.	.	.	.	.	.	.	G	21.7	4.191458	0.78902	.	.	ENSG00000168350	ENST00000305631	T	0.17854	2.25	4.4	4.4	0.53042	Fatty acid desaturase, type 1 (1);	0.049683	0.85682	N	0.000000	T	0.49541	0.1563	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61744	-0.7000	10	0.66056	D	0.02	-31.8525	17.3127	0.87214	0.0:0.0:1.0:0.0	.	146	Q6QHC5	DEGS2_HUMAN	M	146	ENSP00000307126:T146M	ENSP00000307126:T146M	T	-	2	0	DEGS2	99685446	1.000000	0.71417	0.960000	0.40013	0.776000	0.43924	9.748000	0.98867	2.154000	0.67381	0.561000	0.74099	ACG	DEGS2	-	pfam_Fatty_acid_desaturase-1,pirsf_Sphingolipid_d4-desaturase	ENSG00000168350		0.672	DEGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEGS2	HGNC	protein_coding	OTTHUMT00000414003.1	-	0.00	62	0	G	NM_206918		100615693	-1	tier1	-	no_errors	ENST00000305631	ensembl	human	known	74_37	missense	41.86	25	18	SNP	1.000	A
DENND4B	9909	genome.wustl.edu	37	1	153905496	153905496	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:153905496G>T	ENST00000361217.4	-	22	3882	c.3464C>A	c.(3463-3465)tCc>tAc	p.S1155Y	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	1155	Ser-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGAGCAGCTGGACAGCAGAAT	0.617																																																	0													60.0	62.0	61.0					1																	153905496		2130	4236	6366	SO:0001583	missense	0			AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.3464C>A	1.37:g.153905496G>T	ENSP00000354597:p.Ser1155Tyr		Q5T4K0	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.S1155Y	ENST00000361217.4	37	c.3464	CCDS44228.1	1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.413228	0.83449	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.15017	2.47;2.46	5.07	5.07	0.68467	.	0.053609	0.85682	D	0.000000	T	0.31918	0.0812	M	0.66297	2.02	0.58432	D	0.999991	D	0.69078	0.997	D	0.65573	0.936	T	0.04103	-1.0977	10	0.87932	D	0	-22.816	17.3786	0.87399	0.0:0.0:1.0:0.0	.	1155	O75064	DEN4B_HUMAN	Y	1155;1166	ENSP00000354597:S1155Y;ENSP00000357635:S1166Y	ENSP00000354597:S1155Y	S	-	2	0	DENND4B	152172120	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	9.268000	0.95675	2.639000	0.89480	0.455000	0.32223	TCC	DENND4B	-	NULL	ENSG00000198837		0.617	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4B	HGNC	protein_coding	OTTHUMT00000090278.2	-	0.00	38	0	G	XM_375806		153905496	-1	tier1	-	no_errors	ENST00000361217	ensembl	human	known	74_37	missense	24.24	25	8	SNP	1.000	T
DENND5A	23258	genome.wustl.edu	37	11	9202321	9202321	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:9202321A>G	ENST00000328194.3	-	6	1768	c.1448T>C	c.(1447-1449)cTg>cCg	p.L483P	DENND5A_ENST00000530044.1_Missense_Mutation_p.L483P|DENND5A_ENST00000526523.1_5'Flank	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	483					positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TACCTTTTCCAGGCTCACCCC	0.498																																																	0													123.0	129.0	127.0					11																	9202321		2201	4296	6497	SO:0001583	missense	0			AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.1448T>C	11.37:g.9202321A>G	ENSP00000328524:p.Leu483Pro		B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Missense_Mutation	SNP	pfam_DENN_dom,pfam_Run,pfam_uDENN_dom,pfam_dDENN_dom,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_Run,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_PLAT/LH2_dom,pfscan_Run	p.L483P	ENST00000328194.3	37	c.1448	CCDS31423.1	11	.	.	.	.	.	.	.	.	.	.	A	20.2	3.943858	0.73672	.	.	ENSG00000184014	ENST00000328194;ENST00000530044	T;T	0.53423	0.62;0.62	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000001	T	0.55337	0.1914	L	0.51422	1.61	0.80722	D	1	P;P	0.50819	0.828;0.939	B;P	0.52598	0.37;0.703	T	0.59322	-0.7476	10	0.66056	D	0.02	-8.7017	15.3602	0.74469	1.0:0.0:0.0:0.0	.	483;483	E9PS91;Q6IQ26	.;DEN5A_HUMAN	P	483	ENSP00000328524:L483P;ENSP00000435866:L483P	ENSP00000328524:L483P	L	-	2	0	DENND5A	9158897	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	8.910000	0.92685	2.083000	0.62718	0.455000	0.32223	CTG	DENND5A	-	NULL	ENSG00000184014		0.498	DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND5A	HGNC	protein_coding	OTTHUMT00000385910.2		0.00	51	0	A	NM_015213		9202321	-1			no_errors	ENST00000328194	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	G
DFNA5	1687	genome.wustl.edu	37	7	24749999	24749999	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:24749999G>T	ENST00000342947.3	-	6	1131	c.706C>A	c.(706-708)Ctt>Att	p.L236I	DFNA5_ENST00000419307.1_Missense_Mutation_p.L72I|DFNA5_ENST00000409970.1_Missense_Mutation_p.L72I|DFNA5_ENST00000545231.1_Missense_Mutation_p.L72I|DFNA5_ENST00000559637.1_5'UTR|DFNA5_ENST00000409775.3_Missense_Mutation_p.L236I	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	236					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						CCTCGGAGAAGGCAGAACTCT	0.502																																					GBM(78;184 1250 20134 20900 23600)												0													81.0	80.0	80.0					7																	24749999		2203	4300	6503	SO:0001583	missense	0			AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.706C>A	7.37:g.24749999G>T	ENSP00000339587:p.Leu236Ile		A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Missense_Mutation	SNP	pfam_Gasdermin	p.L236I	ENST00000342947.3	37	c.706	CCDS5389.1	7	.	.	.	.	.	.	.	.	.	.	G	16.75	3.210826	0.58343	.	.	ENSG00000105928	ENST00000342947;ENST00000419307;ENST00000545231;ENST00000409970;ENST00000409775	T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85	5.37	4.29	0.51040	.	0.146710	0.47093	D	0.000255	T	0.39200	0.1069	M	0.75447	2.3	0.45822	D	0.998696	P	0.52692	0.955	P	0.52424	0.698	T	0.13335	-1.0513	10	0.34782	T	0.22	-17.1473	11.9215	0.52795	0.0987:0.0:0.9013:0.0	.	236	O60443	DFNA5_HUMAN	I	236;72;72;72;236	ENSP00000339587:L236I;ENSP00000401332:L72I;ENSP00000442661:L72I;ENSP00000387119:L72I;ENSP00000386670:L236I	ENSP00000339587:L236I	L	-	1	0	DFNA5	24716524	1.000000	0.71417	1.000000	0.80357	0.539000	0.34962	1.961000	0.40432	2.489000	0.83994	0.563000	0.77884	CTT	DFNA5	-	pfam_Gasdermin	ENSG00000105928		0.502	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNA5	HGNC	protein_coding	OTTHUMT00000214060.2	-	0.00	75	0	G	NM_004403		24749999	-1	tier1	-	no_errors	ENST00000342947	ensembl	human	known	74_37	missense	8.22	67	6	SNP	1.000	T
DGKH	160851	genome.wustl.edu	37	13	42773722	42773722	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr13:42773722G>T	ENST00000337343.4	+	19	2327	c.2306G>T	c.(2305-2307)tGt>tTt	p.C769F	DGKH_ENST00000379274.2_Missense_Mutation_p.C633F|DGKH_ENST00000261491.5_Missense_Mutation_p.C769F|DGKH_ENST00000536612.1_Missense_Mutation_p.C633F|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000538674.1_Missense_Mutation_p.C524F|DGKH_ENST00000540693.1_Missense_Mutation_p.C769F	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	769					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		TCAGAAAAATGTGTCATGAAC	0.294																																																	0													35.0	37.0	37.0					13																	42773722		2198	4284	6482	SO:0001583	missense	0			AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.2306G>T	13.37:g.42773722G>T	ENSP00000337572:p.Cys769Phe		A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SAM_type1,superfamily_SAM/pointed,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_SAM,pfscan_Pleckstrin_homology,pfscan_SAM,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.C769F	ENST00000337343.4	37	c.2306	CCDS9381.1	13	.	.	.	.	.	.	.	.	.	.	G	22.9	4.351014	0.82132	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	T;T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05;1.05	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.66636	0.2809	M	0.71581	2.175	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;0.995;0.996	D;D;D;D	0.79784	0.993;0.981;0.964;0.968	T	0.67879	-0.5556	10	0.87932	D	0	.	20.0367	0.97561	0.0:0.0:1.0:0.0	.	524;633;769;769	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	F	769;769;769;633;633;524	ENSP00000440823:C769F;ENSP00000337572:C769F;ENSP00000261491:C769F;ENSP00000368576:C633F;ENSP00000445114:C633F;ENSP00000441308:C524F	ENSP00000261491:C769F	C	+	2	0	DGKH	41671722	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.714000	0.98744	2.727000	0.93392	0.591000	0.81541	TGT	DGKH	-	NULL	ENSG00000102780		0.294	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKH	HGNC	protein_coding	OTTHUMT00000044699.2	-	0.00	68	0	G	NM_178009		42773722	+1	tier1	-	no_errors	ENST00000337343	ensembl	human	known	74_37	missense	22.81	44	13	SNP	1.000	T
DHCR7	1717	genome.wustl.edu	37	11	71146570	71146570	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:71146570G>T	ENST00000355527.3	-	9	1555	c.1279C>A	c.(1279-1281)Ctg>Atg	p.L427M	DHCR7_ENST00000407721.2_Missense_Mutation_p.L427M	NM_001163817.1|NM_001360.2	NP_001157289.1|NP_001351.2	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase	427					blood vessel development (GO:0001568)|cell differentiation (GO:0030154)|cholesterol biosynthetic process (GO:0006695)|lung development (GO:0030324)|multicellular organism growth (GO:0035264)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|regulation of cholesterol biosynthetic process (GO:0045540)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear outer membrane (GO:0005640)	7-dehydrocholesterol reductase activity (GO:0047598)			endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(1)|skin(1)	19						TAGGGCAGCAGGTGGCCGCCG	0.677									Smith-Lemli-Opitz syndrome																																								0													24.0	27.0	26.0					11																	71146570		2200	4291	6491	SO:0001583	missense	0	Familial Cancer Database	SLOS type I & II	AF034544	CCDS8200.1	11q13.4	2014-09-17	2004-02-13				1.3.1.21		2860	protein-coding gene	gene with protein product		602858	"""Smith-Lemli-Opitz syndrome"""	SLOS		9465114, 9634533	Standard	NM_001360		Approved		uc001oql.3	Q9UBM7		ENST00000355527.3:c.1279C>A	11.37:g.71146570G>T	ENSP00000347717:p.Leu427Met		B2R6Z2|O60492|O60717	Missense_Mutation	SNP	pfam_Ergosterol_biosynth_ERG4_ERG24	p.L427M	ENST00000355527.3	37	c.1279	CCDS8200.1	11	.	.	.	.	.	.	.	.	.	.	G	14.36	2.511499	0.44660	.	.	ENSG00000172893	ENST00000407721;ENST00000355527;ENST00000533800	D;D;D	0.98075	-4.7;-4.7;-4.7	5.12	3.11	0.35812	.	0.296620	0.31167	N	0.008123	D	0.96027	0.8706	M	0.84082	2.675	0.43559	D	0.995872	P	0.44946	0.846	B	0.38616	0.277	D	0.93685	0.7002	10	0.39692	T	0.17	-28.126	7.2864	0.26342	0.0915:0.0:0.74:0.1685	.	427	Q9UBM7	DHCR7_HUMAN	M	427;427;177	ENSP00000384739:L427M;ENSP00000347717:L427M;ENSP00000435011:L177M	ENSP00000347717:L427M	L	-	1	2	DHCR7	70824218	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	0.831000	0.27476	1.155000	0.42497	0.561000	0.74099	CTG	DHCR7	-	pfam_Ergosterol_biosynth_ERG4_ERG24	ENSG00000172893		0.677	DHCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHCR7	HGNC	protein_coding	OTTHUMT00000394243.1	-	0.00	78	0	G	NM_001360		71146570	-1	tier1	-	no_errors	ENST00000355527	ensembl	human	known	74_37	missense	27.84	70	27	SNP	0.996	T
DIDO1	11083	genome.wustl.edu	37	20	61522367	61522367	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr20:61522367G>T	ENST00000266070.4	-	15	3811	c.3486C>A	c.(3484-3486)atC>atA	p.I1162I	DIDO1_ENST00000395335.2_Silent_p.I1162I|DIDO1_ENST00000395343.1_Silent_p.I1162I|DIDO1_ENST00000395340.1_Silent_p.I1162I	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1162					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CGCTCAGCGGGATCAGGTAGA	0.572																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												0													104.0	101.0	102.0					20																	61522367		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.3486C>A	20.37:g.61522367G>T			A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Silent	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.I1162	ENST00000266070.4	37	c.3486	CCDS33506.1	20																																																																																			DIDO1	-	pfam_SPOC_C	ENSG00000101191		0.572	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	HGNC	protein_coding	OTTHUMT00000080091.2	-	0.00	72	0	G	NM_080796		61522367	-1	tier1	-	no_errors	ENST00000266070	ensembl	human	known	74_37	silent	30.19	37	16	SNP	0.896	T
DIRAS2	54769	genome.wustl.edu	37	9	93376008	93376008	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr9:93376008C>A	ENST00000375765.3	-	2	490	c.102G>T	c.(100-102)gaG>gaT	p.E34D		NM_017594.3	NP_060064.2	Q96HU8	DIRA2_HUMAN	DIRAS family, GTP-binding RAS-like 2	34					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			kidney(1)|large_intestine(6)|lung(3)|skin(2)	12						GGATGTAGCTCTCCCGGAATG	0.572																																																	0													179.0	156.0	164.0					9																	93376008		2203	4300	6503	SO:0001583	missense	0			AB076889	CCDS6687.1	9q22.32	2014-05-09			ENSG00000165023	ENSG00000165023			19323	protein-coding gene	gene with protein product		607863				12194967	Standard	NM_017594		Approved	Di-Ras2, DKFZp761C07121	uc004aqx.1	Q96HU8	OTTHUMG00000020196	ENST00000375765.3:c.102G>T	9.37:g.93376008C>A	ENSP00000364919:p.Glu34Asp		B3KVM2	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E34D	ENST00000375765.3	37	c.102	CCDS6687.1	9	.	.	.	.	.	.	.	.	.	.	C	12.64	1.997604	0.35226	.	.	ENSG00000165023	ENST00000375765	T	0.78364	-1.17	5.06	4.16	0.48862	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.64907	0.2641	L	0.37800	1.135	0.58432	D	0.999999	B	0.02656	0.0	B	0.08055	0.003	T	0.57665	-0.7772	10	0.18276	T	0.48	.	9.5208	0.39133	0.0:0.84:0.0:0.16	.	34	Q96HU8	DIRA2_HUMAN	D	34	ENSP00000364919:E34D	ENSP00000364919:E34D	E	-	3	2	DIRAS2	92415828	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.029000	0.41098	1.514000	0.48869	-0.150000	0.13652	GAG	DIRAS2	-	pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000165023		0.572	DIRAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIRAS2	HGNC	protein_coding	OTTHUMT00000053012.1	-	0.00	49	0	C			93376008	-1	tier1	-	no_errors	ENST00000375765	ensembl	human	known	74_37	missense	14.71	29	5	SNP	1.000	A
DKK2	27123	genome.wustl.edu	37	4	107847018	107847018	+	Missense_Mutation	SNP	C	C	A	rs541386879		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr4:107847018C>A	ENST00000285311.3	-	2	1016	c.311G>T	c.(310-312)cGg>cTg	p.R104L	DKK2_ENST00000513208.1_Missense_Mutation_p.R4L|DKK2_ENST00000510463.1_Missense_Mutation_p.R58L	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	104	DKK-type Cys-1.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		CTTTTTTCTCCGACACACCAT	0.507																																																	0													174.0	155.0	162.0					4																	107847018		2203	4300	6503	SO:0001583	missense	0			AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.311G>T	4.37:g.107847018C>A	ENSP00000285311:p.Arg104Leu		A0AVE9|B2R6S7|Q9UIU3	Missense_Mutation	SNP	pfam_Dickkopf_N,superfamily_Zn2-C6_fun-type_DNA-bd	p.R104L	ENST00000285311.3	37	c.311	CCDS3675.1	4	.	.	.	.	.	.	.	.	.	.	C	35	5.511088	0.96386	.	.	ENSG00000155011	ENST00000285311;ENST00000513208;ENST00000510463	T;T;T	0.60040	0.22;0.26;0.33	5.42	5.42	0.78866	Dickkopf, N-terminal cysteine-rich (1);	0.000000	0.85682	D	0.000000	T	0.77909	0.4201	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.993	T	0.78152	-0.2315	10	0.51188	T	0.08	-15.3426	19.5778	0.95452	0.0:1.0:0.0:0.0	.	104;104	Q9H3R7;Q9UBU2	.;DKK2_HUMAN	L	104;4;58	ENSP00000285311:R104L;ENSP00000421255:R4L;ENSP00000423797:R58L	ENSP00000285311:R104L	R	-	2	0	DKK2	108066467	1.000000	0.71417	0.985000	0.45067	0.993000	0.82548	7.410000	0.80065	2.704000	0.92352	0.467000	0.42956	CGG	DKK2	-	pfam_Dickkopf_N,superfamily_Zn2-C6_fun-type_DNA-bd	ENSG00000155011		0.507	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	DKK2	HGNC	protein_coding	OTTHUMT00000253959.4	-	0.00	62	0	C			107847018	-1	tier1	-	no_errors	ENST00000285311	ensembl	human	novel	74_37	missense	29.63	19	8	SNP	1.000	A
DNAH3	55567	genome.wustl.edu	37	16	20975682	20975682	+	Missense_Mutation	SNP	C	C	T	rs199787492	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:20975682C>T	ENST00000261383.3	-	53	9523	c.9524G>A	c.(9523-9525)cGt>cAt	p.R3175H	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3175	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		ATTCCTCAAACGGGTTGTGAT	0.453													C|||	46	0.0091853	0.0	0.0	5008	,	,		20813	0.0		0.0	False		,,,				2504	0.047																0													109.0	110.0	110.0					16																	20975682		2201	4300	6501	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.9524G>A	16.37:g.20975682C>T	ENSP00000261383:p.Arg3175His		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.R3175H	ENST00000261383.3	37	c.9524	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	11.94	1.787960	0.31593	.	.	ENSG00000158486	ENST00000261383	T	0.23552	1.9	6.17	3.17	0.36434	.	0.209202	0.40908	N	0.000991	T	0.38957	0.1060	M	0.92412	3.305	0.18873	N	0.999987	B	0.15473	0.013	B	0.14023	0.01	T	0.45160	-0.9280	10	0.72032	D	0.01	.	11.8767	0.52552	0.0:0.7584:0.0:0.2416	.	3175	Q8TD57	DYH3_HUMAN	H	3175	ENSP00000261383:R3175H	ENSP00000261383:R3175H	R	-	2	0	DNAH3	20883183	0.423000	0.25482	0.484000	0.27391	0.992000	0.81027	1.678000	0.37586	0.945000	0.37605	0.655000	0.94253	CGT	DNAH3	-	NULL	ENSG00000158486		0.453	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	-	0.00	97	0	C	NM_017539		20975682	-1	tier1	rs199787492	no_errors	ENST00000261383	ensembl	human	known	74_37	missense	15.38	44	8	SNP	0.006	T
DNAH5	1767	genome.wustl.edu	37	5	13817729	13817729	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:13817729C>A	ENST00000265104.4	-	42	7020	c.6916G>T	c.(6916-6918)Gac>Tac	p.D2306Y		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2306	AAA 2. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GTGGCAACGTCCAGCCGACCA	0.393									Kartagener syndrome																																								0													148.0	136.0	140.0					5																	13817729		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6916G>T	5.37:g.13817729C>A	ENSP00000265104:p.Asp2306Tyr		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.D2306Y	ENST00000265104.4	37	c.6916	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	C	28.5	4.927044	0.92389	.	.	ENSG00000039139	ENST00000265104	D	0.90385	-2.66	5.74	5.74	0.90152	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.85682	D	0.000000	D	0.97695	0.9244	H	0.99042	4.41	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98810	1.0743	10	0.87932	D	0	.	19.9222	0.97091	0.0:1.0:0.0:0.0	.	2306	Q8TE73	DYH5_HUMAN	Y	2306	ENSP00000265104:D2306Y	ENSP00000265104:D2306Y	D	-	1	0	DNAH5	13870729	1.000000	0.71417	0.952000	0.39060	0.924000	0.55760	7.789000	0.85783	2.716000	0.92895	0.650000	0.86243	GAC	DNAH5	-	pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000039139		0.393	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	81	0	C	NM_001369		13817729	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	10.53	51	6	SNP	1.000	A
DNAH7	56171	genome.wustl.edu	37	2	196722321	196722321	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:196722321delT	ENST00000312428.6	-	44	8294	c.8194delA	c.(8194-8196)attfs	p.I2732fs		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2732	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)	p.I2732fs*15(1)		NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						AAATCCTCAATTTTTTTCCCT	0.433																																																	1	Deletion - Frameshift(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.8194delA	2.37:g.196722321delT	ENSP00000311273:p.Ile2732fs		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Frame_Shift_Del	DEL	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.I2732fs	ENST00000312428.6	37	c.8194	CCDS42794.1	2																																																																																			DNAH7	-	NULL	ENSG00000118997		0.433	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3		0.00	57	0	T	NM_018897		196722321	-1	tier1		no_errors	ENST00000312428	ensembl	human	known	74_37	frame_shift_del	6.67	28	2	DEL	1.000	-
DNAJC13	23317	genome.wustl.edu	37	3	132211267	132211267	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:132211267G>T	ENST00000260818.6	+	33	3881	c.3633G>T	c.(3631-3633)atG>atT	p.M1211I		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1211					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						GGCGCCTGATGATAGAGAAGA	0.378																																																	0													183.0	198.0	193.0					3																	132211267		2203	4300	6503	SO:0001583	missense	0			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.3633G>T	3.37:g.132211267G>T	ENSP00000260818:p.Met1211Ile		Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	pfam_DnaJ_domain,superfamily_ARM-type_fold,superfamily_GYF,smart_DnaJ_domain,pfscan_DnaJ_domain	p.M1211I	ENST00000260818.6	37	c.3633	CCDS33857.1	3	.	.	.	.	.	.	.	.	.	.	G	21.1	4.099830	0.76983	.	.	ENSG00000138246	ENST00000260818	T	0.20463	2.07	5.73	5.73	0.89815	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.39989	0.1099	M	0.72894	2.215	0.80722	D	1	P	0.41159	0.74	P	0.48425	0.577	T	0.11616	-1.0580	10	0.72032	D	0.01	.	20.2602	0.98440	0.0:0.0:1.0:0.0	.	1211	O75165	DJC13_HUMAN	I	1211	ENSP00000260818:M1211I	ENSP00000260818:M1211I	M	+	3	0	DNAJC13	133693957	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.861000	0.98227	0.655000	0.94253	ATG	DNAJC13	-	superfamily_ARM-type_fold	ENSG00000138246		0.378	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC13	HGNC	protein_coding	OTTHUMT00000356807.2	-	0.00	38	0	G	NM_015268		132211267	+1	tier1	-	no_errors	ENST00000260818	ensembl	human	known	74_37	missense	25.00	36	12	SNP	1.000	T
DNER	92737	genome.wustl.edu	37	2	230223312	230223312	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:230223312C>A	ENST00000341772.4	-	13	2292	c.2158G>T	c.(2158-2160)Gat>Tat	p.D720Y		NM_139072.3	NP_620711.3	Q8NFT8	DNER_HUMAN	delta/notch-like EGF repeat containing	720					central nervous system development (GO:0007417)|endocytosis (GO:0006897)|glial cell differentiation (GO:0010001)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|skeletal muscle fiber development (GO:0048741)|synapse assembly (GO:0007416)	dendrite (GO:0030425)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	63		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		GGACTGTAATCTTCATAGGCG	0.368																																																	0													90.0	91.0	91.0					2																	230223312		2203	4300	6503	SO:0001583	missense	0			AY358891	CCDS33390.1	2q36.3	2006-10-26			ENSG00000187957	ENSG00000187957			24456	protein-coding gene	gene with protein product		607299				11950833, 11997712	Standard	NM_139072		Approved	UNQ26, bet	uc002vpv.3	Q8NFT8	OTTHUMG00000153637	ENST00000341772.4:c.2158G>T	2.37:g.230223312C>A	ENSP00000345229:p.Asp720Tyr		A6NP39|Q53R88|Q53TP7|Q53TQ5|Q8IYT0|Q8TB42|Q9NTF1|Q9UDM2	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_EGF_extracell,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.D720Y	ENST00000341772.4	37	c.2158	CCDS33390.1	2	.	.	.	.	.	.	.	.	.	.	C	20.6	4.014344	0.75161	.	.	ENSG00000187957	ENST00000341772;ENST00000543700	D	0.86956	-2.19	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	D	0.89774	0.6812	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90636	0.4571	10	0.72032	D	0.01	.	20.6013	0.99457	0.0:1.0:0.0:0.0	.	720	Q8NFT8	DNER_HUMAN	Y	720;438	ENSP00000345229:D720Y	ENSP00000345229:D720Y	D	-	1	0	DNER	229931556	1.000000	0.71417	0.989000	0.46669	0.777000	0.43975	7.027000	0.76463	2.878000	0.98634	0.650000	0.86243	GAT	DNER	-	NULL	ENSG00000187957		0.368	DNER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNER	HGNC	protein_coding	OTTHUMT00000331902.1	-	0.00	49	0	C	NM_139072		230223312	-1	tier1	-	no_errors	ENST00000341772	ensembl	human	known	74_37	missense	15.56	38	7	SNP	1.000	A
DNM1P47	100216544	genome.wustl.edu	37	15	102304579	102304579	+	RNA	SNP	G	G	C	rs7169206		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr15:102304579G>C	ENST00000561463.1	+	0	12625									DNM1 pseudogene 47																		GCAGGCAGACGAAGGAGTTCA	0.612																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102304579G>C				RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			DNM1P47	-	-	ENSG00000259660		0.612	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	-	0.00	23	0	G	NG_009149		102304579	+1	tier1	rs7169206	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	30.00	14	6	SNP	0.997	C
DOCK3	1795	genome.wustl.edu	37	3	51418911	51418911	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:51418911G>A	ENST00000266037.9	+	53	6037	c.6014G>A	c.(6013-6015)cGc>cAc	p.R2005H		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	2005					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GGCCTGCACCGCAAGGCTCCA	0.711																																																	0													9.0	12.0	11.0					3																	51418911		2040	4177	6217	SO:0001583	missense	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.6014G>A	3.37:g.51418911G>A	ENSP00000266037:p.Arg2005His		O15017	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.R2005H	ENST00000266037.9	37	c.6014	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	G	22.7	4.319170	0.81469	.	.	ENSG00000088538	ENST00000266037	T	0.17370	2.28	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.16514	0.0397	L	0.27053	0.805	0.58432	D	0.999998	B	0.15473	0.013	B	0.08055	0.003	T	0.04386	-1.0955	10	0.38643	T	0.18	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	2005	Q8IZD9	DOCK3_HUMAN	H	2005	ENSP00000266037:R2005H	ENSP00000266037:R2005H	R	+	2	0	DOCK3	51393951	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.179000	0.94861	2.941000	0.99782	0.655000	0.94253	CGC	DOCK3	-	NULL	ENSG00000088538		0.711	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	-	0.00	21	0	G	NM_004947		51418911	+1	tier1	-	no_errors	ENST00000266037	ensembl	human	known	74_37	missense	62.50	3	5	SNP	1.000	A
DOCK8	81704	genome.wustl.edu	37	9	325713	325713	+	Silent	SNP	C	C	A	rs201244929		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr9:325713C>A	ENST00000453981.1	+	8	982	c.870C>A	c.(868-870)ctC>ctA	p.L290L	DOCK8_ENST00000469391.1_Silent_p.L222L|DOCK8_ENST00000432829.2_Silent_p.L222L			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	290					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		GCATTGCCCTCTACGATGTTA	0.343																																																	0													145.0	145.0	145.0					9																	325713		2203	4300	6503	SO:0001819	synonymous_variant	0			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.870C>A	9.37:g.325713C>A			A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Silent	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.L290	ENST00000453981.1	37	c.870	CCDS6440.2	9																																																																																			DOCK8	-	NULL	ENSG00000107099		0.343	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	HGNC	protein_coding	OTTHUMT00000171792.5	-	0.00	67	0	C	XM_036307		325713	+1	tier1	-	no_errors	ENST00000453981	ensembl	human	known	74_37	silent	25.00	39	13	SNP	0.994	A
DR1	1810	genome.wustl.edu	37	1	93812309	93812309	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:93812309G>T	ENST00000370272.4	+	1	865	c.107G>T	c.(106-108)cGa>cTa	p.R36L	DR1_ENST00000370267.1_Missense_Mutation_p.R36L|RP4-717I23.3_ENST00000413606.1_RNA|RP4-717I23.3_ENST00000451302.2_RNA	NM_001938.2	NP_001929.1	Q01658	NC2B_HUMAN	down-regulator of transcription 1, TBP-binding (negative cofactor 2)	36					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(3)|large_intestine(1)	4		all_lung(203;0.00252)|Lung NSC(277;0.011)|Melanoma(281;0.155)		all cancers(265;0.0032)|GBM - Glioblastoma multiforme(16;0.0165)|Epithelial(280;0.0977)		AACGATGCTCGAGAGCTGGTG	0.453																																																	0													101.0	94.0	96.0					1																	93812309		2203	4300	6503	SO:0001583	missense	0			M97388	CCDS744.1	1p22.1	2008-02-05			ENSG00000117505	ENSG00000117505			3017	protein-coding gene	gene with protein product		601482				1339312, 9040789	Standard	NM_001938		Approved	NC2, NC2-BETA	uc001dpu.3	Q01658	OTTHUMG00000010862	ENST00000370272.4:c.107G>T	1.37:g.93812309G>T	ENSP00000359295:p.Arg36Leu			Missense_Mutation	SNP	pfam_CBFA_NFYB_domain,superfamily_Histone-fold,prints_Transcrpt_fac_NFYB/HAP3	p.R36L	ENST00000370272.4	37	c.107	CCDS744.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.073973	0.94000	.	.	ENSG00000117505	ENST00000370272;ENST00000370267	T;T	0.44083	0.93;0.93	5.76	4.85	0.62838	Histone-fold (2);Transcription factor CBF/NF-Y/archaeal histone (1);	0.000000	0.85682	D	0.000000	T	0.52256	0.1723	M	0.64630	1.985	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.59799	-0.7386	10	0.87932	D	0	-9.8841	14.7736	0.69699	0.069:0.0:0.931:0.0	.	36	Q01658	NC2B_HUMAN	L	36	ENSP00000359295:R36L;ENSP00000359290:R36L	ENSP00000359290:R36L	R	+	2	0	DR1	93584897	1.000000	0.71417	0.997000	0.53966	0.939000	0.58152	9.564000	0.98151	1.437000	0.47472	0.655000	0.94253	CGA	DR1	-	pfam_CBFA_NFYB_domain,superfamily_Histone-fold	ENSG00000117505		0.453	DR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DR1	HGNC	protein_coding	OTTHUMT00000029976.2	-	0.00	44	0	G	NM_001938		93812309	+1	tier1	-	no_errors	ENST00000370267	ensembl	human	known	74_37	missense	33.33	18	9	SNP	1.000	T
DTHD1	401124	genome.wustl.edu	37	4	36285736	36285736	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr4:36285736C>A	ENST00000456874.2	+	1	93	c.35C>A	c.(34-36)tCc>tAc	p.S12Y	DTHD1_ENST00000507598.1_Missense_Mutation_p.S52Y|DTHD1_ENST00000357504.3_Intron	NM_001170700.2	NP_001164171.1	Q6ZMT9	DTHD1_HUMAN	death domain containing 1	12					signal transduction (GO:0007165)					breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|stomach(1)	8						CAGACAATGTCCTCCATTCAA	0.423																																																	0													38.0	30.0	33.0					4																	36285736		692	1591	2283	SO:0001583	missense	0			AK094684	CCDS54754.1	4p14	2009-10-02			ENSG00000197057	ENSG00000197057			37261	protein-coding gene	gene with protein product							Standard	NM_001170700		Approved	FLJ16686	uc021xne.2	Q6ZMT9	OTTHUMG00000160371	ENST00000456874.2:c.35C>A	4.37:g.36285736C>A	ENSP00000401597:p.Ser12Tyr		B2RXK4|B4E2N7	Missense_Mutation	SNP	pfam_Death_domain,superfamily_DEATH-like_dom,pfscan_Death_domain	p.S12Y	ENST00000456874.2	37	c.35	CCDS54754.1	4	.	.	.	.	.	.	.	.	.	.	C	9.134	1.012044	0.19277	.	.	ENSG00000197057	ENST00000507598;ENST00000456874	T;T	0.22945	1.93;1.93	5.65	4.79	0.61399	.	.	.	.	.	T	0.15955	0.0384	N	0.08118	0	0.09310	N	0.999997	.	.	.	.	.	.	T	0.15150	-1.0447	7	0.72032	D	0.01	.	8.2745	0.31864	0.0:0.7577:0.1592:0.0831	.	.	.	.	Y	52;12	ENSP00000424426:S52Y;ENSP00000401597:S12Y	ENSP00000401597:S12Y	S	+	2	0	DTHD1	35962131	0.015000	0.18098	0.480000	0.27341	0.744000	0.42396	0.821000	0.27338	1.490000	0.48466	0.650000	0.86243	TCC	DTHD1	-	NULL	ENSG00000197057		0.423	DTHD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DTHD1	HGNC	protein_coding		-	0.00	27	0	C	NM_001136536		36285736	+1	tier1	-	no_errors	ENST00000456874	ensembl	human	known	74_37	missense	36.36	7	4	SNP	0.336	A
DYNC2H1	79659	genome.wustl.edu	37	11	103040912	103040912	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:103040912G>T	ENST00000375735.2	+	33	5188	c.5044G>T	c.(5044-5046)Gga>Tga	p.G1682*	DYNC2H1_ENST00000398093.3_Nonsense_Mutation_p.G1682*|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1682	AAA 1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CATGAAGATGGGACTTGGAGG	0.418																																																	0													85.0	82.0	83.0					11																	103040912		1877	4108	5985	SO:0001587	stop_gained	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.5044G>T	11.37:g.103040912G>T	ENSP00000364887:p.Gly1682*		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.G1682*	ENST00000375735.2	37	c.5044	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	G	45	12.055749	0.99631	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	19.4742	0.94979	0.0:0.0:1.0:0.0	.	.	.	.	X	1682	.	ENSP00000364887:G1682X	G	+	1	0	DYNC2H1	102546122	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.944000	0.87722	2.602000	0.87976	0.585000	0.79938	GGA	DYNC2H1	-	superfamily_P-loop_NTPase	ENSG00000187240		0.418	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	-	0.00	70	0	G	XM_370652		103040912	+1	tier1	-	no_errors	ENST00000398093	ensembl	human	known	74_37	nonsense	26.83	30	11	SNP	1.000	T
EFCAB1	79645	genome.wustl.edu	37	8	49647687	49647687	+	Silent	SNP	C	C	T	rs372708156		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr8:49647687C>T	ENST00000262103.3	-	1	104	c.24G>A	c.(22-24)aaG>aaA	p.K8K	EFCAB1_ENST00000433756.1_Silent_p.K8K|EFCAB1_ENST00000521002.1_5'UTR|EFCAB1_ENST00000523092.1_Silent_p.K8K	NM_024593.3	NP_078869.1	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1	8							calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(2)	14		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				TGTCCGTCAGCTTCTGCAGTT	0.627																																																	0								C	,	1,4405	2.1+/-5.4	0,1,2202	187.0	170.0	176.0		24,24	4.2	1.0	8		176	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	EFCAB1	NM_001142857.1,NM_024593.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	8/160,8/212	49647687	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6145.1, CCDS47853.1	8q11.21	2013-01-10			ENSG00000034239	ENSG00000034239		"""EF-hand domain containing"""	25678	protein-coding gene	gene with protein product						12477932	Standard	NM_024593		Approved	FLJ11767	uc003xqo.2	Q9HAE3	OTTHUMG00000164203	ENST00000262103.3:c.24G>A	8.37:g.49647687C>T			B4DSB4|E7EVN7	Silent	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.K8	ENST00000262103.3	37	c.24	CCDS6145.1	8																																																																																			EFCAB1	-	NULL	ENSG00000034239		0.627	EFCAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB1	HGNC	protein_coding	OTTHUMT00000377778.1	-	0.00	80	0	C	NM_024593		49647687	-1	tier1	-	no_errors	ENST00000262103	ensembl	human	known	74_37	silent	32.20	40	19	SNP	0.998	T
EFCAB6	64800	genome.wustl.edu	37	22	44168882	44168882	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr22:44168882G>T	ENST00000262726.7	-	4	494	c.241C>A	c.(241-243)Ctg>Atg	p.L81M	EFCAB6_ENST00000356087.4_Intron|EFCAB6_ENST00000358439.4_Intron|EFCAB6_ENST00000396231.2_Intron	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	81	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				GTATCCAGCAGCTGAAAGGCT	0.433																																																	0													143.0	127.0	132.0					22																	44168882		2203	4300	6503	SO:0001583	missense	0			Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.241C>A	22.37:g.44168882G>T	ENSP00000262726:p.Leu81Met		A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	pfam_EF_hand_Ca-bd_contain_6,smart_EF_hand_dom,pfscan_EF_hand_dom	p.L81M	ENST00000262726.7	37	c.241	CCDS14049.1	22	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109901	0.37242	.	.	ENSG00000186976	ENST00000262726	T	0.46819	0.86	4.57	2.22	0.28083	EF-hand-like domain (1);	0.619515	0.13570	N	0.378162	T	0.59169	0.2174	M	0.65975	2.015	0.80722	D	1	D;D	0.61697	0.985;0.99	P;P	0.60682	0.878;0.692	T	0.58295	-0.7661	10	0.45353	T	0.12	-9.9723	8.9586	0.35834	0.0:0.0:0.5956:0.4044	.	81;81	Q5THR3-6;Q5THR3	.;EFCB6_HUMAN	M	81	ENSP00000262726:L81M	ENSP00000262726:L81M	L	-	1	2	EFCAB6	42500215	1.000000	0.71417	1.000000	0.80357	0.651000	0.38670	1.369000	0.34227	1.217000	0.43442	0.563000	0.77884	CTG	EFCAB6	-	smart_EF_hand_dom,pfscan_EF_hand_dom	ENSG00000186976		0.433	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB6	HGNC	protein_coding	OTTHUMT00000353176.1	-	0.00	53	0	G	NM_022785		44168882	-1	tier1	-	no_errors	ENST00000262726	ensembl	human	known	74_37	missense	32.14	19	9	SNP	0.984	T
EFEMP2	30008	genome.wustl.edu	37	11	65638797	65638797	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:65638797C>T	ENST00000307998.6	-	4	428	c.198G>A	c.(196-198)aaG>aaA	p.K66K	EFEMP2_ENST00000528176.1_Silent_p.K66K	NM_016938.4	NP_058634.4	O95967	FBLN4_HUMAN	EGF containing fibulin-like extracellular matrix protein 2	66	EGF-like 1; atypical. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21				READ - Rectum adenocarcinoma(159;0.169)		TCATTTCCCCCTTGCAGGCCT	0.657																																																	0													113.0	123.0	120.0					11																	65638797		2201	4296	6497	SO:0001819	synonymous_variant	0			AF109121	CCDS8116.1	11q13	2011-06-17	2011-01-25		ENSG00000172638	ENSG00000172638		"""Fibulins"""	3219	protein-coding gene	gene with protein product	"""fibulin 4"""	604633	"""EGF-containing fibulin-like extracellular matrix protein 2"""			10601734, 10982184	Standard	NR_037718		Approved	FBLN4, UPH1	uc001ofy.4	O95967	OTTHUMG00000166664	ENST00000307998.6:c.198G>A	11.37:g.65638797C>T			A8K7R4|B3KM31|B3KQT1|O75967	Silent	SNP	pfam_EGF-like_Ca-bd_dom,superfamily_TIL_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,prints_Thrombomodulin	p.K66	ENST00000307998.6	37	c.198	CCDS8116.1	11																																																																																			EFEMP2	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom	ENSG00000172638		0.657	EFEMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFEMP2	HGNC	protein_coding	OTTHUMT00000391047.4	-	0.00	76	0	C	NM_016938		65638797	-1	tier1	-	no_errors	ENST00000307998	ensembl	human	known	74_37	silent	12.64	76	11	SNP	1.000	T
C10orf90	118611	genome.wustl.edu	37	10	128245580	128245580	+	Intron	DEL	A	A	-	rs200947401	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr10:128245580delA	ENST00000544758.1	-	3	343				AL583860.1_ENST00000408790.1_RNA			Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90						mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		taatcaatttaaaaaaaaaaa	0.363													|||unknown(HR)	1383	0.276158	0.2965	0.2911	5008	,	,		14749	0.2688		0.2237	False		,,,				2504	0.2996																0																																										SO:0001627	intron_variant	0			BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000544758.1:c.314-43072T>-	10.37:g.128245580delA			B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	RNA	DEL	-	NULL	ENST00000544758.1	37	NULL		10																																																																																			AL583860.1	-	-	ENSG00000221717		0.363	C10orf90-204	KNOWN	basic	protein_coding	ENSG00000221717	Clone_based_ensembl_gene	protein_coding			0.00	17	0	A	NM_001004298		128245580	-1	tier1		no_errors	ENST00000408790	ensembl	human	novel	74_37	rna	40.00	6	4	DEL	0.006	-
PHACTR1	221692	genome.wustl.edu	37	6	12753981	12753981	+	Intron	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:12753981G>T	ENST00000379350.1	+	3	379				PHACTR1_ENST00000379348.2_Intron|PHACTR1_ENST00000332995.7_Intron|AL354680.1_ENST00000411359.1_RNA			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1						actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			GACAATGGCAGTCAGAACTGG	0.473																																																	0																																										SO:0001627	intron_variant	0			AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.250+3959G>T	6.37:g.12753981G>T			A8K1V2|Q3MJ93|Q5JSJ2	RNA	SNP	-	NULL	ENST00000379350.1	37	NULL		6																																																																																			AL354680.1	-	-	ENSG00000223291		0.473	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	ENSG00000223291	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000039876.1	-	0.00	80	0	G	XM_166420		12753981	+1	tier1	-	no_errors	ENST00000411359	ensembl	human	novel	74_37	rna	26.56	47	17	SNP	0.014	T
RP6-206I17.1	0	genome.wustl.edu	37	1	143663980	143663980	+	lincRNA	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:143663980C>T	ENST00000445753.1	-	0	426																											GAGCCTGTGCCCACTCTGCCC	0.652																																																	0																																												0																															1.37:g.143663980C>T				RNA	SNP	-	NULL	ENST00000445753.1	37	NULL		1																																																																																			RP6-206I17.1	-	-	ENSG00000223804		0.652	RP6-206I17.1-001	KNOWN	basic	lincRNA	ENSG00000223804	Clone_based_vega_gene	lincRNA	OTTHUMT00000037956.1	-	0.00	108	0	C			143663980	-1	tier1	-	no_errors	ENST00000440199	ensembl	human	known	74_37	rna	15.15	56	10	SNP	0.012	T
PCMTD1	115294	genome.wustl.edu	37	8	52730449	52730449	+	3'UTR	SNP	A	A	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr8:52730449A>C	ENST00000360540.5	-	0	3942				AC090186.1_ENST00000415643.1_Silent_p.S16S|PCMTD1_ENST00000544451.1_3'UTR|PCMTD1_ENST00000519559.1_5'Flank	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1							cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				tgtatgtttcaggcaaaacat	0.383																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.*2462T>G	8.37:g.52730449A>C			Q96FK9	Silent	SNP	NULL	p.S16	ENST00000360540.5	37	c.48	CCDS6148.1	8																																																																																			AC090186.1	-	NULL	ENSG00000232941		0.383	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000232941	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000377909.2	-	0.00	20	0	A	NM_052937		52730449	+1	tier1	-	no_errors	ENST00000415643	ensembl	human	known	74_37	silent	26.09	16	6	SNP	0.001	C
PES1P1	345016	genome.wustl.edu	37	4	135248519	135248519	+	lincRNA	SNP	G	G	A	rs115359389	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr4:135248519G>A	ENST00000515491.1	-	0	85																											AAGAGCGAGCGGAACACCGTG	0.522																																																	0																																												0																															4.37:g.135248519G>A				RNA	SNP	-	NULL	ENST00000515491.1	37	NULL		4																																																																																			RP11-400D2.2	-	-	ENSG00000251199		0.522	RP11-400D2.2-002	KNOWN	basic	lincRNA	ENSG00000251199	Clone_based_vega_gene	lincRNA	OTTHUMT00000365046.1		0.00	50	0	G			135248519	-1			no_errors	ENST00000504728	ensembl	human	known	74_37	rna	9.09	30	3	SNP	0.983	A
NOL7	51406	genome.wustl.edu	37	6	13621098	13621098	+	3'UTR	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:13621098G>A	ENST00000451315.2	+	0	845				RANBP9_ENST00000469916.1_5'Flank|AL441883.1_ENST00000600057.1_Silent_p.F8F|NOL7_ENST00000474485.1_Intron	NM_016167.3	NP_057251.2	Q9UMY1	NOL7_HUMAN	nucleolar protein 7, 27kDa							nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(3)|lung(1)	5	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.135)	Epithelial(50;0.176)			TGTATGTATAGAATTTATCTA	0.299																																																	0													20.0	20.0	20.0					6																	13621098		2197	4271	6468	SO:0001624	3_prime_UTR_variant	0			AF172066	CCDS4528.1	6p23	2008-05-23	2004-02-10		ENSG00000225921	ENSG00000225921			21040	protein-coding gene	gene with protein product		611533	"""chromosome 6 open reading frame 90"", ""polyglutamine binding protein 3"""	C6orf90, PQBP3		16205646	Standard	NM_016167		Approved	NOP27, RARG-1, dJ223E5.2	uc003naz.3	Q9UMY1	OTTHUMG00000014277	ENST00000451315.2:c.*39G>A	6.37:g.13621098G>A			Q5T297|Q9Y3U7	Silent	SNP	NULL	p.F8	ENST00000451315.2	37	c.24	CCDS4528.1	6																																																																																			AL441883.1	-	NULL	ENSG00000268059		0.299	NOL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000268059	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000039904.1	-	0.00	58	0	G	NM_016167		13621098	-1	tier1	-	no_errors	ENST00000600057	ensembl	human	novel	74_37	silent	35.90	25	14	SNP	0.001	A
KCNAB1	7881	genome.wustl.edu	37	3	156241549	156241549	+	Intron	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:156241549G>T	ENST00000490337.1	+	12	1024				KCNAB1_ENST00000302490.8_Intron|KCNAB1_ENST00000471742.1_Intron|KCNAB1_ENST00000389636.5_Intron|RP11-305K5.1_ENST00000609190.1_RNA|KCNAB1_ENST00000497291.1_Intron|KCNAB1_ENST00000389634.5_Intron	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1						learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			ATATTTTATTGAATTACCATT	0.343																																																	0																																										SO:0001627	intron_variant	0			U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.961-67G>T	3.37:g.156241549G>T			A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	RNA	SNP	-	NULL	ENST00000490337.1	37	NULL	CCDS3174.1	3																																																																																			RP11-305K5.1	-	-	ENSG00000272990		0.343	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	ENSG00000272990	Clone_based_vega_gene	protein_coding	OTTHUMT00000351411.1	-	0.00	47	0	G	NM_003471		156241549	-1	tier1	-	no_errors	ENST00000609190	ensembl	human	known	74_37	rna	15.38	44	8	SNP	0.000	T
EPB41L4A	64097	genome.wustl.edu	37	5	111598196	111598196	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:111598196C>T	ENST00000261486.5	-	7	913	c.637G>A	c.(637-639)Gtc>Atc	p.V213I		NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A	213	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		CTCACATAGACGGGATGGAGG	0.423																																																	0													119.0	117.0	118.0					5																	111598196		1882	4110	5992	SO:0001583	missense	0			AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.637G>A	5.37:g.111598196C>T	ENSP00000261486:p.Val213Ile		A4FUI6	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.V213I	ENST00000261486.5	37	c.637	CCDS43350.1	5	.	.	.	.	.	.	.	.	.	.	C	29.5	5.007499	0.93287	.	.	ENSG00000129595	ENST00000261486	D	0.83914	-1.78	5.54	5.54	0.83059	FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.89832	0.6829	L	0.58510	1.815	0.58432	D	0.999998	D	0.89917	1.0	D	0.76575	0.988	D	0.90111	0.4192	10	0.72032	D	0.01	.	18.6127	0.91291	0.0:1.0:0.0:0.0	.	213	Q9HCS5	E41LA_HUMAN	I	213	ENSP00000261486:V213I	ENSP00000261486:V213I	V	-	1	0	EPB41L4A	111626095	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	5.966000	0.70395	2.764000	0.94973	0.655000	0.94253	GTC	EPB41L4A	-	pfscan_FERM_domain	ENSG00000129595		0.423	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L4A	HGNC	protein_coding	OTTHUMT00000370969.1	-	0.00	39	0	C			111598196	-1	tier1	-	no_errors	ENST00000261486	ensembl	human	known	74_37	missense	22.58	24	7	SNP	1.000	T
EPHA6	285220	genome.wustl.edu	37	3	97202843	97202843	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:97202843C>A	ENST00000514100.1	+	7	558	c.316C>A	c.(316-318)Cat>Aat	p.H106N	EPHA6_ENST00000389672.5_Missense_Mutation_p.H714N|EPHA6_ENST00000502694.1_Missense_Mutation_p.H106N|EPHA6_ENST00000442602.2_Missense_Mutation_p.H80N	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	620	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						CCTAGCAGTCCATGAATTTGC	0.378																																																	0													101.0	104.0	103.0					3																	97202843		1881	4108	5989	SO:0001583	missense	0			AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.316C>A	3.37:g.97202843C>A	ENSP00000421711:p.His106Asn		D6RAL5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.H714N	ENST00000514100.1	37	c.2140		3	.	.	.	.	.	.	.	.	.	.	C	23.9	4.475270	0.84640	.	.	ENSG00000080224	ENST00000389672;ENST00000514100;ENST00000502694;ENST00000442602	T;T;T;T	0.11169	2.8;2.8;2.8;2.8	5.47	5.47	0.80525	Protein kinase-like domain (1);	.	.	.	.	T	0.39358	0.1075	M	0.82517	2.595	0.80722	D	1	D;P;D;D	0.67145	0.968;0.704;0.996;0.984	P;B;D;P	0.75484	0.504;0.291;0.986;0.724	T	0.30119	-0.9989	9	0.72032	D	0.01	.	19.3959	0.94607	0.0:1.0:0.0:0.0	.	80;619;106;106	B4DXQ6;Q9UF33;Q9UF33-2;D6RAL5	.;EPHA6_HUMAN;.;.	N	714;106;106;80	ENSP00000374323:H714N;ENSP00000421711:H106N;ENSP00000423950:H106N;ENSP00000403100:H80N	ENSP00000374323:H714N	H	+	1	0	EPHA6	98685533	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.622000	0.61240	2.585000	0.87301	0.556000	0.70494	CAT	EPHA6	-	superfamily_Kinase-like_dom	ENSG00000080224		0.378	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	EPHA6	HGNC	protein_coding	OTTHUMT00000359997.1	-	0.00	71	0	C	NM_001080448		97202843	+1	tier1	-	no_errors	ENST00000389672	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	A
EPS15	2060	genome.wustl.edu	37	1	51913746	51913746	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:51913746G>A	ENST00000371733.3	-	9	719	c.623C>T	c.(622-624)gCc>gTc	p.A208V	EPS15_ENST00000371730.2_Missense_Mutation_p.A208V	NM_001981.2	NP_001972.1	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway substrate 15	208	EH 2. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|protein transport (GO:0015031)|vesicle organization (GO:0016050)	AP-2 adaptor complex (GO:0030122)|ciliary membrane (GO:0060170)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|polyubiquitin binding (GO:0031593)	p.0?(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(13)|prostate(2)|skin(1)|stomach(1)|urinary_tract(2)	35						TGGCACCAAGGCTGGAGGCAA	0.453			T	MLL	ALL																																			Dom	yes		1	1p32	2060	epidermal growth factor receptor pathway substrate 15 (AF1p)		L	1	Whole gene deletion(1)	central_nervous_system(1)											191.0	181.0	185.0					1																	51913746		2203	4300	6503	SO:0001583	missense	0			BC054006	CCDS557.1	1p32	2013-01-10			ENSG00000085832	ENSG00000085832		"""EF-hand domain containing"""	3419	protein-coding gene	gene with protein product		600051				8183552	Standard	NM_001159969		Approved	AF-1P, MLLT5	uc001csq.1	P42566	OTTHUMG00000008192	ENST00000371733.3:c.623C>T	1.37:g.51913746G>A	ENSP00000360798:p.Ala208Val		B2R8J7|D3DPJ2|Q5SRH4	Missense_Mutation	SNP	smart_EPS15_homology,smart_EF_hand_dom,smart_Ubiquitin-int_motif,pfscan_EF_hand_dom,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.A208V	ENST00000371733.3	37	c.623	CCDS557.1	1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.330579	0.81690	.	.	ENSG00000085832	ENST00000371730;ENST00000371733	T;T	0.30182	1.54;1.54	5.75	5.75	0.90469	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.000000	0.32204	N	0.006421	T	0.30854	0.0778	N	0.20357	0.565	0.80722	D	1	D;B	0.53619	0.961;0.348	P;B	0.48270	0.572;0.144	T	0.01951	-1.1241	10	0.38643	T	0.18	.	19.9525	0.97208	0.0:0.0:1.0:0.0	.	208;208	B1AUU8;P42566	.;EPS15_HUMAN	V	208	ENSP00000360795:A208V;ENSP00000360798:A208V	ENSP00000360795:A208V	A	-	2	0	EPS15	51686334	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.646000	0.67916	2.719000	0.93026	0.655000	0.94253	GCC	EPS15	-	smart_EPS15_homology,pfscan_EPS15_homology	ENSG00000085832		0.453	EPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS15	HGNC	protein_coding	OTTHUMT00000022422.1	-	0.00	100	0	G	NM_001981		51913746	-1	tier1	-	no_errors	ENST00000371733	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	A
ERBB4	2066	genome.wustl.edu	37	2	212488710	212488710	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:212488710C>A	ENST00000342788.4	-	18	2449	c.2139G>T	c.(2137-2139)ttG>ttT	p.L713F	ERBB4_ENST00000402597.1_Missense_Mutation_p.L703F|ERBB4_ENST00000436443.1_Missense_Mutation_p.L713F	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	713					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CAGTTTCTTTCAAAATACGAA	0.403										TSP Lung(8;0.080)																																							0													100.0	97.0	98.0					2																	212488710		2203	4300	6503	SO:0001583	missense	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.2139G>T	2.37:g.212488710C>A	ENSP00000342235:p.Leu713Phe		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L713F	ENST00000342788.4	37	c.2139	CCDS2394.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.06|18.06	3.539344|3.539344	0.65085|0.65085	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597|ENST00000260943	T;T;T|.	0.76968|.	-1.06;-1.06;-1.04|.	5.74|5.74	4.68|4.68	0.58851|0.58851	Protein kinase-like domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.59797|.	0.2220|.	L|L	0.49126|0.49126	1.545|1.545	0.58432|0.58432	D|D	0.999993|0.999993	D;D;D;D|.	0.89917|.	1.0;0.983;1.0;1.0|.	D;D;D;D|.	0.91635|.	0.996;0.926;0.999;0.999|.	T|.	0.55405|.	-0.8146|.	10|.	0.35671|.	T|.	0.21|.	.|.	10.3596|10.3596	0.43984|0.43984	0.0:0.7995:0.0:0.2005|0.0:0.7995:0.0:0.2005	.|.	703;703;713;713|.	Q15303-4;Q15303-2;Q15303-3;Q15303|.	.;.;.;ERBB4_HUMAN|.	F|L	713;713;703|703	ENSP00000342235:L713F;ENSP00000403204:L713F;ENSP00000385565:L703F|.	ENSP00000342235:L713F|.	L|X	-|-	3|2	2|2	ERBB4|ERBB4	212196955|212196955	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	0.941000|0.941000	0.29005|0.29005	2.703000|2.703000	0.92315|0.92315	0.655000|0.655000	0.94253|0.94253	TTG|TGA	ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,superfamily_Kinase-like_dom	ENSG00000178568		0.403	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1	-	0.00	85	0	C	NM_001042599		212488710	-1	tier1	-	no_errors	ENST00000342788	ensembl	human	known	74_37	missense	25.00	45	15	SNP	1.000	A
ERI3	79033	genome.wustl.edu	37	1	44820595	44820595	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:44820595C>A	ENST00000372257.2	-	1	285	c.104G>T	c.(103-105)tGg>tTg	p.W35L	ERI3_ENST00000537474.1_5'Flank|ERI3_ENST00000495828.1_5'UTR	NM_024066.1	NP_076971.1	O43414	ERI3_HUMAN	ERI1 exoribonuclease family member 3	35							exonuclease activity (GO:0004527)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CGGGCCCATCCAAGTCCAGGG	0.711																																																	0													11.0	15.0	14.0					1																	44820595		2163	4240	6403	SO:0001583	missense	0			AF007157	CCDS30696.1	1p34.1	2009-10-07	2009-10-07	2008-12-16	ENSG00000117419	ENSG00000117419		"""Enhanced RNAi three prime mRNA exonucleases"""	17276	protein-coding gene	gene with protein product	"""enhanced RNAi three prime mRNA exonuclease homolog 3 (C.elegans)"", ""exoribonuclease 3"""	609917	"""prion protein interacting protein"""	PRNPIP			Standard	XM_005271184		Approved	FLJ22943, PINT1	uc001clt.3	O43414	OTTHUMG00000007637	ENST00000372257.2:c.104G>T	1.37:g.44820595C>A	ENSP00000361331:p.Trp35Leu		B1AK98|Q5T2T7|Q5T2T9|Q5TG35|Q9BQA0|Q9UEB4	Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.W35L	ENST00000372257.2	37	c.104	CCDS30696.1	1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.040693	0.55003	.	.	ENSG00000117419	ENST00000372257;ENST00000433471;ENST00000452396;ENST00000457571	.	.	.	5.11	5.11	0.69529	.	0.113257	0.40640	N	0.001046	T	0.25717	0.0626	N	0.08118	0	0.80722	D	1	P;B	0.42518	0.782;0.043	B;B	0.37144	0.242;0.005	T	0.09400	-1.0676	9	0.15952	T	0.53	.	14.3845	0.66934	0.0:1.0:0.0:0.0	.	35;35	F6UGJ8;O43414	.;ERI3_HUMAN	L	35	.	ENSP00000361331:W35L	W	-	2	0	ERI3	44593182	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.433000	0.52834	2.538000	0.85594	0.462000	0.41574	TGG	ERI3	-	NULL	ENSG00000117419		0.711	ERI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERI3	HGNC	protein_coding	OTTHUMT00000020243.1	-	0.00	31	0	C	NM_024066		44820595	-1	tier1	-	no_errors	ENST00000372257	ensembl	human	known	74_37	missense	25.00	18	6	SNP	1.000	A
ERN1	2081	genome.wustl.edu	37	17	62131646	62131646	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:62131646G>T	ENST00000433197.3	-	15	2012	c.1917C>A	c.(1915-1917)taC>taA	p.Y639*		NM_001433.3	NP_001424.3			endoplasmic reticulum to nucleus signaling 1											central_nervous_system(4)|kidney(1)|lung(2)|ovary(1)|stomach(1)	9						CGATGGCAATGTACTGGAATT	0.483																																																	0													61.0	59.0	59.0					17																	62131646		2018	4200	6218	SO:0001587	stop_gained	0			AF059198	CCDS45762.1	17q23	2011-08-12	2007-08-14			ENSG00000178607			3449	protein-coding gene	gene with protein product	"""inositol-requiring enzyme 1"""	604033	"""ER to nucleus signalling 1"""			9637683	Standard	NM_001433		Approved	IRE1, IRE1P	uc002jdz.2	O75460		ENST00000433197.3:c.1917C>A	17.37:g.62131646G>T	ENSP00000401445:p.Tyr639*			Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_KEN_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like_supfam,smart_PQQ_beta_propeller_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PUG-dom,pfscan_Prot_kinase_dom	p.Y639*	ENST00000433197.3	37	c.1917	CCDS45762.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.624098	0.97714	.	.	ENSG00000178607	ENST00000433197	.	.	.	5.49	3.49	0.39957	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.834	9.701	0.40187	0.2147:0.0:0.7853:0.0	.	.	.	.	X	639	.	ENSP00000401445:Y639X	Y	-	3	2	ERN1	59485378	1.000000	0.71417	1.000000	0.80357	0.657000	0.38888	3.100000	0.50275	1.324000	0.45282	0.655000	0.94253	TAC	ERN1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000178607		0.483	ERN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERN1	HGNC	protein_coding	OTTHUMT00000443734.2		0.00	36	0	G	NM_001433		62131646	-1			no_errors	ENST00000433197	ensembl	human	known	74_37	nonsense	13.33	26	4	SNP	1.000	T
ETHE1	23474	genome.wustl.edu	37	19	44015664	44015664	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:44015664G>T	ENST00000292147.2	-	4	496	c.430C>A	c.(430-432)Ctg>Atg	p.L144M	ETHE1_ENST00000600651.1_Missense_Mutation_p.L144M	NM_014297.3	NP_055112.2	O95571	ETHE1_HUMAN	ethylmalonic encephalopathy 1	144					cellular nitrogen compound metabolic process (GO:0034641)|glutathione metabolic process (GO:0006749)|hydrogen sulfide metabolic process (GO:0070813)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|sulfur dioxygenase activity (GO:0050313)			central_nervous_system(1)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	5		Prostate(69;0.0153)				TGGTCATTCAGGACGAAGGTG	0.592																																																	0													89.0	68.0	75.0					19																	44015664		2203	4300	6503	SO:0001583	missense	0				CCDS12622.1	19q13.32	2014-06-20				ENSG00000105755	1.13.11.18		23287	protein-coding gene	gene with protein product		608451				19136963	Standard	NM_014297		Approved	YF13H12, HSCO	uc002owp.3	O95571		ENST00000292147.2:c.430C>A	19.37:g.44015664G>T	ENSP00000292147:p.Leu144Met		Q96HR0|Q9H001	Missense_Mutation	SNP	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	p.L144M	ENST00000292147.2	37	c.430	CCDS12622.1	19	.	.	.	.	.	.	.	.	.	.	G	16.19	3.054224	0.55218	.	.	ENSG00000105755	ENST00000292147	D	0.96200	-3.94	4.95	2.81	0.32909	Beta-lactamase-like (2);	0.565893	0.16775	N	0.200034	D	0.95351	0.8491	L	0.46670	1.46	0.32713	N	0.511372	B;D	0.58620	0.42;0.983	B;D	0.68353	0.155;0.957	D	0.93273	0.6653	10	0.36615	T	0.2	-10.392	6.576	0.22567	0.2998:0.0:0.7002:0.0	.	117;144	B2RCZ7;O95571	.;ETHE1_HUMAN	M	144	ENSP00000292147:L144M	ENSP00000292147:L144M	L	-	1	2	ETHE1	48707504	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	1.476000	0.35420	0.780000	0.33566	0.555000	0.69702	CTG	ETHE1	-	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	ENSG00000105755		0.592	ETHE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETHE1	HGNC	protein_coding	OTTHUMT00000463184.1	-	0.00	60	0	G	NM_014297		44015664	-1	tier1	-	no_errors	ENST00000292147	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.979	T
EXD3	54932	genome.wustl.edu	37	9	140201422	140201422	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr9:140201422G>T	ENST00000340951.4	-	22	2806	c.2611C>A	c.(2611-2613)Ccg>Acg	p.P871T	EXD3_ENST00000342129.4_Missense_Mutation_p.P509T	NM_017820.3	NP_060290.3	Q9NX53	MUT7B_HUMAN	exonuclease 3'-5' domain containing 3	0										NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)	12						CTGCTGGCCGGGCTGGGGGCT	0.652																																																	0													17.0	21.0	19.0					9																	140201422		1914	4092	6006	SO:0001583	missense	0				CCDS48066.1, CCDS75942.1	9q34.3	2009-03-04			ENSG00000187609	ENSG00000187609			26023	protein-coding gene	gene with protein product							Standard	XM_005266093		Approved	LOC54932, FLJ20433, mut-7	uc004cmp.2	Q8N9H8	OTTHUMG00000156149	ENST00000340951.4:c.2611C>A	9.37:g.140201422G>T	ENSP00000340474:p.Pro871Thr		Q6P1M1|Q8IXT8	Missense_Mutation	SNP	pfam_Mut7-C_RNAse_dom,pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	p.P871T	ENST00000340951.4	37	c.2611	CCDS48066.1	9	.	.	.	.	.	.	.	.	.	.	G	11.52	1.662684	0.29515	.	.	ENSG00000187609	ENST00000342129;ENST00000340951	T;T	0.70045	-0.45;0.14	3.07	-1.47	0.08772	.	.	.	.	.	T	0.46927	0.1418	L	0.29908	0.895	0.09310	N	1	B;B	0.21606	0.058;0.035	B;B	0.14023	0.01;0.007	T	0.39563	-0.9608	9	0.87932	D	0	.	2.4157	0.04436	0.2686:0.0:0.3185:0.4129	.	509;871	Q8N9H8-3;Q8N9H8	.;MUT7_HUMAN	T	509;871	ENSP00000343705:P509T;ENSP00000340474:P871T	ENSP00000340474:P871T	P	-	1	0	EXD3	139321243	0.002000	0.14202	0.000000	0.03702	0.050000	0.14768	1.029000	0.30140	-0.177000	0.10690	0.561000	0.74099	CCG	EXD3	-	NULL	ENSG00000187609		0.652	EXD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXD3	HGNC	protein_coding	OTTHUMT00000343182.1	-	0.00	65	0	G	NM_017820		140201422	-1	tier1	-	no_errors	ENST00000340951	ensembl	human	known	74_37	missense	44.19	24	19	SNP	0.000	T
FAM171A1	221061	genome.wustl.edu	37	10	15256581	15256581	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr10:15256581G>A	ENST00000378116.4	-	8	1012	c.1006C>T	c.(1006-1008)Cgt>Tgt	p.R336C	FAM171A1_ENST00000477161.1_5'UTR	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	336						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						TGGTGCTGACGAGGTTTCAAG	0.458																																																	0													55.0	53.0	54.0					10																	15256581		2203	4300	6503	SO:0001583	missense	0			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1006C>T	10.37:g.15256581G>A	ENSP00000367356:p.Arg336Cys		D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	pfam_Uncharacterised_FAM171	p.R336C	ENST00000378116.4	37	c.1006	CCDS31154.1	10	.	.	.	.	.	.	.	.	.	.	G	14.42	2.529961	0.45073	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	T	0.36157	1.27	4.96	4.96	0.65561	.	0.056917	0.64402	D	0.000001	T	0.62085	0.2399	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.66512	-0.5905	10	0.87932	D	0	-19.3892	18.4116	0.90554	0.0:0.0:1.0:0.0	.	336	Q5VUB5	F1711_HUMAN	C	336;337	ENSP00000367356:R336C	ENSP00000367356:R336C	R	-	1	0	FAM171A1	15296587	1.000000	0.71417	0.975000	0.42487	0.540000	0.34992	7.726000	0.84824	2.564000	0.86499	0.563000	0.77884	CGT	FAM171A1	-	pfam_Uncharacterised_FAM171	ENSG00000148468		0.458	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	HGNC	protein_coding	OTTHUMT00000046984.1	-	0.00	46	0	G	XM_167709		15256581	-1	tier1	-	no_errors	ENST00000378116	ensembl	human	known	74_37	missense	30.43	16	7	SNP	0.997	A
FAM47C	442444	genome.wustl.edu	37	X	37027002	37027002	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:37027002C>T	ENST00000358047.3	+	1	571	c.519C>T	c.(517-519)gaC>gaT	p.D173D		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	173										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						AGACAACTGACGAACCCACGG	0.607																																																	0													42.0	39.0	40.0					X																	37027002		2202	4300	6502	SO:0001819	synonymous_variant	0			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.519C>T	X.37:g.37027002C>T			Q6ZU46	Silent	SNP	NULL	p.D173	ENST00000358047.3	37	c.519	CCDS35227.1	X																																																																																			FAM47C	-	NULL	ENSG00000198173		0.607	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	-	0.00	58	0	C	NM_001013736		37027002	+1	tier1	-	no_errors	ENST00000358047	ensembl	human	known	74_37	silent	40.00	24	16	SNP	0.000	T
FAM47C	442444	genome.wustl.edu	37	X	37028719	37028719	+	Missense_Mutation	SNP	C	C	T	rs199727942		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:37028719C>T	ENST00000358047.3	+	1	2288	c.2236C>T	c.(2236-2238)Cgg>Tgg	p.R746W		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	746										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						TCCCAAGCCTCGGGTTTCCAG	0.632																																																	0								C	TRP/ARG	0,3833		0,0,1631,571	46.0	45.0	46.0		2236	-1.9	0.0	X		46	2,6726		0,2,2426,1872	no	missense	FAM47C	NM_001013736.2	101	0,2,4057,2443	TT,TC,CC,C		0.0297,0.0,0.0189	probably-damaging	746/1036	37028719	2,10559	2202	4300	6502	SO:0001583	missense	0			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2236C>T	X.37:g.37028719C>T	ENSP00000367913:p.Arg746Trp		Q6ZU46	Missense_Mutation	SNP	NULL	p.R746W	ENST00000358047.3	37	c.2236	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	-	6.353	0.433266	0.12045	0.0	2.97E-4	ENSG00000198173	ENST00000358047	T	0.16597	2.33	0.929	-1.86	0.07760	.	.	.	.	.	T	0.09818	0.0241	L	0.46157	1.445	0.09310	N	1	P	0.38711	0.643	B	0.14578	0.011	T	0.24404	-1.0161	9	0.66056	D	0.02	.	5.426	0.16425	1.0E-4:0.3759:0.624:0.0	.	746	Q5HY64	FA47C_HUMAN	W	746	ENSP00000367913:R746W	ENSP00000367913:R746W	R	+	1	2	FAM47C	36938640	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	-0.358000	0.07641	0.253000	0.21552	0.257000	0.18616	CGG	FAM47C	-	NULL	ENSG00000198173		0.632	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	-	0.00	113	0	C	NM_001013736		37028719	+1	tier1	rs199727942	no_errors	ENST00000358047	ensembl	human	known	74_37	missense	7.07	92	7	SNP	0.005	T
FAM69A	388650	genome.wustl.edu	37	1	93316498	93316498	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:93316498C>A	ENST00000370310.4	-	3	274	c.204G>T	c.(202-204)aaG>aaT	p.K68N		NM_001006605.4|NM_001252269.1|NM_001252271.1	NP_001006606.2|NP_001239198.1|NP_001239200.1	Q5T7M9	FA69A_HUMAN	family with sequence similarity 69, member A	68						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4		all_lung(203;0.00265)|Lung NSC(277;0.00562)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000563)|all cancers(265;0.000751)|Epithelial(280;0.127)		TAACTCCAGTCTTGTACTTGT	0.343																																																	0													69.0	61.0	63.0					1																	93316498		1832	4083	5915	SO:0001583	missense	0			AK027146	CCDS44173.1, CCDS72822.1, CCDS72823.1, CCDS72824.1, CCDS72825.1	1p22	2014-06-25			ENSG00000154511	ENSG00000154511			32213	protein-coding gene	gene with protein product		614542				21334309	Standard	NM_001006605		Approved	FLJ23493	uc001dpg.3	Q5T7M9	OTTHUMG00000010894	ENST00000370310.4:c.204G>T	1.37:g.93316498C>A	ENSP00000359333:p.Lys68Asn		Q6IRV2	Missense_Mutation	SNP	pfam_FAM69_kinase_dom	p.K68N	ENST00000370310.4	37	c.204	CCDS44173.1	1	.	.	.	.	.	.	.	.	.	.	C	13.75	2.331798	0.41297	.	.	ENSG00000154511	ENST00000370310;ENST00000401027	T	0.46819	0.86	5.81	2.84	0.33178	.	0.215281	0.48767	N	0.000169	T	0.19644	0.0472	L	0.50333	1.59	0.41869	D	0.990261	B;P;P	0.38922	0.421;0.651;0.589	B;B;B	0.33454	0.08;0.115;0.164	T	0.02705	-1.1121	10	0.38643	T	0.18	-11.6087	7.7157	0.28702	0.0:0.7101:0.1336:0.1562	.	61;68;68	B4E174;Q5T7M9;Q5T7M9-2	.;FA69A_HUMAN;.	N	68	ENSP00000359333:K68N	ENSP00000359333:K68N	K	-	3	2	FAM69A	93089086	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.527000	0.45615	0.313000	0.23062	-0.223000	0.12442	AAG	FAM69A	-	NULL	ENSG00000154511		0.343	FAM69A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM69A	HGNC	protein_coding	OTTHUMT00000030046.2	-	0.00	55	0	C	NM_001006605		93316498	-1	tier1	-	no_errors	ENST00000370310	ensembl	human	known	74_37	missense	31.25	22	10	SNP	1.000	A
FAM71B	153745	genome.wustl.edu	37	5	156590082	156590082	+	Silent	SNP	G	G	T	rs548135799		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:156590082G>T	ENST00000302938.4	-	2	1289	c.1194C>A	c.(1192-1194)ctC>ctA	p.L398L		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	398						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGGTGGAGATGAGGGGTCCCA	0.517																																																	0													68.0	72.0	70.0					5																	156590082		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1194C>A	5.37:g.156590082G>T			Q1EDD9|Q8TC64|Q96LY8	Silent	SNP	pfam_DUF3699	p.L398	ENST00000302938.4	37	c.1194	CCDS4335.1	5																																																																																			FAM71B	-	NULL	ENSG00000170613		0.517	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71B	HGNC	protein_coding	OTTHUMT00000252570.2	-	0.00	50	0	G	NM_130899		156590082	-1	tier1	-	no_errors	ENST00000302938	ensembl	human	known	74_37	silent	32.43	25	12	SNP	0.076	T
FBN1	2200	genome.wustl.edu	37	15	48717990	48717990	+	Missense_Mutation	SNP	G	G	T	rs372369490		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr15:48717990G>T	ENST00000316623.5	-	59	7731	c.7276C>A	c.(7276-7278)Cat>Aat	p.H2426N		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2426	EGF-like 41; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CAAATGCAATGATATGATCCT	0.353																																																	0													136.0	116.0	123.0					15																	48717990		2198	4296	6494	SO:0001583	missense	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.7276C>A	15.37:g.48717990G>T	ENSP00000325527:p.His2426Asn		B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.H2426N	ENST00000316623.5	37	c.7276	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	G	18.41	3.617561	0.66787	.	.	ENSG00000166147	ENST00000316623	D	0.91521	-2.86	6.17	6.17	0.99709	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.299915	0.38111	N	0.001818	D	0.83986	0.5373	N	0.11698	0.16	0.80722	D	1	B	0.27791	0.189	B	0.22386	0.039	T	0.79398	-0.1820	10	0.46703	T	0.11	.	20.4745	0.99168	0.0:0.0:1.0:0.0	.	2426	P35555	FBN1_HUMAN	N	2426	ENSP00000325527:H2426N	ENSP00000325527:H2426N	H	-	1	0	FBN1	46505282	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	5.801000	0.69115	2.941000	0.99782	0.655000	0.94253	CAT	FBN1	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom	ENSG00000166147		0.353	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1		0.00	76	0	G			48717990	-1			no_errors	ENST00000316623	ensembl	human	known	74_37	missense	6.06	30	2	SNP	1.000	T
FCGBP	8857	genome.wustl.edu	37	19	40398361	40398361	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:40398361C>T	ENST00000221347.6	-	14	6613	c.6606G>A	c.(6604-6606)gcG>gcA	p.A2202A		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2202	VWFD 5. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGCCCGCGTACGCCGCCGGCA	0.697																																																	0													31.0	39.0	36.0					19																	40398361		2019	3807	5826	SO:0001819	synonymous_variant	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.6606G>A	19.37:g.40398361C>T			O95784	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.A2202	ENST00000221347.6	37	c.6606	CCDS12546.1	19																																																																																			FCGBP	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000090920		0.697	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	-	0.00	138	0	C	NM_003890		40398361	-1	tier1	-	no_errors	ENST00000221347	ensembl	human	known	74_37	silent	8.09	159	14	SNP	0.427	T
FGL2	10875	genome.wustl.edu	37	7	76826238	76826238	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:76826238G>T	ENST00000248598.5	-	2	710	c.678C>A	c.(676-678)acC>acA	p.T226T	RP11-467H10.2_ENST00000459742.1_RNA|CCDC146_ENST00000285871.4_Intron|CCDC146_ENST00000431197.1_Intron	NM_006682.2	NP_006673.1	Q14314	FGL2_HUMAN	fibrinogen-like 2	226	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)				breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	13						TAACTCTGTAGGTCTCACTGC	0.443																																																	0													90.0	85.0	87.0					7																	76826238		2203	4299	6502	SO:0001819	synonymous_variant	0			Z36531	CCDS5591.1	7q11.23	2013-02-06			ENSG00000127951	ENSG00000127951		"""Fibrinogen C domain containing"""	3696	protein-coding gene	gene with protein product		605351				7642106	Standard	NM_006682		Approved	pT49, T49	uc003ugb.3	Q14314	OTTHUMG00000130681	ENST00000248598.5:c.678C>A	7.37:g.76826238G>T				Silent	SNP	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.T226	ENST00000248598.5	37	c.678	CCDS5591.1	7																																																																																			FGL2	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000127951		0.443	FGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGL2	HGNC	protein_coding	OTTHUMT00000253176.1		0.00	27	0	G	NM_006682		76826238	-1			no_errors	ENST00000248598	ensembl	human	known	74_37	silent	44.44	15	12	SNP	0.994	T
FILIP1L	11259	genome.wustl.edu	37	3	99568551	99568551	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:99568551C>A	ENST00000354552.3	-	5	2439	c.1969G>T	c.(1969-1971)Gag>Tag	p.E657*	FILIP1L_ENST00000383694.2_Nonsense_Mutation_p.E417*|FILIP1L_ENST00000331335.5_Nonsense_Mutation_p.E657*|FILIP1L_ENST00000471562.1_Nonsense_Mutation_p.E417*|FILIP1L_ENST00000487087.1_Nonsense_Mutation_p.E233*|FILIP1L_ENST00000476723.1_Intron|CMSS1_ENST00000421999.2_Intron|CMSS1_ENST00000496116.1_Intron	NM_182909.2	NP_878913.2	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like	657						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	35						TCTAGAGTCTCATATTCATCT	0.368																																																	0													182.0	162.0	168.0					3																	99568551		1875	4105	5980	SO:0001587	stop_gained	0				CCDS43117.1, CCDS43118.1, CCDS43119.1, CCDS63700.1, CCDS74969.1	3q12.1	2011-10-21			ENSG00000168386	ENSG00000168386			24589	protein-coding gene	gene with protein product	"""downregulated in ovarian cancer 1"", ""GPBP-interacting protein of 130 kDa"""	612993				8314147, 15935955, 21832087	Standard	NM_001282793		Approved	DOC-1, GIP130	uc003dtm.3	Q4L180	OTTHUMG00000159055	ENST00000354552.3:c.1969G>T	3.37:g.99568551C>A	ENSP00000346560:p.Glu657*		B2CNV7|B2CNV8|Q13597|Q2YDY5|Q6KFX5|Q6KFX6|Q6KFX7|Q8IUM3|Q8N6Z0	Nonsense_Mutation	SNP	pfam_Cortactin-binding_p2_N,superfamily_Prefoldin,prints_Tropomyosin	p.E657*	ENST00000354552.3	37	c.1969	CCDS43117.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.186024	0.94885	.	.	ENSG00000168386	ENST00000354552;ENST00000487087;ENST00000471562;ENST00000331335;ENST00000383694;ENST00000441620;ENST00000495625	.	.	.	5.89	5.89	0.94794	.	0.000000	0.52532	D	0.000064	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	-15.9146	20.2618	0.98447	0.0:1.0:0.0:0.0	.	.	.	.	X	657;233;417;657;417;403;417	.	ENSP00000327880:E657X	E	-	1	0	FILIP1L	101051241	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	6.071000	0.71229	2.793000	0.96121	0.655000	0.94253	GAG	FILIP1L	-	NULL	ENSG00000168386		0.368	FILIP1L-001	KNOWN	basic|CCDS	protein_coding	FILIP1L	HGNC	protein_coding	OTTHUMT00000353069.1	-	0.00	86	0	C	NM_014890		99568551	-1	tier1	-	no_errors	ENST00000354552	ensembl	human	known	74_37	nonsense	34.85	43	23	SNP	1.000	A
FLG	2312	genome.wustl.edu	37	1	152284954	152284954	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:152284954G>T	ENST00000368799.1	-	3	2443	c.2408C>A	c.(2407-2409)tCt>tAt	p.S803Y	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	803	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGAGGACTCAGACTGTTTATG	0.567									Ichthyosis																																								0													255.0	248.0	250.0					1																	152284954		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2408C>A	1.37:g.152284954G>T	ENSP00000357789:p.Ser803Tyr		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.S803Y	ENST00000368799.1	37	c.2408	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	-	5.200	0.222458	0.09863	.	.	ENSG00000143631	ENST00000368799	T	0.03801	3.8	3.46	1.5	0.22942	.	.	.	.	.	T	0.07324	0.0185	M	0.80028	2.48	0.09310	N	1	D	0.59357	0.985	P	0.62813	0.907	T	0.15206	-1.0445	9	0.66056	D	0.02	.	4.5977	0.12338	0.1299:0.2279:0.6422:0.0	.	803	P20930	FILA_HUMAN	Y	803	ENSP00000357789:S803Y	ENSP00000357789:S803Y	S	-	2	0	FLG	150551578	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.096000	0.11059	0.176000	0.19873	0.479000	0.44913	TCT	FLG	-	prints_Filaggrin	ENSG00000143631		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	190	0	G	NM_002016		152284954	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	32.09	90	43	SNP	0.000	T
FOXM1	2305	genome.wustl.edu	37	12	2967850	2967850	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:2967850C>A	ENST00000359843.3	-	9	2314	c.2246G>T	c.(2245-2247)gGc>gTc	p.G749V	AC005841.1_ENST00000382678.3_5'Flank|FOXM1_ENST00000342628.2_Missense_Mutation_p.G787V|ITFG2_ENST00000545509.1_Intron|Y_RNA_ENST00000410561.1_RNA|FOXM1_ENST00000361953.3_Missense_Mutation_p.G734V	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	749					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			GTTGTCAGGGCCCAGTGGGTC	0.577																																																	0													61.0	55.0	57.0					12																	2967850		2203	4300	6503	SO:0001583	missense	0			Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.2246G>T	12.37:g.2967850C>A	ENSP00000352901:p.Gly749Val		O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.G787V	ENST00000359843.3	37	c.2360	CCDS8515.1	12	.	.	.	.	.	.	.	.	.	.	C	14.60	2.582510	0.46006	.	.	ENSG00000111206	ENST00000342628;ENST00000361953;ENST00000359843	D;D;D	0.94828	-3.53;-3.5;-3.42	4.72	4.72	0.59763	.	0.342564	0.29522	N	0.011919	D	0.96147	0.8744	M	0.69823	2.125	0.80722	D	1	D;D;D;D;D	0.76494	0.991;0.998;0.999;0.998;0.999	P;D;D;D;D	0.68621	0.856;0.911;0.959;0.911;0.959	D	0.95861	0.8883	10	0.72032	D	0.01	.	10.4457	0.44493	0.0:0.912:0.0:0.0879	.	733;749;734;749;787	A8K591;Q53Y49;Q08050-2;Q08050;Q08050-3	.;.;.;FOXM1_HUMAN;.	V	787;734;749	ENSP00000342307:G787V;ENSP00000354492:G734V;ENSP00000352901:G749V	ENSP00000342307:G787V	G	-	2	0	FOXM1	2838111	1.000000	0.71417	0.995000	0.50966	0.453000	0.32348	2.953000	0.49105	2.445000	0.82738	0.561000	0.74099	GGC	FOXM1	-	NULL	ENSG00000111206		0.577	FOXM1-002	KNOWN	basic|CCDS	protein_coding	FOXM1	HGNC	protein_coding	OTTHUMT00000398272.1	-	0.00	69	0	C	NM_021953		2967850	-1	tier1	-	no_errors	ENST00000342628	ensembl	human	known	74_37	missense	43.40	30	23	SNP	1.000	A
GAA	2548	genome.wustl.edu	37	17	78090818	78090818	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:78090818G>T	ENST00000302262.3	+	16	2460	c.2241G>T	c.(2239-2241)ggG>ggT	p.G747G	GAA_ENST00000390015.3_Silent_p.G747G	NM_000152.3	NP_000143.2	P10253	LYAG_HUMAN	glucosidase, alpha; acid	747					cardiac muscle contraction (GO:0060048)|diaphragm contraction (GO:0002086)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|heart morphogenesis (GO:0003007)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|maltose metabolic process (GO:0000023)|muscle cell cellular homeostasis (GO:0046716)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|regulation of the force of heart contraction (GO:0002026)|sucrose metabolic process (GO:0005985)|tissue development (GO:0009888)|vacuolar sequestering (GO:0043181)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)|Miglitol(DB00491)	TCCTGTGGGGGGAGGCCCTGC	0.632																																																	0													69.0	66.0	67.0					17																	78090818		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32760.1	17q25.2-q25.3	2014-09-17	2008-08-01				3.2.1.20		4065	protein-coding gene	gene with protein product	"""Pompe disease"", ""glycogen storage disease type II"""	606800					Standard	NM_000152		Approved		uc002jxq.3	P10253		ENST00000302262.3:c.2241G>T	17.37:g.78090818G>T			Q09GN4|Q14351|Q16302|Q8IWE7	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.G747	ENST00000302262.3	37	c.2241	CCDS32760.1	17																																																																																			GAA	-	pfam_Glyco_hydro_31	ENSG00000171298		0.632	GAA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GAA	HGNC	protein_coding	OTTHUMT00000437441.1	-	0.00	50	0	G			78090818	+1	tier1	-	no_errors	ENST00000302262	ensembl	human	known	74_37	silent	31.58	39	18	SNP	0.007	T
GAD1	2571	genome.wustl.edu	37	2	171702547	171702547	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:171702547G>T	ENST00000358196.3	+	10	1526	c.976G>T	c.(976-978)Gca>Tca	p.A326S		NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	326					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						TGATTTTGAGGCAAAAATTCT	0.358																																																	0													62.0	66.0	65.0					2																	171702547		2203	4300	6503	SO:0001583	missense	0				CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.976G>T	2.37:g.171702547G>T	ENSP00000350928:p.Ala326Ser		Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,pfam_Aminotrans_V/Cys_dSase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase	p.A326S	ENST00000358196.3	37	c.976	CCDS2239.1	2	.	.	.	.	.	.	.	.	.	.	G	12.98	2.099742	0.37048	.	.	ENSG00000128683	ENST00000358196	T	0.39787	1.06	5.91	3.19	0.36642	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.203184	0.51477	D	0.000085	T	0.30355	0.0762	L	0.31845	0.965	0.80722	D	1	B	0.06786	0.001	B	0.12156	0.007	T	0.05037	-1.0910	10	0.25751	T	0.34	-3.2305	11.1413	0.48404	0.1972:0.0:0.8028:0.0	.	326	Q99259	DCE1_HUMAN	S	326	ENSP00000350928:A326S	ENSP00000350928:A326S	A	+	1	0	GAD1	171410793	1.000000	0.71417	0.990000	0.47175	0.848000	0.48234	5.385000	0.66231	0.419000	0.25927	0.655000	0.94253	GCA	GAD1	-	pfam_PyrdxlP-dep_de-COase,pfam_Aminotrans_V/Cys_dSase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase	ENSG00000128683		0.358	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAD1	HGNC	protein_coding	OTTHUMT00000102664.2	-	0.00	47	0	G			171702547	+1	tier1	-	no_errors	ENST00000358196	ensembl	human	known	74_37	missense	33.96	35	18	SNP	1.000	T
GAL3ST4	79690	genome.wustl.edu	37	7	99757845	99757845	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:99757845C>A	ENST00000360039.4	-	4	1559	c.1167G>T	c.(1165-1167)ctG>ctT	p.L389L	GAL3ST4_ENST00000413800.1_Silent_p.L389L|GAL3ST4_ENST00000411994.1_3'UTR|C7orf43_ENST00000419841.1_5'Flank|C7orf43_ENST00000457641.1_5'Flank|C7orf43_ENST00000316937.3_5'Flank|GAL3ST4_ENST00000423751.1_3'UTR|GAL3ST4_ENST00000426974.2_Silent_p.L327L	NM_024637.4	NP_078913.3	Q96RP7	G3ST4_HUMAN	galactose-3-O-sulfotransferase 4	389					cell-cell signaling (GO:0007267)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(5)|prostate(1)|upper_aerodigestive_tract(1)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CAGCTGTCTGCAGCCGGCCCT	0.617																																																	0													46.0	52.0	50.0					7																	99757845		2203	4300	6503	SO:0001819	synonymous_variant	0			AF316113	CCDS5688.1	7q22.1	2007-04-02			ENSG00000197093	ENSG00000197093		"""Sulfotransferases, membrane-bound"""	24145	protein-coding gene	gene with protein product		608235				11333265	Standard	NM_024637		Approved	FLJ12116	uc003utu.3	Q96RP7	OTTHUMG00000154885	ENST00000360039.4:c.1167G>T	7.37:g.99757845C>A			A4D2A8|B4DWL8|D6W5U5|Q8N3P7|Q8WZ17|Q96E33|Q9HA78	Silent	SNP	pfam_Gal-3-0_sulfotransfrase,superfamily_P-loop_NTPase	p.L389	ENST00000360039.4	37	c.1167	CCDS5688.1	7																																																																																			GAL3ST4	-	pfam_Gal-3-0_sulfotransfrase	ENSG00000197093		0.617	GAL3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAL3ST4	HGNC	protein_coding	OTTHUMT00000337495.2	-	0.00	41	0	C	NM_024637		99757845	-1	tier1	-	no_errors	ENST00000360039	ensembl	human	known	74_37	silent	27.87	44	17	SNP	0.997	A
GAS2L2	246176	genome.wustl.edu	37	17	34072962	34072962	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:34072962G>T	ENST00000254466.6	-	6	1581	c.1554C>A	c.(1552-1554)agC>agA	p.S518R	GAS2L2_ENST00000587565.1_Missense_Mutation_p.S502R	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	518					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CACCAGGAAAGCTCCTTCCTG	0.622																																																	0													39.0	44.0	42.0					17																	34072962		2203	4300	6503	SO:0001583	missense	0			AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1554C>A	17.37:g.34072962G>T	ENSP00000254466:p.Ser518Arg		Q8NHY4	Missense_Mutation	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.S518R	ENST00000254466.6	37	c.1554	CCDS11298.1	17	.	.	.	.	.	.	.	.	.	.	G	10.73	1.433175	0.25813	.	.	ENSG00000132139	ENST00000254466	T	0.23950	1.88	4.5	-1.95	0.07548	.	1.241570	0.05432	N	0.546207	T	0.16557	0.0398	L	0.27053	0.805	0.09310	N	1	B	0.34015	0.435	B	0.28305	0.088	T	0.28235	-1.0050	10	0.35671	T	0.21	-2.9991	9.5328	0.39205	0.5202:0.0:0.4798:0.0	.	518	Q8NHY3	GA2L2_HUMAN	R	518	ENSP00000254466:S518R	ENSP00000254466:S518R	S	-	3	2	GAS2L2	31097075	0.000000	0.05858	0.003000	0.11579	0.075000	0.17131	0.042000	0.13949	-0.298000	0.08921	0.655000	0.94253	AGC	GAS2L2	-	NULL	ENSG00000132139		0.622	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2L2	HGNC	protein_coding	OTTHUMT00000256497.1	-	0.00	67	0	G	NM_139285		34072962	-1	tier1	-	no_errors	ENST00000254466	ensembl	human	known	74_37	missense	9.26	49	5	SNP	0.000	T
GIMAP7	168537	genome.wustl.edu	37	7	150217465	150217465	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:150217465G>T	ENST00000313543.4	+	2	560	c.403G>T	c.(403-405)Gaa>Taa	p.E135*		NM_153236.3	NP_694968.1	Q8NHV1	GIMA7_HUMAN	GTPase, IMAP family member 7	135	AIG1-type G.				GTP catabolic process (GO:0006184)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)			breast(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	17			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CACTCGCAAAGAAGAGTTGGA	0.527																																																	0													76.0	70.0	72.0					7																	150217465		2203	4300	6503	SO:0001587	stop_gained	0			BC027613	CCDS5903.1	7q36.1	2014-04-04			ENSG00000179144	ENSG00000179144		"""GTPases, IMAP"""	22404	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 7"""					15474311	Standard	NM_153236		Approved	MGC27027, IAN7	uc003whk.3	Q8NHV1	OTTHUMG00000157626	ENST00000313543.4:c.403G>T	7.37:g.150217465G>T	ENSP00000315474:p.Glu135*			Nonsense_Mutation	SNP	pfam_AIG1,superfamily_P-loop_NTPase	p.E135*	ENST00000313543.4	37	c.403	CCDS5903.1	7	.	.	.	.	.	.	.	.	.	.	G	36	5.660254	0.96734	.	.	ENSG00000179144	ENST00000313543	.	.	.	5.09	5.09	0.68999	.	0.188486	0.44902	D	0.000408	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.8816	0.63686	0.0:0.0:1.0:0.0	.	.	.	.	X	135	.	ENSP00000315474:E135X	E	+	1	0	GIMAP7	149848398	1.000000	0.71417	0.993000	0.49108	0.681000	0.39784	6.951000	0.75983	2.672000	0.90937	0.655000	0.94253	GAA	GIMAP7	-	pfam_AIG1,superfamily_P-loop_NTPase	ENSG00000179144		0.527	GIMAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP7	HGNC	protein_coding	OTTHUMT00000349277.1	-	0.00	40	0	G	NM_153236		150217465	+1	tier1	-	no_errors	ENST00000313543	ensembl	human	known	74_37	nonsense	26.53	36	13	SNP	0.972	T
GMPS	8833	genome.wustl.edu	37	3	155611407	155611407	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:155611407G>A	ENST00000496455.2	+	2	463	c.128G>A	c.(127-129)cGa>cAa	p.R43Q	GMPS_ENST00000295920.7_Intron	NM_003875.2	NP_003866.1	P49915	GUAA_HUMAN	guanine monphosphate synthase	43	Glutamine amidotransferase type-1. {ECO:0000255|PROSITE-ProRule:PRU00605}.				glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|GMP synthase (glutamine-hydrolyzing) activity (GO:0003922)|GMP synthase activity (GO:0003921)|pyrophosphatase activity (GO:0016462)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamine(DB00130)	GTCATAGACCGAAGAGTGAGG	0.473			T	MLL	AML																																Ovarian(153;896 1876 4149 15499 28134)			Dom	yes		3	3q24	8833	guanine monphosphate synthetase		L	0													93.0	90.0	91.0					3																	155611407		1963	4152	6115	SO:0001583	missense	0			U10860	CCDS46941.1	3q25.31	2013-06-18	2013-06-18		ENSG00000163655	ENSG00000163655	6.3.5.2		4378	protein-coding gene	gene with protein product	"""GMP synthase"""	600358	"""guanine monphosphate synthetase"""			8089153, 9195163	Standard	NM_003875		Approved		uc003faq.3	P49915	OTTHUMG00000158551	ENST00000496455.2:c.128G>A	3.37:g.155611407G>A	ENSP00000419851:p.Arg43Gln		A8K639|B4DXV7|F8W720	Missense_Mutation	SNP	pfam_GATASE,pfam_GMP_synth_C,pfam_Peptidase_C26,pfam_NAD/GMP_synthase,pfam_QueC,pfam_Asn_synthase,pfam_tRNA-specific_2-thiouridylase,tigrfam_GMP_synth_N	p.R43Q	ENST00000496455.2	37	c.128	CCDS46941.1	3	.	.	.	.	.	.	.	.	.	.	G	37	6.026711	0.97216	.	.	ENSG00000163655	ENST00000496455;ENST00000541628	D	0.89939	-2.59	5.93	5.93	0.95920	Glutamine amidotransferase type 1 (2);GMP synthase, N-terminal (1);	0.000000	0.64402	D	0.000001	D	0.96959	0.9007	H	0.97682	4.055	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97631	1.0142	10	0.87932	D	0	-8.4054	20.334	0.98729	0.0:0.0:1.0:0.0	.	43	P49915	GUAA_HUMAN	Q	43	ENSP00000419851:R43Q	ENSP00000419851:R43Q	R	+	2	0	GMPS	157094101	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	9.597000	0.98273	2.808000	0.96608	0.551000	0.68910	CGA	GMPS	-	pfam_GATASE,tigrfam_GMP_synth_N	ENSG00000163655		0.473	GMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMPS	HGNC	protein_coding	OTTHUMT00000351260.2	-	0.00	58	0	G			155611407	+1	tier1	-	no_errors	ENST00000496455	ensembl	human	known	74_37	missense	20.00	44	11	SNP	1.000	A
GNG2	54331	genome.wustl.edu	37	14	52417395	52417395	+	5'UTR	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr14:52417395C>T	ENST00000335281.4	+	0	405				GNG2_ENST00000555472.1_5'UTR|GNG2_ENST00000556752.1_5'UTR|GNG2_ENST00000556766.1_5'UTR|GNG2_ENST00000554875.1_Missense_Mutation_p.P29L|GNG2_ENST00000553299.1_3'UTR|GNG2_ENST00000557376.1_Missense_Mutation_p.P39L|GNG2_ENST00000554736.1_5'UTR|GNG2_ENST00000553432.1_Missense_Mutation_p.P31L	NM_001243774.1	NP_001230703.1	P59768	GBG2_HUMAN	guanine nucleotide binding protein (G protein), gamma 2						adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|energy reserve metabolic process (GO:0006112)|platelet activation (GO:0030168)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|signal transducer activity (GO:0004871)			lung(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	5	all_epithelial(31;0.0659)|Breast(41;0.0684)				Halothane(DB01159)	TCCAGCACTCCGATGGCCAGC	0.448																																																	0													89.0	77.0	81.0					14																	52417395		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AK001024	CCDS32082.1	14q21	2008-07-28				ENSG00000186469			4404	protein-coding gene	gene with protein product		606981				10833460	Standard	NM_053064		Approved		uc001wzj.3	P59768		ENST00000335281.4:c.-2C>T	14.37:g.52417395C>T			Q5JPE2|Q6P9A9	Missense_Mutation	SNP	pfam_G-protein_gamma-like_dom,superfamily_G-protein_gamma-like_dom,smart_G-protein_gamma-like_dom,pfscan_G-protein_gamma-like_dom,prints_Gprotein-gamma	p.P39L	ENST00000335281.4	37	c.116	CCDS32082.1	14	.	.	.	.	.	.	.	.	.	.	C	14.03	2.415016	0.42817	.	.	ENSG00000186469	ENST00000553432;ENST00000557376;ENST00000554875	T;T;T	0.27890	1.64;1.64;1.64	5.21	-0.243	0.13035	.	.	.	.	.	T	0.19725	0.0474	.	.	.	0.29679	N	0.841875	.	.	.	.	.	.	T	0.29549	-1.0008	5	.	.	.	.	3.5724	0.07922	0.4378:0.3138:0.0:0.2484	.	.	.	.	L	31;39;29	ENSP00000451279:P31L;ENSP00000450758:P39L;ENSP00000451536:P29L	.	P	+	2	0	GNG2	51487145	0.653000	0.27358	0.746000	0.31095	0.203000	0.24098	0.551000	0.23361	0.107000	0.17824	-0.857000	0.03018	CCG	GNG2	-	superfamily_G-protein_gamma-like_dom	ENSG00000186469		0.448	GNG2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GNG2	HGNC	protein_coding	OTTHUMT00000411585.1	-	0.00	45	0	C			52417395	+1	tier1	-	no_errors	ENST00000557376	ensembl	human	putative	74_37	missense	18.18	18	4	SNP	0.843	T
GPR161	23432	genome.wustl.edu	37	1	168066341	168066341	+	Silent	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:168066341G>A	ENST00000367838.1	-	5	817	c.504C>T	c.(502-504)tcC>tcT	p.S168S	GPR161_ENST00000361697.2_Silent_p.S168S|GPR161_ENST00000367835.1_Silent_p.S168S|GPR161_ENST00000271357.5_Silent_p.S168S|GPR161_ENST00000367836.1_Silent_p.S36S|GPR161_ENST00000539777.1_Silent_p.S90S|GPR161_ENST00000537209.1_Silent_p.S188S|GPR161_ENST00000546300.1_Silent_p.S54S	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	168					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					CAAACTCCACGGATGACCAAC	0.577																																																	0													73.0	58.0	63.0					1																	168066341		2203	4300	6503	SO:0001819	synonymous_variant	0			AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.504C>T	1.37:g.168066341G>A			B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.S188	ENST00000367838.1	37	c.564	CCDS1268.1	1																																																																																			GPR161	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000143147		0.577	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR161	HGNC	protein_coding	OTTHUMT00000083829.1	-	0.00	30	0	G	NM_007369		168066341	-1	tier1	-	no_errors	ENST00000537209	ensembl	human	known	74_37	silent	18.52	22	5	SNP	0.001	A
GPR17	2840	genome.wustl.edu	37	2	128408921	128408921	+	Silent	SNP	G	G	A	rs367931492		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:128408921G>A	ENST00000272644.3	+	3	770	c.696G>A	c.(694-696)ccG>ccA	p.P232P	LIMS2_ENST00000324938.5_Intron|GPR17_ENST00000393018.3_Silent_p.P232P|LIMS2_ENST00000545738.2_Intron|LIMS2_ENST00000355119.4_Intron|LIMS2_ENST00000410011.1_Intron|LIMS2_ENST00000409254.1_5'Flank|LIMS2_ENST00000409455.1_Intron|GPR17_ENST00000486700.1_3'UTR|LIMS2_ENST00000409808.2_Intron|GPR17_ENST00000544369.1_Silent_p.P232P	NM_001161416.1|NM_001161417.1|NM_005291.2	NP_001154888.1|NP_001154889.1|NP_005282.1	Q13304	GPR17_HUMAN	G protein-coupled receptor 17	232					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)|urinary_tract(1)	19	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		TCACCTTCCCGTTCATCACCA	0.637																																																	0								G	,,,,,,,	0,4406		0,0,2203	140.0	122.0	128.0		,,,696,612,612,696,	-9.3	0.1	2		128	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron,intron,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,intron	GPR17,LIMS2	NM_001136037.2,NM_001161403.1,NM_001161404.1,NM_001161415.1,NM_001161416.1,NM_001161417.1,NM_005291.2,NM_017980.4	,,,,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,,,,	,,,232/368,204/340,204/340,232/368,	128408921	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2148.1	2q21	2014-01-30			ENSG00000144230	ENSG00000144230		"""GPCR / Class A : Orphans"""	4471	protein-coding gene	gene with protein product		603071				8558062	Standard	NM_001161415		Approved		uc002tpc.3	Q13304	OTTHUMG00000131533	ENST00000272644.3:c.696G>A	2.37:g.128408921G>A			A8K9L0|B2R9X0|Q8N5S7|Q9UDZ6|Q9UE21	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Protea_act_rcpt	p.P232	ENST00000272644.3	37	c.696	CCDS2148.1	2																																																																																			GPR17	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000144230		0.637	GPR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR17	HGNC	protein_coding	OTTHUMT00000254390.1	-	0.00	56	0	G			128408921	+1	tier1	-	no_errors	ENST00000272644	ensembl	human	known	74_37	silent	20.97	49	13	SNP	0.005	A
GPR174	84636	genome.wustl.edu	37	X	78426729	78426729	+	Missense_Mutation	SNP	G	G	T	rs376602978		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:78426729G>T	ENST00000276077.1	+	1	261	c.225G>T	c.(223-225)agG>agT	p.R75S		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						TGCCACTGAGGATCTTCTACT	0.393										HNSCC(63;0.18)																																							0													127.0	96.0	106.0					X																	78426729		2203	4300	6503	SO:0001583	missense	0			AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.225G>T	X.37:g.78426729G>T	ENSP00000276077:p.Arg75Ser		Q2M3F7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.R75S	ENST00000276077.1	37	c.225	CCDS14443.1	X	.	.	.	.	.	.	.	.	.	.	g	15.61	2.884059	0.51908	.	.	ENSG00000147138	ENST00000276077	T	0.71579	-0.58	5.18	3.27	0.37495	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.78880	0.4353	M	0.63428	1.95	0.46061	D	0.998845	D	0.89917	1.0	D	0.97110	1.0	T	0.76982	-0.2757	10	0.46703	T	0.11	.	8.7284	0.34483	0.0873:0.1476:0.7651:0.0	.	75	Q9BXC1	GP174_HUMAN	S	75	ENSP00000276077:R75S	ENSP00000276077:R75S	R	+	3	2	GPR174	78313385	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	0.755000	0.26405	0.951000	0.37770	0.534000	0.68092	AGG	GPR174	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000147138		0.393	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR174	HGNC	protein_coding	OTTHUMT00000057327.1	-	0.00	20	0	G	NM_032553		78426729	+1	tier1	-	no_errors	ENST00000276077	ensembl	human	known	74_37	missense	42.86	20	15	SNP	1.000	T
GPR39	2863	genome.wustl.edu	37	2	133403872	133403872	+	3'UTR	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:133403872G>T	ENST00000329321.3	+	0	2524				GPR39_ENST00000470071.1_3'UTR|LYPD1_ENST00000345008.6_Intron|LYPD1_ENST00000397463.2_Intron	NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39						G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CAGACCCAAAGGAGCTGAGTT	0.562																																																	0													34.0	39.0	38.0					2																	133403872		2123	4234	6357	SO:0001624	3_prime_UTR_variant	0			AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.*693G>T	2.37:g.133403872G>T			B2RC12|B6V9G4|Q08AS2|Q53R01	RNA	SNP	-	NULL	ENST00000329321.3	37	NULL	CCDS2170.1	2																																																																																			GPR39	-	-	ENSG00000183840		0.562	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR39	HGNC	protein_coding	OTTHUMT00000254582.1	-	0.00	24	0	G			133403872	+1	tier1	-	no_errors	ENST00000470071	ensembl	human	known	74_37	rna	26.92	19	7	SNP	0.024	T
GPR56	9289	genome.wustl.edu	37	16	57691325	57691325	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:57691325T>C	ENST00000388812.4	+	10	1648	c.1208T>C	c.(1207-1209)cTg>cCg	p.L403P	GPR56_ENST00000379694.4_Missense_Mutation_p.L233P|GPR56_ENST00000568908.1_Missense_Mutation_p.L403P|GPR56_ENST00000538815.1_Missense_Mutation_p.L403P|GPR56_ENST00000562631.1_Missense_Mutation_p.L403P|GPR56_ENST00000567835.1_Missense_Mutation_p.L403P|GPR56_ENST00000379696.3_Missense_Mutation_p.L403P|GPR56_ENST00000562558.1_Missense_Mutation_p.L403P|GPR56_ENST00000568909.1_Missense_Mutation_p.L403P|GPR56_ENST00000456916.1_Missense_Mutation_p.L403P|GPR56_ENST00000540164.2_Missense_Mutation_p.L403P|GPR56_ENST00000388813.5_Missense_Mutation_p.L403P|GPR56_ENST00000544297.1_Missense_Mutation_p.L228P			Q9Y653	GPR56_HUMAN	G protein-coupled receptor 56	403					angiogenesis (GO:0001525)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cerebral cortex radial glia guided migration (GO:0021801)|G-protein coupled receptor signaling pathway (GO:0007186)|layer formation in cerebral cortex (GO:0021819)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron migration (GO:2001223)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cell adhesion (GO:0045785)|positive regulation of Rho protein signal transduction (GO:0035025)|protein kinase C signaling (GO:0070528)|Rho protein signal transduction (GO:0007266)|vascular endothelial growth factor production (GO:0010573)	extracellular vesicular exosome (GO:0070062)|glial limiting end-foot (GO:0097451)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	15						AAGCACTACCTGAGCCTCCTC	0.642																																																	0													176.0	148.0	158.0					16																	57691325		2198	4300	6498	SO:0001583	missense	0			AJ011001	CCDS32460.1, CCDS32461.1, CCDS73893.1	16q13	2014-08-08				ENSG00000205336		"""-"", ""GPCR / Class B : Orphans"""	4512	protein-coding gene	gene with protein product		604110				10049584, 10100861	Standard	XM_005256237		Approved	TM7LN4, TM7XN1	uc002emb.2	Q9Y653		ENST00000388812.4:c.1208T>C	16.37:g.57691325T>C	ENSP00000373464:p.Leu403Pro		A6NIT7|A6NJV9|B0M0K4|B4DR54|O95966|Q6ZMP1|Q8NGB3|Q96HB4	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,prints_GPCR_2_orphan_rcpt_GPR56,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_GPCR_2-like	p.L403P	ENST00000388812.4	37	c.1208	CCDS32460.1	16	.	.	.	.	.	.	.	.	.	.	T	16.50	3.141568	0.57044	.	.	ENSG00000205336	ENST00000388813;ENST00000388812;ENST00000538815;ENST00000456916;ENST00000540164;ENST00000544297;ENST00000379694;ENST00000379696	T;T;T;T;T;T;T;T	0.54279	0.79;0.58;0.79;0.58;0.79;0.58;0.58;0.58	5.11	5.11	0.69529	GPCR, family 2-like (1);	0.000000	0.47455	D	0.000232	T	0.76905	0.4053	M	0.91612	3.225	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;0.997	T	0.82232	-0.0559	10	0.87932	D	0	.	12.3048	0.54895	0.0:0.0:0.0:1.0	.	228;408;403;403;233	F5H144;B4DR54;Q9Y653-2;Q9Y653;E7ENB2	.;.;.;GPR56_HUMAN;.	P	403;403;403;403;403;228;233;403	ENSP00000373465:L403P;ENSP00000373464:L403P;ENSP00000444415:L403P;ENSP00000398034:L403P;ENSP00000444911:L403P;ENSP00000438006:L228P;ENSP00000369016:L233P;ENSP00000369018:L403P	ENSP00000369016:L233P	L	+	2	0	GPR56	56248826	1.000000	0.71417	0.999000	0.59377	0.244000	0.25665	5.944000	0.70219	1.925000	0.55765	0.402000	0.26972	CTG	GPR56	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000205336		0.642	GPR56-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR56	HGNC	protein_coding	OTTHUMT00000433436.3	-	0.00	71	0	T			57691325	+1	tier1	-	no_errors	ENST00000379696	ensembl	human	known	74_37	missense	27.87	44	17	SNP	1.000	C
GRID1	2894	genome.wustl.edu	37	10	87484364	87484364	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr10:87484364G>A	ENST00000327946.7	-	11	1688	c.1603C>T	c.(1603-1605)Cgg>Tgg	p.R535W	GRID1_ENST00000536331.1_Missense_Mutation_p.R106W	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	535					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.R535W(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						TCCATGTACCGCTTGCTGAAG	0.507										Multiple Myeloma(13;0.14)																																							1	Substitution - Missense(1)	large_intestine(1)											78.0	74.0	76.0					10																	87484364		2203	4300	6503	SO:0001583	missense	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1603C>T	10.37:g.87484364G>A	ENSP00000330148:p.Arg535Trp		B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R535W	ENST00000327946.7	37	c.1603	CCDS31236.1	10	.	.	.	.	.	.	.	.	.	.	G	32	5.147142	0.94603	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.27557	1.66;1.66	5.83	5.83	0.93111	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.56001	0.1956	L	0.61387	1.9	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.54951	-0.8216	10	0.72032	D	0.01	.	19.0851	0.93200	0.0:0.0:1.0:0.0	.	535	Q9ULK0	GRID1_HUMAN	W	535;106	ENSP00000330148:R535W;ENSP00000444455:R106W	ENSP00000330148:R535W	R	-	1	2	GRID1	87474344	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.777000	0.99008	2.741000	0.93983	0.650000	0.86243	CGG	GRID1	-	pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000182771		0.507	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3		0.00	16	0	G	XM_043613		87484364	-1			no_errors	ENST00000327946	ensembl	human	known	74_37	missense	11.76	15	2	SNP	1.000	A
H1FOO	132243	genome.wustl.edu	37	3	129268029	129268029	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:129268029C>A	ENST00000324382.2	+	3	569	c.564C>A	c.(562-564)ccC>ccA	p.P188P	H1FOO_ENST00000503977.1_Silent_p.P49P	NM_153833.1	NP_722575.1	Q8IZA3	H1FOO_HUMAN	H1 histone family, member O, oocyte-specific	188					meiotic nuclear division (GO:0007126)|negative regulation of stem cell differentiation (GO:2000737)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of DNA methylation (GO:0044030)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|female germ cell nucleus (GO:0001674)|nucleosome (GO:0000786)|nucleus (GO:0005634)	nucleosomal DNA binding (GO:0031492)			endometrium(1)|lung(4)|skin(1)	6						AGCCTCCTCCCAAGCCAGGCG	0.642																																																	0													33.0	25.0	27.0					3																	129268029		2175	4272	6447	SO:0001819	synonymous_variant	0			AY158091	CCDS3064.1	3q21.3	2011-01-27			ENSG00000178804	ENSG00000178804		"""Histones / Replication-independent"""	18463	protein-coding gene	gene with protein product						12408966	Standard	NM_153833		Approved		uc003emu.3	Q8IZA3	OTTHUMG00000159541	ENST00000324382.2:c.564C>A	3.37:g.129268029C>A			Q86WT7	Silent	SNP	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15	p.P188	ENST00000324382.2	37	c.564	CCDS3064.1	3																																																																																			H1FOO	-	NULL	ENSG00000178804		0.642	H1FOO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H1FOO	HGNC	protein_coding	OTTHUMT00000356100.3	-	0.00	51	0	C	NM_153833		129268029	+1	tier1	-	no_errors	ENST00000324382	ensembl	human	known	74_37	silent	25.00	30	10	SNP	0.010	A
HEPH	9843	genome.wustl.edu	37	X	65420509	65420510	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:65420509_65420510delTG	ENST00000343002.2	+	11	2656_2657	c.1992_1993delTG	c.(1990-1995)actgtgfs	p.V665fs	HEPH_ENST00000374727.3_Frame_Shift_Del_p.V668fs|HEPH_ENST00000441993.2_Frame_Shift_Del_p.V668fs|HEPH_ENST00000336279.5_Frame_Shift_Del_p.V398fs|HEPH_ENST00000519389.1_Frame_Shift_Del_p.V719fs|HEPH_ENST00000419594.1_Intron			Q9BQS7	HEPH_HUMAN	hephaestin	665	Plastocyanin-like 4.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						AGGGCAACACTGTGCAGCTTCA	0.564																																																	0																																										SO:0001589	frameshift_variant	0			AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.1992_1993delTG	X.37:g.65420511_65420512delTG	ENSP00000343939:p.Val665fs		B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Frame_Shift_Del	DEL	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.V719fs	ENST00000343002.2	37	c.2154_2155		X																																																																																			HEPH	-	superfamily_Cupredoxin	ENSG00000089472		0.564	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	HEPH	HGNC	protein_coding	OTTHUMT00000056995.1		0.00	66	0	TG	NM_138737		65420510	+1	tier1		no_errors	ENST00000519389	ensembl	human	known	74_37	frame_shift_del	53.66	19	22	DEL	0.146:0.142	-
HIP1R	9026	genome.wustl.edu	37	12	123341034	123341034	+	Missense_Mutation	SNP	C	C	T	rs372462877		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:123341034C>T	ENST00000253083.4	+	16	1582	c.1457C>T	c.(1456-1458)gCg>gTg	p.A486V		NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related	486					receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		GAGGAGGTGGCGCGGGTGAAG	0.657																																																	0								C	VAL/ALA	0,4390		0,0,2195	78.0	70.0	72.0		1457	3.8	1.0	12		72	1,8589		0,1,4294	no	missense	HIP1R	NM_003959.1	64	0,1,6489	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	486/1069	123341034	1,12979	2195	4295	6490	SO:0001583	missense	0			AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.1457C>T	12.37:g.123341034C>T	ENSP00000253083:p.Ala486Val		A6NHQ6|Q6NXG8|Q9UED9	Missense_Mutation	SNP	pfam_ANTH_dom,pfam_ILWEQ_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_ILWEQ_dom,pfscan_Epsin-like_N,pfscan_ILWEQ_dom	p.A486V	ENST00000253083.4	37	c.1457	CCDS31922.1	12	.	.	.	.	.	.	.	.	.	.	C	18.11	3.551697	0.65311	0.0	1.16E-4	ENSG00000130787	ENST00000253083	T	0.15017	2.46	4.69	3.8	0.43715	.	0.155240	0.56097	D	0.000026	T	0.19127	0.0459	M	0.68317	2.08	0.40252	D	0.97808	P;P;D	0.60575	0.454;0.955;0.988	B;B;B	0.40329	0.048;0.326;0.194	T	0.07404	-1.0774	10	0.38643	T	0.18	-17.602	12.7554	0.57333	0.0:0.9196:0.0:0.0804	.	486;486;474	O75146;Q6NXG8;B3KQW8	HIP1R_HUMAN;.;.	V	486	ENSP00000253083:A486V	ENSP00000253083:A486V	A	+	2	0	HIP1R	121906987	1.000000	0.71417	0.985000	0.45067	0.966000	0.64601	4.962000	0.63687	0.971000	0.38288	0.561000	0.74099	GCG	HIP1R	-	NULL	ENSG00000130787		0.657	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1R	HGNC	protein_coding	OTTHUMT00000400935.1	-	0.00	51	0	C	NM_003959		123341034	+1	tier1	-	no_errors	ENST00000253083	ensembl	human	known	74_37	missense	48.89	23	22	SNP	0.989	T
HMGN2	3151	genome.wustl.edu	37	1	26799755	26799755	+	Intron	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:26799755C>T	ENST00000361427.5	+	2	109					NM_005517.3	NP_005508.1	P05204	HMGN2_HUMAN	high mobility group nucleosomal binding domain 2							chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|lung(2)	3		all_cancers(24;1.9e-24)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.38e-49)|OV - Ovarian serous cystadenocarcinoma(117;5.38e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.026)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.153)|LUSC - Lung squamous cell carcinoma(448;0.227)		CTCCGCTGCCCTCCCCGGCTG	0.682																																																	0																																										SO:0001627	intron_variant	0			BC081567	CCDS283.1	1p36.1	2011-07-01	2011-04-05	2002-08-16	ENSG00000198830	ENSG00000198830		"""High-mobility group / Canonical"""	4986	protein-coding gene	gene with protein product		163910	"""high-mobility group (nonhistone chromosomal) protein 17"", ""high-mobility group nucleosomal binding domain 2"""	HMG17		2037294	Standard	NM_005517		Approved		uc001bmp.4	P05204	OTTHUMG00000003555	ENST00000361427.5:c.16-219C>T	1.37:g.26799755C>T			Q0VGD5|Q6FGI5|Q96C64	RNA	SNP	-	NULL	ENST00000361427.5	37	NULL	CCDS283.1	1																																																																																			HMGN2	-	-	ENSG00000198830		0.682	HMGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGN2	HGNC	protein_coding	OTTHUMT00000009901.1	-	0.00	12	0	C	NM_005517		26799755	+1	tier1	-	no_errors	ENST00000466194	ensembl	human	known	74_37	rna	57.14	3	4	SNP	0.000	T
HMCN1	83872	genome.wustl.edu	37	1	186099753	186099753	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:186099753G>T	ENST00000271588.4	+	85	13383	c.13154G>T	c.(13153-13155)aGa>aTa	p.R4385I	HMCN1_ENST00000367492.2_Missense_Mutation_p.R4385I	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4385	Ig-like C2-type 43.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAGTGGAACAGAAAGGGAGTG	0.478																																																	0													107.0	105.0	105.0					1																	186099753		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.13154G>T	1.37:g.186099753G>T	ENSP00000271588:p.Arg4385Ile		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.R4385I	ENST00000271588.4	37	c.13154	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.559485	0.65538	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.73469	1.46;-0.75	5.48	4.57	0.56435	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.042700	0.85682	D	0.000000	T	0.82125	0.4969	M	0.64676	1.99	0.49051	D	0.999747	D	0.76494	0.999	D	0.83275	0.996	T	0.82444	-0.0454	10	0.59425	D	0.04	.	9.013	0.36153	0.2725:0.0:0.7275:0.0	.	4385	Q96RW7	HMCN1_HUMAN	I	4385	ENSP00000271588:R4385I;ENSP00000356462:R4385I	ENSP00000271588:R4385I	R	+	2	0	HMCN1	184366376	1.000000	0.71417	0.860000	0.33809	0.624000	0.37722	5.203000	0.65174	1.452000	0.47756	0.591000	0.81541	AGA	HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000143341		0.478	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	39	0	G	NM_031935		186099753	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	28.57	20	8	SNP	1.000	T
HNRNPUL1	11100	genome.wustl.edu	37	19	41812357	41812357	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:41812357G>T	ENST00000392006.3	+	15	2631	c.2458G>T	c.(2458-2460)Gcc>Tcc	p.A820S	HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.A720S|HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.A720S|HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.A731S|HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.A730S|HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.A768S|HNRNPUL1_ENST00000378215.4_Missense_Mutation_p.A716S	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	820	Gln-rich.|Necessary for interaction with TP53.|Tyr-rich.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						TCCCCAGTATGCCCAGCAGTG	0.577																																																	0													135.0	110.0	118.0					19																	41812357		2203	4300	6503	SO:0001583	missense	0			AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.2458G>T	19.37:g.41812357G>T	ENSP00000375863:p.Ala820Ser		B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_SAP_dom,superfamily_ConA-like_lec_gl_sf,superfamily_P-loop_NTPase,smart_SAP_dom,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_SAP_dom	p.A820S	ENST00000392006.3	37	c.2458	CCDS12576.1	19	.	.	.	.	.	.	.	.	.	.	G	16.62	3.173547	0.57584	.	.	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	T;T;T	0.36878	1.69;1.23;1.26	5.37	5.37	0.77165	.	0.201572	0.42294	D	0.000721	T	0.37128	0.0992	N	0.24115	0.695	0.34204	D	0.673531	P;P;P;D;P;P;P;P	0.65815	0.58;0.58;0.705;0.995;0.956;0.705;0.798;0.705	B;B;B;P;B;B;B;B	0.59643	0.096;0.096;0.269;0.861;0.409;0.269;0.138;0.196	T	0.36866	-0.9730	10	0.25106	T	0.35	-10.6986	9.9891	0.41860	0.0886:0.0:0.9114:0.0	.	731;720;768;354;820;716;820;720	B7Z4B8;A8K3W4;Q9BUJ2-2;Q9BUJ2-5;A8K5K0;Q9BUJ2-3;Q9BUJ2;Q9BUJ2-4	.;.;.;.;.;.;HNRL1_HUMAN;.	S	720;820;716;731	ENSP00000375863:A820S;ENSP00000367460:A716S;ENSP00000263367:A731S	ENSP00000263367:A731S	A	+	1	0	HNRNPUL1	46504197	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.426000	0.73374	2.822000	0.97130	0.650000	0.86243	GCC	HNRNPUL1	-	NULL	ENSG00000105323		0.577	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPUL1	HGNC	protein_coding	OTTHUMT00000463406.1	-	0.00	31	0	G	NM_144732, NM_007040		41812357	+1	tier1	-	no_errors	ENST00000392006	ensembl	human	known	74_37	missense	16.67	20	4	SNP	1.000	T
HSD17B1	3292	genome.wustl.edu	37	17	40706597	40706597	+	Silent	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:40706597G>A	ENST00000585807.1	+	5	4434	c.714G>A	c.(712-714)gcG>gcA	p.A238A	HSD17B1_ENST00000225929.5_Silent_p.A239A|RP11-400F19.8_ENST00000585572.1_RNA|RP11-400F19.6_ENST00000590513.1_RNA	NM_000413.2	NP_000404.2	P14061	DHB1_HUMAN	hydroxysteroid (17-beta) dehydrogenase 1	238			A -> V. {ECO:0000269|PubMed:8389226}.		bone development (GO:0060348)|cellular response to metal ion (GO:0071248)|estrogen biosynthetic process (GO:0006703)|estrogen metabolic process (GO:0008210)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			NS(1)|endometrium(1)|kidney(1)|lung(2)	5		all_cancers(22;5.59e-08)|all_epithelial(22;7e-07)|Ovarian(249;0.0261)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Equilin(DB02187)	AGGAGGTGGCGGAGGTGAGCG	0.687																																																	0													38.0	31.0	33.0					17																	40706597		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS11428.1	17q11-q21	2011-09-14					1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5210	protein-coding gene	gene with protein product	"""Estradiol 17-beta-dehydrogenase-1"", ""short chain dehydrogenase/reductase family 28CE, member 1"""	109684		EDHB17, EDH17B2		2330005, 19027726	Standard	NM_000413		Approved	HSD17, MGC138140, SDR28C1	uc002hzw.3	P14061		ENST00000585807.1:c.714G>A	17.37:g.40706597G>A			B3KXS1|Q2M2L8	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pirsf_17beta_DH,prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR	p.A238	ENST00000585807.1	37	c.714	CCDS11428.1	17																																																																																			HSD17B1	-	pirsf_17beta_DH	ENSG00000108786		0.687	HSD17B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HSD17B1	HGNC	protein_coding	OTTHUMT00000450392.1	-	0.00	39	0	G	NM_000413		40706597	+1	tier1	-	no_errors	ENST00000585807	ensembl	human	known	74_37	silent	26.53	36	13	SNP	0.000	A
IGF1R	3480	genome.wustl.edu	37	15	99250814	99250814	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr15:99250814C>T	ENST00000268035.6	+	2	729	c.118C>T	c.(118-120)Cgc>Tgc	p.R40C	IGF1R_ENST00000558762.1_Missense_Mutation_p.R40C	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	40					axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CATCGACATCCGCAACGACTA	0.498																																																	0													54.0	45.0	48.0					15																	99250814		2197	4297	6494	SO:0001583	missense	0			M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.118C>T	15.37:g.99250814C>T	ENSP00000268035:p.Arg40Cys		B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom	p.R40C	ENST00000268035.6	37	c.118	CCDS10378.1	15	.	.	.	.	.	.	.	.	.	.	C	17.95	3.513830	0.64522	.	.	ENSG00000140443	ENST00000268035	D	0.83673	-1.75	5.49	4.56	0.56223	.	0.000000	0.53938	D	0.000042	D	0.90421	0.7001	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.915;0.998	D	0.91659	0.5341	10	0.87932	D	0	.	15.0639	0.71977	0.143:0.8569:0.0:0.0	.	40;40	C9J5X1;P08069	.;IGF1R_HUMAN	C	40	ENSP00000268035:R40C	ENSP00000268035:R40C	R	+	1	0	IGF1R	97068337	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	4.980000	0.63812	1.423000	0.47198	-0.182000	0.12963	CGC	IGF1R	-	pirsf_Tyr_kinase_insulin-like_rcpt	ENSG00000140443		0.498	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	IGF1R	HGNC	protein_coding	OTTHUMT00000313537.2	-	0.00	52	0	C	NM_000875		99250814	+1	tier1	-	no_errors	ENST00000268035	ensembl	human	known	74_37	missense	20.00	28	7	SNP	1.000	T
IGSF1	3547	genome.wustl.edu	37	X	130416537	130416537	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:130416537G>T	ENST00000361420.3	-	7	1206	c.1127C>A	c.(1126-1128)tCa>tAa	p.S376*	IGSF1_ENST00000370910.1_Nonsense_Mutation_p.S367*|IGSF1_ENST00000370903.3_Nonsense_Mutation_p.S376*|IGSF1_ENST00000370904.1_Nonsense_Mutation_p.S367*			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	376	Ig-like C2-type 4.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						GAGGAAGAATGATGTGTTGTC	0.453																																																	0													210.0	166.0	181.0					X																	130416537		2203	4300	6503	SO:0001587	stop_gained	0			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.1127C>A	X.37:g.130416537G>T	ENSP00000355010:p.Ser376*		B5MEG2|H9KV64|O15070|Q9NTC8	Nonsense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S376*	ENST00000361420.3	37	c.1127	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	G	19.04	3.749275	0.69533	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	.	.	.	4.78	3.92	0.45320	.	0.836195	0.10105	N	0.715505	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	8.06	0.30627	0.1123:0.0:0.8877:0.0	.	.	.	.	X	367;376;367;376	.	ENSP00000355010:S376X	S	-	2	0	IGSF1	130244218	0.998000	0.40836	0.917000	0.36280	0.023000	0.10783	2.392000	0.44433	1.153000	0.42468	0.594000	0.82650	TCA	IGSF1	-	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000147255		0.453	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	HGNC	protein_coding	OTTHUMT00000058288.1	-	0.00	38	0	G			130416537	-1	tier1	-	no_errors	ENST00000370903	ensembl	human	known	74_37	nonsense	67.31	17	35	SNP	0.871	T
IGSF3	3321	genome.wustl.edu	37	1	117156778	117156778	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:117156778C>A	ENST00000369486.3	-	4	1206	c.441G>T	c.(439-441)caG>caT	p.Q147H	IGSF3_ENST00000369483.1_Missense_Mutation_p.Q147H|IGSF3_ENST00000318837.6_Missense_Mutation_p.Q147H	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	147	Ig-like C2-type 2.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		TGGCAGTGGTCTGCAGGGAGT	0.577																																																	0													30.0	31.0	31.0					1																	117156778		2200	4293	6493	SO:0001583	missense	0			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.441G>T	1.37:g.117156778C>A	ENSP00000358498:p.Gln147His		A6NJZ6|A6NMC7	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.Q147H	ENST00000369486.3	37	c.441	CCDS30813.1	1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.243905	0.58995	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.03330	3.98;3.97;3.97	5.02	4.08	0.47627	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.315661	0.34338	N	0.004051	T	0.05502	0.0145	L	0.54323	1.7	0.33775	D	0.623583	P;P	0.49358	0.916;0.923	P;P	0.56343	0.796;0.722	T	0.03157	-1.1066	10	0.56958	D	0.05	-41.8169	11.5392	0.50657	0.0:0.9107:0.0:0.0893	.	147;147	O75054;A6NJZ6	IGSF3_HUMAN;.	H	147	ENSP00000358498:Q147H;ENSP00000358495:Q147H;ENSP00000321184:Q147H	ENSP00000321184:Q147H	Q	-	3	2	IGSF3	116958301	0.203000	0.23435	0.976000	0.42696	0.985000	0.73830	-0.411000	0.07142	2.599000	0.87857	0.650000	0.86243	CAG	IGSF3	-	pfscan_Ig-like_dom	ENSG00000143061		0.577	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF3	HGNC	protein_coding	OTTHUMT00000059040.1	-	0.00	40	0	C	NM_001542		117156778	-1	tier1	-	no_errors	ENST00000318837	ensembl	human	known	74_37	missense	51.43	17	18	SNP	0.988	A
ILF3	3609	genome.wustl.edu	37	19	10794640	10794640	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:10794640G>C	ENST00000590261.1	+	16	2053	c.2053G>C	c.(2053-2055)Ggc>Cgc	p.G685R	ILF3_ENST00000588657.1_Missense_Mutation_p.G689R|ILF3_ENST00000592763.1_Missense_Mutation_p.G689R|ILF3_ENST00000250241.8_Missense_Mutation_p.G685R|ILF3_ENST00000420083.1_Missense_Mutation_p.G685R|ILF3_ENST00000449870.1_Missense_Mutation_p.G689R|ILF3_ENST00000318511.3_Missense_Mutation_p.G685R|ILF3_ENST00000589998.1_Missense_Mutation_p.G685R|ILF3_ENST00000407004.3_Missense_Mutation_p.G689R			Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3, 90kDa	685	Interaction with PRMT1.				defense response to virus (GO:0051607)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			GGCGACAGCAGGCTACAGTAA	0.602																																																	0													187.0	149.0	162.0					19																	10794640		2203	4300	6503	SO:0001583	missense	0			U10324	CCDS12246.1, CCDS12247.1, CCDS45965.1, CCDS45966.1, CCDS45967.1	19p13.2	2012-08-10	2002-08-29		ENSG00000129351	ENSG00000129351			6038	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 4"""	603182	"""interleukin enhancer binding factor 3, 90kD"""			7519613, 8885239	Standard	NM_012218		Approved	NF90, MPHOSPH4, MPP4, DRBP76, NFAR-1	uc002mpo.3	Q12906		ENST00000590261.1:c.2053G>C	19.37:g.10794640G>C	ENSP00000468156:p.Gly685Arg		A8K6F2|G5E9M5|O43409|Q6P1X1|Q86XY7|Q99544|Q99545|Q9BZH4|Q9BZH5|Q9NQ95|Q9NQ96|Q9NQ97|Q9NQ98|Q9NQ99|Q9NQA0|Q9NQA1|Q9NQA2|Q9NRN2|Q9NRN3|Q9NRN4|Q9UMZ9|Q9UN00|Q9UN84|Q9UNA2	Missense_Mutation	SNP	pfam_DZF,pfam_dsRNA-bd_dom,smart_DZF,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom	p.G689R	ENST00000590261.1	37	c.2065	CCDS12246.1	19	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030235	0.54790	.	.	ENSG00000129351	ENST00000336059;ENST00000449870;ENST00000318511;ENST00000420083;ENST00000407004;ENST00000250241	T;T;T;T;T	0.24350	1.86;1.86;2.42;2.42;2.42	5.5	5.5	0.81552	.	0.123452	0.52532	D	0.000069	T	0.41766	0.1173	L	0.32530	0.975	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;0.999;0.999	D;D;D;D;D;D	0.87578	0.991;0.998;0.996;0.998;0.998;0.998	T	0.27054	-1.0085	10	0.87932	D	0	.	16.3252	0.82977	0.0:0.0:1.0:0.0	.	689;689;685;689;685;685	Q12906-4;G5E9M5;Q12906;Q12906-6;Q12906-2;Q12906-5	.;.;ILF3_HUMAN;.;.;.	R	685;689;685;685;689;685	ENSP00000404121:G689R;ENSP00000315205:G685R;ENSP00000405436:G685R;ENSP00000384660:G689R;ENSP00000250241:G685R	ENSP00000250241:G685R	G	+	1	0	ILF3	10655640	1.000000	0.71417	0.986000	0.45419	0.943000	0.58893	8.092000	0.89530	2.593000	0.87608	0.655000	0.94253	GGC	ILF3	-	NULL	ENSG00000129351		0.602	ILF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ILF3	HGNC	protein_coding	OTTHUMT00000452074.1	-	0.00	61	0	G			10794640	+1	tier1	-	no_errors	ENST00000449870	ensembl	human	known	74_37	missense	12.50	42	6	SNP	1.000	C
ILVBL	10994	genome.wustl.edu	37	19	15226966	15226966	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:15226966G>A	ENST00000263383.3	-	12	1607	c.1468C>T	c.(1468-1470)Cct>Tct	p.P490S	ILVBL_ENST00000534378.1_Missense_Mutation_p.P383S	NM_006844.3	NP_006835.2	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like	490	Thiamine pyrophosphate binding. {ECO:0000250}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|thiamine pyrophosphate binding (GO:0030976)|transferase activity (GO:0016740)			NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)	26						TCCTTACCAGGATCGAGCCAG	0.642																																																	0													39.0	40.0	39.0					19																	15226966		2203	4300	6503	SO:0001583	missense	0			U61263	CCDS12325.1	19p13.1	2008-07-16			ENSG00000105135	ENSG00000105135			6041	protein-coding gene	gene with protein product	"""acetolactate synthase homolog"""	605770				8954801	Standard	NM_006844		Approved	209L8, AHAS, ILV2H, MGC1269, FLJ39061, MGC19535	uc002nam.3	A1L0T0	OTTHUMG00000165630	ENST00000263383.3:c.1468C>T	19.37:g.15226966G>A	ENSP00000263383:p.Pro490Ser		O43341|Q96F08|Q99651|Q9BWN5|Q9UEB2	Missense_Mutation	SNP	pfam_Thiamin_PyroP_enz_TPP-bd_dom,pfam_TPP_enzyme-bd_C,pfam_Thiamin_PyroP_enz_cen_dom	p.P490S	ENST00000263383.3	37	c.1468	CCDS12325.1	19	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522879	0.64747	.	.	ENSG00000105135	ENST00000263383	T	0.36520	1.25	5.22	4.19	0.49359	Thiamine pyrophosphate enzyme, C-terminal TPP-binding (1);	0.053624	0.85682	N	0.000000	T	0.45994	0.1370	L	0.56340	1.77	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.52049	-0.8627	10	0.02654	T	1	.	9.5328	0.39205	0.0972:0.0:0.9028:0.0	.	490	A1L0T0	ILVBL_HUMAN	S	490	ENSP00000263383:P490S	ENSP00000263383:P490S	P	-	1	0	ILVBL	15087966	1.000000	0.71417	0.913000	0.36048	0.436000	0.31835	8.945000	0.92985	1.206000	0.43276	0.561000	0.74099	CCT	ILVBL	-	pfam_TPP_enzyme-bd_C	ENSG00000105135		0.642	ILVBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILVBL	HGNC	protein_coding	OTTHUMT00000385439.1	-	0.00	37	0	G	NM_006844		15226966	-1	tier1	-	no_errors	ENST00000263383	ensembl	human	known	74_37	missense	35.71	18	10	SNP	1.000	A
INTS1	26173	genome.wustl.edu	37	7	1517247	1517247	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:1517247T>C	ENST00000404767.3	-	35	4962	c.4877A>G	c.(4876-4878)gAc>gGc	p.D1626G	INTS1_ENST00000389470.4_Missense_Mutation_p.D1825G	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	1626					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		CACCTCGGGGTCCAGCATTTC	0.687																																																	0													9.0	12.0	11.0					7																	1517247		1938	4119	6057	SO:0001583	missense	0			AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.4877A>G	7.37:g.1517247T>C	ENSP00000385722:p.Asp1626Gly		A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	pfam_DUF3677,superfamily_ARM-type_fold	p.D1825G	ENST00000404767.3	37	c.5474	CCDS47526.1	7	.	.	.	.	.	.	.	.	.	.	T	17.57	3.422512	0.62622	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.58797	0.42;0.31	4.46	4.46	0.54185	.	0.044863	0.85682	D	0.000000	T	0.63827	0.2544	L	0.32530	0.975	0.53005	D	0.999965	D	0.61697	0.99	D	0.63957	0.92	T	0.67848	-0.5564	10	0.72032	D	0.01	.	13.7465	0.62879	0.0:0.0:0.0:1.0	.	1626	Q8N201	INT1_HUMAN	G	1626;1825	ENSP00000385722:D1626G;ENSP00000374121:D1825G	ENSP00000374121:D1825G	D	-	2	0	INTS1	1483773	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	7.840000	0.86819	1.661000	0.50771	0.459000	0.35465	GAC	INTS1	-	NULL	ENSG00000164880		0.687	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS1	HGNC	protein_coding	OTTHUMT00000323683.1	-	0.00	18	0	T			1517247	-1	tier1	-	no_errors	ENST00000389470	ensembl	human	known	74_37	missense	50.00	7	7	SNP	1.000	C
INTS2	57508	genome.wustl.edu	37	17	59958388	59958388	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:59958388G>T	ENST00000444766.3	-	17	2333	c.2258C>A	c.(2257-2259)tCt>tAt	p.S753Y	INTS2_ENST00000251334.6_Missense_Mutation_p.S745Y	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	753					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						TTGTTTGGGAGAATGATTTTT	0.368																																																	0													103.0	98.0	99.0					17																	59958388		1864	4090	5954	SO:0001583	missense	0			AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.2258C>A	17.37:g.59958388G>T	ENSP00000414237:p.Ser753Tyr		Q9ULD3	Missense_Mutation	SNP	NULL	p.S753Y	ENST00000444766.3	37	c.2258	CCDS45750.1	17	.	.	.	.	.	.	.	.	.	.	G	21.8	4.196359	0.78902	.	.	ENSG00000108506	ENST00000444766;ENST00000251334	T	0.49720	0.77	5.63	5.63	0.86233	.	0.101717	0.64402	D	0.000002	T	0.60353	0.2262	L	0.55990	1.75	0.58432	D	0.999999	D	0.54207	0.965	P	0.56700	0.804	T	0.55995	-0.8052	9	.	.	.	-15.624	18.6515	0.91431	0.0:0.0:1.0:0.0	.	753	Q9H0H0	INT2_HUMAN	Y	753;752	ENSP00000414237:S753Y	.	S	-	2	0	INTS2	57313170	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.875000	0.75551	2.636000	0.89361	0.557000	0.71058	TCT	INTS2	-	NULL	ENSG00000108506		0.368	INTS2-001	KNOWN	basic|CCDS	protein_coding	INTS2	HGNC	protein_coding	OTTHUMT00000445368.1	-	0.00	46	0	G	NM_020748		59958388	-1	tier1	-	no_errors	ENST00000444766	ensembl	human	known	74_37	missense	31.82	15	7	SNP	1.000	T
IQSEC1	9922	genome.wustl.edu	37	3	12978085	12978085	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:12978085C>T	ENST00000273221.4	-	3	689	c.473G>A	c.(472-474)cGc>cAc	p.R158H	IQSEC1_ENST00000473088.1_5'UTR	NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	158	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CATGGAGCTGCGCAAGCGCTC	0.582																																																	0													45.0	36.0	39.0					3																	12978085		2203	4300	6503	SO:0001583	missense	0			BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.473G>A	3.37:g.12978085C>T	ENSP00000273221:p.Arg158His		O94863|Q96D85	Missense_Mutation	SNP	pfam_Sec7_dom,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7_dom	p.R158H	ENST00000273221.4	37	c.473	CCDS33703.1	3	.	.	.	.	.	.	.	.	.	.	C	28.2	4.902538	0.92035	.	.	ENSG00000144711	ENST00000273221;ENST00000435445;ENST00000429247	T;T	0.63096	-0.02;-0.02	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.80497	0.4634	.	.	.	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.996;0.998	D	0.83975	0.0329	9	0.87932	D	0	.	17.558	0.87898	0.0:1.0:0.0:0.0	.	144;144;158	E9PG60;C9JMG9;Q6DN90	.;.;IQEC1_HUMAN	H	158;144;144	ENSP00000273221:R158H;ENSP00000402299:R144H	ENSP00000273221:R158H	R	-	2	0	IQSEC1	12953085	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.645000	0.83430	2.366000	0.80165	0.462000	0.41574	CGC	IQSEC1	-	pfscan_IQ_motif_EF-hand-BS	ENSG00000144711		0.582	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQSEC1	HGNC	protein_coding	OTTHUMT00000339865.2	-	0.00	46	0	C	NM_014869		12978085	-1	tier1	-	no_errors	ENST00000273221	ensembl	human	known	74_37	missense	31.71	28	13	SNP	1.000	T
KAZN	23254	genome.wustl.edu	37	1	15287347	15287347	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:15287347G>T	ENST00000376030.2	+	2	688	c.394G>T	c.(394-396)Gcc>Tcc	p.A132S	KAZN_ENST00000400798.2_Missense_Mutation_p.A38S|KAZN_ENST00000400797.3_Missense_Mutation_p.A38S|KAZN_ENST00000422387.2_Missense_Mutation_p.A132S|KAZN_ENST00000503743.1_Missense_Mutation_p.A132S|KAZN_ENST00000361144.5_Missense_Mutation_p.A126S	NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein	132					keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						GCAGGAGCTAGCCAGAGCCAA	0.647																																																	0													27.0	28.0	28.0					1																	15287347		2202	4300	6502	SO:0001583	missense	0			AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.394G>T	1.37:g.15287347G>T	ENSP00000365198:p.Ala132Ser		B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.A132S	ENST00000376030.2	37	c.394	CCDS152.2	1	.	.	.	.	.	.	.	.	.	.	G	11.16	1.555840	0.27827	.	.	ENSG00000189337	ENST00000376030;ENST00000503743;ENST00000422387;ENST00000361144;ENST00000376028;ENST00000400798;ENST00000400797	T;T;T;T;T;T;T	0.77229	0.94;0.94;0.94;0.94;-1.08;-1.08;-1.08	5.72	4.8	0.61643	.	0.320649	0.33075	N	0.005319	T	0.58466	0.2124	N	0.12182	0.205	0.33261	D	0.559808	B;B;B;P	0.35328	0.119;0.037;0.372;0.495	B;B;B;B	0.30855	0.022;0.021;0.121;0.078	T	0.63355	-0.6656	10	0.10377	T	0.69	-22.6767	15.939	0.79739	0.0:0.1351:0.8649:0.0	.	132;38;126;132	Q674X7-2;Q674X7-4;Q674X7-3;Q674X7	.;.;.;KAZRN_HUMAN	S	132;132;132;126;38;38;38	ENSP00000365198:A132S;ENSP00000426015:A132S;ENSP00000391728:A132S;ENSP00000354727:A126S;ENSP00000365196:A38S;ENSP00000383602:A38S;ENSP00000383601:A38S	ENSP00000354727:A126S	A	+	1	0	KAZN	15159934	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.238000	0.95380	1.417000	0.47077	-0.304000	0.09214	GCC	KAZN	-	NULL	ENSG00000189337		0.647	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAZN	HGNC	protein_coding	OTTHUMT00000005690.2	-	0.00	23	0	G	NM_001017999		15287347	+1	tier1	-	no_errors	ENST00000376030	ensembl	human	known	74_37	missense	42.86	12	9	SNP	1.000	T
KCND2	3751	genome.wustl.edu	37	7	119915538	119915538	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:119915538C>T	ENST00000331113.4	+	1	1817	c.852C>T	c.(850-852)gaC>gaT	p.D284D		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	284					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.D284D(1)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	ACAATGAGGACGTCAGCGGAG	0.532																																																	1	Substitution - coding silent(1)	endometrium(1)											161.0	131.0	141.0					7																	119915538		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.852C>T	7.37:g.119915538C>T			O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Silent	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Shal-type,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.2,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.D284	ENST00000331113.4	37	c.852	CCDS5776.1	7																																																																																			KCND2	-	pfam_Ion_trans_dom	ENSG00000184408		0.532	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCND2	HGNC	protein_coding	OTTHUMT00000346996.1	-	0.00	75	0	C	NM_012281		119915538	+1	tier1	-	no_errors	ENST00000331113	ensembl	human	known	74_37	silent	23.73	45	14	SNP	0.991	T
KCNH1	3756	genome.wustl.edu	37	1	211276912	211276912	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:211276912G>A	ENST00000271751.4	-	3	263	c.236C>T	c.(235-237)aCg>aTg	p.T79M	KCNH1_ENST00000367007.4_Missense_Mutation_p.T79M			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	79	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TTTTTCAATCGTGTCTTTATC	0.338																																																	0													156.0	145.0	149.0					1																	211276912		2201	4298	6499	SO:0001583	missense	0			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.236C>T	1.37:g.211276912G>A	ENSP00000271751:p.Thr79Met		B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.T79M	ENST00000271751.4	37	c.236	CCDS1496.1	1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.119245	0.56505	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.99660	-6.32;-6.32	5.46	5.46	0.80206	PAS (3);PAS fold (1);	0.046640	0.85682	D	0.000000	D	0.98855	0.9613	M	0.64997	1.995	0.80722	D	1	P;P	0.43231	0.801;0.801	B;B	0.39617	0.305;0.305	D	0.99928	1.1303	10	0.56958	D	0.05	.	18.6768	0.91531	0.0:0.0:1.0:0.0	.	79;79	Q14CL3;O95259	.;KCNH1_HUMAN	M	79	ENSP00000271751:T79M;ENSP00000355974:T79M	ENSP00000271751:T79M	T	-	2	0	KCNH1	209343535	1.000000	0.71417	0.993000	0.49108	0.822000	0.46500	4.476000	0.60216	2.706000	0.92434	0.655000	0.94253	ACG	KCNH1	-	pfam_PAS_fold,superfamily_PAS,pfscan_PAS,tigrfam_PAS	ENSG00000143473		0.338	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	HGNC	protein_coding	OTTHUMT00000088332.1		0.00	65	0	G	NM_002238		211276912	-1			no_errors	ENST00000271751	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	A
KCNJ5	3762	genome.wustl.edu	37	11	128781331	128781331	+	Nonsense_Mutation	SNP	G	G	T	rs72544301		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:128781331G>T	ENST00000338350.4	+	3	515	c.163G>T	c.(163-165)Gag>Tag	p.E55*	KCNJ5_ENST00000529694.1_Nonsense_Mutation_p.E55*|KCNJ5_ENST00000533599.1_Nonsense_Mutation_p.E55*			P48544	KCNJ5_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 5	55					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			NS(1)|breast(1)|endometrium(4)|large_intestine(4)|liver(2)|lung(9)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glyburide(DB01016)	GCGCTACATGGAGAAGAGTGG	0.602																																					Pancreas(108;2548 5082)|Esophageal Squamous(165;4544 6231)												0													112.0	94.0	100.0					11																	128781331		2201	4297	6498	SO:0001587	stop_gained	0			D50134	CCDS8479.1	11q24	2014-09-17				ENSG00000120457		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6266	protein-coding gene	gene with protein product		600734				16382105	Standard	NM_000890		Approved	Kir3.4, CIR, KATP1, GIRK4, LQT13	uc001qet.3	P48544		ENST00000338350.4:c.163G>T	11.37:g.128781331G>T	ENSP00000339960:p.Glu55*		B2R744|Q6DK13|Q6DK14|Q92807	Nonsense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir3.4	p.E55*	ENST00000338350.4	37	c.163	CCDS8479.1	11	.	.	.	.	.	.	.	.	.	.	G	27.3	4.815427	0.90790	.	.	ENSG00000120457	ENST00000529694;ENST00000338350;ENST00000533599	.	.	.	5.34	5.34	0.76211	.	0.094910	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.0605	0.93091	0.0:0.0:1.0:0.0	.	.	.	.	X	55	.	ENSP00000339960:E55X	E	+	1	0	KCNJ5	128286541	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.720000	0.68470	2.505000	0.84491	0.650000	0.86243	GAG	KCNJ5	-	pfam_K_chnl_inward-rec_Kir,pirsf_K_chnl_inward-rec_Kir	ENSG00000120457		0.602	KCNJ5-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	KCNJ5	HGNC	protein_coding	OTTHUMT00000386239.1	-	0.00	73	0	G	NM_000890		128781331	+1	tier1	-	no_errors	ENST00000529694	ensembl	human	known	74_37	nonsense	16.47	71	14	SNP	1.000	T
KCNJ6	3763	genome.wustl.edu	37	21	39086633	39086633	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr21:39086633G>A	ENST00000609713.1	-	3	1416	c.827C>T	c.(826-828)cCg>cTg	p.P276L	KCNJ6-IT1_ENST00000435001.1_RNA|KCNJ6_ENST00000288309.6_Missense_Mutation_p.P276L	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	276					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	AATGATCAGCGGTGACACCAG	0.493																																					Pancreas(48;379 1118 2936 19024 28214)												0													127.0	132.0	130.0					21																	39086633		1947	4156	6103	SO:0001583	missense	0			U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.827C>T	21.37:g.39086633G>A	ENSP00000477437:p.Pro276Leu		Q3MJ74|Q53WW6	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir3.2	p.P276L	ENST00000609713.1	37	c.827	CCDS42927.1	21	.	.	.	.	.	.	.	.	.	.	G	26.8	4.772486	0.90108	.	.	ENSG00000157542	ENST00000400482;ENST00000288309	D;D	0.97731	-4.51;-4.51	6.17	6.17	0.99709	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.99333	0.9766	H	0.97564	4.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98574	1.0647	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	276	P48051	IRK6_HUMAN	L	276	ENSP00000383330:P276L;ENSP00000288309:P276L	ENSP00000288309:P276L	P	-	2	0	KCNJ6	38008503	1.000000	0.71417	0.893000	0.35052	0.984000	0.73092	9.835000	0.99442	2.941000	0.99782	0.655000	0.94253	CCG	KCNJ6	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir	ENSG00000157542		0.493	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ6	HGNC	protein_coding	OTTHUMT00000194828.2	-	0.00	84	0	G	NM_002240		39086633	-1	tier1	-	no_errors	ENST00000288309	ensembl	human	known	74_37	missense	22.81	44	13	SNP	1.000	A
KCNJ8	3764	genome.wustl.edu	37	12	21919175	21919175	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:21919175G>T	ENST00000240662.2	-	3	1102	c.757C>A	c.(757-759)Cca>Aca	p.P253T	RP11-59N23.1_ENST00000542489.1_RNA	NM_004982.3	NP_004973.1	Q15842	KCNJ8_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 8	253					defense response to virus (GO:0051607)|heart development (GO:0007507)|kidney development (GO:0001822)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to pH (GO:0009268)|synaptic transmission (GO:0007268)|vasodilation (GO:0042311)	ATP-sensitive potassium channel complex (GO:0008282)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Gliquidone(DB01251)|Glisoxepide(DB01289)|Glyburide(DB01016)|Levosimendan(DB00922)|Phenformin(DB00914)|Thiamylal(DB01154)|Yohimbine(DB01392)	CTCTCGATTGGGTTATCAACA	0.493																																																	0													95.0	89.0	91.0					12																	21919175		2203	4300	6503	SO:0001583	missense	0			BC000544	CCDS8692.1	12p12.1	2011-07-05			ENSG00000121361	ENSG00000121361		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6269	protein-coding gene	gene with protein product		600935				8595887, 16382105	Standard	NM_004982		Approved	Kir6.1	uc001rff.4	Q15842	OTTHUMG00000169093	ENST00000240662.2:c.757C>A	12.37:g.21919175G>T	ENSP00000240662:p.Pro253Thr		O00657	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir6.1	p.P253T	ENST00000240662.2	37	c.757	CCDS8692.1	12	.	.	.	.	.	.	.	.	.	.	G	15.46	2.841133	0.51057	.	.	ENSG00000121361	ENST00000240662;ENST00000539350	D	0.93604	-3.25	5.35	5.35	0.76521	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.047528	0.85682	D	0.000000	D	0.92404	0.7589	L	0.50333	1.59	0.50467	D	0.999873	P	0.39044	0.656	B	0.40982	0.345	D	0.92491	0.6000	10	0.56958	D	0.05	.	19.2644	0.93980	0.0:0.0:1.0:0.0	.	253	Q15842	IRK8_HUMAN	T	253	ENSP00000240662:P253T	ENSP00000240662:P253T	P	-	1	0	KCNJ8	21810442	1.000000	0.71417	0.967000	0.41034	0.945000	0.59286	5.936000	0.70153	2.782000	0.95742	0.563000	0.77884	CCA	KCNJ8	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000121361		0.493	KCNJ8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ8	HGNC	protein_coding	OTTHUMT00000402226.1	-	0.00	75	0	G	NM_004982		21919175	-1	tier1	-	no_errors	ENST00000240662	ensembl	human	known	74_37	missense	36.92	41	24	SNP	1.000	T
KCNMA1	3778	genome.wustl.edu	37	10	78637539	78637539	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr10:78637539G>T	ENST00000404771.3	-	30	3940	c.3825C>A	c.(3823-3825)agC>agA	p.S1275R	KCNMA1_ENST00000372440.1_3'UTR|KCNMA1_ENST00000372443.1_3'UTR			Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	0					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	GAATCAAGCTGCTTGTGGATT	0.403																																																	0													229.0	193.0	204.0					10																	78637539		692	1591	2283	SO:0001583	missense	0			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000404771.3:c.3825C>A	10.37:g.78637539G>T	ENSP00000385717:p.Ser1275Arg		F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_RCK_N,prints_K_chnl_Ca-activ_BK_asu,prints_K_chnl	p.S1275R	ENST00000404771.3	37	c.3825		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.60|14.60	2.584413|2.584413	0.46110|0.46110	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372403|ENST00000372408;ENST00000404771	.|D	.|0.85955	.|-2.05	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	.|.	.|.	.|.	.|.	D|D	0.92662|0.92662	0.7668|0.7668	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	D|D	0.92554|0.92554	0.6052|0.6052	4|6	.|0.87932	.|D	.|0	.|.	20.6593|20.6593	0.99626|0.99626	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	E|R	1169|1154;1212	.|ENSP00000361485:S1154R	.|ENSP00000361485:S1154R	A|S	-|-	2|3	0|2	KCNMA1|KCNMA1	78307545|78307545	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.408000|7.408000	0.80041|0.80041	2.885000|2.885000	0.99019|0.99019	0.655000|0.655000	0.94253|0.94253	GCA|AGC	KCNMA1	-	NULL	ENSG00000156113		0.403	KCNMA1-008	PUTATIVE	not_organism_supported|basic	protein_coding	KCNMA1	HGNC	protein_coding	OTTHUMT00000048884.3	-	0.00	116	0	G	NM_002247		78637539	-1	tier1	-	no_errors	ENST00000404771	ensembl	human	putative	74_37	missense	5.56	68	4	SNP	1.000	T
KCNN3	3782	genome.wustl.edu	37	1	154794592	154794592	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:154794592G>T	ENST00000271915.4	-	2	1317	c.1002C>A	c.(1000-1002)atC>atA	p.I334I	KCNN3_ENST00000361147.4_Silent_p.I29I|KCNN3_ENST00000358505.2_Silent_p.I21I	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	339					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	GGTAGGCGATGATCAAGCCCA	0.547																																																	0													152.0	122.0	132.0					1																	154794592		2203	4300	6503	SO:0001819	synonymous_variant	0			AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.1002C>A	1.37:g.154794592G>T			B1ANX0|O43517|Q86VF9|Q8WXG7	Silent	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_2pore_dom_K_chnl_dom,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.I334	ENST00000271915.4	37	c.1002	CCDS30880.1	1																																																																																			KCNN3	-	pfam_K_chnl_Ca-activ_SK	ENSG00000143603		0.547	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	HGNC	protein_coding	OTTHUMT00000090688.3	-	0.00	61	0	G	NM_002249		154794592	-1	tier1	-	no_errors	ENST00000271915	ensembl	human	novel	74_37	silent	18.18	36	8	SNP	1.000	T
KCNS3	3790	genome.wustl.edu	37	2	18112842	18112842	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:18112842C>A	ENST00000403915.1	+	3	1018	c.567C>A	c.(565-567)atC>atA	p.I189I	KCNS3_ENST00000304101.4_Silent_p.I189I|KCNS3_ENST00000465292.1_Intron	NM_001282428.1	NP_001269357.1	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3	189					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)			endometrium(5)|kidney(1)|large_intestine(7)|lung(11)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TTATCGCTATCTCCTCCTTGA	0.527																																																	0													71.0	70.0	71.0					2																	18112842		2203	4300	6503	SO:0001819	synonymous_variant	0			AF043472	CCDS1692.1	2p24	2011-07-05			ENSG00000170745	ENSG00000170745		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6302	protein-coding gene	gene with protein product		603888				10484328, 16382104	Standard	NM_002252		Approved	Kv9.3	uc002rcw.3	Q9BQ31	OTTHUMG00000044150	ENST00000403915.1:c.567C>A	2.37:g.18112842C>A			D6W520|O43651|Q4ZFY1|Q96B56	Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv2	p.I189	ENST00000403915.1	37	c.567	CCDS1692.1	2																																																																																			KCNS3	-	prints_K_chnl	ENSG00000170745		0.527	KCNS3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNS3	HGNC	protein_coding	OTTHUMT00000323808.1	-	0.00	40	0	C	NM_002252		18112842	+1	tier1	-	no_errors	ENST00000304101	ensembl	human	known	74_37	silent	26.92	38	14	SNP	1.000	A
KDM6A	7403	genome.wustl.edu	37	X	44949973	44949973	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:44949973C>A	ENST00000377967.4	+	26	3783	c.3742C>A	c.(3742-3744)Cag>Aag	p.Q1248K	KDM6A_ENST00000536777.1_Missense_Mutation_p.Q1203K|KDM6A_ENST00000543216.1_Missense_Mutation_p.Q1169K|KDM6A_ENST00000382899.4_Missense_Mutation_p.Q1255K	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	1248	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						CCTAGCCTGCCAGTATAAATT	0.373			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																Colon(129;1273 1667 15230 27352 52914)			Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	6	Whole gene deletion(6)	oesophagus(2)|breast(2)|pancreas(2)											107.0	91.0	97.0					X																	44949973		2203	4300	6503	SO:0001583	missense	0			AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.3742C>A	X.37:g.44949973C>A	ENSP00000367203:p.Gln1248Lys		Q52LL9|Q5JVQ7	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TPR_1,smart_TPR_repeat,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q1255K	ENST00000377967.4	37	c.3763	CCDS14265.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.8|22.8	4.337589|4.337589	0.81911|0.81911	.|.	.|.	ENSG00000147050|ENSG00000147050	ENST00000414389;ENST00000433797|ENST00000334516;ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216	.|T;T;T;T	.|0.70749	.|-0.51;-0.51;-0.51;-0.51	5.57|5.57	5.57|5.57	0.84162|0.84162	.|Transcription factor jumonji/aspartyl beta-hydroxylase (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.88183|0.88183	0.6368|0.6368	M|M	0.92738|0.92738	3.34|3.34	0.80722|0.80722	D|D	1|1	.|P;P;D;D;D	.|0.71674	.|0.924;0.811;0.992;0.998;0.991	.|P;P;P;D;D	.|0.74348	.|0.9;0.879;0.886;0.952;0.983	D|D	0.90959|0.90959	0.4811|0.4811	5|10	.|0.87932	.|D	.|0	-8.11|-8.11	18.6811|18.6811	0.91546|0.91546	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|887;1255;1203;1300;1248	.|B4E0L8;F8W8R6;F5H6S1;B7ZKN5;O15550	.|.;.;.;.;KDM6A_HUMAN	Q|K	845;890|945;1248;1203;1255;1169	.|ENSP00000367203:Q1248K;ENSP00000437405:Q1203K;ENSP00000372355:Q1255K;ENSP00000443078:Q1169K	.|ENSP00000334340:Q945K	P|Q	+|+	2|1	0|0	KDM6A|KDM6A	44834917|44834917	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.487000|7.487000	0.81328|0.81328	2.356000|2.356000	0.79943|0.79943	0.523000|0.523000	0.50628|0.50628	CCA|CAG	KDM6A	-	smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000147050		0.373	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM6A	HGNC	protein_coding	OTTHUMT00000056324.1	-	0.00	40	0	C	NM_021140		44949973	+1	tier1	-	no_errors	ENST00000382899	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	A
KIAA1324	57535	genome.wustl.edu	37	1	109745764	109745764	+	3'UTR	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:109745764G>T	ENST00000369939.3	+	0	3355				KIAA1324_ENST00000369938.1_3'UTR	NM_020775.4	NP_065826	Q6UXG2	K1324_HUMAN	KIAA1324						cellular response to starvation (GO:0009267)|macroautophagy (GO:0016236)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of autophagic vacuole assembly (GO:2000786)|positive regulation of vacuole organization (GO:0044090)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		TCAGATGTTTGAATTTCAGAT	0.448																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK057647	CCDS794.1, CCDS58015.1	1p13.3	2008-09-18			ENSG00000116299	ENSG00000116299			29618	protein-coding gene	gene with protein product	"""estrogen induced gene 121"""	611298				10718198, 16322283	Standard	NM_020775		Approved	maba1, EIG121	uc021orb.1	Q6UXG2	OTTHUMG00000011725	ENST00000369939.3:c.*130G>T	1.37:g.109745764G>T			Q08AE6|Q5T5C9|Q5T5D0|Q5T5D1|Q9P2M2	RNA	SNP	-	NULL	ENST00000369939.3	37	NULL	CCDS794.1	1																																																																																			KIAA1324	-	-	ENSG00000116299		0.448	KIAA1324-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1324	HGNC	protein_coding	OTTHUMT00000032389.2	-	0.00	39	0	G	NM_020775		109745764	+1	tier1	-	no_errors	ENST00000369938	ensembl	human	known	74_37	rna	18.18	18	4	SNP	0.998	T
KIAA1755	85449	genome.wustl.edu	37	20	36841560	36841560	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr20:36841560G>T	ENST00000279024.4	-	14	3758	c.3487C>A	c.(3487-3489)Ccc>Acc	p.P1163T		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	1163										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				TGCCTGGGGGGCTGCTGCCGG	0.642																																																	0													40.0	42.0	41.0					20																	36841560		2203	4300	6503	SO:0001583	missense	0			AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.3487C>A	20.37:g.36841560G>T	ENSP00000279024:p.Pro1163Thr		Q9C0A8	Missense_Mutation	SNP	superfamily_CRAL-TRIO_dom	p.P1163T	ENST00000279024.4	37	c.3487	CCDS33467.1	20	.	.	.	.	.	.	.	.	.	.	G	11.01	1.512917	0.27123	.	.	ENSG00000149633	ENST00000279024	T	0.06218	3.33	4.93	3.99	0.46301	.	0.321330	0.22534	N	0.058814	T	0.04363	0.0120	L	0.36672	1.1	0.09310	N	1	B	0.28470	0.213	B	0.23852	0.049	T	0.38802	-0.9644	10	0.02654	T	1	.	8.8314	0.35087	0.1009:0.0:0.8991:0.0	.	1163	Q5JYT7	K1755_HUMAN	T	1163	ENSP00000279024:P1163T	ENSP00000279024:P1163T	P	-	1	0	KIAA1755	36274974	0.217000	0.23597	0.027000	0.17364	0.142000	0.21351	1.616000	0.36933	1.310000	0.45006	0.561000	0.74099	CCC	KIAA1755	-	NULL	ENSG00000149633		0.642	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1755	HGNC	protein_coding	OTTHUMT00000079144.3	-	0.00	88	0	G	NM_001029864		36841560	-1	tier1	-	no_errors	ENST00000279024	ensembl	human	known	74_37	missense	33.80	46	24	SNP	0.090	T
KIF1C	10749	genome.wustl.edu	37	17	4926854	4926854	+	Missense_Mutation	SNP	G	G	A	rs199975737		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:4926854G>A	ENST00000320785.5	+	23	3077	c.2720G>A	c.(2719-2721)cGc>cAc	p.R907H		NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	907					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						CCCAGTGACCGCATGCCGTCA	0.662																																					Melanoma(96;1023 1447 10250 19259 33730)												0													32.0	32.0	32.0					17																	4926854		2203	4300	6503	SO:0001583	missense	0			U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.2720G>A	17.37:g.4926854G>A	ENSP00000320821:p.Arg907His		D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R907H	ENST00000320785.5	37	c.2720	CCDS11065.1	17	.	.	.	.	.	.	.	.	.	.	g	3.019	-0.202246	0.06219	.	.	ENSG00000129250	ENST00000320785	T	0.73897	-0.79	4.89	-8.76	0.00830	.	.	.	.	.	T	0.41903	0.1179	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29971	-0.9994	9	0.12103	T	0.63	.	4.5549	0.12131	0.5351:0.0949:0.267:0.103	.	907	O43896	KIF1C_HUMAN	H	907	ENSP00000320821:R907H	ENSP00000320821:R907H	R	+	2	0	KIF1C	4867578	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.737000	0.04877	-1.357000	0.02180	-1.966000	0.00469	CGC	KIF1C	-	NULL	ENSG00000129250		0.662	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1C	HGNC	protein_coding	OTTHUMT00000216916.1	-	0.00	45	0	G			4926854	+1	tier1	-	no_errors	ENST00000320785	ensembl	human	known	74_37	missense	50.00	11	11	SNP	0.000	A
KIF20A	10112	genome.wustl.edu	37	5	137522065	137522065	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:137522065G>T	ENST00000394894.3	+	18	2526	c.2300G>T	c.(2299-2301)gGg>gTg	p.G767V	KIF20A_ENST00000508792.1_Missense_Mutation_p.G749V	NM_005733.2	NP_005724.1	O95235	KI20A_HUMAN	kinesin family member 20A	767	Globular. {ECO:0000255}.				ATP catabolic process (GO:0006200)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule bundle formation (GO:0001578)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|liver(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(1)	27			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CACAGCACTGGGGCAGGAAAA	0.478																																																	0													92.0	87.0	89.0					5																	137522065		2203	4300	6503	SO:0001583	missense	0			AF070672	CCDS4199.1	5q31	2008-02-05	2003-01-13	2003-01-17	ENSG00000112984	ENSG00000112984		"""Kinesins"""	9787	protein-coding gene	gene with protein product		605664	"""RAB6 interacting, kinesin-like (rabkinesin6)"""	RAB6KIFL		11416179, 10806357	Standard	NM_005733		Approved		uc003lcj.3	O95235	OTTHUMG00000129195	ENST00000394894.3:c.2300G>T	5.37:g.137522065G>T	ENSP00000378356:p.Gly767Val		B4DL79|D3DQB6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G767V	ENST00000394894.3	37	c.2300	CCDS4199.1	5	.	.	.	.	.	.	.	.	.	.	G	24.0	4.484018	0.84854	.	.	ENSG00000112984	ENST00000394894;ENST00000508792	T;T	0.71341	-0.47;-0.56	5.98	5.98	0.97165	.	0.000000	0.44285	D	0.000467	T	0.81702	0.4878	L	0.56769	1.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.973;0.999	T	0.74216	-0.3737	10	0.15066	T	0.55	-16.1669	20.4352	0.99089	0.0:0.0:1.0:0.0	.	749;767	B4DL79;O95235	.;KI20A_HUMAN	V	767;749	ENSP00000378356:G767V;ENSP00000420880:G749V	ENSP00000378356:G767V	G	+	2	0	KIF20A	137549964	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	6.783000	0.75078	2.836000	0.97738	0.655000	0.94253	GGG	KIF20A	-	NULL	ENSG00000112984		0.478	KIF20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF20A	HGNC	protein_coding	OTTHUMT00000251272.1	-	0.00	41	0	G	NM_005733		137522065	+1	tier1	-	no_errors	ENST00000394894	ensembl	human	known	74_37	missense	13.16	33	5	SNP	1.000	T
KIF5A	3798	genome.wustl.edu	37	12	57963919	57963919	+	Missense_Mutation	SNP	C	C	T	rs140917012		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:57963919C>T	ENST00000455537.2	+	12	1541	c.1267C>T	c.(1267-1269)Cgt>Tgt	p.R423C	KIF5A_ENST00000286452.5_Missense_Mutation_p.R334C	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	423					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						GGAGATCCGCCGTCTCTATAA	0.587																																																	0								C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	44.0	36.0	39.0		1267	4.8	1.0	12	dbSNP_134	39	0,8600		0,0,4300	no	missense	KIF5A	NM_004984.2	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	423/1033	57963919	1,13005	2203	4300	6503	SO:0001583	missense	0			U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.1267C>T	12.37:g.57963919C>T	ENSP00000408979:p.Arg423Cys		A6H8M5|Q4LE26	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R423C	ENST00000455537.2	37	c.1267	CCDS8945.1	12	.	.	.	.	.	.	.	.	.	.	C	15.96	2.985545	0.53934	2.27E-4	0.0	ENSG00000155980	ENST00000455537;ENST00000286452	T;T	0.77877	-1.13;-1.13	4.79	4.79	0.61399	.	0.069272	0.56097	D	0.000024	T	0.66218	0.2767	L	0.28400	0.85	0.58432	D	0.999991	B;B	0.14438	0.01;0.002	B;B	0.08055	0.003;0.003	T	0.64922	-0.6293	10	0.72032	D	0.01	.	10.7372	0.46133	0.2943:0.7057:0.0:0.0	.	334;423	B7Z2M7;Q12840	.;KIF5A_HUMAN	C	423;334	ENSP00000408979:R423C;ENSP00000286452:R334C	ENSP00000286452:R334C	R	+	1	0	KIF5A	56250186	0.919000	0.31177	1.000000	0.80357	0.856000	0.48823	2.188000	0.42612	2.667000	0.90743	0.655000	0.94253	CGT	KIF5A	-	superfamily_P-loop_NTPase	ENSG00000155980		0.587	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5A	HGNC	protein_coding	OTTHUMT00000407634.1	-	0.00	32	0	C	NM_004984		57963919	+1	tier1	rs140917012	no_errors	ENST00000455537	ensembl	human	known	74_37	missense	40.00	6	4	SNP	1.000	T
KIF5A	3798	genome.wustl.edu	37	12	57976385	57976385	+	Splice_Site	SNP	G	G	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:57976385G>C	ENST00000455537.2	+	27	3267	c.2993G>C	c.(2992-2994)gGa>gCa	p.G998A	KIF5A_ENST00000286452.5_Splice_Site_p.G909A	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	998	Globular.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						ATCTCTTCAGGAAATGCCACA	0.438																																																	0													212.0	209.0	210.0					12																	57976385		2203	4300	6503	SO:0001630	splice_region_variant	0			U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.2993-1G>C	12.37:g.57976385G>C			A6H8M5|Q4LE26	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G998A	ENST00000455537.2	37	c.2993	CCDS8945.1	12	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835093	0.71373	.	.	ENSG00000155980	ENST00000455537;ENST00000286452;ENST00000547989	T;T	0.74209	-0.81;-0.82	5.47	5.47	0.80525	.	0.128235	0.52532	D	0.000080	T	0.80232	0.4585	L	0.34521	1.04	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.73708	0.981;0.981	T	0.77629	-0.2516	9	.	.	.	.	18.4974	0.90870	0.0:0.0:1.0:0.0	.	909;998	B7Z2M7;Q12840	.;KIF5A_HUMAN	A	998;909;92	ENSP00000408979:G998A;ENSP00000286452:G909A	.	G	+	2	0	KIF5A	56262652	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.883000	0.87264	2.737000	0.93849	0.655000	0.94253	GGA	KIF5A	-	NULL	ENSG00000155980		0.438	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5A	HGNC	protein_coding	OTTHUMT00000407634.1	-	0.00	65	0	G	NM_004984	Missense_Mutation	57976385	+1	tier1	-	no_errors	ENST00000455537	ensembl	human	known	74_37	missense	21.28	36	10	SNP	1.000	C
KLF3	51274	genome.wustl.edu	37	4	38690448	38690448	+	Silent	SNP	C	C	A	rs145278110		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr4:38690448C>A	ENST00000261438.5	+	3	605	c.300C>A	c.(298-300)tcC>tcA	p.S100S	KLF3_ENST00000514033.1_Silent_p.S100S	NM_016531.5	NP_057615.3	P57682	KLF3_HUMAN	Kruppel-like factor 3 (basic)	100	Pro-rich.				cellular response to peptide (GO:1901653)|multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	18						TGCCTTCTTCCAGCCCACCGA	0.622																																																	0													74.0	73.0	73.0					4																	38690448		2203	4300	6503	SO:0001819	synonymous_variant	0			AF285837	CCDS3444.1	4p16.1-p15.2	2013-01-08			ENSG00000109787	ENSG00000109787		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	16516	protein-coding gene	gene with protein product	"""basic Kruppel-like factor"""	609392				18391014	Standard	NM_016531		Approved	BKLF	uc003gth.4	P57682	OTTHUMG00000097821	ENST00000261438.5:c.300C>A	4.37:g.38690448C>A			Q6PIR1|Q86TN0|Q9P2X6	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S100	ENST00000261438.5	37	c.300	CCDS3444.1	4																																																																																			KLF3	-	NULL	ENSG00000109787		0.622	KLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF3	HGNC	protein_coding	OTTHUMT00000215093.2		0.00	46	0	C			38690448	+1			no_errors	ENST00000261438	ensembl	human	known	74_37	silent	5.66	50	3	SNP	0.854	A
KLHL17	339451	genome.wustl.edu	37	1	897819	897819	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:897819G>T	ENST00000338591.3	+	5	903	c.796G>T	c.(796-798)Gac>Tac	p.D266Y		NM_198317.2	NP_938073.1	Q6TDP4	KLH17_HUMAN	kelch-like family member 17	266	BACK.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|protein ubiquitination (GO:0016567)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|dendrite cytoplasm (GO:0032839)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein complex scaffold (GO:0032947)			central_nervous_system(1)|kidney(2)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.52e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.59e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000469)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GGTGAAACACGACGTGGACGC	0.677																																																	0													49.0	49.0	49.0					1																	897819		2201	4298	6499	SO:0001583	missense	0			AY423763	CCDS30550.1	1p36	2013-01-30	2013-01-30		ENSG00000187961	ENSG00000187961		"""Kelch-like"", ""BTB/POZ domain containing"""	24023	protein-coding gene	gene with protein product	"""actinfilin"""		"""kelch-like 17 (Drosophila)"""			12063253	Standard	NM_198317		Approved		uc001aca.2	Q6TDP4	OTTHUMG00000040721	ENST00000338591.3:c.796G>T	1.37:g.897819G>T	ENSP00000343930:p.Asp266Tyr		Q5SV94	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.D266Y	ENST00000338591.3	37	c.796	CCDS30550.1	1	.	.	.	.	.	.	.	.	.	.	G	18.41	3.618937	0.66787	.	.	ENSG00000187961	ENST00000338591;ENST00000455747	T	0.72394	-0.65	5.52	5.52	0.82312	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.90390	0.6992	H	0.97682	4.055	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.93510	0.6852	10	0.87932	D	0	.	19.0337	0.92969	0.0:0.0:1.0:0.0	.	266	Q6TDP4	KLH17_HUMAN	Y	266;142	ENSP00000343930:D266Y	ENSP00000343930:D266Y	D	+	1	0	KLHL17	887682	1.000000	0.71417	0.153000	0.22517	0.097000	0.18754	4.721000	0.61951	2.601000	0.87937	0.462000	0.41574	GAC	KLHL17	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000187961		0.677	KLHL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL17	HGNC	protein_coding	OTTHUMT00000097875.3	-	0.00	49	0	G	NM_198317		897819	+1	tier1	-	no_errors	ENST00000338591	ensembl	human	known	74_37	missense	35.71	18	10	SNP	0.997	T
KLK1	3816	genome.wustl.edu	37	19	51322531	51322531	+	Silent	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:51322531G>A	ENST00000301420.2	-	5	743	c.708C>T	c.(706-708)ggC>ggT	p.G236G	KLK1_ENST00000448701.2_Silent_p.G134G|CTD-2568A17.5_ENST00000326989.5_lincRNA	NM_002257.2	NP_002248.1	P06870	KLK1_HUMAN	kallikrein 1	236	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			breast(1)|large_intestine(4)|lung(7)|urinary_tract(1)	13		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00399)	Aprotinin(DB06692)	TATTGGGGGTGCCACAAGGGA	0.592																																																	0													118.0	101.0	107.0					19																	51322531		2203	4300	6503	SO:0001819	synonymous_variant	0			L10038	CCDS12804.1	19q13.3	2008-02-05	2006-10-27			ENSG00000167748	3.4.21.35	"""Kallikreins"""	6357	protein-coding gene	gene with protein product		147910	"""kallikrein 1, renal/pancreas/salivary"""			1684954, 16800724, 16800723	Standard	NM_002257		Approved	Klk6	uc002ptk.1	P06870		ENST00000301420.2:c.708C>T	19.37:g.51322531G>A			Q66US9|Q86U61|Q8TCV8|Q9BS53|Q9NQU4|Q9UD19|Q9UMJ1	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1	p.G236	ENST00000301420.2	37	c.708	CCDS12804.1	19																																																																																			KLK1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000167748		0.592	KLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK1	HGNC	protein_coding	OTTHUMT00000464135.2	-	0.00	59	0	G	NM_002257		51322531	-1	tier1	-	no_errors	ENST00000301420	ensembl	human	known	74_37	silent	38.60	35	22	SNP	0.010	A
KLRAP1	10748	genome.wustl.edu	37	12	10742127	10742127	+	RNA	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:10742127C>T	ENST00000510134.2	-	0	664									killer cell lectin-like receptor subfamily A pseudogene 1											breast(1)|large_intestine(1)|lung(1)	3						AGAAGAAAAACGCATTATTGT	0.333																																																	0																																												0			AF047445		12p13.2	2012-01-16	2010-10-28	2010-10-28	ENSG00000256667	ENSG00000256667		"""Killer cell lectin-like receptors"""	6372	pseudogene	pseudogene		604274	"""killer cell lectin-like receptor subfamily A, member 1"""	KLRA1		9645365	Standard	NR_028045		Approved	Ly49, LY49L	uc009zho.3		OTTHUMG00000160127		12.37:g.10742127C>T				RNA	SNP	-	NULL	ENST00000510134.2	37	NULL		12																																																																																			KLRAP1	-	-	ENSG00000256667		0.333	KLRAP1-002	KNOWN	basic	processed_transcript	KLRAP1	HGNC	pseudogene	OTTHUMT00000359305.2	-	0.00	44	0	C	NR_028045		10742127	-1	tier1	-	no_errors	ENST00000510134	ensembl	human	known	74_37	rna	28.12	23	9	SNP	0.000	T
KNDC1	85442	genome.wustl.edu	37	10	135025060	135025060	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr10:135025060T>A	ENST00000304613.3	+	22	4064	c.4043T>A	c.(4042-4044)tTc>tAc	p.F1348Y	KNDC1_ENST00000368572.2_Missense_Mutation_p.F1350Y			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	1348	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CTAGAGGACTTCATCTCCTCC	0.672																																																	0													87.0	90.0	89.0					10																	135025060		2203	4300	6503	SO:0001583	missense	0			AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.4043T>A	10.37:g.135025060T>A	ENSP00000304437:p.Phe1348Tyr		B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_Kinase-like_dom,smart_KIND,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.F1350Y	ENST00000304613.3	37	c.4049	CCDS7674.1	10	.	.	.	.	.	.	.	.	.	.	T	8.418	0.845765	0.16963	.	.	ENSG00000171798	ENST00000304613;ENST00000368572	T;T	0.59224	0.28;0.28	3.96	2.79	0.32731	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.255488	0.38897	U	0.001538	T	0.46619	0.1402	L	0.53249	1.67	0.24527	N	0.994134	B	0.18461	0.028	B	0.21917	0.037	T	0.43294	-0.9400	10	0.49607	T	0.09	-10.0047	3.3495	0.07147	0.2156:0.1134:0.0:0.6709	.	1348	Q76NI1	VKIND_HUMAN	Y	1348;1350	ENSP00000304437:F1348Y;ENSP00000357561:F1350Y	ENSP00000304437:F1348Y	F	+	2	0	KNDC1	134875050	1.000000	0.71417	0.235000	0.24058	0.338000	0.28826	3.259000	0.51515	0.492000	0.27815	0.247000	0.18012	TTC	KNDC1	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N	ENSG00000171798		0.672	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	KNDC1	HGNC	protein_coding	OTTHUMT00000277044.3	-	0.00	39	0	T	NM_152643		135025060	+1	tier1	-	no_errors	ENST00000368572	ensembl	human	known	74_37	missense	15.38	33	6	SNP	0.324	A
KRAS	3845	genome.wustl.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)			Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)											91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.G12D	ENST00000256078.4	37	c.35	CCDS8703.1	12	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	KRAS	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000133703		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KRAS	HGNC	protein_coding	OTTHUMT00000412232.1	-	0.00	37	0	C	NM_033360		25398284	-1	tier1	rs121913529	no_errors	ENST00000256078	ensembl	human	known	74_37	missense	28.21	28	11	SNP	1.000	T
KRT39	390792	genome.wustl.edu	37	17	39115025	39115025	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:39115025G>T	ENST00000355612.2	-	7	1339	c.1304C>A	c.(1303-1305)gCt>gAt	p.A435D	AC004231.2_ENST00000418393.1_RNA	NM_213656.3	NP_998821.3	Q6A163	K1C39_HUMAN	keratin 39	435	Tail.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	17		Breast(137;0.00043)|Ovarian(249;0.15)				GGATGTGCAAGCTGGGGCCGT	0.532																																																	0													93.0	88.0	90.0					17																	39115025		2203	4296	6499	SO:0001583	missense	0			AJ786657	CCDS11382.1	17q21.2	2013-01-16			ENSG00000196859	ENSG00000196859		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	32971	protein-coding gene	gene with protein product						16831889	Standard	NM_213656		Approved	KA35	uc002hvo.1	Q6A163	OTTHUMG00000133424	ENST00000355612.2:c.1304C>A	17.37:g.39115025G>T	ENSP00000347823:p.Ala435Asp		B2RXK6|Q6IFU6	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.A435D	ENST00000355612.2	37	c.1304	CCDS11382.1	17	.	.	.	.	.	.	.	.	.	.	G	11.09	1.535781	0.27475	.	.	ENSG00000196859	ENST00000355612	D	0.82711	-1.64	5.43	0.834	0.18880	.	0.446120	0.16613	N	0.206815	T	0.65923	0.2738	L	0.29908	0.895	0.09310	N	1	B	0.31519	0.327	B	0.16722	0.016	T	0.50355	-0.8838	10	0.21014	T	0.42	.	7.1613	0.25664	0.6164:0.0:0.3836:0.0	.	435	Q6A163	K1C39_HUMAN	D	435	ENSP00000347823:A435D	ENSP00000347823:A435D	A	-	2	0	KRT39	36368551	0.000000	0.05858	0.003000	0.11579	0.057000	0.15508	-0.598000	0.05706	0.377000	0.24735	-0.302000	0.09304	GCT	KRT39	-	NULL	ENSG00000196859		0.532	KRT39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT39	HGNC	protein_coding	OTTHUMT00000257287.1	-	0.00	75	0	G	NM_213656		39115025	-1	tier1	-	no_errors	ENST00000355612	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.003	T
KRTAP1-3	81850	genome.wustl.edu	37	17	39190928	39190928	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:39190928C>A	ENST00000344363.5	-	1	179	c.146G>T	c.(145-147)aGc>aTc	p.S49I		NM_030966.1	NP_112228.1	Q8IUG1	KRA13_HUMAN	keratin associated protein 1-3	59			Missing (in allele KAP1.1). {ECO:0000269|PubMed:11279113, ECO:0000269|PubMed:12228244, ECO:0000269|PubMed:15489334}.			keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(6)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGTTGAGAAGCTAGGAAATCC	0.622																																																	0													54.0	59.0	57.0					17																	39190928		1957	4165	6122	SO:0001583	missense	0			AJ406927	CCDS42323.1	17q21.2	2013-06-20			ENSG00000221880	ENSG00000221880		"""Keratin associated proteins"""	16771	protein-coding gene	gene with protein product		608820				11279113	Standard	NM_030966		Approved	KAP1.3	uc002hvv.3	Q8IUG1	OTTHUMG00000133583	ENST00000344363.5:c.146G>T	17.37:g.39190928C>A	ENSP00000344420:p.Ser49Ile		Q07628|Q8IUG0|Q9BYS2	Missense_Mutation	SNP	pfam_Keratin-assoc	p.S49I	ENST00000344363.5	37	c.146	CCDS42323.1	17	.	.	.	.	.	.	.	.	.	.	C	8.436	0.849775	0.17034	.	.	ENSG00000221880	ENST00000344363	T	0.32515	1.45	1.48	1.48	0.22813	.	.	.	.	.	T	0.31888	0.0811	.	.	.	0.29102	N	0.881394	D	0.59357	0.985	P	0.48815	0.591	T	0.19549	-1.0302	8	0.56958	D	0.05	.	6.8157	0.23829	0.0:1.0:0.0:0.0	.	59	Q8IUG1	KRA13_HUMAN	I	49	ENSP00000344420:S49I	ENSP00000344420:S49I	S	-	2	0	KRTAP1-3	36444454	0.591000	0.26824	0.036000	0.18154	0.249000	0.25844	1.202000	0.32271	0.713000	0.32060	0.467000	0.42956	AGC	KRTAP1-3	-	pfam_Keratin-assoc	ENSG00000221880		0.622	KRTAP1-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP1-3	HGNC	protein_coding	OTTHUMT00000257687.1	-	0.00	167	0	C			39190928	-1	tier1	-	no_errors	ENST00000344363	ensembl	human	known	74_37	missense	22.06	105	30	SNP	0.758	A
KRTAP10-10	353333	genome.wustl.edu	37	21	46057784	46057784	+	Silent	SNP	C	C	A	rs587722247	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr21:46057784C>A	ENST00000380095.1	+	1	512	c.450C>A	c.(448-450)gtC>gtA	p.V150V	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	150	15 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						GTGTGCCTGTCTGCTCTAAGT	0.612																																																	0													305.0	274.0	285.0					21																	46057784		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.450C>A	21.37:g.46057784C>A				Silent	SNP	NULL	p.V150	ENST00000380095.1	37	c.450	CCDS33585.1	21																																																																																			KRTAP10-10	-	NULL	ENSG00000221859		0.612	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-10	HGNC	protein_coding	OTTHUMT00000128034.1	-	0.00	119	0	C	NM_181688		46057784	+1	tier1	-	no_errors	ENST00000380095	ensembl	human	known	74_37	silent	18.89	72	17	SNP	0.838	A
LAMA1	284217	genome.wustl.edu	37	18	6965422	6965422	+	Silent	SNP	A	A	G			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr18:6965422A>G	ENST00000389658.3	-	50	7153	c.7060T>C	c.(7060-7062)Tta>Cta	p.L2354L		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2354	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				TCGATGGATAAAAAGTCTTTC	0.443																																																	0													73.0	74.0	74.0					18																	6965422		2203	4300	6503	SO:0001819	synonymous_variant	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.7060T>C	18.37:g.6965422A>G				Silent	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.L2354	ENST00000389658.3	37	c.7060	CCDS32787.1	18																																																																																			LAMA1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000101680		0.443	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	-	0.00	49	0	A	NM_005559		6965422	-1	tier1	-	no_errors	ENST00000389658	ensembl	human	known	74_37	silent	48.15	14	13	SNP	0.977	G
LDLRAD4	753	genome.wustl.edu	37	18	13438311	13438311	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr18:13438311G>T	ENST00000359446.5	+	3	577	c.109G>T	c.(109-111)Gac>Tac	p.D37Y	LDLRAD4_ENST00000361205.4_Missense_Mutation_p.D37Y|LDLRAD4_ENST00000399848.3_Missense_Mutation_p.D37Y	NM_001276251.1	NP_001263180.1	O15165	LRAD4_HUMAN	low density lipoprotein receptor class A domain containing 4	37	LDL-receptor class A. {ECO:0000255|PROSITE-ProRule:PRU00124}.				negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	early endosome membrane (GO:0031901)|endosome (GO:0005768)|integral component of membrane (GO:0016021)	R-SMAD binding (GO:0070412)										CCAACAGAACGACTGTGGGGA	0.507																																																	0													130.0	121.0	124.0					18																	13438311		2203	4300	6503	SO:0001583	missense	0			AF009424, AF009428	CCDS32793.1, CCDS32794.1, CCDS32795.1, CCDS42415.1, CCDS62392.1, CCDS62393.1	18p11.21	2014-04-29	2012-10-24	2012-10-24	ENSG00000168675	ENSG00000168675			1224	protein-coding gene	gene with protein product	"""clone 22"""	606571	"""chromosome 18 open reading frame 1"""	C18orf1		9479497, 9129712, 24627487	Standard	NM_181482		Approved		uc002ksb.3	O15165	OTTHUMG00000181925	ENST00000359446.5:c.109G>T	18.37:g.13438311G>T	ENSP00000352420:p.Asp37Tyr		B3KNT9|E9PAY9|K7EN38|O15166|O15167|O15168|Q5U646|Q6NXP3	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	p.D37Y	ENST00000359446.5	37	c.109	CCDS32793.1	18	.	.	.	.	.	.	.	.	.	.	G	23.1	4.374016	0.82573	.	.	ENSG00000168675	ENST00000361205;ENST00000399848	D;D	0.99042	-5.36;-5.36	5.22	5.22	0.72569	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.64402	D	0.000018	D	0.99429	0.9798	M	0.91459	3.21	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.70716	0.95;0.97	D	0.98662	1.0684	10	0.87932	D	0	-6.7555	18.7934	0.91983	0.0:0.0:1.0:0.0	.	37;37	O15165-2;O15165	.;CR001_HUMAN	Y	37	ENSP00000354753:D37Y;ENSP00000382741:D37Y	ENSP00000354753:D37Y	D	+	1	0	C18orf1	13428311	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.309000	0.65774	2.447000	0.82792	0.655000	0.94253	GAC	LDLRAD4	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000168675		0.507	LDLRAD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDLRAD4	HGNC	protein_coding	OTTHUMT00000458326.1		0.00	31	0	G	NM_181481		13438311	+1			no_errors	ENST00000359446	ensembl	human	known	74_37	missense	15.79	16	3	SNP	1.000	T
LEPREL1	55214	genome.wustl.edu	37	3	189688652	189688652	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:189688652C>A	ENST00000319332.5	-	13	2043	c.1846G>T	c.(1846-1848)Gaa>Taa	p.E616*	LEPREL1_ENST00000427335.2_Nonsense_Mutation_p.E435*	NM_018192.3	NP_060662.2	Q8IVL5	P3H2_HUMAN	leprecan-like 1	616	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|peptidyl-proline hydroxylation (GO:0019511)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(5)	41	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TCTCCTCCTTCAAAGTCATCA	0.323																																																	0													105.0	104.0	104.0					3																	189688652		2203	4296	6499	SO:0001587	stop_gained	0				CCDS3294.1, CCDS46981.1	3q29	2014-01-28			ENSG00000090530	ENSG00000090530	1.14.11.7		19317	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 2"""	610341				15063763, 21885030	Standard	NM_018192		Approved	FLJ10718, MLAT4, P3H2	uc011bsk.2	Q8IVL5	OTTHUMG00000156312	ENST00000319332.5:c.1846G>T	3.37:g.189688652C>A	ENSP00000316881:p.Glu616*		B3KPK0|B3KWI9|D3DNV8|Q9NVI2	Nonsense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.E616*	ENST00000319332.5	37	c.1846	CCDS3294.1	3	.	.	.	.	.	.	.	.	.	.	C	41	9.028731	0.99040	.	.	ENSG00000090530	ENST00000319332;ENST00000427335	.	.	.	5.9	5.9	0.94986	.	0.234676	0.50627	D	0.000111	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.1822	19.2555	0.93944	0.0:1.0:0.0:0.0	.	.	.	.	X	616;435	.	.	E	-	1	0	LEPREL1	191171346	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.463000	0.80869	2.786000	0.95864	0.643000	0.83706	GAA	LEPREL1	-	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	ENSG00000090530		0.323	LEPREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPREL1	HGNC	protein_coding	OTTHUMT00000343855.1	-	0.00	28	0	C	NM_018192		189688652	-1	tier1	-	no_errors	ENST00000319332	ensembl	human	known	74_37	nonsense	40.91	13	9	SNP	1.000	A
LGR5	8549	genome.wustl.edu	37	12	71978313	71978313	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:71978313G>T	ENST00000266674.5	+	18	2834	c.2523G>T	c.(2521-2523)tgG>tgT	p.W841C	LGR5_ENST00000536515.1_Missense_Mutation_p.W769C|RP11-186F10.2_ENST00000546601.1_RNA|LGR5_ENST00000540815.2_Missense_Mutation_p.W817C			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	841					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						CCTACGTCTGGACAAGATCAA	0.448																																																	0													132.0	126.0	128.0					12																	71978313		2203	4300	6503	SO:0001583	missense	0			AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.2523G>T	12.37:g.71978313G>T	ENSP00000266674:p.Trp841Cys		D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.W841C	ENST00000266674.5	37	c.2523	CCDS9000.1	12	.	.	.	.	.	.	.	.	.	.	G	10.99	1.507592	0.27036	.	.	ENSG00000139292	ENST00000266674;ENST00000536515;ENST00000540815	T;T;T	0.36520	1.25;1.25;1.25	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000007	T	0.45196	0.1330	M	0.73598	2.24	0.80722	D	1	B;B	0.17852	0.024;0.007	B;B	0.18871	0.023;0.005	T	0.35226	-0.9797	10	0.59425	D	0.04	.	19.3434	0.94355	0.0:0.0:1.0:0.0	.	817;841	O75473-2;O75473	.;LGR5_HUMAN	C	841;769;817	ENSP00000266674:W841C;ENSP00000443033:W769C;ENSP00000441035:W817C	ENSP00000266674:W841C	W	+	3	0	LGR5	70264580	1.000000	0.71417	0.931000	0.37212	0.554000	0.35429	5.417000	0.66423	2.812000	0.96745	0.557000	0.71058	TGG	LGR5	-	NULL	ENSG00000139292		0.448	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR5	HGNC	protein_coding	OTTHUMT00000404744.1	-	0.00	68	0	G	NM_003667		71978313	+1	tier1	-	no_errors	ENST00000266674	ensembl	human	known	74_37	missense	32.00	34	16	SNP	1.000	T
LHCGR	3973	genome.wustl.edu	37	2	48915873	48915873	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:48915873C>A	ENST00000294954.7	-	11	1084	c.1063G>T	c.(1063-1065)Gat>Tat	p.D355Y	LHCGR_ENST00000401907.1_Intron|LHCGR_ENST00000344775.3_Missense_Mutation_p.D293Y|LHCGR_ENST00000405626.1_Missense_Mutation_p.D328Y|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000403273.1_Intron	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	355					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	CCCATAATATCTTCACAGGGA	0.443																																																	0													134.0	135.0	135.0					2																	48915873		2203	4300	6503	SO:0001583	missense	0				CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.1063G>T	2.37:g.48915873C>A	ENSP00000294954:p.Asp355Tyr		Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_LSH_rcpt,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,prints_TSH_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.D355Y	ENST00000294954.7	37	c.1063	CCDS1842.1	2	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127468	0.77549	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626	D;D;D	0.85773	-2.03;-2.03;-2.03	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.93083	0.7798	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.92670	0.6149	9	.	.	.	.	19.2939	0.94114	0.0:1.0:0.0:0.0	.	355	P22888	LSHR_HUMAN	Y	293;355;328	ENSP00000344301:D293Y;ENSP00000294954:D355Y;ENSP00000386033:D328Y	.	D	-	1	0	LHCGR	48769377	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.925000	0.63425	2.791000	0.96007	0.655000	0.94253	GAT	LHCGR	-	prints_Gphrmn_rcpt_fam	ENSG00000138039		0.443	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHCGR	HGNC	protein_coding	OTTHUMT00000251364.4	-	0.00	37	0	C	NM_000233.3		48915873	-1	tier1	-	no_errors	ENST00000294954	ensembl	human	known	74_37	missense	28.21	28	11	SNP	1.000	A
LINC00094	266655	genome.wustl.edu	37	9	136892100	136892100	+	RNA	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr9:136892100G>T	ENST00000603928.1	+	0	572				LINC00094_ENST00000599836.1_RNA|LINC00094_ENST00000605164.1_RNA|LINC00094_ENST00000552018.1_RNA|LINC00094_ENST00000432807.1_RNA|LINC00094_ENST00000430633.1_RNA|LINC00094_ENST00000550853.1_RNA	NR_015427.2				long intergenic non-protein coding RNA 94																		ACACAGGGCAGTCCAAGTTTT	0.478																																																	0																																												0			AK092667		9q34	2012-10-12	2011-08-11	2011-08-11	ENSG00000235106	ENSG00000235106		"""Long non-coding RNAs"""	24742	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 94"""	NCRNA00094		12477932	Standard	NR_015427		Approved	FLJ35348, bA374P20.3	uc004ceu.3		OTTHUMG00000020880		9.37:g.136892100G>T				RNA	SNP	-	NULL	ENST00000603928.1	37	NULL		9																																																																																			LINC00094	-	-	ENSG00000235106		0.478	LINC00094-005	KNOWN	basic	antisense	LINC00094	HGNC	antisense	OTTHUMT00000470013.1		0.00	38	0	G			136892100	+1			no_errors	ENST00000430633	ensembl	human	known	74_37	rna	22.22	14	4	SNP	0.997	T
LINC00283	100874057	genome.wustl.edu	37	13	103396504	103396504	+	RNA	SNP	T	T	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr13:103396504T>C	ENST00000430111.1	+	0	877									long intergenic non-protein coding RNA 283																		GCTTTTTCTTTCTGTGGTTTT	0.363																																																	0													406.0	311.0	340.0					13																	103396504		692	1591	2283			0					13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103396504T>C				RNA	SNP	-	NULL	ENST00000430111.1	37	NULL		13																																																																																			LINC00283	-	-	ENSG00000231633		0.363	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	LINC00283	HGNC	antisense	OTTHUMT00000045714.1	-	0.00	113	0	T			103396504	+1	tier1	-	no_errors	ENST00000430111	ensembl	human	known	74_37	rna	12.07	51	7	SNP	0.007	C
KRT73	319101	genome.wustl.edu	37	12	53007439	53007439	+	Intron	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:53007439C>A	ENST00000305748.3	-	5	1019				RP11-641A6.2_ENST00000549180.1_RNA|RP11-641A6.2_ENST00000552364.1_RNA|RP11-641A6.2_ENST00000551089.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73							extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		GAGGGCCCTGCATACTTCACT	0.612																																																	0													59.0	54.0	56.0					12																	53007439		2203	4300	6503	SO:0001627	intron_variant	0			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.984+32G>T	12.37:g.53007439C>A			Q32MB2	RNA	SNP	-	NULL	ENST00000305748.3	37	NULL	CCDS8834.1	12																																																																																			RP11-641A6.2	-	-	ENSG00000257495		0.612	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100127967	Clone_based_vega_gene	protein_coding	OTTHUMT00000405700.1	-	0.00	50	0	C	NM_175068		53007439	+1	tier1	-	no_errors	ENST00000549180	ensembl	human	known	74_37	rna	20.00	24	6	SNP	0.000	A
TMEM8A	58986	genome.wustl.edu	37	16	436727	436728	+	Intron	DEL	AA	AA	-	rs143645242|rs10544230|rs537641750|rs397823418		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:436727_436728delAA	ENST00000476735.1	-	1	217				Z97634.3_ENST00000412293.1_RNA			Q9HCN3	TMM8A_HUMAN	transmembrane protein 8A						cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)				central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	14						aaaaaaaaccaaaaaaaaaaaa	0.391																																																	0																																										SO:0001627	intron_variant	0			AB045292	CCDS10407.1	16p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000129925	ENSG00000129925			17205	protein-coding gene	gene with protein product			"""transmembrane protein 6"", ""transmembrane protein 8 (five membrane-spanning domains)"""	TMEM6, TMEM8		11006113	Standard	NM_021259		Approved	M83	uc002cgu.4	Q9HCN3	OTTHUMG00000047996	ENST00000476735.1:c.584+168TT>-	16.37:g.436737_436738delAA			D3DU49|Q4TT35|Q8WU24|Q96S25|Q9BR03|Q9BT97|Q9H7B9	RNA	DEL	-	NULL	ENST00000476735.1	37	NULL		16																																																																																			Z97634.3	-	-	ENSG00000236829		0.391	TMEM8A-007	KNOWN	basic	processed_transcript	LOC100134368	Clone_based_vega_gene	protein_coding	OTTHUMT00000313680.1		0.00	13	0	AA	NM_021259		436728	+1	tier1		no_errors	ENST00000457760	ensembl	human	known	74_37	rna	33.33	4	2	DEL	0.004:0.019	-
RP11-85O21.2	0	genome.wustl.edu	37	9	126770359	126770359	+	RNA	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr9:126770359C>A	ENST00000453529.2	-	0	342				RP11-85O21.4_ENST00000421041.1_RNA																							TCTCCAAGAGCAACATCCCTG	0.473																																																	0																																												0																															9.37:g.126770359C>A				RNA	SNP	-	NULL	ENST00000453529.2	37	NULL		9																																																																																			RP11-85O21.2	-	-	ENSG00000236668		0.473	RP11-85O21.2-001	KNOWN	basic	antisense	LOC100505588	Clone_based_vega_gene	antisense	OTTHUMT00000054007.2	-	0.00	37	0	C			126770359	-1	tier1	-	no_errors	ENST00000453529	ensembl	human	known	74_37	rna	38.46	16	10	SNP	1.000	A
DAAM2	23500	genome.wustl.edu	37	6	39867686	39867686	+	Intron	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:39867686C>A	ENST00000398904.2	+	23	2861				DAAM2_ENST00000274867.4_Intron|RP11-61I13.3_ENST00000606829.1_RNA|RP11-61I13.3_ENST00000437947.1_RNA|RP11-61I13.3_ENST00000420293.1_RNA|DAAM2_ENST00000538976.1_Intron|RP11-61I13.3_ENST00000430595.1_RNA			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2						actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					GGGCTGGCTGCTAATGTTAGC	0.493																																																	0																																										SO:0001627	intron_variant	0			AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.2680-167C>A	6.37:g.39867686C>A			G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	RNA	SNP	-	NULL	ENST00000398904.2	37	NULL	CCDS56426.1	6																																																																																			RP11-61I13.3	-	-	ENSG00000235033		0.493	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	LOC100505635	Clone_based_vega_gene	protein_coding	OTTHUMT00000280648.1	-	0.00	15	0	C			39867686	-1	tier1	-	no_errors	ENST00000437947	ensembl	human	known	74_37	rna	28.57	10	4	SNP	0.000	A
SMG1P7	100506060	genome.wustl.edu	37	16	70268081	70268081	+	RNA	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:70268081G>A	ENST00000459379.1	-	0	0																											TCTTACTGTTGGCTAAAAGGC	0.373																																																	0																																												0																															16.37:g.70268081G>A				RNA	SNP	-	NULL	ENST00000459379.1	37	NULL		16																																																																																			RP11-296I10.6	-	-	ENSG00000261556		0.373	snoU13.216-201	NOVEL	basic	snoRNA	LOC100506060	Clone_based_vega_gene	snoRNA		-	0.00	152	0	G			70268081	-1	tier1	-	no_errors	ENST00000568855	ensembl	human	known	74_37	rna	7.61	85	7	SNP	0.997	A
KIAA2012	100652824	genome.wustl.edu	37	2	202967673	202967673	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:202967673C>A	ENST00000541917.1	+	8	1533	c.1160C>A	c.(1159-1161)cCa>cAa	p.P387Q	AC079354.1_ENST00000409515.3_3'UTR|AC079354.1_ENST00000295844.3_Missense_Mutation_p.P443Q																							CTCCAGGCACCAAAGGCTTTG	0.468																																																	0																																										SO:0001583	missense	0																														ENST00000541917.1:c.1160C>A	2.37:g.202967673C>A	ENSP00000437957:p.Pro387Gln			Missense_Mutation	SNP	NULL	p.P387Q	ENST00000541917.1	37	c.1160		2	.	.	.	.	.	.	.	.	.	.	C	16.32	3.089539	0.55968	.	.	ENSG00000182329	ENST00000541917;ENST00000295844;ENST00000498697	.	.	.	5.92	4.12	0.48240	.	0.278953	0.26086	N	0.026429	T	0.53834	0.1821	L	0.56769	1.78	0.09310	N	1	D;D	0.67145	0.996;0.996	P;P	0.62298	0.9;0.9	T	0.45425	-0.9262	9	0.52906	T	0.07	-1.1708	9.4226	0.38561	0.0:0.8352:0.0:0.1648	.	387;443	B4DIH8;E7EP55	.;.	Q	387;443;7	.	ENSP00000295844:P443Q	P	+	2	0	AC079354.1	202675918	0.049000	0.20398	0.003000	0.11579	0.995000	0.86356	1.715000	0.37971	0.838000	0.34948	0.650000	0.86243	CCA	AC079354.1	-	NULL	ENSG00000182329		0.468	AC079354.1-201	KNOWN	basic|appris_principal	protein_coding	LOC100652824	Clone_based_vega_gene	protein_coding		-	0.00	70	0	C			202967673	+1	tier1	-	no_errors	ENST00000541917	ensembl	human	known	74_37	missense	24.44	34	11	SNP	0.003	A
RP11-435B5.5	0	genome.wustl.edu	37	1	143399709	143399710	+	lincRNA	INS	-	-	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:143399709_143399710insT	ENST00000428624.1	+	0	4990				RP11-435B5.4_ENST00000423249.1_lincRNA																							ggaatgagtcattttttttaga	0.46																																																	0																																												0																															1.37:g.143399717_143399717dupT				RNA	INS	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			RP11-435B5.5	-	-	ENSG00000238261		0.460	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1		0.00	9	0	0			143399710	+1			no_errors	ENST00000431700	ensembl	human	known	74_37	rna	42.86	4	3	INS	0.004:0.006	T
LAMP5	24141	genome.wustl.edu	37	20	9495488	9495488	+	5'UTR	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr20:9495488G>T	ENST00000246070.2	+	0	481				RP5-1119D9.4_ENST00000443469.1_RNA|LAMP5_ENST00000427562.2_5'UTR	NM_012261.3	NP_036393.1	Q9UJQ1	LAMP5_HUMAN	lysosomal-associated membrane protein family, member 5							cytoplasmic vesicle membrane (GO:0030659)|dendrite membrane (GO:0032590)|early endosome membrane (GO:0031901)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|endosome membrane (GO:0010008)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)											CCTCATTCGGGGCACTGCGAG	0.622																																																	0													70.0	55.0	60.0					20																	9495488		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AL121740	CCDS13106.1, CCDS56177.1	20p12	2013-03-14	2011-11-25	2011-11-25	ENSG00000125869	ENSG00000125869			16097	protein-coding gene	gene with protein product	"""brain and dendritic cell associated LAMP"""	614641	"""chromosome 20 open reading frame 103"""	C20orf103		11780052, 21642595	Standard	NM_012261		Approved	dJ1119D9.3, BAD-LAMP, UNC-43	uc002wni.2	Q9UJQ1	OTTHUMG00000031851	ENST00000246070.2:c.-12G>T	20.37:g.9495488G>T			B4DHZ7|B7Z9Z9	RNA	SNP	-	NULL	ENST00000246070.2	37	NULL	CCDS13106.1	20																																																																																			RP5-1119D9.4	-	-	ENSG00000225988		0.622	LAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101929329	Clone_based_vega_gene	protein_coding	OTTHUMT00000077946.2	-	0.00	54	0	G	NM_012261		9495488	-1	tier1	-	no_errors	ENST00000443469	ensembl	human	known	74_37	rna	25.71	26	9	SNP	0.000	T
LPHN2	23266	genome.wustl.edu	37	1	82409360	82409360	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:82409360G>T	ENST00000370728.1	+	8	1750	c.1105G>T	c.(1105-1107)Gat>Tat	p.D369Y	LPHN2_ENST00000370721.1_Missense_Mutation_p.D373Y|LPHN2_ENST00000370715.1_Missense_Mutation_p.D369Y|LPHN2_ENST00000394879.1_Missense_Mutation_p.D369Y|LPHN2_ENST00000370723.1_Missense_Mutation_p.D369Y|LPHN2_ENST00000370725.1_Missense_Mutation_p.D369Y|LPHN2_ENST00000319517.6_Missense_Mutation_p.D369Y|LPHN2_ENST00000370730.1_Missense_Mutation_p.D369Y|LPHN2_ENST00000370717.2_Missense_Mutation_p.D369Y|LPHN2_ENST00000370713.1_Missense_Mutation_p.D369Y|LPHN2_ENST00000370727.1_Missense_Mutation_p.D369Y|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000271029.4_Missense_Mutation_p.D369Y|LPHN2_ENST00000359929.3_Missense_Mutation_p.D369Y|LPHN2_ENST00000335786.5_Missense_Mutation_p.D369Y			O95490	LPHN2_HUMAN	latrophilin 2	369	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TGCTGCAGTGGATTACAATCC	0.403																																																	0													139.0	134.0	135.0					1																	82409360		2203	4299	6502	SO:0001583	missense	0			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.1105G>T	1.37:g.82409360G>T	ENSP00000359763:p.Asp369Tyr		A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.D369Y	ENST00000370728.1	37	c.1105		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.09|16.09	3.023981|3.023981	0.54683|0.54683	.|.	.|.	ENSG00000117114|ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786|ENST00000449420	D;D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.90261|.	-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64|.	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	0.055044|.	0.64402|.	D|.	0.000001|.	D|D	0.84620|0.84620	0.5512|0.5512	M|M	0.91818|0.91818	3.245|3.245	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.75484|.	0.986;0.971;0.986|.	D|D	0.87421|0.87421	0.2382|0.2382	10|5	0.87932|.	D|.	0|.	.|.	19.4846|19.4846	0.95024|0.95024	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	369;369;369|.	O95490-3;O95490-4;O95490-2|.	.;.;.|.	Y|C	373;369;369;369;369;369;369;369;369;369;369;369;369;369|236	ENSP00000359756:D373Y;ENSP00000359763:D369Y;ENSP00000359765:D369Y;ENSP00000359762:D369Y;ENSP00000359760:D369Y;ENSP00000359758:D369Y;ENSP00000353006:D369Y;ENSP00000359750:D369Y;ENSP00000359748:D369Y;ENSP00000322270:D369Y;ENSP00000359752:D369Y;ENSP00000378344:D369Y;ENSP00000271029:D369Y;ENSP00000337306:D369Y|.	ENSP00000271029:D369Y|.	D|W	+|+	1|3	0|0	LPHN2|LPHN2	82181948|82181948	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.392000|9.392000	0.97252|0.97252	2.589000|2.589000	0.87451|0.87451	0.557000|0.557000	0.71058|0.71058	GAT|TGG	LPHN2	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000117114		0.403	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	LPHN2	HGNC	protein_coding	OTTHUMT00000027188.1	-	0.00	54	0	G	NM_012302		82409360	+1	tier1	-	no_errors	ENST00000370717	ensembl	human	known	74_37	missense	25.00	24	8	SNP	1.000	T
LRBA	987	genome.wustl.edu	37	4	151502535	151502535	+	Intron	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr4:151502535G>T	ENST00000357115.3	-	41	6607				LRBA_ENST00000535741.1_Intron|LRBA_ENST00000507224.1_Intron|LRBA_ENST00000503716.1_5'UTR|MAB21L2_ENST00000317605.4_5'Flank|LRBA_ENST00000510413.1_Intron|RP11-1336O20.2_ENST00000507934.1_RNA	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing							cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TGGCAACAATGGGAGGGGAGG	0.433																																																	0																																										SO:0001627	intron_variant	0			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.6363+6664C>A	4.37:g.151502535G>T			Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	RNA	SNP	-	NULL	ENST00000357115.3	37	NULL	CCDS3773.1	4																																																																																			LRBA	-	-	ENSG00000198589		0.433	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	HGNC	protein_coding	OTTHUMT00000364939.1	-	0.00	59	0	G			151502535	-1	tier1	-	no_errors	ENST00000503716	ensembl	human	known	74_37	rna	18.00	41	9	SNP	0.276	T
LRRC32	2615	genome.wustl.edu	37	11	76372027	76372027	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:76372027G>A	ENST00000407242.2	-	3	852	c.610C>T	c.(610-612)Ctc>Ttc	p.L204F	LRRC32_ENST00000260061.5_Missense_Mutation_p.L204F|LRRC32_ENST00000404995.1_Missense_Mutation_p.L204F|LRRC32_ENST00000464145.1_Intron|AP001189.4_ENST00000447519.1_RNA	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	204					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						TTCCTGGAGAGGTTGAGATGG	0.612																																																	0													73.0	68.0	70.0					11																	76372027		2200	4292	6492	SO:0001583	missense	0			Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.610C>T	11.37:g.76372027G>A	ENSP00000384126:p.Leu204Phe		Q86V06	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.L204F	ENST00000407242.2	37	c.610	CCDS8245.1	11	.	.	.	.	.	.	.	.	.	.	G	16.50	3.139870	0.56936	.	.	ENSG00000137507	ENST00000260061;ENST00000407242;ENST00000404995	T;T;T	0.74842	-0.88;-0.88;-0.88	4.43	4.43	0.53597	.	0.145674	0.46442	D	0.000291	D	0.86723	0.6001	M	0.81614	2.55	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.89056	0.3459	10	0.87932	D	0	.	17.238	0.87005	0.0:0.0:1.0:0.0	.	204	Q14392	LRC32_HUMAN	F	204	ENSP00000260061:L204F;ENSP00000384126:L204F;ENSP00000385766:L204F	ENSP00000260061:L204F	L	-	1	0	LRRC32	76049675	0.998000	0.40836	0.998000	0.56505	0.604000	0.37047	2.503000	0.45407	2.306000	0.77630	0.462000	0.41574	CTC	LRRC32	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000137507		0.612	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC32	HGNC	protein_coding	OTTHUMT00000257926.2	-	0.00	35	0	G	NM_005512		76372027	-1	tier1	-	no_errors	ENST00000260061	ensembl	human	known	74_37	missense	22.81	44	13	SNP	1.000	A
LRRC4B	94030	genome.wustl.edu	37	19	51022489	51022489	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:51022489G>A	ENST00000599957.1	-	3	678	c.481C>T	c.(481-483)Cgg>Tgg	p.R161W	LRRC4B_ENST00000389201.3_Missense_Mutation_p.R161W			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	161					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		CAGAGCTCCCGCAGCTTGGAC	0.667																																																	0													57.0	62.0	60.0					19																	51022489		2202	4300	6502	SO:0001583	missense	0			BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.481C>T	19.37:g.51022489G>A	ENSP00000471502:p.Arg161Trp		Q3ZCQ4|Q58F20	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R161W	ENST00000599957.1	37	c.481	CCDS42595.1	19	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711267	0.68730	.	.	ENSG00000131409	ENST00000389201;ENST00000535879	D	0.91577	-2.87	3.96	3.96	0.45880	.	0.000000	0.56097	U	0.000035	D	0.94656	0.8277	M	0.85299	2.745	0.49213	D	0.999766	D	0.89917	1.0	D	0.80764	0.994	D	0.94546	0.7749	10	0.87932	D	0	.	9.1887	0.37187	0.0:0.0:0.7833:0.2167	.	161	Q9NT99	LRC4B_HUMAN	W	161	ENSP00000373853:R161W	ENSP00000373853:R161W	R	-	1	2	LRRC4B	55714301	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.660000	0.54496	2.235000	0.73313	0.491000	0.48974	CGG	LRRC4B	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000131409		0.667	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC4B	HGNC	protein_coding	OTTHUMT00000464907.1	-	0.00	74	0	G	NM_001080457		51022489	-1	tier1	-	no_errors	ENST00000389201	ensembl	human	known	74_37	missense	21.05	89	24	SNP	1.000	A
LRRK2	120892	genome.wustl.edu	37	12	40714949	40714949	+	Missense_Mutation	SNP	A	A	C	rs139014427		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:40714949A>C	ENST00000298910.7	+	35	5187	c.5129A>C	c.(5128-5130)aAt>aCt	p.N1710T		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1710					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				AGATTAATCAATCGATTACTT	0.333																																																	0													130.0	126.0	128.0					12																	40714949		2203	4300	6503	SO:0001583	missense	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.5129A>C	12.37:g.40714949A>C	ENSP00000298910:p.Asn1710Thr		A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.N1710T	ENST00000298910.7	37	c.5129	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	A	1.663	-0.511066	0.04231	.	.	ENSG00000188906	ENST00000298910	T	0.70399	-0.48	5.92	-0.486	0.12064	.	0.348947	0.35936	N	0.002895	T	0.37265	0.0997	N	0.01874	-0.695	0.35969	D	0.835157	B;B	0.11235	0.002;0.004	B;B	0.12837	0.006;0.008	T	0.20571	-1.0271	10	0.12766	T	0.61	.	10.3502	0.43931	0.6818:0.0:0.3182:0.0	.	1710;1710	Q17RV3;Q5S007	.;LRRK2_HUMAN	T	1710	ENSP00000298910:N1710T	ENSP00000298910:N1710T	N	+	2	0	LRRK2	39001216	1.000000	0.71417	0.989000	0.46669	0.917000	0.54804	1.231000	0.32624	-0.057000	0.13199	-0.899000	0.02877	AAT	LRRK2	-	NULL	ENSG00000188906		0.333	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	-	0.00	81	0	A	XM_058513		40714949	+1	tier1	-	no_errors	ENST00000298910	ensembl	human	known	74_37	missense	39.22	31	20	SNP	0.997	C
LRSAM1	90678	genome.wustl.edu	37	9	130230083	130230083	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr9:130230083C>T	ENST00000323301.4	+	9	1197	c.593C>T	c.(592-594)gCg>gTg	p.A198V	LRSAM1_ENST00000300417.6_Missense_Mutation_p.A198V|LRSAM1_ENST00000373322.1_Missense_Mutation_p.A198V|LRSAM1_ENST00000373324.4_Missense_Mutation_p.A198V	NM_138361.5	NP_612370.3	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif containing 1	198					cell death (GO:0008219)|negative regulation of endocytosis (GO:0045806)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent endocytosis (GO:0070086)|viral budding (GO:0046755)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(2)	16						GCCGGCACTGCGGCCATCTTG	0.627																																																	0													66.0	50.0	56.0					9																	130230083		2203	4300	6503	SO:0001583	missense	0			AK056203	CCDS6873.1, CCDS55347.1	9q34.13	2014-09-17			ENSG00000148356	ENSG00000148356		"""Sterile alpha motif (SAM) domain containing"""	25135	protein-coding gene	gene with protein product		610933				12975309	Standard	NM_001005373		Approved	FLJ31641	uc004brd.2	Q6UWE0	OTTHUMG00000020701	ENST00000323301.4:c.593C>T	9.37:g.130230083C>T	ENSP00000322937:p.Ala198Val		Q5VVV0|Q8NB40|Q96GT5|Q96MX5|Q96MZ7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_PTS_PEP_utilis_N,smart_Leu-rich_rpt_typical-subtyp,smart_SAM,pfscan_SAM,pfscan_Znf_RING	p.A198V	ENST00000323301.4	37	c.593	CCDS6873.1	9	.	.	.	.	.	.	.	.	.	.	C	8.841	0.942252	0.18281	.	.	ENSG00000148356	ENST00000300417;ENST00000373324;ENST00000323301;ENST00000373322	T;T;T;T	0.33654	1.43;1.4;1.43;1.43	5.46	2.09	0.27110	Insulin-like (1);	0.266951	0.41712	D	0.000823	T	0.22205	0.0535	N	0.22421	0.69	0.09310	N	1	B;B	0.29766	0.209;0.256	B;B	0.25987	0.065;0.029	T	0.12192	-1.0557	10	0.22706	T	0.39	-0.044	12.4897	0.55893	0.2919:0.7081:0.0:0.0	.	198;198	Q6UWE0-2;Q6UWE0	.;LRSM1_HUMAN	V	198	ENSP00000300417:A198V;ENSP00000362421:A198V;ENSP00000322937:A198V;ENSP00000362419:A198V	ENSP00000300417:A198V	A	+	2	0	LRSAM1	129269904	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	0.197000	0.17197	0.154000	0.19237	0.561000	0.74099	GCG	LRSAM1	-	NULL	ENSG00000148356		0.627	LRSAM1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRSAM1	HGNC	protein_coding	OTTHUMT00000054164.1	-	0.00	31	0	C	NM_138361		130230083	+1	tier1	-	no_errors	ENST00000300417	ensembl	human	known	74_37	missense	33.33	22	11	SNP	0.000	T
LSM14B	149986	genome.wustl.edu	37	20	60708434	60708434	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr20:60708434C>T	ENST00000279068.6	+	8	1235	c.1075C>T	c.(1075-1077)Cgg>Tgg	p.R359W	LSM14B_ENST00000253001.4_Missense_Mutation_p.R359W	NM_144703.2	NP_653304.2	Q9BX40	LS14B_HUMAN	LSM14B, SCD6 homolog B (S. cerevisiae)	359					multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)	ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|lung(4)	8	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			CCGCAGTTCTCGGGGCGGATT	0.637																																																	0													84.0	100.0	95.0					20																	60708434		1991	4144	6135	SO:0001583	missense	0			AF172328	CCDS46626.1	20q13.33	2010-01-27	2006-12-21	2006-01-24	ENSG00000149657	ENSG00000149657			15887	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 40"", ""family with sequence similarity 61, member B"", ""LSM14 homolog B (SCD6, S. cerevisiae)"""	C20orf40, FAM61B			Standard	NM_144703		Approved	FT005, bA11M20.3, FLJ25473, LSM13, RAP55B	uc010gjy.1	Q9BX40	OTTHUMG00000032901	ENST00000279068.6:c.1075C>T	20.37:g.60708434C>T	ENSP00000279068:p.Arg359Trp		Q6PFW8|Q96LH8	Missense_Mutation	SNP	pfam_FDF_dom,superfamily_LSM_dom	p.R359W	ENST00000279068.6	37	c.1075	CCDS46626.1	20	.	.	.	.	.	.	.	.	.	.	C	19.47	3.833525	0.71258	.	.	ENSG00000149657	ENST00000279068;ENST00000253001	T;T	0.58940	0.33;0.3	4.7	2.57	0.30868	.	0.000000	0.85682	D	0.000000	T	0.57330	0.2046	N	0.24115	0.695	0.44337	D	0.997225	D;D;D	0.76494	0.996;0.999;0.999	P;P;P	0.59703	0.53;0.732;0.862	T	0.63301	-0.6668	10	0.87932	D	0	.	12.8522	0.57864	0.3237:0.6763:0.0:0.0	.	279;359;359	E9PG81;Q9BX40;Q9BX40-2	.;LS14B_HUMAN;.	W	359	ENSP00000279068:R359W;ENSP00000253001:R359W	ENSP00000253001:R359W	R	+	1	2	LSM14B	60141829	1.000000	0.71417	0.463000	0.27130	0.945000	0.59286	1.298000	0.33412	1.157000	0.42530	0.655000	0.94253	CGG	LSM14B	-	NULL	ENSG00000149657		0.637	LSM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM14B	HGNC	protein_coding	OTTHUMT00000079996.4	-	0.00	51	0	C	NM_144703		60708434	+1	tier1	-	no_errors	ENST00000253001	ensembl	human	known	74_37	missense	25.00	33	11	SNP	0.949	T
MAB21L1	4081	genome.wustl.edu	37	13	36049408	36049408	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr13:36049408C>T	ENST00000379919.4	-	1	1424	c.868G>A	c.(868-870)Gac>Aac	p.D290N	NBEA_ENST00000400445.3_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000310336.4_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	290					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		TCGTCCCAGTCCGACTCTCGG	0.542																																																	0													98.0	84.0	89.0					13																	36049408		2203	4300	6503	SO:0001583	missense	0			BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.868G>A	13.37:g.36049408C>T	ENSP00000369251:p.Asp290Asn		Q6I9T5	Missense_Mutation	SNP	pfam_Mab-21_dom	p.D290N	ENST00000379919.4	37	c.868	CCDS9353.1	13	.	.	.	.	.	.	.	.	.	.	C	23.2	4.382673	0.82792	.	.	ENSG00000180660	ENST00000379919	T	0.09255	3.0	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.23210	0.0561	L	0.43152	1.355	0.80722	D	1	P	0.38863	0.65	P	0.51701	0.677	T	0.00132	-1.2011	10	0.40728	T	0.16	-24.7997	19.9576	0.97228	0.0:1.0:0.0:0.0	.	290	Q13394	MB211_HUMAN	N	290	ENSP00000369251:D290N	ENSP00000369251:D290N	D	-	1	0	MAB21L1	34947408	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.736000	0.93811	0.655000	0.94253	GAC	MAB21L1	-	pfam_Mab-21_dom	ENSG00000180660		0.542	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L1	HGNC	protein_coding	OTTHUMT00000044459.3	-	0.00	66	0	C	NM_005584		36049408	-1	tier1	-	no_errors	ENST00000379919	ensembl	human	known	74_37	missense	14.29	30	5	SNP	1.000	T
MAB21L3	126868	genome.wustl.edu	37	1	116675848	116675848	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:116675848G>T	ENST00000369500.3	+	7	1216	c.951G>T	c.(949-951)aaG>aaT	p.K317N		NM_152367.2	NP_689580.2	Q8N8X9	MB213_HUMAN	mab-21-like 3 (C. elegans)	317										breast(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|urinary_tract(1)	19						AACTGCACAAGTGCGTGAGCC	0.517																																																	0													97.0	82.0	87.0					1																	116675848		2203	4300	6503	SO:0001583	missense	0			AK096035	CCDS886.1	1p13.1	2011-02-23	2011-02-23	2011-02-23	ENSG00000173212	ENSG00000173212			26787	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 161"""	C1orf161		14702039	Standard	NM_152367		Approved	FLJ38716	uc001egc.1	Q8N8X9	OTTHUMG00000012110	ENST00000369500.3:c.951G>T	1.37:g.116675848G>T	ENSP00000358512:p.Lys317Asn		Q5TDL7	Missense_Mutation	SNP	pfam_Mab-21_dom	p.K317N	ENST00000369500.3	37	c.951	CCDS886.1	1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111097	0.77210	.	.	ENSG00000173212	ENST00000369500	T	0.09817	2.94	5.57	4.64	0.57946	.	0.159662	0.44285	D	0.000466	T	0.17534	0.0421	M	0.76838	2.35	0.44660	D	0.997644	D	0.63880	0.993	D	0.65874	0.939	T	0.05037	-1.0910	10	0.23302	T	0.38	-33.3048	11.2421	0.48974	0.1428:0.0:0.8572:0.0	.	317	Q8N8X9	MB213_HUMAN	N	317	ENSP00000358512:K317N	ENSP00000358512:K317N	K	+	3	2	MAB21L3	116477371	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.579000	0.53900	1.460000	0.47911	0.655000	0.94253	AAG	MAB21L3	-	pfam_Mab-21_dom	ENSG00000173212		0.517	MAB21L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L3	HGNC	protein_coding	OTTHUMT00000033486.1	-	0.00	39	0	G	NM_152367		116675848	+1	tier1	-	no_errors	ENST00000369500	ensembl	human	known	74_37	missense	29.03	22	9	SNP	1.000	T
MAGEL2	54551	genome.wustl.edu	37	15	23889871	23889871	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr15:23889871G>A	ENST00000532292.1	-	1	1304	c.1210C>T	c.(1210-1212)Cag>Tag	p.Q404*		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	287	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		GAATTATCCTGGGTGGCACTG	0.587																																																	0													43.0	44.0	43.0					15																	23889871		2007	4177	6184	SO:0001587	stop_gained	0			AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.1210C>T	15.37:g.23889871G>A	ENSP00000433433:p.Gln404*			Nonsense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.Q404*	ENST00000532292.1	37	c.1210		15																																																																																			MAGEL2	-	NULL	ENSG00000254585		0.587	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	MAGEL2	HGNC	protein_coding	OTTHUMT00000395182.2	-	0.00	41	0	G	NM_019066		23889871	-1	tier1	-	no_errors	ENST00000532292	ensembl	human	known	74_37	nonsense	44.44	10	8	SNP	0.117	A
MAGI3	260425	genome.wustl.edu	37	1	114226111	114226111	+	Silent	SNP	A	A	G			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:114226111A>G	ENST00000307546.9	+	21	3996	c.3921A>G	c.(3919-3921)aaA>aaG	p.K1307K	MAGI3_ENST00000369615.1_3'UTR	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	1332					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGAGGCCAAATTATTAGAGG	0.463																																																	0													115.0	106.0	109.0					1																	114226111		1568	3582	5150	SO:0001819	synonymous_variant	0			AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.3921A>G	1.37:g.114226111A>G			Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Silent	SNP	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.K1307	ENST00000307546.9	37	c.3921	CCDS44196.1	1																																																																																			MAGI3	-	NULL	ENSG00000081026		0.463	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	MAGI3	HGNC	protein_coding	OTTHUMT00000032429.1		0.00	30	0	A	NM_152900		114226111	+1			no_errors	ENST00000307546	ensembl	human	novel	74_37	silent	15.38	11	2	SNP	0.000	G
MAP4K3	8491	genome.wustl.edu	37	2	39477812	39477812	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:39477812G>A	ENST00000263881.3	-	34	2956	c.2632C>T	c.(2632-2634)Ccc>Tcc	p.P878S	MAP4K3_ENST00000536018.1_Missense_Mutation_p.P431S|MAP4K3_ENST00000437545.1_Missense_Mutation_p.P794S|MAP4K3_ENST00000341681.5_Missense_Mutation_p.P857S	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	878					intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				TTTGCTGTGGGGTTATCAGTT	0.363																																																	0													141.0	120.0	127.0					2																	39477812		2203	4300	6503	SO:0001583	missense	0			AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.2632C>T	2.37:g.39477812G>A	ENSP00000263881:p.Pro878Ser		Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.P878S	ENST00000263881.3	37	c.2632	CCDS1803.1	2	.	.	.	.	.	.	.	.	.	.	G	18.70	3.680217	0.68042	.	.	ENSG00000011566	ENST00000263881;ENST00000437545;ENST00000341681;ENST00000536018	T;T;T;T	0.72835	-0.69;-0.53;-0.68;2.24	5.4	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.77519	0.4142	L	0.40543	1.245	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.78314	0.991;0.96	T	0.77859	-0.2431	10	0.45353	T	0.12	.	14.4503	0.67379	0.0706:0.0:0.9294:0.0	.	857;878	Q8IVH8-3;Q8IVH8	.;M4K3_HUMAN	S	878;794;857;431	ENSP00000263881:P878S;ENSP00000416958:P794S;ENSP00000345434:P857S;ENSP00000440580:P431S	ENSP00000263881:P878S	P	-	1	0	MAP4K3	39331316	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.062000	0.93920	1.521000	0.48983	0.591000	0.81541	CCC	MAP4K3	-	NULL	ENSG00000011566		0.363	MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP4K3	HGNC	protein_coding	OTTHUMT00000219966.2	-	0.00	52	0	G	NM_003618		39477812	-1	tier1	-	no_errors	ENST00000263881	ensembl	human	known	74_37	missense	22.50	31	9	SNP	1.000	A
MAPK8IP1	9479	genome.wustl.edu	37	11	45924519	45924519	+	Missense_Mutation	SNP	G	G	A	rs368904071		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:45924519G>A	ENST00000241014.2	+	5	1371	c.1201G>A	c.(1201-1203)Gga>Aga	p.G401R	RP11-618K13.2_ENST00000533218.1_RNA|MAPK8IP1_ENST00000395629.2_Missense_Mutation_p.G391R	NM_005456.3	NP_005447.1	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting protein 1	401	Interaction with MAP3K7.				JUN phosphorylation (GO:0007258)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|positive regulation of signal transduction (GO:0009967)|regulation of JNK cascade (GO:0046328)|regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic growth cone (GO:0044294)|dentate gyrus mossy fiber (GO:0044302)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase inhibitor activity (GO:0004860)	p.G401*(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)	24				GBM - Glioblastoma multiforme(35;0.231)		GCCGTGCTTCGGAGACTACAG	0.592																																																	1	Substitution - Nonsense(1)	lung(1)						G	ARG/GLY	0,4406		0,0,2203	49.0	39.0	42.0		1201	3.7	1.0	11		42	1,8595	1.2+/-3.3	0,1,4297	no	missense	MAPK8IP1	NM_005456.3	125	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	benign	401/712	45924519	1,13001	2203	4298	6501	SO:0001583	missense	0				CCDS7916.1	11p11.2	2009-07-24			ENSG00000121653	ENSG00000121653			6882	protein-coding gene	gene with protein product		604641		PRKM8IP		9235893, 9442013	Standard	NM_005456		Approved	IB1, JIP-1, JIP1	uc001nbr.3	Q9UQF2	OTTHUMG00000134324	ENST00000241014.2:c.1201G>A	11.37:g.45924519G>A	ENSP00000241014:p.Gly401Arg		D3DQP4|O43407	Missense_Mutation	SNP	pfam_PTB/PI_dom,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,smart_PTB/PI_dom,pfscan_PTB/PI_dom,pfscan_SH3_domain	p.G401R	ENST00000241014.2	37	c.1201	CCDS7916.1	11	.	.	.	.	.	.	.	.	.	.	G	11.38	1.621883	0.28889	0.0	1.16E-4	ENSG00000121653	ENST00000241014;ENST00000395629	T;T	0.22134	1.97;1.97	4.69	3.73	0.42828	Src homology-3 domain (1);	0.416377	0.27151	N	0.020691	T	0.11580	0.0282	N	0.08118	0	0.09310	N	0.999998	B	0.22746	0.074	B	0.10450	0.005	T	0.24621	-1.0155	10	0.62326	D	0.03	-8.3699	13.3664	0.60687	0.0:0.0:0.7527:0.2473	.	401	Q9UQF2	JIP1_HUMAN	R	401;391	ENSP00000241014:G401R;ENSP00000378991:G391R	ENSP00000241014:G401R	G	+	1	0	MAPK8IP1	45881095	0.926000	0.31397	0.997000	0.53966	0.952000	0.60782	0.801000	0.27055	2.448000	0.82819	0.561000	0.74099	GGA	MAPK8IP1	-	superfamily_SH3_domain	ENSG00000121653		0.592	MAPK8IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK8IP1	HGNC	protein_coding	OTTHUMT00000259405.1	-	0.00	46	0	G	NM_005456		45924519	+1	tier1	-	no_errors	ENST00000241014	ensembl	human	known	74_37	missense	17.86	23	5	SNP	0.131	A
MARC2	54996	genome.wustl.edu	37	1	220957426	220957426	+	3'UTR	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:220957426G>T	ENST00000366913.3	+	0	1403				MARC1_ENST00000366910.5_5'Flank|MARC2_ENST00000359316.2_3'UTR|MARC2_ENST00000472447.1_3'UTR	NM_017898.3	NP_060368.2	Q969Z3	MARC2_HUMAN	mitochondrial amidoxime reducing component 2						detoxification of nitrogen compound (GO:0051410)|nitrate metabolic process (GO:0042126)|oxidation-reduction process (GO:0055114)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|nitrate reductase activity (GO:0008940)|pyridoxal phosphate binding (GO:0030170)										GAAAGTATTAGAGGGGGGAAT	0.308																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS1525.1	1q41	2011-11-02	2011-11-02	2011-11-02	ENSG00000117791	ENSG00000117791			26064	protein-coding gene	gene with protein product		614127	"""MOCO sulphurase C-terminal domain containing 2"""	MOSC2		11886751	Standard	NM_017898		Approved	FLJ20605	uc001hmq.3	Q969Z3	OTTHUMG00000037354	ENST00000366913.3:c.*197G>T	1.37:g.220957426G>T			B2D0R5|D3DTB3|Q0JSK7|Q5VT67|Q5VXC7|Q7L317|Q9H066|Q9NWU0	RNA	SNP	-	NULL	ENST00000366913.3	37	NULL	CCDS1525.1	1																																																																																			MARC2	-	-	ENSG00000117791		0.308	MARC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARC2	HGNC	protein_coding	OTTHUMT00000090911.1	-	0.00	25	0	G	NM_017898		220957426	+1	tier1	-	no_errors	ENST00000472447	ensembl	human	known	74_37	rna	23.53	13	4	SNP	0.000	T
MARK2	2011	genome.wustl.edu	37	11	63672373	63672373	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:63672373C>A	ENST00000509502.2	+	16	2153	c.1690C>A	c.(1690-1692)Cat>Aat	p.H564N	MARK2_ENST00000315032.8_Missense_Mutation_p.H598N|MARK2_ENST00000350490.7_Missense_Mutation_p.H543N|MARK2_ENST00000502399.3_Missense_Mutation_p.H597N|MARK2_ENST00000413835.2_Missense_Mutation_p.H544N|MARK2_ENST00000408948.3_Missense_Mutation_p.H510N|MARK2_ENST00000361128.5_Missense_Mutation_p.H544N|MARK2_ENST00000425897.2_Missense_Mutation_p.H518N|MARK2_ENST00000377810.3_Missense_Mutation_p.H510N|MARK2_ENST00000508192.1_Missense_Mutation_p.H543N|MARK2_ENST00000377809.4_Missense_Mutation_p.H598N|MARK2_ENST00000402010.2_Missense_Mutation_p.H598N|MARK2_ENST00000513765.2_Missense_Mutation_p.H565N	NM_017490.3	NP_059672.2			MAP/microtubule affinity-regulating kinase 2											autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33						AAGCACCTTCCATGCTGGGCA	0.667																																																	0													64.0	59.0	61.0					11																	63672373		2201	4297	6498	SO:0001583	missense	0			BC008771	CCDS8051.1, CCDS41665.1, CCDS8051.2, CCDS53649.1, CCDS53650.1, CCDS53651.1	11q13.1	2013-06-27	2002-07-26	2002-08-01	ENSG00000072518	ENSG00000072518			3332	protein-coding gene	gene with protein product	"""ELKL motif kinase 1"", ""serine/threonine kinase"", ""protein-serine/threonine kinase"", ""Ser/Thr protein kinase PAR-1B"""	600526	"""ELKL motif kinase"""	EMK1		9730619, 10516437	Standard	NM_017490		Approved	PAR-1, Par1b, PAR-1B	uc001nxw.3	Q7KZI7	OTTHUMG00000160504	ENST00000509502.2:c.1690C>A	11.37:g.63672373C>A	ENSP00000423974:p.His564Asn			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.H598N	ENST00000509502.2	37	c.1792	CCDS41665.1	11	.	.	.	.	.	.	.	.	.	.	c	12.55	1.970250	0.34754	.	.	ENSG00000072518	ENST00000402010;ENST00000315032;ENST00000377809;ENST00000413835;ENST00000377810;ENST00000508192;ENST00000361128;ENST00000350490;ENST00000502399;ENST00000509502;ENST00000513765;ENST00000408948;ENST00000425897	T;T;T;T;T;T;T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79;0.79	4.51	2.63	0.31362	.	0.061560	0.64402	D	0.000005	T	0.63212	0.2492	M	0.71581	2.175	0.44417	D	0.997331	B;D;B;P;D;D	0.71674	0.058;0.998;0.318;0.557;0.993;0.989	B;D;B;B;P;D	0.74674	0.029;0.984;0.343;0.215;0.889;0.948	T	0.63769	-0.6562	10	0.62326	D	0.03	.	10.0802	0.42384	0.0:0.8309:0.0:0.1691	.	518;564;543;544;598;543	E7ETY4;Q7KZI7-14;Q7KZI7-15;Q7KZI7-5;Q7KZI7;Q7KZI7-16	.;.;.;.;MARK2_HUMAN;.	N	598;598;598;544;510;543;544;543;599;564;565;510;518	ENSP00000385751:H598N;ENSP00000326632:H598N;ENSP00000367040:H598N;ENSP00000389184:H544N;ENSP00000367041:H510N;ENSP00000425765:H543N;ENSP00000355091:H544N;ENSP00000294247:H543N;ENSP00000423974:H564N;ENSP00000421075:H565N;ENSP00000386128:H510N;ENSP00000415494:H518N	ENSP00000326632:H598N	H	+	1	0	MARK2	63428949	1.000000	0.71417	0.972000	0.41901	0.003000	0.03518	7.624000	0.83124	0.647000	0.30713	-0.267000	0.10333	CAT	MARK2	-	NULL	ENSG00000072518		0.667	MARK2-003	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	MARK2	HGNC	protein_coding	OTTHUMT00000360862.2	-	0.00	51	0	C	NM_017490		63672373	+1	tier1	-	no_errors	ENST00000402010	ensembl	human	known	74_37	missense	23.26	33	10	SNP	1.000	A
MCF2L2	23101	genome.wustl.edu	37	3	183097171	183097171	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:183097171G>T	ENST00000328913.3	-	3	486	c.189C>A	c.(187-189)atC>atA	p.I63I	MCF2L2_ENST00000447025.2_Silent_p.I63I|MCF2L2_ENST00000414362.2_Silent_p.I63I|MCF2L2_ENST00000473233.1_Silent_p.I63I	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	63	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GGAACGTGATGATGGGGGCGC	0.527																																																	0													112.0	95.0	101.0					3																	183097171		2203	4300	6503	SO:0001819	synonymous_variant	0			AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.189C>A	3.37:g.183097171G>T			O94942|Q6P2B8|Q6ZVJ5|Q8N318	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.I63	ENST00000328913.3	37	c.189	CCDS3243.1	3																																																																																			MCF2L2	-	superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000053524		0.527	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCF2L2	HGNC	protein_coding	OTTHUMT00000350868.1	-	0.00	55	0	G	NM_015078		183097171	-1	tier1	-	no_errors	ENST00000328913	ensembl	human	known	74_37	silent	20.83	38	10	SNP	1.000	T
MASP1	5648	genome.wustl.edu	37	3	186943175	186943175	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:186943175C>A	ENST00000337774.5	-	13	2067	c.1678G>T	c.(1678-1680)Gag>Tag	p.E560*		NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	560	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		ACTGGGCTCTCCAACAGCTCC	0.562																																																	0													197.0	174.0	182.0					3																	186943175		2203	4300	6503	SO:0001587	stop_gained	0			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1678G>T	3.37:g.186943175C>A	ENSP00000336792:p.Glu560*		A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Nonsense_Mutation	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,smart_Peptidase_S1,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.E560*	ENST00000337774.5	37	c.1678	CCDS33907.1	3	.	.	.	.	.	.	.	.	.	.	C	38	7.230244	0.98150	.	.	ENSG00000127241	ENST00000337774	.	.	.	5.9	-1.66	0.08265	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	6.1742	0.20434	0.0:0.4943:0.2226:0.2831	.	.	.	.	X	560	.	ENSP00000336792:E560X	E	-	1	0	MASP1	188425869	0.000000	0.05858	0.000000	0.03702	0.696000	0.40369	-0.085000	0.11250	-0.209000	0.10156	0.563000	0.77884	GAG	MASP1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	ENSG00000127241		0.562	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	HGNC	protein_coding	OTTHUMT00000344262.1	-	0.00	76	0	C	NM_001879		186943175	-1	tier1	-	no_errors	ENST00000337774	ensembl	human	known	74_37	nonsense	44.55	56	45	SNP	0.000	A
MDN1	23195	genome.wustl.edu	37	6	90362717	90362717	+	Silent	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:90362717G>A	ENST00000369393.3	-	94	15934	c.15819C>T	c.(15817-15819)atC>atT	p.I5273I	MDN1_ENST00000428876.1_Silent_p.I5273I			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	5273					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CTACCTGGAAGATCGTGTCCA	0.333																																																	0													232.0	211.0	218.0					6																	90362717		2203	4300	6503	SO:0001819	synonymous_variant	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.15819C>T	6.37:g.90362717G>A			O15019|Q5T794	Silent	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.I5273	ENST00000369393.3	37	c.15819	CCDS5024.1	6																																																																																			MDN1	-	pirsf_Midasin	ENSG00000112159		0.333	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	-	0.00	160	0	G			90362717	-1	tier1	-	no_errors	ENST00000369393	ensembl	human	known	74_37	silent	33.01	69	34	SNP	0.320	A
MED12	9968	genome.wustl.edu	37	X	70346289	70346289	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:70346289G>T	ENST00000374080.3	+	19	2672	c.2640G>T	c.(2638-2640)atG>atT	p.M880I	MED12_ENST00000374102.1_Missense_Mutation_p.M880I|MED12_ENST00000462984.1_3'UTR|MED12_ENST00000333646.6_Missense_Mutation_p.M880I			Q93074	MED12_HUMAN	mediator complex subunit 12	880					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					TCGACCTCATGGAATATTCAC	0.532			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																	Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													165.0	153.0	157.0					X																	70346289		2126	4208	6334	SO:0001583	missense	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.2640G>T	X.37:g.70346289G>T	ENSP00000363193:p.Met880Ile		O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.M880I	ENST00000374080.3	37	c.2640	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	.	18.17	3.565146	0.65651	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	D	0.86944	0.6055	M	0.69823	2.125	0.80722	D	1	D;P;P;D	0.61697	0.99;0.949;0.864;0.983	D;P;P;D	0.68483	0.958;0.504;0.547;0.909	D	0.88648	0.3180	10	0.72032	D	0.01	-16.4165	17.1036	0.86656	0.0:0.0:1.0:0.0	.	880;727;880;880	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	I	880;880;880;880;848	ENSP00000333125:M880I;ENSP00000363215:M880I;ENSP00000363193:M880I;ENSP00000414203:M848I	ENSP00000333125:M880I	M	+	3	0	MED12	70263014	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.986000	0.93492	2.217000	0.71921	0.529000	0.55759	ATG	MED12	-	NULL	ENSG00000184634		0.532	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	-	0.00	38	0	G	NM_005120		70346289	+1	tier1	-	no_errors	ENST00000333646	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
MET	4233	genome.wustl.edu	37	7	116339373	116339373	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:116339373C>A	ENST00000318493.6	+	2	422	c.235C>A	c.(235-237)Cag>Aag	p.Q79K	MET_ENST00000436117.2_Missense_Mutation_p.Q79K|MET_ENST00000397752.3_Missense_Mutation_p.Q79K			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			GGAAGACCTTCAGAAGGTTGC	0.458			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																															Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	0													90.0	86.0	87.0					7																	116339373		1915	4132	6047	SO:0001583	missense	0	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.235C>A	7.37:g.116339373C>A	ENSP00000317272:p.Gln79Lys		A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semap_dom,pfscan_Prot_kinase_dom	p.Q79K	ENST00000318493.6	37	c.235	CCDS47689.1	7	.	.	.	.	.	.	.	.	.	.	C	8.359	0.832721	0.16820	.	.	ENSG00000105976	ENST00000437703;ENST00000456159;ENST00000397752;ENST00000318493;ENST00000436117	T;T;T;T	0.04603	3.59;3.59;3.59;3.59	5.9	5.02	0.67125	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.241003	0.41712	D	0.000821	T	0.06234	0.0161	L	0.48642	1.525	0.80722	D	1	B;B;B;B;B;B;B;B;B;B;B;B;B	0.22080	0.021;0.018;0.018;0.018;0.018;0.018;0.018;0.018;0.004;0.001;0.018;0.064;0.064	B;B;B;B;B;B;B;B;B;B;B;B;B	0.26416	0.023;0.026;0.042;0.042;0.042;0.026;0.042;0.026;0.011;0.009;0.026;0.069;0.069	T	0.33394	-0.9870	10	0.22109	T	0.4	-4.4631	12.0145	0.53307	0.1368:0.7318:0.1314:0.0	.	79;79;79;79;79;79;79;79;79;79;79;79;79	B5A929;E7EQ94;B5A930;B5A934;B5A936;B5A937;B5A939;B5A941;B5A940;P08581-2;B5A942;P08581;A1L467	.;.;.;.;.;.;.;.;.;.;.;MET_HUMAN;.	K	98;98;79;79;79	ENSP00000413857:Q98K;ENSP00000380860:Q79K;ENSP00000317272:Q79K;ENSP00000410980:Q79K	ENSP00000317272:Q79K	Q	+	1	0	MET	116126609	0.989000	0.36119	0.996000	0.52242	0.675000	0.39556	2.767000	0.47637	1.498000	0.48600	0.655000	0.94253	CAG	MET	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000105976		0.458	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MET	HGNC	protein_coding	OTTHUMT00000059620.3	-	0.00	31	0	C			116339373	+1	tier1	-	no_errors	ENST00000318493	ensembl	human	known	74_37	missense	44.62	36	29	SNP	0.990	A
METTL10	399818	genome.wustl.edu	37	10	126454174	126454174	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr10:126454174C>A	ENST00000368836.2	-	5	439	c.403G>T	c.(403-405)Gaa>Taa	p.E135*	RP11-12J10.3_ENST00000494792.1_Nonstop_Mutation_p.*99Y|Y_RNA_ENST00000362596.1_RNA	NM_212554.2	NP_997719.2	Q5JPI9	MET10_HUMAN	methyltransferase like 10	135							methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5		all_lung(145;0.0186)|Lung NSC(174;0.0295)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.101)|COAD - Colon adenocarcinoma(40;0.111)		AAAAAGTCTTCTACCTATATT	0.333																																																	0													42.0	42.0	42.0					10																	126454174		2203	4300	6503	SO:0001587	stop_gained	0				CCDS31307.1	10q26.13	2010-01-15			ENSG00000203791	ENSG00000203791			33787	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 138"""	C10orf138			Standard	NM_212554		Approved	Em:AC068896.3	uc001lhy.1	Q5JPI9	OTTHUMG00000019217	ENST00000368836.2:c.403G>T	10.37:g.126454174C>A	ENSP00000357829:p.Glu135*		A8MPY7	Nonsense_Mutation	SNP	pfam_Methyltransf_11,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom,pfam_tRNA_(Gua-N-7)_MeTrfase	p.E135*	ENST00000368836.2	37	c.403	CCDS31307.1	10	.	.	.	.	.	.	.	.	.	.	C	35	5.475480	0.96291	.	.	ENSG00000203791	ENST00000368836;ENST00000358960	.	.	.	5.69	5.69	0.88448	.	0.120124	0.53938	D	0.000048	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-16.7725	13.0634	0.59020	0.0:0.9267:0.0:0.0733	.	.	.	.	X	135	.	ENSP00000351845:E135X	E	-	1	0	METTL10	126444164	0.772000	0.28567	0.996000	0.52242	0.969000	0.65631	1.145000	0.31577	2.688000	0.91661	0.460000	0.39030	GAA	METTL10	-	pfam_Methyltransf_11,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom,pfam_tRNA_(Gua-N-7)_MeTrfase	ENSG00000203791		0.333	METTL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL10	HGNC	protein_coding	OTTHUMT00000050884.1	-	0.00	38	0	C	NM_212554		126454174	-1	tier1	-	no_errors	ENST00000368836	ensembl	human	known	74_37	nonsense	37.04	17	10	SNP	0.996	A
MFI2	4241	genome.wustl.edu	37	3	196748333	196748333	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:196748333C>T	ENST00000296350.5	-	6	767	c.654G>A	c.(652-654)gcG>gcA	p.A218A	MFI2_ENST00000296351.4_Silent_p.A218A	NM_005929.5	NP_005920.2	P08582	TRFM_HUMAN	antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5	218	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of plasminogen activation (GO:0010756)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ferric iron binding (GO:0008199)|iron ion binding (GO:0005506)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(1)	20	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		CTGCCCCTTCCGCCAGGCACC	0.662																																																	0													70.0	62.0	64.0					3																	196748333		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3325.1, CCDS3326.1	3q28-q29	2012-10-02			ENSG00000163975	ENSG00000163975		"""CD molecules"""	7037	protein-coding gene	gene with protein product	"""melanotransferrin"", ""membrane-bound transferrin-like protein"""	155750					Standard	NM_033316		Approved	CD228, FLJ38863, MAP97, MGC4856, MTF1	uc003fxk.4	P08582	OTTHUMG00000155518	ENST00000296350.5:c.654G>A	3.37:g.196748333C>T			Q9BQE2	Silent	SNP	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin,prints_Transferrin_fam	p.A218	ENST00000296350.5	37	c.654	CCDS3325.1	3																																																																																			MFI2	-	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin,prints_Transferrin_fam	ENSG00000163975		0.662	MFI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MFI2	HGNC	protein_coding	OTTHUMT00000340458.1	-	0.00	52	0	C			196748333	-1	tier1	-	no_errors	ENST00000296350	ensembl	human	known	74_37	silent	30.43	32	14	SNP	0.198	T
MFSD10	10227	genome.wustl.edu	37	4	2933310	2933310	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr4:2933310G>T	ENST00000329687.4	-	8	1529	c.995C>A	c.(994-996)cCt>cAt	p.P332H	MFSD10_ENST00000514800.1_Missense_Mutation_p.P332H|MFSD10_ENST00000507555.1_Intron|MFSD10_ENST00000355443.4_Missense_Mutation_p.P332H|MFSD10_ENST00000508221.1_Missense_Mutation_p.P332H	NM_001120.4	NP_001111.3	Q14728	MFS10_HUMAN	major facilitator superfamily domain containing 10	332					apoptotic process (GO:0006915)|tetracycline transport (GO:0015904)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)	tetracycline transporter activity (GO:0008493)			breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		TTCCCCGCCAGGGTGGATCCG	0.652																																																	0													27.0	30.0	29.0					4																	2933310		2201	4300	6501	SO:0001583	missense	0			L11669	CCDS3365.1	4p16.3	2008-03-03			ENSG00000109736	ENSG00000109736			16894	protein-coding gene	gene with protein product	"""tetracycline transporter like protein"""	610977				8353488, 17362938	Standard	NM_001120		Approved	TETRAN, IT10C3	uc003gfz.3	Q14728	OTTHUMG00000122081	ENST00000329687.4:c.995C>A	4.37:g.2933310G>T	ENSP00000332646:p.Pro332His		Q07706	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.P332H	ENST00000329687.4	37	c.995	CCDS3365.1	4	.	.	.	.	.	.	.	.	.	.	G	13.65	2.301095	0.40694	.	.	ENSG00000109736	ENST00000514800;ENST00000355443;ENST00000329687;ENST00000508221	T;T;T;T	0.80393	-1.37;-1.37;-1.37;0.27	4.19	3.34	0.38264	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.059788	0.64402	D	0.000002	D	0.88665	0.6498	M	0.80422	2.495	0.80722	D	1	D;P;P	0.89917	1.0;0.909;0.647	D;P;P	0.85130	0.997;0.497;0.566	D	0.88462	0.3056	10	0.59425	D	0.04	-8.5615	11.7509	0.51847	0.0872:0.0:0.9128:0.0	.	332;332;332	D6RIZ4;D6RE79;Q14728	.;.;MFS10_HUMAN	H	332	ENSP00000426907:P332H;ENSP00000347619:P332H;ENSP00000332646:P332H;ENSP00000425757:P332H	ENSP00000332646:P332H	P	-	2	0	MFSD10	2903108	1.000000	0.71417	0.103000	0.21229	0.089000	0.18198	6.400000	0.73252	0.738000	0.32606	0.561000	0.74099	CCT	MFSD10	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000109736		0.652	MFSD10-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MFSD10	HGNC	protein_coding	OTTHUMT00000358072.2	-	0.00	67	0	G	NM_001120		2933310	-1	tier1	-	no_errors	ENST00000329687	ensembl	human	known	74_37	missense	25.00	18	6	SNP	0.987	T
MFSD11	79157	genome.wustl.edu	37	17	74772611	74772611	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:74772611C>A	ENST00000588460.1	+	12	3215	c.1173C>A	c.(1171-1173)ttC>ttA	p.F391L	MFSD11_ENST00000590070.1_3'UTR|MFSD11_ENST00000593181.1_Missense_Mutation_p.F339L|MFSD11_ENST00000355954.3_Missense_Mutation_p.F339L|MFSD11_ENST00000586622.1_Missense_Mutation_p.F391L|MFSD11_ENST00000336509.4_Missense_Mutation_p.F391L|MFSD11_ENST00000590514.1_Missense_Mutation_p.F391L	NM_001242534.1	NP_001229463.1	O43934	MFS11_HUMAN	major facilitator superfamily domain containing 11	391						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)	17						TTGCCATCTTCAAGTTTGTTC	0.438																																																	0													167.0	160.0	163.0					17																	74772611		2203	4300	6503	SO:0001583	missense	0			BC002753	CCDS11750.1, CCDS56045.1	17q25.1	2012-03-09			ENSG00000092931	ENSG00000092931			25458	protein-coding gene	gene with protein product						9358160	Standard	NM_001242532		Approved	FLJ22196, FLJ20226	uc002jte.3	O43934		ENST00000588460.1:c.1173C>A	17.37:g.74772611C>A	ENSP00000464932:p.Phe391Leu		O43442|Q9NXI5	Missense_Mutation	SNP	pfam_Ion_channel_UNC-93,pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.F391L	ENST00000588460.1	37	c.1173	CCDS11750.1	17	.	.	.	.	.	.	.	.	.	.	C	20.3	3.959190	0.74016	.	.	ENSG00000092931	ENST00000336509;ENST00000355954	T;T	0.80393	-1.37;-1.37	5.43	0.371	0.16168	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.86045	0.5839	M	0.71581	2.175	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.72075	0.947;0.976	D	0.83611	0.0134	10	0.72032	D	0.01	-22.0173	9.6884	0.40114	0.0:0.4927:0.0:0.5073	.	339;391	O43934-2;O43934	.;MFS11_HUMAN	L	391;339	ENSP00000337240:F391L;ENSP00000348225:F339L	ENSP00000337240:F391L	F	+	3	2	MFSD11	72284206	0.992000	0.36948	0.992000	0.48379	0.735000	0.41995	0.287000	0.18920	-0.258000	0.09446	0.563000	0.77884	TTC	MFSD11	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000092931		0.438	MFSD11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MFSD11	HGNC	protein_coding	OTTHUMT00000451516.1	-	0.00	90	0	C	NM_024311		74772611	+1	tier1	-	no_errors	ENST00000336509	ensembl	human	known	74_37	missense	21.05	45	12	SNP	1.000	A
MICAL1	64780	genome.wustl.edu	37	6	109765475	109765475	+	Silent	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:109765475G>A	ENST00000358807.3	-	25	3434	c.3123C>T	c.(3121-3123)gtC>gtT	p.V1041V	MICAL1_ENST00000368952.4_Silent_p.V1060V|MICAL1_ENST00000358577.3_Silent_p.V955V	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	1041					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		CTCTCTGGTTGACCAAATCCA	0.597																																																	0													38.0	40.0	39.0					6																	109765475		2203	4300	6503	SO:0001819	synonymous_variant	0			AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.3123C>T	6.37:g.109765475G>A			B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Silent	SNP	pfam_DUF3585,pfam_CH-domain,pfam_Znf_LIM,pfam_mOase_FAD-bd,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM	p.V1060	ENST00000358807.3	37	c.3180	CCDS5076.1	6																																																																																			MICAL1	-	pfam_DUF3585	ENSG00000135596		0.597	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL1	HGNC	protein_coding	OTTHUMT00000041759.2	-	0.00	55	0	G	NM_022765		109765475	-1	tier1	-	no_errors	ENST00000368952	ensembl	human	known	74_37	silent	23.40	36	11	SNP	1.000	A
MICAL2	9645	genome.wustl.edu	37	11	12261023	12261024	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:12261023_12261024insTT	ENST00000256194.4	+	17	2393_2394	c.2105_2106insTT	c.(2104-2109)gagtgtfs	p.E702fs	MICAL2_ENST00000379612.3_Frame_Shift_Ins_p.E702fs|MICAL2_ENST00000342902.5_Frame_Shift_Ins_p.E702fs|MICAL2_ENST00000537344.1_Frame_Shift_Ins_p.E702fs|MICAL2_ENST00000527546.1_Frame_Shift_Ins_p.E702fs	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	702					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		TCCAATCAAGAGTGTGGGAGCA	0.5																																																	0																																										SO:0001589	frameshift_variant	0			AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	Exception_encountered	11.37:g.12261023_12261024insTT	ENSP00000256194:p.Glu702fs		B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Frame_Shift_Ins	INS	pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,pfam_FAD_bind_dom,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_Rng_hydrolase-like	p.E702fs	ENST00000256194.4	37	c.2105_2106	CCDS7809.1	11																																																																																			MICAL2	-	NULL	ENSG00000133816		0.500	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL2	HGNC	protein_coding	OTTHUMT00000385993.1		0.00	71	0	-	NM_014632		12261024	+1	tier1		no_errors	ENST00000256194	ensembl	human	known	74_37	frame_shift_ins	23.81	32	10	INS	0.609:0.116	TT
MLF1	4291	genome.wustl.edu	37	3	158289110	158289110	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:158289110C>T	ENST00000355893.5	+	1	159	c.21C>T	c.(19-21)agC>agT	p.S7S	MLF1_ENST00000484955.1_5'UTR|RP11-538P18.2_ENST00000475981.1_RNA|MLF1_ENST00000392822.3_5'UTR|RP11-538P18.2_ENST00000479233.1_RNA|MLF1_ENST00000482628.1_5'UTR|MLF1_ENST00000469452.1_5'UTR|MLF1_ENST00000471745.1_5'UTR|MLF1_ENST00000359117.5_5'UTR|MLF1_ENST00000497004.1_3'UTR|MLF1_ENST00000478894.2_5'UTR	NM_022443.4	NP_071888.1	P58340	MLF1_HUMAN	myeloid leukemia factor 1	7					cell cycle arrest (GO:0007050)|myeloid progenitor cell differentiation (GO:0002318)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)			large_intestine(3)	3		Melanoma(1037;0.000458)|Prostate(884;0.0235)|all_neural(597;0.0299)	Lung(72;0.00199)|LUSC - Lung squamous cell carcinoma(72;0.00256)			TGCTGAACAGCAGTTTTGAGG	0.552			T	NPM1	AML																																			Dom	yes		3	3q25.1	4291	myeloid leukemia factor 1		L	0													60.0	60.0	60.0					3																	158289110		2202	4300	6502	SO:0001819	synonymous_variant	0			L49054	CCDS3182.1, CCDS46945.1, CCDS56286.1, CCDS56287.1, CCDS56288.1	3q25	2008-07-18			ENSG00000178053	ENSG00000178053			7125	protein-coding gene	gene with protein product	"""myeloid leukemia factor 1 variant 1"", ""myeloid leukemia factor 1 variant 2"", ""myeloid leukemia factor 1 variant 3"""	601402				8570204	Standard	NM_022443		Approved		uc003fcb.3	P58340	OTTHUMG00000158775	ENST00000355893.5:c.21C>T	3.37:g.158289110C>T			E9PEU9|Q2TLE3|Q2TLE5|Q8N8F8|Q96MH1	Silent	SNP	pfam_Myeloid_leukemia_factor	p.S7	ENST00000355893.5	37	c.21	CCDS3182.1	3																																																																																			MLF1	-	NULL	ENSG00000178053		0.552	MLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLF1	HGNC	protein_coding	OTTHUMT00000352164.3	-	0.00	55	0	C	NM_022443		158289110	+1	tier1	-	no_errors	ENST00000355893	ensembl	human	known	74_37	silent	7.14	52	4	SNP	0.998	T
MMP2	4313	genome.wustl.edu	37	16	55513424	55513424	+	Silent	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:55513424G>A	ENST00000219070.4	+	1	542	c.33G>A	c.(31-33)acG>acA	p.T11T	MMP2_ENST00000437642.2_5'Flank|MMP2_ENST00000543485.1_5'Flank|MMP2_ENST00000570308.1_Intron	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	11					angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	GCGCGCTCACGGGTCCCCTGA	0.751																																																	0													7.0	8.0	8.0					16																	55513424		2161	4242	6403	SO:0001819	synonymous_variant	0				CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.33G>A	16.37:g.55513424G>A			B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Silent	SNP	pfam_Pept_M10_metallopeptidase,pfam_FN_type2_col-bd,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Kringle-like,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_FN_type2_col-bd,smart_Hemopexin-like_repeat,pfscan_FN_type2_col-bd,prints_Pept_M10A	p.T11	ENST00000219070.4	37	c.33	CCDS10752.1	16																																																																																			MMP2	-	NULL	ENSG00000087245		0.751	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP2	HGNC	protein_coding	OTTHUMT00000256913.3	-	0.00	12	0	G			55513424	+1	tier1	-	no_errors	ENST00000219070	ensembl	human	known	74_37	silent	66.67	3	6	SNP	0.000	A
MMS22L	253714	genome.wustl.edu	37	6	97711246	97711246	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:97711246G>T	ENST00000275053.4	-	9	1172	c.907C>A	c.(907-909)Ctt>Att	p.L303I	MMS22L_ENST00000369251.2_Missense_Mutation_p.L303I|MMS22L_ENST00000506256.1_5'UTR	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	303					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						TGGTCTAGAAGATGAATAAGT	0.318																																																	0													137.0	141.0	140.0					6																	97711246		2203	4295	6498	SO:0001583	missense	0				CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.907C>A	6.37:g.97711246G>T	ENSP00000275053:p.Leu303Ile		D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L303I	ENST00000275053.4	37	c.907	CCDS5039.1	6	.	.	.	.	.	.	.	.	.	.	G	13.73	2.325104	0.41197	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.53423	0.62;0.62	5.66	4.78	0.61160	.	0.074255	0.56097	N	0.000035	T	0.32133	0.0819	M	0.72894	2.215	0.52501	D	0.99995	B;B	0.22414	0.069;0.031	B;B	0.27887	0.084;0.035	T	0.22730	-1.0208	10	0.36615	T	0.2	-1.6791	10.9028	0.47062	0.0687:0.0:0.8007:0.1306	.	303;303	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	I	303	ENSP00000275053:L303I;ENSP00000358254:L303I	ENSP00000275053:L303I	L	-	1	0	MMS22L	97817967	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	4.258000	0.58822	1.350000	0.45770	0.491000	0.48974	CTT	MMS22L	-	NULL	ENSG00000146263		0.318	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMS22L	HGNC	protein_coding	OTTHUMT00000041573.3	-	0.00	27	0	G	NM_198468		97711246	-1	tier1	-	no_errors	ENST00000275053	ensembl	human	known	74_37	missense	26.67	11	4	SNP	0.997	T
MRPL3	11222	genome.wustl.edu	37	3	131188618	131188618	+	Splice_Site	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:131188618C>A	ENST00000264995.3	-	8	886		c.e8-1		MRPL3_ENST00000425847.2_Splice_Site	NM_007208.3	NP_009139.1	P09001	RM03_HUMAN	mitochondrial ribosomal protein L3						translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	10						TGCCAATATCCTAAATGAGAA	0.308																																																	0													88.0	80.0	82.0					3																	131188618		2203	4300	6503	SO:0001630	splice_region_variant	0			X06323	CCDS3071.1	3q21-q23	2012-09-13			ENSG00000114686	ENSG00000114686		"""Mitochondrial ribosomal proteins / large subunits"""	10379	protein-coding gene	gene with protein product		607118		RPML3		2891103	Standard	NM_007208		Approved	MRL3	uc003eoh.3	P09001	OTTHUMG00000159607	ENST00000264995.3:c.739-1G>T	3.37:g.131188618C>A			Q6IBT2	Splice_Site	SNP	-	e8-1	ENST00000264995.3	37	c.739-1	CCDS3071.1	3	.	.	.	.	.	.	.	.	.	.	C	18.73	3.686069	0.68157	.	.	ENSG00000114686	ENST00000264995;ENST00000511168;ENST00000425847;ENST00000507669	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5725	0.87939	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MRPL3	132671308	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	6.585000	0.74062	2.435000	0.82474	0.650000	0.86243	.	MRPL3	-	-	ENSG00000114686		0.308	MRPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL3	HGNC	protein_coding	OTTHUMT00000356471.3	-	0.00	68	0	C	NM_007208	Intron	131188618	-1	tier1	-	no_errors	ENST00000264995	ensembl	human	known	74_37	splice_site	10.53	51	6	SNP	1.000	A
MRS2	57380	genome.wustl.edu	37	6	24412553	24412553	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:24412553G>C	ENST00000378386.3	+	5	611	c.518G>C	c.(517-519)gGa>gCa	p.G173A	MRS2_ENST00000378353.1_Missense_Mutation_p.G173A|MRS2_ENST00000443868.2_Missense_Mutation_p.G176A|MRS2_ENST00000543597.1_5'UTR|MRS2_ENST00000483634.1_3'UTR|MRS2_ENST00000535061.1_Missense_Mutation_p.G123A|MRS2_ENST00000274747.7_3'UTR	NM_020662.2	NP_065713.1	Q9HD23	MRS2_HUMAN	MRS2 magnesium transporter	173						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	12						CAGTTGTCTGGAGAGGGTCAA	0.398																																																	0													132.0	125.0	128.0					6																	24412553		2203	4300	6503	SO:0001583	missense	0			AF288288	CCDS4552.1, CCDS69055.1, CCDS69056.1, CCDS75408.1	6p22.3-p22.1	2013-05-03	2013-05-03	2008-01-18	ENSG00000124532	ENSG00000124532			13785	protein-coding gene	gene with protein product			"""MRS2-like, magnesium homeostasis factor (S. cerevisiae)"", ""MRS2 magnesium homeostasis factor homolog (S. cerevisiae)"""	MRS2L			Standard	XM_005249242		Approved		uc003neb.3	Q9HD23	OTTHUMG00000014355	ENST00000378386.3:c.518G>C	6.37:g.24412553G>C	ENSP00000367637:p.Gly173Ala		A8K4U3|B3KNN2|B4DQL2|Q5T3Y1|Q6NTG4|Q96KF8|Q9BVP1	Missense_Mutation	SNP	NULL	p.G176A	ENST00000378386.3	37	c.527	CCDS4552.1	6	.	.	.	.	.	.	.	.	.	.	G	14.70	2.613474	0.46631	.	.	ENSG00000124532	ENST00000535061;ENST00000378386;ENST00000378353;ENST00000443868	T;T;T;T	0.46063	1.55;1.45;0.88;1.49	5.31	1.19	0.21007	.	0.441905	0.23805	N	0.044382	T	0.25717	0.0626	L	0.42245	1.32	0.80722	D	1	B;D;B;P	0.57257	0.155;0.979;0.158;0.499	B;P;B;B	0.54100	0.123;0.742;0.047;0.234	T	0.04242	-1.0966	10	0.26408	T	0.33	-13.388	6.3625	0.21437	0.2141:0.0:0.6578:0.1281	.	123;176;173;173	F5GWH3;B4DQL2;Q9HD23;Q9HD23-2	.;.;MRS2_HUMAN;.	A	123;173;173;176	ENSP00000441839:G123A;ENSP00000367637:G173A;ENSP00000367604:G173A;ENSP00000399585:G176A	ENSP00000367604:G173A	G	+	2	0	MRS2	24520532	1.000000	0.71417	0.993000	0.49108	0.990000	0.78478	2.756000	0.47549	0.624000	0.30286	0.462000	0.41574	GGA	MRS2	-	NULL	ENSG00000124532		0.398	MRS2-009	KNOWN	basic|appris_principal|CCDS	protein_coding	MRS2	HGNC	protein_coding	OTTHUMT00000040002.1	-	0.00	63	0	G			24412553	+1	tier1	-	no_errors	ENST00000443868	ensembl	human	known	74_37	missense	40.38	31	21	SNP	1.000	C
MSN	4478	genome.wustl.edu	37	X	64949488	64949488	+	Silent	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:64949488G>A	ENST00000360270.5	+	4	553	c.381G>A	c.(379-381)tcG>tcA	p.S127S		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	127	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)		MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						TGCTGGCCTCGTATGCTGTCC	0.527			T	ALK	ALCL																																			Dom	yes		X	Xq11.2-q12	4478	moesin		L	0													83.0	60.0	68.0					X																	64949488		2203	4300	6503	SO:0001819	synonymous_variant	0			M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.381G>A	X.37:g.64949488G>A				Silent	SNP	pirsf_ERM,pfam_ERM_C_dom,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin_tail,smart_Band_41_domain,prints_Ez/rad/moesin_like,prints_Band_41_fam,pfscan_FERM_domain	p.S127	ENST00000360270.5	37	c.381	CCDS14382.1	X																																																																																			MSN	-	pirsf_ERM,pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,prints_Ez/rad/moesin_like,prints_Band_41_fam,pfscan_FERM_domain	ENSG00000147065		0.527	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSN	HGNC	protein_coding	OTTHUMT00000056981.1	-	0.00	26	0	G	NM_002444		64949488	+1	tier1	-	no_errors	ENST00000360270	ensembl	human	known	74_37	silent	78.95	4	15	SNP	0.824	A
MT-CO2	4513	genome.wustl.edu	37	M	8027	8027	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrM:8027G>A	ENST00000361739.1	+	1	442	c.442G>A	c.(442-444)Gcc>Acc	p.A148T	MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TK_ENST00000387421.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	148			A -> T. {ECO:0000269|PubMed:8277847}.		cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						TCCCGATTGAAGCCCCCATTC	0.468																																																	0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.442G>A	M.37:g.8027G>A	ENSP00000354876:p.Ala148Thr		Q37526	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.A148T	ENST00000361739.1	37	c.442		MT																																																																																			MT-CO2	-	pfam_Cyt_c_oxidase_su2_C,superfamily_Cupredoxin,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	ENSG00000198712		0.468	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	HGNC	protein_coding		-	0.00	471	0	G	YP_003024029		8027	+1	tier1	rs1116904	no_errors	ENST00000361739	ensembl	human	known	74_37	missense	86.02	13	80	SNP	NULL	A
MTMR10	54893	genome.wustl.edu	37	15	31253222	31253222	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr15:31253222C>T	ENST00000435680.1	-	7	717	c.620G>A	c.(619-621)gGt>gAt	p.G207D	MTMR10_ENST00000314404.8_5'UTR|MTMR10_ENST00000563714.1_Missense_Mutation_p.G125D|MTMR10_ENST00000425768.1_Missense_Mutation_p.V177I	NM_017762.2	NP_060232.2	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10	207	Poly-Gly.						phosphatase activity (GO:0016791)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		AGCTCCATTAcctcctcctcc	0.463																																																	0													51.0	50.0	51.0					15																	31253222		1946	4122	6068	SO:0001583	missense	0			AK000320	CCDS45204.1	15q13.3	2011-06-09				ENSG00000166912		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	25999	protein-coding gene	gene with protein product						12495846	Standard	NM_017762		Approved	FLJ20313	uc001zfh.1	Q9NXD2		ENST00000435680.1:c.620G>A	15.37:g.31253222C>T	ENSP00000402537:p.Gly207Asp		Q6P4Q6	Missense_Mutation	SNP	pfam_Myotubularin_assoc,pfam_Myotubularin-like_Pase_dom	p.G207D	ENST00000435680.1	37	c.620	CCDS45204.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.25|10.25	1.299121|1.299121	0.23650|0.23650	.|.	.|.	ENSG00000166912|ENSG00000166912	ENST00000435680;ENST00000340566|ENST00000425768	D|T	0.81821|0.51325	-1.54|0.71	5.05|5.05	0.826|0.826	0.18829|0.18829	.|.	1.823740|.	0.02668|.	N|.	0.108235|.	T|T	0.36026|0.36026	0.0952|0.0952	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.27502|0.27502	-1.0072|-1.0072	10|7	0.32370|0.35671	T|T	0.25|0.21	.|.	4.226|4.226	0.10580|0.10580	0.3288:0.4916:0.0:0.1796|0.3288:0.4916:0.0:0.1796	.|.	125;207|.	Q9NXD2-2;Q9NXD2|.	.;MTMRA_HUMAN|.	D|I	207;125|177	ENSP00000402537:G207D|ENSP00000412314:V177I	ENSP00000340637:G125D|ENSP00000412314:V177I	G|V	-|-	2|1	0|0	MTMR10|MTMR10	29040514|29040514	0.006000|0.006000	0.16342|0.16342	0.001000|0.001000	0.08648|0.08648	0.114000|0.114000	0.19823|0.19823	0.188000|0.188000	0.17018|0.17018	0.136000|0.136000	0.18733|0.18733	-0.253000|-0.253000	0.11424|0.11424	GGT|GTA	MTMR10	-	NULL	ENSG00000166912		0.463	MTMR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR10	HGNC	protein_coding	OTTHUMT00000430747.1	-	0.00	57	0	C	NM_017762		31253222	-1	tier1	-	no_errors	ENST00000435680	ensembl	human	known	74_37	missense	35.48	20	11	SNP	0.005	T
MTMR11	10903	genome.wustl.edu	37	1	149907008	149907008	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:149907008G>T	ENST00000439741.2	-	5	589	c.339C>A	c.(337-339)tcC>tcA	p.S113S	MTMR11_ENST00000369140.3_Silent_p.S41S|MTMR11_ENST00000492824.1_5'UTR|MTMR11_ENST00000406732.3_Silent_p.S85S|MTMR11_ENST00000361405.6_Silent_p.S113S	NM_001145862.1	NP_001139334.1	A4FU01	MTMRB_HUMAN	myotubularin related protein 11	113							phosphatase activity (GO:0016791)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(13)|prostate(2)|stomach(1)|urinary_tract(4)	34	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			GCTGGACTCGGGACAAGCCGC	0.547																																																	0													58.0	64.0	62.0					1																	149907008		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097000	CCDS72901.1, CCDS72902.1	1q12-q21	2011-06-09			ENSG00000014914	ENSG00000014914		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	24307	protein-coding gene	gene with protein product	"""cisplatin resistance associated"""					12495846	Standard	NM_181873		Approved	CRA	uc001etl.4	A4FU01	OTTHUMG00000012207	ENST00000439741.2:c.339C>A	1.37:g.149907008G>T			B3KUE4|B4DJI6|B4DQF5|B4E3Q6|Q3ZCP7|Q5SZ62|Q6P2Q8|Q99752|Q99753	Silent	SNP	pfam_Myotubularin_assoc,pfam_Myotubularin-like_Pase_dom	p.S113	ENST00000439741.2	37	c.339	CCDS53360.1	1																																																																																			MTMR11	-	NULL	ENSG00000014914		0.547	MTMR11-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR11	HGNC	protein_coding			0.00	48	0	G	NM_181873		149907008	-1			no_errors	ENST00000439741	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.371	T
MUC19	283463	genome.wustl.edu	37	12	40919118	40919118	+	3'UTR	SNP	A	A	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:40919118A>T	ENST00000474954.1	+	0	1816				MUC19_ENST00000454784.4_Intron			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						TGTTGGCCACATTTTTCCAAG	0.438																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000474954.1:c.*1813A>T	12.37:g.40919118A>T			Q8NA85	RNA	SNP	-	NULL	ENST00000474954.1	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.438	MUC19-006	KNOWN	basic	processed_transcript	MUC19	HGNC	protein_coding	OTTHUMT00000134360.1	-	0.00	51	0	A	XM_003403524		40919118	+1	tier1	-	no_errors	ENST00000474954	ensembl	human	known	74_37	rna	32.08	36	17	SNP	0.005	T
MUC19	283463	genome.wustl.edu	37	12	40919206	40919206	+	3'UTR	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:40919206G>T	ENST00000474954.1	+	0	1904				MUC19_ENST00000454784.4_Intron			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						TCTGGTACAAGAGTCACCCCT	0.522																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000474954.1:c.*1901G>T	12.37:g.40919206G>T			Q8NA85	RNA	SNP	-	NULL	ENST00000474954.1	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.522	MUC19-006	KNOWN	basic	processed_transcript	MUC19	HGNC	protein_coding	OTTHUMT00000134360.1	-	0.00	129	0	G	XM_003403524		40919206	+1	tier1	-	no_errors	ENST00000474954	ensembl	human	known	74_37	rna	31.63	67	31	SNP	0.005	T
MXRA5	25878	genome.wustl.edu	37	X	3228851	3228851	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:3228851C>T	ENST00000217939.6	-	7	7547	c.7393G>A	c.(7393-7395)Gac>Aac	p.D2465N		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2465	Ig-like C2-type 9.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GCTTTGCAGTCAATCAGTTTC	0.572																																																	0													43.0	29.0	34.0					X																	3228851		2203	4298	6501	SO:0001583	missense	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.7393G>A	X.37:g.3228851C>T	ENSP00000217939:p.Asp2465Asn		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.D2465N	ENST00000217939.6	37	c.7393	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	C	11.38	1.620404	0.28801	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.65916	-0.18	3.54	2.65	0.31530	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40064	U	0.001185	T	0.72495	0.3467	L	0.58354	1.805	0.39269	D	0.964351	D	0.76494	0.999	D	0.71870	0.975	T	0.72381	-0.4311	10	0.45353	T	0.12	.	12.4185	0.55508	0.0:0.8334:0.1666:0.0	.	2465	Q9NR99	MXRA5_HUMAN	N	2465	ENSP00000217939:D2465N	ENSP00000217939:D2465N	D	-	1	0	MXRA5	3238851	0.973000	0.33851	0.008000	0.14137	0.001000	0.01503	1.755000	0.38379	0.373000	0.24621	-0.234000	0.12200	GAC	MXRA5	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000101825		0.572	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	-	0.00	32	0	C	NM_015419		3228851	-1	tier1	-	no_errors	ENST00000217939	ensembl	human	known	74_37	missense	62.96	10	17	SNP	0.995	T
MYH1	4619	genome.wustl.edu	37	17	10402365	10402365	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:10402365G>A	ENST00000226207.5	-	29	4004	c.3910C>T	c.(3910-3912)Cag>Tag	p.Q1304*	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1304					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CTCGAGAGCTGTGAAACTAGT	0.403																																																	0													186.0	173.0	178.0					17																	10402365		2203	4300	6503	SO:0001587	stop_gained	0				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3910C>T	17.37:g.10402365G>A	ENSP00000226207:p.Gln1304*		Q14CA4|Q9Y622	Nonsense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q1304*	ENST00000226207.5	37	c.3910	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	G	39	7.632261	0.98399	.	.	ENSG00000109061	ENST00000226207	.	.	.	5.36	5.36	0.76844	.	0.000000	0.41194	U	0.000936	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.4571	0.94897	0.0:0.0:1.0:0.0	.	.	.	.	X	1304	.	ENSP00000226207:Q1304X	Q	-	1	0	MYH1	10343090	1.000000	0.71417	1.000000	0.80357	0.055000	0.15305	9.779000	0.99018	2.690000	0.91761	0.655000	0.94253	CAG	MYH1	-	pfam_Myosin_tail	ENSG00000109061		0.403	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	-	0.00	69	0	G	NM_005963		10402365	-1	tier1	-	no_errors	ENST00000226207	ensembl	human	known	74_37	nonsense	8.89	41	4	SNP	1.000	A
MYCBPAP	84073	genome.wustl.edu	37	17	48598572	48598572	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:48598572G>T	ENST00000323776.5	+	8	1309	c.1147G>T	c.(1147-1149)Gat>Tat	p.D383Y	MYCBPAP_ENST00000436259.2_Missense_Mutation_p.D346Y	NM_032133.4	NP_115509.4			MYCBP associated protein											breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			GGAAGAGCTGGATTTCAGCCA	0.547																																																	0													78.0	67.0	71.0					17																	48598572		2203	4300	6503	SO:0001583	missense	0			BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.1147G>T	17.37:g.48598572G>T	ENSP00000323184:p.Asp383Tyr			Missense_Mutation	SNP	NULL	p.D383Y	ENST00000323776.5	37	c.1147	CCDS32680.2	17	.	.	.	.	.	.	.	.	.	.	G	14.35	2.509366	0.44660	.	.	ENSG00000136449	ENST00000323776;ENST00000436259	T;T	0.43688	0.94;0.94	5.43	2.34	0.29019	.	0.353770	0.27572	N	0.018768	T	0.56247	0.1972	M	0.74258	2.255	0.38415	D	0.946026	D;D	0.76494	0.999;0.999	D;D	0.65874	0.939;0.939	T	0.56306	-0.8001	10	0.54805	T	0.06	-3.5989	6.4159	0.21715	0.2109:0.1313:0.6578:0.0	.	346;383	Q8TBZ2;B4DZQ1	MYBPP_HUMAN;.	Y	383;346	ENSP00000323184:D383Y;ENSP00000397209:D346Y	ENSP00000323184:D383Y	D	+	1	0	MYCBPAP	45953571	0.968000	0.33430	0.370000	0.25965	0.524000	0.34500	2.152000	0.42272	0.273000	0.22049	0.549000	0.68633	GAT	MYCBPAP	-	NULL	ENSG00000136449		0.547	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYCBPAP	HGNC	protein_coding	OTTHUMT00000347814.1	-	0.00	50	0	G	NM_032133		48598572	+1	tier1	-	no_errors	ENST00000323776	ensembl	human	known	74_37	missense	17.65	28	6	SNP	0.802	T
MYH9	4627	genome.wustl.edu	37	22	36700136	36700136	+	Silent	SNP	G	G	T	rs150133983	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr22:36700136G>T	ENST00000216181.5	-	19	2525	c.2295C>A	c.(2293-2295)gcC>gcA	p.A765A		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	765	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CCAGCACACCGGCACGGAAGA	0.602			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																															Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													73.0	66.0	68.0					22																	36700136		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2295C>A	22.37:g.36700136G>T			A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A765	ENST00000216181.5	37	c.2295	CCDS13927.1	22																																																																																			MYH9	-	superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000100345		0.602	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	-	0.00	46	0	G	NM_002473		36700136	-1	tier1	-	no_errors	ENST00000216181	ensembl	human	known	74_37	silent	27.27	16	6	SNP	0.004	T
MYO10	4651	genome.wustl.edu	37	5	16704730	16704730	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:16704730G>T	ENST00000513610.1	-	22	2688	c.2234C>A	c.(2233-2235)gCg>gAg	p.A745E	MYO10_ENST00000515803.1_Missense_Mutation_p.A84E|MYO10_ENST00000427430.2_Missense_Mutation_p.A102E|MYO10_ENST00000274203.9_Missense_Mutation_p.A102E|MYO10_ENST00000505695.1_Missense_Mutation_p.A84E|MYO10_ENST00000512061.1_5'UTR	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	745	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						CACCATGGCCGCGTGGCTCAC	0.552																																																	0													68.0	74.0	72.0					5																	16704730		2021	4178	6199	SO:0001583	missense	0			AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.2234C>A	5.37:g.16704730G>T	ENSP00000421280:p.Ala745Glu		A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_Pleckstrin_homology,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_Ras-assoc,superfamily_P-loop_NTPase,superfamily_FERM_central,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology,prints_Myosin_head_motor_dom	p.A745E	ENST00000513610.1	37	c.2234	CCDS54834.1	5	.	.	.	.	.	.	.	.	.	.	G	16.35	3.098548	0.56183	.	.	ENSG00000145555	ENST00000513610;ENST00000515803;ENST00000274203;ENST00000505695;ENST00000427430;ENST00000513882	T;D;D;D;D;T	0.96200	-0.96;-3.94;-3.94;-3.94;-3.94;-0.96	5.37	5.37	0.77165	.	.	.	.	.	D	0.98504	0.9501	H	0.95611	3.695	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.977;0.994	D	0.99041	1.0824	9	0.54805	T	0.06	.	19.1172	0.93346	0.0:0.0:1.0:0.0	.	386;745	Q69YP8;Q9HD67	.;MYO10_HUMAN	E	745;84;102;84;102;756	ENSP00000421280:A745E;ENSP00000425051:A84E;ENSP00000274203:A102E;ENSP00000421170:A84E;ENSP00000391106:A102E;ENSP00000421309:A756E	ENSP00000274203:A102E	A	-	2	0	MYO10	16757730	1.000000	0.71417	0.330000	0.25442	0.088000	0.18126	9.798000	0.99111	2.509000	0.84616	0.563000	0.77884	GCG	MYO10	-	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000145555		0.552	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO10	HGNC	protein_coding	OTTHUMT00000366167.1		0.00	50	0	G	NM_012334		16704730	-1			no_errors	ENST00000513610	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.999	T
MYO3A	53904	genome.wustl.edu	37	10	26315325	26315325	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr10:26315325G>T	ENST00000265944.5	+	10	983	c.817G>T	c.(817-819)Gaa>Taa	p.E273*	MYO3A_ENST00000543632.1_Nonsense_Mutation_p.E273*	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	273	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TAAAGATTATGAAAAGCGTCC	0.318																																																	0													78.0	76.0	77.0					10																	26315325		2203	4300	6503	SO:0001587	stop_gained	0			AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.817G>T	10.37:g.26315325G>T	ENSP00000265944:p.Glu273*		Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_dom,prints_Myosin_head_motor_dom	p.E273*	ENST00000265944.5	37	c.817	CCDS7148.1	10	.	.	.	.	.	.	.	.	.	.	G	40	8.016973	0.98613	.	.	ENSG00000095777	ENST00000265944;ENST00000543632	.	.	.	5.76	5.76	0.90799	.	0.089006	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.5043	0.90892	0.0:0.0:1.0:0.0	.	.	.	.	X	273	.	ENSP00000265944:E273X	E	+	1	0	MYO3A	26355331	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.919000	0.92770	2.882000	0.98803	0.655000	0.94253	GAA	MYO3A	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000095777		0.318	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO3A	HGNC	protein_coding	OTTHUMT00000047259.1	-	0.00	56	0	G	NM_017433		26315325	+1	tier1	-	no_errors	ENST00000265944	ensembl	human	known	74_37	nonsense	27.03	27	10	SNP	1.000	T
NAIF1	203245	genome.wustl.edu	37	9	130829111	130829111	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr9:130829111C>A	ENST00000373078.4	-	1	489	c.270G>T	c.(268-270)gtG>gtT	p.V90V	SLC25A25_ENST00000373069.5_5'Flank|SLC25A25_ENST00000373068.2_5'Flank|NAIF1_ENST00000488519.1_5'Flank	NM_197956.3	NP_931045.1	Q69YI7	NAIF1_HUMAN	nuclear apoptosis inducing factor 1	90					negative regulation of cell growth (GO:0030308)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CACCACCCTCCACGGCGGCCC	0.706																																																	0													36.0	38.0	38.0					9																	130829111		2200	4300	6500	SO:0001819	synonymous_variant	0			AK122729	CCDS6889.1	9q34.11	2008-04-10	2008-04-10	2008-04-10	ENSG00000171169	ENSG00000171169			25446	protein-coding gene	gene with protein product	"""nuclear apoptosis-inducing factor 1"""	610673	"""chromosome 9 open reading frame 90"""	C9orf90		14702039, 16378748	Standard	NM_197956		Approved	DKFZp762G199, bA379C10.2	uc004bta.3	Q69YI7	OTTHUMG00000020727	ENST00000373078.4:c.270G>T	9.37:g.130829111C>A			B3KV81|Q8WU12	Silent	SNP	NULL	p.V90	ENST00000373078.4	37	c.270	CCDS6889.1	9																																																																																			NAIF1	-	NULL	ENSG00000171169		0.706	NAIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAIF1	HGNC	protein_coding	OTTHUMT00000054330.1	-	0.00	55	0	C	NM_197956		130829111	-1	tier1	-	no_errors	ENST00000373078	ensembl	human	known	74_37	silent	28.26	33	13	SNP	1.000	A
NAV2	89797	genome.wustl.edu	37	11	19954795	19954795	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:19954795C>A	ENST00000396087.3	+	8	1173	c.1074C>A	c.(1072-1074)agC>agA	p.S358R	NAV2_ENST00000527559.2_Missense_Mutation_p.S287R|NAV2_ENST00000360655.4_Missense_Mutation_p.S271R|NAV2_ENST00000540292.1_Missense_Mutation_p.S289R|NAV2_ENST00000396085.1_Missense_Mutation_p.S335R|NAV2_ENST00000349880.4_Missense_Mutation_p.S335R	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	358					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						AGAGCGGCAGCAGCTCCACCC	0.607																																																	0													140.0	142.0	142.0					11																	19954795		2199	4293	6492	SO:0001583	missense	0			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.1074C>A	11.37:g.19954795C>A	ENSP00000379396:p.Ser358Arg		A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.S358R	ENST00000396087.3	37	c.1074	CCDS58126.1	11	.	.	.	.	.	.	.	.	.	.	C	7.218	0.596789	0.13875	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292	T;T;T;T;T;T	0.30448	1.53;1.64;1.64;1.64;1.53;1.54	5.36	3.49	0.39957	.	0.423880	0.24635	N	0.036855	T	0.30448	0.0765	L	0.46157	1.445	0.28343	N	0.92127	B;B	0.28400	0.122;0.21	B;B	0.37422	0.043;0.249	T	0.21075	-1.0256	9	.	.	.	.	10.6721	0.45764	0.0:0.8428:0.0:0.1572	.	335;271	Q8IVL1-3;Q8IVL1-4	.;.	R	271;335;335;358;287;289	ENSP00000353871:S271R;ENSP00000379394:S335R;ENSP00000309577:S335R;ENSP00000379396:S358R;ENSP00000435395:S287R;ENSP00000443489:S289R	.	S	+	3	2	NAV2	19911371	0.955000	0.32602	0.003000	0.11579	0.063000	0.16089	2.166000	0.42406	0.643000	0.30638	0.650000	0.86243	AGC	NAV2	-	NULL	ENSG00000166833		0.607	NAV2-001	KNOWN	basic|CCDS	protein_coding	NAV2	HGNC	protein_coding	OTTHUMT00000324112.1	-	0.00	66	0	C	NM_145117		19954795	+1	tier1	-	no_errors	ENST00000396087	ensembl	human	known	74_37	missense	24.49	37	12	SNP	0.176	A
NAV2	89797	genome.wustl.edu	37	11	20072880	20072880	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:20072880G>T	ENST00000396087.3	+	18	4649		c.e18+1		NAV2_ENST00000533917.1_Splice_Site|NAV2_ENST00000311043.8_Splice_Site|NAV2_ENST00000527559.2_Splice_Site|NAV2_ENST00000360655.4_Splice_Site|NAV2-AS2_ENST00000533767.1_RNA|NAV2_ENST00000540292.1_Splice_Site|NAV2_ENST00000396085.1_Splice_Site|NAV2_ENST00000349880.4_Splice_Site	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2						glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						AAGGACTCAGGTATCTGTGTT	0.498																																																	0													241.0	189.0	206.0					11																	20072880		2203	4300	6503	SO:0001630	splice_region_variant	0			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.4550+1G>T	11.37:g.20072880G>T			A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Splice_Site	SNP	-	e18+1	ENST00000396087.3	37	c.4550+1	CCDS58126.1	11	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541963	0.85917	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292;ENST00000533917;ENST00000311043	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9348	0.97133	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NAV2	20029456	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.143000	0.94623	2.789000	0.95967	0.591000	0.81541	.	NAV2	-	-	ENSG00000166833		0.498	NAV2-001	KNOWN	basic|CCDS	protein_coding	NAV2	HGNC	protein_coding	OTTHUMT00000324112.1		0.00	95	0	G	NM_145117	Intron	20072880	+1			no_errors	ENST00000396087	ensembl	human	known	74_37	splice_site	5.06	75	4	SNP	1.000	T
NCOR2	9612	genome.wustl.edu	37	12	124835202	124835202	+	Missense_Mutation	SNP	G	G	A	rs373295499		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:124835202G>A	ENST00000405201.1	-	28	3775	c.3775C>T	c.(3775-3777)Cgg>Tgg	p.R1259W	NCOR2_ENST00000404621.1_Missense_Mutation_p.R1249W|NCOR2_ENST00000397355.1_Missense_Mutation_p.R1250W|NCOR2_ENST00000429285.2_Missense_Mutation_p.R1249W|NCOR2_ENST00000356219.3_Missense_Mutation_p.R1266W|NCOR2_ENST00000404121.2_Missense_Mutation_p.R820W			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1267					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CTGTCCTCCCGGCCGCGGTCC	0.652																																																	0								G	TRP/ARG,TRP/ARG,TRP/ARG	2,4338		0,2,2168	77.0	84.0	82.0		3745,3745,3775	2.9	0.9	12		82	0,8538		0,0,4269	no	missense,missense,missense	NCOR2	NM_001077261.3,NM_001206654.1,NM_006312.5	101,101,101	0,2,6437	AA,AG,GG		0.0,0.0461,0.0155	probably-damaging,probably-damaging,probably-damaging	1249/2459,1249/2505,1259/2515	124835202	2,12876	2170	4269	6439	SO:0001583	missense	0			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.3775C>T	12.37:g.124835202G>A	ENSP00000384018:p.Arg1259Trp		O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.R1266W	ENST00000405201.1	37	c.3796	CCDS41858.2	12	.	.	.	.	.	.	.	.	.	.	G	14.45	2.538467	0.45176	4.61E-4	0.0	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285;ENST00000458234	T;T;T;T;T;T;T	0.58506	1.24;1.5;1.24;1.5;1.29;1.5;0.33	4.99	2.93	0.34026	.	0.000000	0.85682	D	0.000000	T	0.71082	0.3298	M	0.64404	1.975	0.43793	D	0.996339	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.974;0.993;0.984	T	0.75534	-0.3284	10	0.87932	D	0	-25.7219	13.8341	0.63400	0.0:0.0:0.7585:0.2415	.	1249;1250;1259	C9J0Q5;C9J239;C9JFD3	.;.;.	W	1259;1249;1266;1250;1258;820;1249;1267	ENSP00000384018:R1259W;ENSP00000384202:R1249W;ENSP00000348551:R1266W;ENSP00000380513:R1250W;ENSP00000385618:R820W;ENSP00000400281:R1249W;ENSP00000402808:R1267W	ENSP00000348551:R1266W	R	-	1	2	NCOR2	123401155	0.995000	0.38212	0.937000	0.37676	0.670000	0.39368	2.309000	0.43699	2.315000	0.78130	0.478000	0.44815	CGG	NCOR2	-	NULL	ENSG00000196498		0.652	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	HGNC	protein_coding	OTTHUMT00000318173.2	-	0.00	86	0	G	NM_006312		124835202	-1	tier1	-	no_errors	ENST00000356219	ensembl	human	known	74_37	missense	16.44	61	12	SNP	0.882	A
NEB	4703	genome.wustl.edu	37	2	152409288	152409288	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:152409288G>T	ENST00000172853.10	-	100	14778	c.14631C>A	c.(14629-14631)atC>atA	p.I4877I	NEB_ENST00000603639.1_Silent_p.I6578I|NEB_ENST00000427231.2_Silent_p.I6578I|NEB_ENST00000409198.1_Silent_p.I4877I|NEB_ENST00000397345.3_Silent_p.I6578I|NEB_ENST00000604864.1_Silent_p.I6578I			P20929	NEBU_HUMAN	nebulin	4877					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CTTTATACTTGATCTGCCGAG	0.428																																																	0													146.0	127.0	133.0					2																	152409288		1905	4122	6027	SO:0001819	synonymous_variant	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.14631C>A	2.37:g.152409288G>T			F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.I6578	ENST00000172853.10	37	c.19734		2																																																																																			NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.428	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		-	0.00	75	0	G	NM_004543		152409288	-1	tier1	-	no_errors	ENST00000397345	ensembl	human	known	74_37	silent	35.00	26	14	SNP	0.998	T
NECAB1	64168	genome.wustl.edu	37	8	91937792	91937792	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr8:91937792C>T	ENST00000417640.2	+	7	861	c.524C>T	c.(523-525)tCg>tTg	p.S175L		NM_022351.4	NP_071746.1	Q8N987	NECA1_HUMAN	N-terminal EF-hand calcium binding protein 1	175						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)	12			BRCA - Breast invasive adenocarcinoma(11;0.0499)			GAAGTCCTGTCGATTCAATGG	0.483																																																	0													61.0	67.0	65.0					8																	91937792		1977	4156	6133	SO:0001583	missense	0			AF414126	CCDS47889.1	8q21.3	2013-01-10	2007-12-06	2007-12-06	ENSG00000123119	ENSG00000123119		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	20983	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 1"""	EFCBP1			Standard	NM_022351		Approved		uc011lgg.2	Q8N987	OTTHUMG00000164009	ENST00000417640.2:c.524C>T	8.37:g.91937792C>T	ENSP00000387380:p.Ser175Leu		Q6NUS7|Q96AZ7|Q9HBW8	Missense_Mutation	SNP	pfam_Antibiotic_mOase,superfamily_Dimeric_a/b-barrel,smart_EF_hand_dom,pfscan_EF_hand_dom	p.S175L	ENST00000417640.2	37	c.524	CCDS47889.1	8	.	.	.	.	.	.	.	.	.	.	C	15.71	2.913901	0.52439	.	.	ENSG00000123119	ENST00000417640	T	0.19532	2.14	5.44	4.54	0.55810	.	0.170268	0.53938	N	0.000047	T	0.13329	0.0323	L	0.46157	1.445	0.80722	D	1	P	0.48640	0.913	B	0.28385	0.089	T	0.06570	-1.0819	10	0.38643	T	0.18	-17.1936	9.1644	0.37043	0.1438:0.7771:0.0:0.079	.	175	Q8N987	NECA1_HUMAN	L	175	ENSP00000387380:S175L	ENSP00000387380:S175L	S	+	2	0	NECAB1	92006968	0.997000	0.39634	0.874000	0.34290	0.972000	0.66771	3.669000	0.54561	1.229000	0.43630	0.655000	0.94253	TCG	NECAB1	-	NULL	ENSG00000123119		0.483	NECAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NECAB1	HGNC	protein_coding	OTTHUMT00000376728.1	-	0.00	75	0	C	NM_022351		91937792	+1	tier1	-	no_errors	ENST00000417640	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.975	T
NID1	4811	genome.wustl.edu	37	1	236154248	236154248	+	Missense_Mutation	SNP	G	G	A	rs369274245		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:236154248G>A	ENST00000264187.6	-	14	2948	c.2866C>T	c.(2866-2868)Cgc>Tgc	p.R956C	NID1_ENST00000366595.3_Missense_Mutation_p.R823C	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	956					basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	AGGGGCAGGCGCTCAATCTTC	0.582																																																	0								G	CYS/ARG	0,4406		0,0,2203	102.0	95.0	98.0		2866	4.2	0.4	1		98	1,8599	1.2+/-3.3	0,1,4299	no	missense	NID1	NM_002508.2	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	956/1248	236154248	1,13005	2203	4300	6503	SO:0001583	missense	0			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.2866C>T	1.37:g.236154248G>A	ENSP00000264187:p.Arg956Cys		Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd_dom,superfamily_GFP,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_G2_nidogen/fibulin_G2F,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.R956C	ENST00000264187.6	37	c.2866	CCDS1608.1	1	.	.	.	.	.	.	.	.	.	.	G	19.97	3.924461	0.73213	0.0	1.16E-4	ENSG00000116962	ENST00000264187;ENST00000366595	T;T	0.32272	1.46;1.46	5.1	4.17	0.49024	Six-bladed beta-propeller, TolB-like (1);	0.342797	0.33854	N	0.004481	T	0.39835	0.1093	L	0.54323	1.7	0.40273	D	0.978311	D;D	0.65815	0.995;0.995	P;P	0.50314	0.585;0.637	T	0.40059	-0.9583	10	0.52906	T	0.07	.	15.3464	0.74340	0.0:0.0:0.8595:0.1405	.	823;956	P14543-2;P14543	.;NID1_HUMAN	C	956;823	ENSP00000264187:R956C;ENSP00000355554:R823C	ENSP00000264187:R956C	R	-	1	0	NID1	234220871	1.000000	0.71417	0.375000	0.26029	0.956000	0.61745	4.178000	0.58284	1.265000	0.44215	0.491000	0.48974	CGC	NID1	-	NULL	ENSG00000116962		0.582	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID1	HGNC	protein_coding	OTTHUMT00000096647.2		0.00	65	0	G	NM_002508		236154248	-1			no_errors	ENST00000264187	ensembl	human	known	74_37	missense	5.77	49	3	SNP	0.988	A
NINJ1	4814	genome.wustl.edu	37	9	95888728	95888728	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr9:95888728G>T	ENST00000375446.4	-	2	338	c.268C>A	c.(268-270)Ctg>Atg	p.L90M	NINJ1_ENST00000489274.1_5'Flank	NM_004148.3	NP_004139.2	Q92982	NINJ1_HUMAN	ninjurin 1	90					cell adhesion (GO:0007155)|hyaloid vascular plexus regression (GO:1990384)|nervous system development (GO:0007399)|positive regulation of cell-matrix adhesion (GO:0001954)|tissue regeneration (GO:0042246)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|upper_aerodigestive_tract(1)	4						CCGATCTGCAGCACAAGGGAG	0.647																																																	0													99.0	86.0	90.0					9																	95888728		2203	4300	6503	SO:0001583	missense	0			U91512	CCDS6703.1	9q22	2008-07-21			ENSG00000131669	ENSG00000131669			7824	protein-coding gene	gene with protein product	"""nerve injury-induced protein-1"""	602062				8780658	Standard	NM_004148		Approved	NIN1	uc004atg.4	Q92982	OTTHUMG00000020242	ENST00000375446.4:c.268C>A	9.37:g.95888728G>T	ENSP00000364595:p.Leu90Met		Q6GU89|Q8WUV5|Q9BT07	Missense_Mutation	SNP	pfam_Ninjurin	p.L90M	ENST00000375446.4	37	c.268	CCDS6703.1	9	.	.	.	.	.	.	.	.	.	.	G	13.85	2.358818	0.41801	.	.	ENSG00000131669	ENST00000375446	T	0.58358	0.34	4.49	4.49	0.54785	.	0.068417	0.64402	D	0.000014	T	0.55577	0.1929	L	0.45698	1.435	0.45378	D	0.998361	D	0.63880	0.993	P	0.54856	0.762	T	0.55509	-0.8130	10	0.49607	T	0.09	-24.0325	9.9873	0.41849	0.0945:0.0:0.9055:0.0	.	90	Q92982	NINJ1_HUMAN	M	90	ENSP00000364595:L90M	ENSP00000364595:L90M	L	-	1	2	NINJ1	94928549	1.000000	0.71417	0.946000	0.38457	0.345000	0.29048	3.101000	0.50283	2.502000	0.84385	0.462000	0.41574	CTG	NINJ1	-	pfam_Ninjurin	ENSG00000131669		0.647	NINJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NINJ1	HGNC	protein_coding	OTTHUMT00000053123.2		0.00	49	0	G	NM_004148		95888728	-1			no_errors	ENST00000375446	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.969	T
NLGN3	54413	genome.wustl.edu	37	X	70390928	70390928	+	IGR	DEL	T	T	-			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:70390928delT	ENST00000358741.3	+	0	3046				NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000374051.3_3'UTR|NLGN3_ENST00000536169.1_3'UTR	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3						adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					TTGTTGTTGGTTTTTTTTTTT	0.318																																					Esophageal Squamous(103;760 1488 16849 22250 40351)												0																																										SO:0001628	intergenic_variant	0			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790		X.37:g.70390928delT			B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	RNA	DEL	-	NULL	ENST00000358741.3	37	NULL	CCDS55441.1	X																																																																																			NLGN3	-	-	ENSG00000196338		0.318	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN3	HGNC	protein_coding	OTTHUMT00000057121.1		0.00	44	0	T	NM_018977		70390928	+1	tier1		no_errors	ENST00000476589	ensembl	human	known	74_37	rna	12.20	36	5	DEL	0.997	-
NLRP1	22861	genome.wustl.edu	37	17	5404294	5404294	+	IGR	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:5404294G>A	ENST00000262467.5	-	0	5131					NM_001033053.2	NP_001028225.1	Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				ATCGCGGGTAGGTGGGTCAGC	0.692																																																	0													13.0	20.0	18.0					17																	5404294		687	1586	2273	SO:0001628	intergenic_variant	0			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000			17.37:g.5404294G>A			E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	RNA	SNP	-	NULL	ENST00000262467.5	37	NULL	CCDS32537.1	17																																																																																			NLRP1	-	-	ENSG00000091592		0.692	NLRP1-001	KNOWN	basic|CCDS	protein_coding	NLRP1	HGNC	protein_coding	OTTHUMT00000439513.1	-	0.00	41	0	G	NM_033004		5404294	-1	tier1	-	no_errors	ENST00000568641	ensembl	human	known	74_37	rna	40.00	12	8	SNP	0.000	A
NMB	4828	genome.wustl.edu	37	15	85200480	85200480	+	Missense_Mutation	SNP	T	T	A	rs375215046		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr15:85200480T>A	ENST00000360476.3	-	2	652	c.257A>T	c.(256-258)cAt>cTt	p.H86L	NMB_ENST00000394588.3_Missense_Mutation_p.H86L|WDR73_ENST00000434634.2_5'Flank|WDR73_ENST00000398528.3_5'Flank			P08949	NMB_HUMAN	neuromedin B	86					arachidonic acid secretion (GO:0050482)|cell-cell signaling (GO:0007267)|glucose homeostasis (GO:0042593)|negative regulation of hormone secretion (GO:0046888)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hormone secretion (GO:0046887)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|neuron projection (GO:0043005)	hormone activity (GO:0005179)			endometrium(1)	1				all cancers(203;3.5e-06)		GAGCAGATCATGACTCAGCTG	0.622																																																	0													33.0	29.0	30.0					15																	85200480		2203	4299	6502	SO:0001583	missense	0				CCDS10332.1, CCDS42076.1	15q25.2-q25.3	2013-09-19			ENSG00000197696	ENSG00000197696			7842	protein-coding gene	gene with protein product		162340				2458345	Standard	NM_021077		Approved	MGC2277, MGC3936, MGC17211	uc002bla.3	P08949	OTTHUMG00000148666	ENST00000360476.3:c.257A>T	15.37:g.85200480T>A	ENSP00000353664:p.His86Leu		Q96A06|Q96HH5	Missense_Mutation	SNP	pfam_Bombesin	p.H86L	ENST00000360476.3	37	c.257	CCDS10332.1	15	.	.	.	.	.	.	.	.	.	.	T	18.27	3.586993	0.66105	.	.	ENSG00000197696	ENST00000360476;ENST00000394588	T;T	0.46451	0.89;0.87	5.31	4.17	0.49024	.	0.220560	0.39687	N	0.001282	T	0.31827	0.0809	L	0.34521	1.04	0.28886	N	0.894147	B;B	0.30281	0.275;0.18	B;B	0.33454	0.164;0.044	T	0.26744	-1.0094	10	0.51188	T	0.08	-2.2437	8.2795	0.31892	0.1759:0.0:0.0:0.8241	.	86;86	P08949-2;P08949	.;NMB_HUMAN	L	86	ENSP00000353664:H86L;ENSP00000378089:H86L	ENSP00000353664:H86L	H	-	2	0	NMB	83001484	0.999000	0.42202	0.948000	0.38648	0.690000	0.40134	1.911000	0.39937	0.995000	0.38917	0.533000	0.62120	CAT	NMB	-	NULL	ENSG00000197696		0.622	NMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMB	HGNC	protein_coding	OTTHUMT00000308995.1	-	0.00	50	0	T	NM_021077		85200480	-1	tier1	-	no_errors	ENST00000394588	ensembl	human	known	74_37	missense	12.50	35	5	SNP	0.982	A
NOX4	50507	genome.wustl.edu	37	11	89177378	89177378	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:89177378C>T	ENST00000263317.4	-	5	610	c.372G>A	c.(370-372)ctG>ctA	p.L124L	NOX4_ENST00000532825.1_Silent_p.L100L|NOX4_ENST00000424319.1_Silent_p.L100L|NOX4_ENST00000528341.1_Silent_p.L99L|NOX4_ENST00000527626.1_Intron|NOX4_ENST00000375979.3_Intron|NOX4_ENST00000534731.1_Silent_p.L124L|NOX4_ENST00000542487.1_Silent_p.L100L|NOX4_ENST00000413594.2_Silent_p.L145L|NOX4_ENST00000531342.1_Intron|NOX4_ENST00000527956.1_Silent_p.L100L|NOX4_ENST00000535633.1_Silent_p.L100L|NOX4_ENST00000343727.5_Silent_p.L100L|NOX4_ENST00000525196.1_Silent_p.L124L			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	124	Ferric oxidoreductase.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				GGGCATTCACCAGATGGGCAG	0.468																																																	0													123.0	104.0	110.0					11																	89177378		2201	4299	6500	SO:0001819	synonymous_variant	0			AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.372G>A	11.37:g.89177378C>T			A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Silent	SNP	pfam_Fe_red_NAD-bd_6,pfam_Fe3_Rdtase_TM_dom,pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.L145	ENST00000263317.4	37	c.435	CCDS8285.1	11																																																																																			NOX4	-	pfam_Fe3_Rdtase_TM_dom,prints_Cyt_b245_heavy_chain	ENSG00000086991		0.468	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX4	HGNC	protein_coding	OTTHUMT00000394054.1	-	0.00	31	0	C	NM_016931		89177378	-1	tier1	-	no_errors	ENST00000413594	ensembl	human	known	74_37	silent	21.43	11	3	SNP	1.000	T
NPAP1	23742	genome.wustl.edu	37	15	24923939	24923939	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr15:24923939C>A	ENST00000329468.2	+	1	3399	c.2925C>A	c.(2923-2925)ggC>ggA	p.G975G		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	975					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											TCCCCAATGGCACAGCAAAGA	0.478																																																	0													68.0	70.0	69.0					15																	24923939		2203	4300	6503	SO:0001819	synonymous_variant	0			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2925C>A	15.37:g.24923939C>A				Silent	SNP	NULL	p.G975	ENST00000329468.2	37	c.2925	CCDS10015.1	15																																																																																			NPAP1	-	NULL	ENSG00000185823		0.478	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1	-	0.00	65	0	C	NM_018958		24923939	+1	tier1	-	no_errors	ENST00000329468	ensembl	human	known	74_37	silent	30.61	34	15	SNP	0.000	A
NPHP4	261734	genome.wustl.edu	37	1	5935119	5935119	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:5935119C>A	ENST00000378156.4	-	21	3124	c.2859G>T	c.(2857-2859)caG>caT	p.Q953H	NPHP4_ENST00000478423.2_5'UTR	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	953					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		CGGCGATGACCTGTAGGTCCC	0.672																																																	0													50.0	59.0	56.0					1																	5935119		2190	4285	6475	SO:0001583	missense	0			AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.2859G>T	1.37:g.5935119C>A	ENSP00000367398:p.Gln953His		Q8IWC0	Missense_Mutation	SNP	NULL	p.Q953H	ENST00000378156.4	37	c.2859	CCDS44052.1	1	.	.	.	.	.	.	.	.	.	.	c	14.53	2.564220	0.45694	.	.	ENSG00000131697	ENST00000378156	D	0.87966	-2.32	4.88	3.95	0.45737	.	0.250550	0.33127	N	0.005249	D	0.83487	0.5265	L	0.43152	1.355	0.32498	N	0.539217	P	0.42337	0.776	B	0.42798	0.398	D	0.85336	0.1093	10	0.40728	T	0.16	.	12.6168	0.56582	0.0:0.9189:0.0:0.0811	.	953	O75161	NPHP4_HUMAN	H	953	ENSP00000367398:Q953H	ENSP00000367398:Q953H	Q	-	3	2	NPHP4	5857706	1.000000	0.71417	1.000000	0.80357	0.605000	0.37080	2.414000	0.44627	1.048000	0.40298	0.550000	0.68814	CAG	NPHP4	-	NULL	ENSG00000131697		0.672	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	NPHP4	HGNC	protein_coding	OTTHUMT00000001715.2	-	0.00	41	0	C			5935119	-1	tier1	-	no_errors	ENST00000378156	ensembl	human	known	74_37	missense	39.53	26	17	SNP	1.000	A
NRG3	10718	genome.wustl.edu	37	10	84733598	84733598	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr10:84733598A>C	ENST00000404547.1	+	7	1339	c.1339A>C	c.(1339-1341)Agt>Cgt	p.S447R	NRG3_ENST00000372142.2_Missense_Mutation_p.S226R|NRG3_ENST00000556918.1_Missense_Mutation_p.S277R|NRG3_ENST00000545131.1_Missense_Mutation_p.S97R|NRG3_ENST00000372141.2_Missense_Mutation_p.S447R|NRG3_ENST00000537893.1_Missense_Mutation_p.S97R|NRG3_ENST00000404576.2_Missense_Mutation_p.S251R			P56975	NRG3_HUMAN	neuregulin 3	447					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		GATGGAGTCAAGTTTTGTCGG	0.483																																																	0													134.0	113.0	120.0					10																	84733598		2203	4300	6503	SO:0001583	missense	0			AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.1339A>C	10.37:g.84733598A>C	ENSP00000384796:p.Ser447Arg		A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	pfscan_EG-like_dom	p.S447R	ENST00000404547.1	37	c.1339	CCDS31233.1	10	.	.	.	.	.	.	.	.	.	.	A	23.9	4.472103	0.84533	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918;ENST00000545131;ENST00000537893	T;T;T;T;T;T;T	0.61742	0.8;1.09;0.08;0.08;0.08;0.08;0.08	6.06	6.06	0.98353	.	0.256570	0.33670	N	0.004677	T	0.73560	0.3602	M	0.62723	1.935	0.45580	D	0.998525	D;D;D;D	0.89917	0.996;1.0;0.992;0.996	D;D;P;D	0.85130	0.918;0.997;0.866;0.918	T	0.76027	-0.3109	10	0.87932	D	0	-39.1954	14.5765	0.68252	1.0:0.0:0.0:0.0	.	446;447;226;447	B9EGV5;P56975;P56975-3;P56975-4	.;NRG3_HUMAN;.;.	R	447;447;446;226;251;277;97;97	ENSP00000361214:S447R;ENSP00000384796:S447R;ENSP00000361215:S226R;ENSP00000385804:S251R;ENSP00000451376:S277R;ENSP00000441201:S97R;ENSP00000440377:S97R	ENSP00000361214:S447R	S	+	1	0	NRG3	84723578	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.021000	0.70832	2.323000	0.78572	0.528000	0.53228	AGT	NRG3	-	NULL	ENSG00000185737		0.483	NRG3-005	KNOWN	basic|CCDS	protein_coding	NRG3	HGNC	protein_coding	OTTHUMT00000412262.1	-	0.00	48	0	A	XM_166086		84733598	+1	tier1	-	no_errors	ENST00000404547	ensembl	human	known	74_37	missense	22.50	31	9	SNP	1.000	C
NUDCD3	23386	genome.wustl.edu	37	7	44530130	44530130	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:44530130G>T	ENST00000355451.7	-	1	349	c.70C>A	c.(70-72)Cag>Aag	p.Q24K		NM_015332.3	NP_056147.2	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3	24										endometrium(2)|large_intestine(1)|lung(3)|skin(1)	7						AGGAAATCCTGGACGTTGCCC	0.632																																																	0													27.0	35.0	33.0					7																	44530130		2088	4227	6315	SO:0001583	missense	0			BC003691	CCDS5490.2	7p13-p12	2005-03-18			ENSG00000015676	ENSG00000015676			22208	protein-coding gene	gene with protein product		610296					Standard	NM_015332		Approved	KIAA1068	uc003tkz.3	Q8IVD9	OTTHUMG00000129174	ENST00000355451.7:c.70C>A	7.37:g.44530130G>T	ENSP00000347626:p.Gln24Lys		Q9BTI3|Q9H7W9|Q9UPT4	Missense_Mutation	SNP	pfam_CS_dom,superfamily_HSP20-like_chaperone,pfscan_CS_dom	p.Q24K	ENST00000355451.7	37	c.70	CCDS5490.2	7	.	.	.	.	.	.	.	.	.	.	G	17.10	3.303845	0.60305	.	.	ENSG00000015676	ENST00000355451	T	0.55234	0.53	4.54	3.65	0.41850	.	0.000000	0.85682	D	0.000000	T	0.52565	0.1742	L	0.58583	1.82	0.45005	D	0.998021	P	0.47034	0.889	P	0.49451	0.611	T	0.50725	-0.8794	10	0.40728	T	0.16	-2.3322	6.789	0.23689	0.0977:0.1779:0.7244:0.0	.	24	Q8IVD9	NUDC3_HUMAN	K	24	ENSP00000347626:Q24K	ENSP00000347626:Q24K	Q	-	1	0	NUDCD3	44496655	1.000000	0.71417	0.997000	0.53966	0.344000	0.29017	4.236000	0.58675	1.215000	0.43411	0.563000	0.77884	CAG	NUDCD3	-	NULL	ENSG00000015676		0.632	NUDCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDCD3	HGNC	protein_coding	OTTHUMT00000251248.3	-	0.00	54	0	G	NM_015332		44530130	-1	tier1	-	no_errors	ENST00000355451	ensembl	human	known	74_37	missense	18.39	71	16	SNP	1.000	T
OBSCN	84033	genome.wustl.edu	37	1	228467014	228467014	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:228467014G>T	ENST00000422127.1	+	27	7309	c.7265G>T	c.(7264-7266)gGg>gTg	p.G2422V	OBSCN_ENST00000359599.6_Missense_Mutation_p.G1269V|OBSCN_ENST00000284548.11_Missense_Mutation_p.G2422V|OBSCN_ENST00000570156.2_Missense_Mutation_p.G2851V|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000366707.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2422					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TTGCAGGCTGGGGGGAACGTG	0.662																																																	0													63.0	73.0	70.0					1																	228467014		2101	4216	6317	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.7265G>T	1.37:g.228467014G>T	ENSP00000409493:p.Gly2422Val		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.G2422V	ENST00000422127.1	37	c.7265	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	13.02	2.112280	0.37242	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599;ENST00000366706	T;T;T	0.48522	0.81;0.81;0.81	4.4	4.4	0.53042	Immunoglobulin-like fold (1);	0.081627	0.51477	D	0.000085	T	0.68522	0.3010	M	0.75615	2.305	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.991	D;D;P	0.76071	0.987;0.976;0.785	T	0.71676	-0.4521	10	0.48119	T	0.1	.	17.3234	0.87241	0.0:0.0:1.0:0.0	.	2422;2422;2422	Q5VST9;Q5VST9-2;Q5VST9-3	OBSCN_HUMAN;.;.	V	2422;2422;1269;121	ENSP00000284548:G2422V;ENSP00000409493:G2422V;ENSP00000352613:G1269V	ENSP00000284548:G2422V	G	+	2	0	OBSCN	226533637	1.000000	0.71417	0.121000	0.21740	0.008000	0.06430	5.267000	0.65530	2.176000	0.68965	0.555000	0.69702	GGG	OBSCN	-	NULL	ENSG00000154358		0.662	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	108	0	G	NM_052843		228467014	+1	tier1	-	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	17.86	69	15	SNP	0.735	T
OLFML2B	25903	genome.wustl.edu	37	1	161953836	161953836	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:161953836C>A	ENST00000294794.3	-	8	2305	c.1882G>T	c.(1882-1884)Ggc>Tgc	p.G628C	OLFML2B_ENST00000367938.1_Missense_Mutation_p.G111C|OLFML2B_ENST00000367940.2_Missense_Mutation_p.G629C	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	628	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			AGCCATAGGCCATTCTCGTCC	0.627																																																	0													71.0	62.0	65.0					1																	161953836		2203	4300	6503	SO:0001583	missense	0			BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.1882G>T	1.37:g.161953836C>A	ENSP00000294794:p.Gly628Cys		B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	pfam_Olfac-like,superfamily_NA-bd_OB-fold,smart_Olfac-like,pfscan_Olfac-like	p.G628C	ENST00000294794.3	37	c.1882	CCDS1236.1	1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.316293	0.81469	.	.	ENSG00000162745	ENST00000294794;ENST00000367940;ENST00000367938	D;D;D	0.96396	-4.0;-4.0;-4.0	5.21	5.21	0.72293	Olfactomedin-like (3);	.	.	.	.	D	0.98735	0.9575	H	0.95917	3.74	0.49389	D	0.999781	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99771	1.1024	8	0.87932	D	0	.	16.2308	0.82341	0.0:1.0:0.0:0.0	.	629;628	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	C	628;629;111	ENSP00000294794:G628C;ENSP00000356917:G629C;ENSP00000356915:G111C	ENSP00000294794:G628C	G	-	1	0	OLFML2B	160220460	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.707000	0.84623	2.414000	0.81942	0.561000	0.74099	GGC	OLFML2B	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000162745		0.627	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OLFML2B	HGNC	protein_coding	OTTHUMT00000060552.2	-	0.00	41	0	C	NM_015441		161953836	-1	tier1	-	no_errors	ENST00000294794	ensembl	human	known	74_37	missense	46.88	17	15	SNP	1.000	A
OBSCN	84033	genome.wustl.edu	37	1	228474500	228474500	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:228474500C>T	ENST00000422127.1	+	35	9348	c.9304C>T	c.(9304-9306)Ctc>Ttc	p.L3102F	OBSCN_ENST00000359599.6_Missense_Mutation_p.L1949F|OBSCN_ENST00000284548.11_Missense_Mutation_p.L3102F|OBSCN_ENST00000570156.2_Missense_Mutation_p.L3531F|OBSCN_ENST00000366709.4_Missense_Mutation_p.L221F|OBSCN_ENST00000366707.4_Missense_Mutation_p.L221F	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3102	Ig-like 31.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CTCCCGGGAGCTCACAGATGC	0.607																																																	0													62.0	72.0	68.0					1																	228474500		2098	4229	6327	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.9304C>T	1.37:g.228474500C>T	ENSP00000409493:p.Leu3102Phe		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.L3102F	ENST00000422127.1	37	c.9304	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.115540	0.77323	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599	T;T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48;-0.48	4.8	4.8	0.61643	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000005	D	0.87083	0.6089	M	0.92970	3.365	0.48135	D	0.999594	D;D	0.89917	0.999;1.0	D;D	0.87578	0.998;0.991	D	0.87244	0.2268	10	0.29301	T	0.29	.	17.0189	0.86428	0.0:1.0:0.0:0.0	.	3102;3102	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	F	3102;3102;221;221;1949	ENSP00000284548:L3102F;ENSP00000409493:L3102F;ENSP00000355668:L221F;ENSP00000355670:L221F;ENSP00000352613:L1949F	ENSP00000284548:L3102F	L	+	1	0	OBSCN	226541123	1.000000	0.71417	0.919000	0.36401	0.344000	0.29017	3.567000	0.53813	2.480000	0.83734	0.484000	0.47621	CTC	OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000154358		0.607	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	26	0	C	NM_052843		228474500	+1	tier1	-	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	32.00	17	8	SNP	0.993	T
OMG	4974	genome.wustl.edu	37	17	29622474	29622474	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:29622474C>T	ENST00000247271.4	-	2	1137	c.876G>A	c.(874-876)ctG>ctA	p.L292L	NF1_ENST00000356175.3_Intron|NF1_ENST00000358273.4_Intron	NM_002544.4	NP_002535.3	P23515	OMGP_HUMAN	oligodendrocyte myelin glycoprotein	292					cell adhesion (GO:0007155)|negative regulation of axonogenesis (GO:0050771)|neuron projection regeneration (GO:0031102)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|regulation of collateral sprouting of intact axon in response to injury (GO:0048683)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.0?(8)|p.?(3)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)|stomach(1)	13		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;1.81e-13)|Epithelial(4;4.04e-12)|OV - Ovarian serous cystadenocarcinoma(4;9.49e-12)|GBM - Glioblastoma multiforme(4;0.121)		TTACCACACTCAGAGAGTTAA	0.413																																																	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)											222.0	192.0	202.0					17																	29622474		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11265.1	17q11-q12	2008-07-18			ENSG00000126861	ENSG00000126861			8135	protein-coding gene	gene with protein product		164345				1899288, 2277079	Standard	NM_002544		Approved	OMGP	uc002hgj.3	P23515	OTTHUMG00000132870	ENST00000247271.4:c.876G>A	17.37:g.29622474C>T			E1P659	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.L292	ENST00000247271.4	37	c.876	CCDS11265.1	17																																																																																			OMG	-	NULL	ENSG00000126861		0.413	OMG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OMG	HGNC	protein_coding	OTTHUMT00000256350.2	-	0.00	84	0	C	NM_002544		29622474	-1	tier1	-	no_errors	ENST00000247271	ensembl	human	known	74_37	silent	31.58	52	24	SNP	1.000	T
OPCML	4978	genome.wustl.edu	37	11	132812977	132812977	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:132812977C>T	ENST00000331898.7	-	1	589	c.11G>A	c.(10-12)tGt>tAt	p.C4Y	OPCML_ENST00000524381.1_Intron|OPCML_ENST00000374778.4_Intron|OPCML_ENST00000529038.1_Intron|OPCML_ENST00000541867.1_Missense_Mutation_p.C4Y	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	4					cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)			endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		CAGGTACCCACAGACCCCCAT	0.677																																																	0													95.0	87.0	90.0					11																	132812977		2201	4297	6498	SO:0001583	missense	0			BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.11G>A	11.37:g.132812977C>T	ENSP00000330862:p.Cys4Tyr		B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.C4Y	ENST00000331898.7	37	c.11	CCDS8492.1	11	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697431	0.48202	.	.	ENSG00000183715	ENST00000331898;ENST00000541867	T;T	0.61859	0.45;0.07	5.47	5.47	0.80525	.	0.335795	0.25981	N	0.027068	T	0.43853	0.1266	N	0.22421	0.69	0.37896	D	0.930866	P;B;B	0.48162	0.906;0.128;0.128	B;B;B	0.34722	0.188;0.048;0.048	T	0.57400	-0.7818	10	0.66056	D	0.02	-4.5335	19.32	0.94234	0.0:1.0:0.0:0.0	.	4;4;4	B7ZLQ1;B7ZLQ0;Q14982	.;.;OPCM_HUMAN	Y	4	ENSP00000330862:C4Y;ENSP00000445496:C4Y	ENSP00000330862:C4Y	C	-	2	0	OPCML	132318187	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.206000	0.58473	2.580000	0.87095	0.561000	0.74099	TGT	OPCML	-	NULL	ENSG00000183715		0.677	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPCML	HGNC	protein_coding	OTTHUMT00000374689.3	-	0.00	141	0	C	NM_001012393		132812977	-1	tier1	-	no_errors	ENST00000541867	ensembl	human	known	74_37	missense	33.10	95	47	SNP	1.000	T
OR11G2	390439	genome.wustl.edu	37	14	20666414	20666414	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr14:20666414G>T	ENST00000357366.3	+	1	920	c.920G>T	c.(919-921)gGa>gTa	p.G307V		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	307						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		aatgaagctggaaagcagaag	0.453																																																	0													132.0	127.0	129.0					14																	20666414		2203	4300	6503	SO:0001583	missense	0				CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.920G>T	14.37:g.20666414G>T	ENSP00000349930:p.Gly307Val		Q6IF09|Q96R33	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G307V	ENST00000357366.3	37	c.920	CCDS32032.1	14	.	.	.	.	.	.	.	.	.	.	g	8.843	0.942820	0.18281	.	.	ENSG00000196832	ENST00000357366	T	0.00099	8.73	4.94	4.94	0.65067	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000247	T	0.00144	0.0004	L	0.31294	0.92	0.27261	N	0.958626	B	0.28258	0.205	B	0.32090	0.14	T	0.48317	-0.9046	10	0.32370	T	0.25	.	12.9063	0.58154	0.0:0.1638:0.8361:0.0	.	307	Q8NGC1	O11G2_HUMAN	V	307	ENSP00000349930:G307V	ENSP00000349930:G307V	G	+	2	0	OR11G2	19736254	0.108000	0.22018	0.973000	0.42090	0.455000	0.32408	0.761000	0.26489	2.569000	0.86673	0.655000	0.94253	GGA	OR11G2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196832		0.453	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR11G2	HGNC	protein_coding	OTTHUMT00000395722.1		0.00	50	0	G			20666414	+1			no_errors	ENST00000357366	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.321	T
OR11L1	391189	genome.wustl.edu	37	1	248005050	248005050	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:248005050C>A	ENST00000355784.2	-	1	204	c.149G>T	c.(148-150)aGc>aTc	p.S50I		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	50						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CAGGCCCTGGCTCACCACGGT	0.532																																																	0													73.0	64.0	67.0					1																	248005050		2203	4300	6503	SO:0001583	missense	0			AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.149G>T	1.37:g.248005050C>A	ENSP00000348033:p.Ser50Ile			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.S50I	ENST00000355784.2	37	c.149	CCDS31098.1	1	.	.	.	.	.	.	.	.	.	.	C	0.047	-1.264337	0.01433	.	.	ENSG00000197591	ENST00000355784	T	0.01076	5.37	4.2	1.29	0.21616	GPCR, rhodopsin-like superfamily (1);	0.162929	0.28482	U	0.015200	T	0.00754	0.0025	N	0.21240	0.645	0.09310	N	1	B	0.22211	0.066	B	0.17098	0.017	T	0.48570	-0.9024	10	0.20519	T	0.43	.	1.9808	0.03426	0.1389:0.4685:0.1359:0.2567	.	50	Q8NGX0	O11L1_HUMAN	I	50	ENSP00000348033:S50I	ENSP00000348033:S50I	S	-	2	0	OR11L1	246071673	0.000000	0.05858	0.374000	0.26016	0.067000	0.16453	-1.188000	0.03064	0.529000	0.28599	0.543000	0.68304	AGC	OR11L1	-	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000197591		0.532	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11L1	HGNC	protein_coding	OTTHUMT00000096850.1	-	0.00	53	0	C	NM_001001959		248005050	-1	tier1	-	no_errors	ENST00000355784	ensembl	human	known	74_37	missense	27.27	16	6	SNP	0.000	A
OR1G1	8390	genome.wustl.edu	37	17	3030174	3030174	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:3030174G>T	ENST00000328890.2	-	1	701	c.672C>A	c.(670-672)acC>acA	p.T224T		NM_003555.1	NP_003546.1	P47890	OR1G1_HUMAN	olfactory receptor, family 1, subfamily G, member 1	224					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(3)|skin(3)	11						TCTTCAGGATGGTCGAGAAAA	0.498																																					Colon(127;1481 1654 8243 19426 50557)												0													92.0	87.0	89.0					17																	3030174		2203	4300	6503	SO:0001819	synonymous_variant	0			U04689	CCDS11020.1	17p13.3	2012-08-09			ENSG00000183024	ENSG00000183024		"""GPCR / Class A : Olfactory receptors"""	8204	protein-coding gene	gene with protein product				OR1G2		8004088, 9500546	Standard	NM_003555		Approved	OR17-209	uc002fvc.1	P47890	OTTHUMG00000090618	ENST00000328890.2:c.672C>A	17.37:g.3030174G>T			Q4VBM1|Q6IFL9|Q9UM76	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T224	ENST00000328890.2	37	c.672	CCDS11020.1	17																																																																																			OR1G1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000183024		0.498	OR1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1G1	HGNC	protein_coding	OTTHUMT00000207206.2	-	0.00	48	0	G			3030174	-1	tier1	-	no_errors	ENST00000328890	ensembl	human	known	74_37	silent	33.33	14	7	SNP	0.000	T
OR2G2	81470	genome.wustl.edu	37	1	247752501	247752501	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:247752501C>A	ENST00000320065.1	+	1	840	c.840C>A	c.(838-840)ttC>ttA	p.F280L	RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TTTCTCTCTTCTACACTGTGG	0.463																																																	0													139.0	137.0	138.0					1																	247752501		2203	4300	6503	SO:0001583	missense	0			BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.840C>A	1.37:g.247752501C>A	ENSP00000326349:p.Phe280Leu		Q5JQT2|Q6IEZ0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F280L	ENST00000320065.1	37	c.840	CCDS31092.1	1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.492660	0.44352	.	.	ENSG00000177489	ENST00000320065	T	0.00032	8.88	4.29	1.3	0.21679	GPCR, rhodopsin-like superfamily (1);	0.186497	0.25427	U	0.030760	T	0.00144	0.0004	L	0.42008	1.315	0.26315	N	0.977766	B	0.28350	0.208	B	0.33690	0.168	T	0.27365	-1.0076	10	0.66056	D	0.02	.	3.6645	0.08250	0.1719:0.5346:0.0:0.2934	.	280	Q8NGZ5	OR2G2_HUMAN	L	280	ENSP00000326349:F280L	ENSP00000326349:F280L	F	+	3	2	OR2G2	245819124	0.000000	0.05858	0.999000	0.59377	0.954000	0.61252	-1.963000	0.01513	0.447000	0.26695	0.591000	0.81541	TTC	OR2G2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000177489		0.463	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G2	HGNC	protein_coding	OTTHUMT00000097623.1	-	0.00	147	0	C			247752501	+1	tier1	-	no_errors	ENST00000320065	ensembl	human	known	74_37	missense	40.51	47	32	SNP	0.863	A
OR2M2	391194	genome.wustl.edu	37	1	248344020	248344020	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:248344020C>A	ENST00000359682.2	+	1	733	c.733C>A	c.(733-735)Ctc>Atc	p.L245I		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TTCCTCTCACCTCATGGTGGT	0.483																																																	0													222.0	199.0	207.0					1																	248344020		2203	4300	6503	SO:0001583	missense	0			AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.733C>A	1.37:g.248344020C>A	ENSP00000352710:p.Leu245Ile		A3KFT4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L245I	ENST00000359682.2	37	c.733	CCDS31106.1	1	.	.	.	.	.	.	.	.	.	.	c	12.72	2.021934	0.35701	.	.	ENSG00000198601	ENST00000359682	T	0.43294	0.95	2.03	1.02	0.19986	GPCR, rhodopsin-like superfamily (1);	0.000000	0.24160	U	0.040984	T	0.41696	0.1170	L	0.56199	1.76	0.21499	N	0.999667	P	0.44195	0.828	P	0.50934	0.654	T	0.20672	-1.0268	10	0.45353	T	0.12	.	4.1007	0.10012	0.232:0.6338:0.0:0.1342	.	245	Q96R28	OR2M2_HUMAN	I	245	ENSP00000352710:L245I	ENSP00000352710:L245I	L	+	1	0	OR2M2	246410643	0.003000	0.15002	0.003000	0.11579	0.004000	0.04260	-0.077000	0.11394	0.171000	0.19730	0.454000	0.30748	CTC	OR2M2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000198601		0.483	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M2	HGNC	protein_coding	OTTHUMT00000097356.2	-	0.00	171	0	C	NM_001004688		248344020	+1	tier1	-	no_errors	ENST00000359682	ensembl	human	known	74_37	missense	19.29	113	27	SNP	0.935	A
OR4B1	119765	genome.wustl.edu	37	11	48239263	48239263	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:48239263G>T	ENST00000309562.2	+	1	920	c.902G>T	c.(901-903)aGc>aTc	p.S301I		NM_001005470.1	NP_001005470.1	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B, member 1	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						AGATTGTGGAGCAAAAAGGAG	0.418																																																	0													53.0	54.0	54.0					11																	48239263		2201	4298	6499	SO:0001583	missense	0			AB065848	CCDS31485.1	11p11.2	2012-08-09			ENSG00000175619	ENSG00000175619		"""GPCR / Class A : Olfactory receptors"""	8290	protein-coding gene	gene with protein product							Standard	NM_001005470		Approved	OST208	uc010rhs.2	Q8NGF8	OTTHUMG00000166576	ENST00000309562.2:c.902G>T	11.37:g.48239263G>T	ENSP00000311605:p.Ser301Ile		Q6IF75|Q96R64	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S301I	ENST00000309562.2	37	c.902	CCDS31485.1	11	.	.	.	.	.	.	.	.	.	.	G	9.206	1.029638	0.19512	.	.	ENSG00000175619	ENST00000309562	T	0.38077	1.16	5.29	2.35	0.29111	.	1.495230	0.04457	N	0.373689	T	0.32556	0.0833	L	0.60067	1.865	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.20773	-1.0265	10	0.17369	T	0.5	.	3.9965	0.09561	0.2715:0.1805:0.548:0.0	.	301	Q8NGF8	OR4B1_HUMAN	I	301	ENSP00000311605:S301I	ENSP00000311605:S301I	S	+	2	0	OR4B1	48195839	.	.	0.001000	0.08648	0.279000	0.26890	.	.	0.574000	0.29417	0.494000	0.49563	AGC	OR4B1	-	NULL	ENSG00000175619		0.418	OR4B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4B1	HGNC	protein_coding	OTTHUMT00000390554.1	-	0.00	47	0	G	NM_001005470		48239263	+1	tier1	-	no_errors	ENST00000309562	ensembl	human	known	74_37	missense	11.11	48	6	SNP	0.000	T
OR4Q3	441669	genome.wustl.edu	37	14	20216180	20216180	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr14:20216180G>T	ENST00000331723.1	+	1	594	c.594G>T	c.(592-594)gtG>gtT	p.V198V		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	198						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V198V(1)		NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TGGTAGAGGTGCTGGTGATAG	0.498																																																	1	Substitution - coding silent(1)	lung(1)											208.0	163.0	178.0					14																	20216180		2203	4300	6503	SO:0001819	synonymous_variant	0			AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.594G>T	14.37:g.20216180G>T			Q6IEX4	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V198	ENST00000331723.1	37	c.594	CCDS32020.1	14																																																																																			OR4Q3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000182652		0.498	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4Q3	HGNC	protein_coding	OTTHUMT00000409818.2	-	0.00	252	0	G			20216180	+1	tier1	-	no_errors	ENST00000331723	ensembl	human	known	74_37	silent	16.28	144	28	SNP	0.002	T
OR51G1	79324	genome.wustl.edu	37	11	4944765	4944765	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:4944765G>T	ENST00000321961.2	-	1	872	c.805C>A	c.(805-807)Cat>Aat	p.H269N	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		CGGGGCAGATGTTCACCAAAG	0.502																																																	0													202.0	162.0	175.0					11																	4944765		2201	4298	6499	SO:0001583	missense	0			AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.805C>A	11.37:g.4944765G>T	ENSP00000322546:p.His269Asn		B9EGW8|Q6IFH6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.H269N	ENST00000321961.2	37	c.805	CCDS31366.1	11	.	.	.	.	.	.	.	.	.	.	G	8.361	0.833173	0.16820	.	.	ENSG00000176879	ENST00000321961	T	0.00099	8.73	4.53	2.48	0.30137	GPCR, rhodopsin-like superfamily (1);	0.191615	0.25538	U	0.029982	T	0.00144	0.0004	N	0.25485	0.75	0.09310	N	1	B	0.31611	0.331	B	0.41723	0.365	T	0.25328	-1.0135	10	0.54805	T	0.06	.	10.3648	0.44017	0.0:0.0:0.5285:0.4715	.	269	Q8NGK1	O51G1_HUMAN	N	269	ENSP00000322546:H269N	ENSP00000322546:H269N	H	-	1	0	OR51G1	4901341	0.000000	0.05858	0.995000	0.50966	0.168000	0.22595	-1.088000	0.03379	1.082000	0.41137	0.557000	0.71058	CAT	OR51G1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176879		0.502	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51G1	HGNC	protein_coding	OTTHUMT00000142345.1	-	0.00	69	0	G	NM_001005237		4944765	-1	tier1	-	no_errors	ENST00000321961	ensembl	human	known	74_37	missense	16.67	50	10	SNP	0.013	T
OR52D1	390066	genome.wustl.edu	37	11	5510671	5510671	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:5510671C>A	ENST00000322641.5	+	1	757	c.735C>A	c.(733-735)ggC>ggA	p.G245G	HBE1_ENST00000380237.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron	NM_001005163.2	NP_001005163.1	Q9H346	O52D1_HUMAN	olfactory receptor, family 52, subfamily D, member 1	245					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	22		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.46e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTACCTGTGGCTCCCACATTG	0.498																																																	0													200.0	177.0	184.0					11																	5510671		2201	4297	6498	SO:0001819	synonymous_variant	0			BK004276	CCDS31384.1	11p15.4	2012-08-09			ENSG00000181609	ENSG00000181609		"""GPCR / Class A : Olfactory receptors"""	15212	protein-coding gene	gene with protein product							Standard	NM_001005163		Approved		uc010qzg.2	Q9H346	OTTHUMG00000066895	ENST00000322641.5:c.735C>A	11.37:g.5510671C>A			B9EGY9|Q6IFI6	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G245	ENST00000322641.5	37	c.735	CCDS31384.1	11																																																																																			OR52D1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000181609		0.498	OR52D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52D1	HGNC	protein_coding	OTTHUMT00000143372.1	-	0.00	80	0	C	NM_001005163		5510671	+1	tier1	-	no_errors	ENST00000322641	ensembl	human	known	74_37	silent	32.31	44	21	SNP	0.715	A
OR5J2	282775	genome.wustl.edu	37	11	55944157	55944157	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:55944157G>T	ENST00000312298.1	+	1	64	c.64G>T	c.(64-66)Gaa>Taa	p.E22*		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	22						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					AGATCATGCTGAACTAAAAGC	0.368																																																	0													157.0	152.0	154.0					11																	55944157		2201	4296	6497	SO:0001587	stop_gained	0			AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.64G>T	11.37:g.55944157G>T	ENSP00000310788:p.Glu22*		Q6IEU5	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	p.E22*	ENST00000312298.1	37	c.64	CCDS31522.1	11	.	.	.	.	.	.	.	.	.	.	G	9.250	1.040564	0.19669	.	.	ENSG00000174957	ENST00000312298	.	.	.	4.32	3.39	0.38822	.	0.106600	0.40728	N	0.001038	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	12.5087	0.55995	0.0:0.169:0.831:0.0	.	.	.	.	X	22	.	ENSP00000310788:E22X	E	+	1	0	OR5J2	55700733	0.004000	0.15560	0.003000	0.11579	0.048000	0.14542	0.934000	0.28910	0.946000	0.37632	0.577000	0.79330	GAA	OR5J2	-	NULL	ENSG00000174957		0.368	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5J2	HGNC	protein_coding	OTTHUMT00000391544.1	-	0.00	97	0	G	NM_001005492		55944157	+1	tier1	-	no_errors	ENST00000312298	ensembl	human	known	74_37	nonsense	22.37	59	17	SNP	0.054	T
OR5AR1	219493	genome.wustl.edu	37	11	56431989	56431989	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:56431989G>T	ENST00000302969.2	+	1	852	c.828G>T	c.(826-828)gtG>gtT	p.V276V		NM_001004730.1	NP_001004730.1	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR, member 1 (gene/pseudogene)	276						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(12)|prostate(1)|skin(3)|stomach(1)	26						GGGCCTCTGTGTTCTACACGG	0.453																																																	0													89.0	82.0	85.0					11																	56431989		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065740	CCDS31535.1	11q11	2013-10-10	2013-10-10		ENSG00000172459	ENSG00000172459		"""GPCR / Class A : Olfactory receptors"""	15260	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AR, member 1"""				Standard	NM_001004730		Approved		uc010rjm.2	Q8NGP9	OTTHUMG00000154213	ENST00000302969.2:c.828G>T	11.37:g.56431989G>T			Q6IF61	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V276	ENST00000302969.2	37	c.828	CCDS31535.1	11																																																																																			OR5AR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000172459		0.453	OR5AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AR1	HGNC	protein_coding	OTTHUMT00000334434.1	-	0.00	47	0	G	NM_001004730		56431989	+1	tier1	-	no_errors	ENST00000302969	ensembl	human	known	74_37	silent	32.43	25	12	SNP	1.000	T
OR6K6	128371	genome.wustl.edu	37	1	158724756	158724756	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:158724756G>T	ENST00000368144.2	+	1	247	c.151G>T	c.(151-153)Ggt>Tgt	p.G51C		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	51						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					TGCGCACAGAGGTGGCCTCTT	0.468																																																	0													208.0	193.0	198.0					1																	158724756		2203	4300	6503	SO:0001583	missense	0			BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.151G>T	1.37:g.158724756G>T	ENSP00000357126:p.Gly51Cys		B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G51C	ENST00000368144.2	37	c.151	CCDS30904.1	1	.	.	.	.	.	.	.	.	.	.	G	7.696	0.692146	0.15039	.	.	ENSG00000180433	ENST00000368144	T	0.01335	5.0	5.11	3.21	0.36854	.	0.152990	0.30565	N	0.009354	T	0.02047	0.0064	M	0.71581	2.175	0.21325	N	0.999722	D	0.63046	0.992	P	0.60345	0.873	T	0.42498	-0.9448	10	0.48119	T	0.1	-4.8215	8.9501	0.35783	0.079:0.0:0.7725:0.1485	.	51	Q8NGW6	OR6K6_HUMAN	C	51	ENSP00000357126:G51C	ENSP00000357126:G51C	G	+	1	0	OR6K6	156991380	0.000000	0.05858	0.733000	0.30861	0.022000	0.10575	0.281000	0.18810	0.705000	0.31890	0.655000	0.94253	GGT	OR6K6	-	NULL	ENSG00000180433		0.468	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6K6	HGNC	protein_coding	OTTHUMT00000059065.2	-	0.00	69	0	G	NM_001005184		158724756	+1	tier1	-	no_errors	ENST00000368144	ensembl	human	known	74_37	missense	18.87	43	10	SNP	0.388	T
OVCH2	341277	genome.wustl.edu	37	11	7718030	7718030	+	RNA	SNP	A	A	G			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:7718030A>G	ENST00000533663.1	-	0	0				OVCH2_ENST00000534193.2_RNA|OVCH2_ENST00000454689.1_RNA			Q7RTZ1	OVCH2_HUMAN	ovochymase 2 (gene/pseudogene)							extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(2)	15				Epithelial(150;7.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.197)		CTGTCTTCTAAAGAATACATT	0.453																																																	0													88.0	85.0	86.0					11																	7718030		1925	4120	6045			0			BN000120	CCDS73251.1	11p15.4	2012-10-02	2010-06-08		ENSG00000183378	ENSG00000183378			29970	protein-coding gene	gene with protein product			"""ovochymase 2"""			12838346	Standard	XM_006718221		Approved	OVTN	uc031pyw.1	Q7RTZ1	OTTHUMG00000165418		11.37:g.7718030A>G				Silent	SNP	pfam_Peptidase_S1,pfam_CUB_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,smart_Peptidase_S1,smart_CUB_dom,pfscan_CUB_dom,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.L375	ENST00000533663.1	37	c.1123		11																																																																																			OVCH2	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000183378		0.453	OVCH2-002	KNOWN	basic	processed_transcript	OVCH2	HGNC	polymorphic_pseudogene	OTTHUMT00000383928.1	-	0.00	34	0	A	NM_198185		7718030	-1	tier1	-	no_errors	ENST00000454689	ensembl	human	known	74_37	silent	20.00	20	5	SNP	0.995	G
OXR1	55074	genome.wustl.edu	37	8	107718695	107718695	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr8:107718695C>A	ENST00000442977.2	+	8	1048	c.949C>A	c.(949-951)Cga>Aga	p.R317R	OXR1_ENST00000497705.1_Silent_p.R249R|OXR1_ENST00000452423.2_5'UTR|OXR1_ENST00000531443.1_Silent_p.R316R|OXR1_ENST00000312046.6_Silent_p.R309R|OXR1_ENST00000517566.2_Silent_p.R316R|OXR1_ENST00000445937.1_Silent_p.R316R	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	317					adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			CTCAAGAATCCGAGATGCAGG	0.423																																																	0													91.0	92.0	92.0					8																	107718695		2203	4300	6503	SO:0001819	synonymous_variant	0			AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.949C>A	8.37:g.107718695C>A			A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Silent	SNP	pfam_TLDc,pfam_LysM_dom,pfam_GRAM,smart_LysM_dom,smart_TLDc	p.R317	ENST00000442977.2	37	c.949	CCDS56548.1	8																																																																																			OXR1	-	NULL	ENSG00000164830		0.423	OXR1-201	KNOWN	basic|CCDS	protein_coding	OXR1	HGNC	protein_coding			0.00	42	0	C	NM_181354		107718695	+1			no_errors	ENST00000442977	ensembl	human	known	74_37	silent	14.29	36	6	SNP	0.972	A
PANK2	80025	genome.wustl.edu	37	20	3893116	3893116	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr20:3893116G>A	ENST00000316562.4	+	4	1253	c.1247G>A	c.(1246-1248)gGa>gAa	p.G416E	PANK2_ENST00000497424.1_Missense_Mutation_p.G125E|PANK2_ENST00000610179.1_Missense_Mutation_p.G293E|PANK2_ENST00000464452.1_3'UTR	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	416					aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CTTGGAGGAGGAACTTTTTTT	0.338																																																	0													140.0	150.0	147.0					20																	3893116		2203	4300	6503	SO:0001583	missense	0			AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.1247G>A	20.37:g.3893116G>A	ENSP00000313377:p.Gly416Glu		B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	pfam_Type_II_PanK,tigrfam_Type_II_PanK	p.G416E	ENST00000316562.4	37	c.1247	CCDS13071.2	20	.	.	.	.	.	.	.	.	.	.	G	17.83	3.485811	0.63962	.	.	ENSG00000125779	ENST00000497424;ENST00000316562;ENST00000399552	D;D	0.99911	-7.92;-7.92	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	D	0.99926	0.9966	H	0.95574	3.69	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.95993	0.8987	10	0.87932	D	0	.	15.7055	0.77577	0.0:0.0:1.0:0.0	.	416	Q9BZ23	PANK2_HUMAN	E	125;416;232	ENSP00000417609:G125E;ENSP00000313377:G416E	ENSP00000313377:G416E	G	+	2	0	PANK2	3841116	1.000000	0.71417	1.000000	0.80357	0.318000	0.28184	9.563000	0.98148	2.589000	0.87451	0.591000	0.81541	GGA	PANK2	-	pfam_Type_II_PanK,tigrfam_Type_II_PanK	ENSG00000125779		0.338	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PANK2	HGNC	protein_coding	OTTHUMT00000077793.2		0.00	51	0	G	NM_024960		3893116	+1			no_errors	ENST00000316562	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	A
PATL1	219988	genome.wustl.edu	37	11	59423058	59423058	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:59423058G>T	ENST00000300146.9	-	8	1053	c.969C>A	c.(967-969)ccC>ccA	p.P323P		NM_152716.2	NP_689929.2	Q86TB9	PATL1_HUMAN	protein associated with topoisomerase II homolog 1 (yeast)	323	Involved in RNA-binding.|Involved in nuclear foci localization.|Pro-rich.|Region N; interaction with decapping machinery.				cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)	p.P323P(1)		central_nervous_system(1)|endometrium(2)|lung(5)|ovary(1)|prostate(2)	11						GTGTAGCGGAGGGTGGAGCAC	0.552																																																	1	Substitution - coding silent(1)	ovary(1)											61.0	64.0	63.0					11																	59423058		1980	4147	6127	SO:0001819	synonymous_variant	0			AK094193	CCDS44613.1	11q12.1	2012-06-07	2007-10-18		ENSG00000166889	ENSG00000166889			26721	protein-coding gene	gene with protein product		614660				17936923	Standard	NM_152716		Approved	FLJ36874, Pat1b	uc001noe.4	Q86TB9	OTTHUMG00000167423	ENST00000300146.9:c.969C>A	11.37:g.59423058G>T			B3KXT9|Q2TA86|Q6P166|Q8N9M6|Q8NI63	Silent	SNP	pfam_Topo_II-assoc_PAT1	p.P323	ENST00000300146.9	37	c.969	CCDS44613.1	11																																																																																			PATL1	-	pfam_Topo_II-assoc_PAT1	ENSG00000166889		0.552	PATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PATL1	HGNC	protein_coding	OTTHUMT00000394559.1	-	0.00	81	0	G	NM_152716		59423058	-1	tier1	-	no_errors	ENST00000300146	ensembl	human	known	74_37	silent	21.35	70	19	SNP	0.966	T
PAX1	5075	genome.wustl.edu	37	20	21689255	21689255	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr20:21689255G>A	ENST00000398485.2	+	3	1030	c.976G>A	c.(976-978)Gtg>Atg	p.V326M	PAX1_ENST00000444366.2_Missense_Mutation_p.V302M|PAX1_ENST00000460221.1_3'UTR	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	326					bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						CTGGGCCGGCGTGAACCGCAC	0.597																																																	0													47.0	55.0	52.0					20																	21689255		2203	4300	6503	SO:0001583	missense	0				CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.976G>A	20.37:g.21689255G>A	ENSP00000381499:p.Val326Met		B4E0D6|Q642X9|Q6NTC0|Q9Y558	Missense_Mutation	SNP	pfam_Paired_dom,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom	p.V326M	ENST00000398485.2	37	c.976	CCDS13146.2	20	.	.	.	.	.	.	.	.	.	.	G	13.49	2.251396	0.39797	.	.	ENSG00000125813	ENST00000398485;ENST00000444366	D;D	0.98400	-4.44;-4.91	5.41	4.47	0.54385	.	0.291939	0.31963	N	0.006792	D	0.95503	0.8539	L	0.59912	1.85	0.44129	D	0.996917	B;B;P	0.40360	0.212;0.048;0.714	B;B;B	0.25759	0.063;0.016;0.063	D	0.94192	0.7442	10	0.26408	T	0.33	.	14.0349	0.64638	0.0739:0.0:0.9261:0.0	.	302;232;326	P15863-2;C9J775;P15863	.;.;PAX1_HUMAN	M	326;302	ENSP00000381499:V326M;ENSP00000410355:V302M	ENSP00000381499:V326M	V	+	1	0	PAX1	21637255	1.000000	0.71417	0.900000	0.35374	0.113000	0.19764	5.192000	0.65115	1.285000	0.44548	-0.463000	0.05309	GTG	PAX1	-	NULL	ENSG00000125813		0.597	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAX1	HGNC	protein_coding	OTTHUMT00000078282.3	-	0.00	40	0	G			21689255	+1	tier1	-	no_errors	ENST00000398485	ensembl	human	known	74_37	missense	40.00	20	14	SNP	1.000	A
PCBP3	54039	genome.wustl.edu	37	21	47316264	47316264	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr21:47316264G>T	ENST00000400314.1	+	4	491	c.153G>T	c.(151-153)ctG>ctT	p.L51L	PCBP3_ENST00000400310.1_Silent_p.L51L|PCBP3_ENST00000400309.1_Silent_p.L51L|PCBP3_ENST00000400304.1_Silent_p.L19L|PCBP3_ENST00000400308.1_Silent_p.L51L|PCBP3_ENST00000449640.1_Silent_p.L51L			P57721	PCBP3_HUMAN	poly(rC) binding protein 3	51	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				mRNA metabolic process (GO:0016071)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(3)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		TCCGCCTGCTGATGCATGGAA	0.577																																																	0													33.0	39.0	37.0					21																	47316264		1856	3865	5721	SO:0001819	synonymous_variant	0			AF176329	CCDS42974.2, CCDS46652.1	21q22.3	2013-07-16	2001-11-28		ENSG00000183570	ENSG00000183570			8651	protein-coding gene	gene with protein product		608502	"""poly(rC)-binding protein 3"""			10936052	Standard	NM_020528		Approved		uc002zhq.2	P57721	OTTHUMG00000090399	ENST00000400314.1:c.153G>T	21.37:g.47316264G>T			A8MPS2|A8MQ26|B7WNN9|B7WPC1|Q8N9K6|Q96EP6	Silent	SNP	pfam_KH_dom_type_1,pfam_KH_dom_type_2,smart_KH_dom,pfscan_KH_dom_type_1	p.L51	ENST00000400314.1	37	c.153	CCDS42974.2	21																																																																																			PCBP3	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000183570		0.577	PCBP3-001	KNOWN	basic|CCDS	protein_coding	PCBP3	HGNC	protein_coding	OTTHUMT00000206808.2	-	0.00	72	0	G			47316264	+1	tier1	-	no_errors	ENST00000400314	ensembl	human	known	74_37	silent	25.00	36	12	SNP	0.995	T
PCDH10	57575	genome.wustl.edu	37	4	134072237	134072237	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr4:134072237C>T	ENST00000264360.5	+	1	1768	c.942C>T	c.(940-942)ggC>ggT	p.G314G	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	314	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		AGGTAAGCGGCGAGTTGGACT	0.622																																																	0													65.0	60.0	62.0					4																	134072237		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.942C>T	4.37:g.134072237C>T			Q4W5F6|Q96SF0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G314	ENST00000264360.5	37	c.942	CCDS34063.1	4																																																																																			PCDH10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000138650		0.622	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	-	0.00	28	0	C	NM_032961		134072237	+1	tier1	-	no_errors	ENST00000264360	ensembl	human	known	74_37	silent	30.00	14	6	SNP	0.184	T
PCDH11X	27328	genome.wustl.edu	37	X	91873445	91873445	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:91873445C>A	ENST00000373094.1	+	7	4395	c.3550C>A	c.(3550-3552)Cac>Aac	p.H1184N	PCDH11X_ENST00000361655.2_Missense_Mutation_p.H1166N|PCDH11X_ENST00000406881.1_Missense_Mutation_p.H1176N|PCDH11X_ENST00000504220.2_3'UTR|PCDH11X_ENST00000373088.1_Missense_Mutation_p.H1147N|PCDH11X_ENST00000373097.1_Missense_Mutation_p.H1174N|PCDH11X_ENST00000298274.8_Missense_Mutation_p.H1147N	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1184					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CTCTACTCAGCACCACAGCCC	0.592																																					NSCLC(38;925 1092 2571 38200 45895)												0													213.0	164.0	181.0					X																	91873445		2203	4300	6503	SO:0001583	missense	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3550C>A	X.37:g.91873445C>A	ENSP00000362186:p.His1184Asn		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.H1184N	ENST00000373094.1	37	c.3550	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	C	4.749	0.139336	0.09083	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000373088;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T	0.49720	0.77;0.79;0.78;0.77;0.79;0.78	3.82	-0.106	0.13596	.	.	.	.	.	T	0.20455	0.0492	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.13594	0.008;0.008;0.008;0.008;0.005	B;B;B;B;B	0.13407	0.009;0.009;0.009;0.009;0.004	T	0.24476	-1.0159	9	0.12103	T	0.63	.	3.9341	0.09298	0.0:0.3052:0.3506:0.3441	.	1147;1166;1176;1174;1184	Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7	.;.;.;.;PC11X_HUMAN	N	1184;1174;1147;1166;1176;1184;1147	ENSP00000362186:H1184N;ENSP00000362189:H1174N;ENSP00000362180:H1147N;ENSP00000355105:H1166N;ENSP00000384758:H1176N;ENSP00000298274:H1147N	ENSP00000298274:H1147N	H	+	1	0	PCDH11X	91760101	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	0.363000	0.20301	-0.032000	0.13758	0.370000	0.22315	CAC	PCDH11X	-	NULL	ENSG00000102290		0.592	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	-	0.00	65	0	C	NM_032969		91873445	+1	tier1	-	no_errors	ENST00000373094	ensembl	human	known	74_37	missense	76.83	19	63	SNP	0.000	A
PCDHB2	56133	genome.wustl.edu	37	5	140474968	140474968	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:140474968G>T	ENST00000194155.4	+	1	742	c.594G>T	c.(592-594)ctG>ctT	p.L198L		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	198	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCTGGTGCTGAACAGAGCCC	0.517																																																	0													38.0	38.0	38.0					5																	140474968		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.594G>T	5.37:g.140474968G>T			Q4KMU1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L198	ENST00000194155.4	37	c.594	CCDS4244.1	5																																																																																			PCDHB2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000112852		0.517	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2	-	0.00	54	0	G	NM_018936		140474968	+1	tier1	-	no_errors	ENST00000194155	ensembl	human	known	74_37	silent	13.33	26	4	SNP	1.000	T
PCDHGB3	56102	genome.wustl.edu	37	5	140807630	140807630	+	Intron	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:140807630C>T	ENST00000576222.1	+	1	2546				PCDHGB8P_ENST00000502926.1_RNA|PCDHGA11_ENST00000518882.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA12_ENST00000252085.3_5'Flank|PCDHGA11_ENST00000398587.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGCGGTGGACGCAGATTCGG	0.657																																																	0																																										SO:0001627	intron_variant	0			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2415+55254C>T	5.37:g.140807630C>T			A7E229|Q9Y5C7	RNA	SNP	-	NULL	ENST00000576222.1	37	NULL	CCDS58980.1	5																																																																																			PCDHGB8P	-	-	ENSG00000248449		0.657	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB8P	HGNC	protein_coding	OTTHUMT00000437094.1	-	0.00	98	0	C	NM_018924		140807630	+1	tier1	-	no_errors	ENST00000502926	ensembl	human	known	74_37	rna	34.74	62	33	SNP	1.000	T
PCNT	5116	genome.wustl.edu	37	21	47850518	47850518	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr21:47850518G>T	ENST00000359568.5	+	37	8118	c.8011G>T	c.(8011-8013)Gag>Tag	p.E2671*	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2671					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CCAGCTGGAGGAGGAGCAGCT	0.647																																																	0													32.0	27.0	29.0					21																	47850518		2187	4291	6478	SO:0001587	stop_gained	0			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.8011G>T	21.37:g.47850518G>T	ENSP00000352572:p.Glu2671*		O43152|Q7Z7C9	Nonsense_Mutation	SNP	pfam_PACT_domain	p.E2671*	ENST00000359568.5	37	c.8011	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	G	48	14.194214	0.99784	.	.	ENSG00000160299	ENST00000359568	.	.	.	4.87	1.8	0.24995	.	0.263331	0.20231	N	0.096462	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	7.9597	0.30064	0.0861:0.3405:0.5734:0.0	.	.	.	.	X	2671	.	ENSP00000352572:E2671X	E	+	1	0	PCNT	46674946	1.000000	0.71417	1.000000	0.80357	0.237000	0.25408	2.288000	0.43514	0.558000	0.29135	0.563000	0.77884	GAG	PCNT	-	NULL	ENSG00000160299		0.647	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	-	0.00	52	0	G	NM_006031		47850518	+1	tier1	-	no_errors	ENST00000359568	ensembl	human	known	74_37	nonsense	10.00	36	4	SNP	1.000	T
PCNXL3	399909	genome.wustl.edu	37	11	65404426	65404426	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:65404426C>A	ENST00000355703.3	+	35	6621	c.6082C>A	c.(6082-6084)Ccc>Acc	p.P2028T	MIR4690_ENST00000578459.1_RNA|SIPA1_ENST00000527525.1_5'Flank|SIPA1_ENST00000534313.1_5'Flank	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	2028						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						GGCAGCCCAGCCCCTGCTGGA	0.632																																																	0													14.0	17.0	16.0					11																	65404426		1971	4132	6103	SO:0001583	missense	0			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.6082C>A	11.37:g.65404426C>A	ENSP00000347931:p.Pro2028Thr		Q6MZN8	Missense_Mutation	SNP	pfam_Pecanex	p.P2028T	ENST00000355703.3	37	c.6082	CCDS44650.1	11	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673538	0.47781	.	.	ENSG00000197136	ENST00000355703	T	0.08720	3.06	5.17	5.17	0.71159	.	0.000000	0.40385	N	0.001107	T	0.13841	0.0335	L	0.27053	0.805	0.35510	D	0.80051	D;P	0.55172	0.97;0.948	P;B	0.56127	0.792;0.431	T	0.07177	-1.0786	10	0.87932	D	0	.	14.1497	0.65375	0.0:1.0:0.0:0.0	.	915;2028	Q9H6A9-3;Q9H6A9	.;PCX3_HUMAN	T	2028	ENSP00000347931:P2028T	ENSP00000347931:P2028T	P	+	1	0	PCNXL3	65161002	1.000000	0.71417	1.000000	0.80357	0.280000	0.26924	3.116000	0.50399	2.416000	0.81992	0.462000	0.41574	CCC	PCNXL3	-	NULL	ENSG00000197136		0.632	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL3	HGNC	protein_coding	OTTHUMT00000390321.1	-	0.00	31	0	C	NM_032223		65404426	+1	tier1	-	no_errors	ENST00000355703	ensembl	human	known	74_37	missense	50.00	11	11	SNP	1.000	A
PCYT1B	9468	genome.wustl.edu	37	X	24597492	24597492	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:24597492C>A	ENST00000379144.2	-	6	779	c.649G>T	c.(649-651)Gcc>Tcc	p.A217S	PCYT1B_ENST00000356768.4_Missense_Mutation_p.A217S|PCYT1B_ENST00000379145.1_Missense_Mutation_p.A199S	NM_004845.4	NP_004836.2	Q9Y5K3	PCY1B_HUMAN	phosphate cytidylyltransferase 1, choline, beta	217					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|ovarian follicle development (GO:0001541)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	choline-phosphate cytidylyltransferase activity (GO:0004105)			breast(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	17					Choline(DB00122)	TTACGTCGGGCATAAACATCA	0.453																																																	0													284.0	203.0	230.0					X																	24597492		2203	4300	6503	SO:0001583	missense	0			AF052510	CCDS14213.1, CCDS55391.1, CCDS55392.1	Xp22	2008-02-05	2005-09-05		ENSG00000102230	ENSG00000102230	2.7.7.15		8755	protein-coding gene	gene with protein product		604926	"""phosphate cytidylyltransferase 1, choline, beta isoform"""			9593753	Standard	NM_004845		Approved	CCT-beta, CTB	uc004dbi.3	Q9Y5K3	OTTHUMG00000021270	ENST00000379144.2:c.649G>T	X.37:g.24597492C>A	ENSP00000368439:p.Ala217Ser		A8IX00|B2RCX8|B4DK10|E9PD84|O60621|Q86XC9	Missense_Mutation	SNP	pfam_Cyt_trans-like,tigrfam_Cyt_trans-like	p.A217S	ENST00000379144.2	37	c.649	CCDS14213.1	X	.	.	.	.	.	.	.	.	.	.	c	19.58	3.854774	0.71719	.	.	ENSG00000102230	ENST00000379145;ENST00000379144;ENST00000356768	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.46619	0.1402	L	0.29908	0.895	0.80722	D	1	B;B;B	0.33198	0.168;0.401;0.401	B;B;B	0.25506	0.061;0.048;0.048	T	0.52997	-0.8500	9	0.87932	D	0	-18.9325	17.745	0.88418	0.0:1.0:0.0:0.0	.	217;199;217	Q9Y5K3-2;E9PD84;Q9Y5K3	.;.;PCY1B_HUMAN	S	199;217;217	.	ENSP00000349211:A217S	A	-	1	0	PCYT1B	24507413	1.000000	0.71417	0.994000	0.49952	0.938000	0.57974	7.313000	0.78978	2.378000	0.81104	0.525000	0.51046	GCC	PCYT1B	-	NULL	ENSG00000102230		0.453	PCYT1B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYT1B	HGNC	protein_coding	OTTHUMT00000056103.1	-	0.00	51	0	C	NM_004845		24597492	-1	tier1	-	no_errors	ENST00000379144	ensembl	human	known	74_37	missense	59.38	26	38	SNP	1.000	A
PDCD6IP	10015	genome.wustl.edu	37	3	33868054	33868054	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:33868054C>T	ENST00000307296.3	+	6	1076	c.699C>T	c.(697-699)taC>taT	p.Y233Y	PDCD6IP_ENST00000457054.2_Silent_p.Y233Y			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	233	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.|Interaction with CHMP4A, CHMP4B and CHMP4C.|Interaction with EIAV p9.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						AGTGTCAATACAAAGATACTC	0.328																																																	0													116.0	110.0	112.0					3																	33868054		2203	4300	6503	SO:0001819	synonymous_variant	0			BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.699C>T	3.37:g.33868054C>T			C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Silent	SNP	pfam_BRO1_dom,pfscan_BRO1_dom	p.Y233	ENST00000307296.3	37	c.699	CCDS2660.1	3																																																																																			PDCD6IP	-	pfam_BRO1_dom,pfscan_BRO1_dom	ENSG00000170248		0.328	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PDCD6IP	HGNC	protein_coding	OTTHUMT00000253251.2	-	0.00	53	0	C			33868054	+1	tier1	-	no_errors	ENST00000457054	ensembl	human	known	74_37	silent	36.54	33	19	SNP	1.000	T
PDZRN4	29951	genome.wustl.edu	37	12	41831755	41831755	+	Intron	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:41831755C>A	ENST00000402685.2	+	4	851				PDZRN4_ENST00000539469.2_Nonsense_Mutation_p.C3*|RP11-413B19.2_ENST00000547168.1_RNA|PDZRN4_ENST00000298919.7_5'UTR	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4								ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				GAATGGGCTGCAATTTGTGCA	0.453																																																	0													193.0	196.0	195.0					12																	41831755		2203	4300	6503	SO:0001627	intron_variant	0			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.844-68503C>A	12.37:g.41831755C>A			Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Nonsense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.C3*	ENST00000402685.2	37	c.9	CCDS53777.1	12	.	.	.	.	.	.	.	.	.	.	C	38	6.876681	0.97904	.	.	ENSG00000165966	ENST00000539469	.	.	.	4.96	4.96	0.65561	.	0.574377	0.15138	N	0.278443	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.0953	0.93248	0.0:1.0:0.0:0.0	.	.	.	.	X	3	.	ENSP00000439990:C3X	C	+	3	2	PDZRN4	40118022	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.228000	0.78079	2.674000	0.91012	0.655000	0.94253	TGC	PDZRN4	-	NULL	ENSG00000165966		0.453	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN4	HGNC	protein_coding	OTTHUMT00000403701.1	-	0.00	80	0	C	NM_013377		41831755	+1	tier1	-	no_errors	ENST00000539469	ensembl	human	known	74_37	nonsense	27.08	35	13	SNP	1.000	A
PKHD1	5314	genome.wustl.edu	37	6	51777375	51777375	+	Splice_Site	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:51777375C>A	ENST00000371117.3	-	38	6397		c.e38-1		PKHD1_ENST00000340994.4_Splice_Site	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)						cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GGTAGTGAACCTAAAGCAGCC	0.398																																																	0													76.0	70.0	72.0					6																	51777375		2203	4300	6503	SO:0001630	splice_region_variant	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.6122-1G>T	6.37:g.51777375C>A			Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Splice_Site	SNP	-	e37-1	ENST00000371117.3	37	c.6122-1	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	C	19.11	3.764193	0.69878	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7685	0.78146	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PKHD1	51885334	1.000000	0.71417	0.999000	0.59377	0.819000	0.46315	3.854000	0.55949	2.800000	0.96347	0.591000	0.81541	.	PKHD1	-	-	ENSG00000170927		0.398	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1		0.00	49	0	C	NM_138694	Intron	51777375	-1			no_errors	ENST00000371117	ensembl	human	known	74_37	splice_site	31.03	20	9	SNP	1.000	A
PLCD4	84812	genome.wustl.edu	37	2	219500634	219500634	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:219500634C>T	ENST00000450993.2	+	14	2351	c.2012C>T	c.(2011-2013)aCc>aTc	p.T671I	PLCD4_ENST00000417849.1_Missense_Mutation_p.T671I|PLCD4_ENST00000432688.1_Missense_Mutation_p.T703I|RP11-548H3.1_ENST00000607946.1_RNA	NM_032726.3	NP_116115.1	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4	671	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosome reaction (GO:0007340)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|urinary_tract(3)	23		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CGGCAGGAGACCAACTATGTG	0.498																																																	0													74.0	76.0	75.0					2																	219500634		1983	4146	6129	SO:0001583	missense	0			AI366170	CCDS46516.1	2q35	2013-01-10			ENSG00000115556	ENSG00000115556	3.1.4.11	"""EF-hand domain containing"""	9062	protein-coding gene	gene with protein product		605939				10702683, 9056492	Standard	NM_032726		Approved		uc021vwx.1	Q9BRC7	OTTHUMG00000154743	ENST00000450993.2:c.2012C>T	2.37:g.219500634C>T	ENSP00000388631:p.Thr671Ile		Q53FS8	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_EF_hand_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.T671I	ENST00000450993.2	37	c.2012	CCDS46516.1	2	.	.	.	.	.	.	.	.	.	.	C	25.0	4.589750	0.86851	.	.	ENSG00000115556	ENST00000450993;ENST00000417849;ENST00000432688	T;T;T	0.48836	0.8;0.8;0.8	5.55	5.55	0.83447	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.81640	0.4865	H	0.98866	4.355	0.54753	D	0.999989	D	0.89917	1.0	D	0.97110	1.0	D	0.88281	0.2936	10	0.87932	D	0	.	16.0061	0.80363	0.0:0.8657:0.1343:0.0	.	671	Q9BRC7	PLCD4_HUMAN	I	671;671;703	ENSP00000388631:T671I;ENSP00000396942:T671I;ENSP00000396185:T703I	ENSP00000396942:T671I	T	+	2	0	PLCD4	219208878	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	5.762000	0.68809	2.894000	0.99253	0.655000	0.94253	ACC	PLCD4	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000115556		0.498	PLCD4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	PLCD4	HGNC	protein_coding	OTTHUMT00000336876.1	-	0.00	36	0	C			219500634	+1	tier1	-	no_errors	ENST00000417849	ensembl	human	known	74_37	missense	26.47	25	9	SNP	1.000	T
PLXDC1	57125	genome.wustl.edu	37	17	37243872	37243872	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:37243872T>C	ENST00000315392.4	-	8	1106	c.895A>G	c.(895-897)Acc>Gcc	p.T299A	PLXDC1_ENST00000444911.2_Missense_Mutation_p.T259A|PLXDC1_ENST00000493200.1_5'UTR|PLXDC1_ENST00000539608.1_Missense_Mutation_p.T226A|PLXDC1_ENST00000394316.2_Missense_Mutation_p.T299A	NM_020405.4	NP_065138.2	Q8IUK5	PLDX1_HUMAN	plexin domain containing 1	299					angiogenesis (GO:0001525)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)	receptor activity (GO:0004872)			kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						GGCAATGGGGTGAACTCCACG	0.557																																																	0													97.0	73.0	81.0					17																	37243872		2203	4300	6503	SO:0001583	missense	0			AF279144	CCDS11333.1	17q21.1	2006-04-12			ENSG00000161381	ENSG00000161381			20945	protein-coding gene	gene with protein product	"""tumor endothelial marker 7 precursor"""	606826				10947988, 11559528	Standard	NM_020405		Approved	TEM3, TEM7	uc002hrg.2	Q8IUK5	OTTHUMG00000133183	ENST00000315392.4:c.895A>G	17.37:g.37243872T>C	ENSP00000323927:p.Thr299Ala		B2R7I8|Q5QCZ7|Q5QCZ8|Q5QCZ9|Q9HCT9	Missense_Mutation	SNP	pfam_Plexin_repeat,superfamily_Plexin-like_fold	p.T299A	ENST00000315392.4	37	c.895	CCDS11333.1	17	.	.	.	.	.	.	.	.	.	.	T	13.29	2.194353	0.38806	.	.	ENSG00000161381	ENST00000315392;ENST00000394318;ENST00000539608;ENST00000444911;ENST00000394316	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	6.04	6.04	0.98038	.	0.171992	0.49916	D	0.000125	T	0.73442	0.3587	L	0.53729	1.69	0.39609	D	0.969852	B;B	0.14438	0.01;0.001	B;B	0.12156	0.007;0.001	T	0.70142	-0.4953	10	0.42905	T	0.14	-36.9684	12.9681	0.58497	0.0:0.0:0.0:1.0	.	259;299	B4E173;Q8IUK5	.;PXDC1_HUMAN	A	299;226;226;259;299	ENSP00000323927:T299A;ENSP00000441881:T226A;ENSP00000409687:T259A;ENSP00000377851:T299A	ENSP00000323927:T299A	T	-	1	0	PLXDC1	34497398	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	1.536000	0.36072	2.317000	0.78254	0.459000	0.35465	ACC	PLXDC1	-	superfamily_Plexin-like_fold	ENSG00000161381		0.557	PLXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXDC1	HGNC	protein_coding	OTTHUMT00000256892.2	-	0.00	42	0	T	NM_020405		37243872	-1	tier1	-	no_errors	ENST00000315392	ensembl	human	known	74_37	missense	25.00	33	11	SNP	1.000	C
PODN	127435	genome.wustl.edu	37	1	53544109	53544109	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:53544109C>A	ENST00000312553.5	+	8	1078	c.1071C>A	c.(1069-1071)cgC>cgA	p.R357R	PODN_ENST00000371500.3_Silent_p.R338R|RP11-334A14.5_ENST00000447867.1_RNA|PODN_ENST00000395871.2_Silent_p.R215R	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	309					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GGCTGCCGCGCAGCCTGGTGC	0.632																																																	0													61.0	65.0	64.0					1																	53544109		2203	4300	6503	SO:0001819	synonymous_variant	0			AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.1071C>A	1.37:g.53544109C>A			B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Silent	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.R357	ENST00000312553.5	37	c.1071	CCDS573.1	1																																																																																			PODN	-	smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	ENSG00000174348		0.632	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PODN	HGNC	protein_coding	OTTHUMT00000024735.1	-	0.00	68	0	C	NM_153703		53544109	+1	tier1	-	no_errors	ENST00000312553	ensembl	human	known	74_37	silent	37.21	27	16	SNP	0.987	A
POLE	5426	genome.wustl.edu	37	12	133219196	133219196	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:133219196C>T	ENST00000320574.5	-	37	4891	c.4848G>A	c.(4846-4848)aaG>aaA	p.K1616K	POLE_ENST00000434528.3_5'Flank|POLE_ENST00000535270.1_Silent_p.K1589K	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1616					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	CATAGTTGATCTTGTCAGCCA	0.577								DNA polymerases (catalytic subunits)																																									0													57.0	59.0	58.0					12																	133219196		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.4848G>A	12.37:g.133219196C>T			Q13533|Q86VH9	Silent	SNP	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.K1616	ENST00000320574.5	37	c.4848	CCDS9278.1	12																																																																																			POLE	-	pfam_DNA_pol_e_suA_C	ENSG00000177084		0.577	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	HGNC	protein_coding	OTTHUMT00000397689.2	-	0.00	30	0	C	NM_006231		133219196	-1	tier1	-	no_errors	ENST00000320574	ensembl	human	known	74_37	silent	48.39	16	15	SNP	0.929	T
PON3	5446	genome.wustl.edu	37	7	95024002	95024002	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:95024002T>G	ENST00000265627.5	-	2	109	c.99A>C	c.(97-99)gaA>gaC	p.E33D	PON3_ENST00000475439.1_5'UTR|PON1_ENST00000542556.1_Missense_Mutation_p.E33D|PON3_ENST00000451904.1_Missense_Mutation_p.E33D|PON3_ENST00000427422.1_Missense_Mutation_p.E33D	NM_000940.2	NP_000931.1	Q15166	PON3_HUMAN	paraoxonase 3	33					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|coumarin catabolic process (GO:0046226)|phenylacetate catabolic process (GO:0010124)|response to external stimulus (GO:0009605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	3,4-dihydrocoumarin hydrolase activity (GO:0018733)|aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|dihydrocoumarin hydrolase activity (GO:0047856)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	24	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)		Edetic Acid(DB00974)|Lovastatin(DB00227)	CTGGCTCCACTTCTCGAGAGG	0.448																																																	0													156.0	125.0	136.0					7																	95024002		2203	4300	6503	SO:0001583	missense	0			L48516, AF320003	CCDS5639.1	7q21.3	2014-03-14			ENSG00000105852	ENSG00000105852	3.1.1.2	"""Paraoxonases"""	9206	protein-coding gene	gene with protein product	"""arylesterase 3"""	602720				8661009	Standard	NM_000940		Approved			Q15166	OTTHUMG00000153917	ENST00000265627.5:c.99A>C	7.37:g.95024002T>G	ENSP00000265627:p.Glu33Asp		A4D1H8|O75855|O76060|Q6IRU9|Q8IX97|Q9BZH9	Missense_Mutation	SNP	pfam_Arylesterase,pfam_SGL,pfam_Strictosidine_synth_cons-reg,prints_Arylesterase,prints_Paraoxonase2,prints_Paraoxonase1	p.E33D	ENST00000265627.5	37	c.99	CCDS5639.1	7	.	.	.	.	.	.	.	.	.	.	T	12.59	1.983600	0.35036	.	.	ENSG00000005421;ENSG00000105852;ENSG00000105852	ENST00000542556;ENST00000265627;ENST00000427422	T;T;T	0.42513	0.97;0.97;0.97	4.75	2.28	0.28536	Six-bladed beta-propeller, TolB-like (1);	0.416142	0.27473	N	0.019213	T	0.42268	0.1195	M	0.83953	2.67	0.09310	N	0.999999	B;B;B	0.16166	0.016;0.01;0.002	B;B;B	0.17098	0.005;0.017;0.008	T	0.46707	-0.9172	10	0.72032	D	0.01	-10.283	5.4517	0.16568	0.1749:0.0:0.1828:0.6423	.	33;33;33	B4E2I0;F5H4W9;Q15166	.;.;PON3_HUMAN	D	33	ENSP00000444854:E33D;ENSP00000265627:E33D;ENSP00000413276:E33D	ENSP00000444854:E33D	E	-	3	2	PON1;PON3	94861938	0.003000	0.15002	0.523000	0.27875	0.008000	0.06430	0.015000	0.13355	0.380000	0.24823	-0.344000	0.07964	GAA	PON1	-	NULL	ENSG00000005421		0.448	PON3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PON1	HGNC	protein_coding	OTTHUMT00000333007.1	-	0.00	80	0	T	NM_000940		95024002	-1	tier1	-	no_errors	ENST00000542556	ensembl	human	known	74_37	missense	40.00	39	26	SNP	0.154	G
POTEG	404785	genome.wustl.edu	37	14	19563418	19563418	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr14:19563418T>G	ENST00000409832.3	+	5	984	c.932T>G	c.(931-933)cTt>cGt	p.L311R	RNU6-1239P_ENST00000391310.1_RNA|CTD-2311B13.5_ENST00000548748.1_lincRNA	NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	311										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						GCTCTCATACTTGCTGTATGT	0.368																																																	0													1.0	1.0	1.0					14																	19563418		323	625	948	SO:0001583	missense	0				CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.932T>G	14.37:g.19563418T>G	ENSP00000386971:p.Leu311Arg		A1L153|A6NMI9|Q6S5H6|Q6S8J2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L311R	ENST00000409832.3	37	c.932	CCDS32018.1	14	.	.	.	.	.	.	.	.	.	.	t	12.43	1.935540	0.34189	.	.	ENSG00000222036	ENST00000409832	T	0.67698	-0.28	1.09	1.09	0.20402	Ankyrin repeat-containing domain (4);	0.704021	0.10714	U	0.642572	T	0.74030	0.3663	L	0.59967	1.855	0.24954	N	0.99178	D	0.89917	1.0	D	0.91635	0.999	T	0.59010	-0.7534	10	0.66056	D	0.02	.	4.4331	0.11538	0.0:0.0:0.0:1.0	.	311	Q6S5H5	POTEG_HUMAN	R	311	ENSP00000386971:L311R	ENSP00000386971:L311R	L	+	2	0	POTEG	18633418	0.999000	0.42202	0.833000	0.33012	0.096000	0.18686	0.510000	0.22723	0.758000	0.33059	0.155000	0.16302	CTT	POTEG	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000222036		0.368	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEG	HGNC	protein_coding	OTTHUMT00000408579.1	-	0.00	166	0	T	NM_001005356		19563418	+1	tier1	-	no_errors	ENST00000409832	ensembl	human	known	74_37	missense	16.88	128	26	SNP	0.881	G
POU2AF1	5450	genome.wustl.edu	37	11	111229619	111229619	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:111229619G>T	ENST00000393067.3	-	2	555	c.41C>A	c.(40-42)gCc>gAc	p.A14D		NM_006235.2	NP_006226.2	Q16633	OBF1_HUMAN	POU class 2 associating factor 1	14					humoral immune response (GO:0006959)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			breast(1)|kidney(2)|lung(2)	5		all_cancers(61;1.36e-12)|all_epithelial(67;1.87e-07)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|all_neural(223;0.0146)|Medulloblastoma(222;0.0245)|Breast(348;0.0389)		Epithelial(105;1.01e-06)|BRCA - Breast invasive adenocarcinoma(274;3.12e-06)|all cancers(92;1.8e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0364)		CCGGGCCGGGGCTGGGGCTTG	0.637			T	BCL6	NHL																																			Dom	yes		11	11q23.1	5450	"""POU domain, class 2, associating factor 1 (OBF1)"""		L	0													48.0	48.0	48.0					11																	111229619		2201	4297	6498	SO:0001583	missense	0				CCDS31675.1	11q23.1	2011-06-01	2007-07-13			ENSG00000110777			9211	protein-coding gene	gene with protein product		601206	"""POU domain class 2, associating factor 1"""			8617501	Standard	NM_006235		Approved	OBF1	uc001plg.4	Q16633		ENST00000393067.3:c.41C>A	11.37:g.111229619G>T	ENSP00000376786:p.Ala14Asp		B2R8Z9|Q14983	Missense_Mutation	SNP	pfam_PD-C2-AF1	p.A14D	ENST00000393067.3	37	c.41	CCDS31675.1	11	.	.	.	.	.	.	.	.	.	.	G	17.47	3.398734	0.62177	.	.	ENSG00000110777	ENST00000393067;ENST00000531398	T;T	0.29655	1.56;1.56	4.47	2.51	0.30379	.	0.232106	0.33553	N	0.004790	T	0.36635	0.0974	L	0.50333	1.59	0.34697	D	0.726323	D	0.59767	0.986	P	0.54815	0.761	T	0.50759	-0.8790	10	0.54805	T	0.06	-2.0841	8.1114	0.30917	0.0883:0.1577:0.7539:0.0	.	14	Q16633	OBF1_HUMAN	D	14;16	ENSP00000376786:A14D;ENSP00000433527:A16D	ENSP00000376786:A14D	A	-	2	0	POU2AF1	110734829	1.000000	0.71417	0.950000	0.38849	0.671000	0.39405	4.057000	0.57455	1.086000	0.41228	0.305000	0.20034	GCC	POU2AF1	-	pfam_PD-C2-AF1	ENSG00000110777		0.637	POU2AF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU2AF1	HGNC	protein_coding	OTTHUMT00000391002.1	-	0.00	26	0	G	NM_006235		111229619	-1	tier1	-	no_errors	ENST00000393067	ensembl	human	known	74_37	missense	27.27	24	9	SNP	0.994	T
POU6F1	5463	genome.wustl.edu	37	12	51598016	51598016	+	5'UTR	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:51598016C>T	ENST00000389243.4	-	0	282				POU6F1_ENST00000547854.1_5'Flank			Q14863	PO6F1_HUMAN	POU class 6 homeobox 1						brain development (GO:0007420)|heart development (GO:0007507)|muscle organ development (GO:0007517)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	11						GCTTGACTGGCTTCAGCAGGG	0.632																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AL832881	CCDS31803.1	12q13.13	2011-06-20	2007-07-13			ENSG00000184271		"""Homeoboxes / POU class"""	9224	protein-coding gene	gene with protein product			"""POU domain, class 6, transcription factor 1"""			7908264	Standard	NM_002702		Approved	BRN5, MPOU, TCFB1	uc001rxz.3	Q14863		ENST00000389243.4:c.-658G>A	12.37:g.51598016C>T			Q15944|Q6DK47|Q7Z7P6	RNA	SNP	-	NULL	ENST00000389243.4	37	NULL	CCDS31803.1	12																																																																																			POU6F1	-	-	ENSG00000184271		0.632	POU6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU6F1	HGNC	protein_coding	OTTHUMT00000405126.1	-	0.00	25	0	C	NM_002702		51598016	-1	tier1	-	no_errors	ENST00000546685	ensembl	human	known	74_37	rna	25.00	21	7	SNP	0.989	T
PPL	5493	genome.wustl.edu	37	16	4934233	4934233	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:4934233G>T	ENST00000345988.2	-	22	4512	c.4423C>A	c.(4423-4425)Ctc>Atc	p.L1475I	PPL_ENST00000590782.2_Missense_Mutation_p.L1473I	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	1475					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						CCCTCCAGGAGCTGCCGCCGG	0.647																																																	0													39.0	38.0	38.0					16																	4934233		2186	4258	6444	SO:0001583	missense	0			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.4423C>A	16.37:g.4934233G>T	ENSP00000340510:p.Leu1475Ile		O60314|O60454|Q14C98	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.L1475I	ENST00000345988.2	37	c.4423	CCDS10526.1	16	.	.	.	.	.	.	.	.	.	.	G	3.618	-0.078070	0.07184	.	.	ENSG00000118898	ENST00000345988	T	0.41758	0.99	5.74	3.46	0.39613	.	0.481273	0.20174	N	0.097673	T	0.27629	0.0679	N	0.21448	0.665	0.35251	D	0.778688	B	0.09022	0.002	B	0.06405	0.002	T	0.26121	-1.0112	10	0.36615	T	0.2	.	10.125	0.42643	0.0:0.519:0.3853:0.0956	.	1475	O60437	PEPL_HUMAN	I	1475	ENSP00000340510:L1475I	ENSP00000340510:L1475I	L	-	1	0	PPL	4874234	0.996000	0.38824	1.000000	0.80357	0.550000	0.35303	1.558000	0.36309	1.450000	0.47717	0.591000	0.81541	CTC	PPL	-	NULL	ENSG00000118898		0.647	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPL	HGNC	protein_coding	OTTHUMT00000251715.1	-	0.00	44	0	G	NM_002705		4934233	-1	tier1	-	no_errors	ENST00000345988	ensembl	human	known	74_37	missense	36.11	23	13	SNP	0.978	T
PPP1R12C	54776	genome.wustl.edu	37	19	55606101	55606101	+	Missense_Mutation	SNP	G	G	A	rs34972456		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:55606101G>A	ENST00000263433.3	-	12	1535	c.1520C>T	c.(1519-1521)cCt>cTt	p.P507L	PPP1R12C_ENST00000435544.2_Missense_Mutation_p.P433L|PPP1R12C_ENST00000376393.2_Missense_Mutation_p.P507L	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C											central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		TGGGGATTCAGGCTCCGGAAT	0.617																																																	0													59.0	55.0	56.0					19																	55606101		2201	4298	6499	SO:0001583	missense	0			AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.1520C>T	19.37:g.55606101G>A	ENSP00000263433:p.Pro507Leu			Missense_Mutation	SNP	pirsf_Pase-1_reg_su_12A/B/C_euk,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P507L	ENST00000263433.3	37	c.1520	CCDS12916.1	19	.	.	.	.	.	.	.	.	.	.	G	14.78	2.638585	0.47153	.	.	ENSG00000125503	ENST00000263433;ENST00000376393;ENST00000435544	T;T;T	0.68624	-0.17;-0.2;-0.34	4.98	4.98	0.66077	.	1.637460	0.03846	N	0.271494	T	0.67468	0.2896	L	0.47716	1.5	0.20307	N	0.999914	B;P;B	0.39250	0.0;0.665;0.0	B;B;B	0.41088	0.002;0.347;0.001	T	0.56655	-0.7943	10	0.25751	T	0.34	.	14.108	0.65104	0.0:0.0:1.0:0.0	rs34972456	433;506;507	B4DME2;Q9BZL4-3;Q9BZL4	.;.;PP12C_HUMAN	L	507;507;433	ENSP00000263433:P507L;ENSP00000365573:P507L;ENSP00000387833:P433L	ENSP00000263433:P507L	P	-	2	0	PPP1R12C	60297913	0.924000	0.31332	0.022000	0.16811	0.027000	0.11550	2.012000	0.40932	2.486000	0.83907	0.561000	0.74099	CCT	PPP1R12C	-	pirsf_Pase-1_reg_su_12A/B/C_euk	ENSG00000125503		0.617	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R12C	HGNC	protein_coding	OTTHUMT00000451814.2	-	0.00	47	0	G	NM_017607		55606101	-1	tier1	rs34972456	no_errors	ENST00000263433	ensembl	human	known	74_37	missense	27.87	44	17	SNP	0.277	A
PPP1R26	9858	genome.wustl.edu	37	9	138377387	138377387	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr9:138377387C>T	ENST00000356818.2	+	4	1580	c.1031C>T	c.(1030-1032)gCa>gTa	p.A344V	PPP1R26_ENST00000605660.1_Missense_Mutation_p.A344V|PPP1R26_ENST00000605286.1_Missense_Mutation_p.A344V|PPP1R26_ENST00000604351.1_Missense_Mutation_p.A344V|PPP1R26_ENST00000401470.3_Missense_Mutation_p.A344V|PPP1R26_ENST00000602993.1_Intron	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	344					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										GCCAGCGCTGCAAGGAGGGGA	0.627																																																	0													54.0	62.0	59.0					9																	138377387		2203	4300	6503	SO:0001583	missense	0			AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.1031C>T	9.37:g.138377387C>T	ENSP00000349274:p.Ala344Val		Q86WU0|Q8WVV0|Q9Y4D3	Missense_Mutation	SNP	NULL	p.A344V	ENST00000356818.2	37	c.1031	CCDS6988.1	9	.	.	.	.	.	.	.	.	.	.	C	11.15	1.552821	0.27739	.	.	ENSG00000196422	ENST00000356818	T	0.10477	2.87	5.36	-0.543	0.11851	.	1.338270	0.04977	N	0.464915	T	0.07098	0.0180	N	0.22421	0.69	0.09310	N	1	B	0.21147	0.052	B	0.18561	0.022	T	0.40664	-0.9551	10	0.19590	T	0.45	-4.0138	5.4801	0.16719	0.0874:0.417:0.3794:0.1163	.	344	Q5T8A7	PPR26_HUMAN	V	344	ENSP00000349274:A344V	ENSP00000349274:A344V	A	+	2	0	KIAA0649	137517208	0.006000	0.16342	0.000000	0.03702	0.001000	0.01503	0.808000	0.27154	0.222000	0.20900	0.655000	0.94253	GCA	PPP1R26	-	NULL	ENSG00000196422		0.627	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R26	HGNC	protein_coding	OTTHUMT00000054987.1	-	0.00	73	0	C	NM_014811		138377387	+1	tier1	-	no_errors	ENST00000356818	ensembl	human	known	74_37	missense	27.63	55	21	SNP	0.000	T
PPP1R26	9858	genome.wustl.edu	37	9	138378132	138378132	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr9:138378132C>A	ENST00000356818.2	+	4	2325	c.1776C>A	c.(1774-1776)tgC>tgA	p.C592*	PPP1R26_ENST00000605660.1_Nonsense_Mutation_p.C592*|PPP1R26_ENST00000605286.1_Nonsense_Mutation_p.C592*|PPP1R26_ENST00000604351.1_Nonsense_Mutation_p.C592*|PPP1R26_ENST00000401470.3_Nonsense_Mutation_p.C592*|PPP1R26_ENST00000602993.1_Intron	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	592					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										TGCTGGGCTGCAAAAGGAAGC	0.617																																																	0													49.0	54.0	53.0					9																	138378132		2203	4299	6502	SO:0001587	stop_gained	0			AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.1776C>A	9.37:g.138378132C>A	ENSP00000349274:p.Cys592*		Q86WU0|Q8WVV0|Q9Y4D3	Nonsense_Mutation	SNP	NULL	p.C592*	ENST00000356818.2	37	c.1776	CCDS6988.1	9	.	.	.	.	.	.	.	.	.	.	C	40	8.220482	0.98712	.	.	ENSG00000196422	ENST00000356818	.	.	.	5.55	3.72	0.42706	.	0.520882	0.21834	N	0.068424	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	-13.0469	5.0014	0.14266	0.0:0.5531:0.1441:0.3027	.	.	.	.	X	592	.	ENSP00000349274:C592X	C	+	3	2	KIAA0649	137517953	0.969000	0.33509	0.467000	0.27180	0.021000	0.10359	0.299000	0.19138	0.706000	0.31912	-0.258000	0.10820	TGC	PPP1R26	-	NULL	ENSG00000196422		0.617	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R26	HGNC	protein_coding	OTTHUMT00000054987.1	-	0.00	37	0	C	NM_014811		138378132	+1	tier1	-	no_errors	ENST00000356818	ensembl	human	known	74_37	nonsense	21.88	25	7	SNP	0.780	A
PRAMEF2	65122	genome.wustl.edu	37	1	12920049	12920049	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:12920049C>A	ENST00000240189.2	+	3	876	c.789C>A	c.(787-789)ttC>ttA	p.F263L		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	263					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCTCTGTGTTCCTCAGGCTGG	0.453																																																	0																																										SO:0001583	missense	0				CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.789C>A	1.37:g.12920049C>A	ENSP00000240189:p.Phe263Leu			Missense_Mutation	SNP	NULL	p.F263L	ENST00000240189.2	37	c.789	CCDS149.1	1	.	.	.	.	.	.	.	.	.	.	C	8.667	0.901811	0.17760	.	.	ENSG00000120952	ENST00000240189	T	0.00724	5.78	0.842	0.842	0.18927	.	0.511690	0.19863	N	0.104382	T	0.00906	0.0030	L	0.50993	1.605	0.09310	N	1	B	0.31413	0.322	B	0.35312	0.2	T	0.46707	-0.9172	10	0.25106	T	0.35	.	5.0452	0.14480	0.0:1.0:0.0:0.0	.	263	O60811	PRAM2_HUMAN	L	263	ENSP00000240189:F263L	ENSP00000240189:F263L	F	+	3	2	PRAMEF2	12842636	0.012000	0.17670	0.030000	0.17652	0.034000	0.12701	-0.020000	0.12525	0.759000	0.33084	0.194000	0.17425	TTC	PRAMEF2	-	NULL	ENSG00000120952		0.453	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF2	HGNC	protein_coding	OTTHUMT00000005517.1	-	0.00	65	0	C	NM_023014		12920049	+1	tier1	-	no_errors	ENST00000240189	ensembl	human	known	74_37	missense	30.43	32	14	SNP	0.037	A
PRCP	5547	genome.wustl.edu	37	11	82611355	82611355	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:82611355G>T	ENST00000313010.3	-	1	284	c.90C>A	c.(88-90)ggC>ggA	p.G30G	PRCP_ENST00000393399.2_Silent_p.G30G|C11orf82_ENST00000533655.1_5'Flank|PRCP_ENST00000535099.1_Intron|C11orf82_ENST00000525388.1_5'Flank|C11orf82_ENST00000524921.1_5'Flank|C11orf82_ENST00000528759.1_5'Flank|C11orf82_ENST00000430323.2_5'Flank|C11orf82_ENST00000525361.1_5'Flank	NM_005040.2	NP_005031.1	P42785	PCP_HUMAN	prolylcarboxypeptidase (angiotensinase C)	30					angiogenesis involved in wound healing (GO:0060055)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|energy homeostasis (GO:0097009)|glucose homeostasis (GO:0042593)|negative regulation of systemic arterial blood pressure (GO:0003085)|plasma kallikrein-kinin cascade (GO:0002353)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)	basal part of cell (GO:0045178)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						AGTGTAGGCTGCCGAGGGCCC	0.637																																																	0													66.0	74.0	71.0					11																	82611355		2203	4300	6503	SO:0001819	synonymous_variant	0			BC001500, BI827978, L13977	CCDS8262.1, CCDS41695.1	11q14	2005-10-04				ENSG00000137509			9344	protein-coding gene	gene with protein product		176785				8344943	Standard	NM_199418		Approved	PCP, HUMPCP	uc001ozr.3	P42785		ENST00000313010.3:c.90C>A	11.37:g.82611355G>T			A8MU24|B2R7B7|B3KRK5|B5BU34	Silent	SNP	pfam_Peptidase_S28	p.G30	ENST00000313010.3	37	c.90	CCDS8262.1	11																																																																																			PRCP	-	NULL	ENSG00000137509		0.637	PRCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRCP	HGNC	protein_coding	OTTHUMT00000391792.1	-	0.00	69	0	G	NM_005040		82611355	-1	tier1	-	no_errors	ENST00000393399	ensembl	human	known	74_37	silent	40.30	40	27	SNP	0.027	T
PRELP	5549	genome.wustl.edu	37	1	203452624	203452624	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:203452624C>A	ENST00000343110.2	+	2	439	c.312C>A	c.(310-312)atC>atA	p.I104I		NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	P51888	PRELP_HUMAN	proline/arginine-rich end leucine-rich repeat protein	104					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			BRCA - Breast invasive adenocarcinoma(75;0.109)			CGCCCCGCATCCATTACCTCT	0.562																																																	0													88.0	87.0	87.0					1																	203452624		2203	4300	6503	SO:0001819	synonymous_variant	0			BC032498	CCDS1438.1	1q32	2008-02-05	2005-07-24		ENSG00000188783	ENSG00000188783		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	9357	protein-coding gene	gene with protein product	"""prolargin proteoglycan"""	601914	"""proline arginine-rich end leucine-rich repeat protein"""				Standard	NM_002725		Approved	SLRR2A, prolargin	uc001gzt.3	P51888	OTTHUMG00000035911	ENST00000343110.2:c.312C>A	1.37:g.203452624C>A			Q6FG38	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.I104	ENST00000343110.2	37	c.312	CCDS1438.1	1																																																																																			PRELP	-	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	ENSG00000188783		0.562	PRELP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRELP	HGNC	protein_coding	OTTHUMT00000087474.1	-	0.00	86	0	C	NM_002725		203452624	+1	tier1	-	no_errors	ENST00000343110	ensembl	human	known	74_37	silent	38.60	35	22	SNP	1.000	A
PRR14L	253143	genome.wustl.edu	37	22	32110194	32110194	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr22:32110194C>A	ENST00000327423.6	-	4	3820	c.3631G>T	c.(3631-3633)Gaa>Taa	p.E1211*	PRR14L_ENST00000397493.2_Nonsense_Mutation_p.E1211*|PRR14L_ENST00000434485.1_Nonsense_Mutation_p.E1211*|PRR14L_ENST00000461722.1_5'Flank	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	1211										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						AAGGTACTTTCTTTGCCAAAC	0.393											OREG0003535	type=REGULATORY REGION|Gene=AK130944|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													231.0	174.0	191.0					22																	32110194		692	1591	2283	SO:0001587	stop_gained	0			BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.3631G>T	22.37:g.32110194C>A	ENSP00000331845:p.Glu1211*	829	Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Nonsense_Mutation	SNP	NULL	p.E1211*	ENST00000327423.6	37	c.3631	CCDS13900.2	22	.	.	.	.	.	.	.	.	.	.	C	40	8.162149	0.98683	.	.	ENSG00000183530	ENST00000397493;ENST00000327423;ENST00000434485	.	.	.	5.63	2.41	0.29592	.	0.237224	0.29152	N	0.012983	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.7408	8.402	0.32592	0.0:0.7621:0.0:0.2379	.	.	.	.	X	1211	.	.	E	-	1	0	PRR14L	30440194	0.000000	0.05858	0.069000	0.20011	0.099000	0.18886	0.245000	0.18142	0.320000	0.23234	0.650000	0.86243	GAA	PRR14L	-	NULL	ENSG00000183530		0.393	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR14L	HGNC	protein_coding	OTTHUMT00000074993.2	-	0.00	44	0	C	NM_173566		32110194	-1	tier1	-	no_errors	ENST00000397493	ensembl	human	known	74_37	nonsense	20.93	34	9	SNP	0.095	A
PRRC2A	7916	genome.wustl.edu	37	6	31600164	31600164	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:31600164G>T	ENST00000376033.2	+	16	3948	c.3714G>T	c.(3712-3714)gaG>gaT	p.E1238D	PRRC2A_ENST00000376007.4_Missense_Mutation_p.E1238D	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1238	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						AAGATGGGGAGCGACCCCGAA	0.612																																																	0													64.0	65.0	64.0					6																	31600164		1511	2709	4220	SO:0001583	missense	0			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.3714G>T	6.37:g.31600164G>T	ENSP00000365201:p.Glu1238Asp		B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	pfam_BAT2_N	p.E1238D	ENST00000376033.2	37	c.3714	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	G	10.61	1.399016	0.25291	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.02552	4.25;4.25	5.26	0.3	0.15776	.	0.000000	0.56097	D	0.000023	T	0.01061	0.0035	L	0.43152	1.355	0.34353	D	0.690118	P	0.43788	0.817	B	0.36244	0.22	T	0.57997	-0.7714	10	0.87932	D	0	-18.5967	9.1361	0.36875	0.3983:0.0:0.6017:0.0	.	1238	P48634	PRC2A_HUMAN	D	1232;1221;1238;1238;463	ENSP00000365175:E1238D;ENSP00000365201:E1238D	ENSP00000365175:E1238D	E	+	3	2	PRRC2A	31708143	0.504000	0.26123	0.993000	0.49108	0.965000	0.64279	0.071000	0.14594	-0.138000	0.11434	0.655000	0.94253	GAG	PRRC2A	-	NULL	ENSG00000204469		0.612	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2A	HGNC	protein_coding	OTTHUMT00000259319.1	-	0.00	33	0	G	NM_080686		31600164	+1	tier1	-	no_errors	ENST00000376007	ensembl	human	known	74_37	missense	37.50	10	6	SNP	0.997	T
PRSS12	8492	genome.wustl.edu	37	4	119219952	119219952	+	Missense_Mutation	SNP	G	G	T	rs34131974	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr4:119219952G>T	ENST00000296498.3	-	9	2055	c.1773C>A	c.(1771-1773)caC>caA	p.H591Q	PRSS12_ENST00000510903.1_5'Flank	NM_003619.3	NP_003610.2	P56730	NETR_HUMAN	protease, serine, 12 (neurotrypsin, motopsin)	591	SRCR 4. {ECO:0000255|PROSITE- ProRule:PRU00196}.				exocytosis (GO:0006887)|zymogen activation (GO:0031638)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)|terminal bouton (GO:0043195)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(3)|kidney(1)|large_intestine(9)|lung(11)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	29						CATCTTCACTGTGGCGGCAGT	0.443																																																	0													152.0	138.0	143.0					4																	119219952		2203	4300	6503	SO:0001583	missense	0			AJ001531	CCDS3709.1	4q25-q26	2010-05-07			ENSG00000164099	ENSG00000164099		"""Serine peptidases / Serine peptidases"""	9477	protein-coding gene	gene with protein product		606709				9540828, 9245503	Standard	NM_003619		Approved	BSSP-3, MRT1	uc003ica.2	P56730	OTTHUMG00000161166	ENST00000296498.3:c.1773C>A	4.37:g.119219952G>T	ENSP00000296498:p.His591Gln		Q9UP16	Missense_Mutation	SNP	pfam_SRCR,pfam_Peptidase_S1,pfam_Kringle,superfamily_Trypsin-like_Pept_dom,superfamily_Srcr_rcpt-rel,superfamily_Kringle-like,smart_Kringle,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_Kringle,pfscan_SRCR,pfscan_Peptidase_S1,prints_SRCR,prints_Peptidase_S1A	p.H591Q	ENST00000296498.3	37	c.1773	CCDS3709.1	4	.	.	.	.	.	.	.	.	.	.	G	17.80	3.477669	0.63849	.	.	ENSG00000164099	ENST00000296498	T	0.33654	1.4	5.46	3.4	0.38934	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.043726	0.85682	D	0.000000	T	0.73916	0.3648	H	0.98802	4.335	0.42906	D	0.994248	D	0.89917	1.0	D	0.97110	1.0	D	0.84493	0.0612	10	0.87932	D	0	.	12.974	0.58527	0.1548:0.0:0.8452:0.0	.	591	P56730	NETR_HUMAN	Q	591	ENSP00000296498:H591Q	ENSP00000296498:H591Q	H	-	3	2	PRSS12	119439400	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.623000	0.46435	1.311000	0.45024	0.591000	0.81541	CAC	PRSS12	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000164099		0.443	PRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS12	HGNC	protein_coding	OTTHUMT00000256516.2	-	0.00	99	0	G			119219952	-1	tier1	-	no_errors	ENST00000296498	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
PRTG	283659	genome.wustl.edu	37	15	56032809	56032809	+	Silent	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr15:56032809G>A	ENST00000561292.1	-	2	326	c.168C>T	c.(166-168)gtC>gtT	p.V56V	PRTG_ENST00000389286.4_Silent_p.V56V					protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		AATCTAAAACGACTGGGTCCT	0.408																																																	0													103.0	99.0	100.0					15																	56032809		1840	4087	5927	SO:0001819	synonymous_variant	0			AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000561292.1:c.168C>T	15.37:g.56032809G>A				Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V56	ENST00000561292.1	37	c.168		15																																																																																			PRTG	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000166450		0.408	PRTG-004	PUTATIVE	basic|exp_conf	protein_coding	PRTG	HGNC	protein_coding	OTTHUMT00000419360.1	-	0.00	72	0	G	NM_173814		56032809	-1	tier1	-	no_errors	ENST00000389286	ensembl	human	known	74_37	silent	23.81	32	10	SNP	0.470	A
PSMD12	5718	genome.wustl.edu	37	17	65337107	65337107	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:65337107C>A	ENST00000356126.3	-	11	1330	c.1223G>T	c.(1222-1224)aGa>aTa	p.R408I	PSMD12_ENST00000357146.4_Missense_Mutation_p.R388I	NM_002816.3	NP_002807.1	O00232	PSD12_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 12	408	PCI.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|large_intestine(4)|lung(6)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)					TCCTGCTAATCTGTCTACTTT	0.358																																																	0													85.0	86.0	86.0					17																	65337107		2203	4299	6502	SO:0001583	missense	0			AB003103	CCDS11669.1, CCDS11670.1	17q24.3	2008-05-22			ENSG00000197170	ENSG00000197170		"""Proteasome (prosome, macropain) subunits"""	9557	protein-coding gene	gene with protein product		604450				9426256	Standard	NM_002816		Approved	p55, Rpn5	uc002jfy.3	O00232	OTTHUMG00000140376	ENST00000356126.3:c.1223G>T	17.37:g.65337107C>A	ENSP00000348442:p.Arg408Ile		A6NP15|Q53HA2|Q6P053	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.R408I	ENST00000356126.3	37	c.1223	CCDS11669.1	17	.	.	.	.	.	.	.	.	.	.	C	28.0	4.882098	0.91740	.	.	ENSG00000197170	ENST00000356126;ENST00000357146	T;T	0.32753	1.44;1.44	4.81	4.81	0.61882	Winged helix-turn-helix transcription repressor DNA-binding (1);Proteasome component (PCI) domain (2);	0.000000	0.85682	D	0.000000	T	0.67841	0.2936	H	0.94582	3.555	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79405	-0.1817	10	0.87932	D	0	-16.2217	17.8938	0.88880	0.0:1.0:0.0:0.0	.	388;408	A6NP15;O00232	.;PSD12_HUMAN	I	408;388	ENSP00000348442:R408I;ENSP00000349667:R388I	ENSP00000348442:R408I	R	-	2	0	PSMD12	62767569	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.720000	0.68470	2.226000	0.72624	0.484000	0.47621	AGA	PSMD12	-	pfam_PCI_dom,smart_PCI_dom	ENSG00000197170		0.358	PSMD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD12	HGNC	protein_coding	OTTHUMT00000277103.1	-	0.00	79	0	C	NM_002816, NM_174871		65337107	-1	tier1	-	no_errors	ENST00000356126	ensembl	human	known	74_37	missense	8.62	52	5	SNP	1.000	A
PSTK	118672	genome.wustl.edu	37	10	124742964	124742964	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr10:124742964C>A	ENST00000368887.3	+	3	1125	c.685C>A	c.(685-687)Cca>Aca	p.P229T	PSTK_ENST00000405485.1_Missense_Mutation_p.P229T|PSTK_ENST00000497219.1_3'UTR	NM_153336.2	NP_699167.2	Q8IV42	PSTK_HUMAN	phosphoseryl-tRNA kinase	229					selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|tRNA binding (GO:0000049)			endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|skin(1)|stomach(2)	13		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0725)		AATTCCGAGTCCAGCATGTGC	0.517																																																	0													71.0	74.0	73.0					10																	124742964		2203	4300	6503	SO:0001583	missense	0			AK127173	CCDS7633.1	10q26.13	2007-04-17	2007-04-17	2007-04-17	ENSG00000179988	ENSG00000179988			28578	protein-coding gene	gene with protein product		611310	"""chromosome 10 open reading frame 89"""	C10orf89		15317934	Standard	NM_153336		Approved	MGC35392	uc001lgy.1	Q8IV42	OTTHUMG00000019191	ENST00000368887.3:c.685C>A	10.37:g.124742964C>A	ENSP00000357882:p.Pro229Thr		Q6ZSS9	Missense_Mutation	SNP	pfam_Chromatin_KTI12,superfamily_P-loop_NTPase,tigrfam_L-seryl-tRNA_Sec_kinase_euk	p.P229T	ENST00000368887.3	37	c.685	CCDS7633.1	10	.	.	.	.	.	.	.	.	.	.	C	1.384	-0.582680	0.03827	.	.	ENSG00000179988	ENST00000368887;ENST00000405485	T;T	0.42900	1.09;0.96	6.04	-1.39	0.08997	.	0.956526	0.08732	N	0.901914	T	0.17959	0.0431	N	0.13043	0.29	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.25398	-1.0133	10	0.12103	T	0.63	-8.9023	1.0642	0.01607	0.4407:0.2074:0.1115:0.2405	.	229	Q8IV42	PSTK_HUMAN	T	229	ENSP00000357882:P229T;ENSP00000384764:P229T	ENSP00000357882:P229T	P	+	1	0	PSTK	124732954	0.000000	0.05858	0.051000	0.19133	0.155000	0.21991	-1.519000	0.02243	0.049000	0.15920	0.563000	0.77884	CCA	PSTK	-	pfam_Chromatin_KTI12,tigrfam_L-seryl-tRNA_Sec_kinase_euk	ENSG00000179988		0.517	PSTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSTK	HGNC	protein_coding	OTTHUMT00000050811.1	-	0.00	45	0	C	NM_153336		124742964	+1	tier1	-	no_errors	ENST00000368887	ensembl	human	known	74_37	missense	12.90	27	4	SNP	0.018	A
PTK2B	2185	genome.wustl.edu	37	8	27308400	27308400	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr8:27308400G>T	ENST00000397501.1	+	30	3283	c.2475G>T	c.(2473-2475)gaG>gaT	p.E825D	PTK2B_ENST00000346049.5_Missense_Mutation_p.E825D|PTK2B_ENST00000338238.4_Missense_Mutation_p.E783D|PTK2B_ENST00000420218.2_Missense_Mutation_p.E783D|PTK2B_ENST00000517339.1_Missense_Mutation_p.E783D|PTK2B_ENST00000397497.4_Missense_Mutation_p.E529D|PTK2B_ENST00000544172.1_Missense_Mutation_p.E825D	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	825	Interaction with TGFB1I1. {ECO:0000250}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	TCAGGCAGGAGGAGAAGTCCC	0.607																																																	0													96.0	85.0	89.0					8																	27308400		2203	4300	6503	SO:0001583	missense	0			U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.2475G>T	8.37:g.27308400G>T	ENSP00000380638:p.Glu825Asp		D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Focal_adhesion_kin_target_dom,pfam_Prot_kinase_dom,pfam_FERM_central,superfamily_Kinase-like_dom,superfamily_Focal_adhesion_kin_target_dom,superfamily_FERM_central,smart_Band_41_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E825D	ENST00000397501.1	37	c.2475	CCDS6057.1	8	.	.	.	.	.	.	.	.	.	.	G	31	5.097487	0.94197	.	.	ENSG00000120899	ENST00000397501;ENST00000338238;ENST00000544172;ENST00000346049;ENST00000420218;ENST00000517339;ENST00000397497	T;T;T;T;T;T;T	0.80123	-1.34;-1.19;-1.34;-1.34;-1.19;-1.19;-1.11	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.89791	0.6817	M	0.77103	2.36	0.80722	D	1	D;P	0.89917	1.0;0.861	D;P	0.91635	0.999;0.533	D	0.90488	0.4465	10	0.66056	D	0.02	.	17.0295	0.86457	0.0:0.0:1.0:0.0	.	783;825	Q14289-2;Q14289	.;FAK2_HUMAN	D	825;783;825;825;783;783;529	ENSP00000380638:E825D;ENSP00000342242:E783D;ENSP00000440926:E825D;ENSP00000332816:E825D;ENSP00000391995:E783D;ENSP00000427931:E783D;ENSP00000380634:E529D	ENSP00000342242:E783D	E	+	3	2	PTK2B	27364317	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.033000	0.49743	2.609000	0.88269	0.655000	0.94253	GAG	PTK2B	-	NULL	ENSG00000120899		0.607	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTK2B	HGNC	protein_coding	OTTHUMT00000219916.1	-	0.00	50	0	G	NM_004103		27308400	+1	tier1	-	no_errors	ENST00000346049	ensembl	human	known	74_37	missense	40.54	22	15	SNP	1.000	T
PTPN3	5774	genome.wustl.edu	37	9	112172566	112172566	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr9:112172566G>T	ENST00000374541.2	-	15	1547	c.1443C>A	c.(1441-1443)ttC>ttA	p.F481L	PTPN3_ENST00000412145.1_Missense_Mutation_p.F350L|PTPN3_ENST00000262539.3_Missense_Mutation_p.F327L|PTPN3_ENST00000394827.3_5'UTR|PTPN3_ENST00000446349.1_Missense_Mutation_p.F305L	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	481					negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						TCACCCTGTGGAAGTCATCTA	0.587																																																	0													90.0	95.0	93.0					9																	112172566		2203	4300	6503	SO:0001583	missense	0				CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.1443C>A	9.37:g.112172566G>T	ENSP00000363667:p.Phe481Leu		A0AUW9|E7EN99|E9PGU7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_PDZ,pfam_Dual-sp_phosphatase_cat-dom,superfamily_FERM_central,superfamily_PDZ,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-3/4,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,prints_Ez/rad/moesin_like,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.F481L	ENST00000374541.2	37	c.1443	CCDS6776.1	9	.	.	.	.	.	.	.	.	.	.	G	12.50	1.955908	0.34471	.	.	ENSG00000070159	ENST00000394831;ENST00000412145;ENST00000446349;ENST00000374541;ENST00000262539	T;T;T;T	0.69435	-0.27;-0.28;-0.4;-0.22	5.67	3.48	0.39840	.	0.670897	0.15576	N	0.255176	T	0.38506	0.1043	N	0.08118	0	0.80722	D	1	B;B;B	0.15719	0.014;0.0;0.0	B;B;B	0.12837	0.008;0.001;0.007	T	0.17048	-1.0382	10	0.11485	T	0.65	.	4.6915	0.12783	0.208:0.2159:0.5761:0.0	.	327;436;481	B7Z3H5;B7Z9V1;P26045	.;.;PTN3_HUMAN	L	481;350;305;481;327	ENSP00000416654:F350L;ENSP00000395384:F305L;ENSP00000363667:F481L;ENSP00000262539:F327L	ENSP00000262539:F327L	F	-	3	2	PTPN3	111212387	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	1.053000	0.30442	1.381000	0.46364	0.563000	0.77884	TTC	PTPN3	-	pirsf_Tyr_Pase_non-rcpt_typ-3/4	ENSG00000070159		0.587	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN3	HGNC	protein_coding	OTTHUMT00000053598.4	-	0.00	58	0	G			112172566	-1	tier1	-	no_errors	ENST00000374541	ensembl	human	known	74_37	missense	20.51	31	8	SNP	0.997	T
PTPRN2	5799	genome.wustl.edu	37	7	157926523	157926523	+	Missense_Mutation	SNP	C	C	T	rs151334443		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:157926523C>T	ENST00000389418.4	-	9	1411	c.1402G>A	c.(1402-1404)Gct>Act	p.A468T	PTPRN2_ENST00000409483.1_Missense_Mutation_p.A430T|PTPRN2_ENST00000404321.2_Missense_Mutation_p.A491T|PTPRN2_ENST00000389416.4_Missense_Mutation_p.A451T|PTPRN2_ENST00000389413.3_Missense_Mutation_p.A468T	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	468					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A468P(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CCAAACGCAGCGGCCCCGGGC	0.627													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16373	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	lung(1)							THR/ALA,THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	43.0	49.0	47.0		1402,1351,1402	-1.6	0.0	7	dbSNP_134	47	0,8600		0,0,4300	no	missense,missense,missense	PTPRN2	NM_002847.3,NM_130842.2,NM_130843.2	58,58,58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign,benign	468/1016,451/999,468/987	157926523	1,13005	2203	4300	6503	SO:0001583	missense	0			AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.1402G>A	7.37:g.157926523C>T	ENSP00000374069:p.Ala468Thr		E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.A491T	ENST00000389418.4	37	c.1471	CCDS5947.1	7	.	.	.	.	.	.	.	.	.	.	C	9.602	1.128916	0.21041	2.27E-4	0.0	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	T;T;T;T;T	0.02837	4.14;4.14;4.15;4.14;4.14	3.87	-1.56	0.08532	.	2.359550	0.02623	U	0.103452	T	0.01730	0.0055	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.23316	0.043;0.05;0.083;0.05;0.05	B;B;B;B;B	0.14578	0.007;0.005;0.011;0.005;0.005	T	0.44034	-0.9354	10	0.23891	T	0.37	.	4.508	0.11898	0.1543:0.3688:0.0:0.4768	.	491;430;468;451;468	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	T	430;468;451;468;491	ENSP00000387114:A430T;ENSP00000374064:A468T;ENSP00000374067:A451T;ENSP00000374069:A468T;ENSP00000385464:A491T	ENSP00000374064:A468T	A	-	1	0	PTPRN2	157619284	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.779000	0.04659	-0.337000	0.08426	0.585000	0.79938	GCT	PTPRN2	-	NULL	ENSG00000155093		0.627	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTPRN2	HGNC	protein_coding	OTTHUMT00000353214.1		0.00	42	0	C			157926523	-1			no_errors	ENST00000404321	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.000	T
PWP2	5822	genome.wustl.edu	37	21	45528948	45528948	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr21:45528948C>A	ENST00000291576.7	+	2	229	c.102C>A	c.(100-102)ggC>ggA	p.G34G		NM_005049.2	NP_005040.2	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog (yeast)	34					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(6)|large_intestine(6)|lung(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	21				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		GTCCCGTGGGCAATAGAGTCA	0.353																																																	0													111.0	93.0	99.0					21																	45528948		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33579.1	21q22.3	2013-01-10	2001-11-28	2006-11-24	ENSG00000241945	ENSG00000241945		"""WD repeat domain containing"""	9711	protein-coding gene	gene with protein product		601475	"""PWP2 (periodic tryptophan protein, yeast) homolog"""	PWP2H		8893822	Standard	NM_005049		Approved	EHOC-17, UTP1	uc002zeb.3	Q15269	OTTHUMG00000086893	ENST00000291576.7:c.102C>A	21.37:g.45528948C>A			B2RAG8|Q96A77	Silent	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G34	ENST00000291576.7	37	c.102	CCDS33579.1	21																																																																																			PWP2	-	superfamily_Quinonprotein_ADH-like_supfam	ENSG00000241945		0.353	PWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PWP2	HGNC	protein_coding	OTTHUMT00000195736.3	-	0.00	45	0	C	NM_005049		45528948	+1	tier1	-	no_errors	ENST00000291576	ensembl	human	known	74_37	silent	26.32	14	5	SNP	0.970	A
R3HCC1	203069	genome.wustl.edu	37	8	23147887	23147887	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr8:23147887delA	ENST00000411463.1	+	5	877	c.877delA	c.(877-879)aggfs	p.R293fs	R3HCC1_ENST00000265806.6_Frame_Shift_Del_p.R66fs|R3HCC1_ENST00000522012.1_3'UTR|R3HCC1_ENST00000518454.1_Frame_Shift_Del_p.R66fs			Q9Y3T6	R3HC1_HUMAN	R3H domain and coiled-coil containing 1	293							nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)			central_nervous_system(1)|skin(2)	3						GTTGGAGAAGAGGCTGGTGGC	0.587																																																	0													108.0	120.0	116.0					8																	23147887		692	1591	2283	SO:0001589	frameshift_variant	0				CCDS47826.1	8p21.3	2012-05-23		2005-11-20	ENSG00000104679	ENSG00000104679			27329	protein-coding gene	gene with protein product						12477932	Standard	XM_005273427		Approved	DKFZp564N123	uc003xdf.3	Q9Y3T6	OTTHUMG00000163786	ENST00000411463.1:c.877delA	8.37:g.23147887delA	ENSP00000397555:p.Arg293fs		B7ZLI1	Frame_Shift_Del	DEL	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.R293fs	ENST00000411463.1	37	c.877		8																																																																																			R3HCC1	-	NULL	ENSG00000104679		0.587	R3HCC1-201	KNOWN	basic|appris_principal	protein_coding	R3HCC1	HGNC	protein_coding			0.00	43	0	A	NM_001136108		23147887	+1	tier1		no_errors	ENST00000411463	ensembl	human	known	74_37	frame_shift_del	15.38	11	2	DEL	0.270	-
R3HCC1L	27291	genome.wustl.edu	37	10	99968528	99968528	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr10:99968528G>T	ENST00000298999.3	+	5	960	c.657G>T	c.(655-657)gaG>gaT	p.E219D	R3HCC1L_ENST00000370586.2_Intron|R3HCC1L_ENST00000370584.3_Missense_Mutation_p.E219D|R3HCC1L_ENST00000314594.5_5'UTR	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	219							nucleotide binding (GO:0000166)	p.E219E(1)									TACTATATGAGTTTCCTAGAG	0.363																																																	1	Substitution - coding silent(1)	large_intestine(1)											57.0	60.0	59.0					10																	99968528		2203	4300	6503	SO:0001583	missense	0			AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.657G>T	10.37:g.99968528G>T	ENSP00000298999:p.Glu219Asp		O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	NULL	p.E219D	ENST00000298999.3	37	c.657	CCDS31267.1	10	.	.	.	.	.	.	.	.	.	.	G	0.117	-1.130440	0.01756	.	.	ENSG00000166024	ENST00000370584;ENST00000538495;ENST00000298999	T;T	0.06608	3.28;3.28	5.42	1.42	0.22433	.	0.840638	0.10317	N	0.689171	T	0.04952	0.0133	L	0.29908	0.895	0.41717	D	0.989483	B;B	0.28258	0.205;0.205	B;B	0.23419	0.046;0.046	T	0.41645	-0.9497	9	.	.	.	-0.2234	8.1715	0.31258	0.3344:0.0:0.6656:0.0	.	219;219	Q7Z5L2;Q7Z5L2-2	GIDRP_HUMAN;.	D	219	ENSP00000359616:E219D;ENSP00000298999:E219D	.	E	+	3	2	C10orf28	99958518	0.987000	0.35691	0.227000	0.23927	0.072000	0.16883	0.906000	0.28517	0.002000	0.14630	0.655000	0.94253	GAG	R3HCC1L	-	NULL	ENSG00000166024		0.363	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	R3HCC1L	HGNC	protein_coding	OTTHUMT00000049764.1		0.00	91	0	G	NM_014472		99968528	+1			no_errors	ENST00000370584	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.641	T
RASGRF2	5924	genome.wustl.edu	37	5	80502710	80502710	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:80502710G>T	ENST00000265080.4	+	20	3020	c.2953G>T	c.(2953-2955)Gat>Tat	p.D985Y	CKMT2-AS1_ENST00000503483.2_RNA	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	985					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		AAAATTAGAGGATATAATTCA	0.378																																																	0													116.0	112.0	113.0					5																	80502710		2203	4300	6503	SO:0001583	missense	0			AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.2953G>T	5.37:g.80502710G>T	ENSP00000265080:p.Asp985Tyr		B9EG89|Q9UK56	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.D985Y	ENST00000265080.4	37	c.2953	CCDS4052.1	5	.	.	.	.	.	.	.	.	.	.	G	22.5	4.301751	0.81136	.	.	ENSG00000113319	ENST00000265080	T	0.30714	1.52	5.48	5.48	0.80851	Ras guanine nucleotide exchange factor, domain (1);	0.200898	0.51477	D	0.000092	T	0.49830	0.1580	L	0.51422	1.61	0.80722	D	1	D	0.76494	0.999	D	0.63488	0.915	T	0.42565	-0.9444	10	0.51188	T	0.08	.	18.9431	0.92611	0.0:0.0:1.0:0.0	.	985	O14827	RGRF2_HUMAN	Y	985	ENSP00000265080:D985Y	ENSP00000265080:D985Y	D	+	1	0	RASGRF2	80538466	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.586000	0.82596	2.563000	0.86464	0.555000	0.69702	GAT	RASGRF2	-	superfamily_Ras_GEF_dom	ENSG00000113319		0.378	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASGRF2	HGNC	protein_coding	OTTHUMT00000239215.2	-	0.00	32	0	G	NM_006909		80502710	+1	tier1	-	no_errors	ENST00000265080	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	T
RASGRP1	10125	genome.wustl.edu	37	15	38852095	38852095	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr15:38852095C>A	ENST00000310803.5	-	2	324	c.147G>T	c.(145-147)atG>atT	p.M49I	RASGRP1_ENST00000559830.1_Missense_Mutation_p.M49I|RASGRP1_ENST00000561180.1_Missense_Mutation_p.M100I|RASGRP1_ENST00000558164.1_Missense_Mutation_p.M49I|RASGRP1_ENST00000450598.2_Missense_Mutation_p.M49I|RASGRP1_ENST00000539159.1_Start_Codon_SNP_p.M1I	NM_001128602.1|NM_005739.3	NP_001122074.1|NP_005730.2	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 (calcium and DAG-regulated)	49					activation of Rho GTPase activity (GO:0032862)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)|secretory granule localization (GO:0032252)|signal transduction (GO:0007165)|vesicle transport along microtubule (GO:0047496)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		GAGACACCATCATTCGGAACT	0.537																																																	0													76.0	80.0	78.0					15																	38852095		1955	4161	6116	SO:0001583	missense	0			AF106071	CCDS45221.1, CCDS45222.1	15q15	2013-01-10				ENSG00000172575		"""EF-hand domain containing"""	9878	protein-coding gene	gene with protein product		603962				10087292, 9789079	Standard	NM_005739		Approved	CalDAG-GEFII, RASGRP	uc001zke.4	O95267		ENST00000310803.5:c.147G>T	15.37:g.38852095C>A	ENSP00000310244:p.Met49Ile		Q56CZ0|Q58G75|Q59HB1|Q5I3A8|Q6GV31|Q6NX39|Q7LDG6|Q9UI94|Q9UNN9	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_DAG/PE-bd	p.M49I	ENST00000310803.5	37	c.147	CCDS45222.1	15	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641392	0.29157	.	.	ENSG00000172575	ENST00000310803;ENST00000450598;ENST00000415523;ENST00000431814;ENST00000539159;ENST00000414708;ENST00000541438	T;T;T;T	0.77877	1.62;1.62;-1.13;1.62	4.97	4.97	0.65823	Ras guanine nucleotide exchange factor, domain (1);	0.308830	0.41396	D	0.000891	T	0.67078	0.2855	N	0.24115	0.695	0.45183	D	0.998194	B;B	0.10296	0.002;0.003	B;B	0.14023	0.004;0.01	T	0.62291	-0.6885	10	0.41790	T	0.15	-30.9455	16.1185	0.81325	0.0:1.0:0.0:0.0	.	49;49	O95267;O95267-2	GRP1_HUMAN;.	I	49;49;49;49;1;49;49	ENSP00000310244:M49I;ENSP00000388540:M49I;ENSP00000444762:M1I;ENSP00000413105:M49I	ENSP00000310244:M49I	M	-	3	0	RASGRP1	36639387	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.697000	0.25556	2.741000	0.93983	0.655000	0.94253	ATG	RASGRP1	-	superfamily_Ras_GEF_dom	ENSG00000172575		0.537	RASGRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASGRP1	HGNC	protein_coding	OTTHUMT00000418223.1	-	0.00	65	0	C	NM_005739		38852095	-1	tier1	-	no_errors	ENST00000310803	ensembl	human	known	74_37	missense	35.29	32	18	SNP	1.000	A
RASGRP3	25780	genome.wustl.edu	37	2	33740275	33740275	+	Splice_Site	SNP	T	T	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:33740275T>A	ENST00000403687.3	+	3	810		c.e3+2		RASGRP3_ENST00000402538.3_Splice_Site|RASGRP3_ENST00000407811.1_Splice_Site	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)						MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					AGATGTTTGGTACGAGCCTTT	0.433																																																	0													261.0	241.0	247.0					2																	33740275		1963	4146	6109	SO:0001630	splice_region_variant	0			AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.70+2T>A	2.37:g.33740275T>A			D6W583|O94931|Q53SD7	Splice_Site	SNP	-	e1+2	ENST00000403687.3	37	c.70+2	CCDS46256.1	2	.	.	.	.	.	.	.	.	.	.	T	16.05	3.012616	0.54468	.	.	ENSG00000152689	ENST00000402538;ENST00000437184;ENST00000403687;ENST00000442390;ENST00000425210;ENST00000444784;ENST00000423159;ENST00000407811	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8249	0.78690	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RASGRP3	33593779	1.000000	0.71417	0.995000	0.50966	0.508000	0.34012	7.139000	0.77314	2.194000	0.70268	0.533000	0.62120	.	RASGRP3	-	-	ENSG00000152689		0.433	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	RASGRP3	HGNC	protein_coding	OTTHUMT00000325462.2	-	0.00	80	0	T	NM_015376	Intron	33740275	+1	tier1	-	no_errors	ENST00000402538	ensembl	human	known	74_37	splice_site	33.82	44	23	SNP	1.000	A
RASGRP3	25780	genome.wustl.edu	37	2	33745725	33745725	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:33745725C>T	ENST00000403687.3	+	6	1082	c.342C>T	c.(340-342)caC>caT	p.H114H	RASGRP3_ENST00000402538.3_Silent_p.H114H|RASGRP3_ENST00000407811.1_Silent_p.H114H	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	114	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)	p.H114H(1)		large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					ATGAAAAACACGTCAGCCTCA	0.448																																																	1	Substitution - coding silent(1)	prostate(1)											211.0	204.0	206.0					2																	33745725		1986	4157	6143	SO:0001819	synonymous_variant	0			AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.342C>T	2.37:g.33745725C>T			D6W583|O94931|Q53SD7	Silent	SNP	pfam_RasGRF_CDC25,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_DAG/PE-bd	p.H114	ENST00000403687.3	37	c.342	CCDS46256.1	2																																																																																			RASGRP3	-	superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N	ENSG00000152689		0.448	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	RASGRP3	HGNC	protein_coding	OTTHUMT00000325462.2		0.00	55	0	C	NM_015376		33745725	+1			no_errors	ENST00000402538	ensembl	human	known	74_37	silent	5.13	37	2	SNP	0.327	T
RBM41	55285	genome.wustl.edu	37	X	106310814	106310814	+	Silent	SNP	T	T	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:106310814T>C	ENST00000372479.3	-	7	1215	c.1185A>G	c.(1183-1185)caA>caG	p.Q395Q	RBM41_ENST00000372487.1_Silent_p.Q395Q	NM_018301.3	NP_060771.3	Q96IZ5	RBM41_HUMAN	RNA binding motif protein 41	395							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	13						GAGAAGTCGCTTGGAGATTTG	0.378																																																	0													220.0	207.0	211.0					X																	106310814		2203	4300	6503	SO:0001819	synonymous_variant	0			BC006986	CCDS14526.1, CCDS55472.1	Xq22.3	2013-02-12			ENSG00000089682	ENSG00000089682		"""RNA binding motif (RRM) containing"""	25617	protein-coding gene	gene with protein product						12477932	Standard	NM_001171080		Approved	FLJ11016	uc004emz.3	Q96IZ5	OTTHUMG00000022156	ENST00000372479.3:c.1185A>G	X.37:g.106310814T>C			Q5JSN7|Q5JSN8|Q9H8F7|Q9NV04	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Q395	ENST00000372479.3	37	c.1185	CCDS14526.1	X																																																																																			RBM41	-	NULL	ENSG00000089682		0.378	RBM41-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBM41	HGNC	protein_coding	OTTHUMT00000057819.1	-	0.00	30	0	T	NM_018301		106310814	-1	tier1	-	no_errors	ENST00000372479	ensembl	human	known	74_37	silent	62.50	12	20	SNP	0.015	C
RERE	473	genome.wustl.edu	37	1	8585942	8585942	+	Intron	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:8585942C>T	ENST00000337907.3	-	8	1465				RERE_ENST00000400907.2_Intron|RERE_ENST00000400908.2_Intron|RERE_ENST00000377464.1_De_novo_Start_InFrame	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats						chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		AATGGAGGCACATGCAGTCTC	0.473																																																	0																																										SO:0001627	intron_variant	0			AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.830+15330G>A	1.37:g.8585942C>T			O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	RNA	SNP	-	NULL	ENST00000337907.3	37	NULL	CCDS95.1	1																																																																																			RERE	-	-	ENSG00000142599		0.473	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RERE	HGNC	protein_coding	OTTHUMT00000004916.1	-	0.00	46	0	C			8585942	-1	tier1	-	no_errors	ENST00000507012	ensembl	human	putative	74_37	rna	35.90	25	14	SNP	1.000	T
RIMS1	22999	genome.wustl.edu	37	6	72957772	72957772	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:72957772C>A	ENST00000521978.1	+	12	2183	c.2183C>A	c.(2182-2184)tCt>tAt	p.S728Y	RIMS1_ENST00000517827.1_Missense_Mutation_p.S187Y|RIMS1_ENST00000401910.3_Missense_Mutation_p.S202Y|RIMS1_ENST00000523963.1_Missense_Mutation_p.S202Y|RIMS1_ENST00000522291.1_Missense_Mutation_p.S728Y|RIMS1_ENST00000520567.1_Missense_Mutation_p.S728Y|RIMS1_ENST00000425662.2_Missense_Mutation_p.S121Y|RIMS1_ENST00000491071.2_Missense_Mutation_p.S728Y|RIMS1_ENST00000264839.7_Missense_Mutation_p.S728Y|RIMS1_ENST00000348717.5_Missense_Mutation_p.S728Y|RIMS1_ENST00000517960.1_Missense_Mutation_p.S728Y|RIMS1_ENST00000518273.1_Missense_Mutation_p.S728Y	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	728					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				TCTGTTATTTCTCCAACAAGT	0.363																																																	0													128.0	121.0	123.0					6																	72957772		1820	4079	5899	SO:0001583	missense	0			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.2183C>A	6.37:g.72957772C>A	ENSP00000428417:p.Ser728Tyr		A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.S728Y	ENST00000521978.1	37	c.2183	CCDS47449.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.2|28.2	4.897350|4.897350	0.91962|0.91962	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000517433|ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827	.|T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.20069	.|2.1;2.24;2.16;2.24;2.23;2.22;2.24;2.14;2.25;2.23;2.27;2.17;2.25	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	.|0.000000	.|0.64402	.|D	.|0.000005	T|T	0.30665|0.30665	0.0772|0.0772	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	.|P;D;D;D;D;D;D	.|0.76494	.|0.879;0.995;0.999;0.999;0.999;0.999;0.997	.|P;D;D;D;D;D;D	.|0.80764	.|0.54;0.986;0.994;0.959;0.984;0.994;0.926	T|T	0.05920|0.05920	-1.0856|-1.0856	5|10	.|0.87932	.|D	.|0	-13.2445|-13.2445	19.8769|19.8769	0.96880|0.96880	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|187;202;728;187;202;728;728	.|B7Z3S3;E9PHF5;E9PHR1;B7Z9Z3;E9PF48;C9JNW6;Q86UR5	.|.;.;.;.;.;.;RIMS1_HUMAN	L|Y	301|728;728;728;728;728;728;728;728;728;728;728;728;202;202;121;121;187	.|ENSP00000430101:S728Y;ENSP00000275037:S728Y;ENSP00000264839:S728Y;ENSP00000429959:S728Y;ENSP00000430408:S728Y;ENSP00000430502:S728Y;ENSP00000430932:S728Y;ENSP00000428417:S728Y;ENSP00000385649:S202Y;ENSP00000428328:S202Y;ENSP00000411235:S121Y;ENSP00000389503:S121Y;ENSP00000428367:S187Y	.|ENSP00000264839:S728Y	F|S	+|+	3|2	2|0	RIMS1|RIMS1	73014493|73014493	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.696000|7.696000	0.84270|0.84270	2.767000|2.767000	0.95098|0.95098	0.557000|0.557000	0.71058|0.71058	TTC|TCT	RIMS1	-	NULL	ENSG00000079841		0.363	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	HGNC	protein_coding	OTTHUMT00000374968.1	-	0.00	51	0	C			72957772	+1	tier1	-	no_errors	ENST00000521978	ensembl	human	known	74_37	missense	32.61	31	15	SNP	1.000	A
RFX6	222546	genome.wustl.edu	37	6	117250059	117250059	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:117250059G>T	ENST00000332958.2	+	18	2552	c.2536G>T	c.(2536-2538)Gac>Tac	p.D846Y		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	846					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						CATTTTAGATGACAGTGGTAG	0.448																																																	0													155.0	133.0	141.0					6																	117250059		2203	4300	6503	SO:0001583	missense	0			BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.2536G>T	6.37:g.117250059G>T	ENSP00000332208:p.Asp846Tyr		Q5T6B3	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.D846Y	ENST00000332958.2	37	c.2536	CCDS5113.1	6	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803608	0.90623	.	.	ENSG00000185002	ENST00000332958	T	0.60299	0.2	5.63	5.63	0.86233	.	0.319683	0.33813	N	0.004535	T	0.62780	0.2456	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.69307	0.963	T	0.65590	-0.6131	10	0.87932	D	0	-24.4001	20.0442	0.97604	0.0:0.0:1.0:0.0	.	846	Q8HWS3	RFX6_HUMAN	Y	846	ENSP00000332208:D846Y	ENSP00000332208:D846Y	D	+	1	0	RFX6	117356752	1.000000	0.71417	0.990000	0.47175	0.961000	0.63080	9.358000	0.97109	2.814000	0.96858	0.655000	0.94253	GAC	RFX6	-	NULL	ENSG00000185002		0.448	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX6	HGNC	protein_coding	OTTHUMT00000041970.2	-	0.00	60	0	G	NM_173560		117250059	+1	tier1	-	no_errors	ENST00000332958	ensembl	human	known	74_37	missense	27.66	34	13	SNP	1.000	T
RLN1	6013	genome.wustl.edu	37	9	5335515	5335515	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr9:5335515C>A	ENST00000223862.1	-	2	420	c.294G>T	c.(292-294)ctG>ctT	p.L98L	RLN1_ENST00000223858.4_3'UTR|RLN1_ENST00000487557.2_5'UTR	NM_006911.2	NP_008842.1	P04808	REL1_HUMAN	relaxin 1	98					female pregnancy (GO:0007565)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			large_intestine(1)|lung(4)	5	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.02)|Lung(218;0.0984)		GGGCTGCCTTCAGCTCCGGTG	0.363																																																	0													93.0	90.0	91.0					9																	5335515		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6462.1	9p24.1	2013-02-26	2004-11-15		ENSG00000107018	ENSG00000107018		"""Endogenous ligands"""	10026	protein-coding gene	gene with protein product	"""prorelaxin H1"""	179730	"""relaxin 1 (H1)"""				Standard	NM_006911		Approved	H1	uc003zjb.2	P04808	OTTHUMG00000019495	ENST00000223862.1:c.294G>T	9.37:g.5335515C>A			Q99936|Q9UQJ1	Silent	SNP	pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like,prints_Relaxin,prints_Insulin_family	p.L98	ENST00000223862.1	37	c.294	CCDS6462.1	9																																																																																			RLN1	-	pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like,prints_Relaxin	ENSG00000107018		0.363	RLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLN1	HGNC	protein_coding	OTTHUMT00000051617.1	-	0.00	98	0	C			5335515	-1	tier1	-	no_errors	ENST00000223862	ensembl	human	known	74_37	silent	22.39	52	15	SNP	0.000	A
RMI2	116028	genome.wustl.edu	37	16	11410760	11410760	+	3'UTR	DEL	A	A	-			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:11410760delA	ENST00000572992.1	+	0	801				RMI2_ENST00000572173.1_Intron|RMI2_ENST00000381820.2_Intron|Y_RNA_ENST00000362798.1_RNA			Q96E14	RMI2_HUMAN	RecQ mediated genome instability 2						DNA replication (GO:0006260)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.0?(1)		endometrium(1)|kidney(1)|ovary(1)	3						GGGGGACCCCAAAATCCCCCT	0.577																																																	1	Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(1)																																								SO:0001624	3_prime_UTR_variant	0			AK123764	CCDS10548.1	16p13.13	2013-06-10	2013-06-10	2011-06-09	ENSG00000175643	ENSG00000175643			28349	protein-coding gene	gene with protein product		612426	"""chromosome 16 open reading frame 75"", ""RMI2, RecQ mediated genome instability 2, homolog (S. cerevisiae)"""	C16orf75		18923083, 20826341	Standard	NM_152308		Approved	MGC24665, BLAP18	uc002daw.1	Q96E14	OTTHUMG00000129793	ENST00000572992.1:c.*798A>-	16.37:g.11410760delA			B3KVZ6|Q49AE2|Q8TBL0	RNA	DEL	-	NULL	ENST00000572992.1	37	NULL		16																																																																																			RMI2	-	-	ENSG00000175643		0.577	RMI2-004	KNOWN	basic	processed_transcript	RMI2	HGNC	protein_coding	OTTHUMT00000436709.1		0.00	51	0	A	NM_152308		11410760	+1	tier1		no_errors	ENST00000572992	ensembl	human	known	74_37	rna	6.90	27	2	DEL	0.000	-
RND1	27289	genome.wustl.edu	37	12	49254792	49254792	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:49254792G>T	ENST00000309739.5	-	4	571	c.441C>A	c.(439-441)atC>atA	p.I147I		NM_014470.3	NP_055285.1	Q92730	RND1_HUMAN	Rho family GTPase 1	147					actin filament organization (GO:0007015)|axon guidance (GO:0007411)|GTP catabolic process (GO:0006184)|negative regulation of cell adhesion (GO:0007162)|neuron remodeling (GO:0016322)|small GTPase mediated signal transduction (GO:0007264)	adherens junction (GO:0005912)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(2)|skin(1)|urinary_tract(1)	10						GCTCATAGGAGATGGGCGCCT	0.552																																																	0													103.0	95.0	98.0					12																	49254792		2203	4300	6503	SO:0001819	synonymous_variant	0			Y07923	CCDS8771.1	12q12	2008-01-23				ENSG00000172602			18314	protein-coding gene	gene with protein product	"""ras homolog gene family, member S"""	609038				9531558	Standard	NM_014470		Approved	Rho6, ARHS, RHOS	uc001rsn.3	Q92730	OTTHUMG00000170400	ENST00000309739.5:c.441C>A	12.37:g.49254792G>T			A8K9P7	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.I147	ENST00000309739.5	37	c.441	CCDS8771.1	12																																																																																			RND1	-	pfam_Small_GTPase,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho	ENSG00000172602		0.552	RND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RND1	HGNC	protein_coding	OTTHUMT00000408915.1	-	0.00	34	0	G	NM_014470		49254792	-1	tier1	-	no_errors	ENST00000309739	ensembl	human	known	74_37	silent	41.38	17	12	SNP	1.000	T
RNPS1	10921	genome.wustl.edu	37	16	2314307	2314307	+	Missense_Mutation	SNP	C	C	A	rs139166674		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:2314307C>A	ENST00000565678.1	-	3	642	c.97G>T	c.(97-99)Gac>Tac	p.D33Y	RNPS1_ENST00000566397.1_5'UTR|RNPS1_ENST00000301730.8_Missense_Mutation_p.D33Y|RNPS1_ENST00000320225.5_Missense_Mutation_p.D33Y|RNPS1_ENST00000397086.2_Missense_Mutation_p.D33Y|RNPS1_ENST00000561718.1_5'UTR|RNPS1_ENST00000566458.1_Missense_Mutation_p.D10Y|RNPS1_ENST00000568631.1_Missense_Mutation_p.D33Y|RNPS1_ENST00000569598.2_Intron|RNPS1_ENST00000567147.1_Missense_Mutation_p.D10Y			Q15287	RNPS1_HUMAN	RNA binding protein S1, serine-rich domain	33	Lys-rich.|Necessary for interaction with SRP54, nuclear localization and exon-skipping.|Necessary for interaction with the cleaved p110 isoform of CDC2L1.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(4)|ovary(2)|urinary_tract(1)	9						TCTGAGCGGTCTTTGCGTTTG	0.547																																																	0													123.0	121.0	122.0					16																	2314307		2198	4300	6498	SO:0001583	missense	0			AF015608	CCDS10465.1, CCDS66907.1, CCDS73811.1	16p13.3	2013-02-12	2001-11-28		ENSG00000205937	ENSG00000205937		"""RNA binding motif (RRM) containing"""	10080	protein-coding gene	gene with protein product		606447	"""RNA-binding protein S1, serine-rich domain"""			9580558, 8543184	Standard	XM_005255048		Approved		uc002cpu.3	Q15287	OTTHUMG00000128828	ENST00000565678.1:c.97G>T	16.37:g.2314307C>A	ENSP00000457723:p.Asp33Tyr		A8K1P0|B4DDU8|B4DZU7|B7ZA17|O75308|Q32P25|Q8WY42|Q9NYG3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D33Y	ENST00000565678.1	37	c.97	CCDS10465.1	16	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409238	0.83340	.	.	ENSG00000205937	ENST00000320225;ENST00000397086;ENST00000301730	T;T;T	0.07114	3.22;3.22;3.22	5.69	5.69	0.88448	.	0.097461	0.64402	D	0.000001	T	0.12475	0.0303	L	0.38175	1.15	0.58432	D	0.999998	P;P	0.41214	0.736;0.742	P;B	0.44359	0.447;0.367	T	0.00800	-1.1561	10	0.72032	D	0.01	-22.4349	17.3031	0.87187	0.0:1.0:0.0:0.0	.	10;33	Q15287-2;Q15287	.;RNPS1_HUMAN	Y	33	ENSP00000315859:D33Y;ENSP00000380275:D33Y;ENSP00000301730:D33Y	ENSP00000301730:D33Y	D	-	1	0	RNPS1	2254308	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.194000	0.77789	2.688000	0.91661	0.551000	0.68910	GAC	RNPS1	-	NULL	ENSG00000205937		0.547	RNPS1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNPS1	HGNC	protein_coding	OTTHUMT00000435415.1	-	0.00	69	0	C	NM_080594		2314307	-1	tier1	-	no_errors	ENST00000301730	ensembl	human	known	74_37	missense	58.97	16	23	SNP	1.000	A
RPE	6120	genome.wustl.edu	37	2	210867476	210867476	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:210867476G>T	ENST00000359429.6	+	1	188	c.91G>T	c.(91-93)Gcc>Tcc	p.A31S	RPE_ENST00000445268.1_5'UTR|RPE_ENST00000540255.1_Missense_Mutation_p.A31S|RPE_ENST00000429921.1_5'UTR|RPE_ENST00000354506.6_Missense_Mutation_p.A31S|RPE_ENST00000436630.2_5'UTR|RPE_ENST00000452025.1_Missense_Mutation_p.A31S|RPE_ENST00000438204.2_5'UTR|RPE_ENST00000435437.2_Missense_Mutation_p.A31S|RPE_ENST00000411934.2_5'UTR|RPE_ENST00000429907.1_5'UTR|RPE_ENST00000454822.1_5'UTR	NM_199229.1	NP_954699.1	Q96AT9	RPE_HUMAN	ribulose-5-phosphate-3-epimerase	31					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|ribulose-phosphate 3-epimerase activity (GO:0004750)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(2)	9				Epithelial(149;0.00241)|Lung(261;0.041)|all cancers(144;0.0429)|LUSC - Lung squamous cell carcinoma(261;0.0431)		AGACTCTGGGGCCGATTATCT	0.632																																																	0													82.0	85.0	84.0					2																	210867476		2203	4300	6503	SO:0001583	missense	0				CCDS2388.1, CCDS42810.1, CCDS63107.1, CCDS63108.1	2q32-q33.3	2012-10-02			ENSG00000197713	ENSG00000197713	5.1.3.1		10293	protein-coding gene	gene with protein product		180480					Standard	NM_199229		Approved		uc002vdn.4	Q96AT9	OTTHUMG00000154690	ENST00000359429.6:c.91G>T	2.37:g.210867476G>T	ENSP00000352401:p.Ala31Ser		A8K4S0|B4E016|C9JPQ7|O43767|Q53TV9|Q8N215|Q96N34|Q9BSB5	Missense_Mutation	SNP	pfam_Ribul_P_3_epim-like,superfamily_RibuloseP-bd_barrel,tigrfam_Ribul_P_3_epim-like	p.A31S	ENST00000359429.6	37	c.91	CCDS2388.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.582699	0.96578	.	.	ENSG00000197713	ENST00000359429;ENST00000540255;ENST00000452025;ENST00000435437;ENST00000354506	.	.	.	5.1	5.1	0.69264	Aldolase-type TIM barrel (1);Ribulose-phosphate binding barrel (1);	0.000000	0.85682	D	0.000000	T	0.78291	0.4260	M	0.70275	2.135	0.80722	D	1	D;D;P	0.59767	0.986;0.966;0.754	P;D;D	0.66716	0.897;0.946;0.945	T	0.78643	-0.2124	9	0.54805	T	0.06	.	19.0748	0.93156	0.0:0.0:1.0:0.0	.	31;31;31	B4E016;Q96AT9;C9J9T0	.;RPE_HUMAN;.	S	31	.	ENSP00000346501:A31S	A	+	1	0	RPE	210575721	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.546000	0.90661	2.817000	0.96982	0.561000	0.74099	GCC	RPE	-	pfam_Ribul_P_3_epim-like,superfamily_RibuloseP-bd_barrel,tigrfam_Ribul_P_3_epim-like	ENSG00000197713		0.632	RPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPE	HGNC	protein_coding	OTTHUMT00000336574.2	-	0.00	36	0	G	NM_006916		210867476	+1	tier1	-	no_errors	ENST00000359429	ensembl	human	known	74_37	missense	23.33	23	7	SNP	1.000	T
RPL26	6154	genome.wustl.edu	37	17	8280943	8280943	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:8280943C>T	ENST00000584164.1	-	4	768	c.377G>A	c.(376-378)cGc>cAc	p.R126H	RPL26_ENST00000293842.5_Missense_Mutation_p.R126H|RPL26_ENST00000582556.1_Missense_Mutation_p.R126H|RP11-849F2.5_ENST00000585181.1_RNA|RP11-849F2.5_ENST00000579904.1_RNA|RP11-849F2.7_ENST00000582471.1_Intron|RPL26_ENST00000585176.1_5'UTR|RP11-849F2.5_ENST00000580537.1_RNA|RPL26_ENST00000583011.1_Missense_Mutation_p.R126H|KRBA2_ENST00000396267.1_5'Flank			P61254	RL26_HUMAN	ribosomal protein L26	126					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			skin(1)|urinary_tract(1)	2						TCCTACTTGGCGAGATTTGGC	0.378																																																	0													90.0	95.0	94.0					17																	8280943		2203	4299	6502	SO:0001583	missense	0				CCDS11142.1	17p13	2011-04-06			ENSG00000161970	ENSG00000161970		"""L ribosomal proteins"""	10327	protein-coding gene	gene with protein product		603704				8479925	Standard	XM_005256749		Approved	L26	uc002glh.1	P61254	OTTHUMG00000108191	ENST00000584164.1:c.377G>A	17.37:g.8280943C>T	ENSP00000463784:p.Arg126His		B2R4F0|D3DTR8|Q02877|Q6IPY2	Missense_Mutation	SNP	pfam_KOW,superfamily_Translation_prot_SH3-like,smart_KOW,tigrfam_Ribosomal_L26/L24P_euk/arc	p.R126H	ENST00000584164.1	37	c.377	CCDS11142.1	17	.	.	.	.	.	.	.	.	.	.	C	18.00	3.525514	0.64860	.	.	ENSG00000161970	ENST00000293842	.	.	.	4.41	4.41	0.53225	Translation protein SH3-like (1);Ribosomal protein L24, SH3-like (1);	0.178982	0.48286	N	0.000199	T	0.57227	0.2039	L	0.50919	1.6	0.80722	D	1	B	0.09022	0.002	B	0.01281	0.0	T	0.58679	-0.7594	9	0.56958	D	0.05	.	14.8643	0.70404	0.0:1.0:0.0:0.0	.	126	P61254	RL26_HUMAN	H	126	.	ENSP00000293842:R126H	R	-	2	0	RPL26	8221668	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.972000	0.70448	2.152000	0.67230	0.585000	0.79938	CGC	RPL26	-	superfamily_Translation_prot_SH3-like	ENSG00000161970		0.378	RPL26-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPL26	HGNC	protein_coding	OTTHUMT00000442322.1		0.00	59	0	C	NM_000987		8280943	-1			no_errors	ENST00000293842	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
RPS6KA5	9252	genome.wustl.edu	37	14	91340005	91340005	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr14:91340005C>T	ENST00000261991.3	-	16	2304	c.2131G>A	c.(2131-2133)Gtg>Atg	p.V711M	RPS6KA5_ENST00000536315.2_Missense_Mutation_p.V632M	NM_004755.2	NP_004746.2	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 5	711					axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|histone H2A-S1 phosphorylation (GO:0043990)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cytokine production (GO:0001818)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		CAGGTATGCACGGCAGCTCCG	0.473																																																	0													140.0	126.0	131.0					14																	91340005		2203	4300	6503	SO:0001583	missense	0			AF074393	CCDS9893.1, CCDS45149.1	14q31-q32.1	2011-04-05	2002-08-29			ENSG00000100784			10434	protein-coding gene	gene with protein product		603607	"""ribosomal protein S6 kinase, 90kD, polypeptide 5"""			9687510, 10702687	Standard	NM_004755		Approved	MSK1, RLPK	uc001xys.2	O75582		ENST00000261991.3:c.2131G>A	14.37:g.91340005C>T	ENSP00000261991:p.Val711Met		O95316|Q96AF7	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_Aminoglycoside_PTrfase,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_AGC-kinase_C,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_dom	p.V711M	ENST00000261991.3	37	c.2131	CCDS9893.1	14	.	.	.	.	.	.	.	.	.	.	C	25.1	4.607289	0.87157	.	.	ENSG00000100784	ENST00000261991;ENST00000536315	T;T	0.68624	-0.34;-0.34	5.79	5.79	0.91817	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.61400	0.2344	L	0.54323	1.7	0.80722	D	1	P	0.36282	0.546	B	0.19666	0.026	T	0.65651	-0.6116	10	0.62326	D	0.03	.	20.0435	0.97601	0.0:1.0:0.0:0.0	.	711	O75582	KS6A5_HUMAN	M	711;632	ENSP00000261991:V711M;ENSP00000442803:V632M	ENSP00000261991:V711M	V	-	1	0	RPS6KA5	90409758	1.000000	0.71417	0.988000	0.46212	0.624000	0.37722	7.794000	0.85869	2.731000	0.93534	0.650000	0.86243	GTG	RPS6KA5	-	superfamily_Kinase-like_dom,pirsf_Ribosomal_S6_kinase_II	ENSG00000100784		0.473	RPS6KA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA5	HGNC	protein_coding	OTTHUMT00000411442.2	-	0.00	38	0	C	NM_004755		91340005	-1	tier1	-	no_errors	ENST00000261991	ensembl	human	known	74_37	missense	51.72	14	15	SNP	1.000	T
RTTN	25914	genome.wustl.edu	37	18	67742586	67742586	+	Splice_Site	SNP	A	A	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr18:67742586A>T	ENST00000255674.6	-	33	4851		c.e33+1		RTTN_ENST00000437017.1_Splice_Site|RTTN_ENST00000454359.1_Splice_Site	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin						determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)		p.?(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				TATCGTACTTACCATTTAAAT	0.234																																																	1	Unknown(1)	endometrium(1)											54.0	52.0	52.0					18																	67742586		1791	4062	5853	SO:0001630	splice_region_variant	0			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.4564+1T>A	18.37:g.67742586A>T			Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Splice_Site	SNP	-	e33+2	ENST00000255674.6	37	c.4564+2	CCDS42443.1	18	.	.	.	.	.	.	.	.	.	.	A	13.14	2.149508	0.37923	.	.	ENSG00000176225	ENST00000255674;ENST00000437017	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2222	0.65836	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RTTN	65893566	1.000000	0.71417	0.987000	0.45799	0.233000	0.25261	4.625000	0.61262	2.090000	0.63153	0.454000	0.30748	.	RTTN	-	-	ENSG00000176225		0.234	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTTN	HGNC	protein_coding	OTTHUMT00000442988.1		0.00	22	0	A	NM_173630	Intron	67742586	-1			no_errors	ENST00000255674	ensembl	human	known	74_37	splice_site	10.00	18	2	SNP	1.000	T
SCNM1	79005	genome.wustl.edu	37	1	151139496	151139496	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:151139496C>T	ENST00000368905.4	+	3	320	c.209C>T	c.(208-210)tCc>tTc	p.S70F	LYSMD1_ENST00000368908.5_5'Flank|SCNM1_ENST00000461862.1_3'UTR|LYSMD1_ENST00000440902.2_5'Flank	NM_001204856.1|NM_024041.3	NP_001191785.1|NP_076946.1	Q9BWG6	SCNM1_HUMAN	sodium channel modifier 1	70					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AAACATCTGTCCAGTAAGTTA	0.537																																																	0													71.0	65.0	67.0					1																	151139496		2203	4300	6503	SO:0001583	missense	0			BC000264	CCDS987.1, CCDS55636.1	1q21.3	2012-03-13			ENSG00000163156	ENSG00000163156			23136	protein-coding gene	gene with protein product		608095				12920299	Standard	NM_024041		Approved	MGC3180	uc001ewz.3	Q9BWG6	OTTHUMG00000012258	ENST00000368905.4:c.209C>T	1.37:g.151139496C>T	ENSP00000357901:p.Ser70Phe		B4DWR1|Q5JR74	Missense_Mutation	SNP	NULL	p.S70F	ENST00000368905.4	37	c.209	CCDS987.1	1	.	.	.	.	.	.	.	.	.	.	C	14.91	2.676124	0.47886	.	.	ENSG00000163156	ENST00000368905;ENST00000368902	.	.	.	5.79	4.88	0.63580	.	0.171847	0.49916	N	0.000128	T	0.11537	0.0281	N	0.14661	0.345	0.28694	N	0.90442	B;B	0.11235	0.004;0.004	B;B	0.14023	0.01;0.01	T	0.12553	-1.0543	9	0.27785	T	0.31	-12.1145	12.6305	0.56655	0.0:0.9199:0.0:0.0801	.	70;70	B4DWR1;Q9BWG6	.;SCNM1_HUMAN	F	70;35	.	ENSP00000357898:S35F	S	+	2	0	SCNM1	149406120	1.000000	0.71417	0.999000	0.59377	0.843000	0.47879	3.067000	0.50010	1.458000	0.47871	0.448000	0.29417	TCC	SCNM1	-	NULL	ENSG00000163156		0.537	SCNM1-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	SCNM1	HGNC	protein_coding	OTTHUMT00000034064.2	-	0.00	63	0	C	NM_024041		151139496	+1	tier1	-	no_errors	ENST00000368905	ensembl	human	known	74_37	missense	15.00	34	6	SNP	1.000	T
S100A12	6283	genome.wustl.edu	37	1	153346380	153346380	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:153346380G>T	ENST00000368737.3	-	3	319	c.202C>A	c.(202-204)Cag>Aag	p.Q68K		NM_005621.1	NP_005612.1	P80511	S10AC_HUMAN	S100 calcium binding protein A12	68	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cytokine secretion (GO:0050663)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|killing of cells of other organism (GO:0031640)|mast cell activation (GO:0045576)|monocyte chemotaxis (GO:0002548)|neutrophil chemotaxis (GO:0030593)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|RAGE receptor binding (GO:0050786)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|skin(2)	4	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)		Amlexanox(DB01025)|Olopatadine(DB00768)	AAGTCGACCTGTTCATCTTGA	0.423																																																	0													151.0	144.0	146.0					1																	153346380		2203	4300	6503	SO:0001583	missense	0			BC070294	CCDS1037.1	1q21	2013-01-10	2006-09-11		ENSG00000163221	ENSG00000163221		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10489	protein-coding gene	gene with protein product		603112	"""S100 calcium-binding protein A12 (calgranulin C)"", ""S100 calcium binding protein A12 (calgranulin C)"""			8985590	Standard	NM_005621		Approved	p6, MRP6, CGRP, CAAF1, CAGC, ENRAGE	uc001fbr.1	P80511	OTTHUMG00000013127	ENST00000368737.3:c.202C>A	1.37:g.153346380G>T	ENSP00000357726:p.Gln68Lys		P83219|Q5SY66|Q7M4R1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.Q68K	ENST00000368737.3	37	c.202	CCDS1037.1	1	.	.	.	.	.	.	.	.	.	.	G	11.47	1.647867	0.29336	.	.	ENSG00000163221	ENST00000368737;ENST00000368736	T	0.05447	3.44	3.95	0.837	0.18896	S100/Calbindin-D9k, conserved site (1);EF-hand-like domain (1);	0.673446	0.14247	N	0.331680	T	0.02119	0.0066	.	.	.	0.09310	N	1	P	0.41313	0.745	B	0.39379	0.298	T	0.43327	-0.9398	9	0.39692	T	0.17	.	11.6037	0.51020	0.0:0.546:0.454:0.0	.	68	P80511	S10AC_HUMAN	K	68;72	ENSP00000357726:Q68K	ENSP00000357725:Q72K	Q	-	1	0	S100A12	151613004	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.193000	0.09573	0.193000	0.20303	0.655000	0.94253	CAG	S100A12	-	pfscan_EF_hand_dom	ENSG00000163221		0.423	S100A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A12	HGNC	protein_coding	OTTHUMT00000036795.1	-	0.00	95	0	G	NM_005621		153346380	-1	tier1	-	no_errors	ENST00000368737	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.000	T
RYR2	6262	genome.wustl.edu	37	1	237666611	237666611	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:237666611C>T	ENST00000366574.2	+	22	2736	c.2419C>T	c.(2419-2421)Cga>Tga	p.R807*	RYR2_ENST00000360064.6_Nonsense_Mutation_p.R805*|RYR2_ENST00000542537.1_Nonsense_Mutation_p.R791*	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	807	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCTTGGAGGGCGACATGGAGA	0.403																																																	0													67.0	63.0	64.0					1																	237666611		1905	4115	6020	SO:0001587	stop_gained	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2419C>T	1.37:g.237666611C>T	ENSP00000355533:p.Arg807*		Q15411|Q546N8|Q5T3P2	Nonsense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.R805*	ENST00000366574.2	37	c.2413	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	C	40	8.491584	0.98834	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	.	.	.	5.73	0.569	0.17340	.	0.000000	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.6868	0.85310	0.3242:0.6758:0.0:0.0	.	.	.	.	X	807;805;791	.	ENSP00000353174:R805X	R	+	1	2	RYR2	235733234	0.997000	0.39634	0.997000	0.53966	0.978000	0.69477	3.518000	0.53451	0.242000	0.21303	0.655000	0.94253	CGA	RYR2	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY	ENSG00000198626		0.403	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	45	0	C	NM_001035		237666611	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	nonsense	27.27	24	9	SNP	0.998	T
SCNN1G	6340	genome.wustl.edu	37	16	23226660	23226660	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:23226660C>A	ENST00000300061.2	+	13	1963	c.1820C>A	c.(1819-1821)tCt>tAt	p.S607Y	CTC-391G2.1_ENST00000563471.1_RNA	NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	607					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)			NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	ACTTTCAACTCTGCTTTGCAC	0.592																																																	0													102.0	98.0	99.0					16																	23226660		2197	4300	6497	SO:0001583	missense	0			U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.1820C>A	16.37:g.23226660C>A	ENSP00000300061:p.Ser607Tyr		P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.S607Y	ENST00000300061.2	37	c.1820	CCDS10608.1	16	.	.	.	.	.	.	.	.	.	.	C	22.2	4.256781	0.80246	.	.	ENSG00000166828	ENST00000300061	T	0.71817	-0.6	5.41	5.41	0.78517	.	0.239144	0.36555	N	0.002529	T	0.60753	0.2293	N	0.08118	0	0.42485	D	0.992875	D	0.56521	0.976	P	0.48030	0.564	T	0.70597	-0.4828	10	0.72032	D	0.01	-18.5858	18.1719	0.89747	0.0:1.0:0.0:0.0	.	607	P51170	SCNNG_HUMAN	Y	607	ENSP00000300061:S607Y	ENSP00000300061:S607Y	S	+	2	0	SCNN1G	23134161	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	5.626000	0.67777	2.514000	0.84764	0.561000	0.74099	TCT	SCNN1G	-	tigrfam_EnaC	ENSG00000166828		0.592	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCNN1G	HGNC	protein_coding	OTTHUMT00000254496.1	-	0.00	28	0	C	NM_001039		23226660	+1	tier1	-	no_errors	ENST00000300061	ensembl	human	known	74_37	missense	22.22	21	6	SNP	1.000	A
SDHAP1	255812	genome.wustl.edu	37	3	195686830	195686830	+	RNA	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:195686830G>T	ENST00000427841.1	-	0	2452					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		ctcttacgcagcgtagtgact	0.527																																					Ovarian(67;1158 1227 12109 20189 43170)												0																																												0			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195686830G>T				RNA	SNP	-	NULL	ENST00000427841.1	37	NULL		3																																																																																			SDHAP1	-	-	ENSG00000185485		0.527	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1	-	0.00	80	0	G			195686830	-1	tier1	-	no_errors	ENST00000427149	ensembl	human	known	74_37	rna	12.20	72	10	SNP	0.008	T
SEMA3A	10371	genome.wustl.edu	37	7	83590866	83590866	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:83590866G>A	ENST00000265362.4	-	17	2451	c.2137C>T	c.(2137-2139)Ccc>Tcc	p.P713S	SEMA3A_ENST00000436949.1_Missense_Mutation_p.P713S	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	713					apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						TTGAGATTGGGGTGGTTGATG	0.468																																																	0													192.0	167.0	175.0					7																	83590866		2203	4300	6503	SO:0001583	missense	0			L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.2137C>T	7.37:g.83590866G>A	ENSP00000265362:p.Pro713Ser			Missense_Mutation	SNP	pfam_Semap_dom,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,pfscan_Semap_dom,pfscan_Ig-like_dom	p.P713S	ENST00000265362.4	37	c.2137	CCDS5599.1	7	.	.	.	.	.	.	.	.	.	.	G	16.09	3.023266	0.54683	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.27402	1.67;1.67	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.45236	0.1332	L	0.37561	1.115	0.80722	D	1	D	0.71674	0.998	D	0.70935	0.971	T	0.05599	-1.0875	10	0.12430	T	0.62	.	20.3668	0.98882	0.0:0.0:1.0:0.0	.	713	Q14563	SEM3A_HUMAN	S	713	ENSP00000265362:P713S;ENSP00000415260:P713S	ENSP00000265362:P713S	P	-	1	0	SEMA3A	83428802	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.751000	0.98889	2.894000	0.99253	0.655000	0.94253	CCC	SEMA3A	-	NULL	ENSG00000075213		0.468	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3A	HGNC	protein_coding	OTTHUMT00000253355.2	-	0.00	77	0	G	NM_006080		83590866	-1	tier1	-	no_errors	ENST00000265362	ensembl	human	known	74_37	missense	52.10	57	62	SNP	1.000	A
SEZ6L2	26470	genome.wustl.edu	37	16	29888628	29888628	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:29888628G>T	ENST00000308713.5	-	11	2400	c.1873C>A	c.(1873-1875)Cca>Aca	p.P625T	SEZ6L2_ENST00000346932.5_Missense_Mutation_p.P511T|SEZ6L2_ENST00000537485.1_Missense_Mutation_p.P581T|SEZ6L2_ENST00000350527.3_Missense_Mutation_p.P555T	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	625	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CCCAGGCCTGGATTTGGGGGC	0.677																																																	0													16.0	19.0	18.0					16																	29888628		2197	4297	6494	SO:0001583	missense	0			AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.1873C>A	16.37:g.29888628G>T	ENSP00000312550:p.Pro625Thr		B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.P625T	ENST00000308713.5	37	c.1873	CCDS10659.1	16	.	.	.	.	.	.	.	.	.	.	G	16.03	3.006493	0.54361	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.33654	1.62;1.4;1.57;1.59	5.57	5.57	0.84162	CUB (4);	0.000000	0.56097	D	0.000038	T	0.25269	0.0614	N	0.03608	-0.345	0.36015	D	0.838315	P;D;D;D;D;D	0.61080	0.762;0.989;0.986;0.983;0.986;0.986	B;P;P;P;P;P	0.55508	0.429;0.777;0.715;0.592;0.715;0.577	T	0.22277	-1.0221	10	0.22109	T	0.4	.	8.6272	0.33897	0.1632:0.0:0.8368:0.0	.	581;625;511;555;625;555	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	T	555;625;511;581	ENSP00000310206:P555T;ENSP00000312550:P625T;ENSP00000319215:P511T;ENSP00000439412:P581T	ENSP00000312550:P625T	P	-	1	0	SEZ6L2	29796129	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	4.769000	0.62300	2.618000	0.88619	0.655000	0.94253	CCA	SEZ6L2	-	superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000174938		0.677	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L2	HGNC	protein_coding	OTTHUMT00000255154.2	-	0.00	68	0	G	NM_012410		29888628	-1	tier1	-	no_errors	ENST00000308713	ensembl	human	known	74_37	missense	14.89	40	7	SNP	0.972	T
SEZ6L2	26470	genome.wustl.edu	37	16	29899100	29899100	+	Missense_Mutation	SNP	G	G	A	rs201034422		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:29899100G>A	ENST00000308713.5	-	7	1605	c.1078C>T	c.(1078-1080)Cgc>Tgc	p.R360C	SEZ6L2_ENST00000346932.5_Missense_Mutation_p.R246C|SEZ6L2_ENST00000562159.1_5'Flank|SEZ6L2_ENST00000537485.1_Missense_Mutation_p.R316C|SEZ6L2_ENST00000350527.3_Missense_Mutation_p.R290C	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	360	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GACACGATGCGGCCCAGGGTG	0.647																																																	0													34.0	33.0	34.0					16																	29899100		2197	4300	6497	SO:0001583	missense	0			AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.1078C>T	16.37:g.29899100G>A	ENSP00000312550:p.Arg360Cys		B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.R360C	ENST00000308713.5	37	c.1078	CCDS10659.1	16	.	.	.	.	.	.	.	.	.	.	G	23.2	4.393052	0.83011	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	5.46	4.44	0.53790	CUB (4);	0.000000	0.53938	D	0.000060	T	0.65080	0.2657	M	0.71206	2.165	0.58432	D	0.999998	D;D;D;D;D;D	0.89917	1.0;0.99;0.999;1.0;1.0;0.999	D;P;P;D;D;P	0.74023	0.968;0.53;0.732;0.982;0.925;0.855	T	0.67845	-0.5565	10	0.72032	D	0.01	.	12.1183	0.53878	0.0:0.0:0.713:0.287	.	316;360;246;290;360;290	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	C	290;360;246;316	ENSP00000310206:R290C;ENSP00000312550:R360C;ENSP00000319215:R246C;ENSP00000439412:R316C	ENSP00000312550:R360C	R	-	1	0	SEZ6L2	29806601	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.798000	0.47884	2.579000	0.87056	0.555000	0.69702	CGC	SEZ6L2	-	superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000174938		0.647	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L2	HGNC	protein_coding	OTTHUMT00000255154.2	-	0.00	87	0	G	NM_012410		29899100	-1	tier1	rs201034422	no_errors	ENST00000308713	ensembl	human	known	74_37	missense	43.48	39	30	SNP	1.000	A
SGOL2	151246	genome.wustl.edu	37	2	201436243	201436243	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:201436243G>T	ENST00000357799.4	+	7	1272	c.1174G>T	c.(1174-1176)Gaa>Taa	p.E392*		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	392					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)		p.E392Q(1)		NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						AAAAACAAATGAACATGGAAT	0.318																																																	1	Substitution - Missense(1)	urinary_tract(1)											37.0	37.0	37.0					2																	201436243		1807	4063	5870	SO:0001587	stop_gained	0			AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.1174G>T	2.37:g.201436243G>T	ENSP00000350447:p.Glu392*		Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Nonsense_Mutation	SNP	NULL	p.E392*	ENST00000357799.4	37	c.1174	CCDS42796.1	2	.	.	.	.	.	.	.	.	.	.	G	12.73	2.024810	0.35701	.	.	ENSG00000163535	ENST00000357799	.	.	.	5.0	1.2	0.21068	.	0.789609	0.11632	N	0.544722	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-0.7642	9.0655	0.36460	0.302:0.0:0.698:0.0	.	.	.	.	X	392	.	ENSP00000350447:E392X	E	+	1	0	SGOL2	201144488	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.183000	0.16919	0.379000	0.24794	0.585000	0.79938	GAA	SGOL2	-	NULL	ENSG00000163535		0.318	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGOL2	HGNC	protein_coding	OTTHUMT00000335834.1		0.00	17	0	G	NM_152524		201436243	+1			no_errors	ENST00000357799	ensembl	human	known	74_37	nonsense	15.38	11	2	SNP	0.000	T
SHMT2	6472	genome.wustl.edu	37	12	57627884	57627884	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:57627884A>G	ENST00000328923.3	+	11	1830	c.1378A>G	c.(1378-1380)Agc>Ggc	p.S460G	SHMT2_ENST00000557487.1_Missense_Mutation_p.S450G|SHMT2_ENST00000553474.1_Missense_Mutation_p.S439G|SHMT2_ENST00000393827.4_Missense_Mutation_p.S364G|SHMT2_ENST00000414700.3_Missense_Mutation_p.S439G|SHMT2_ENST00000449049.3_Missense_Mutation_p.S439G	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	460					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	AGAGGTGAAGAGCAAGACTGG	0.562																																					Esophageal Squamous(150;1369 2416 49071 49364)												0													81.0	86.0	84.0					12																	57627884		2203	4300	6503	SO:0001583	missense	0			AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.1378A>G	12.37:g.57627884A>G	ENSP00000333667:p.Ser460Gly		B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Missense_Mutation	SNP	pfam_Ser_HO-MeTrfase,superfamily_PyrdxlP-dep_Trfase,pirsf_Ser_HO-MeTrfase	p.S460G	ENST00000328923.3	37	c.1378	CCDS8934.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.668|8.668	0.902092|0.902092	0.17760|0.17760	.|.	.|.	ENSG00000182199|ENSG00000182199	ENST00000557529|ENST00000328923;ENST00000557487;ENST00000414700;ENST00000553474;ENST00000449049;ENST00000393827	.|T;T;T;T;T;T	.|0.32988	.|1.55;1.47;1.55;1.55;1.55;1.43	4.98|4.98	2.58|2.58	0.30949|0.30949	.|Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	.|0.574499	.|0.19988	.|N	.|0.101626	T|T	0.17238|0.17238	0.0414|0.0414	N|N	0.17838|0.17838	0.53|0.53	0.27008|0.27008	N|N	0.964757|0.964757	.|B;B;B;B;B	.|0.06786	.|0.0;0.0;0.001;0.0;0.001	.|B;B;B;B;B	.|0.04013	.|0.0;0.0;0.0;0.0;0.001	T|T	0.12344|0.12344	-1.0551|-1.0551	5|10	.|0.48119	.|T	.|0.1	-12.2616|-12.2616	6.0057|6.0057	0.19544|0.19544	0.5787:0.3344:0.0869:0.0|0.5787:0.3344:0.0869:0.0	.|.	.|469;450;364;391;460	.|B4DWA7;Q8N1A5;B4DLV4;B4DP88;P34897	.|.;.;.;.;GLYM_HUMAN	G|G	259|460;450;439;439;439;364	.|ENSP00000333667:S460G;ENSP00000452315:S450G;ENSP00000406881:S439G;ENSP00000452419:S439G;ENSP00000413770:S439G;ENSP00000377413:S364G	.|ENSP00000333667:S460G	E|S	+|+	2|1	0|0	SHMT2|SHMT2	55914151|55914151	1.000000|1.000000	0.71417|0.71417	0.886000|0.886000	0.34754|0.34754	0.205000|0.205000	0.24178|0.24178	2.793000|2.793000	0.47845|0.47845	0.840000|0.840000	0.34995|0.34995	0.533000|0.533000	0.62120|0.62120	GAG|AGC	SHMT2	-	superfamily_PyrdxlP-dep_Trfase,pirsf_Ser_HO-MeTrfase	ENSG00000182199		0.562	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHMT2	HGNC	protein_coding	OTTHUMT00000412525.2	-	0.00	41	0	A	NM_005412		57627884	+1	tier1	-	no_errors	ENST00000328923	ensembl	human	known	74_37	missense	26.47	25	9	SNP	0.982	G
SIGLEC1	6614	genome.wustl.edu	37	20	3673201	3673201	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr20:3673201G>A	ENST00000344754.4	-	15	3996	c.3997C>T	c.(3997-3999)Cgc>Tgc	p.R1333C	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.R1333C	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1333	Ig-like C2-type 13.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						CGGGAGCTGCGGGTGCCCTGG	0.677																																																	0													16.0	18.0	17.0					20																	3673201		2200	4297	6497	SO:0001583	missense	0			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3997C>T	20.37:g.3673201G>A	ENSP00000341141:p.Arg1333Cys		Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R1333C	ENST00000344754.4	37	c.3997	CCDS13060.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.0|21.0	4.089292|4.089292	0.76756|0.76756	.|.	.|.	ENSG00000088827|ENSG00000088827	ENST00000419548|ENST00000344754;ENST00000202578	.|T;T	.|0.12465	.|2.68;2.68	5.8|5.8	5.8|5.8	0.92144|0.92144	.|Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.000000	.|0.34725	.|N	.|0.003725	T|T	0.40015|0.40015	0.1100|0.1100	M|M	0.85859|0.85859	2.78|2.78	0.47441|0.47441	D|D	0.999425|0.999425	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.85130	.|0.997;0.995	T|T	0.28106|0.28106	-1.0054|-1.0054	5|10	.|0.66056	.|D	.|0.02	.|.	10.911|10.911	0.47108|0.47108	0.0848:0.0:0.9152:0.0|0.0848:0.0:0.9152:0.0	.|.	.|1333;1333	.|Q9BZZ2;Q9BZZ2-3	.|SN_HUMAN;.	L|C	146|1333	.|ENSP00000341141:R1333C;ENSP00000202578:R1333C	.|ENSP00000202578:R1333C	P|R	-|-	2|1	0|0	SIGLEC1|SIGLEC1	3621201|3621201	0.011000|0.011000	0.17503|0.17503	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	0.850000|0.850000	0.27737|0.27737	2.755000|2.755000	0.94549|0.94549	0.655000|0.655000	0.94253|0.94253	CCG|CGC	SIGLEC1	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000088827		0.677	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC1	HGNC	protein_coding	OTTHUMT00000077761.2	-	0.00	62	0	G	NM_023068		3673201	-1	tier1	-	no_errors	ENST00000344754	ensembl	human	known	74_37	missense	37.74	33	20	SNP	0.993	A
SLC26A4	5172	genome.wustl.edu	37	7	107340538	107340538	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:107340538C>A	ENST00000265715.3	+	15	1849	c.1625C>A	c.(1624-1626)cCt>cAt	p.P542H	SLC26A4_ENST00000541474.1_Missense_Mutation_p.P103H|SLC26A4_ENST00000544569.1_Missense_Mutation_p.P129H|SLC26A4_ENST00000480841.1_3'UTR|SLC26A4_ENST00000543100.1_Missense_Mutation_p.P111H	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	542	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						ATTGAAGAACCTCAAGGAGTG	0.333									Pendred syndrome																																								0													101.0	105.0	104.0					7																	107340538		2202	4300	6502	SO:0001583	missense	0	Familial Cancer Database	Goiter-Deafness syndrome	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.1625C>A	7.37:g.107340538C>A	ENSP00000265715:p.Pro542His		B7Z266|O43170	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.P542H	ENST00000265715.3	37	c.1625	CCDS5746.1	7	.	.	.	.	.	.	.	.	.	.	C	15.20	2.763594	0.49574	.	.	ENSG00000091137	ENST00000265715;ENST00000541474;ENST00000544569;ENST00000543100	D;D;D;D	0.88354	-2.37;-2.37;-2.37;-2.37	5.55	0.761	0.18448	Sulphate transporter/antisigma-factor antagonist STAS (4);	0.441733	0.24664	N	0.036612	D	0.91099	0.7198	M	0.69463	2.115	0.35870	D	0.82814	D;D;D	0.60160	0.975;0.98;0.987	P;P;D	0.67900	0.771;0.865;0.954	D	0.88535	0.3105	10	0.23302	T	0.38	.	9.8748	0.41197	0.0:0.6726:0.0:0.3274	.	103;129;542	F5H104;B7Z6M6;O43511	.;.;S26A4_HUMAN	H	542;103;129;111	ENSP00000265715:P542H;ENSP00000439743:P103H;ENSP00000437427:P129H;ENSP00000441209:P111H	ENSP00000265715:P542H	P	+	2	0	SLC26A4	107127774	0.978000	0.34361	0.987000	0.45799	0.988000	0.76386	0.479000	0.22228	-0.130000	0.11599	0.563000	0.77884	CCT	SLC26A4	-	pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	ENSG00000091137		0.333	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A4	HGNC	protein_coding	OTTHUMT00000337148.1	-	0.00	32	0	C	NM_000441		107340538	+1	tier1	-	no_errors	ENST00000265715	ensembl	human	known	74_37	missense	54.76	19	23	SNP	0.995	A
SLC26A3	1811	genome.wustl.edu	37	7	107423283	107423283	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:107423283C>G	ENST00000340010.5	-	11	1454	c.1270G>C	c.(1270-1272)Gtc>Ctc	p.V424L	SLC26A3_ENST00000422236.2_Missense_Mutation_p.V389L	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	424					anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						GCTAGAACGACAATCAGCACG	0.428																																																	0													85.0	82.0	83.0					7																	107423283		2203	4300	6503	SO:0001583	missense	0			L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.1270G>C	7.37:g.107423283C>G	ENSP00000345873:p.Val424Leu			Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.V424L	ENST00000340010.5	37	c.1270	CCDS5748.1	7	.	.	.	.	.	.	.	.	.	.	C	16.36	3.102511	0.56183	.	.	ENSG00000091138	ENST00000422236;ENST00000340010	D;D	0.93247	-3.19;-3.19	6.07	4.24	0.50183	Sulphate transporter (1);	0.227351	0.44483	D	0.000458	D	0.96147	0.8744	M	0.89095	3.005	0.48762	D	0.999708	D;P	0.54964	0.969;0.873	P;P	0.55087	0.768;0.731	D	0.95618	0.8678	10	0.48119	T	0.1	.	15.6775	0.77338	0.2506:0.7494:0.0:0.0	.	389;424	G5E9U3;P40879	.;S26A3_HUMAN	L	389;424	ENSP00000415817:V389L;ENSP00000345873:V424L	ENSP00000345873:V424L	V	-	1	0	SLC26A3	107210519	1.000000	0.71417	0.266000	0.24541	0.036000	0.12997	2.842000	0.48230	0.861000	0.35504	0.655000	0.94253	GTC	SLC26A3	-	pfam_Sulph_transpt,tigrfam_SulP_transpt	ENSG00000091138		0.428	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A3	HGNC	protein_coding	OTTHUMT00000337190.1	-	0.00	65	0	C	NM_000111		107423283	-1	tier1	-	no_errors	ENST00000340010	ensembl	human	known	74_37	missense	55.17	26	32	SNP	0.943	G
SLC27A6	28965	genome.wustl.edu	37	5	128365297	128365297	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:128365297C>A	ENST00000262462.4	+	9	2590	c.1580C>A	c.(1579-1581)tCt>tAt	p.S527Y	SLC27A6_ENST00000395266.1_Missense_Mutation_p.S527Y|SLC27A6_ENST00000506176.1_Missense_Mutation_p.S527Y			Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid transporter), member 6	527					long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|transmembrane transport (GO:0055085)|very long-chain fatty acid metabolic process (GO:0000038)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(2)|endometrium(1)|kidney(3)|large_intestine(11)|liver(1)|lung(20)|prostate(1)|skin(4)|stomach(1)	44		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		GGAATGGCTTCTATTATTTTA	0.279																																																	0													50.0	52.0	51.0					5																	128365297		2200	4289	6489	SO:0001583	missense	0			AF064254	CCDS4145.1	5q23.3	2013-05-22			ENSG00000113396	ENSG00000113396		"""Acyl-CoA synthetase family"", ""Solute carriers"""	11000	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 2"""	604196				12556534, 10479480	Standard	XM_005271967		Approved	FATP6, VLCS-H1, FACVL2, ACSVL2	uc003kuy.3	Q9Y2P4	OTTHUMG00000128991	ENST00000262462.4:c.1580C>A	5.37:g.128365297C>A	ENSP00000262462:p.Ser527Tyr		Q6IAM5|Q7Z6E6|Q86YF6	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.S527Y	ENST00000262462.4	37	c.1580	CCDS4145.1	5	.	.	.	.	.	.	.	.	.	.	C	23.2	4.389310	0.82902	.	.	ENSG00000113396	ENST00000262462;ENST00000395266;ENST00000506176	T;T;T	0.52754	0.65;0.65;0.65	4.67	4.67	0.58626	.	0.157041	0.64402	D	0.000020	T	0.71134	0.3304	M	0.84082	2.675	0.52501	D	0.999952	D	0.64830	0.994	D	0.68765	0.96	T	0.73436	-0.3983	9	.	.	.	-4.5134	18.8825	0.92362	0.0:1.0:0.0:0.0	.	527	Q9Y2P4	S27A6_HUMAN	Y	527	ENSP00000262462:S527Y;ENSP00000378684:S527Y;ENSP00000421024:S527Y	.	S	+	2	0	SLC27A6	128393196	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.159000	0.77483	2.866000	0.98385	0.650000	0.86243	TCT	SLC27A6	-	NULL	ENSG00000113396		0.279	SLC27A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A6	HGNC	protein_coding	OTTHUMT00000250980.1	-	0.00	46	0	C	NM_014031		128365297	+1	tier1	-	no_errors	ENST00000262462	ensembl	human	known	74_37	missense	22.73	34	10	SNP	1.000	A
SLC44A5	204962	genome.wustl.edu	37	1	75684273	75684273	+	Silent	SNP	G	G	A	rs148196192		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:75684273G>A	ENST00000370855.5	-	17	1544	c.1431C>T	c.(1429-1431)tgC>tgT	p.C477C	SLC44A5_ENST00000370859.3_Silent_p.C477C|SLC44A5_ENST00000535611.1_Silent_p.C347C	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	477					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						CAGCAAGGGCGCACTGACCTA	0.438																																																	0								G	,	0,4406		0,0,2203	143.0	133.0	137.0		1431,1431	2.0	0.9	1	dbSNP_134	137	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	SLC44A5	NM_001130058.1,NM_152697.4	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	477/718,477/720	75684273	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1431C>T	1.37:g.75684273G>A			B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Silent	SNP	pfam_Choline_transptr-like	p.C477	ENST00000370855.5	37	c.1431	CCDS667.1	1																																																																																			SLC44A5	-	pfam_Choline_transptr-like	ENSG00000137968		0.438	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC44A5	HGNC	protein_coding	OTTHUMT00000026921.1		0.00	67	0	G	NM_152697		75684273	-1			no_errors	ENST00000370855	ensembl	human	known	74_37	silent	5.56	34	2	SNP	1.000	A
SLC45A2	51151	genome.wustl.edu	37	5	33947439	33947439	+	Silent	SNP	A	A	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:33947439A>T	ENST00000296589.4	-	6	1343	c.1197T>A	c.(1195-1197)ggT>ggA	p.G399G	SLC45A2_ENST00000342059.3_Silent_p.G340G|SLC45A2_ENST00000382102.3_Silent_p.G399G	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	399					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						TGAAGTAAAGACCCTTTAATC	0.453																																					Ovarian(31;380 859 8490 22203 49048)												0													111.0	113.0	113.0					5																	33947439		2203	4300	6503	SO:0001819	synonymous_variant	0			AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.1197T>A	5.37:g.33947439A>T			Q6P2P0|Q9BTM3	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.G399	ENST00000296589.4	37	c.1197	CCDS3901.1	5																																																																																			SLC45A2	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000164175		0.453	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A2	HGNC	protein_coding	OTTHUMT00000207443.2	-	0.00	48	0	A	NM_016180		33947439	-1	tier1	-	no_errors	ENST00000296589	ensembl	human	known	74_37	silent	41.67	21	15	SNP	0.665	T
SLC46A3	283537	genome.wustl.edu	37	13	29275613	29275613	+	3'UTR	SNP	T	T	G	rs549270231	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr13:29275613T>G	ENST00000266943.6	-	0	1776				SLC46A3_ENST00000380814.4_Intron|SLC46A3_ENST00000475385.1_5'UTR|RNU6-53P_ENST00000365367.1_RNA	NM_001135919.1|NM_181785.3	NP_001129391.1|NP_861450.1	Q7Z3Q1	S46A3_HUMAN	solute carrier family 46, member 3						transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)	15		Lung SC(185;0.0367)		all cancers(112;0.159)		CATAGATTTTTTTTGTTTGTT	0.353													T|||	2	0.000399361	0.0015	0.0	5008	,	,		18293	0.0		0.0	False		,,,				2504	0.0																0													77.0	74.0	75.0					13																	29275613		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0				CCDS9332.1, CCDS45021.1	13q12.3	2013-05-22	2007-03-29		ENSG00000139508	ENSG00000139508		"""Solute carriers"""	27501	protein-coding gene	gene with protein product							Standard	NM_001135919		Approved	DKFZp686A1775, FLJ42613	uc001usj.3	Q7Z3Q1	OTTHUMG00000016650	ENST00000266943.6:c.*21A>C	13.37:g.29275613T>G			Q3ZCV8|Q6NUK5|Q6P9B3|Q6ZVG5|Q96QA1	RNA	SNP	-	NULL	ENST00000266943.6	37	NULL	CCDS9332.1	13																																																																																			SLC46A3	-	-	ENSG00000139508		0.353	SLC46A3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC46A3	HGNC	protein_coding	OTTHUMT00000276111.1	-	0.00	15	0	T	NM_181785		29275613	-1	tier1	-	no_errors	ENST00000475385	ensembl	human	known	74_37	rna	35.29	11	6	SNP	0.012	G
SLC7A11	23657	genome.wustl.edu	37	4	139101836	139101836	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr4:139101836delA	ENST00000280612.5	-	10	1504	c.1225delT	c.(1225-1227)tatfs	p.Y409fs	SLC7A11-AS1_ENST00000510767.1_RNA	NM_014331.3	NP_055146.1	Q9UPY5	XCT_HUMAN	solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11	409					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|brain development (GO:0007420)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|lens fiber cell differentiation (GO:0070306)|leukocyte migration (GO:0050900)|platelet aggregation (GO:0070527)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	cystine:glutamate antiporter activity (GO:0015327)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)	18	all_hematologic(180;0.166)				Acetylcysteine(DB06151)|L-Cystine(DB00138)|Riluzole(DB00740)|Rosuvastatin(DB01098)|Sulfasalazine(DB00795)|Tauroursodeoxycholic acid(DB08834)	TATCGAAGATAAATCAGCCCA	0.438																																																	0													66.0	66.0	66.0					4																	139101836		2203	4300	6503	SO:0001589	frameshift_variant	0			AB026891	CCDS3742.1	4q28-q32	2013-05-22	2011-07-12		ENSG00000151012	ENSG00000151012		"""Solute carriers"""	11059	protein-coding gene	gene with protein product		607933				10206947, 12763038	Standard	XM_005262875		Approved	xCT	uc021xrw.1	Q9UPY5	OTTHUMG00000133396	ENST00000280612.5:c.1225delT	4.37:g.139101836delA	ENSP00000280612:p.Tyr409fs		A8K2U4	Frame_Shift_Del	DEL	pfam_AA-permease/SLC12A_dom,pfam_AA_transpt_TM,pirsf_AA/rel_permease1,tigrfam_L_AA_transporter	p.Y409fs	ENST00000280612.5	37	c.1225	CCDS3742.1	4																																																																																			SLC7A11	-	pirsf_AA/rel_permease1,tigrfam_L_AA_transporter	ENSG00000151012		0.438	SLC7A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A11	HGNC	protein_coding	OTTHUMT00000257251.2		0.00	54	0	A			139101836	-1	tier1		no_errors	ENST00000280612	ensembl	human	known	74_37	frame_shift_del	8.00	23	2	DEL	1.000	-
SLC9A1	6548	genome.wustl.edu	37	1	27427705	27427705	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:27427705C>T	ENST00000263980.3	-	11	2674	c.2099G>A	c.(2098-2100)cGc>cAc	p.R700H	SLC9A1_ENST00000545949.1_Missense_Mutation_p.R361H|SLC9A1_ENST00000490329.1_5'Flank	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	700					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	TGAGCCGATGCGGGCCCGAGA	0.637																																																	0													50.0	51.0	51.0					1																	27427705		2203	4300	6503	SO:0001583	missense	0			M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.2099G>A	1.37:g.27427705C>T	ENSP00000263980:p.Arg700His		B1ALD6|D3DPL4|Q96EM2	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_1,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.R700H	ENST00000263980.3	37	c.2099	CCDS295.1	1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.870096	0.91587	.	.	ENSG00000090020	ENST00000263980;ENST00000374089;ENST00000545949;ENST00000447808	T;T	0.53640	0.61;1.22	5.28	4.37	0.52481	.	0.169780	0.52532	N	0.000064	T	0.60157	0.2247	M	0.72894	2.215	0.54753	D	0.999986	D	0.67145	0.996	P	0.56514	0.8	T	0.61168	-0.7117	10	0.34782	T	0.22	.	13.8743	0.63643	0.0:0.9274:0.0:0.0726	.	700	P19634	SL9A1_HUMAN	H	700;204;361;121	ENSP00000263980:R700H;ENSP00000445520:R361H	ENSP00000263980:R700H	R	-	2	0	SLC9A1	27300292	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	6.805000	0.75191	1.480000	0.48289	0.650000	0.86243	CGC	SLC9A1	-	prints_Na/H_exchanger_1	ENSG00000090020		0.637	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A1	HGNC	protein_coding	OTTHUMT00000012336.2	-	0.00	75	0	C	NM_003047		27427705	-1	tier1	-	no_errors	ENST00000263980	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
SLCO1C1	53919	genome.wustl.edu	37	12	20854304	20854304	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:20854304G>C	ENST00000266509.2	+	3	550	c.182G>C	c.(181-183)gGc>gCc	p.G61A	SLCO1C1_ENST00000545102.1_Intron|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.G61A|SLCO1C1_ENST00000381552.1_Missense_Mutation_p.G61A|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.G61A	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	61					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	TTGGCAGAAGGCTATCTGAAG	0.423																																																	0													272.0	207.0	229.0					12																	20854304		2203	4300	6503	SO:0001583	missense	0			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.182G>C	12.37:g.20854304G>C	ENSP00000266509:p.Gly61Ala		B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.G61A	ENST00000266509.2	37	c.182	CCDS8683.1	12	.	.	.	.	.	.	.	.	.	.	G	6.431	0.447587	0.12223	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552	T;T;T;T	0.58652	0.32;0.32;0.32;0.32	5.09	4.18	0.49190	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.046510	0.85682	D	0.000000	T	0.39784	0.1091	N	0.13098	0.295	0.39316	D	0.965152	B;B;B	0.15141	0.009;0.012;0.003	B;B;B	0.20184	0.017;0.007;0.028	T	0.21999	-1.0229	10	0.15066	T	0.55	.	14.9148	0.70789	0.0:0.0:0.8558:0.1442	.	61;61;61	B7Z3Q3;Q5JPA4;Q9NYB5	.;.;SO1C1_HUMAN	A	61	ENSP00000444149:G61A;ENSP00000438665:G61A;ENSP00000266509:G61A;ENSP00000370964:G61A	ENSP00000266509:G61A	G	+	2	0	SLCO1C1	20745571	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.305000	0.78891	1.336000	0.45506	0.655000	0.94253	GGC	SLCO1C1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000139155		0.423	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1C1	HGNC	protein_coding	OTTHUMT00000401765.1	-	0.00	140	0	G	NM_017435		20854304	+1	tier1	-	no_errors	ENST00000381552	ensembl	human	known	74_37	missense	26.09	85	30	SNP	1.000	C
SLX4	84464	genome.wustl.edu	37	16	3633275	3633275	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:3633275G>T	ENST00000294008.3	-	14	5616	c.4976C>A	c.(4975-4977)cCt>cAt	p.P1659H	RP11-461A8.1_ENST00000573982.1_lincRNA	NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	1659	Interaction with PLK1 and TERF2-TERF2IP.|Interaction with SLX1.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						GGTCTTAGCAGGTCCCTTGGG	0.622								Direct reversal of damage																																									0													96.0	93.0	94.0					16																	3633275		2197	4300	6497	SO:0001583	missense	0			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.4976C>A	16.37:g.3633275G>T	ENSP00000294008:p.Pro1659His		Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.P1659H	ENST00000294008.3	37	c.4976	CCDS10506.2	16	.	.	.	.	.	.	.	.	.	.	G	18.18	3.566430	0.65651	.	.	ENSG00000188827	ENST00000294008	T	0.01152	5.26	5.06	2.66	0.31614	.	0.558093	0.13612	N	0.375027	T	0.00998	0.0033	N	0.19112	0.55	0.09310	N	1	B	0.21821	0.061	B	0.18263	0.021	T	0.47623	-0.9103	10	0.54805	T	0.06	.	6.177	0.20449	0.0996:0.0:0.5535:0.3469	.	1659	Q8IY92	SLX4_HUMAN	H	1659	ENSP00000294008:P1659H	ENSP00000294008:P1659H	P	-	2	0	SLX4	3573276	0.000000	0.05858	0.002000	0.10522	0.635000	0.38103	0.085000	0.14912	1.095000	0.41419	0.655000	0.94253	CCT	SLX4	-	NULL	ENSG00000188827		0.622	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLX4	HGNC	protein_coding	OTTHUMT00000157301.3	-	0.00	108	0	G	NM_032444		3633275	-1	tier1	-	no_errors	ENST00000294008	ensembl	human	known	74_37	missense	11.76	60	8	SNP	0.000	T
SMAD4	4089	genome.wustl.edu	37	18	48604749	48604749	+	Missense_Mutation	SNP	G	G	T	rs377767375		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr18:48604749G>T	ENST00000342988.3	+	12	2109	c.1571G>T	c.(1570-1572)tGg>tTg	p.W524L	SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Missense_Mutation_p.W524L|SMAD4_ENST00000588745.1_Missense_Mutation_p.W428L	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	524	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		ACACCTTGCTGGATTGAAATT	0.488																																																	38	Whole gene deletion(36)|Unknown(2)	pancreas(26)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	GRCh37	CM057959	SMAD4	M							92.0	90.0	91.0					18																	48604749		2203	4300	6503	SO:0001583	missense	0			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1571G>T	18.37:g.48604749G>T	ENSP00000341551:p.Trp524Leu		A8K405	Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.W524L	ENST00000342988.3	37	c.1571	CCDS11950.1	18	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243596	0.79912	.	.	ENSG00000141646	ENST00000342988;ENST00000398417	D;D	0.99812	-6.88;-6.88	6.08	6.08	0.98989	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.108387	0.64402	D	0.000002	D	0.99729	0.9894	M	0.92833	3.35	0.80722	D	1	P	0.44380	0.834	P	0.49637	0.617	D	0.97755	1.0217	10	0.87932	D	0	.	19.4362	0.94796	0.0:0.0:1.0:0.0	.	524	Q13485	SMAD4_HUMAN	L	524	ENSP00000341551:W524L;ENSP00000381452:W524L	ENSP00000341551:W524L	W	+	2	0	SMAD4	46858747	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.586000	0.98226	2.890000	0.99128	0.655000	0.94253	TGG	SMAD4	-	pfam_SMAD_dom_Dwarfin-type,superfamily_SMAD_FHA_domain,smart_SMAD_dom_Dwarfin-type,pfscan_SMAD_dom_Dwarfin-type	ENSG00000141646		0.488	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD4	HGNC	protein_coding	OTTHUMT00000255993.3	-	0.00	63	0	G	NM_005359		48604749	+1	tier1	-	no_errors	ENST00000342988	ensembl	human	known	74_37	missense	44.83	16	13	SNP	1.000	T
SMARCA5	8467	genome.wustl.edu	37	4	144434713	144434713	+	5'UTR	SNP	C	C	T	rs535506148		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr4:144434713C>T	ENST00000283131.3	+	0	98				SMARCA5-AS1_ENST00000500800.2_RNA	NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5						ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					GAAGCGTTTTCCCAGCCTCAG	0.572													C|||	1	0.000199681	0.0	0.0014	5008	,	,		15383	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001623	5_prime_UTR_variant	0			AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.-365C>T	4.37:g.144434713C>T				RNA	SNP	-	NULL	ENST00000283131.3	37	NULL	CCDS3761.1	4																																																																																			SMARCA5-AS1	-	-	ENSG00000245112		0.572	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCA5-AS1	HGNC	protein_coding	OTTHUMT00000365077.3	-	0.00	71	0	C			144434713	-1	tier1	-	no_errors	ENST00000500800	ensembl	human	known	74_37	rna	10.64	42	5	SNP	0.035	T
SNIP1	79753	genome.wustl.edu	37	1	38003422	38003422	+	Missense_Mutation	SNP	G	G	A	rs61755314		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:38003422G>A	ENST00000296215.6	-	4	1190	c.1118C>T	c.(1117-1119)tCg>tTg	p.S373L	SNIP1_ENST00000468040.1_5'Flank	NM_024700.3	NP_078976.2	Q8TAD8	SNIP1_HUMAN	Smad nuclear interacting protein 1	373					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(586;0.0393)				AGTGTCCGACGACTCATGGAG	0.413																																																	0								G	LEU/SER	0,4406		0,0,2203	242.0	218.0	226.0		1118	6.2	1.0	1	dbSNP_129	226	2,8598	2.2+/-6.3	0,2,4298	yes	missense	SNIP1	NM_024700.2	145	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	373/397	38003422	2,13004	2203	4300	6503	SO:0001583	missense	0				CCDS419.1	1p34.3	2010-07-06			ENSG00000163877	ENSG00000163877			30587	protein-coding gene	gene with protein product		608241				10887155, 15378006	Standard	NM_024700		Approved		uc001cbi.4	Q8TAD8	OTTHUMG00000004225	ENST00000296215.6:c.1118C>T	1.37:g.38003422G>A	ENSP00000296215:p.Ser373Leu		Q96SP9|Q9H9T7	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.S373L	ENST00000296215.6	37	c.1118	CCDS419.1	1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663225	0.47572	0.0	2.33E-4	ENSG00000163877	ENST00000296215;ENST00000436196	T	0.46451	0.87	6.17	6.17	0.99709	Forkhead-associated (FHA) domain (1);SMAD/FHA domain (1);	0.057424	0.64402	D	0.000001	T	0.30008	0.0751	N	0.14661	0.345	0.47341	D	0.999398	B	0.31548	0.328	B	0.24155	0.051	T	0.04825	-1.0924	10	0.36615	T	0.2	-14.2013	20.8794	0.99867	0.0:0.0:1.0:0.0	rs61755314	373	Q8TAD8	SNIP1_HUMAN	L	373;357	ENSP00000296215:S373L	ENSP00000296215:S373L	S	-	2	0	SNIP1	37776009	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.110000	0.77069	2.941000	0.99782	0.655000	0.94253	TCG	SNIP1	-	superfamily_SMAD_FHA_domain	ENSG00000163877		0.413	SNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNIP1	HGNC	protein_coding	OTTHUMT00000012169.2	-	0.00	119	0	G	NM_024700		38003422	-1	tier1	rs61755314	no_errors	ENST00000296215	ensembl	human	known	74_37	missense	61.04	30	47	SNP	1.000	A
SMG7	9887	genome.wustl.edu	37	1	183519019	183519019	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:183519019G>T	ENST00000347615.2	+	19	3063	c.2944G>T	c.(2944-2946)Gaa>Taa	p.E982*	SMG7_ENST00000515829.2_Nonsense_Mutation_p.E936*|SMG7_ENST00000508461.1_Nonsense_Mutation_p.E990*|SMG7_ENST00000367537.3_Nonsense_Mutation_p.E1015*|SMG7_ENST00000456731.2_Nonsense_Mutation_p.E894*|SMG7_ENST00000507469.1_Nonsense_Mutation_p.E986*	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	982	Ser-rich.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						TTCCCTTTTTGAAGGGACTCC	0.433																																																	0													105.0	99.0	101.0					1																	183519019		2203	4300	6503	SO:0001587	stop_gained	0			D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.2944G>T	1.37:g.183519019G>T	ENSP00000340766:p.Glu982*		B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Nonsense_Mutation	SNP	pfam_EST1	p.E986*	ENST00000347615.2	37	c.2956	CCDS1355.1	1	.	.	.	.	.	.	.	.	.	.	G	43	10.048057	0.99325	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000347615;ENST00000507469;ENST00000515829	.	.	.	5.66	5.66	0.87406	.	0.102420	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-14.9178	19.7559	0.96291	0.0:0.0:1.0:0.0	.	.	.	.	X	894;1015;990;982;986;936	.	ENSP00000340766:E982X	E	+	1	0	SMG7	181785642	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.930000	0.92872	2.656000	0.90262	0.655000	0.94253	GAA	SMG7	-	NULL	ENSG00000116698		0.433	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SMG7	HGNC	protein_coding	OTTHUMT00000085432.1	-	0.00	41	0	G	NM_014837		183519019	+1	tier1	-	no_errors	ENST00000507469	ensembl	human	known	74_37	nonsense	21.74	18	5	SNP	1.000	T
TEX2	55852	genome.wustl.edu	37	17	62223488	62223488	+	IGR	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:62223488G>T	ENST00000583097.1	-	0	4852				SNORA76_ENST00000408535.2_lincRNA|SNORD104_ENST00000362883.1_RNA			Q8IWB9	TEX2_HUMAN	testis expressed 2						signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		CTGCTGACGCGGGTGATGCGA	0.662																																																	0													52.0	62.0	59.0					17																	62223488		876	1991	2867	SO:0001628	intergenic_variant	0			AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9			17.37:g.62223488G>T			Q6AHZ5|Q8N3L0|Q9C0C5	RNA	SNP	-	NULL	ENST00000583097.1	37	NULL		17																																																																																			SNORD104	-	-	ENSG00000199753		0.662	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	SNORD104	HGNC	protein_coding	OTTHUMT00000443745.1	-	0.00	79	0	G	NM_018469		62223488	+1	tier1	-	no_errors	ENST00000362883	ensembl	human	known	74_37	rna	34.00	66	34	SNP	0.003	T
SOCS4	122809	genome.wustl.edu	37	14	55510760	55510760	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr14:55510760G>T	ENST00000395472.2	+	2	1333	c.1001G>T	c.(1000-1002)aGa>aTa	p.R334I	SOCS4_ENST00000555846.1_Missense_Mutation_p.R334I|SOCS4_ENST00000339298.2_Missense_Mutation_p.R334I	NM_080867.2|NM_199421.1	NP_543143.1|NP_955453.1	Q8WXH5	SOCS4_HUMAN	suppressor of cytokine signaling 4	334	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				intracellular signal transduction (GO:0035556)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)					central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	14						CTTCATGCTAGAATTGAACAG	0.418																																																	0													110.0	106.0	107.0					14																	55510760		2203	4300	6503	SO:0001583	missense	0			AF424815	CCDS9722.1	14q22.1	2013-02-14	2004-02-25	2004-02-27	ENSG00000180008	ENSG00000180008		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19392	protein-coding gene	gene with protein product			"""suppressor of cytokine signaling 7"""	SOCS7		12076535, 10500304	Standard	NM_080867		Approved		uc001xbp.3	Q8WXH5	OTTHUMG00000140311	ENST00000395472.2:c.1001G>T	14.37:g.55510760G>T	ENSP00000378855:p.Arg334Ile			Missense_Mutation	SNP	pfam_SOCS,pfam_SOCS_C,pfam_SH2,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2	p.R334I	ENST00000395472.2	37	c.1001	CCDS9722.1	14	.	.	.	.	.	.	.	.	.	.	G	21.8	4.200075	0.79015	.	.	ENSG00000180008	ENST00000395472;ENST00000555846;ENST00000339298	D;D;D	0.89485	-2.52;-2.52;-2.52	5.82	4.93	0.64822	SH2 motif (4);	0.064498	0.64402	D	0.000013	D	0.93390	0.7892	M	0.81614	2.55	0.80722	D	1	D	0.62365	0.991	P	0.58820	0.846	D	0.94162	0.7415	10	0.87932	D	0	-21.6739	15.0055	0.71510	0.0684:0.0:0.9316:0.0	.	334	Q8WXH5	SOCS4_HUMAN	I	334	ENSP00000378855:R334I;ENSP00000452522:R334I;ENSP00000341327:R334I	ENSP00000341327:R334I	R	+	2	0	SOCS4	54580513	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.864000	0.99589	1.452000	0.47756	0.655000	0.94253	AGA	SOCS4	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000180008		0.418	SOCS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS4	HGNC	protein_coding	OTTHUMT00000276910.1	-	0.00	87	0	G			55510760	+1	tier1	-	no_errors	ENST00000339298	ensembl	human	known	74_37	missense	41.46	24	17	SNP	1.000	T
MTCL1	23255	genome.wustl.edu	37	18	8784602	8784602	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr18:8784602G>A	ENST00000306329.11	+	5	2572	c.2572G>A	c.(2572-2574)Gaa>Aaa	p.E858K	SOGA2_ENST00000400050.3_Missense_Mutation_p.E498K|SOGA2_ENST00000359865.3_Missense_Mutation_p.E498K|SOGA2_ENST00000306285.7_5'UTR|SOGA2_ENST00000517570.1_Missense_Mutation_p.E498K																							CCTCCAGGGCGAAGAGGAGCA	0.657																																																	0													40.0	46.0	44.0					18																	8784602		2203	4300	6503	SO:0001583	missense	0																														ENST00000306329.11:c.2572G>A	18.37:g.8784602G>A	ENSP00000305027:p.Glu858Lys			Missense_Mutation	SNP	pfam_SOGA	p.E498K	ENST00000306329.11	37	c.1492		18	.	.	.	.	.	.	.	.	.	.	G	0.914	-0.718175	0.03182	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050	T;T;T	0.40225	1.04;1.04;1.04	4.53	2.58	0.30949	.	3.021260	0.01575	N	0.020798	T	0.22085	0.0532	N	0.24115	0.695	0.19575	N	0.999968	P;B	0.40398	0.716;0.335	B;B	0.25614	0.058;0.062	T	0.25745	-1.0123	10	0.10636	T	0.68	.	4.4009	0.11386	0.0854:0.154:0.6018:0.1588	.	519;498	A8MQ54;Q9Y4B5-3	.;.	K	519;498;498;498	ENSP00000429556:E498K;ENSP00000352927:E498K;ENSP00000382924:E498K	ENSP00000305027:E519K	E	+	1	0	CCDC165	8774602	0.024000	0.19004	0.001000	0.08648	0.021000	0.10359	2.089000	0.41672	0.881000	0.35993	0.655000	0.94253	GAA	SOGA2	-	NULL	ENSG00000168502		0.657	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	SOGA2	HGNC	protein_coding	OTTHUMT00000444141.1	-	0.00	27	0	G			8784602	+1	tier1	-	no_errors	ENST00000359865	ensembl	human	known	74_37	missense	43.48	13	10	SNP	0.001	A
SORBS1	10580	genome.wustl.edu	37	10	97101351	97101351	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr10:97101351C>A	ENST00000361941.3	-	25	2540	c.2514G>T	c.(2512-2514)cgG>cgT	p.R838R	SORBS1_ENST00000277982.5_Silent_p.R860R|SORBS1_ENST00000371239.1_Silent_p.R615R|SORBS1_ENST00000371241.1_Silent_p.R488R|SORBS1_ENST00000347291.4_Silent_p.R650R|SORBS1_ENST00000474353.2_5'UTR|SORBS1_ENST00000371249.2_Silent_p.R620R|SORBS1_ENST00000371246.2_Silent_p.R860R|SORBS1_ENST00000371247.2_Silent_p.R838R|SORBS1_ENST00000371245.3_Silent_p.R689R|SORBS1_ENST00000371227.4_Silent_p.R792R|SORBS1_ENST00000393949.1_Silent_p.R808R|SORBS1_ENST00000354106.3_Silent_p.R808R|SORBS1_ENST00000306402.6_Silent_p.R585R|SORBS1_ENST00000353505.5_Silent_p.R689R|SORBS1_ENST00000607232.1_Silent_p.R1098R	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		AGATTCCCACCCGGCCGTGGT	0.468																																																	0													98.0	98.0	98.0					10																	97101351		2203	4300	6503	SO:0001819	synonymous_variant	0			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.2514G>T	10.37:g.97101351C>A				Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_p67phox,prints_SH3_domain	p.R1098	ENST00000361941.3	37	c.3294	CCDS31255.1	10																																																																																			SORBS1	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_p67phox	ENSG00000095637		0.468	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SORBS1	HGNC	protein_coding	OTTHUMT00000049517.1	-	0.00	45	0	C			97101351	-1	tier1	-	no_errors	ENST00000607232	ensembl	human	known	74_37	silent	36.00	16	9	SNP	0.997	A
SPHKAP	80309	genome.wustl.edu	37	2	228882999	228882999	+	Silent	SNP	G	G	A	rs533054194	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:228882999G>A	ENST00000392056.3	-	7	2617	c.2571C>T	c.(2569-2571)tcC>tcT	p.S857S	SPHKAP_ENST00000344657.5_Silent_p.S857S	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	857						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.S857S(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TTTGTCCTTCGGAAGAGGCTC	0.488													G|||	2	0.000399361	0.0	0.0	5008	,	,		20744	0.0		0.0	False		,,,				2504	0.002																2	Substitution - coding silent(2)	endometrium(2)											684.0	648.0	660.0					2																	228882999		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2571C>T	2.37:g.228882999G>A			Q68DA3|Q68DR8|Q9C0I5	Silent	SNP	pfam_AKAP_110_C	p.S857	ENST00000392056.3	37	c.2571	CCDS46537.1	2																																																																																			SPHKAP	-	NULL	ENSG00000153820		0.488	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	-	0.00	98	0	G	NM_030623		228882999	-1	tier1	-	no_errors	ENST00000392056	ensembl	human	known	74_37	silent	43.75	36	28	SNP	0.000	A
SPTBN5	51332	genome.wustl.edu	37	15	42153663	42153663	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr15:42153663C>T	ENST00000320955.6	-	46	7996	c.7769G>A	c.(7768-7770)cGt>cAt	p.R2590H		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	2590					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GCAAAGCCAACGTTCCATCTT	0.547																																																	0													73.0	76.0	75.0					15																	42153663		2018	4176	6194	SO:0001583	missense	0			AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.7769G>A	15.37:g.42153663C>T	ENSP00000317790:p.Arg2590His			Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.R2590H	ENST00000320955.6	37	c.7769		15	.	.	.	.	.	.	.	.	.	.	.	7.327	0.618080	0.14129	.	.	ENSG00000137877	ENST00000320955	T	0.50277	0.75	5.01	0.835	0.18886	.	0.521930	0.17433	N	0.174413	T	0.28532	0.0706	N	0.16478	0.41	0.22811	N	0.99871	B	0.02656	0.0	B	0.06405	0.002	T	0.13818	-1.0495	10	0.35671	T	0.21	.	9.6308	0.39778	0.0:0.7002:0.1056:0.1943	.	2590	Q9NRC6	SPTN5_HUMAN	H	2590	ENSP00000317790:R2590H	ENSP00000317790:R2590H	R	-	2	0	SPTBN5	39940955	0.763000	0.28462	0.111000	0.21465	0.018000	0.09664	0.377000	0.20552	-0.345000	0.08325	-1.094000	0.02160	CGT	SPTBN5	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000137877		0.547	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	SPTBN5	HGNC	protein_coding	OTTHUMT00000420237.1	-	0.00	54	0	C	NM_016642		42153663	-1	tier1	-	no_errors	ENST00000320955	ensembl	human	known	74_37	missense	16.00	21	4	SNP	0.996	T
SRCAP	10847	genome.wustl.edu	37	16	30718900	30718900	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:30718900G>T	ENST00000262518.4	+	6	885	c.500G>T	c.(499-501)cGc>cTc	p.R167L	SNORA30_ENST00000384028.1_RNA|SRCAP_ENST00000344771.4_Missense_Mutation_p.R167L|SRCAP_ENST00000395059.2_Missense_Mutation_p.R167L	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	167	HSA. {ECO:0000255|PROSITE- ProRule:PRU00549}.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CAGGTGGTGCGCATGGTGATC	0.557																																																	0													45.0	37.0	40.0					16																	30718900		2197	4300	6497	SO:0001583	missense	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.500G>T	16.37:g.30718900G>T	ENSP00000262518:p.Arg167Leu		B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.R167L	ENST00000262518.4	37	c.500	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	G	17.58	3.424480	0.62733	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.91295	-2.82;-2.8;-2.82	5.29	5.29	0.74685	Helicase/SANT-associated, DNA binding (1);HSA (1);	0.130684	0.35525	N	0.003159	D	0.93579	0.7950	L	0.52905	1.665	0.58432	D	0.999997	D;D	0.76494	0.999;0.999	D;D	0.64237	0.923;0.922	D	0.93679	0.6997	10	0.62326	D	0.03	-6.8499	17.8681	0.88801	0.0:0.0:1.0:0.0	.	167;167	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	L	167	ENSP00000262518:R167L;ENSP00000378499:R167L;ENSP00000343042:R167L	ENSP00000262518:R167L	R	+	2	0	SRCAP	30626401	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	9.394000	0.97261	2.756000	0.94617	0.561000	0.74099	CGC	SRCAP	-	pfam_Helicase/SANT-assoc_DNA-bd,smart_HAS_subgr,pfscan_Helicase/SANT-assoc_DNA-bd	ENSG00000080603		0.557	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	-	0.00	79	0	G	NM_006662		30718900	+1	tier1	-	no_errors	ENST00000262518	ensembl	human	known	74_37	missense	36.73	30	18	SNP	1.000	T
SRCIN1	80725	genome.wustl.edu	37	17	36704897	36704897	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:36704897G>A	ENST00000264659.7	-	17	3390	c.3166C>T	c.(3166-3168)Cgc>Tgc	p.R1056C	SRCIN1_ENST00000578925.1_Missense_Mutation_p.R1090C|SRCIN1_ENST00000398579.4_5'UTR	NM_025248.2	NP_079524.2	Q9C0H9	SRCN1_HUMAN	SRC kinase signaling inhibitor 1	928					exocytosis (GO:0006887)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	protein kinase binding (GO:0019901)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	19						ACAGCCCGGCGCAGCTTCACC	0.652																																																	0													44.0	51.0	48.0					17																	36704897		2120	4224	6344	SO:0001583	missense	0				CCDS45660.1	17q12	2009-12-14			ENSG00000017373	ENSG00000277363			29506	protein-coding gene	gene with protein product	"""p130Cas-associated protein"", ""SNAP-25-interacting protein"""	610786				11214970	Standard	NM_025248		Approved	SNIP, p140Cap, KIAA1684	uc002hqd.3	Q9C0H9		ENST00000264659.7:c.3166C>T	17.37:g.36704897G>A	ENSP00000264659:p.Arg1056Cys		Q75T46|Q8N4W8	Missense_Mutation	SNP	pfam_AIP3_C	p.R1056C	ENST00000264659.7	37	c.3166	CCDS45660.1	17	.	.	.	.	.	.	.	.	.	.	G	22.2	4.256393	0.80246	.	.	ENSG00000017373	ENST00000264659;ENST00000542707;ENST00000398579	T	0.42513	0.97	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.61135	0.2323	L	0.55481	1.735	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.63386	-0.6649	10	0.62326	D	0.03	-20.7892	17.195	0.86891	0.0:0.0:1.0:0.0	.	928;928;1056	Q9C0H9-2;Q9C0H9;Q9C0H9-5	.;SRCN1_HUMAN;.	C	1056;837;910	ENSP00000264659:R1056C	ENSP00000264659:R1056C	R	-	1	0	SRCIN1	33958423	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.009000	0.49552	2.351000	0.79841	0.462000	0.41574	CGC	SRCIN1	-	NULL	ENSG00000017373		0.652	SRCIN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SRCIN1	HGNC	protein_coding	OTTHUMT00000441878.4	-	0.00	37	0	G	NM_025248		36704897	-1	tier1	-	no_errors	ENST00000264659	ensembl	human	known	74_37	missense	43.24	21	16	SNP	1.000	A
SRGAP3	9901	genome.wustl.edu	37	3	9036154	9036154	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:9036154G>T	ENST00000383836.3	-	19	2708	c.2281C>A	c.(2281-2283)Cgt>Agt	p.R761S	SRGAP3_ENST00000360413.3_Missense_Mutation_p.R737S	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	761	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		GATAGCTCACGCGGGGACCGC	0.597			T	RAF1	pilocytic astrocytoma																																			Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0													71.0	69.0	70.0					3																	9036154		2203	4300	6503	SO:0001583	missense	0			AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.2281C>A	3.37:g.9036154G>T	ENSP00000373347:p.Arg761Ser		Q8IX13|Q8IZV8	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.R761S	ENST00000383836.3	37	c.2281	CCDS2572.1	3	.	.	.	.	.	.	.	.	.	.	G	23.3	4.402271	0.83230	.	.	ENSG00000196220	ENST00000383836;ENST00000360413	T;T	0.42513	0.97;0.97	4.95	4.95	0.65309	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.65165	0.2665	M	0.78285	2.405	0.58432	D	0.999999	D;B	0.63046	0.992;0.287	D;B	0.70487	0.969;0.336	T	0.63998	-0.6510	10	0.32370	T	0.25	.	18.1343	0.89612	0.0:0.0:1.0:0.0	.	737;761	O43295-2;O43295	.;SRGP2_HUMAN	S	761;737	ENSP00000373347:R761S;ENSP00000353587:R737S	ENSP00000353587:R737S	R	-	1	0	SRGAP3	9011154	1.000000	0.71417	0.990000	0.47175	0.981000	0.71138	6.194000	0.72082	2.433000	0.82419	0.650000	0.86243	CGT	SRGAP3	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000196220		0.597	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	HGNC	protein_coding	OTTHUMT00000207137.3	-	0.00	28	0	G			9036154	-1	tier1	-	no_errors	ENST00000383836	ensembl	human	known	74_37	missense	27.59	21	8	SNP	0.997	T
SRRM1	10250	genome.wustl.edu	37	1	24993374	24993374	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:24993374C>A	ENST00000323848.9	+	13	2012	c.1697C>A	c.(1696-1698)cCt>cAt	p.P566H	SRRM1_ENST00000537199.1_3'UTR|SRRM1_ENST00000447431.2_Missense_Mutation_p.P578H|snoU13_ENST00000459464.1_RNA|SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000374389.4_Missense_Mutation_p.P575H	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	566	Arg-rich.|Necessary for speckles and matrix localization.|Pro-rich.|Ser-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.P566H(2)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		CCCGCCCCTCCTCCTCGACGG	0.542																																					Ovarian(68;897 1494 3282 17478)												2	Substitution - Missense(2)	urinary_tract(1)|central_nervous_system(1)											53.0	45.0	48.0					1																	24993374		2203	4300	6503	SO:0001583	missense	0			AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.1697C>A	1.37:g.24993374C>A	ENSP00000326261:p.Pro566His		O60585|Q5VVN4	Missense_Mutation	SNP	pfam_PWI_dom,superfamily_PWI_dom,smart_PWI_dom	p.P578H	ENST00000323848.9	37	c.1733	CCDS255.1	1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.173271	0.78452	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389	T;T;T	0.56776	0.44;0.65;0.71	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000007	T	0.70613	0.3244	L	0.58101	1.795	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.68074	-0.5505	10	0.42905	T	0.14	-3.0627	19.3453	0.94361	0.0:1.0:0.0:0.0	.	578;566	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	H	566;578;575	ENSP00000326261:P566H;ENSP00000391430:P578H;ENSP00000363510:P575H	ENSP00000326261:P566H	P	+	2	0	SRRM1	24865961	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	4.865000	0.62998	2.654000	0.90174	0.650000	0.86243	CCT	SRRM1	-	NULL	ENSG00000133226		0.542	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM1	HGNC	protein_coding	OTTHUMT00000009292.2		0.00	70	0	C	NM_005839		24993374	+1			no_errors	ENST00000447431	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	A
SRRM1	10250	genome.wustl.edu	37	1	24996716	24996716	+	Silent	SNP	C	C	A	rs369669439		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:24996716C>A	ENST00000323848.9	+	15	2625	c.2310C>A	c.(2308-2310)ccC>ccA	p.P770P	SRRM1_ENST00000447431.2_Silent_p.P782P|SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000374389.4_Silent_p.P779P	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	770	Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		CTCCATCCCCCGTCCAGTCTC	0.572																																					Ovarian(68;897 1494 3282 17478)												0													116.0	113.0	114.0					1																	24996716		2203	4300	6503	SO:0001819	synonymous_variant	0			AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.2310C>A	1.37:g.24996716C>A			O60585|Q5VVN4	Silent	SNP	pfam_PWI_dom,superfamily_PWI_dom,smart_PWI_dom	p.P782	ENST00000323848.9	37	c.2346	CCDS255.1	1																																																																																			SRRM1	-	NULL	ENSG00000133226		0.572	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM1	HGNC	protein_coding	OTTHUMT00000009292.2	-	0.00	84	0	C	NM_005839		24996716	+1	tier1	-	no_errors	ENST00000447431	ensembl	human	known	74_37	silent	37.88	41	25	SNP	0.875	A
SRRM5	100170229	genome.wustl.edu	37	19	44117487	44117487	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:44117487G>T	ENST00000607544.1	+	3	1536	c.1214G>T	c.(1213-1215)aGa>aTa	p.R405I	SRRM5_ENST00000526798.1_Missense_Mutation_p.R420I|ZNF428_ENST00000300811.3_Intron|SRRM5_ENST00000417606.1_Missense_Mutation_p.R405I			B3KS81	SRRM5_HUMAN	serine/arginine repetitive matrix 5	405	Ser-rich.									endometrium(11)|kidney(2)|skin(1)|stomach(1)	15						AGCCGATCTAGAAGTCCCAAC	0.547																																																	0													36.0	44.0	42.0					19																	44117487		692	1591	2283	SO:0001583	missense	0			AK297891	CCDS46095.1	19q13.31	2013-09-20			ENSG00000226763	ENSG00000226763			37248	protein-coding gene	gene with protein product							Standard	NM_001145641		Approved		uc010xwr.2	B3KS81	OTTHUMG00000165480	ENST00000607544.1:c.1214G>T	19.37:g.44117487G>T	ENSP00000476253:p.Arg405Ile		B4DNF0	Missense_Mutation	SNP	NULL	p.R420I	ENST00000607544.1	37	c.1259	CCDS46095.1	19	.	.	.	.	.	.	.	.	.	.	G	16.08	3.022970	0.54683	.	.	ENSG00000226763	ENST00000526798;ENST00000417606	.	.	.	3.84	1.72	0.24424	.	.	.	.	.	T	0.47173	0.1431	L	0.34521	1.04	0.09310	N	0.999998	D	0.69078	0.997	D	0.65010	0.931	T	0.26430	-1.0103	8	0.72032	D	0.01	.	7.8996	0.29727	0.211:0.0:0.789:0.0	.	405	B3KS81	SRRM5_HUMAN	I	420;405	.	ENSP00000414512:R405I	R	+	2	0	SRRM5	48809327	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	0.322000	0.19576	0.600000	0.29862	0.650000	0.86243	AGA	SRRM5	-	NULL	ENSG00000226763		0.547	SRRM5-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	SRRM5	HGNC	protein_coding	OTTHUMT00000384398.2	-	0.00	48	0	G	NM_001145641		44117487	+1	tier1	-	no_errors	ENST00000526798	ensembl	human	known	74_37	missense	47.37	20	18	SNP	0.001	T
ST18	9705	genome.wustl.edu	37	8	53074007	53074007	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr8:53074007C>A	ENST00000276480.7	-	14	2205	c.1522G>T	c.(1522-1524)Gat>Tat	p.D508Y		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	508					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				ACTTGGGCATCAAAACTGGCA	0.433																																																	0													213.0	205.0	208.0					8																	53074007		2203	4300	6503	SO:0001583	missense	0			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.1522G>T	8.37:g.53074007C>A	ENSP00000276480:p.Asp508Tyr		Q17RY1	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.D508Y	ENST00000276480.7	37	c.1522	CCDS6149.1	8	.	.	.	.	.	.	.	.	.	.	C	26.0	4.690814	0.88735	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.61742	0.08;0.08	5.46	5.46	0.80206	Myelin transcription factor 1 (1);	0.000000	0.85682	D	0.000000	T	0.78984	0.4370	M	0.83603	2.65	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.71870	0.975;0.971	T	0.81265	-0.1011	10	0.72032	D	0.01	-17.2818	19.7302	0.96179	0.0:1.0:0.0:0.0	.	508;508	E5RHS3;O60284	.;ST18_HUMAN	Y	508	ENSP00000276480:D508Y;ENSP00000428521:D508Y	ENSP00000276480:D508Y	D	-	1	0	ST18	53236560	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.252000	0.78309	2.724000	0.93272	0.558000	0.71614	GAT	ST18	-	pfam_Myelin_TF	ENSG00000147488		0.433	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST18	HGNC	protein_coding	OTTHUMT00000377867.1	-	0.00	109	0	C			53074007	-1	tier1	-	no_errors	ENST00000276480	ensembl	human	known	74_37	missense	30.93	67	30	SNP	1.000	A
TRIM74	378108	genome.wustl.edu	37	7	72440395	72440395	+	5'Flank	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:72440395C>A	ENST00000285805.3	-	0	0				TRIM74_ENST00000395244.1_5'Flank	NM_198853.1	NP_942150.1	Q86UV6	TRI74_HUMAN	tripartite motif containing 74							intracellular (GO:0005622)	zinc ion binding (GO:0008270)			prostate(1)	1						ACGACGCCCCCGGCCAGGTGA	0.687																																																	0																																										SO:0001631	upstream_gene_variant	0			AF498999	CCDS5545.1	7q11.23	2013-01-09	2011-01-25	2006-03-31	ENSG00000155428	ENSG00000155428		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	17453	protein-coding gene	gene with protein product		612550	"""tripartite motif-containing 50C"", ""tripartite motif-containing 74"""	TRIM50C			Standard	NM_198853		Approved	MGC45440		Q86UV6	OTTHUMG00000129851		7.37:g.72440395C>A	Exception_encountered		B7WP46	RNA	SNP	-	NULL	ENST00000285805.3	37	NULL	CCDS5545.1	7																																																																																			STAG3L3	-	-	ENSG00000174353		0.687	TRIM74-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAG3L3	HGNC	protein_coding	OTTHUMT00000252093.1	-	0.00	46	0	C	NM_198853		72440395	-1	tier1	-	no_errors	ENST00000436857	ensembl	human	known	74_37	rna	47.14	37	33	SNP	0.006	A
STAT1	6772	genome.wustl.edu	37	2	191873763	191873763	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:191873763G>T	ENST00000361099.3	-	4	586	c.199C>A	c.(199-201)Caa>Aaa	p.Q67K	STAT1_ENST00000540176.1_Missense_Mutation_p.Q67K|STAT1_ENST00000409465.1_Missense_Mutation_p.Q67K|STAT1_ENST00000392323.2_Missense_Mutation_p.Q69K|STAT1_ENST00000392322.3_Missense_Mutation_p.Q67K	NM_007315.3	NP_009330.1	P42224	STAT1_HUMAN	signal transducer and activator of transcription 1, 91kDa	67					apoptotic process (GO:0006915)|blood circulation (GO:0008015)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-beta (GO:0035458)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of macrophage fusion (GO:0034240)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|renal tubule development (GO:0061326)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|tumor necrosis factor receptor binding (GO:0005164)	p.Q67*(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)			CGACTATATTGATCATCCAGC	0.388																																																	1	Substitution - Nonsense(1)	lung(1)											107.0	101.0	103.0					2																	191873763		2203	4300	6503	SO:0001583	missense	0				CCDS2309.1, CCDS42793.1	2q32.2-q32.3	2014-09-17	2002-08-29		ENSG00000115415	ENSG00000115415		"""SH2 domain containing"""	11362	protein-coding gene	gene with protein product	"""transcription factor ISGF-3 components p91/p84"""	600555	"""signal transducer and activator of transcription 1, 91kD"""			7885841	Standard	NM_139266		Approved	STAT91, ISGF-3	uc002usj.2	P42224	OTTHUMG00000132699	ENST00000361099.3:c.199C>A	2.37:g.191873763G>T	ENSP00000354394:p.Gln67Lys		A8K989|B2RCA0|D2KFR8|D3DPI7|Q53S88|Q53XW4|Q68D00|Q9UDL5	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_STAT1_TAZ2-bd_C,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.Q67K	ENST00000361099.3	37	c.199	CCDS2309.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.568499	0.96540	.	.	ENSG00000115415	ENST00000361099;ENST00000409465;ENST00000540176;ENST00000392322;ENST00000392323;ENST00000424722;ENST00000454414;ENST00000432058	T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.67	5.67	0.87782	STAT transcription factor, protein interaction (4);	0.000000	0.85682	D	0.000000	T	0.54951	0.1890	M	0.71581	2.175	0.80722	D	1	P;P	0.48911	0.917;0.741	B;P	0.47102	0.443;0.537	T	0.50874	-0.8776	10	0.16420	T	0.52	-28.5849	18.7673	0.91878	0.0:0.0:1.0:0.0	.	67;67	P42224-2;P42224	.;STAT1_HUMAN	K	67;67;67;67;69;67;67;67	ENSP00000354394:Q67K;ENSP00000386244:Q67K;ENSP00000438703:Q67K;ENSP00000376136:Q67K;ENSP00000376137:Q69K;ENSP00000402548:Q67K;ENSP00000411398:Q67K;ENSP00000416019:Q67K	ENSP00000354394:Q67K	Q	-	1	0	STAT1	191582008	1.000000	0.71417	0.927000	0.36925	0.956000	0.61745	9.869000	0.99810	2.683000	0.91414	0.557000	0.71058	CAA	STAT1	-	pfam_STAT_TF_prot_interaction,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction	ENSG00000115415		0.388	STAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT1	HGNC	protein_coding	OTTHUMT00000255997.3	-	0.00	38	0	G	NM_007315		191873763	-1	tier1	-	no_errors	ENST00000361099	ensembl	human	known	74_37	missense	23.53	26	8	SNP	1.000	T
STAT3	6774	genome.wustl.edu	37	17	40485740	40485740	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:40485740C>A	ENST00000264657.5	-	10	1312	c.1000G>T	c.(1000-1002)Gac>Tac	p.D334Y	STAT3_ENST00000404395.3_Missense_Mutation_p.D334Y|STAT3_ENST00000389272.3_Missense_Mutation_p.D236Y|STAT3_ENST00000588969.1_Missense_Mutation_p.D334Y|STAT3_ENST00000585517.1_Missense_Mutation_p.D334Y	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	334					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		AGGGGCCGGTCAGGATGCATG	0.577									Hyperimmunoglobulin E Recurrent Infection Syndrome																																								0													75.0	68.0	70.0					17																	40485740		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.1000G>T	17.37:g.40485740C>A	ENSP00000264657:p.Asp334Tyr		A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.D334Y	ENST00000264657.5	37	c.1000	CCDS32656.1	17	.	.	.	.	.	.	.	.	.	.	C	21.3	4.122512	0.77436	.	.	ENSG00000168610	ENST00000264657;ENST00000389272;ENST00000404395	D;D;D	0.88354	-2.37;-2.37;-2.37	5.41	5.41	0.78517	STAT transcription factor, DNA-binding, subdomain (1);STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.91061	0.7187	N	0.22421	0.69	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.998	D	0.92438	0.5959	10	0.72032	D	0.01	-29.4723	19.1988	0.93701	0.0:1.0:0.0:0.0	.	334;334;334	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	Y	334;236;334	ENSP00000264657:D334Y;ENSP00000373923:D236Y;ENSP00000384943:D334Y	ENSP00000264657:D334Y	D	-	1	0	STAT3	37739266	0.999000	0.42202	0.961000	0.40146	0.863000	0.49368	3.974000	0.56852	2.531000	0.85337	0.655000	0.94253	GAC	STAT3	-	pfam_STAT_TF_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000168610		0.577	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT3	HGNC	protein_coding	OTTHUMT00000319353.3	-	0.00	46	0	C	NM_139276, NM_003150		40485740	-1	tier1	-	no_errors	ENST00000264657	ensembl	human	known	74_37	missense	17.78	37	8	SNP	0.995	A
STAT6	6778	genome.wustl.edu	37	12	57492845	57492845	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:57492845C>A	ENST00000300134.3	-	17	2233	c.1908G>T	c.(1906-1908)aaG>aaT	p.K636N	STAT6_ENST00000454075.3_Missense_Mutation_p.K636N|STAT6_ENST00000556155.1_Missense_Mutation_p.K636N|STAT6_ENST00000538913.2_Missense_Mutation_p.K526N|STAT6_ENST00000537215.2_Missense_Mutation_p.K526N|STAT6_ENST00000543873.2_Missense_Mutation_p.K636N	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	636					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						CCCTGCCATCCTTACCCATCT	0.537																																																	0													242.0	200.0	214.0					12																	57492845		2203	4300	6503	SO:0001583	missense	0			BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.1908G>T	12.37:g.57492845C>A	ENSP00000300134:p.Lys636Asn		A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.K636N	ENST00000300134.3	37	c.1908	CCDS8931.1	12	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127740	0.77549	.	.	ENSG00000166888	ENST00000300134;ENST00000535201;ENST00000538913;ENST00000543873;ENST00000556155;ENST00000537215;ENST00000454075;ENST00000542721;ENST00000555318;ENST00000542516	D;D;D;D;D;D;D	0.96619	-4.07;-4.07;-4.07;-4.07;-4.07;-4.07;-4.07	5.77	4.88	0.63580	SH2 motif (1);	0.151107	0.46145	D	0.000310	D	0.95912	0.8669	L	0.27053	0.805	0.44073	D	0.99682	D;D	0.71674	0.998;0.994	D;P	0.76071	0.987;0.778	D	0.95927	0.8935	10	0.72032	D	0.01	-29.6309	10.7067	0.45958	0.0:0.9123:0.0:0.0877	.	636;636	A8K4S9;P42226	.;STAT6_HUMAN	N	636;526;526;636;636;526;636;526;64;636	ENSP00000300134:K636N;ENSP00000445409:K526N;ENSP00000438451:K636N;ENSP00000451742:K636N;ENSP00000444530:K526N;ENSP00000401486:K636N;ENSP00000450428:K64N	ENSP00000300134:K636N	K	-	3	2	STAT6	55779112	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.593000	0.36686	1.451000	0.47736	0.561000	0.74099	AAG	STAT6	-	NULL	ENSG00000166888		0.537	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT6	HGNC	protein_coding	OTTHUMT00000412248.3	-	0.00	78	0	C	NM_003153		57492845	-1	tier1	-	no_errors	ENST00000300134	ensembl	human	known	74_37	missense	17.86	46	10	SNP	1.000	A
SUSD2	56241	genome.wustl.edu	37	22	24583631	24583631	+	Nonsense_Mutation	SNP	G	G	T	rs372525863		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr22:24583631G>T	ENST00000358321.3	+	12	2245	c.1984G>T	c.(1984-1986)Gag>Tag	p.E662*		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	662	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						CCCCACCTTCGAGCCCCTCTT	0.577																																																	0													141.0	124.0	130.0					22																	24583631		2203	4300	6503	SO:0001587	stop_gained	0			AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.1984G>T	22.37:g.24583631G>T	ENSP00000351075:p.Glu662*		Q9H5Y6	Nonsense_Mutation	SNP	pfam_AMOP,pfam_VWF_type-D,pfam_Sushi_SCR_CCP,pfam_Somatomedin_B_dom,superfamily_Sushi_SCR_CCP,superfamily_Ig_E-set,smart_AMOP,smart_VWF_type-D,smart_Sushi_SCR_CCP,pfscan_AMOP,pfscan_Somatomedin_B_dom,pfscan_Sushi_SCR_CCP	p.E662*	ENST00000358321.3	37	c.1984	CCDS13824.1	22	.	.	.	.	.	.	.	.	.	.	g	38	6.716179	0.97784	.	.	ENSG00000099994	ENST00000358321	.	.	.	4.52	-5.93	0.02254	.	1.129380	0.06453	N	0.728071	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-3.1022	7.5143	0.27592	0.4208:0.355:0.2242:0.0	.	.	.	.	X	662	.	ENSP00000351075:E662X	E	+	1	0	SUSD2	22913631	0.003000	0.15002	0.003000	0.11579	0.842000	0.47809	0.019000	0.13444	-1.218000	0.02601	-0.292000	0.09595	GAG	SUSD2	-	NULL	ENSG00000099994		0.577	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD2	HGNC	protein_coding	OTTHUMT00000320088.1	-	0.00	45	0	G	NM_019601		24583631	+1	tier1	-	no_errors	ENST00000358321	ensembl	human	known	74_37	nonsense	12.12	29	4	SNP	0.305	T
SUSD5	26032	genome.wustl.edu	37	3	33195262	33195262	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:33195262G>T	ENST00000309558.3	-	5	1279	c.862C>A	c.(862-864)Ctg>Atg	p.L288M		NM_015551.1	NP_056366.1	O60279	SUSD5_HUMAN	sushi domain containing 5	288					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	hyaluronic acid binding (GO:0005540)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						TTCTGGAGCAGCCGTGATCCT	0.537																																																	0													46.0	46.0	46.0					3																	33195262		1928	4139	6067	SO:0001583	missense	0			AB011099	CCDS46787.1	3p23	2014-02-12	2006-01-13		ENSG00000173705	ENSG00000173705			29061	protein-coding gene	gene with protein product							Standard	NM_015551		Approved	KIAA0527	uc003cfo.1	O60279	OTTHUMG00000155829	ENST00000309558.3:c.862C>A	3.37:g.33195262G>T	ENSP00000308727:p.Leu288Met			Missense_Mutation	SNP	pfam_Link,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Link,pfscan_Link,pfscan_Sushi_SCR_CCP	p.L288M	ENST00000309558.3	37	c.862	CCDS46787.1	3	.	.	.	.	.	.	.	.	.	.	G	10.55	1.382332	0.24944	.	.	ENSG00000173705	ENST00000309558	T	0.16324	2.35	6.02	3.2	0.36748	.	0.331755	0.27284	N	0.020061	T	0.30166	0.0756	M	0.66939	2.045	0.09310	N	1	D	0.57899	0.981	P	0.57371	0.819	T	0.05566	-1.0877	10	0.66056	D	0.02	-0.0485	8.1247	0.30992	0.1276:0.2454:0.627:0.0	.	288	O60279	SUSD5_HUMAN	M	288	ENSP00000308727:L288M	ENSP00000308727:L288M	L	-	1	2	SUSD5	33170266	0.041000	0.20044	0.001000	0.08648	0.002000	0.02628	0.690000	0.25451	0.858000	0.35431	0.655000	0.94253	CTG	SUSD5	-	NULL	ENSG00000173705		0.537	SUSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD5	HGNC	protein_coding	OTTHUMT00000341902.1	-	0.00	43	0	G	XM_171054		33195262	-1	tier1	-	no_errors	ENST00000309558	ensembl	human	known	74_37	missense	29.63	19	8	SNP	0.001	T
SYNE1	23345	genome.wustl.edu	37	6	152776714	152776714	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:152776714C>A	ENST00000367255.5	-	24	3340	c.2739G>T	c.(2737-2739)aaG>aaT	p.K913N	SYNE1_ENST00000423061.1_Missense_Mutation_p.K920N|SYNE1_ENST00000448038.1_Missense_Mutation_p.K920N|SYNE1_ENST00000367253.4_Missense_Mutation_p.K913N|SYNE1_ENST00000495090.2_Missense_Mutation_p.K480N|SYNE1_ENST00000413186.2_Missense_Mutation_p.K913N|SYNE1_ENST00000341594.5_Missense_Mutation_p.K979N|SYNE1_ENST00000367248.3_Missense_Mutation_p.K903N|SYNE1_ENST00000265368.4_Missense_Mutation_p.K913N	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	913					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTCCAGTTTTCTTTACCATAC	0.388										HNSCC(10;0.0054)																																							0													98.0	98.0	98.0					6																	152776714		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.2739G>T	6.37:g.152776714C>A	ENSP00000356224:p.Lys913Asn		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.K913N	ENST00000367255.5	37	c.2739	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	20.2	3.957841	0.73902	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000495090	T;T;T;T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31;1.31;1.31;1.31	5.26	5.26	0.73747	.	0.099315	0.43919	D	0.000505	T	0.45935	0.1367	M	0.61703	1.905	0.80722	D	1	D;P;P;D;D;P;D	0.69078	0.995;0.565;0.956;0.985;0.997;0.565;0.985	P;B;P;P;D;B;P	0.64687	0.711;0.201;0.72;0.888;0.928;0.201;0.888	T	0.19418	-1.0306	10	0.21014	T	0.42	.	18.8594	0.92266	0.0:1.0:0.0:0.0	.	896;913;480;903;913;913;920	B3W695;Q8NF91;F5H422;F5GXQ8;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.;.;.	N	913;920;913;920;979;913;903;913;480	ENSP00000356224:K913N;ENSP00000396024:K920N;ENSP00000265368:K913N;ENSP00000390975:K920N;ENSP00000341887:K979N;ENSP00000356222:K913N;ENSP00000356217:K903N;ENSP00000414510:K913N;ENSP00000438508:K480N	ENSP00000265368:K913N	K	-	3	2	SYNE1	152818407	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.539000	0.53604	2.441000	0.82636	0.655000	0.94253	AAG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom	ENSG00000131018		0.388	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2		0.00	16	0	C	NM_182961		152776714	-1			no_errors	ENST00000265368	ensembl	human	known	74_37	missense	23.53	13	4	SNP	1.000	A
SYP	6855	genome.wustl.edu	37	X	49054188	49054188	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:49054188G>T	ENST00000263233.4	-	3	285	c.213C>A	c.(211-213)ttC>ttA	p.F71L	SYP-AS1_ENST00000433499.1_RNA|SYP_ENST00000479808.1_Missense_Mutation_p.F71L|SYP_ENST00000538567.1_Intron	NM_003179.2	NP_003170.1	P08247	SYPH_HUMAN	synaptophysin	71	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cellular response to organic substance (GO:0071310)|endocytosis (GO:0006897)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle membrane organization (GO:0048499)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of synaptic vesicle membrane (GO:0030285)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	cholesterol binding (GO:0015485)|protein self-association (GO:0043621)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)	15		all_lung(315;0.00016)				AGGGGTACTCGAACTCGACCT	0.607																																																	0													70.0	41.0	51.0					X																	49054188		2203	4300	6503	SO:0001583	missense	0			X06389	CCDS14321.1	Xp11.23-p11.22	2014-02-19			ENSG00000102003	ENSG00000102003			11506	protein-coding gene	gene with protein product		313475				3120152, 19377476	Standard	NM_003179		Approved	MRX96	uc004dmz.1	P08247	OTTHUMG00000034557	ENST00000263233.4:c.213C>A	X.37:g.49054188G>T	ENSP00000263233:p.Phe71Leu		B2R7L6|B7Z359|Q6P2F7	Missense_Mutation	SNP	pfam_Marvel,prints_Synaptophysin/porin	p.F71L	ENST00000263233.4	37	c.213	CCDS14321.1	X	.	.	.	.	.	.	.	.	.	.	g	14.94	2.684691	0.47991	.	.	ENSG00000102003	ENST00000263233;ENST00000479808	T;T	0.79554	-1.28;-1.28	4.55	-0.519	0.11939	Marvel (1);MARVEL-like domain (1);	0.000000	0.85682	D	0.000000	D	0.89203	0.6648	M	0.90369	3.11	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.87540	0.2458	10	0.87932	D	0	-0.7943	10.0396	0.42151	0.5829:0.0:0.4171:0.0	.	71	P08247	SYPH_HUMAN	L	71	ENSP00000263233:F71L;ENSP00000418169:F71L	ENSP00000263233:F71L	F	-	3	2	SYP	48941132	0.998000	0.40836	0.993000	0.49108	0.276000	0.26787	0.547000	0.23299	-0.299000	0.08909	-0.303000	0.09236	TTC	SYP	-	pfam_Marvel,prints_Synaptophysin/porin	ENSG00000102003		0.607	SYP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYP	HGNC	protein_coding	OTTHUMT00000083625.2	-	0.00	44	0	G	NM_003179		49054188	-1	tier1	-	no_errors	ENST00000263233	ensembl	human	known	74_37	missense	57.14	12	16	SNP	0.992	T
SYVN1	84447	genome.wustl.edu	37	11	64896048	64896048	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:64896048C>A	ENST00000377190.3	-	15	1828	c.1734G>T	c.(1732-1734)atG>atT	p.M578I	SYVN1_ENST00000307289.6_Missense_Mutation_p.M526I|SYVN1_ENST00000294256.8_Missense_Mutation_p.M577I|SYVN1_ENST00000526060.1_Missense_Mutation_p.M577I|SYVN1_ENST00000526121.1_5'Flank	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	578					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						GAGGCCTTTCCATTTCAGGGG	0.607																																																	0													48.0	57.0	54.0					11																	64896048		2201	4297	6498	SO:0001583	missense	0			AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.1734G>T	11.37:g.64896048C>A	ENSP00000366395:p.Met578Ile		Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.M578I	ENST00000377190.3	37	c.1734	CCDS31605.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	2.800|2.800	-0.249380|-0.249380	0.05867|0.05867	.|.	.|.	ENSG00000162298|ENSG00000162298	ENST00000377190;ENST00000294256;ENST00000307289;ENST00000526060|ENST00000434219	T;T;T;T|.	0.08720|.	3.06;3.06;3.23;3.06|.	4.73|4.73	-9.46|-9.46	0.00597|0.00597	.|.	0.917957|.	0.09309|.	N|.	0.819793|.	T|T	0.11707|0.11707	0.0285|0.0285	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.09377|.	0.004;0.004;0.002|.	T|T	0.18085|0.18085	-1.0348|-1.0348	10|6	0.34782|0.35671	T|T	0.22|0.21	-0.1072|-0.1072	0.3962|0.3962	0.00418|0.00418	0.1907:0.2275:0.2402:0.3416|0.1907:0.2275:0.2402:0.3416	.|.	526;577;578|.	Q86TM6-2;Q86TM6-3;Q86TM6|.	.;.;SYVN1_HUMAN|.	I|L	578;577;526;577|578	ENSP00000366395:M578I;ENSP00000294256:M577I;ENSP00000302035:M526I;ENSP00000436984:M577I|.	ENSP00000294256:M577I|ENSP00000412962:W578L	M|W	-|-	3|2	0|0	SYVN1|SYVN1	64652624|64652624	0.001000|0.001000	0.12720|0.12720	0.003000|0.003000	0.11579|0.11579	0.043000|0.043000	0.13939|0.13939	-0.706000|-0.706000	0.05047|0.05047	-1.638000|-1.638000	0.01529|0.01529	-1.127000|-1.127000	0.01993|0.01993	ATG|TGG	SYVN1	-	NULL	ENSG00000162298		0.607	SYVN1-001	KNOWN	basic|CCDS	protein_coding	SYVN1	HGNC	protein_coding	OTTHUMT00000385274.1	-	0.00	101	0	C	NM_032431		64896048	-1	tier1	-	no_errors	ENST00000377190	ensembl	human	known	74_37	missense	6.25	75	5	SNP	0.000	A
TAL2	6887	genome.wustl.edu	37	9	108424837	108424837	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr9:108424837C>A	ENST00000334077.3	+	1	100	c.60C>A	c.(58-60)agC>agA	p.S20R		NM_005421.2	NP_005412.1	Q16559	TAL2_HUMAN	T-cell acute lymphocytic leukemia 2	20	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				midbrain development (GO:0030901)|multicellular organism growth (GO:0035264)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|thalamus development (GO:0021794)|transcription, DNA-templated (GO:0006351)		DNA binding (GO:0003677)										ATGTCAACAGCGCCTTTGCCA	0.507			T	TRB@	T-ALL																																			Dom	yes		9	9q31	6887	T-cell acute lymphocytic leukemia 2		L	0													87.0	81.0	83.0					9																	108424837		2203	4300	6503	SO:0001583	missense	0				CCDS6767.1	9q32	2013-05-21			ENSG00000186051	ENSG00000186051		"""Basic helix-loop-helix proteins"""	11557	protein-coding gene	gene with protein product		186855				1763056	Standard	NM_005421		Approved	bHLHa19	uc004bct.3	Q16559	OTTHUMG00000020424	ENST00000334077.3:c.60C>A	9.37:g.108424837C>A	ENSP00000334547:p.Ser20Arg		A0AVI7	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.S20R	ENST00000334077.3	37	c.60	CCDS6767.1	9	.	.	.	.	.	.	.	.	.	.	C	10.82	1.457417	0.26161	.	.	ENSG00000186051	ENST00000334077	D	0.98207	-4.79	5.52	-9.38	0.00623	Helix-loop-helix DNA-binding (5);	0.221867	0.52532	N	0.000069	D	0.93341	0.7877	N	0.13352	0.335	0.24132	N	0.995761	P	0.39759	0.687	B	0.39805	0.31	D	0.83686	0.0174	10	0.51188	T	0.08	-2.8939	18.1553	0.89689	0.0:0.5422:0.0:0.4578	.	20	Q16559	TAL2_HUMAN	R	20	ENSP00000334547:S20R	ENSP00000334547:S20R	S	+	3	2	TAL2	107464658	0.000000	0.05858	0.643000	0.29450	0.758000	0.43043	-5.379000	0.00127	-1.717000	0.01385	-1.876000	0.00548	AGC	TAL2	-	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	ENSG00000186051		0.507	TAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAL2	HGNC	protein_coding	OTTHUMT00000053504.1	-	0.00	25	0	C	NM_005421		108424837	+1	tier1	-	no_errors	ENST00000334077	ensembl	human	known	74_37	missense	32.26	21	10	SNP	0.113	A
TAT	6898	genome.wustl.edu	37	16	71603806	71603806	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:71603806G>T	ENST00000355962.4	-	10	1209	c.1076C>A	c.(1075-1077)gCc>gAc	p.A359D	RP11-432I5.1_ENST00000561529.1_RNA	NM_000353.2	NP_000344.1	P17735	ATTY_HUMAN	tyrosine aminotransferase	359					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|L-phenylalanine catabolic process (GO:0006559)|response to glucocorticoid (GO:0051384)|response to mercury ion (GO:0046689)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|L-tyrosine:2-oxoglutarate aminotransferase activity (GO:0004838)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(3)	29		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)	TCCAGGGATGGCAGCCAACGC	0.483																																					Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)												0													53.0	45.0	48.0					16																	71603806		2198	4300	6498	SO:0001583	missense	0				CCDS10903.1	16q22.1	2012-10-02			ENSG00000198650	ENSG00000198650	2.6.1.5		11573	protein-coding gene	gene with protein product		613018					Standard	NM_000353		Approved		uc002fap.2	P17735	OTTHUMG00000137590	ENST00000355962.4:c.1076C>A	16.37:g.71603806G>T	ENSP00000348234:p.Ala359Asp		B2R8I1|D3DWS2	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,pfam_Tyr_aminoTrfase_ubiquitination,pfam_ArAA_b-elim_lyase/Thr_aldolase,pfam_Aminotrans_V/Cys_dSase,pfam_DegT/StrS_aminotransferase,superfamily_PyrdxlP-dep_Trfase,pirsf_Tyrosine_transaminase,tigrfam_Tyrosine_aminoTrfase,tigrfam_TyrNic_aminoTrfase	p.A359D	ENST00000355962.4	37	c.1076	CCDS10903.1	16	.	.	.	.	.	.	.	.	.	.	G	12.75	2.030901	0.35797	.	.	ENSG00000198650	ENST00000355962	D	0.88201	-2.35	5.69	5.69	0.88448	Tyrosine aminotransferase (1);Aminotransferase, class I/classII (1);Tyrosine/nicotianamine aminotransferase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.264398	0.44285	D	0.000479	T	0.72787	0.3504	N	0.01091	-1.02	0.52099	D	0.999943	B	0.27068	0.167	B	0.27076	0.076	T	0.72475	-0.4282	10	0.10377	T	0.69	-13.902	19.8146	0.96562	0.0:0.0:1.0:0.0	.	359	P17735	ATTY_HUMAN	D	359	ENSP00000348234:A359D	ENSP00000348234:A359D	A	-	2	0	TAT	70161307	1.000000	0.71417	0.998000	0.56505	0.802000	0.45316	7.732000	0.84908	2.682000	0.91365	0.655000	0.94253	GCC	TAT	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase,pirsf_Tyrosine_transaminase,tigrfam_Tyrosine_aminoTrfase,tigrfam_TyrNic_aminoTrfase	ENSG00000198650		0.483	TAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAT	HGNC	protein_coding	OTTHUMT00000268989.1	-	0.00	29	0	G			71603806	-1	tier1	-	no_errors	ENST00000355962	ensembl	human	known	74_37	missense	44.44	5	4	SNP	1.000	T
TBCB	1155	genome.wustl.edu	37	19	36612449	36612449	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:36612449A>G	ENST00000221855.3	+	4	951	c.376A>G	c.(376-378)Aag>Gag	p.K126E	TBCB_ENST00000586868.1_Intron|TBCB_ENST00000589996.1_Missense_Mutation_p.K126E|TBCB_ENST00000585746.1_Missense_Mutation_p.K75E|TBCB_ENST00000392178.4_3'UTR	NM_001281.2	NP_001272.2	Q99426	TBCB_HUMAN	tubulin folding cofactor B	126					'de novo' posttranslational protein folding (GO:0051084)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CTCTTTCCTGAAGCGCAGCAA	0.701																																																	0													11.0	7.0	9.0					19																	36612449		2158	4217	6375	SO:0001583	missense	0			AF013488	CCDS12488.1, CCDS74344.1	19q13.11-q13.12	2008-02-05	2006-11-22	2006-11-22	ENSG00000105254	ENSG00000105254			1989	protein-coding gene	gene with protein product		601303	"""cytoskeleton-associated protein 1"", ""cytoskeleton associated protein 1"""	CKAP1		8978778	Standard	NM_001281		Approved	CG22, CKAPI	uc002odg.1	Q99426	OTTHUMG00000048143	ENST00000221855.3:c.376A>G	19.37:g.36612449A>G	ENSP00000221855:p.Lys126Glu		O00111|O00674|O14728|Q6FGY5	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.K126E	ENST00000221855.3	37	c.376	CCDS12488.1	19	.	.	.	.	.	.	.	.	.	.	A	29.1	4.974677	0.92919	.	.	ENSG00000105254	ENST00000221855;ENST00000392178	D	0.92348	-3.02	5.21	5.21	0.72293	Cytoskeleton-associated protein, Gly-rich domain (1);	0.090168	0.85682	N	0.000000	D	0.89234	0.6657	L	0.52011	1.625	0.80722	D	1	P;B	0.40909	0.732;0.35	B;B	0.40199	0.322;0.188	D	0.87777	0.2609	10	0.30854	T	0.27	-32.2065	13.0725	0.59070	1.0:0.0:0.0:0.0	.	75;126	Q6FGY5;Q99426	.;TBCB_HUMAN	E	126	ENSP00000221855:K126E	ENSP00000221855:K126E	K	+	1	0	TBCB	41304289	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	8.550000	0.90675	1.993000	0.58246	0.444000	0.29173	AAG	TBCB	-	superfamily_CAP-Gly_domain	ENSG00000105254		0.701	TBCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCB	HGNC	protein_coding	OTTHUMT00000156291.2	-	0.00	10	0	A	NM_001281		36612449	+1	tier1	-	no_errors	ENST00000221855	ensembl	human	known	74_37	missense	36.36	7	4	SNP	1.000	G
TBPL2	387332	genome.wustl.edu	37	14	55895654	55895654	+	Missense_Mutation	SNP	C	C	T	rs535815795		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr14:55895654C>T	ENST00000247219.5	-	5	897	c.827G>A	c.(826-828)cGt>cAt	p.R276H		NM_199047.2	NP_950248.1			TATA box binding protein like 2											endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	8						CTGCACCACACGAGCATATTT	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		18773	0.0		0.0	False		,,,				2504	0.001																0													100.0	100.0	100.0					14																	55895654		2203	4300	6503	SO:0001583	missense	0			AY457923	CCDS9724.1	14q22.2	2004-06-03			ENSG00000182521	ENSG00000182521			19841	protein-coding gene	gene with protein product		608964				14634207	Standard	NM_199047		Approved	TRF3, TBP2	uc001xby.3	Q6SJ96	OTTHUMG00000140313	ENST00000247219.5:c.827G>A	14.37:g.55895654C>T	ENSP00000247219:p.Arg276His			Missense_Mutation	SNP	pfam_TBP,prints_TBP	p.R276H	ENST00000247219.5	37	c.827	CCDS9724.1	14	.	.	.	.	.	.	.	.	.	.	C	34	5.377142	0.95945	.	.	ENSG00000182521	ENST00000247219	T	0.56275	0.47	4.91	4.91	0.64330	Transcription factor TFIID, C-terminal/DNA glycosylase, N-terminal (1);Beta2-adaptin/TATA-box binding, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.78052	0.4223	M	0.93898	3.47	0.80722	D	1	D	0.89917	1.0	P	0.62560	0.904	D	0.84714	0.0736	10	0.87932	D	0	-13.9983	17.2626	0.87075	0.0:1.0:0.0:0.0	.	276	Q6SJ96	TBPL2_HUMAN	H	276	ENSP00000247219:R276H	ENSP00000247219:R276H	R	-	2	0	TBPL2	54965407	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.399000	0.79935	2.542000	0.85734	0.563000	0.77884	CGT	TBPL2	-	pfam_TBP	ENSG00000182521		0.458	TBPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBPL2	HGNC	protein_coding	OTTHUMT00000276916.1		0.00	44	0	C	NM_199047		55895654	-1			no_errors	ENST00000247219	ensembl	human	known	74_37	missense	18.18	18	4	SNP	1.000	T
TBX15	6913	genome.wustl.edu	37	1	119467305	119467305	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:119467305G>T	ENST00000369429.3	-	4	666	c.657C>A	c.(655-657)ctC>ctA	p.L219L	TBX15_ENST00000207157.3_Silent_p.L113L			Q96SF7	TBX15_HUMAN	T-box 15	219					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		TGGTAAGCTTGAGTTTGTCAA	0.453																																																	0													160.0	153.0	156.0					1																	119467305		2203	4300	6503	SO:0001819	synonymous_variant	0			AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.657C>A	1.37:g.119467305G>T			Q08E76|Q5JT54|Q5T9S7	Silent	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.L113	ENST00000369429.3	37	c.339		1																																																																																			TBX15	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	ENSG00000092607		0.453	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	TBX15	HGNC	protein_coding	OTTHUMT00000034351.1	-	0.00	40	0	G	NM_152380		119467305	-1	tier1	-	no_errors	ENST00000207157	ensembl	human	known	74_37	silent	57.14	6	8	SNP	1.000	T
TCTN2	79867	genome.wustl.edu	37	12	124171412	124171412	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:124171412C>T	ENST00000303372.5	+	6	722	c.594C>T	c.(592-594)ttC>ttT	p.F198F	TCTN2_ENST00000426174.2_Silent_p.F197F	NM_001143850.2|NM_024809.4	NP_001137322.1|NP_079085.2	Q96GX1	TECT2_HUMAN	tectonic family member 2	198					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		CAACGCTGTTCAGACGGTCCT	0.527																																																	0													187.0	147.0	160.0					12																	124171412		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056924	CCDS9253.1, CCDS45007.1	12q24.31	2011-04-12	2007-08-20	2007-08-20	ENSG00000168778	ENSG00000168778		"""Tectonic proteins"""	25774	protein-coding gene	gene with protein product	"""Meckel syndrome, type 8"""	613846	"""chromosome 12 open reading frame 38"""	C12orf38		21462283	Standard	NM_024809		Approved	FLJ12975, TECT2, MKS8	uc001ufp.3	Q96GX1	OTTHUMG00000168700	ENST00000303372.5:c.594C>T	12.37:g.124171412C>T			A8K7Y8|B3KPW5|Q9H966	Silent	SNP	pfam_DUF1619	p.F198	ENST00000303372.5	37	c.594	CCDS9253.1	12																																																																																			TCTN2	-	pfam_DUF1619	ENSG00000168778		0.527	TCTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCTN2	HGNC	protein_coding	OTTHUMT00000400652.1	-	0.00	83	0	C	NM_024809		124171412	+1	tier1	-	no_errors	ENST00000303372	ensembl	human	known	74_37	silent	8.51	86	8	SNP	0.874	T
TECPR2	9895	genome.wustl.edu	37	14	102900832	102900832	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr14:102900832C>A	ENST00000359520.7	+	9	1904	c.1678C>A	c.(1678-1680)Ctg>Atg	p.L560M	TECPR2_ENST00000558678.1_Missense_Mutation_p.L560M	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	560					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						GCCTGATTCTCTGGCTGAGGA	0.512																																																	0													84.0	81.0	82.0					14																	102900832		2203	4300	6503	SO:0001583	missense	0			AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.1678C>A	14.37:g.102900832C>A	ENSP00000352510:p.Leu560Met		A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	pfam_Beta-propeller_rpt_TECPR,superfamily_WD40_repeat_dom,superfamily_RCC1/BLIP-II,smart_WD40_repeat,smart_Beta-propeller_rpt_TECPR	p.L560M	ENST00000359520.7	37	c.1678	CCDS32162.1	14	.	.	.	.	.	.	.	.	.	.	C	10.31	1.314431	0.23908	.	.	ENSG00000196663	ENST00000359520;ENST00000380088	T	0.15718	2.4	5.24	-0.672	0.11377	.	2.306130	0.01612	N	0.022570	T	0.13243	0.0321	L	0.40543	1.245	0.09310	N	1	P;B	0.46395	0.877;0.177	B;B	0.39185	0.293;0.072	T	0.20107	-1.0285	10	0.40728	T	0.16	.	2.4524	0.04521	0.1265:0.319:0.3498:0.2047	.	560;560	A5PKY3;O15040	.;TCPR2_HUMAN	M	560	ENSP00000352510:L560M	ENSP00000352510:L560M	L	+	1	2	TECPR2	101970585	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.421000	0.07053	0.195000	0.20347	-0.315000	0.08773	CTG	TECPR2	-	NULL	ENSG00000196663		0.512	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECPR2	HGNC	protein_coding	OTTHUMT00000415056.2		0.00	57	0	C	NM_014844		102900832	+1			no_errors	ENST00000359520	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.000	A
TEKT2	27285	genome.wustl.edu	37	1	36551586	36551586	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:36551586C>A	ENST00000207457.3	+	4	559	c.432C>A	c.(430-432)atC>atA	p.I144I	ADPRHL2_ENST00000373178.4_5'Flank	NM_014466.2	NP_055281.2	Q9UIF3	TEKT2_HUMAN	tektin 2 (testicular)	144					cell projection organization (GO:0030030)|inner dynein arm assembly (GO:0036159)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|pancreas(1)|skin(2)	13		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TGGAGGTCATCGAGGCCACCA	0.592																																																	0													87.0	61.0	70.0					1																	36551586		2201	4300	6501	SO:0001819	synonymous_variant	0			AB033823	CCDS401.1	1p34.3	2008-02-05			ENSG00000092850	ENSG00000092850			11725	protein-coding gene	gene with protein product		608953				12029069, 11751288	Standard	NM_014466		Approved	TEKTB1	uc001bzr.3	Q9UIF3	OTTHUMG00000007629	ENST00000207457.3:c.432C>A	1.37:g.36551586C>A			A6NIS6|O60638	Silent	SNP	pfam_Tektin,superfamily_Prefoldin,prints_Tektin	p.I144	ENST00000207457.3	37	c.432	CCDS401.1	1																																																																																			TEKT2	-	pfam_Tektin	ENSG00000092850		0.592	TEKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT2	HGNC	protein_coding	OTTHUMT00000020200.1	-	0.00	37	0	C	NM_014466		36551586	+1	tier1	-	no_errors	ENST00000207457	ensembl	human	known	74_37	silent	30.23	30	13	SNP	0.975	A
TENM1	10178	genome.wustl.edu	37	X	123838998	123838998	+	Missense_Mutation	SNP	G	G	T	rs138121113		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:123838998G>T	ENST00000371130.3	-	5	943	c.880C>A	c.(880-882)Cct>Act	p.P294T	TENM1_ENST00000422452.2_Missense_Mutation_p.P294T	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	294	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CGAGGAAGAGGCCTGGGAGGG	0.522																																																	0													144.0	133.0	136.0					X																	123838998		2203	4300	6503	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.880C>A	X.37:g.123838998G>T	ENSP00000360171:p.Pro294Thr		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD	p.P294T	ENST00000371130.3	37	c.880	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	G	23.1	4.378137	0.82682	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.33438	1.41;1.41	5.39	5.39	0.77823	Teneurin intracellular, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.55784	0.1942	M	0.65975	2.015	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.984;0.989	T	0.54774	-0.8243	10	0.46703	T	0.11	.	18.4435	0.90676	0.0:0.0:1.0:0.0	.	294;294;294	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	T	294	ENSP00000360171:P294T;ENSP00000403954:P294T	ENSP00000360171:P294T	P	-	1	0	ODZ1	123666679	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.767000	0.98960	2.384000	0.81235	0.523000	0.50628	CCT	TENM1	-	pfam_Ten_N	ENSG00000009694		0.522	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM1	HGNC	protein_coding	OTTHUMT00000058985.1	-	0.00	29	0	G	NM_014253		123838998	-1	tier1	-	no_errors	ENST00000422452	ensembl	human	known	74_37	missense	75.86	7	22	SNP	1.000	T
TENM2	57451	genome.wustl.edu	37	5	167489242	167489242	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:167489242G>T	ENST00000518659.1	+	7	1526	c.1487G>T	c.(1486-1488)aGa>aTa	p.R496I	TENM2_ENST00000519204.1_Missense_Mutation_p.R375I|TENM2_ENST00000403607.2_Missense_Mutation_p.R329I|TENM2_ENST00000520394.1_Missense_Mutation_p.R264I|TENM2_ENST00000545108.1_Missense_Mutation_p.R496I	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	496					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										GTTTACATAAGAAGAGGACTT	0.413																																																	0													112.0	108.0	109.0					5																	167489242		1907	4124	6031	SO:0001583	missense	0			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.1487G>T	5.37:g.167489242G>T	ENSP00000429430:p.Arg496Ile		Q9ULU2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl_sf,superfamily_Cytokine_IL1-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.R496I	ENST00000518659.1	37	c.1487		5	.	.	.	.	.	.	.	.	.	.	G	34	5.331292	0.95733	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.65974	0.2743	M	0.83483	2.645	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	0.999;0.988;1.0	T	0.70691	-0.4802	10	0.87932	D	0	.	19.3422	0.94347	0.0:0.0:1.0:0.0	.	496;264;375	Q9NT68;F8VNQ3;G3V106	TEN2_HUMAN;.;.	I	496;496;375;264;329	ENSP00000429430:R496I;ENSP00000438635:R496I;ENSP00000428964:R375I;ENSP00000427874:R264I;ENSP00000384905:R329I	ENSP00000384905:R329I	R	+	2	0	ODZ2	167421820	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	9.804000	0.99143	2.567000	0.86603	0.655000	0.94253	AGA	TENM2	-	NULL	ENSG00000145934		0.413	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	TENM2	HGNC	protein_coding	OTTHUMT00000376096.1	-	0.00	64	0	G	NM_001122679		167489242	+1	tier1	-	no_errors	ENST00000518659	ensembl	human	known	74_37	missense	23.64	42	13	SNP	1.000	T
TFE3	7030	genome.wustl.edu	37	X	48889017	48889017	+	Silent	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:48889017C>A	ENST00000315869.7	-	9	1438	c.1179G>T	c.(1177-1179)gtG>gtT	p.V393V	TFE3_ENST00000487451.1_5'UTR	NM_006521.4	NP_006512.2	P19532	TFE3_HUMAN	transcription factor binding to IGHM enhancer 3	393	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				humoral immune response (GO:0006959)|positive regulation of cell adhesion (GO:0045785)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of osteoclast differentiation (GO:0045670)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)		NONO/TFE3(2)|PRCC/TFE3(25)|SFPQ/TFE3(6)|CLTC/TFE3(2)|ASPSCR1/TFE3(167)	central_nervous_system(1)	1						GGATATAATCCACAGAGGCCT	0.607			T	"""SFPQ, ASPSCR1, PRCC, NONO, CLTC"""	"""papillary renal, alveolar soft part sarcoma, renal"""																																			Dom	yes		X	Xp11.22	7030	transcription factor binding to IGHM enhancer 3		E	0													31.0	28.0	29.0					X																	48889017		2201	4296	6497	SO:0001819	synonymous_variant	0			X96717	CCDS14315.3	Xp11.22	2013-05-21			ENSG00000068323	ENSG00000068323		"""Basic helix-loop-helix proteins"""	11752	protein-coding gene	gene with protein product	transcription factor E family, member A	314310				1672758, 1685140	Standard	NM_006521		Approved	TFEA, bHLHe33	uc004dmb.3	P19532	OTTHUMG00000022690	ENST00000315869.7:c.1179G>T	X.37:g.48889017C>A			A8MZL6|Q5JU74|Q92757|Q92758|Q99964	Silent	SNP	pfam_bHLH_ZIP_TF_MiT/TFE,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.V393	ENST00000315869.7	37	c.1179	CCDS14315.3	X																																																																																			TFE3	-	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	ENSG00000068323		0.607	TFE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFE3	HGNC	protein_coding	OTTHUMT00000058872.2	-	0.00	33	0	C	NM_006521		48889017	-1	tier1	-	no_errors	ENST00000315869	ensembl	human	known	74_37	silent	25.81	23	8	SNP	1.000	A
THSD7A	221981	genome.wustl.edu	37	7	11633043	11633043	+	Missense_Mutation	SNP	C	C	A	rs374534063		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:11633043C>A	ENST00000423059.4	-	3	1360	c.1109G>T	c.(1108-1110)aGc>aTc	p.S370I		NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	370	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TGAGCAGGGGCTCCACTCTGA	0.512										HNSCC(18;0.044)																																							0								C	ILE/SER	1,3883		0,1,1941	105.0	103.0	104.0		1109	4.5	1.0	7		104	0,8314		0,0,4157	no	missense	THSD7A	NM_015204.2	142	0,1,6098	AA,AC,CC		0.0,0.0257,0.0082	possibly-damaging	370/1658	11633043	1,12197	1942	4157	6099	SO:0001583	missense	0				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.1109G>T	7.37:g.11633043C>A	ENSP00000406482:p.Ser370Ile			Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.S370I	ENST00000423059.4	37	c.1109	CCDS47543.1	7	.	.	.	.	.	.	.	.	.	.	C	18.57	3.652540	0.67472	2.57E-4	0.0	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.64260	-0.09	5.39	4.5	0.54988	.	0.228496	0.52532	D	0.000069	D	0.84835	0.5560	H	0.97829	4.085	0.39611	D	0.969889	D	0.55605	0.972	P	0.59171	0.853	D	0.91271	0.5044	10	0.87932	D	0	.	15.3687	0.74545	0.0:0.6952:0.3047:0.0	.	370	Q9UPZ6	THS7A_HUMAN	I	370	ENSP00000406482:S370I	ENSP00000262042:S370I	S	-	2	0	THSD7A	11599568	0.956000	0.32656	0.989000	0.46669	0.886000	0.51366	1.459000	0.35234	1.242000	0.43836	0.655000	0.94253	AGC	THSD7A	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000005108		0.512	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	HGNC	protein_coding	OTTHUMT00000325944.4		0.00	46	0	C	XM_928187.2		11633043	-1			no_errors	ENST00000423059	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	A
TLN2	83660	genome.wustl.edu	37	15	63092687	63092687	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr15:63092687G>T	ENST00000561311.1	+	48	6585	c.6355G>T	c.(6355-6357)Gcc>Tcc	p.A2119S	TLN2_ENST00000306829.6_Missense_Mutation_p.A2119S			Q9Y4G6	TLN2_HUMAN	talin 2	2119					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CAAGGGGGCTGCCAAGGTAGA	0.557																																																	0													65.0	61.0	62.0					15																	63092687		2203	4300	6503	SO:0001583	missense	0			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.6355G>T	15.37:g.63092687G>T	ENSP00000453508:p.Ala2119Ser		A6NLB8	Missense_Mutation	SNP	pfam_Talin_cent,pfam_ILWEQ_dom,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.A2119S	ENST00000561311.1	37	c.6355	CCDS32261.1	15	.	.	.	.	.	.	.	.	.	.	G	31	5.102287	0.94245	.	.	ENSG00000171914	ENST00000306829	T	0.27104	1.69	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.49115	0.1538	M	0.62088	1.915	0.80722	D	1	D	0.63880	0.993	D	0.66497	0.944	T	0.17349	-1.0372	10	0.33940	T	0.23	-19.2809	20.0706	0.97721	0.0:0.0:1.0:0.0	.	2119	Q9Y4G6	TLN2_HUMAN	S	2119	ENSP00000303476:A2119S	ENSP00000303476:A2119S	A	+	1	0	TLN2	60879740	1.000000	0.71417	0.980000	0.43619	0.772000	0.43724	9.813000	0.99286	2.744000	0.94065	0.655000	0.94253	GCC	TLN2	-	superfamily_Vinculin/catenin	ENSG00000171914		0.557	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2	-	0.00	49	0	G			63092687	+1	tier1	-	no_errors	ENST00000306829	ensembl	human	known	74_37	missense	14.71	29	5	SNP	1.000	T
TICRR	90381	genome.wustl.edu	37	15	90125942	90125942	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr15:90125942G>T	ENST00000268138.7	+	2	785	c.680G>T	c.(679-681)gGa>gTa	p.G227V	RP11-429B14.3_ENST00000560477.1_RNA|TICRR_ENST00000560985.1_Missense_Mutation_p.G227V|RP11-429B14.1_ENST00000559041.1_RNA			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	227					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										GACCACCTTGGATACTGGACT	0.438																																																	0													120.0	115.0	117.0					15																	90125942		1887	4124	6011	SO:0001583	missense	0			AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.680G>T	15.37:g.90125942G>T	ENSP00000268138:p.Gly227Val		B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	NULL	p.G227V	ENST00000268138.7	37	c.680	CCDS10352.2	15	.	.	.	.	.	.	.	.	.	.	G	23.6	4.433592	0.83776	.	.	ENSG00000140534	ENST00000268138	T	0.23754	1.89	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.52565	0.1742	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.52866	-0.8518	10	0.87932	D	0	-22.3123	19.6178	0.95640	0.0:0.0:1.0:0.0	.	227	Q7Z2Z1	TICRR_HUMAN	V	227	ENSP00000268138:G227V	ENSP00000268138:G227V	G	+	2	0	C15orf42	87926946	1.000000	0.71417	0.967000	0.41034	0.978000	0.69477	6.459000	0.73513	2.716000	0.92895	0.491000	0.48974	GGA	TICRR	-	NULL	ENSG00000140534		0.438	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TICRR	HGNC	protein_coding	OTTHUMT00000312856.1		0.00	70	0	G	NM_152259		90125942	+1			no_errors	ENST00000268138	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.988	T
TMEM132D	121256	genome.wustl.edu	37	12	129558777	129558777	+	Silent	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:129558777G>A	ENST00000422113.2	-	9	3269	c.2943C>T	c.(2941-2943)gcC>gcT	p.A981A	TMEM132D_ENST00000389441.4_Silent_p.A519A	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	981					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CTTGCGAGGAGGCAAAGTTGA	0.488																																																	0													120.0	106.0	111.0					12																	129558777		2203	4300	6503	SO:0001819	synonymous_variant	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2943C>T	12.37:g.129558777G>A			Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	NULL	p.A981	ENST00000422113.2	37	c.2943	CCDS9266.1	12																																																																																			TMEM132D	-	NULL	ENSG00000151952		0.488	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	-	0.00	54	0	G	NM_133448		129558777	-1	tier1	-	no_errors	ENST00000422113	ensembl	human	known	74_37	silent	39.62	32	21	SNP	0.000	A
TNXB	7148	genome.wustl.edu	37	6	32036692	32036692	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:32036692A>T	ENST00000375244.3	-	16	6010	c.5809T>A	c.(5809-5811)Tct>Act	p.S1937T	TNXB_ENST00000375247.2_Missense_Mutation_p.S1937T			P22105	TENX_HUMAN	tenascin XB	2019	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TCCAGGCCAGAGAGGGTGATG	0.527																																																	0													109.0	125.0	119.0					6																	32036692		1362	2604	3966	SO:0001583	missense	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.5809T>A	6.37:g.32036692A>T	ENSP00000364393:p.Ser1937Thr		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.S1937T	ENST00000375244.3	37	c.5809		6	.	.	.	.	.	.	.	.	.	.	A	8.284	0.816260	0.16607	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.04454	3.62;3.62	5.16	-1.83	0.07833	.	0.703789	0.12230	N	0.487552	T	0.00815	0.0027	L	0.36672	1.1	0.09310	N	1	B	0.25441	0.126	B	0.25140	0.058	T	0.47328	-0.9126	10	0.06625	T	0.88	.	3.7579	0.08592	0.2917:0.0:0.237:0.4712	.	1937	P22105-3	.	T	1937	ENSP00000364393:S1937T;ENSP00000364396:S1937T	ENSP00000364393:S1937T	S	-	1	0	TNXB	32144670	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	-0.570000	0.05895	-0.211000	0.10124	0.533000	0.62120	TCT	TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000168477		0.527	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	-	0.00	54	0	A	NM_019105		32036692	-1	tier1	-	no_errors	ENST00000375247	ensembl	human	known	74_37	missense	39.29	17	11	SNP	0.000	T
TNFAIP3	7128	genome.wustl.edu	37	6	138196069	138196069	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr6:138196069G>T	ENST00000237289.4	+	3	449	c.383G>T	c.(382-384)aGc>aTc	p.S128I		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	128	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)|p.W113_F140del(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		GCGCTGTTCAGCACGCTCAAG	0.493			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																GBM(130;153 1739 22295 28918 47987)			Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	26	Whole gene deletion(25)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(26)											122.0	111.0	115.0					6																	138196069		2203	4300	6503	SO:0001583	missense	0			M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.383G>T	6.37:g.138196069G>T	ENSP00000237289:p.Ser128Ile		B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	pfam_Znf_A20,pfam_OTU,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.S128I	ENST00000237289.4	37	c.383	CCDS5187.1	6	.	.	.	.	.	.	.	.	.	.	G	22.5	4.299720	0.81136	.	.	ENSG00000118503	ENST00000420009;ENST00000237289;ENST00000535574;ENST00000535332;ENST00000539356;ENST00000544646;ENST00000536070	T;T	0.32988	1.43;1.43	5.97	5.97	0.96955	Ovarian tumour, otubain (2);	0.177879	0.64402	D	0.000008	T	0.23171	0.0560	L	0.36672	1.1	0.47245	D	0.99936	P	0.45672	0.864	P	0.49192	0.602	T	0.00981	-1.1492	10	0.48119	T	0.1	-5.6135	12.8542	0.57876	0.0746:0.0:0.9254:0.0	.	128	P21580	TNAP3_HUMAN	I	128	ENSP00000401562:S128I;ENSP00000237289:S128I	ENSP00000237289:S128I	S	+	2	0	TNFAIP3	138237762	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.772000	0.55325	2.819000	0.97034	0.655000	0.94253	AGC	TNFAIP3	-	pfam_OTU,pfscan_OTU	ENSG00000118503		0.493	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFAIP3	HGNC	protein_coding	OTTHUMT00000042414.1	-	0.00	50	0	G			138196069	+1	tier1	-	no_errors	ENST00000237289	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
TOMM20L	387990	genome.wustl.edu	37	14	58874106	58874106	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr14:58874106G>T	ENST00000360945.2	+	4	367	c.325G>T	c.(325-327)Gaa>Taa	p.E109*	RP11-517O13.1_ENST00000556734.1_RNA|TIMM9_ENST00000216463.4_5'Flank	NM_207377.2	NP_997260.1	Q6UXN7	TO20L_HUMAN	translocase of outer mitochondrial membrane 20 homolog (yeast)-like	109					protein targeting (GO:0006605)	integral component of membrane (GO:0016021)|mitochondrial outer membrane translocase complex (GO:0005742)				large_intestine(2)|lung(2)	4						GCAACCACGGGAACTTCTGAA	0.423																																																	0													102.0	96.0	98.0					14																	58874106		2203	4300	6503	SO:0001587	stop_gained	0				CCDS9734.1	14q23.1	2009-01-14			ENSG00000196860	ENSG00000196860			33752	protein-coding gene	gene with protein product	"""translocase of outer mitochondrial membrane 20 homolog type I"""					15733919	Standard	NM_207377		Approved	UNQ9438	uc001xdr.1	Q6UXN7	OTTHUMG00000140323	ENST00000360945.2:c.325G>T	14.37:g.58874106G>T	ENSP00000354204:p.Glu109*		B2RPR0	Nonsense_Mutation	SNP	pfam_MAS20_rcpt-related,superfamily_Tom20_dom,pirsf_MAS20_rcpt-related,prints_MAS20_rcpt_metazoan,prints_MAS20_rcpt-related	p.E109*	ENST00000360945.2	37	c.325	CCDS9734.1	14	.	.	.	.	.	.	.	.	.	.	G	15.28	2.787521	0.49997	.	.	ENSG00000196860	ENST00000360945	.	.	.	4.97	1.94	0.25998	.	0.129986	0.35235	N	0.003355	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-8.3114	3.7964	0.08741	0.2998:0.1863:0.5139:0.0	.	.	.	.	X	109	.	ENSP00000354204:E109X	E	+	1	0	TOMM20L	57943859	0.959000	0.32827	0.734000	0.30879	0.718000	0.41266	1.712000	0.37940	0.692000	0.31613	0.655000	0.94253	GAA	TOMM20L	-	superfamily_Tom20_dom,pirsf_MAS20_rcpt-related,prints_MAS20_rcpt_metazoan,prints_MAS20_rcpt-related	ENSG00000196860		0.423	TOMM20L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM20L	HGNC	protein_coding	OTTHUMT00000276937.1	-	0.00	33	0	G	NM_207377		58874106	+1	tier1	-	no_errors	ENST00000360945	ensembl	human	known	74_37	nonsense	42.86	16	12	SNP	0.623	T
TOP2B	7155	genome.wustl.edu	37	3	25670414	25670414	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:25670414G>T	ENST00000264331.4	-	15	1829	c.1830C>A	c.(1828-1830)ttC>ttA	p.F610L	TOP2B_ENST00000435706.2_Missense_Mutation_p.F605L	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	610					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	GAATACTGTAGAAGGAAAGTT	0.254																																																	0													54.0	51.0	52.0					3																	25670414		1787	4055	5842	SO:0001583	missense	0			X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.1830C>A	3.37:g.25670414G>T	ENSP00000264331:p.Phe610Leu		Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	pfam_Topo_IIA_A/C,pfam_Topo_IIA_bsu_dom2,pfam_DTHCT,pfam_HATPase_ATP-bd,superfamily_Topo_IIA_like_dom,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,smart_Topo_IIA_A/C,prints_TopoII_euk,prints_Topo_IIA,prints_Transcrpt_fac_NFYB/HAP3	p.F610L	ENST00000264331.4	37	c.1830		3	.	.	.	.	.	.	.	.	.	.	G	24.8	4.568841	0.86439	.	.	ENSG00000077097	ENST00000435706;ENST00000264331;ENST00000424225	T;T	0.49720	0.77;0.77	5.37	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.78521	0.4296	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85912	0.1441	10	0.87932	D	0	-6.5001	14.0684	0.64847	0.073:0.0:0.927:0.0	.	605	Q02880-2	.	L	605;610;605	ENSP00000396704:F605L;ENSP00000264331:F610L	ENSP00000264331:F610L	F	-	3	2	TOP2B	25645418	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.792000	0.62467	1.394000	0.46624	0.650000	0.86243	TTC	TOP2B	-	superfamily_Topo_IIA_like_dom,smart_Topo_IIA	ENSG00000077097		0.254	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	TOP2B	HGNC	protein_coding		-	0.00	61	0	G			25670414	-1	tier1	-	no_errors	ENST00000264331	ensembl	human	known	74_37	missense	33.33	20	10	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578401	7578401	+	Missense_Mutation	SNP	G	G	A	rs147002414		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:7578401G>A	ENST00000269305.4	-	5	718	c.529C>T	c.(529-531)Ccc>Tcc	p.P177S	TP53_ENST00000359597.4_Missense_Mutation_p.P177S|TP53_ENST00000413465.2_Missense_Mutation_p.P177S|TP53_ENST00000420246.2_Missense_Mutation_p.P177S|TP53_ENST00000455263.2_Missense_Mutation_p.P177S|TP53_ENST00000445888.2_Missense_Mutation_p.P177S|TP53_ENST00000574684.1_5'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	177	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		CP -> FS (in a sporadic cancer; somatic mutation).|P -> A (in a sporadic cancer; somatic mutation).|P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> I (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|P -> L (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|P -> S (in sporadic cancers; somatic mutation).|P -> T (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P177_C182delPHHERC(8)|p.0?(8)|p.P177S(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.H178fs*69(2)|p.P177fs*3(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.P177fs*69(1)|p.R175_H178>X(1)|p.P177fs*4(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.P177I(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.R174fs*3(1)|p.P177T(1)|p.E171fs*61(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCATGGTGGGGGCAGCGCCTC	0.652		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	65	Deletion - Frameshift(23)|Deletion - In frame(20)|Substitution - Missense(10)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(1)	large_intestine(11)|upper_aerodigestive_tract(10)|breast(10)|oesophagus(6)|haematopoietic_and_lymphoid_tissue(5)|central_nervous_system(4)|bone(4)|ovary(3)|lung(2)|liver(2)|prostate(2)|thyroid(1)|stomach(1)|biliary_tract(1)|endometrium(1)|urinary_tract(1)|pancreas(1)											48.0	48.0	48.0					17																	7578401		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.529C>T	17.37:g.7578401G>A	ENSP00000269305:p.Pro177Ser		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.P177S	ENST00000269305.4	37	c.529	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	34	5.327329	0.95708	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99881	-7.47;-7.47;-7.47;-7.47;-7.47;-7.47;-7.47;-7.47	5.59	5.59	0.84812	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.052869	0.85682	D	0.000000	D	0.99902	0.9953	M	0.90082	3.085	0.80722	D	1	D;D;P;D;D;D;D	0.89917	0.998;0.993;0.747;1.0;0.995;0.995;0.993	D;D;P;D;D;D;D	0.81914	0.964;0.958;0.497;0.995;0.964;0.975;0.941	D	0.96424	0.9314	10	0.87932	D	0	-24.4396	17.4784	0.87667	0.0:0.0:1.0:0.0	.	138;177;177;84;177;177;177	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	S	177;177;177;177;177;177;166;84;45;84;45	ENSP00000410739:P177S;ENSP00000352610:P177S;ENSP00000269305:P177S;ENSP00000398846:P177S;ENSP00000391127:P177S;ENSP00000391478:P177S;ENSP00000425104:P45S;ENSP00000423862:P84S	ENSP00000269305:P177S	P	-	1	0	TP53	7519126	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	9.813000	0.99286	2.804000	0.96469	0.655000	0.94253	CCC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	397	0	G	NM_000546		7578401	-1	tier1	rs147002414	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	46.38	148	128	SNP	1.000	A
TPTEP1	387590	genome.wustl.edu	37	22	17178477	17178477	+	lincRNA	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr22:17178477C>T	ENST00000423580.2	-	0	0																											GGGCCCAATGCCCACCGGGAT	0.607																																																	0																																												0																															22.37:g.17178477C>T				RNA	SNP	-	NULL	ENST00000423580.2	37	NULL		22																																																																																			TPTEP1	-	-	ENSG00000100181		0.607	KB-7G2.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	TPTEP1	HGNC	lincRNA	OTTHUMT00000418976.1	-	0.00	96	0	C			17178477	+1	tier1	-	no_errors	ENST00000558085	ensembl	human	known	74_37	rna	21.33	59	16	SNP	1.000	T
TRIM24	8805	genome.wustl.edu	37	7	138268703	138268703	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:138268703G>T	ENST00000343526.4	+	18	3117	c.2902G>T	c.(2902-2904)Gat>Tat	p.D968Y	TRIM24_ENST00000415680.2_Missense_Mutation_p.D934Y			O15164	TIF1A_HUMAN	tripartite motif containing 24	968	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				calcium ion homeostasis (GO:0055074)|cellular response to estrogen stimulus (GO:0071391)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of protein stability (GO:0031647)|regulation of signal transduction by p53 class mediator (GO:1901796)|regulation of vitamin D receptor signaling pathway (GO:0070562)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|ligase activity (GO:0016874)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	40						TTTTGTAGCTGATTTTAGATT	0.348																																					Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)												0													75.0	84.0	81.0					7																	138268703		2203	4300	6503	SO:0001583	missense	0			AF009353	CCDS5847.1, CCDS47720.1	7q32-q34	2013-01-28	2011-01-25	2005-06-02	ENSG00000122779	ENSG00000122779		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	11812	protein-coding gene	gene with protein product		603406	"""transcriptional intermediary factor 1"", ""tripartite motif-containing 24"""	TIF1		9115274, 9191165	Standard	NM_003852		Approved	hTIF1, Tif1a, RNF82, TIF1A	uc003vuc.3	O15164	OTTHUMG00000155820	ENST00000343526.4:c.2902G>T	7.37:g.138268703G>T	ENSP00000340507:p.Asp968Tyr		A4D1R7|A4D1R8|O95854	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_Bromodomain,prints_Bromodomain	p.D968Y	ENST00000343526.4	37	c.2902	CCDS5847.1	7	.	.	.	.	.	.	.	.	.	.	G	28.7	4.941622	0.92526	.	.	ENSG00000122779	ENST00000343526;ENST00000452999;ENST00000536822;ENST00000415680	T;T	0.44881	0.91;0.91	5.95	5.95	0.96441	Bromodomain (6);Bromodomain, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.80232	0.4585	H	0.98629	4.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87215	0.2250	10	0.87932	D	0	-24.2854	19.9698	0.97280	0.0:0.0:1.0:0.0	.	968;934	O15164;O15164-2	TIF1A_HUMAN;.	Y	968;360;879;934	ENSP00000340507:D968Y;ENSP00000390829:D934Y	ENSP00000340507:D968Y	D	+	1	0	TRIM24	137919243	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.687000	0.84139	2.817000	0.96982	0.563000	0.77884	GAT	TRIM24	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	ENSG00000122779		0.348	TRIM24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM24	HGNC	protein_coding	OTTHUMT00000341814.1	-	0.00	41	0	G	NM_015905		138268703	+1	tier1	-	no_errors	ENST00000343526	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
TRIM51	84767	genome.wustl.edu	37	11	55653117	55653117	+	Silent	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr11:55653117G>A	ENST00000449290.2	+	2	305	c.213G>A	c.(211-213)aaG>aaA	p.K71K	TRIM51_ENST00000244891.3_5'Flank	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	71						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										TTTGTTTGAAGAACATGGCTT	0.473																																																	0													30.0	26.0	27.0					11																	55653117		692	1591	2283	SO:0001819	synonymous_variant	0			BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.213G>A	11.37:g.55653117G>A			A6NMG2	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.K71	ENST00000449290.2	37	c.213		11																																																																																			TRIM51	-	NULL	ENSG00000124900		0.473	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	TRIM51	HGNC	protein_coding	OTTHUMT00000391522.1	-	0.00	179	0	G	NM_032681		55653117	+1	tier1	-	no_errors	ENST00000449290	ensembl	human	known	74_37	silent	30.56	100	44	SNP	0.002	A
TRIP11	9321	genome.wustl.edu	37	14	92472507	92472507	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr14:92472507C>A	ENST00000267622.4	-	11	2186	c.1813G>T	c.(1813-1815)Gag>Tag	p.E605*		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	605					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		TCTAAATTCTCCTTCTGGATG	0.313			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)			Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	0													96.0	96.0	96.0					14																	92472507		2203	4296	6499	SO:0001587	stop_gained	0			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.1813G>T	14.37:g.92472507C>A	ENSP00000267622:p.Glu605*		B2RUT2|O14689|O15154|O95949	Nonsense_Mutation	SNP	superfamily_Ribosomal_L29,pfscan_GRIP	p.E605*	ENST00000267622.4	37	c.1813	CCDS9899.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.19|17.19	3.325998|3.325998	0.60743|0.60743	.|.	.|.	ENSG00000100815|ENSG00000100815	ENST00000267622;ENST00000542257|ENST00000554357	.|.	.|.	.|.	6.16|6.16	3.4|3.4	0.38934|0.38934	.|.	0.048060|.	0.85682|.	D|.	0.000000|.	.|T	.|0.55657	.|0.1934	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.62886	.|-0.6759	.|3	0.45353|.	T|.	0.12|.	.|.	11.6091|11.6091	0.51049|0.51049	0.0:0.8118:0.0:0.1882|0.0:0.8118:0.0:0.1882	.|.	.|.	.|.	.|.	X|V	605;341|320	.|.	ENSP00000267622:E605X|.	E|G	-|-	1|2	0|0	TRIP11|TRIP11	91542260|91542260	1.000000|1.000000	0.71417|0.71417	0.870000|0.870000	0.34147|0.34147	0.008000|0.008000	0.06430|0.06430	5.549000|5.549000	0.67261|0.67261	0.492000|0.492000	0.27815|0.27815	-0.806000|-0.806000	0.03193|0.03193	GAG|GGA	TRIP11	-	NULL	ENSG00000100815		0.313	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP11	HGNC	protein_coding	OTTHUMT00000411823.1	-	0.00	110	0	C			92472507	-1	tier1	-	no_errors	ENST00000267622	ensembl	human	known	74_37	nonsense	34.38	42	22	SNP	0.997	A
TRIP12	9320	genome.wustl.edu	37	2	230660024	230660024	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:230660024C>T	ENST00000283943.5	-	25	3792	c.3614G>A	c.(3613-3615)gGa>gAa	p.G1205E	TRIP12_ENST00000389045.3_Missense_Mutation_p.G935E|TRIP12_ENST00000389044.4_Missense_Mutation_p.G1253E	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1205					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TTCCACTCTTCCAATGGGCTC	0.383																																																	0													82.0	74.0	77.0					2																	230660024		2203	4300	6503	SO:0001583	missense	0			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.3614G>A	2.37:g.230660024C>T	ENSP00000283943:p.Gly1205Glu		D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ARM-type_fold,smart_HECT,pfscan_HECT,pfscan_WWE-dom	p.G1205E	ENST00000283943.5	37	c.3614	CCDS33391.1	2	.	.	.	.	.	.	.	.	.	.	C	16.46	3.130400	0.56721	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.44482	0.92;1.29;0.92	5.74	4.87	0.63330	.	0.094559	0.64402	N	0.000001	T	0.33904	0.0879	L	0.54323	1.7	0.80722	D	1	B;B;B	0.27559	0.155;0.181;0.155	B;B;B	0.30572	0.117;0.075;0.117	T	0.11518	-1.0584	10	0.02654	T	1	.	10.3486	0.43920	0.0:0.7951:0.1344:0.0705	.	935;1253;1205	Q14CF1;Q14CA3;Q14669	.;.;TRIPC_HUMAN	E	1205;935;1253	ENSP00000283943:G1205E;ENSP00000373697:G935E;ENSP00000373696:G1253E	ENSP00000283943:G1205E	G	-	2	0	TRIP12	230368268	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.421000	0.59848	1.438000	0.47492	0.650000	0.86243	GGA	TRIP12	-	NULL	ENSG00000153827		0.383	TRIP12-001	KNOWN	basic|CCDS	protein_coding	TRIP12	HGNC	protein_coding	OTTHUMT00000331861.3	-	0.00	41	0	C	NM_004238		230660024	-1	tier1	-	no_errors	ENST00000283943	ensembl	human	known	74_37	missense	23.33	22	7	SNP	1.000	T
TSKS	60385	genome.wustl.edu	37	19	50243122	50243122	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:50243122G>T	ENST00000246801.3	-	11	1772	c.1690C>A	c.(1690-1692)Ctg>Atg	p.L564M	TSKS_ENST00000358830.3_Missense_Mutation_p.L364M	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	564					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		TCAAGTGGCAGGTTGCTGAGA	0.587																																																	0													106.0	101.0	103.0					19																	50243122		2203	4300	6503	SO:0001583	missense	0			BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.1690C>A	19.37:g.50243122G>T	ENSP00000246801:p.Leu564Met		Q8WXJ0	Missense_Mutation	SNP	NULL	p.L564M	ENST00000246801.3	37	c.1690	CCDS12780.1	19	.	.	.	.	.	.	.	.	.	.	G	13.05	2.120688	0.37436	.	.	ENSG00000126467	ENST00000246801;ENST00000358830	T;T	0.38240	1.15;1.15	5.44	4.39	0.52855	.	0.000000	0.37761	N	0.001959	T	0.43411	0.1246	N	0.24115	0.695	0.29884	N	0.825798	D	0.76494	0.999	D	0.85130	0.997	T	0.39522	-0.9610	10	0.59425	D	0.04	-16.8191	10.4585	0.44565	0.0914:0.0:0.9086:0.0	.	564	Q9UJT2	TSKS_HUMAN	M	564;364	ENSP00000246801:L564M;ENSP00000351691:L364M	ENSP00000246801:L564M	L	-	1	2	TSKS	54934934	1.000000	0.71417	1.000000	0.80357	0.177000	0.22998	1.943000	0.40253	1.267000	0.44247	0.609000	0.83330	CTG	TSKS	-	NULL	ENSG00000126467		0.587	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSKS	HGNC	protein_coding	OTTHUMT00000465795.1	-	0.00	55	0	G	NM_021733		50243122	-1	tier1	-	no_errors	ENST00000246801	ensembl	human	known	74_37	missense	20.00	48	12	SNP	1.000	T
TTLL1	25809	genome.wustl.edu	37	22	43464566	43464566	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr22:43464566G>T	ENST00000266254.7	-	5	593	c.353C>A	c.(352-354)gCt>gAt	p.A118D	TTLL1_ENST00000331018.7_Missense_Mutation_p.A118D	NM_012263.4	NP_036395.1	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1	118	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				axoneme assembly (GO:0035082)|epithelial cilium movement (GO:0003351)|protein polyglutamylation (GO:0018095)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	tubulin-glutamic acid ligase activity (GO:0070740)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|stomach(1)	23		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		GTTGTAGTCAGCGGGCAGCAT	0.537																																																	0													146.0	149.0	148.0					22																	43464566		2203	4300	6503	SO:0001583	missense	0			AL096886	CCDS14043.1	22q13.1	2013-02-14			ENSG00000100271	ENSG00000100271		"""Tubulin tyrosine ligase-like family"""	1312	protein-coding gene	gene with protein product		608955	"""tubulin tyrosine ligase-like 1"""	C22orf7		10591208, 11054573	Standard	NM_012263		Approved		uc003bdi.3	O95922	OTTHUMG00000150699	ENST00000266254.7:c.353C>A	22.37:g.43464566G>T	ENSP00000266254:p.Ala118Asp		B2RDS7|Q9BR27|Q9NRS9|Q9UMU0	Missense_Mutation	SNP	pfam_TTL/TTLL_fam	p.A118D	ENST00000266254.7	37	c.353	CCDS14043.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.9|24.9	4.578522|4.578522	0.86645|0.86645	.|.	.|.	ENSG00000100271|ENSG00000100271	ENST00000331018;ENST00000266254|ENST00000495814	T;T|.	0.07327|.	3.2;3.2|.	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	0.047520|.	0.85682|.	D|.	0.000000|.	T|T	0.75280|0.75280	0.3828|0.3828	M|M	0.66506|0.66506	2.035|2.035	0.80722|0.80722	D|D	1|1	P;P|.	0.49253|.	0.921;0.851|.	P;P|.	0.51550|.	0.543;0.673|.	T|T	0.73081|0.73081	-0.4095|-0.4095	10|5	0.66056|.	D|.	0.02|.	.|.	19.4814|19.4814	0.95011|0.95011	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	118;118|.	O95922-4;O95922|.	.;TTLL1_HUMAN|.	D|M	118|44	ENSP00000333734:A118D;ENSP00000266254:A118D|.	ENSP00000266254:A118D|.	A|L	-|-	2|1	0|2	TTLL1|TTLL1	41794510|41794510	1.000000|1.000000	0.71417|0.71417	0.144000|0.144000	0.22314|0.22314	0.841000|0.841000	0.47740|0.47740	9.369000|9.369000	0.97156|0.97156	2.603000|2.603000	0.88011|0.88011	0.655000|0.655000	0.94253|0.94253	GCT|CTG	TTLL1	-	pfam_TTL/TTLL_fam	ENSG00000100271		0.537	TTLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL1	HGNC	protein_coding	OTTHUMT00000319659.1		0.00	35	0	G	NM_012263		43464566	-1			no_errors	ENST00000266254	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.996	T
TTLL7	79739	genome.wustl.edu	37	1	84417943	84417943	+	5'UTR	SNP	T	T	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:84417943T>C	ENST00000260505.8	-	0	329				TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7						cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		TACCAAGCTCTCAGGAAATCT	0.418																																																	0													70.0	64.0	66.0					1																	84417943		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.-49A>G	1.37:g.84417943T>C			Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	RNA	SNP	-	NULL	ENST00000260505.8	37	NULL	CCDS690.2	1																																																																																			TTLL7	-	-	ENSG00000137941		0.418	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL7	HGNC	protein_coding	OTTHUMT00000027498.1	-	0.00	24	0	T	NM_024686		84417943	-1	tier1	-	no_errors	ENST00000477524	ensembl	human	known	74_37	rna	29.41	12	5	SNP	0.125	C
TTN	7273	genome.wustl.edu	37	2	179431596	179431596	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:179431596G>T	ENST00000591111.1	-	276	74564	c.74340C>A	c.(74338-74340)taC>taA	p.Y24780*	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.Y17481*|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Nonsense_Mutation_p.Y17356*|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.Y26421*|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.Y17548*|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.Y23853*|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	24780	Fibronectin type-III 80. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTCTACAATGTAACCAATAA	0.413																																																	0													64.0	62.0	62.0					2																	179431596		1876	4108	5984	SO:0001587	stop_gained	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.74340C>A	2.37:g.179431596G>T	ENSP00000465570:p.Tyr24780*		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.Y23853*	ENST00000591111.1	37	c.71559		2	.	.	.	.	.	.	.	.	.	.	G	63	79.388558	0.99993	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.75	2.55	0.30701	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.5366	0.45007	0.2899:0.0:0.7101:0.0	.	.	.	.	X	23853;17356;17548;17481;17354	.	ENSP00000340554:Y17548X	Y	-	3	2	TTN	179139842	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	2.411000	0.44600	0.776000	0.33473	0.561000	0.74099	TAC	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	47	0	G	NM_133378		179431596	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	nonsense	11.43	31	4	SNP	1.000	T
TUBA3D	113457	genome.wustl.edu	37	2	132238133	132238133	+	Silent	SNP	C	C	T	rs554719635	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:132238133C>T	ENST00000321253.6	+	4	974	c.867C>T	c.(865-867)gcC>gcT	p.A289A		NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	289					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		TGTCTGTGGCCGAGATCACCA	0.597													.|||	22	0.00439297	0.0068	0.0029	5008	,	,		17648	0.006		0.004	False		,,,				2504	0.001				Ovarian(137;2059 2432 35543 39401)												0													82.0	116.0	105.0					2																	132238133		2200	4298	6498	SO:0001819	synonymous_variant	0			K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.867C>T	2.37:g.132238133C>T			A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.A289	ENST00000321253.6	37	c.867	CCDS33290.1	2																																																																																			TUBA3D	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin	ENSG00000075886		0.597	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA3D	HGNC	protein_coding	OTTHUMT00000331800.2	-	0.00	130	0	C	NM_080386		132238133	+1	tier1	rs140955382	no_errors	ENST00000321253	ensembl	human	known	74_37	silent	38.38	61	38	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179620975	179620975	+	Intron	SNP	G	G	A	rs368071705		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:179620975G>A	ENST00000591111.1	-	44	10528				TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000360870.5_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.T3743M|TTN-AS1_ENST00000610005.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T3572M|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACTGCTGACGTTGTCCTCTC	0.388																																																	0								G	,,,,MET/THR	0,3900		0,0,1950	176.0	175.0	175.0		,,,,10715	1.5	0.0	2		175	1,8309		0,1,4154	no	intron,intron,intron,intron,missense	TTN	NM_003319.4,NM_133378.4,NM_133379.3,NM_133432.3,NM_133437.3	,,,,81	0,1,6104	AA,AG,GG		0.012,0.0,0.0082	,,,,	,,,,3572/27119	179620975	1,12209	1950	4155	6105	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10303+2735C>T	2.37:g.179620975G>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.T3572M	ENST00000591111.1	37	c.10715		2	.	.	.	.	.	.	.	.	.	.	G	8.954	0.968835	0.18659	0.0	1.2E-4	ENSG00000155657	ENST00000342175	T	0.68331	-0.32	5.33	1.47	0.22746	.	.	.	.	.	T	0.53658	0.1810	.	.	.	0.23204	N	0.998129	B	0.14438	0.01	B	0.15052	0.012	T	0.48127	-0.9062	8	0.87932	D	0	.	7.0478	0.25055	0.2079:0.1246:0.6674:0.0	.	3572	E7ET18	.	M	3572	ENSP00000340554:T3572M	ENSP00000340554:T3572M	T	-	2	0	TTN	179329220	0.448000	0.25681	0.000000	0.03702	0.641000	0.38312	3.077000	0.50089	-0.008000	0.14320	0.650000	0.86243	ACG	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000155657		0.388	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	65	0	G	NM_133378		179620975	-1	tier1	-	no_errors	ENST00000342175	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.010	A
P2RX6	9127	genome.wustl.edu	37	22	21367445	21367445	+	5'Flank	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr22:21367445C>T	ENST00000413302.2	+	0	0				TUBA3FP_ENST00000422086.1_RNA|P2RX6_ENST00000591411.1_Intron|P2RX6_ENST00000402329.3_5'Flank|P2RX6_ENST00000401443.1_5'Flank|P2RX6_ENST00000443995.3_5'Flank|THAP7-AS1_ENST00000452284.1_RNA|P2RX6_ENST00000336296.2_5'Flank			O15547	P2RX6_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 6						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|channel activity (GO:0015267)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)										ACAGGGTGTCCCCGACCAGTT	0.592																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS13788.2, CCDS54504.1	22q11.21	2012-01-17	2008-03-28	2008-03-28	ENSG00000099957	ENSG00000099957		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8538	protein-coding gene	gene with protein product		608077	"""purinergic receptor P2X-like 1, orphan receptor"""	P2RXL1		9242461, 10591208, 8786426	Standard	NM_005446		Approved	P2XM, MGC129625, P2X6	uc010gsu.1	O15547	OTTHUMG00000150689		22.37:g.21367445C>T	Exception_encountered		F6V3D7|Q32MB6|Q58F04|Q6IC33|Q9UL50	RNA	SNP	-	NULL	ENST00000413302.2	37	NULL	CCDS13788.2	22																																																																																			TUBA3FP	-	-	ENSG00000161149		0.592	P2RX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA3FP	HGNC	protein_coding	OTTHUMT00000319625.2	-	0.00	24	0	C	NM_005446		21367445	-1	tier1	-	no_errors	ENST00000292748	ensembl	human	known	74_37	rna	29.17	17	7	SNP	0.013	T
P2RX6	9127	genome.wustl.edu	37	22	21368288	21368288	+	5'Flank	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr22:21368288C>T	ENST00000413302.2	+	0	0				P2RX6_ENST00000402329.3_5'Flank|TUBA3FP_ENST00000422086.1_RNA|P2RX6_ENST00000591411.1_Intron|P2RX6_ENST00000336296.2_5'Flank|P2RX6_ENST00000401443.1_5'Flank|P2RX6_ENST00000443995.3_5'Flank			O15547	P2RX6_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 6						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|channel activity (GO:0015267)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)										GCCTCCTCGGCGGCGCCAGCC	0.716																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS13788.2, CCDS54504.1	22q11.21	2012-01-17	2008-03-28	2008-03-28	ENSG00000099957	ENSG00000099957		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8538	protein-coding gene	gene with protein product		608077	"""purinergic receptor P2X-like 1, orphan receptor"""	P2RXL1		9242461, 10591208, 8786426	Standard	NM_005446		Approved	P2XM, MGC129625, P2X6	uc010gsu.1	O15547	OTTHUMG00000150689		22.37:g.21368288C>T	Exception_encountered		F6V3D7|Q32MB6|Q58F04|Q6IC33|Q9UL50	RNA	SNP	-	NULL	ENST00000413302.2	37	NULL	CCDS13788.2	22																																																																																			TUBA3FP	-	-	ENSG00000161149		0.716	P2RX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA3FP	HGNC	protein_coding	OTTHUMT00000319625.2		0.00	22	0	C	NM_005446		21368288	-1			no_errors	ENST00000292748	ensembl	human	known	74_37	rna	12.12	29	4	SNP	0.000	T
TULP2	7288	genome.wustl.edu	37	19	49387034	49387034	+	Silent	SNP	G	G	T	rs376067742		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:49387034G>T	ENST00000221399.3	-	11	1396	c.1252C>A	c.(1252-1254)Cga>Aga	p.R418R		NM_003323.2	NP_003314.2	O00295	TULP2_HUMAN	tubby like protein 2	418					visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	protein complex binding (GO:0032403)			NS(1)|breast(2)|central_nervous_system(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	22		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		ACATTGATTCGCTGGTTCTGG	0.547																																																	0													109.0	101.0	104.0					19																	49387034		2203	4300	6503	SO:0001819	synonymous_variant	0			U82469	CCDS12739.1	19q13.1	2009-08-06			ENSG00000104804	ENSG00000104804			12424	protein-coding gene	gene with protein product	"""cancer/testis antigen 65"""	602309				9096357	Standard	NM_003323		Approved	TUBL2, CT65	uc002pkz.2	O00295	OTTHUMG00000164406	ENST00000221399.3:c.1252C>A	19.37:g.49387034G>T			Q8TC50	Silent	SNP	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_C,prints_Tubby_N	p.R418	ENST00000221399.3	37	c.1252	CCDS12739.1	19																																																																																			TULP2	-	pfam_Tubby_C,superfamily_Tubby_C-like	ENSG00000104804		0.547	TULP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP2	HGNC	protein_coding	OTTHUMT00000378633.1	-	0.00	108	0	G	NM_003323		49387034	-1	tier1	-	no_errors	ENST00000221399	ensembl	human	known	74_37	silent	30.51	41	18	SNP	1.000	T
TXNDC16	57544	genome.wustl.edu	37	14	52937324	52937324	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr14:52937324C>T	ENST00000281741.4	-	15	1758	c.1387G>A	c.(1387-1389)Gaa>Aaa	p.E463K	TXNDC16_ENST00000554399.1_Intron	NM_001160047.1|NM_020784.2	NP_001153519.1|NP_065835.2	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16	463	Thioredoxin.				cell redox homeostasis (GO:0045454)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(3)|skin(1)	21	Breast(41;0.0716)					ATAGGAAATTCAGTAACATTT	0.353																																																	0													115.0	109.0	111.0					14																	52937324		2203	4300	6503	SO:0001583	missense	0			AB037765	CCDS32083.1	14q22.1	2007-08-16	2007-08-16	2007-08-16		ENSG00000087301			19965	protein-coding gene	gene with protein product			"""KIAA1344"""	KIAA1344			Standard	NM_020784		Approved		uc001wzs.3	Q9P2K2		ENST00000281741.4:c.1387G>A	14.37:g.52937324C>T	ENSP00000281741:p.Glu463Lys		A5PKW9|A7E260|A7MD07|B9EH67|Q9H9W7	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.E463K	ENST00000281741.4	37	c.1387	CCDS32083.1	14	.	.	.	.	.	.	.	.	.	.	C	14.73	2.623270	0.46840	.	.	ENSG00000087301	ENST00000281741	T	0.38401	1.14	5.16	5.16	0.70880	Thioredoxin domain (1);Thioredoxin-like fold (2);	0.456220	0.25047	N	0.033559	T	0.27454	0.0674	L	0.36672	1.1	0.25064	N	0.991044	B;B	0.32573	0.32;0.376	B;B	0.37387	0.248;0.173	T	0.18903	-1.0322	10	0.08179	T	0.78	-43.0808	10.0324	0.42109	0.0:0.9077:0.0:0.0923	.	458;463	B7ZME4;Q9P2K2	.;TXD16_HUMAN	K	463	ENSP00000281741:E463K	ENSP00000281741:E463K	E	-	1	0	TXNDC16	52007074	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	1.754000	0.38369	2.539000	0.85634	0.655000	0.94253	GAA	TXNDC16	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	ENSG00000087301		0.353	TXNDC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNDC16	HGNC	protein_coding	OTTHUMT00000411681.1	-	0.00	47	0	C	XM_051699		52937324	-1	tier1	-	no_errors	ENST00000281741	ensembl	human	known	74_37	missense	38.46	16	10	SNP	1.000	T
UBR4	23352	genome.wustl.edu	37	1	19500928	19500928	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:19500928A>G	ENST00000375254.3	-	22	2894	c.2867T>C	c.(2866-2868)cTt>cCt	p.L956P	UBR4_ENST00000375226.2_Missense_Mutation_p.L956P|UBR4_ENST00000375267.2_Missense_Mutation_p.L956P|UBR4_ENST00000375217.2_Missense_Mutation_p.L956P	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	956					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTTGGAGAAAAGGACGTCACA	0.413																																																	0													105.0	91.0	96.0					1																	19500928		2203	4300	6503	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.2867T>C	1.37:g.19500928A>G	ENSP00000364403:p.Leu956Pro		A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.L956P	ENST00000375254.3	37	c.2867	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.430066	0.83776	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000419533	T;T;T;T	0.32272	1.49;1.49;1.47;1.46	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.47691	0.1459	L	0.40543	1.245	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.46816	-0.9164	10	0.87932	D	0	.	15.7251	0.77751	1.0:0.0:0.0:0.0	.	956	Q5T4S7	UBR4_HUMAN	P	956;956;956;956;172	ENSP00000364403:L956P;ENSP00000364416:L956P;ENSP00000364365:L956P;ENSP00000364374:L956P	ENSP00000364365:L956P	L	-	2	0	UBR4	19373515	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.377000	0.79668	2.197000	0.70478	0.533000	0.62120	CTT	UBR4	-	NULL	ENSG00000127481		0.413	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1		0.00	55	0	A	NM_020765		19500928	-1			no_errors	ENST00000375267	ensembl	human	known	74_37	missense	8.33	33	3	SNP	1.000	G
UNC13C	440279	genome.wustl.edu	37	15	54306906	54306906	+	Silent	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr15:54306906G>A	ENST00000260323.11	+	1	1806	c.1806G>A	c.(1804-1806)aaG>aaA	p.K602K	UNC13C_ENST00000537900.1_Silent_p.K602K|UNC13C_ENST00000545554.1_Silent_p.K602K	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	602					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		ACAGTCCCAAGGACCAGCATT	0.483																																																	0													127.0	122.0	124.0					15																	54306906		1981	4147	6128	SO:0001819	synonymous_variant	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.1806G>A	15.37:g.54306906G>A			Q0P613|Q8ND48|Q96NP3	Silent	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.K602	ENST00000260323.11	37	c.1806	CCDS45264.1	15																																																																																			UNC13C	-	NULL	ENSG00000137766		0.483	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	-	0.00	53	0	G	NM_173166		54306906	+1	tier1	-	no_errors	ENST00000260323	ensembl	human	known	74_37	silent	17.14	29	6	SNP	1.000	A
UNC13D	201294	genome.wustl.edu	37	17	73830787	73830787	+	Missense_Mutation	SNP	C	C	T	rs143939013	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr17:73830787C>T	ENST00000207549.4	-	22	2382	c.2003G>A	c.(2002-2004)cGc>cAc	p.R668H	UNC13D_ENST00000412096.2_Missense_Mutation_p.R668H	NM_199242.2	NP_954712.1	Q70J99	UN13D_HUMAN	unc-13 homolog D (C. elegans)	668	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				defense response to virus (GO:0051607)|germinal center formation (GO:0002467)|granuloma formation (GO:0002432)|natural killer cell degranulation (GO:0043320)|phagocytosis (GO:0006909)|positive regulation of exocytosis (GO:0045921)|regulation of mast cell degranulation (GO:0043304)	endosome (GO:0005768)|exocytic vesicle (GO:0070382)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			CAGGGCCAGGCGACAGGTGTC	0.622									Familial Hemophagocytic Lymphohistiocytosis				C|||	2	0.000399361	0.0008	0.0014	5008	,	,		14179	0.0		0.0	False		,,,				2504	0.0																0								C	HIS/ARG	1,4401	2.1+/-5.4	0,1,2200	26.0	30.0	29.0		2003	3.8	1.0	17	dbSNP_134	29	0,8598		0,0,4299	no	missense	UNC13D	NM_199242.2	29	0,1,6499	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	668/1091	73830787	1,12999	2201	4299	6500	SO:0001583	missense	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AK024474	CCDS11730.1	17q25.3	2014-09-17				ENSG00000092929			23147	protein-coding gene	gene with protein product		608897					Standard	NM_199242		Approved	Munc13-4	uc002jpp.3	Q70J99		ENST00000207549.4:c.2003G>A	17.37:g.73830787C>T	ENSP00000207549:p.Arg668His		B4DWG9|Q9H7K5	Missense_Mutation	SNP	pfam_C2_dom,pfam_Munc13_subgr_dom-2,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.R668H	ENST00000207549.4	37	c.2003	CCDS11730.1	17	.	.	.	.	.	.	.	.	.	.	C	22.3	4.271393	0.80469	2.27E-4	0.0	ENSG00000092929	ENST00000207549;ENST00000412096;ENST00000448606	T;T	0.80480	-1.38;-1.38	4.87	3.83	0.44106	Munc13 homology 1 (1);	0.073555	0.52532	D	0.000065	D	0.82999	0.5159	M	0.62723	1.935	0.43485	D	0.995712	D;D	0.71674	0.998;0.996	P;P	0.60609	0.877;0.563	T	0.83105	-0.0126	10	0.72032	D	0.01	5.5829	4.7052	0.12846	0.0:0.7811:0.0:0.2189	.	668;668	Q70J99-3;Q70J99	.;UN13D_HUMAN	H	668	ENSP00000207549:R668H;ENSP00000388093:R668H	ENSP00000207549:R668H	R	-	2	0	UNC13D	71342382	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.834000	0.48167	2.518000	0.84900	0.563000	0.77884	CGC	UNC13D	-	NULL	ENSG00000092929		0.622	UNC13D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC13D	HGNC	protein_coding	OTTHUMT00000448847.2	-	0.00	31	0	C	XM_113950		73830787	-1	tier1	rs143939013	no_errors	ENST00000412096	ensembl	human	known	74_37	missense	36.84	11	7	SNP	1.000	T
UNC79	57578	genome.wustl.edu	37	14	94088106	94088106	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr14:94088106G>T	ENST00000393151.2	+	30	4527	c.4527G>T	c.(4525-4527)tcG>tcT	p.S1509S	UNC79_ENST00000555664.1_Silent_p.S1509S|UNC79_ENST00000256339.4_Silent_p.S1332S|UNC79_ENST00000553484.1_Silent_p.S1531S			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1509					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						ATGCAGACTCGCTTTTGTTTA	0.433																																																	0													97.0	93.0	94.0					14																	94088106		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.4527G>T	14.37:g.94088106G>T			B5MDL6|Q6ZUT7	Silent	SNP	superfamily_P-loop_NTPase,superfamily_ARM-type_fold	p.S1531	ENST00000393151.2	37	c.4593		14																																																																																			UNC79	-	superfamily_ARM-type_fold	ENSG00000133958		0.433	UNC79-006	KNOWN	basic	protein_coding	UNC79	HGNC	protein_coding	OTTHUMT00000412766.1	-	0.00	30	0	G	XM_028395		94088106	+1	tier1	-	no_errors	ENST00000553484	ensembl	human	known	74_37	silent	23.08	29	9	SNP	1.000	T
UNKL	64718	genome.wustl.edu	37	16	1456057	1456057	+	Intron	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:1456057C>A	ENST00000389221.4	-	3	287				UNKL_ENST00000301712.5_Intron|LA16c-312E8.2_ENST00000568554.1_RNA|UNKL_ENST00000397462.1_Missense_Mutation_p.W133L|UNKL_ENST00000503648.1_Intron|UNKL_ENST00000508903.2_Intron	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				GGCTGGTTCCCAGGGAACGTG	0.637																																																	0																																										SO:0001627	intron_variant	0			BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.288-2712G>T	16.37:g.1456057C>A			B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.W133L	ENST00000389221.4	37	c.398	CCDS53981.1	16	.	.	.	.	.	.	.	.	.	.	C	7.869	0.727663	0.15439	.	.	ENSG00000059145	ENST00000397462	.	.	.	0.95	0.95	0.19572	.	.	.	.	.	T	0.15652	0.0377	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28235	-1.0050	5	0.10377	T	0.69	.	5.2234	0.15381	0.0:1.0:0.0:0.0	.	.	.	.	L	133	.	ENSP00000380604:W133L	W	-	2	0	UNKL	1396058	0.015000	0.18098	0.021000	0.16686	0.222000	0.24845	0.902000	0.28459	0.820000	0.34516	0.205000	0.17691	TGG	UNKL	-	NULL	ENSG00000059145		0.637	UNKL-201	KNOWN	basic|CCDS	protein_coding	UNKL	HGNC	protein_coding		-	0.00	61	0	C	NM_001037125		1456057	-1	tier1	-	no_errors	ENST00000397462	ensembl	human	known	74_37	missense	46.51	23	20	SNP	0.022	A
USP24	23358	genome.wustl.edu	37	1	55612610	55612610	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:55612610C>A	ENST00000294383.6	-	19	2241	c.2242G>T	c.(2242-2244)Gat>Tat	p.D748Y	USP24_ENST00000407756.1_Missense_Mutation_p.D588Y	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	748					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						ACCTCTCTATCTAATTCACAA	0.393																																																	0													117.0	110.0	112.0					1																	55612610		1859	4104	5963	SO:0001583	missense	0			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.2242G>T	1.37:g.55612610C>A	ENSP00000294383:p.Asp748Tyr		Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19/C67	p.D588Y	ENST00000294383.6	37	c.1762	CCDS44154.2	1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592577	0.86953	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.06294	3.32;3.35	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.24470	0.0593	M	0.62723	1.935	0.58432	D	0.999998	D	0.89917	1.0	D	0.68765	0.96	T	0.00060	-1.2162	10	0.87932	D	0	.	19.8535	0.96748	0.0:1.0:0.0:0.0	.	588	B7WPF4	.	Y	748;588	ENSP00000294383:D748Y;ENSP00000385700:D588Y	ENSP00000294383:D748Y	D	-	1	0	USP24	55385198	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.686000	0.91538	0.585000	0.79938	GAT	USP24	-	NULL	ENSG00000162402		0.393	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	HGNC	protein_coding	OTTHUMT00000022275.2	-	0.00	40	0	C			55612610	-1	tier1	-	no_errors	ENST00000407756	ensembl	human	known	74_37	missense	40.00	21	14	SNP	1.000	A
USP26	83844	genome.wustl.edu	37	X	132161455	132161455	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:132161455A>G	ENST00000511190.1	-	6	1263	c.794T>C	c.(793-795)gTa>gCa	p.V265A	USP26_ENST00000406273.1_Missense_Mutation_p.V265A|USP26_ENST00000370832.1_Missense_Mutation_p.V265A	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	265					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					TAACAGAAATACCAAAACCAT	0.383																																					NSCLC(104;342 1621 36940 47097 52632)												0													90.0	77.0	81.0					X																	132161455		2203	4300	6503	SO:0001583	missense	0			AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.794T>C	X.37:g.132161455A>G	ENSP00000423390:p.Val265Ala		B9WRT6|Q5H9H4	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.V265A	ENST00000511190.1	37	c.794	CCDS14635.1	X	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.568259	0.00895	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	T;T;T	0.52057	0.68;0.68;0.68	4.01	1.18	0.20946	.	1.208140	0.06459	N	0.729142	T	0.15782	0.0380	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26430	-1.0103	10	0.02654	T	1	-0.0012	2.8839	0.05656	0.3489:0.0:0.4506:0.2005	.	265	Q9BXU7	UBP26_HUMAN	A	265	ENSP00000359869:V265A;ENSP00000423390:V265A;ENSP00000384360:V265A	ENSP00000359869:V265A	V	-	2	0	USP26	131989121	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	-0.152000	0.10159	-0.105000	0.12132	-0.272000	0.10252	GTA	USP26	-	NULL	ENSG00000134588		0.383	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP26	HGNC	protein_coding	OTTHUMT00000359441.1	-	0.00	27	0	A	NM_031907		132161455	-1	tier1	-	no_errors	ENST00000370832	ensembl	human	known	74_37	missense	58.62	12	17	SNP	0.000	G
UTP20	27340	genome.wustl.edu	37	12	101732688	101732688	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:101732688G>T	ENST00000261637.4	+	31	4140	c.3966G>T	c.(3964-3966)aaG>aaT	p.K1322N		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1322	Poly-Lys.				endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						AGGTGAAAAAGAAAAAGAATA	0.348																																																	0													74.0	76.0	75.0					12																	101732688		2203	4298	6501	SO:0001583	missense	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.3966G>T	12.37:g.101732688G>T	ENSP00000261637:p.Lys1322Asn		Q9H3H4	Missense_Mutation	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.K1322N	ENST00000261637.4	37	c.3966	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	G	20.4	3.979262	0.74360	.	.	ENSG00000120800	ENST00000261637	T	0.19105	2.17	5.63	4.74	0.60224	Armadillo-type fold (1);	0.093522	0.64402	D	0.000001	T	0.34048	0.0884	L	0.53249	1.67	0.47341	D	0.999398	D	0.69078	0.997	P	0.61477	0.889	T	0.04333	-1.0959	10	0.25751	T	0.34	-18.9331	10.6924	0.45879	0.1459:0.0:0.8541:0.0	.	1322	O75691	UTP20_HUMAN	N	1322	ENSP00000261637:K1322N	ENSP00000261637:K1322N	K	+	3	2	UTP20	100256819	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.140000	0.77322	1.379000	0.46325	0.491000	0.48974	AAG	UTP20	-	superfamily_ARM-type_fold	ENSG00000120800		0.348	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1		0.00	25	0	G	NM_014503		101732688	+1			no_errors	ENST00000261637	ensembl	human	known	74_37	missense	20.00	12	3	SNP	1.000	T
UVSSA	57654	genome.wustl.edu	37	4	1374728	1374728	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr4:1374728G>T	ENST00000389851.4	+	12	2260	c.1813G>T	c.(1813-1815)Gac>Tac	p.D605Y	UVSSA_ENST00000507531.1_Missense_Mutation_p.D605Y|UVSSA_ENST00000512728.1_Missense_Mutation_p.D156Y|UVSSA_ENST00000511563.1_Missense_Mutation_p.D156Y|UVSSA_ENST00000511216.1_Missense_Mutation_p.D605Y	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	605					protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)										CGACCCGGAAGACAGGGCTCG	0.677																																																	0													48.0	51.0	50.0					4																	1374728		2202	4300	6502	SO:0001583	missense	0			BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.1813G>T	4.37:g.1374728G>T	ENSP00000374501:p.Asp605Tyr		A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Missense_Mutation	SNP	pfam_DUF2043,superfamily_ENTH_VHS	p.D605Y	ENST00000389851.4	37	c.1813	CCDS33938.1	4	.	.	.	.	.	.	.	.	.	.	G	14.25	2.480460	0.44044	.	.	ENSG00000163945	ENST00000511216;ENST00000389851;ENST00000507531;ENST00000511563;ENST00000512728	T;T;T;T;T	0.51574	1.23;1.23;1.23;0.7;0.7	4.56	3.69	0.42338	.	0.135309	0.64402	D	0.000003	T	0.69415	0.3108	M	0.82923	2.615	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.75079	-0.3444	10	0.87932	D	0	.	14.3403	0.66622	0.0:0.1495:0.8505:0.0	.	605	Q2YD98	K1530_HUMAN	Y	605;605;605;156;156	ENSP00000425130:D605Y;ENSP00000374501:D605Y;ENSP00000421741:D605Y;ENSP00000423340:D156Y;ENSP00000427701:D156Y	ENSP00000374501:D605Y	D	+	1	0	KIAA1530	1364728	1.000000	0.71417	0.496000	0.27539	0.004000	0.04260	8.514000	0.90545	0.876000	0.35872	0.561000	0.74099	GAC	UVSSA	-	pfam_DUF2043	ENSG00000163945		0.677	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UVSSA	HGNC	protein_coding	OTTHUMT00000359480.1	-	0.00	49	0	G	NM_020894		1374728	+1	tier1	-	no_errors	ENST00000389851	ensembl	human	known	74_37	missense	25.93	20	7	SNP	1.000	T
VAV1	7409	genome.wustl.edu	37	19	6821807	6821807	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:6821807T>C	ENST00000602142.1	+	4	468	c.386T>C	c.(385-387)tTc>tCc	p.F129S	VAV1_ENST00000304076.2_Missense_Mutation_p.F129S|VAV1_ENST00000599806.1_Missense_Mutation_p.F74S|VAV1_ENST00000539284.1_Missense_Mutation_p.F64S|VAV1_ENST00000596764.1_Missense_Mutation_p.F129S	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	129					apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						CCCAGGCCCTTCCCCACCGAG	0.647																																																	0													55.0	53.0	53.0					19																	6821807		2203	4298	6501	SO:0001583	missense	0				CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.386T>C	19.37:g.6821807T>C	ENSP00000472929:p.Phe129Ser		B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH3_domain,prints_SH2,prints_SM22_calponin	p.F129S	ENST00000602142.1	37	c.386	CCDS12174.1	19	.	.	.	.	.	.	.	.	.	.	T	16.76	3.211122	0.58343	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T;T	0.34072	1.38;1.38	4.34	3.32	0.38043	Calponin homology domain (2);	0.065100	0.64402	N	0.000009	T	0.55289	0.1911	M	0.76838	2.35	0.53005	D	0.999961	D;D;D;D	0.89917	1.0;1.0;0.978;0.999	D;D;P;D	0.87578	0.997;0.998;0.742;0.99	T	0.52571	-0.8558	10	0.42905	T	0.14	.	7.5346	0.27702	0.0:0.1037:0.0:0.8963	.	64;129;74;129	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	S	129;64	ENSP00000302269:F129S;ENSP00000443242:F64S	ENSP00000302269:F129S	F	+	2	0	VAV1	6772807	1.000000	0.71417	1.000000	0.80357	0.641000	0.38312	6.871000	0.75531	0.732000	0.32470	0.379000	0.24179	TTC	VAV1	-	superfamily_CH-domain	ENSG00000141968		0.647	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV1	HGNC	protein_coding	OTTHUMT00000458475.1	-	0.00	49	0	T			6821807	+1	tier1	-	no_errors	ENST00000602142	ensembl	human	known	74_37	missense	25.00	21	7	SNP	1.000	C
VWDE	221806	genome.wustl.edu	37	7	12379975	12379975	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:12379975C>A	ENST00000275358.3	-	24	4527	c.4339G>T	c.(4339-4341)Gga>Tga	p.G1447*		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	1447	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						CCAAAGAATCCATTTGGACAG	0.393																																																	0													124.0	97.0	105.0					7																	12379975		692	1591	2283	SO:0001587	stop_gained	0				CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.4339G>T	7.37:g.12379975C>A	ENSP00000275358:p.Gly1447*		B7ZM77|Q96SQ3	Nonsense_Mutation	SNP	pfam_EGF_extracell,pfam_VWF_type-D,superfamily_Cadherin-like,smart_VWF_type-D,smart_EG-like_dom,pfscan_EG-like_dom	p.G1447*	ENST00000275358.3	37	c.4339	CCDS47544.1	7	.	.	.	.	.	.	.	.	.	.	C	45	11.692112	0.99592	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	.	.	.	4.73	3.85	0.44370	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	12.9051	0.58147	0.0:0.921:0.0:0.079	.	.	.	.	X	1447;901	.	ENSP00000275358:G1447X	G	-	1	0	VWDE	12346500	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.647000	0.67923	1.207000	0.43291	0.585000	0.79938	GGA	VWDE	-	pfam_EGF_extracell,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000146530		0.393	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VWDE	HGNC	protein_coding	OTTHUMT00000325870.3	-	0.00	43	0	C	XM_371878		12379975	-1	tier1	-	no_errors	ENST00000275358	ensembl	human	novel	74_37	nonsense	8.51	43	4	SNP	0.999	A
WBSCR27	155368	genome.wustl.edu	37	7	73254452	73254453	+	Splice_Site	DEL	TG	TG	-	rs375025208		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:73254452_73254453delTG	ENST00000297873.4	-	5	438		c.e5-2			NM_152559.2	NP_689772.2	Q8N6F8	WBS27_HUMAN	Williams Beuren syndrome chromosome region 27											NS(1)|central_nervous_system(1)|lung(2)|prostate(1)	5		Lung NSC(55;0.159)				CGAAGGTCCCTGTGTGTGTGTG	0.604																																																	0																																										SO:0001630	splice_region_variant	0			AF534110	CCDS5561.1	7q11.23	2004-07-05			ENSG00000165171	ENSG00000165171			19068	protein-coding gene	gene with protein product		612546					Standard	NM_152559		Approved		uc003tzj.2	Q8N6F8	OTTHUMG00000130033	ENST00000297873.4:c.389-2CA>-	7.37:g.73254462_73254463delTG				Splice_Site	DEL	-	e4-2	ENST00000297873.4	37	c.389-3_389-2	CCDS5561.1	7																																																																																			WBSCR27	-	-	ENSG00000165171		0.604	WBSCR27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR27	HGNC	protein_coding	OTTHUMT00000252312.1		0.00	26	0	TG	NM_152559	Intron	73254453	-1	tier1		no_errors	ENST00000297873	ensembl	human	known	74_37	splice_site_del	42.86	28	21	DEL	0.468:0.402	-
CFAP44	55779	genome.wustl.edu	37	3	113015691	113015691	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:113015691C>A	ENST00000393845.2	-	33	5185	c.5119G>T	c.(5119-5121)Ggc>Tgc	p.G1707C	WDR52_ENST00000308346.6_Missense_Mutation_p.G310C	NM_001164496.1	NP_001157968.1														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						ACCACACGGCCAAACTTGCTG	0.423																																																	0													161.0	133.0	141.0					3																	113015691		692	1591	2283	SO:0001583	missense	0																														ENST00000393845.2:c.5119G>T	3.37:g.113015691C>A	ENSP00000377428:p.Gly1707Cys			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G1707C	ENST00000393845.2	37	c.5119	CCDS54624.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.27|18.27	3.586938|3.586938	0.66105|0.66105	.|.	.|.	ENSG00000206530|ENSG00000206530	ENST00000393845;ENST00000308346|ENST00000465636	T;T|.	0.45276|.	0.9;0.9|.	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78672|0.78672	0.4320|0.4320	M|M	0.79258|0.79258	2.445|2.445	0.49299|0.49299	D|D	0.999779|0.999779	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	T|T	0.78396|0.78396	-0.2220|-0.2220	10|5	0.72032|.	D|.	0.01|.	-12.9409|-12.9409	19.5409|19.5409	0.95273|0.95273	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1707|.	Q96MT7-2|.	.|.	C|L	1707;310|843	ENSP00000377428:G1707C;ENSP00000311497:G310C|.	ENSP00000311497:G310C|.	G|W	-|-	1|2	0|0	WDR52|WDR52	114498381|114498381	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.398000|0.398000	0.30690|0.30690	5.677000|5.677000	0.68142|0.68142	2.614000|2.614000	0.88457|0.88457	0.561000|0.561000	0.74099|0.74099	GGC|TGG	WDR52	-	NULL	ENSG00000206530		0.423	WDR52-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR52	HGNC	protein_coding		-	0.00	53	0	C			113015691	-1	tier1	-	no_errors	ENST00000393845	ensembl	human	known	74_37	missense	18.92	30	7	SNP	1.000	A
WDR66	144406	genome.wustl.edu	37	12	122359379	122359381	+	In_Frame_Del	DEL	AAC	AAC	-			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	AAC	AAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:122359379_122359381delAAC	ENST00000288912.4	+	2	1022_1024	c.168_170delAAC	c.(166-171)aaaacg>aag	p.T57del	WDR66_ENST00000397454.2_In_Frame_Del_p.T57del	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	57	Glu-rich.						calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		aggagaggaaaacgggcgaggag	0.468																																					Esophageal Squamous(85;849 1794 49757 52143)												0																																										SO:0001651	inframe_deletion	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.168_170delAAC	12.37:g.122359379_122359381delAAC	ENSP00000288912:p.Thr57del		C9J1W2|Q8IYA3|Q8N898|Q8NDE7	In_Frame_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.T57in_frame_del	ENST00000288912.4	37	c.168_170	CCDS41853.1	12																																																																																			WDR66	-	NULL	ENSG00000158023		0.468	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1		0.00	14	0	AAC	NM_144668		122359381	+1	tier1		no_errors	ENST00000288912	ensembl	human	known	74_37	in_frame_del	30.77	9	4	DEL	0.001:0.000:0.000	-
WDR66	144406	genome.wustl.edu	37	12	122359385	122359385	+	Frame_Shift_Del	DEL	C	C	-	rs370060195		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:122359385delC	ENST00000288912.4	+	2	1028	c.174delC	c.(172-174)ggcfs	p.G58fs	WDR66_ENST00000397454.2_Frame_Shift_Del_p.G58fs	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	58	Glu-rich.						calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		ggaaaacgggcgaggaggaag	0.463																																					Esophageal Squamous(85;849 1794 49757 52143)												0													44.0	45.0	45.0					12																	122359385		1915	4116	6031	SO:0001589	frameshift_variant	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.174delC	12.37:g.122359385delC	ENSP00000288912:p.Gly58fs		C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.E59fs	ENST00000288912.4	37	c.174	CCDS41853.1	12																																																																																			WDR66	-	NULL	ENSG00000158023		0.463	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1		0.00	14	0	C	NM_144668		122359385	+1	tier1		no_errors	ENST00000288912	ensembl	human	known	74_37	frame_shift_del	33.33	8	4	DEL	0.000	-
XIRP2	129446	genome.wustl.edu	37	2	167760159	167760159	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:167760159C>T	ENST00000409728.1	+	2	256	c.167C>T	c.(166-168)tCt>tTt	p.S56F	XIRP2_ENST00000409756.2_Missense_Mutation_p.S56F|XIRP2_ENST00000409195.1_Missense_Mutation_p.S56F|XIRP2_ENST00000420519.1_Missense_Mutation_p.S56F|XIRP2_ENST00000295237.9_Missense_Mutation_p.S56F|XIRP2_ENST00000409043.1_Missense_Mutation_p.S56F	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.S56Y(2)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GCACCTCAATCTTTGGATCCC	0.493																																																	2	Substitution - Missense(2)	large_intestine(2)											75.0	74.0	75.0					2																	167760159		1952	4133	6085	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.167C>T	2.37:g.167760159C>T	ENSP00000386619:p.Ser56Phe		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.S56F	ENST00000409728.1	37	c.167	CCDS56143.1	2	.	.	.	.	.	.	.	.	.	.	C	11.38	1.620352	0.28801	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237	T;T;T;T;T;T	0.77750	-1.11;-1.12;4.23;-1.11;-1.12;4.23	5.36	1.36	0.22044	.	.	.	.	.	T	0.66819	0.2828	.	.	.	0.09310	N	1	B;B	0.14805	0.011;0.011	B;B	0.19946	0.027;0.027	T	0.57441	-0.7811	8	0.56958	D	0.05	-1.1174	7.2739	0.26273	0.0:0.5988:0.0:0.4012	.	56;56	A4UGR9-4;A4UGR9-6	.;.	F	56	ENSP00000386454:S56F;ENSP00000386619:S56F;ENSP00000386840:S56F;ENSP00000386724:S56F;ENSP00000415541:S56F;ENSP00000295237:S56F	ENSP00000295237:S56F	S	+	2	0	XIRP2	167468405	0.000000	0.05858	0.001000	0.08648	0.091000	0.18340	0.294000	0.19047	0.210000	0.20664	0.655000	0.94253	TCT	XIRP2	-	NULL	ENSG00000163092		0.493	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333552.1	-	0.00	62	0	C	NM_152381		167760159	+1	tier1	-	no_errors	ENST00000295237	ensembl	human	known	74_37	missense	15.00	34	6	SNP	0.007	T
YME1L1	10730	genome.wustl.edu	37	10	27408224	27408224	+	Splice_Site	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr10:27408224C>A	ENST00000326799.3	-	15	1885	c.1737G>T	c.(1735-1737)atG>atT	p.M579I	YME1L1_ENST00000376016.3_Splice_Site_p.M522I|YME1L1_ENST00000375972.3_Splice_Site_p.M489I	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase	579					cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						GAAACCTACCCATTAGAATTT	0.363																																																	0													105.0	113.0	110.0					10																	27408224		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.1738+1G>T	10.37:g.27408224C>A			B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Missense_Mutation	SNP	pfam_Peptidase_M41,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_FtsH	p.M579I	ENST00000326799.3	37	c.1737	CCDS7152.1	10	.	.	.	.	.	.	.	.	.	.	C	28.5	4.921463	0.92249	.	.	ENSG00000136758	ENST00000376016;ENST00000326799;ENST00000375969;ENST00000375972;ENST00000546122	D;D;D	0.83163	-1.69;-1.69;-1.69	5.34	5.34	0.76211	Peptidase M41 (1);Peptidase M41, FtsH (2);	0.035410	0.85682	D	0.000000	D	0.90584	0.7048	M	0.66439	2.03	0.80722	D	1	D;D;D	0.89917	0.969;1.0;0.988	D;D;D	0.80764	0.968;0.994;0.934	D	0.91143	0.4947	10	0.87932	D	0	-10.6842	19.419	0.94713	0.0:1.0:0.0:0.0	.	489;522;579	B4DNM1;Q96TA2-2;Q96TA2	.;.;YMEL1_HUMAN	I	522;579;579;489;325	ENSP00000365184:M522I;ENSP00000318480:M579I;ENSP00000365139:M489I	ENSP00000318480:M579I	M	-	3	0	YME1L1	27448230	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.734000	0.84928	2.658000	0.90341	0.655000	0.94253	ATG	YME1L1	-	pfam_Peptidase_M41,tigrfam_FtsH	ENSG00000136758		0.363	YME1L1-005	KNOWN	basic|CCDS	protein_coding	YME1L1	HGNC	protein_coding	OTTHUMT00000047306.1	-	0.00	37	0	C	NM_139312	Missense_Mutation	27408224	-1	tier1	-	no_errors	ENST00000326799	ensembl	human	known	74_37	missense	35.71	9	5	SNP	1.000	A
YPEL5	51646	genome.wustl.edu	37	2	30379342	30379342	+	Intron	SNP	C	C	A	rs565121649	byFrequency	TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr2:30379342C>A	ENST00000379520.3	+	4	480				YPEL5_ENST00000379519.3_Intron|YPEL5_ENST00000495673.1_3'UTR|YPEL5_ENST00000402003.3_Intron|YPEL5_ENST00000402708.1_Intron|YPEL5_ENST00000261353.4_Intron	NM_001127401.1	NP_001120873.1	P62699	YPEL5_HUMAN	yippee-like 5 (Drosophila)											NS(1)|endometrium(1)|kidney(1)|lung(3)|prostate(1)	7	Acute lymphoblastic leukemia(172;0.155)					AACTTTGGATCTTTTTGTTCA	0.388																																																	0																																										SO:0001627	intron_variant	0			AF135161	CCDS1771.1	2p23	2004-06-28			ENSG00000119801	ENSG00000119801			18329	protein-coding gene	gene with protein product		609726					Standard	NM_016061		Approved	CGI-127	uc002rmz.4	P62699	OTTHUMG00000097839	ENST00000379520.3:c.-24-152C>A	2.37:g.30379342C>A			D6W568|Q65Z97|Q8R174|Q9D6M1|Q9UMX7|Q9Y3C9	RNA	SNP	-	NULL	ENST00000379520.3	37	NULL	CCDS1771.1	2																																																																																			YPEL5	-	-	ENSG00000119801		0.388	YPEL5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	YPEL5	HGNC	protein_coding	OTTHUMT00000215128.1	-	0.00	23	0	C	NM_016061		30379342	+1	tier1	-	no_errors	ENST00000495673	ensembl	human	known	74_37	rna	40.00	12	8	SNP	0.017	A
YY1AP1	55249	genome.wustl.edu	37	1	155629732	155629732	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:155629732G>A	ENST00000295566.4	-	11	2130	c.2107C>T	c.(2107-2109)Ccc>Tcc	p.P703S	YY1AP1_ENST00000361831.5_Missense_Mutation_p.P646S|YY1AP1_ENST00000311573.5_Missense_Mutation_p.P626S|YY1AP1_ENST00000347088.5_Missense_Mutation_p.P657S|YY1AP1_ENST00000368340.5_Missense_Mutation_p.P775S|MSTO1_ENST00000538143.1_Intron|MSTO1_ENST00000452804.2_Intron|YY1AP1_ENST00000407221.1_Missense_Mutation_p.P626S|YY1AP1_ENST00000368330.2_Missense_Mutation_p.P657S|YY1AP1_ENST00000368339.5_Missense_Mutation_p.P795S|YY1AP1_ENST00000355499.4_Missense_Mutation_p.P657S|YY1AP1_ENST00000404643.1_Missense_Mutation_p.P637S|YY1AP1_ENST00000535662.1_Missense_Mutation_p.P503S|YY1AP1_ENST00000359205.5_Missense_Mutation_p.P646S	NM_001198906.1|NM_139118.2	NP_001185835.1|NP_620829.1	Q9H869	YYAP1_HUMAN	YY1 associated protein 1	703					regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(7)|ovary(2)|skin(2)|urinary_tract(2)	31	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					TCTAATTTGGGTTCTAGGCCC	0.502																																																	0													84.0	84.0	84.0					1																	155629732		2203	4297	6500	SO:0001583	missense	0			BC008766	CCDS1115.1, CCDS1116.1, CCDS55643.1, CCDS55644.1, CCDS55645.1	1q22	2009-05-07			ENSG00000163374	ENSG00000163374			30935	protein-coding gene	gene with protein product		607860				11710830	Standard	NM_139119		Approved	YY1AP, HCCA2, YAP		Q9H869	OTTHUMG00000035437	ENST00000295566.4:c.2107C>T	1.37:g.155629732G>A	ENSP00000295566:p.Pro703Ser		B0QZ54|B4DMP2|B4E0I0|D3DV96|D3DV98|H7BY62|Q5VYZ1|Q5VYZ4|Q5VYZ7|Q7L4C3|Q7L5E2|Q8IXA6|Q8TEW5|Q8TF04|Q96HB6|Q9BQ64|Q9NV84	Missense_Mutation	SNP	NULL	p.P795S	ENST00000295566.4	37	c.2383	CCDS1115.1	1	.	.	.	.	.	.	.	.	.	.	g	12.78	2.040121	0.35989	.	.	ENSG00000163374	ENST00000359205;ENST00000355499;ENST00000311573;ENST00000347088;ENST00000361831;ENST00000368340;ENST00000295566;ENST00000368330;ENST00000407221;ENST00000404643;ENST00000368339;ENST00000535662	T;T;T;T;T;T;T;T;T;T;T;T	0.29397	1.67;1.67;1.68;1.67;1.67;1.6;1.65;1.67;1.68;1.7;1.57;1.68	2.57	1.59	0.23543	.	0.095014	0.47093	N	0.000250	T	0.29684	0.0741	L	0.48362	1.52	0.80722	D	1	B;D;D;D;D	0.89917	0.122;1.0;0.981;1.0;1.0	B;D;D;D;D	0.91635	0.072;0.999;0.954;0.999;0.998	T	0.05500	-1.0881	10	0.48119	T	0.1	.	7.8822	0.29629	0.1298:0.0:0.8702:0.0	.	795;637;703;657;775	B4DMP2;Q9H869-4;Q9H869;Q9H869-2;Q5VYZ1	.;.;YYAP1_HUMAN;.;.	S	646;657;626;657;646;775;703;657;626;637;795;503	ENSP00000352134:P646S;ENSP00000347686:P657S;ENSP00000311138:P626S;ENSP00000316079:P657S;ENSP00000355298:P646S;ENSP00000357324:P775S;ENSP00000295566:P703S;ENSP00000357314:P657S;ENSP00000385791:P626S;ENSP00000385390:P637S;ENSP00000357323:P795S;ENSP00000437926:P503S	ENSP00000295566:P703S	P	-	1	0	YY1AP1	153896356	1.000000	0.71417	0.937000	0.37676	0.826000	0.46750	2.324000	0.43831	0.360000	0.24265	0.313000	0.20887	CCC	YY1AP1	-	NULL	ENSG00000163374		0.502	YY1AP1-043	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	YY1AP1	HGNC	protein_coding	OTTHUMT00000086027.1	-	0.00	69	0	G	NM_139118		155629732	-1	tier1	-	no_errors	ENST00000368339	ensembl	human	known	74_37	missense	43.18	25	19	SNP	0.882	A
ZBTB41	360023	genome.wustl.edu	37	1	197128851	197128851	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:197128851C>A	ENST00000367405.4	-	10	2436	c.2368G>T	c.(2368-2370)Gtt>Ttt	p.V790F	ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	790					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						GACTGATAAACTTTGGGCTGG	0.413																																																	0													187.0	173.0	178.0					1																	197128851		2203	4300	6503	SO:0001583	missense	0				CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.2368G>T	1.37:g.197128851C>A	ENSP00000356375:p.Val790Phe		A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.V790F	ENST00000367405.4	37	c.2368	CCDS30960.1	1	.	.	.	.	.	.	.	.	.	.	C	7.705	0.693971	0.15039	.	.	ENSG00000177888	ENST00000367405	T	0.05319	3.46	5.45	2.51	0.30379	.	0.842064	0.09836	N	0.749517	T	0.04363	0.0120	N	0.14661	0.345	0.21445	N	0.99968	B	0.21309	0.054	B	0.19946	0.027	T	0.42032	-0.9475	10	0.62326	D	0.03	.	5.8672	0.18781	0.0:0.4916:0.2405:0.268	.	790	Q5SVQ8	ZBT41_HUMAN	F	790	ENSP00000356375:V790F	ENSP00000356375:V790F	V	-	1	0	ZBTB41	195395474	0.042000	0.20092	0.985000	0.45067	0.359000	0.29487	0.023000	0.13533	0.468000	0.27243	-0.136000	0.14681	GTT	ZBTB41	-	NULL	ENSG00000177888		0.413	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB41	HGNC	protein_coding	OTTHUMT00000088249.2	-	0.00	172	0	C	NM_194314		197128851	-1	tier1	-	no_errors	ENST00000367405	ensembl	human	known	74_37	missense	31.93	81	38	SNP	0.106	A
ZBTB47	92999	genome.wustl.edu	37	3	42700678	42700678	+	Silent	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr3:42700678C>T	ENST00000232974.6	+	2	1112	c.831C>T	c.(829-831)gaC>gaT	p.D277D	ZBTB47_ENST00000457842.3_5'UTR|ZBTB47_ENST00000505904.1_5'UTR			Q9UFB7	ZBT47_HUMAN	zinc finger and BTB domain containing 47	277	Glu-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(3)|ovary(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.216)		GACACTCggacgaggaggagg	0.672																																																	0													18.0	26.0	23.0					3																	42700678		692	1590	2282	SO:0001819	synonymous_variant	0			AB033016	CCDS46805.1, CCDS46805.2	3p22.1	2013-01-08	2006-09-19	2006-09-19	ENSG00000114853	ENSG00000114853		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26955	protein-coding gene	gene with protein product			"""zinc finger protein 651"""	ZNF651		10574461	Standard	NM_145166		Approved	KIAA1190, DKFZp434N0615	uc003clu.2	Q9UFB7	OTTHUMG00000156207	ENST00000232974.6:c.831C>T	3.37:g.42700678C>T			H7BXD3|Q6ZSY6|Q8WTY8|Q9ULN0	Silent	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.D277	ENST00000232974.6	37	c.831	CCDS46805.2	3																																																																																			ZBTB47	-	NULL	ENSG00000114853		0.672	ZBTB47-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB47	HGNC	protein_coding	OTTHUMT00000343485.3		0.00	21	0	C	NM_145166		42700678	+1			no_errors	ENST00000232974	ensembl	human	known	74_37	silent	29.41	12	5	SNP	0.993	T
ZC3H3	23144	genome.wustl.edu	37	8	144550431	144550431	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr8:144550431C>A	ENST00000262577.5	-	8	2154	c.2123G>T	c.(2122-2124)tGc>tTc	p.C708F		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	708					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			CGTTTTCTTGCAGGTGCCCCG	0.657																																																	0													60.0	56.0	58.0					8																	144550431		2202	4300	6502	SO:0001583	missense	0			D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.2123G>T	8.37:g.144550431C>A	ENSP00000262577:p.Cys708Phe		Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.C708F	ENST00000262577.5	37	c.2123	CCDS6402.1	8	.	.	.	.	.	.	.	.	.	.	C	20.3	3.973968	0.74246	.	.	ENSG00000014164	ENST00000262577	D	0.85629	-2.01	5.4	4.5	0.54988	Zinc finger, CCCH-type (2);	0.054211	0.64402	N	0.000001	D	0.95313	0.8479	H	0.98238	4.18	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96942	0.9688	10	0.87932	D	0	-22.467	15.3121	0.74042	0.141:0.859:0.0:0.0	.	708	Q8IXZ2	ZC3H3_HUMAN	F	708	ENSP00000262577:C708F	ENSP00000262577:C708F	C	-	2	0	ZC3H3	144621574	1.000000	0.71417	0.973000	0.42090	0.948000	0.59901	7.137000	0.77295	1.239000	0.43787	0.655000	0.94253	TGC	ZC3H3	-	smart_Znf_CCCH	ENSG00000014164		0.657	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H3	HGNC	protein_coding	OTTHUMT00000382011.2	-	0.00	62	0	C	NM_015117		144550431	-1	tier1	-	no_errors	ENST00000262577	ensembl	human	known	74_37	missense	30.00	56	24	SNP	1.000	A
ZC3HAV1	56829	genome.wustl.edu	37	7	138764691	138764691	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr7:138764691C>A	ENST00000242351.5	-	4	1312	c.996G>T	c.(994-996)gaG>gaT	p.E332D	ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.E332D|ZC3HAV1_ENST00000471652.1_Missense_Mutation_p.E332D	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	332					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						GACTGCCGTTCTCTAAAAACC	0.552																																																	0													71.0	70.0	70.0					7																	138764691		2203	4300	6503	SO:0001583	missense	0			BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.996G>T	7.37:g.138764691C>A	ENSP00000242351:p.Glu332Asp		A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.E332D	ENST00000242351.5	37	c.996	CCDS5851.1	7	.	.	.	.	.	.	.	.	.	.	C	17.00	3.276365	0.59649	.	.	ENSG00000105939	ENST00000242351;ENST00000464606;ENST00000471652;ENST00000540247	T;T;T	0.29655	1.56;1.56;1.56	4.19	4.19	0.49359	.	0.274302	0.26265	N	0.025361	T	0.45657	0.1353	L	0.52573	1.65	0.20638	N	0.999872	D;D	0.71674	0.998;0.989	D;P	0.66084	0.941;0.828	T	0.22487	-1.0215	10	0.56958	D	0.05	.	12.2301	0.54482	0.0:1.0:0.0:0.0	.	332;332	Q7Z2W4-2;Q7Z2W4	.;ZCCHV_HUMAN	D	332;332;332;92	ENSP00000242351:E332D;ENSP00000418385:E332D;ENSP00000419855:E332D	ENSP00000242351:E332D	E	-	3	2	ZC3HAV1	138415231	0.800000	0.28916	0.517000	0.27799	0.021000	0.10359	1.761000	0.38440	2.302000	0.77476	0.650000	0.86243	GAG	ZC3HAV1	-	NULL	ENSG00000105939		0.552	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3HAV1	HGNC	protein_coding	OTTHUMT00000348915.1	-	0.00	52	0	C	NM_020119		138764691	-1	tier1	-	no_errors	ENST00000242351	ensembl	human	known	74_37	missense	13.79	50	8	SNP	0.400	A
ZDHHC11B	653082	genome.wustl.edu	37	5	756143	756143	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:756143G>T	ENST00000382776.4	-	2	338	c.339C>A	c.(337-339)ttC>ttA	p.F113L	ZDHHC11_ENST00000424784.2_Intron|ZDHHC11B_ENST00000508859.2_Missense_Mutation_p.F124L			P0C7U3	ZH11B_HUMAN	zinc finger, DHHC-type containing 11B	113						integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			lung(3)|stomach(1)	4						TTGATCTGTCGAAGAGGGGCA	0.582																																																	0																																										SO:0001583	missense	0					5p15.33	2007-01-29				ENSG00000206077		"""Zinc fingers, DHHC-type"""	32962	protein-coding gene	gene with protein product							Standard	XM_003118532		Approved			P0C7U3		ENST00000382776.4:c.339C>A	5.37:g.756143G>T	ENSP00000445280:p.Phe113Leu		A6NHR3	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.F113L	ENST00000382776.4	37	c.339		5	.	.	.	.	.	.	.	.	.	.	-	16.43	3.121298	0.56613	.	.	ENSG00000206077	ENST00000508859;ENST00000382776	T;T	0.36878	1.23;1.23	3.62	-0.929	0.10444	.	0.298226	0.25549	U	0.029913	T	0.18841	0.0452	.	.	.	0.36334	D	0.859066	.	.	.	.	.	.	T	0.17018	-1.0383	7	0.10902	T	0.67	-31.8951	4.8846	0.13697	0.5113:0.2232:0.2655:0.0	.	.	.	.	L	124;113	ENSP00000442373:F124L;ENSP00000445280:F113L	ENSP00000445280:F113L	F	-	3	2	ZDHHC11B	809143	0.977000	0.34250	0.031000	0.17742	0.007000	0.05969	-0.068000	0.11561	-0.203000	0.10251	-0.339000	0.08088	TTC	ZDHHC11B	-	NULL	ENSG00000206077		0.582	ZDHHC11B-201	KNOWN	basic|appris_candidate	protein_coding	ZDHHC11B	HGNC	protein_coding		-	0.00	29	0	G	XM_926053		756143	-1	tier1	-	no_errors	ENST00000382776	ensembl	human	known	74_37	missense	29.17	17	7	SNP	0.914	T
ZNF135	7694	genome.wustl.edu	37	19	58574827	58574827	+	Silent	SNP	G	G	A	rs375491279		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:58574827G>A	ENST00000313434.5	+	4	275	c.174G>A	c.(172-174)ccG>ccA	p.P58P	ZNF135_ENST00000506786.1_Silent_p.P16P|ZNF135_ENST00000401053.4_Silent_p.P70P|ZNF135_ENST00000511556.1_Silent_p.P58P|ZNF135_ENST00000359978.6_Silent_p.P70P|ZNF135_ENST00000439855.2_Silent_p.P58P	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	58	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		ATTGGTTACCGAAGCCGAATG	0.572																																																	0								G	,,,,	0,4406		0,0,2203	100.0	87.0	91.0		210,210,210,174,210	-5.0	0.0	19		91	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ZNF135	NM_001164527.1,NM_001164529.1,NM_001164530.1,NM_003436.3,NM_007134.1	,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,	70/124,70/116,70/391,58/671,70/683	58574827	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.174G>A	19.37:g.58574827G>A			B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P70	ENST00000313434.5	37	c.210		19	.	.	.	.	.	.	.	.	.	.	G	1.694	-0.503292	0.04261	0.0	1.16E-4	ENSG00000176293	ENST00000391699	.	.	.	2.51	-5.02	0.02982	.	.	.	.	.	T	0.27241	0.0668	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.09818	-1.0657	4	.	.	.	.	6.6644	0.23032	0.3707:0.3186:0.3108:0.0	.	.	.	.	Q	64	.	.	R	+	2	0	ZNF135	63266639	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-3.058000	0.00624	-4.108000	0.00073	-1.008000	0.02478	CGA	ZNF135	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000176293		0.572	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	ZNF135	HGNC	protein_coding	OTTHUMT00000361899.2	-	0.00	57	0	G	NM_003436		58574827	+1	tier1	-	no_errors	ENST00000401053	ensembl	human	known	74_37	silent	47.50	21	19	SNP	0.000	A
ZNF185	7739	genome.wustl.edu	37	X	152097182	152097182	+	Silent	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chrX:152097182G>T	ENST00000370268.4	+	12	928	c.891G>T	c.(889-891)gtG>gtT	p.V297V	ZNF185_ENST00000370270.2_Silent_p.V297V|ZNF185_ENST00000449285.2_Silent_p.V298V|ZNF185_ENST00000535861.1_Silent_p.V297V|ZNF185_ENST00000318504.7_Intron|ZNF185_ENST00000318529.8_Intron|ZNF185_ENST00000324823.6_Silent_p.V133V|ZNF185_ENST00000539731.1_Intron			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	297						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					TCCGCCTGGTGGCCCCAGACG	0.612																																																	0													44.0	50.0	48.0					X																	152097182		1990	4150	6140	SO:0001819	synonymous_variant	0			AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.891G>T	X.37:g.152097182G>T			A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Silent	SNP	smart_Znf_LIM,pfscan_Znf_LIM	p.V297	ENST00000370268.4	37	c.891	CCDS48184.1	X	.	.	.	.	.	.	.	.	.	.	G	9.112	1.006815	0.19199	.	.	ENSG00000147394	ENST00000447088	.	.	.	3.09	1.26	0.21427	.	.	.	.	.	T	0.45617	0.1351	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24440	-1.0160	4	.	.	.	-0.311	3.7371	0.08515	0.1511:0.2534:0.5955:0.0	.	.	.	.	C	115	.	.	G	+	1	0	ZNF185	151847838	0.994000	0.37717	0.992000	0.48379	0.943000	0.58893	0.161000	0.16481	0.209000	0.20645	0.600000	0.82982	GGC	ZNF185	-	NULL	ENSG00000147394		0.612	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF185	HGNC	protein_coding	OTTHUMT00000377480.1	-	0.00	53	0	G	NM_007150		152097182	+1	tier1	-	no_errors	ENST00000370270	ensembl	human	known	74_37	silent	73.44	17	47	SNP	0.986	T
ZNF252P	286101	genome.wustl.edu	37	8	146202598	146202598	+	RNA	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr8:146202598C>A	ENST00000426361.2	-	0	1586					NR_023392.1				zinc finger protein 252, pseudogene											endometrium(1)	1						AGGTTTCTCTCCAGTGTGAAT	0.408																																																	0																																												0			BC019922		8q24.3	2012-10-05	2012-04-19	2012-04-19	ENSG00000196922	ENSG00000196922			13046	pseudogene	pseudogene			"""zinc finger protein 252"""	ZNF252			Standard	NR_023392		Approved		uc011llo.2		OTTHUMG00000165201		8.37:g.146202598C>A				RNA	SNP	-	NULL	ENST00000426361.2	37	NULL		8	.	.	.	.	.	.	.	.	.	.	C	15.72	2.916008	0.52546	.	.	ENSG00000196922	ENST00000426361;ENST00000355436	.	.	.	2.79	2.79	0.32731	.	.	.	.	.	T	0.74238	0.3690	.	.	.	.	.	.	D	0.89917	1.0	D	0.85130	0.997	T	0.82617	-0.0369	6	0.87932	D	0	.	12.381	0.55307	0.0:1.0:0.0:0.0	.	459	E9PMP9	.	V	459;438	.	ENSP00000347611:G438V	G	-	2	0	ZNF252	146173402	0.052000	0.20516	0.871000	0.34182	0.884000	0.51177	1.921000	0.40035	1.369000	0.46134	0.514000	0.50259	GGA	ZNF252P	-	-	ENSG00000196922		0.408	ZNF252P-008	KNOWN	basic|exp_conf	processed_transcript	ZNF252P	HGNC	pseudogene	OTTHUMT00000451422.1	-	0.00	52	0	C	NR_023392		146202598	-1	tier1	-	no_errors	ENST00000426361	ensembl	human	known	74_37	rna	28.12	23	9	SNP	0.996	A
ZNF268	10795	genome.wustl.edu	37	12	133780453	133780453	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr12:133780453G>T	ENST00000536435.2	+	6	2511	c.2181G>T	c.(2179-2181)agG>agT	p.R727S	ZNF268_ENST00000228289.5_Missense_Mutation_p.R727S|ZNF268_ENST00000536899.2_3'UTR|ZNF268_ENST00000537565.1_Missense_Mutation_p.R566S|ZNF268_ENST00000542986.2_3'UTR|ZNF268_ENST00000541009.2_3'UTR	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	727					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		ATGAGTGCAGGGAATGCGGGA	0.423																																																	0													52.0	52.0	52.0					12																	133780453		692	1591	2283	SO:0001583	missense	0			X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.2181G>T	12.37:g.133780453G>T	ENSP00000444412:p.Arg727Ser		Q8TDG8|Q96RH4|Q9BZJ9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R727S	ENST00000536435.2	37	c.2181	CCDS45012.1	12	.	.	.	.	.	.	.	.	.	.	G	5.372	0.253963	0.10185	.	.	ENSG00000090612	ENST00000541009;ENST00000228289;ENST00000537565;ENST00000541019	T;T	0.16457	2.34;3.19	4.2	0.431	0.16523	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04318	0.0119	N	0.01134	-0.995	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.43940	-0.9360	8	.	.	.	.	4.9059	0.13799	0.0:0.1774:0.3059:0.5167	.	727;566	Q14587;Q14587-2	ZN268_HUMAN;.	S	727;727;566;566	ENSP00000228289:R727S;ENSP00000445713:R566S	.	R	+	3	2	ZNF268	.	0.000000	0.05858	0.010000	0.14722	0.975000	0.68041	-3.654000	0.00402	-0.076000	0.12775	-0.266000	0.10368	AGG	ZNF268	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000090612		0.423	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF268	HGNC	protein_coding	OTTHUMT00000397191.2	-	0.00	65	0	G	NM_152943		133780453	+1	tier1	-	no_errors	ENST00000228289	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.001	T
ZNF317	57693	genome.wustl.edu	37	19	9271573	9271573	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:9271573G>A	ENST00000247956.6	+	7	1557	c.1252G>A	c.(1252-1254)Gtg>Atg	p.V418M	ZNF317_ENST00000360385.3_Missense_Mutation_p.V386M	NM_020933.4	NP_065984.3	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	418					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	27						CAAGAAACCCGTGGAATGTCG	0.507																																																	0													77.0	78.0	77.0					19																	9271573		2203	4300	6503	SO:0001583	missense	0			AF275255	CCDS12210.1, CCDS54213.1	19p13	2013-01-08				ENSG00000130803		"""Zinc fingers, C2H2-type"", ""-"""	13507	protein-coding gene	gene with protein product		613864				10997877, 11688974	Standard	NM_020933		Approved		uc002mku.3	Q96PQ6		ENST00000247956.6:c.1252G>A	19.37:g.9271573G>A	ENSP00000247956:p.Val418Met		Q6DCA9|Q96PM0|Q96PM1|Q96PT2|Q9HCI4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V418M	ENST00000247956.6	37	c.1252	CCDS12210.1	19	.	.	.	.	.	.	.	.	.	.	G	10.32	1.316695	0.23908	.	.	ENSG00000130803	ENST00000247956;ENST00000360385	T;T	0.19394	2.15;2.15	2.92	-2.0	0.07433	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.630962	0.13121	N	0.412234	T	0.09905	0.0243	N	0.13098	0.295	0.09310	N	1	P;P	0.42649	0.567;0.786	B;B	0.40256	0.052;0.324	T	0.17653	-1.0362	10	0.87932	D	0	-8.6007	3.6369	0.08153	0.5196:0.0:0.2934:0.187	.	386;418	Q96PQ6-2;Q96PQ6	.;ZN317_HUMAN	M	418;386	ENSP00000247956:V418M;ENSP00000353554:V386M	ENSP00000247956:V418M	V	+	1	0	ZNF317	9132573	0.005000	0.15991	0.000000	0.03702	0.664000	0.39144	1.593000	0.36686	-0.309000	0.08779	0.491000	0.48974	GTG	ZNF317	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000130803		0.507	ZNF317-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF317	HGNC	protein_coding	OTTHUMT00000448995.1	-	0.00	39	0	G	NM_020933		9271573	+1	tier1	-	no_errors	ENST00000247956	ensembl	human	known	74_37	missense	26.47	25	9	SNP	0.000	A
ZNF354C	30832	genome.wustl.edu	37	5	178506424	178506424	+	Missense_Mutation	SNP	G	G	A	rs149169026		TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr5:178506424G>A	ENST00000315475.6	+	5	1297	c.991G>A	c.(991-993)Ggc>Agc	p.G331S		NM_014594.1	NP_055409.1	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	331					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|urinary_tract(3)	30	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		CTATAAATGCGGCGAATGTGA	0.438																																																	0								G	SER/GLY	0,4406		0,0,2203	171.0	181.0	178.0		991	0.2	0.1	5	dbSNP_134	178	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZNF354C	NM_014594.1	56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	331/555	178506424	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS4443.1	5q35	2013-01-08			ENSG00000177932	ENSG00000177932		"""Zinc fingers, C2H2-type"", ""-"""	16736	protein-coding gene	gene with protein product						10786630	Standard	NM_014594		Approved	KID3	uc003mju.3	Q86Y25	OTTHUMG00000130888	ENST00000315475.6:c.991G>A	5.37:g.178506424G>A	ENSP00000324064:p.Gly331Ser		Q6P4P9|Q8NFX1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G331S	ENST00000315475.6	37	c.991	CCDS4443.1	5	.	.	.	.	.	.	.	.	.	.	G	7.956	0.745988	0.15710	0.0	1.16E-4	ENSG00000177932	ENST00000315475	T	0.07216	3.21	4.04	0.254	0.15557	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03053	0.0090	N	0.05230	-0.09	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47623	-0.9103	9	0.13853	T	0.58	-1.1818	3.379	0.07247	0.4094:0.0:0.4105:0.1801	.	331	Q86Y25	Z354C_HUMAN	S	331	ENSP00000324064:G331S	ENSP00000324064:G331S	G	+	1	0	ZNF354C	178439030	0.000000	0.05858	0.060000	0.19600	0.898000	0.52572	-0.659000	0.05323	0.126000	0.18424	-0.948000	0.02665	GGC	ZNF354C	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000177932		0.438	ZNF354C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF354C	HGNC	protein_coding	OTTHUMT00000253473.2	-	0.00	28	0	G			178506424	+1	tier1	rs149169026	no_errors	ENST00000315475	ensembl	human	known	74_37	missense	19.05	17	4	SNP	0.115	A
ZNF518B	85460	genome.wustl.edu	37	4	10445662	10445662	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr4:10445662G>T	ENST00000326756.3	-	3	2729	c.2291C>A	c.(2290-2292)gCt>gAt	p.A764D		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	764					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						GGCAACATGAGCCTTCCTGGC	0.458																																																	0													94.0	95.0	95.0					4																	10445662		2203	4300	6503	SO:0001583	missense	0			AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.2291C>A	4.37:g.10445662G>T	ENSP00000317614:p.Ala764Asp		Q96LN8	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A764D	ENST00000326756.3	37	c.2291	CCDS33960.1	4	.	.	.	.	.	.	.	.	.	.	G	12.53	1.966563	0.34659	.	.	ENSG00000178163	ENST00000326756	T	0.01613	4.73	6.02	4.09	0.47781	.	1.169980	0.06296	N	0.700071	T	0.01905	0.0060	N	0.14661	0.345	0.09310	N	1	B	0.16396	0.017	B	0.15052	0.012	T	0.46925	-0.9156	10	0.36615	T	0.2	-0.1037	12.1596	0.54098	0.0:0.1216:0.7377:0.1407	.	764	Q9C0D4	Z518B_HUMAN	D	764	ENSP00000317614:A764D	ENSP00000317614:A764D	A	-	2	0	ZNF518B	10054760	0.000000	0.05858	0.650000	0.29550	0.589000	0.36550	0.844000	0.27654	1.513000	0.48852	0.655000	0.94253	GCT	ZNF518B	-	NULL	ENSG00000178163		0.458	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF518B	HGNC	protein_coding	OTTHUMT00000359040.1	-	0.00	36	0	G	NM_053042		10445662	-1	tier1	-	no_errors	ENST00000326756	ensembl	human	known	74_37	missense	28.57	10	4	SNP	0.048	T
ZNF524	147807	genome.wustl.edu	37	19	56114037	56114037	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:56114037C>T	ENST00000591046.1	+	1	793	c.559C>T	c.(559-561)Cac>Tac	p.H187Y	ZNF865_ENST00000568956.1_5'Flank|ZNF524_ENST00000301073.3_Missense_Mutation_p.H187Y			Q96C55	ZN524_HUMAN	zinc finger protein 524	187					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|large_intestine(2)|lung(6)|prostate(1)	10			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		CGAGCTGGCGCACCACCACCG	0.731																																																	0													7.0	10.0	9.0					19																	56114037		2149	4175	6324	SO:0001583	missense	0			BC014666	CCDS12929.1	19q13.43	2013-01-08				ENSG00000171443		"""Zinc fingers, C2H2-type"""	28322	protein-coding gene	gene with protein product						12477932	Standard	NM_153219		Approved	MGC23143	uc002qlk.1	Q96C55		ENST00000591046.1:c.559C>T	19.37:g.56114037C>T	ENSP00000466907:p.His187Tyr		Q6NW31|Q96IL7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H187Y	ENST00000591046.1	37	c.559	CCDS12929.1	19	.	.	.	.	.	.	.	.	.	.	C	15.49	2.850091	0.51270	.	.	ENSG00000171443	ENST00000301073	T	0.07567	3.18	3.38	2.35	0.29111	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07999	0.0200	N	0.05031	-0.125	0.09310	N	1	D	0.59357	0.985	P	0.57620	0.824	T	0.28138	-1.0053	9	0.59425	D	0.04	.	5.8397	0.18627	0.1905:0.7023:0.0:0.1071	.	187	Q96C55	ZN524_HUMAN	Y	187	ENSP00000301073:H187Y	ENSP00000301073:H187Y	H	+	1	0	ZNF524	60805849	0.000000	0.05858	0.969000	0.41365	0.814000	0.46013	0.282000	0.18829	0.998000	0.38996	0.561000	0.74099	CAC	ZNF524	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171443		0.731	ZNF524-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF524	HGNC	protein_coding	OTTHUMT00000457938.1		0.00	13	0	C	NM_153219		56114037	+1			no_errors	ENST00000301073	ensembl	human	known	74_37	missense	37.50	10	6	SNP	0.091	T
ZNF613	79898	genome.wustl.edu	37	19	52448658	52448658	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:52448658G>T	ENST00000293471.6	+	6	2201	c.1522G>T	c.(1522-1524)Ggg>Tgg	p.G508W	ZNF613_ENST00000601794.1_3'UTR|ZNF613_ENST00000391794.4_Missense_Mutation_p.G472W	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	508					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		AACTCATACAGGGGAGAGACC	0.448																																																	0													90.0	71.0	78.0					19																	52448658		2203	4300	6503	SO:0001583	missense	0			AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.1522G>T	19.37:g.52448658G>T	ENSP00000293471:p.Gly508Trp		Q96SS9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G508W	ENST00000293471.6	37	c.1522	CCDS33089.1	19	.	.	.	.	.	.	.	.	.	.	G	15.84	2.952586	0.53293	.	.	ENSG00000176024	ENST00000293471;ENST00000391794;ENST00000535279	T;T	0.26810	1.71;1.71	2.8	1.77	0.24775	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36972	N	0.002319	T	0.57095	0.2030	H	0.94462	3.54	0.27905	N	0.938842	D	0.89917	1.0	D	0.97110	1.0	T	0.54622	-0.8266	10	0.87932	D	0	.	9.4097	0.38485	0.1134:0.0:0.8866:0.0	.	508	Q6PF04	ZN613_HUMAN	W	508;472;182	ENSP00000293471:G508W;ENSP00000375671:G472W	ENSP00000293471:G508W	G	+	1	0	ZNF613	57140470	0.434000	0.25570	1.000000	0.80357	0.989000	0.77384	2.799000	0.47892	0.764000	0.33197	0.655000	0.94253	GGG	ZNF613	-	pfscan_Znf_C2H2	ENSG00000176024		0.448	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF613	HGNC	protein_coding	OTTHUMT00000461104.2	-	0.00	56	0	G	NM_024840		52448658	+1	tier1	-	no_errors	ENST00000293471	ensembl	human	known	74_37	missense	63.16	21	36	SNP	1.000	T
ZNF665	79788	genome.wustl.edu	37	19	53686050	53686050	+	Intron	SNP	T	T	G			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:53686050T>G	ENST00000600412.1	-	1	63				ZNF665_ENST00000598440.1_5'UTR|ZNF665_ENST00000396424.3_Intron			Q9H7R5	ZN665_HUMAN	zinc finger protein 665						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		GGCAGGATGCTTCAGACTCAG	0.498																																																	0													146.0	109.0	120.0					19																	53686050		692	1591	2283	SO:0001627	intron_variant	0				CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.52+10514A>C	19.37:g.53686050T>G			A8K5T8	RNA	SNP	-	NULL	ENST00000600412.1	37	NULL		19																																																																																			ZNF665	-	-	ENSG00000197497		0.498	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	ZNF665	HGNC	protein_coding	OTTHUMT00000464179.1	-	0.00	125	0	T	NM_024733		53686050	-1	tier1	-	no_errors	ENST00000598440	ensembl	human	known	74_37	rna	49.58	60	59	SNP	0.000	G
ZNF552	79818	genome.wustl.edu	37	19	58320386	58320386	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr19:58320386C>T	ENST00000391701.1	-	3	415	c.246G>A	c.(244-246)atG>atA	p.M82I	ZNF586_ENST00000598885.1_Intron|ZNF586_ENST00000599802.1_Intron	NM_024762.3	NP_079038.2	Q9H707	ZN552_HUMAN	zinc finger protein 552	82	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		ACACACCTGCCATAGGAGTCC	0.498																																																	0													6.0	7.0	6.0					19																	58320386		1438	3147	4585	SO:0001583	missense	0			AK097041	CCDS12963.1	19q13.43	2013-09-20			ENSG00000178935	ENSG00000178935		"""Zinc fingers, C2H2-type"", ""-"""	26135	protein-coding gene	gene with protein product							Standard	XM_005259267		Approved	FLJ21603	uc002qqg.3	Q9H707	OTTHUMG00000183478	ENST00000391701.1:c.246G>A	19.37:g.58320386C>T	ENSP00000375582:p.Met82Ile		B3KUE9|Q6P5A6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.M82I	ENST00000391701.1	37	c.246	CCDS12963.1	19	.	.	.	.	.	.	.	.	.	.	C	5.969	0.362750	0.11296	.	.	ENSG00000178935	ENST00000391701	T	0.04862	3.54	0.982	-0.314	0.12750	Krueppel-associated box (1);	.	.	.	.	T	0.03011	0.0089	N	0.08118	0	0.09310	N	1	B;B	0.18968	0.017;0.032	B;B	0.11329	0.006;0.003	T	0.42531	-0.9446	9	0.54805	T	0.06	.	3.6959	0.08364	0.0:0.7148:0.0:0.2852	.	78;82	B7Z1H1;Q9H707	.;ZN552_HUMAN	I	82	ENSP00000375582:M82I	ENSP00000375582:M82I	M	-	3	0	ZNF552	63012198	0.003000	0.15002	0.001000	0.08648	0.082000	0.17680	0.199000	0.17237	-0.048000	0.13401	0.205000	0.17691	ATG	ZNF552	-	pfscan_Krueppel-associated_box	ENSG00000178935		0.498	ZNF552-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF552	HGNC	protein_coding	OTTHUMT00000466829.1	-	0.00	26	0	C	NM_024762		58320386	-1	tier1	-	no_errors	ENST00000391701	ensembl	human	known	74_37	missense	34.38	21	11	SNP	0.002	T
ZNF678	339500	genome.wustl.edu	37	1	227834356	227834356	+	5'UTR	SNP	A	A	C			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr1:227834356A>C	ENST00000343776.5	+	0	294				ZNF678_ENST00000608949.1_5'UTR|ZNF678_ENST00000397097.3_Missense_Mutation_p.N79H|AL592310.1_ENST00000580546.1_RNA|ZNF678_ENST00000465266.1_3'UTR	NM_178549.3	NP_848644.2	Q5SXM1	ZN678_HUMAN	zinc finger protein 678						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|pancreas(1)|prostate(1)	24		Prostate(94;0.0885)				GAACTACAGAAACCTGGTCTC	0.428																																																	0													55.0	52.0	53.0					1																	227834356		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			BC042500		1q42.13	2013-01-08			ENSG00000181450	ENSG00000181450		"""Zinc fingers, C2H2-type"", ""-"""	28652	protein-coding gene	gene with protein product	"""hypothetical protein MGC42493"""					12477932	Standard	NM_178549		Approved	MGC42493	uc021pjy.1	Q5SXM1	OTTHUMG00000037700	ENST00000343776.5:c.-52A>C	1.37:g.227834356A>C			Q8IVQ9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N79H	ENST00000343776.5	37	c.235		1	.	.	.	.	.	.	.	.	.	.	A	15.48	2.845869	0.51164	.	.	ENSG00000181450	ENST00000397097;ENST00000440339	T;T	0.02421	4.3;4.3	1.3	-0.0385	0.13880	.	.	.	.	.	T	0.00906	0.0030	N	0.00771	-1.2	0.22280	N	0.999237	.	.	.	.	.	.	T	0.45338	-0.9268	7	0.49607	T	0.09	.	2.1927	0.03903	0.4173:0.2929:0.0:0.2898	.	.	.	.	H	79	ENSP00000440403:N79H;ENSP00000394651:N79H	ENSP00000440403:N79H	N	+	1	0	ZNF678	225900979	0.000000	0.05858	0.834000	0.33040	0.803000	0.45373	0.403000	0.20982	-0.032000	0.13758	0.334000	0.21626	AAC	ZNF678	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000181450		0.428	ZNF678-001	KNOWN	basic	protein_coding	ZNF678	HGNC	protein_coding	OTTHUMT00000091976.2	-	0.00	100	0	A	NM_178549		227834356	+1	tier1	-	no_errors	ENST00000397097	ensembl	human	known	74_37	missense	14.81	46	8	SNP	0.938	C
ZNF768	79724	genome.wustl.edu	37	16	30536019	30536019	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OE-01A-11D-A27G-09	TCGA-L5-A4OE-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5e93d5d-1a31-4968-ba2f-9a5aea90c8f5	f5a7b9b7-93ee-4402-bdbb-f582ed0568b5	g.chr16:30536019C>A	ENST00000380412.5	-	2	1617	c.1442G>T	c.(1441-1443)gGc>gTc	p.G481V	ZNF768_ENST00000562803.1_Missense_Mutation_p.G450V	NM_024671.3	NP_078947.3	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	481					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	DNA-directed RNA polymerase II, core complex (GO:0005665)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						GGGCCGCTCGCCCGTGTGGGA	0.682																																																	0													35.0	31.0	32.0					16																	30536019		2197	4299	6496	SO:0001583	missense	0			BC013760	CCDS10681.2	16p11.2	2013-01-08			ENSG00000169957	ENSG00000169957		"""Zinc fingers, C2H2-type"""	26273	protein-coding gene	gene with protein product						12477932	Standard	NM_024671		Approved	FLJ23436	uc002dyk.4	Q9H5H4	OTTHUMG00000132392	ENST00000380412.5:c.1442G>T	16.37:g.30536019C>A	ENSP00000369777:p.Gly481Val		Q569L7|Q96CX4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_RNA_pol_II_repeat_euk,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G481V	ENST00000380412.5	37	c.1442	CCDS10681.2	16	.	.	.	.	.	.	.	.	.	.	C	16.69	3.192113	0.58017	.	.	ENSG00000169957	ENST00000380412;ENST00000538507	T	0.01599	4.74	4.6	4.6	0.57074	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.173783	0.27932	N	0.017277	T	0.13415	0.0325	M	0.88640	2.97	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.00643	-1.1630	10	0.87932	D	0	-8.0082	16.3261	0.82979	0.0:1.0:0.0:0.0	.	481	Q9H5H4	ZN768_HUMAN	V	481;394	ENSP00000369777:G481V	ENSP00000369777:G481V	G	-	2	0	ZNF768	30443520	0.870000	0.30015	0.998000	0.56505	0.730000	0.41778	1.979000	0.40608	2.405000	0.81733	0.436000	0.28706	GGC	ZNF768	-	pfscan_Znf_C2H2	ENSG00000169957		0.682	ZNF768-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF768	HGNC	protein_coding	OTTHUMT00000255522.2	-	0.00	150	0	C	NM_024671		30536019	-1	tier1	-	no_errors	ENST00000380412	ensembl	human	known	74_37	missense	38.58	78	49	SNP	0.999	A
