#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AATK	9625	genome.wustl.edu	37	17	79108176	79108176	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:79108176C>T	ENST00000326724.4	-	2	205	c.181G>A	c.(181-183)Ggg>Agg	p.G61R	RP11-149I9.2_ENST00000570413.1_RNA|MIR1250_ENST00000408098.1_RNA|AATK_ENST00000417379.1_5'Flank	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	61				MLACLCCKKGGIGFK -> HQVKVQGCWGRWRWQ (in Ref. 2). {ECO:0000305}.	brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			ACCTTGAACCCGATACCGCCC	0.657																																																	0													32.0	35.0	34.0					17																	79108176		1567	3579	5146	SO:0001583	missense	0			AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.181G>A	17.37:g.79108176C>T	ENSP00000324196:p.Gly61Arg		O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G61R	ENST00000326724.4	37	c.181	CCDS45807.1	17	.	.	.	.	.	.	.	.	.	.	C	18.79	3.698903	0.68501	.	.	ENSG00000181409	ENST00000326724;ENST00000374792	T;T	0.78924	-1.22;-1.05	3.81	3.81	0.43845	.	0.274703	0.27315	N	0.019931	T	0.75191	0.3816	M	0.66939	2.045	0.80722	D	1	B	0.28605	0.217	B	0.22753	0.041	T	0.78357	-0.2235	10	0.72032	D	0.01	.	15.4861	0.75569	0.0:1.0:0.0:0.0	.	61	Q6ZMQ8	LMTK1_HUMAN	R	61	ENSP00000324196:G61R;ENSP00000363924:G61R	ENSP00000324196:G61R	G	-	1	0	AATK	76722771	0.999000	0.42202	1.000000	0.80357	0.906000	0.53458	5.436000	0.66538	1.961000	0.56991	0.460000	0.39030	GGG	AATK	-	NULL	ENSG00000181409		0.657	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AATK	HGNC	protein_coding	OTTHUMT00000256055.1	-	0.00	103	0	C	NM_004920		79108176	-1	tier1	-	no_errors	ENST00000326724	ensembl	human	known	74_37	missense	7.23	77	6	SNP	1.000	T
ABCC9	10060	genome.wustl.edu	37	12	21960336	21960336	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr12:21960336G>A	ENST00000261201.4	-	36	4392	c.4393C>T	c.(4393-4395)Cgc>Tgc	p.R1465C	ABCC9_ENST00000345162.2_Missense_Mutation_p.R1429C|ABCC9_ENST00000261200.4_Missense_Mutation_p.R1465C	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1465	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	CTGCTTTTGCGGACAAAGGCC	0.438																																																	0													158.0	145.0	149.0					12																	21960336		2203	4300	6503	SO:0001583	missense	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.4393C>T	12.37:g.21960336G>A	ENSP00000261201:p.Arg1465Cys		O60707	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2	p.R1465C	ENST00000261201.4	37	c.4393	CCDS8694.1	12	.	.	.	.	.	.	.	.	.	.	G	20.3	3.973723	0.74246	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.94046	-3.34;-3.34;-3.34;-3.34	5.15	5.15	0.70609	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.96950	0.9004	M	0.83384	2.64	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.97379	0.9981	10	0.87932	D	0	-10.9657	18.8248	0.92114	0.0:0.0:1.0:0.0	.	1465;1465	O60706;O60706-2	ABCC9_HUMAN;.	C	1465;1092;1465;1429	ENSP00000261200:R1465C;ENSP00000440521:R1092C;ENSP00000261201:R1465C;ENSP00000261202:R1429C	ENSP00000261200:R1465C	R	-	1	0	ABCC9	21851603	1.000000	0.71417	0.999000	0.59377	0.907000	0.53573	4.070000	0.57548	2.654000	0.90174	0.655000	0.94253	CGC	ABCC9	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000069431		0.438	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	-	0.00	61	0	G	NM_005691		21960336	-1	tier1	-	no_errors	ENST00000261200	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	A
ACOT11	26027	genome.wustl.edu	37	1	55013965	55013965	+	5'UTR	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:55013965C>T	ENST00000371316.3	+	0	65				ACOT11_ENST00000481208.1_Intron|ACOT11_ENST00000343744.2_5'UTR	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11						fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						GCGCTGCTTTCCCCGGCCACC	0.657																																					Ovarian(148;1440 1861 22015 32453 51933)												0													19.0	20.0	19.0					1																	55013965		2198	4299	6497	SO:0001623	5_prime_UTR_variant	0			AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.-18C>T	1.37:g.55013965C>T			B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	RNA	SNP	-	NULL	ENST00000371316.3	37	NULL	CCDS592.1	1																																																																																			ACOT11	-	-	ENSG00000162390		0.657	ACOT11-001	KNOWN	basic|CCDS	protein_coding	ACOT11	HGNC	protein_coding	OTTHUMT00000027356.1	-	0.00	66	0	C	NM_015547		55013965	+1	tier1	-	no_errors	ENST00000498228	ensembl	human	known	74_37	rna	9.30	39	4	SNP	0.216	T
ADAP2	55803	genome.wustl.edu	37	17	29253929	29253929	+	Missense_Mutation	SNP	G	G	T	rs568016516		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:29253929G>T	ENST00000330889.3	+	3	645	c.310G>T	c.(310-312)Gac>Tac	p.D104Y	ADAP2_ENST00000580525.1_Missense_Mutation_p.D110Y	NM_018404.2	NP_060874.1	Q9NPF8	ADAP2_HUMAN	ArfGAP with dual PH domains 2	104	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				heart development (GO:0007507)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|mitochondrial envelope (GO:0005740)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						CCAGGCCAACGACTGCCTGTG	0.542																																																	1	Unknown(1)	central_nervous_system(1)											96.0	76.0	83.0					17																	29253929		2203	4300	6503	SO:0001583	missense	0			AJ238994	CCDS11261.1	17q11.2	2013-01-10	2008-09-22	2008-09-22	ENSG00000184060	ENSG00000184060		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16487	protein-coding gene	gene with protein product		608635	"""centaurin, alpha 2"""	CENTA2			Standard	XM_005258008		Approved		uc002hfx.3	Q9NPF8	OTTHUMG00000132868	ENST00000330889.3:c.310G>T	17.37:g.29253929G>T	ENSP00000329468:p.Asp104Tyr		Q8N4Q6|Q96SD5	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,smart_ArfGAP,smart_Pleckstrin_homology,prints_ArfGAP,pfscan_Pleckstrin_homology,pfscan_ArfGAP	p.D104Y	ENST00000330889.3	37	c.310	CCDS11261.1	17	.	.	.	.	.	.	.	.	.	.	G	13.13	2.144890	0.37825	.	.	ENSG00000184060	ENST00000330889	T	0.48836	0.8	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.80199	0.4579	H	0.97852	4.09	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.86947	0.2083	10	0.72032	D	0.01	.	14.8511	0.70297	0.0:0.0:1.0:0.0	.	110;104;104	Q2V6Q1;Q9NPF8-2;Q9NPF8	.;.;ADAP2_HUMAN	Y	104	ENSP00000329468:D104Y	ENSP00000329468:D104Y	D	+	1	0	ADAP2	26278055	1.000000	0.71417	0.959000	0.39883	0.797000	0.45037	8.242000	0.89818	2.599000	0.87857	0.561000	0.74099	GAC	ADAP2	-	pfam_ArfGAP,smart_ArfGAP,pfscan_ArfGAP	ENSG00000184060		0.542	ADAP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAP2	HGNC	protein_coding	OTTHUMT00000256346.1	-	0.00	106	0	G	NM_018404		29253929	+1	tier1	-	no_errors	ENST00000330889	ensembl	human	known	74_37	missense	18.33	98	22	SNP	0.998	T
ADCK3	56997	genome.wustl.edu	37	1	227173017	227173017	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:227173017G>C	ENST00000366779.1	+	19	4406	c.1635G>C	c.(1633-1635)aaG>aaC	p.K545N	ADCK3_ENST00000458507.2_Missense_Mutation_p.K266N|ADCK3_ENST00000478406.1_3'UTR|ADCK3_ENST00000433743.2_Missense_Mutation_p.K219N|ADCK3_ENST00000366778.1_Missense_Mutation_p.K493N|ADCK3_ENST00000366777.3_Missense_Mutation_p.K545N			Q8NI60	ADCK3_HUMAN	aarF domain containing kinase 3	545					cell death (GO:0008219)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(2)|large_intestine(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	9						TAGAGATGAAGTTCCTCACCG	0.622																																																	0													117.0	110.0	112.0					1																	227173017		2203	4300	6503	SO:0001583	missense	0			AJ278126	CCDS1557.1	1q42.11	2011-05-03	2010-10-01	2010-10-01	ENSG00000163050	ENSG00000163050			16812	protein-coding gene	gene with protein product	"""coenzyme Q8 homolog (yeast)"""	606980	"""chaperone-ABC1 (activity of bc1 complex, S.pombe)-like"", ""chaperone, ABC1 activity of bc1 complex like (S. pombe)"", ""chaperone, ABC1 activity of bc1 complex homolog (S. pombe)"""	CABC1			Standard	NM_020247		Approved	COQ8, SCAR9	uc001hqn.1	Q8NI60	OTTHUMG00000037621	ENST00000366779.1:c.1635G>C	1.37:g.227173017G>C	ENSP00000355741:p.Lys545Asn		Q5T7A5|Q63HK0|Q8NCJ6|Q9HBQ1|Q9NQ67	Missense_Mutation	SNP	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.K545N	ENST00000366779.1	37	c.1635	CCDS1557.1	1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047243	0.75846	.	.	ENSG00000163050	ENST00000366779;ENST00000366778;ENST00000366777;ENST00000366776;ENST00000458507;ENST00000366775;ENST00000405743;ENST00000433743	T;T;T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58;0.58;0.58	5.6	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.46946	0.1419	L	0.61218	1.895	0.58432	D	0.999995	B;P	0.42375	0.251;0.778	B;B	0.40864	0.097;0.342	T	0.52975	-0.8503	10	0.62326	D	0.03	-42.8978	5.3449	0.16004	0.2752:0.0:0.7247:0.0	.	219;545	E7EVZ8;Q8NI60	.;ADCK3_HUMAN	N	545;493;545;470;266;390;496;219	ENSP00000355741:K545N;ENSP00000355740:K493N;ENSP00000355739:K545N;ENSP00000355738:K470N;ENSP00000403704:K266N;ENSP00000355737:K390N;ENSP00000404550:K219N	ENSP00000355737:K390N	K	+	3	2	ADCK3	225239640	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	3.420000	0.52735	2.625000	0.88918	0.561000	0.74099	AAG	ADCK3	-	NULL	ENSG00000163050		0.622	ADCK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ADCK3	HGNC	protein_coding	OTTHUMT00000091712.1	-	0.00	36	0	G	NM_020247		227173017	+1	tier1	-	no_errors	ENST00000366777	ensembl	human	known	74_37	missense	12.82	34	5	SNP	1.000	C
AKAP6	9472	genome.wustl.edu	37	14	33014439	33014439	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr14:33014439C>T	ENST00000280979.4	+	4	750	c.580C>T	c.(580-582)Cgg>Tgg	p.R194W	AKAP6_ENST00000557272.1_Missense_Mutation_p.R194W|AKAP6_ENST00000557354.1_Missense_Mutation_p.R194W	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	194					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GTTTCAGGGCCGGCTTGATTC	0.393																																					Melanoma(49;821 1200 7288 13647 42351)												0													120.0	116.0	117.0					14																	33014439		2203	4300	6503	SO:0001583	missense	0			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.580C>T	14.37:g.33014439C>T	ENSP00000280979:p.Arg194Trp		A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.R194W	ENST00000280979.4	37	c.580	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	C	19.15	3.770978	0.69992	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557272	T;T;T	0.38240	2.4;1.17;1.15	5.89	5.89	0.94794	.	0.000000	0.64402	D	0.000001	T	0.59032	0.2164	M	0.66939	2.045	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.59989	-0.7350	10	0.87932	D	0	-10.7639	15.03	0.71698	0.1421:0.8579:0.0:0.0	.	194;194	A7E242;Q13023	.;AKAP6_HUMAN	W	194	ENSP00000280979:R194W;ENSP00000450531:R194W;ENSP00000451247:R194W	ENSP00000280979:R194W	R	+	1	2	AKAP6	32084190	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	5.306000	0.65756	2.793000	0.96121	0.655000	0.94253	CGG	AKAP6	-	NULL	ENSG00000151320		0.393	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	-	0.00	37	0	C	NM_004274		33014439	+1	tier1	-	no_errors	ENST00000280979	ensembl	human	known	74_37	missense	20.00	28	7	SNP	1.000	T
GMPPB	29925	genome.wustl.edu	37	3	49756817	49756817	+	3'UTR	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr3:49756817G>T	ENST00000480687.1	-	0	3567				RNF123_ENST00000433785.1_Intron|RNF123_ENST00000497099.1_Intron|RNF123_ENST00000327697.6_Intron|AMIGO3_ENST00000320431.7_Missense_Mutation_p.P28T|AMIGO3_ENST00000535833.1_Missense_Mutation_p.P28T			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AGCGCACGGGGCGGGAAACCC	0.652											OREG0015572	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													54.0	60.0	58.0					3																	49756817		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.*2368C>A	3.37:g.49756817G>T		964	A8K6N5|Q9H7U3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.P28T	ENST00000480687.1	37	c.82	CCDS2803.1	3	.	.	.	.	.	.	.	.	.	.	G	16.15	3.042810	0.55003	.	.	ENSG00000176020	ENST00000320431;ENST00000535833	T;T	0.60040	0.22;0.22	5.8	-1.23	0.09465	.	0.850734	0.10466	N	0.671388	T	0.32133	0.0819	N	0.14661	0.345	0.25352	N	0.98885	B	0.14012	0.009	B	0.17098	0.017	T	0.17684	-1.0361	10	0.41790	T	0.15	-7.8442	1.2337	0.01949	0.2945:0.11:0.3715:0.224	.	28	Q86WK7	AMGO3_HUMAN	T	28	ENSP00000323096:P28T;ENSP00000439268:P28T	ENSP00000323096:P28T	P	-	1	0	AMIGO3	49731821	0.000000	0.05858	0.003000	0.11579	0.073000	0.16967	0.112000	0.15479	-0.131000	0.11578	0.655000	0.94253	CCC	AMIGO3	-	NULL	ENSG00000176020		0.652	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMIGO3	HGNC	protein_coding	OTTHUMT00000350291.1		0.00	41	0	G	NM_013334		49756817	-1			no_errors	ENST00000320431	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.001	T
ANKRD36C	400986	genome.wustl.edu	37	2	96557486	96557486	+	Splice_Site	SNP	C	C	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:96557486C>G	ENST00000456556.1	-	46	2869		c.e46-1		ANKRD36C_ENST00000295246.5_Splice_Site|ANKRD36C_ENST00000420871.2_Splice_Site|ANKRD36C_ENST00000419039.2_Splice_Site			Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C								ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						CACTTGTAGCCTGAATGGAAT	0.289																																																	0																																										SO:0001630	splice_region_variant	0			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.2785-1G>C	2.37:g.96557486C>G			C9JZ08|Q15694|Q53S06|Q658V2	Splice_Site	SNP	-	e46-1	ENST00000456556.1	37	c.2785-1		2	.	.	.	.	.	.	.	.	.	.	c	1.833	-0.469424	0.04445	.	.	ENSG00000174501	ENST00000420871;ENST00000456556;ENST00000295246	.	.	.	0.569	0.569	0.17340	.	.	.	.	.	.	.	.	.	.	.	0.21579	N	0.999633	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	-1	.	.	.	-	.	.	AC073995.2	95921213	0.168000	0.22989	0.035000	0.18076	0.018000	0.09664	1.442000	0.35046	0.567000	0.29293	0.184000	0.17185	.	ANKRD36C	-	-	ENSG00000174501		0.289	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	HGNC	protein_coding	OTTHUMT00000338799.2	-	0.00	138	0	C	NM_001010914	Intron	96557486	-1	tier1	-	no_errors	ENST00000456556	ensembl	human	known	74_37	splice_site	19.29	111	27	SNP	0.047	G
ARHGAP15	55843	genome.wustl.edu	37	2	144194557	144194557	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:144194557A>T	ENST00000295095.6	+	8	816	c.649A>T	c.(649-651)Agt>Tgt	p.S217C	AC096558.1_ENST00000442794.1_RNA|AC096558.1_ENST00000549032.1_RNA|AC096558.1_ENST00000550516.1_RNA|RP11-570L15.2_ENST00000546678.1_RNA	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	217					positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		TGAATTGCTAAGTCACTACGA	0.348																																																	0													77.0	75.0	76.0					2																	144194557		2203	4300	6503	SO:0001583	missense	0			AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.649A>T	2.37:g.144194557A>T	ENSP00000295095:p.Ser217Cys		Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.S217C	ENST00000295095.6	37	c.649	CCDS2184.1	2	.	.	.	.	.	.	.	.	.	.	A	15.52	2.858965	0.51376	.	.	ENSG00000075884	ENST00000295095	T	0.09911	2.93	5.55	2.84	0.33178	.	0.612022	0.18861	N	0.129127	T	0.08935	0.0221	L	0.29908	0.895	0.36185	D	0.849698	P;P	0.51653	0.947;0.86	B;P	0.44359	0.319;0.447	T	0.25433	-1.0132	10	0.62326	D	0.03	.	6.7508	0.23485	0.7159:0.1307:0.1534:0.0	.	217;217	B4E0R3;Q53QZ3	.;RHG15_HUMAN	C	217	ENSP00000295095:S217C	ENSP00000295095:S217C	S	+	1	0	ARHGAP15	143911027	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.154000	0.42291	0.926000	0.37118	0.528000	0.53228	AGT	ARHGAP15	-	NULL	ENSG00000075884		0.348	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP15	HGNC	protein_coding	OTTHUMT00000254793.2	-	0.00	57	0	A	NM_018460		144194557	+1	tier1	-	no_errors	ENST00000295095	ensembl	human	known	74_37	missense	28.57	25	10	SNP	0.996	T
ARHGAP23	57636	genome.wustl.edu	37	17	36633872	36633872	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:36633872C>T	ENST00000431231.2	+	12	2239	c.2171C>T	c.(2170-2172)gCg>gTg	p.A724V	ARHGAP23_ENST00000437668.3_Missense_Mutation_p.A724V|ARHGAP23_ENST00000443378.1_Missense_Mutation_p.A630V	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	724	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						GCGCTGCGGGCGCGCTCGCTC	0.766																																																	0													2.0	2.0	2.0					17																	36633872		575	1315	1890	SO:0001583	missense	0			AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.2171C>T	17.37:g.36633872C>T	ENSP00000393539:p.Ala724Val			Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_PDZ,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.A724V	ENST00000431231.2	37	c.2171	CCDS56027.1	17	.	.	.	.	.	.	.	.	.	.	c	10.05	1.242927	0.22796	.	.	ENSG00000225485	ENST00000437668;ENST00000431231;ENST00000443378	T;T;T	0.79554	-1.28;-1.28;-1.28	3.18	2.18	0.27775	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.418585	0.23563	U	0.046836	T	0.58104	0.2099	N	0.12182	0.205	0.24382	N	0.994785	P;B	0.36483	0.555;0.236	B;B	0.30855	0.121;0.02	T	0.53521	-0.8427	10	0.54805	T	0.06	.	5.9581	0.19286	0.0:0.6846:0.1998:0.1156	.	724;724	Q9P227;Q9P227-2	RHG23_HUMAN;.	V	724;724;630	ENSP00000394153:A724V;ENSP00000393539:A724V;ENSP00000407333:A630V	ENSP00000393539:A724V	A	+	2	0	ARHGAP23	33887398	0.997000	0.39634	1.000000	0.80357	0.010000	0.07245	1.408000	0.34668	0.533000	0.28675	-0.428000	0.05917	GCG	ARHGAP23	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000225485		0.766	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP23	HGNC	protein_coding	OTTHUMT00000441789.1		0.00	33	0	C	XM_290799		36633872	+1			no_errors	ENST00000431231	ensembl	human	known	74_37	missense	11.11	24	3	SNP	0.999	T
ARHGAP5	394	genome.wustl.edu	37	14	32563112	32563112	+	Silent	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr14:32563112G>A	ENST00000345122.3	+	2	3552	c.3237G>A	c.(3235-3237)ttG>ttA	p.L1079L	ARHGAP5_ENST00000539826.2_Silent_p.L1079L|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000556611.1_Silent_p.L1079L|ARHGAP5_ENST00000432921.1_Silent_p.L1079L|ARHGAP5_ENST00000433497.1_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	1079					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		GGGTGCCTTTGGCACATCCTG	0.388																																					NSCLC(9;77 350 3443 29227 41353)												0													47.0	51.0	50.0					14																	32563112		2203	4299	6502	SO:0001819	synonymous_variant	0			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.3237G>A	14.37:g.32563112G>A			A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Silent	SNP	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.L1079	ENST00000345122.3	37	c.3237	CCDS32062.1	14																																																																																			ARHGAP5	-	NULL	ENSG00000100852		0.388	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	HGNC	protein_coding	OTTHUMT00000409735.1	-	0.00	31	0	G	NM_001030055		32563112	+1	tier1	-	no_errors	ENST00000345122	ensembl	human	known	74_37	silent	19.05	17	4	SNP	1.000	A
ARID2	196528	genome.wustl.edu	37	12	46298934	46298934	+	3'UTR	SNP	C	C	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr12:46298934C>G	ENST00000334344.6	+	0	5753				ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000444670.1_3'UTR|ARID2_ENST00000457135.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)						chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		AAGAAAGCACCAAGTCTTAAT	0.393			"""N, S, F"""		hepatocellular carcinoma																																			Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.*73C>G	12.37:g.46298934C>G			Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	RNA	SNP	-	NULL	ENST00000334344.6	37	NULL	CCDS31783.1	12																																																																																			ARID2	-	-	ENSG00000189079		0.393	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	HGNC	protein_coding	OTTHUMT00000318380.2	-	0.00	18	0	C	XM_350875		46298934	+1	tier1	-	no_errors	ENST00000479608	ensembl	human	known	74_37	rna	29.41	12	5	SNP	1.000	G
ART1	417	genome.wustl.edu	37	11	3681398	3681398	+	Missense_Mutation	SNP	A	A	G	rs199558962		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr11:3681398A>G	ENST00000250693.1	+	3	750	c.649A>G	c.(649-651)Acc>Gcc	p.T217A		NM_004314.2	NP_004305.2	P52961	NAR1_HUMAN	ADP-ribosyltransferase 1	217					innate immune response (GO:0045087)|protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(1)|large_intestine(2)|liver(1)|lung(3)|skin(1)	8		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0351)|LUSC - Lung squamous cell carcinoma(625;0.195)		TGGTGAGGACACCTTCTTCGG	0.632																																																	0													45.0	41.0	42.0					11																	3681398		2201	4298	6499	SO:0001583	missense	0			S74683	CCDS7744.1	11p15	2006-02-23			ENSG00000129744	ENSG00000129744		"""CD molecules"""	723	protein-coding gene	gene with protein product		601625				8812442	Standard	NM_004314		Approved	ART2, CD296	uc001lye.1	P52961	OTTHUMG00000011845	ENST00000250693.1:c.649A>G	11.37:g.3681398A>G	ENSP00000250693:p.Thr217Ala		Q6NTD2|Q96KT9	Missense_Mutation	SNP	pfam_ART,prints_ART	p.T217A	ENST00000250693.1	37	c.649	CCDS7744.1	11	.	.	.	.	.	.	.	.	.	.	A	17.42	3.385119	0.61956	.	.	ENSG00000129744	ENST00000250693	T	0.12465	2.68	5.41	4.21	0.49690	.	0.205234	0.52532	N	0.000080	T	0.34077	0.0885	M	0.84156	2.68	0.38362	D	0.944627	D	0.63046	0.992	D	0.63192	0.912	T	0.29731	-1.0002	9	.	.	.	.	9.4462	0.38699	0.841:0.0:0.0:0.159	.	217	P52961	NAR1_HUMAN	A	217	ENSP00000250693:T217A	.	T	+	1	0	ART1	3637974	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.776000	0.55356	2.048000	0.60808	0.460000	0.39030	ACC	ART1	-	pfam_ART,prints_ART	ENSG00000129744		0.632	ART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ART1	HGNC	protein_coding	OTTHUMT00000032765.1	-	0.00	46	0	A	NM_004314		3681398	+1	tier1	rs199558962	no_errors	ENST00000250693	ensembl	human	known	74_37	missense	28.21	28	11	SNP	1.000	G
ASPM	259266	genome.wustl.edu	37	1	197060162	197060162	+	Nonsense_Mutation	SNP	G	G	A	rs587783292		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:197060162G>A	ENST00000367409.4	-	23	9710	c.9454C>T	c.(9454-9456)Cga>Tga	p.R3152*	ASPM_ENST00000367408.1_Nonsense_Mutation_p.R817*|ASPM_ENST00000294732.7_Nonsense_Mutation_p.R1567*	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	3152					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						AATCTTGCTCGAAACCATCTC	0.289																																																	0													68.0	69.0	69.0					1																	197060162		2202	4299	6501	SO:0001587	stop_gained	0			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.9454C>T	1.37:g.197060162G>A	ENSP00000356379:p.Arg3152*		Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Nonsense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.R3152*	ENST00000367409.4	37	c.9454	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	G	51	17.640436	0.99890	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408;ENST00000367406	.	.	.	4.88	3.94	0.45596	.	0.168402	0.36740	N	0.002439	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.6061	0.28103	0.0766:0.0:0.6288:0.2946	.	.	.	.	X	3152;1567;817;1138	.	ENSP00000294732:R1567X	R	-	1	2	ASPM	195326785	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	1.552000	0.36244	1.141000	0.42275	0.313000	0.20887	CGA	ASPM	-	superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_IQ_motif_EF-hand-BS	ENSG00000066279		0.289	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1		0.00	40	0	G	NM_018136		197060162	-1			no_errors	ENST00000367409	ensembl	human	known	74_37	nonsense	5.41	35	2	SNP	1.000	A
ASTE1	28990	genome.wustl.edu	37	3	130743962	130743962	+	Missense_Mutation	SNP	G	G	T	rs200808262		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr3:130743962G>T	ENST00000264992.3	-	3	630	c.189C>A	c.(187-189)ttC>ttA	p.F63L	NEK11_ENST00000356918.4_5'Flank|ASTE1_ENST00000514044.1_Missense_Mutation_p.F63L|NEK11_ENST00000510769.1_5'Flank|NEK11_ENST00000429253.2_5'Flank|NEK11_ENST00000383366.4_5'Flank|NEK11_ENST00000507910.1_5'Flank|NEK11_ENST00000412440.2_5'Flank|NEK11_ENST00000510688.1_5'Flank|NEK11_ENST00000511262.1_5'Flank	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	63					DNA repair (GO:0006281)		nuclease activity (GO:0004518)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						GTGATTCAAAGAATTTTTGTA	0.363																																																	0													90.0	83.0	85.0					3																	130743962		2203	4300	6503	SO:0001583	missense	0			AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.189C>A	3.37:g.130743962G>T	ENSP00000264992:p.Phe63Leu		B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Missense_Mutation	SNP	pfam_XPG_DNA_repair_N	p.F63L	ENST00000264992.3	37	c.189	CCDS3068.1	3	.	.	.	.	.	.	.	.	.	.	G	13.71	2.317860	0.40996	.	.	ENSG00000034533	ENST00000514044;ENST00000264992;ENST00000446270	T;T	0.62498	0.02;0.02	5.44	2.56	0.30785	XPG N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.77890	0.4198	M	0.86953	2.85	0.44181	D	0.996995	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.76377	-0.2981	10	0.48119	T	0.1	-24.158	8.3714	0.32417	0.3474:0.0:0.6526:0.0	.	63;63	D6RG30;Q2TB18	.;ASTE1_HUMAN	L	63	ENSP00000426421:F63L;ENSP00000264992:F63L	ENSP00000264992:F63L	F	-	3	2	ASTE1	132226652	0.999000	0.42202	0.994000	0.49952	0.118000	0.20060	0.496000	0.22499	0.602000	0.29896	-0.145000	0.13849	TTC	ASTE1	-	pfam_XPG_DNA_repair_N	ENSG00000034533		0.363	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTE1	HGNC	protein_coding	OTTHUMT00000356659.1		0.00	24	0	G	NM_014065		130743962	-1			no_errors	ENST00000264992	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
ATP6V0D2	245972	genome.wustl.edu	37	8	87111238	87111238	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr8:87111238G>A	ENST00000285393.3	+	1	173	c.31G>A	c.(31-33)Gtg>Atg	p.V11M	CTD-3118D11.2_ENST00000522679.1_RNA	NM_152565.1	NP_689778.1	Q8N8Y2	VA0D2_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2	11					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrogen ion transmembrane transporter activity (GO:0015078)			breast(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|prostate(1)	27						GTACTTCAACGTGGACCATGG	0.562																																																	0													136.0	102.0	114.0					8																	87111238		2203	4300	6503	SO:0001583	missense	0			AY079172	CCDS6241.1	8q21.3	2014-01-28	2006-01-20	2002-05-24	ENSG00000147614	ENSG00000147614		"""ATPases / V-type"""	18266	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 38kD, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D2"""			12384298	Standard	NM_152565		Approved	FLJ38708, VMA6, ATP6D2	uc003ydp.1	Q8N8Y2	OTTHUMG00000163637	ENST00000285393.3:c.31G>A	8.37:g.87111238G>A	ENSP00000285393:p.Val11Met			Missense_Mutation	SNP	pfam_ATPase_V0-cplx_csu/dsu,superfamily_ATPase_V0-cplx_csu/dsu,pirsf_ATPase_V0-cplx_dsu	p.V11M	ENST00000285393.3	37	c.31	CCDS6241.1	8	.	.	.	.	.	.	.	.	.	.	G	17.13	3.311143	0.60414	.	.	ENSG00000147614	ENST00000521564;ENST00000523635;ENST00000285393	T	0.34472	1.36	5.56	4.67	0.58626	.	0.236615	0.33401	N	0.004948	T	0.36082	0.0954	L	0.53617	1.68	0.48762	D	0.999707	P	0.52061	0.95	B	0.44044	0.439	T	0.11060	-1.0603	10	0.39692	T	0.17	10.1292	12.5516	0.56229	0.0827:0.0:0.9173:0.0	.	11	Q8N8Y2	VA0D2_HUMAN	M	11	ENSP00000285393:V11M	ENSP00000285393:V11M	V	+	1	0	ATP6V0D2	87180354	1.000000	0.71417	0.968000	0.41197	0.926000	0.56050	5.108000	0.64609	2.612000	0.88384	0.591000	0.81541	GTG	ATP6V0D2	-	pirsf_ATPase_V0-cplx_dsu	ENSG00000147614		0.562	ATP6V0D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0D2	HGNC	protein_coding	OTTHUMT00000374651.1	-	0.00	77	0	G	NM_152565		87111238	+1	tier1	-	no_errors	ENST00000285393	ensembl	human	known	74_37	missense	20.00	40	10	SNP	0.981	A
ATRN	8455	genome.wustl.edu	37	20	3557593	3557593	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr20:3557593G>A	ENST00000262919.5	+	14	2370	c.2302G>A	c.(2302-2304)Gac>Aac	p.D768N	ATRN_ENST00000446916.2_Missense_Mutation_p.D768N	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	768	PSI 2.				cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						CTGTGCCCTGGACCAGAACTG	0.537																																																	0													100.0	97.0	98.0					20																	3557593		2203	4300	6503	SO:0001583	missense	0			AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.2302G>A	20.37:g.3557593G>A	ENSP00000262919:p.Asp768Asn		A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Plexin_repeat,pfam_CUB_dom,superfamily_C-type_lectin_fold,superfamily_CUB_dom,superfamily_Plexin-like_fold,smart_EG-like_dom,smart_CUB_dom,smart_Plexin-like_fold,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.D768N	ENST00000262919.5	37	c.2302	CCDS13053.1	20	.	.	.	.	.	.	.	.	.	.	G	12.20	1.867846	0.32977	.	.	ENSG00000088812	ENST00000262919;ENST00000446916;ENST00000340500	T;T	0.05319	3.46;3.52	5.81	5.81	0.92471	.	0.045877	0.85682	D	0.000000	T	0.12305	0.0299	N	0.25144	0.715	0.80722	D	1	B;D	0.76494	0.007;0.999	B;D	0.69479	0.007;0.964	T	0.07404	-1.0774	10	0.05436	T	0.98	-22.7802	19.6765	0.95936	0.0:0.0:1.0:0.0	.	768;768	O75882;O75882-2	ATRN_HUMAN;.	N	768;768;694	ENSP00000262919:D768N;ENSP00000416587:D768N	ENSP00000262919:D768N	D	+	1	0	ATRN	3505593	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.994000	0.88315	2.758000	0.94735	0.561000	0.74099	GAC	ATRN	-	smart_Plexin-like_fold	ENSG00000088812		0.537	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRN	HGNC	protein_coding	OTTHUMT00000077740.2	-	0.00	71	0	G	NM_139321		3557593	+1	tier1	-	no_errors	ENST00000262919	ensembl	human	known	74_37	missense	16.42	56	11	SNP	1.000	A
BOD1L1	259282	genome.wustl.edu	37	4	13602210	13602210	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr4:13602210A>G	ENST00000040738.5	-	10	6449	c.6314T>C	c.(6313-6315)aTg>aCg	p.M2105T		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2105						nucleus (GO:0005634)	DNA binding (GO:0003677)										GGTACCTTCCATATTTTCTTC	0.468																																																	0													64.0	61.0	62.0					4																	13602210		2203	4300	6503	SO:0001583	missense	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.6314T>C	4.37:g.13602210A>G	ENSP00000040738:p.Met2105Thr		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	NULL	p.M2105T	ENST00000040738.5	37	c.6314	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	A	8.164	0.790278	0.16258	.	.	ENSG00000038219	ENST00000040738	T	0.06142	3.34	5.5	-10.8	0.00216	.	2.561000	0.01213	N	0.007880	T	0.03305	0.0096	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37009	-0.9724	10	0.13853	T	0.58	0.105	5.7496	0.18140	0.1237:0.3573:0.4228:0.0961	.	2105	Q8NFC6	BOD1L_HUMAN	T	2105	ENSP00000040738:M2105T	ENSP00000040738:M2105T	M	-	2	0	BOD1L	13211308	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-3.216000	0.00554	-1.323000	0.02275	0.454000	0.30748	ATG	BOD1L1	-	NULL	ENSG00000038219		0.468	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	-	0.00	33	0	A	NM_148894		13602210	-1	tier1	-	no_errors	ENST00000040738	ensembl	human	known	74_37	missense	53.33	14	16	SNP	0.000	G
BRINP3	339479	genome.wustl.edu	37	1	190067650	190067650	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:190067650T>G	ENST00000367462.3	-	8	2030	c.1799A>C	c.(1798-1800)aAg>aCg	p.K600T	BRINP3_ENST00000534846.1_Missense_Mutation_p.K498T	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	600					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											TAGGTCCAACTTAGTCCGCTC	0.473																																																	0													206.0	213.0	211.0					1																	190067650		2203	4300	6503	SO:0001583	missense	0			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1799A>C	1.37:g.190067650T>G	ENSP00000356432:p.Lys600Thr		B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.K600T	ENST00000367462.3	37	c.1799	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	T	7.503	0.653099	0.14580	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.18657	2.46;2.2	5.61	1.91	0.25777	.	0.157466	0.56097	D	0.000035	T	0.14184	0.0343	L	0.48642	1.525	0.48696	D	0.999692	B;P	0.34522	0.081;0.455	B;B	0.29440	0.065;0.102	T	0.12477	-1.0546	10	0.20046	T	0.44	.	7.7758	0.29037	0.0:0.2751:0.0:0.7249	.	498;600	B7Z260;Q76B58	.;FAM5C_HUMAN	T	600;498	ENSP00000356432:K600T;ENSP00000438022:K498T	ENSP00000356432:K600T	K	-	2	0	FAM5C	188334273	0.998000	0.40836	0.900000	0.35374	0.995000	0.86356	2.788000	0.47806	0.072000	0.16694	0.477000	0.44152	AAG	BRINP3	-	NULL	ENSG00000162670		0.473	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP3	HGNC	protein_coding	OTTHUMT00000086278.1	-	0.00	46	0	T	NM_199051		190067650	-1	tier1	-	no_errors	ENST00000367462	ensembl	human	known	74_37	missense	35.29	33	18	SNP	1.000	G
BTBD11	121551	genome.wustl.edu	37	12	108008884	108008884	+	Missense_Mutation	SNP	G	G	T	rs140496495		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr12:108008884G>T	ENST00000280758.5	+	7	2474	c.1946G>T	c.(1945-1947)cGc>cTc	p.R649L	RP11-128P10.1_ENST00000548473.1_RNA|BTBD11_ENST00000357167.4_Missense_Mutation_p.R186L|BTBD11_ENST00000420571.2_Missense_Mutation_p.R649L|BTBD11_ENST00000490090.2_Missense_Mutation_p.R649L	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	649						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CCCGAGACCCGCCATTGGACG	0.403																																																	0													159.0	143.0	148.0					12																	108008884		2203	4300	6503	SO:0001583	missense	0			AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.1946G>T	12.37:g.108008884G>T	ENSP00000280758:p.Arg649Leu		A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_BTB_POZ,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,superfamily_Histone-fold,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.R649L	ENST00000280758.5	37	c.1946	CCDS31893.1	12	.	.	.	.	.	.	.	.	.	.	G	23.2	4.388349	0.82902	.	.	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000490090;ENST00000357167	T;T;T;T	0.63744	0.69;-0.06;0.69;0.69	5.76	5.76	0.90799	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.72334	0.3447	L	0.28649	0.875	0.80722	D	1	D;D;D;D	0.76494	0.998;0.999;0.999;0.977	D;D;D;P	0.85130	0.994;0.997;0.997;0.693	T	0.74380	-0.3684	10	0.72032	D	0.01	.	19.9857	0.97347	0.0:0.0:1.0:0.0	.	649;186;649;649	A6QL63-2;E9PHS4;A6QL63;A6QL63-3	.;.;BTBDB_HUMAN;.	L	649;649;649;186	ENSP00000280758:R649L;ENSP00000413889:R649L;ENSP00000447319:R649L;ENSP00000349690:R186L	ENSP00000280758:R649L	R	+	2	0	BTBD11	106533014	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.848000	0.99507	2.706000	0.92434	0.655000	0.94253	CGC	BTBD11	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000151136		0.403	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD11	HGNC	protein_coding	OTTHUMT00000318003.1	-	0.00	80	0	G	NM_152322		108008884	+1	tier1	-	no_errors	ENST00000280758	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
C15orf39	56905	genome.wustl.edu	37	15	75501009	75501009	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr15:75501009C>T	ENST00000360639.2	+	2	2940	c.2620C>T	c.(2620-2622)Cgg>Tgg	p.R874W	C15orf39_ENST00000394987.4_Missense_Mutation_p.R874W|C15orf39_ENST00000567617.1_Missense_Mutation_p.R874W|RP11-69H7.3_ENST00000563568.1_RNA			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	874						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						TGTGGAGCTGCGGCCCACCAC	0.672																																																	0													24.0	18.0	20.0					15																	75501009		2195	4292	6487	SO:0001583	missense	0			AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.2620C>T	15.37:g.75501009C>T	ENSP00000353854:p.Arg874Trp		B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Missense_Mutation	SNP	NULL	p.R874W	ENST00000360639.2	37	c.2620	CCDS10276.1	15	.	.	.	.	.	.	.	.	.	.	C	27.3	4.815382	0.90790	.	.	ENSG00000167173	ENST00000360639;ENST00000394987;ENST00000446981	T;T	0.46819	0.86;0.86	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.67392	0.2888	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.70226	-0.4930	10	0.87932	D	0	-31.5333	17.5238	0.87794	0.0:1.0:0.0:0.0	.	436;874	Q2VPA3;Q6ZRI6	.;CO039_HUMAN	W	874;874;272	ENSP00000353854:R874W;ENSP00000378438:R874W	ENSP00000353854:R874W	R	+	1	2	C15orf39	73288062	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	5.550000	0.67268	2.476000	0.83614	0.561000	0.74099	CGG	C15orf39	-	NULL	ENSG00000167173		0.672	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf39	HGNC	protein_coding	OTTHUMT00000286410.1	-	0.00	50	0	C	NM_015492		75501009	+1	tier1	-	no_errors	ENST00000360639	ensembl	human	known	74_37	missense	17.50	33	7	SNP	1.000	T
CA5BP1	340591	genome.wustl.edu	37	X	15715507	15715507	+	RNA	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:15715507C>T	ENST00000380334.2	+	0	321							Q8WTZ4	CA5BL_HUMAN	carbonic anhydrase VB pseudogene 1							mitochondrion (GO:0005739)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)										GCTGTTTTCCCACTGGAGAAT	0.443																																																	0																																												0			BC021816		Xp22.2	2012-11-02	2011-02-07	2011-02-07	ENSG00000186312	ENSG00000186312			29544	pseudogene	pseudogene	"""similar to carbonic anhydrase VB, mitochondrial precursor"", ""carbonic dehydratase"""		"""carbonic anhydrase VB-like"", ""carbonic anhydrase VB pseudogene"""	CA5BL, CA5BP		12477932	Standard	NR_026551		Approved	PRO2325	uc011mir.1	Q8WTZ4	OTTHUMG00000021182		X.37:g.15715507C>T			A6NEZ4	RNA	SNP	-	NULL	ENST00000380334.2	37	NULL		X																																																																																			CA5BP1	-	-	ENSG00000186312		0.443	CA5BP1-005	KNOWN	basic	processed_transcript	CA5BP1	HGNC	pseudogene	OTTHUMT00000055884.3	-	0.00	43	0	C	NR_026551		15715507	+1	tier1	-	no_errors	ENST00000380331	ensembl	human	known	74_37	rna	41.86	25	18	SNP	0.000	T
CACNA1I	8911	genome.wustl.edu	37	22	40080328	40080328	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr22:40080328C>A	ENST00000402142.3	+	36	5852	c.5852C>A	c.(5851-5853)cCg>cAg	p.P1951Q	CACNA1I_ENST00000401624.1_Missense_Mutation_p.P1951Q|CACNA1I_ENST00000407673.1_Missense_Mutation_p.P1916Q|CACNA1I_ENST00000400164.3_Missense_Mutation_p.P1916Q|CACNA1I_ENST00000404898.1_Missense_Mutation_p.P1916Q|CACNA1I_ENST00000336649.4_Missense_Mutation_p.P1957Q	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1951					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	CCCTTCTCCCCGGATGCCTCC	0.642																																																	0													41.0	47.0	45.0					22																	40080328		2024	4156	6180	SO:0001583	missense	0			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.5852C>A	22.37:g.40080328C>A	ENSP00000385019:p.Pro1951Gln		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.P1957Q	ENST00000402142.3	37	c.5870	CCDS46710.1	22	.	.	.	.	.	.	.	.	.	.	C	15.34	2.804545	0.50315	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.96940	-4.16;-4.13;-4.12;-4.08;-4.18;-4.09	5.05	1.47	0.22746	.	4.843300	0.00465	N	0.000112	D	0.94909	0.8354	L	0.27053	0.805	0.29150	N	0.878439	P;P;P;P	0.46220	0.729;0.729;0.874;0.8	B;B;P;P	0.48368	0.285;0.401;0.575;0.497	D	0.87434	0.2390	10	0.87932	D	0	.	10.2744	0.43501	0.0:0.7678:0.0:0.2322	.	1916;1951;1916;1951	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	Q	1951;1916;1951;1916;1957;1916	ENSP00000385019:P1951Q;ENSP00000384093:P1916Q;ENSP00000383887:P1951Q;ENSP00000385680:P1916Q;ENSP00000337829:P1957Q;ENSP00000383028:P1916Q	ENSP00000337829:P1957Q	P	+	2	0	CACNA1I	38410274	0.944000	0.32072	0.943000	0.38184	0.452000	0.32318	1.832000	0.39151	0.088000	0.17205	-0.254000	0.11334	CCG	CACNA1I	-	NULL	ENSG00000100346		0.642	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	CACNA1I	HGNC	protein_coding	OTTHUMT00000321290.1	-	0.00	28	0	C	NM_001003406		40080328	+1	tier1	-	no_errors	ENST00000336649	ensembl	human	known	74_37	missense	27.78	13	5	SNP	0.998	A
CCDC137	339230	genome.wustl.edu	37	17	79639171	79639171	+	Missense_Mutation	SNP	G	G	A	rs201656915		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:79639171G>A	ENST00000329214.8	+	5	1049	c.646G>A	c.(646-648)Gta>Ata	p.V216I		NM_199287.2	NP_954981.1	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137	216							poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(2)	12	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			CCAGAGGAGCGTAAGCAAGGA	0.602																																																	0								G	ILE/VAL	3,4039		0,3,2018	42.0	47.0	45.0		646	-9.9	0.0	17		45	0,8370		0,0,4185	yes	missense	CCDC137	NM_199287.2	29	0,3,6203	AA,AG,GG		0.0,0.0742,0.0242	benign	216/290	79639171	3,12409	2021	4185	6206	SO:0001583	missense	0			BC009369	CCDS42400.1	17q25.3	2008-07-04				ENSG00000185298			33451	protein-coding gene	gene with protein product		614271					Standard	NM_199287		Approved	MGC16597	uc002kbc.4	Q6PK04		ENST00000329214.8:c.646G>A	17.37:g.79639171G>A	ENSP00000329360:p.Val216Ile			Missense_Mutation	SNP	NULL	p.V216I	ENST00000329214.8	37	c.646	CCDS42400.1	17	.	.	.	.	.	.	.	.	.	.	G	9.745	1.165909	0.21538	7.42E-4	0.0	ENSG00000185298	ENST00000329214	D	0.90004	-2.6	4.96	-9.92	0.00455	.	2.050500	0.01858	N	0.036388	T	0.76004	0.3927	N	0.17082	0.46	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.64651	-0.6357	10	0.33141	T	0.24	1.8715	6.4053	0.21660	0.3251:0.0981:0.4808:0.0961	.	216	Q6PK04	CC137_HUMAN	I	216	ENSP00000329360:V216I	ENSP00000329360:V216I	V	+	1	0	CCDC137	77249576	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.825000	0.04433	-2.501000	0.00510	-0.290000	0.09829	GTA	CCDC137	-	NULL	ENSG00000185298		0.602	CCDC137-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC137	HGNC	protein_coding	OTTHUMT00000440387.1	-	0.00	57	0	G			79639171	+1	tier1	rs201656915	no_errors	ENST00000329214	ensembl	human	known	74_37	missense	16.67	30	6	SNP	0.000	A
CCDC66	285331	genome.wustl.edu	37	3	56600710	56600710	+	Silent	SNP	A	A	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr3:56600710A>G	ENST00000394672.3	+	5	703	c.633A>G	c.(631-633)tcA>tcG	p.S211S	CCDC66_ENST00000442522.2_3'UTR|CCDC66_ENST00000326595.7_Silent_p.S177S|CCDC66_ENST00000436465.2_Silent_p.S211S|CCDC66_ENST00000538560.1_Silent_p.S211S	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	211					post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		AAATGGTTTCATCTGTCCCAG	0.328																																																	0													88.0	90.0	89.0					3																	56600710		2202	4300	6502	SO:0001819	synonymous_variant	0			AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.633A>G	3.37:g.56600710A>G			B3KWL8|Q4VC34|Q8N949	Silent	SNP	NULL	p.S211	ENST00000394672.3	37	c.633	CCDS46852.1	3																																																																																			CCDC66	-	NULL	ENSG00000180376		0.328	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC66	HGNC	protein_coding	OTTHUMT00000341473.1		0.00	23	0	A	NM_001012506		56600710	+1			no_errors	ENST00000394672	ensembl	human	known	74_37	silent	8.33	22	2	SNP	0.000	G
CDH4	1002	genome.wustl.edu	37	20	60511879	60511879	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr20:60511879G>A	ENST00000360469.5	+	16	2717	c.2629G>A	c.(2629-2631)Gca>Aca	p.A877T	CDH4_ENST00000543233.1_Missense_Mutation_p.A803T	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	877	Ser-rich.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			CGGCTCCACCGCAGGCTCCGT	0.622																																																	0													52.0	48.0	49.0					20																	60511879		2203	4299	6502	SO:0001583	missense	0			L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.2629G>A	20.37:g.60511879G>A	ENSP00000353656:p.Ala877Thr		B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin	p.A877T	ENST00000360469.5	37	c.2629	CCDS13488.1	20	.	.	.	.	.	.	.	.	.	.	G	34	5.395393	0.96009	.	.	ENSG00000179242	ENST00000360469;ENST00000536643;ENST00000543233	D;D	0.82255	-1.59;-1.59	4.49	4.49	0.54785	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.91178	0.7221	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91966	0.5583	9	.	.	.	.	17.1925	0.86883	0.0:0.0:1.0:0.0	.	877	P55283	CADH4_HUMAN	T	877;785;803	ENSP00000353656:A877T;ENSP00000443301:A803T	.	A	+	1	0	CDH4	59945274	1.000000	0.71417	0.998000	0.56505	0.863000	0.49368	9.524000	0.98036	2.068000	0.61886	0.467000	0.42956	GCA	CDH4	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000179242		0.622	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH4	HGNC	protein_coding	OTTHUMT00000079965.2	-	0.00	31	0	G	NM_001794		60511879	+1	tier1	-	no_errors	ENST00000360469	ensembl	human	known	74_37	missense	35.29	22	12	SNP	1.000	A
CDH7	1005	genome.wustl.edu	37	18	63481784	63481784	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr18:63481784G>T	ENST00000397968.2	+	4	995	c.569G>T	c.(568-570)aGa>aTa	p.R190I	CDH7_ENST00000536984.2_Missense_Mutation_p.R190I|CDH7_ENST00000323011.3_Missense_Mutation_p.R190I	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	190	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				AACAGTGCCAGAGTGGTCTAC	0.428																																																	0													176.0	156.0	163.0					18																	63481784		2203	4300	6503	SO:0001583	missense	0			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.569G>T	18.37:g.63481784G>T	ENSP00000381058:p.Arg190Ile		Q9H157	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R190I	ENST00000397968.2	37	c.569	CCDS11993.1	18	.	.	.	.	.	.	.	.	.	.	G	34	5.382252	0.95967	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.54675	0.56;0.56;0.56	5.75	5.75	0.90469	Cadherin (4);Cadherin-like (1);	0.072732	0.52532	D	0.000064	T	0.67906	0.2943	L	0.45051	1.395	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.73708	0.981;0.972	T	0.68872	-0.5294	10	0.87932	D	0	.	19.9478	0.97189	0.0:0.0:1.0:0.0	.	190;190	F5H5X9;Q9ULB5	.;CADH7_HUMAN	I	190	ENSP00000319166:R190I;ENSP00000443030:R190I;ENSP00000381058:R190I	ENSP00000319166:R190I	R	+	2	0	CDH7	61632764	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.235000	0.72332	2.712000	0.92718	0.591000	0.81541	AGA	CDH7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000081138		0.428	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	HGNC	protein_coding	OTTHUMT00000256217.2		0.00	72	0	G	NM_033646		63481784	+1			no_errors	ENST00000323011	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
CDK19	23097	genome.wustl.edu	37	6	110991738	110991738	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr6:110991738G>A	ENST00000368911.3	-	3	390	c.211C>T	c.(211-213)Cga>Tga	p.R71*	CDK19_ENST00000323817.3_Nonsense_Mutation_p.R11*	NM_015076.3	NP_055891.1	Q9BWU1	CDK19_HUMAN	cyclin-dependent kinase 19	71	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)	22						TTCAATTCTCGCAAAAGCTGA	0.408																																																	0													67.0	57.0	60.0					6																	110991738		2203	4300	6503	SO:0001587	stop_gained	0			AL122055	CCDS5085.1, CCDS75503.1	6q21	2011-10-25	2009-12-16	2009-12-16	ENSG00000155111	ENSG00000155111		"""Cyclin-dependent kinases"""	19338	protein-coding gene	gene with protein product		614720	"""cyclin-dependent kinase (CDC2-like) 11"", ""cell division cycle 2-like 6 (CDK8-like)"""	CDK11, CDC2L6		10470851, 19884882	Standard	XM_005266871		Approved	KIAA1028, bA346C16.3	uc003puh.1	Q9BWU1	OTTHUMG00000015365	ENST00000368911.3:c.211C>T	6.37:g.110991738G>A	ENSP00000357907:p.Arg71*		Q5JQZ7|Q5JR00|Q8TC78|Q9UPX2	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R71*	ENST00000368911.3	37	c.211	CCDS5085.1	6	.	.	.	.	.	.	.	.	.	.	G	21.7	4.190798	0.78789	.	.	ENSG00000155111	ENST00000368911;ENST00000323817;ENST00000392576;ENST00000457688	.	.	.	4.67	3.7	0.42460	.	0.070846	0.56097	D	0.000021	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.8406	13.2715	0.60164	0.0:0.0:0.7917:0.2083	.	.	.	.	X	71;11;10;11	.	ENSP00000317665:R11X	R	-	1	2	CDK19	111098431	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.010000	0.64004	0.978000	0.38470	0.644000	0.83932	CGA	CDK19	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000155111		0.408	CDK19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK19	HGNC	protein_coding	OTTHUMT00000041804.1	-	0.00	56	0	G	NM_015076		110991738	-1	tier1	-	no_errors	ENST00000368911	ensembl	human	known	74_37	nonsense	5.06	75	4	SNP	1.000	A
CDK5RAP2	55755	genome.wustl.edu	37	9	123166353	123166353	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr9:123166353C>T	ENST00000349780.4	-	33	5181	c.5002G>A	c.(5002-5004)Gat>Aat	p.D1668N	CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.D1627N|CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.D1636N|CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.D1589N|CDK5RAP2_ENST00000480467.1_5'Flank	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1668					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						TCAAACAGATCAAATGAATTA	0.403																																																	0													139.0	120.0	126.0					9																	123166353		2203	4300	6503	SO:0001583	missense	0			BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.5002G>A	9.37:g.123166353C>T	ENSP00000343818:p.Asp1668Asn		Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	pfam_Spindle_assoc	p.D1668N	ENST00000349780.4	37	c.5002	CCDS6823.1	9	.	.	.	.	.	.	.	.	.	.	C	18.12	3.552708	0.65425	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000416449;ENST00000425647;ENST00000345313	T;T;T;T;T;T	0.22134	3.97;3.88;3.97;3.69;2.29;1.97	5.51	5.51	0.81932	.	0.379903	0.25447	N	0.030603	T	0.36358	0.0964	M	0.62723	1.935	0.37356	D	0.911039	P;P;P;D;P	0.54047	0.763;0.944;0.95;0.964;0.589	B;P;P;P;B	0.53185	0.288;0.714;0.72;0.637;0.288	T	0.35351	-0.9792	10	0.87932	D	0	.	14.9214	0.70841	0.0:1.0:0.0:0.0	.	678;1636;1589;1668;1062	Q5JTU8;Q96SN8-2;Q96SN8-4;Q96SN8;B1AMJ5	.;.;.;CK5P2_HUMAN;.	N	1636;1627;1668;1589;1062;678;1440	ENSP00000354065:D1636N;ENSP00000352258:D1627N;ENSP00000343818:D1668N;ENSP00000353317:D1589N;ENSP00000400395:D1062N;ENSP00000409941:D678N	ENSP00000341695:D1440N	D	-	1	0	CDK5RAP2	122206174	0.972000	0.33761	0.925000	0.36789	0.984000	0.73092	3.451000	0.52964	2.589000	0.87451	0.655000	0.94253	GAT	CDK5RAP2	-	NULL	ENSG00000136861		0.403	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK5RAP2	HGNC	protein_coding	OTTHUMT00000055535.1	-	0.00	76	0	C	NM_018249		123166353	-1	tier1	-	no_errors	ENST00000349780	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.988	T
CDYL2	124359	genome.wustl.edu	37	16	80718882	80718882	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr16:80718882C>T	ENST00000570137.2	-	2	324	c.169G>A	c.(169-171)Ggg>Agg	p.G57R	CDYL2_ENST00000562753.1_5'UTR|CDYL2_ENST00000563890.1_Missense_Mutation_p.G57R|CDYL2_ENST00000562812.1_Missense_Mutation_p.G57R|CDYL2_ENST00000566173.1_Missense_Mutation_p.G57R	NM_152342.2	NP_689555.2	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	57	Chromo. {ECO:0000255|PROSITE- ProRule:PRU00053}.					nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	21						ATGTGCAACCCATTGAATTCA	0.542																																																	0													142.0	119.0	127.0					16																	80718882		2203	4300	6503	SO:0001583	missense	0			AK096185	CCDS32493.1	16q23.2	2008-02-05	2003-09-12			ENSG00000166446			23030	protein-coding gene	gene with protein product			"""chromodomain Y-like protein 2"""			12837688	Standard	NM_152342		Approved	FLJ38866	uc002ffs.3	Q8N8U2		ENST00000570137.2:c.169G>A	16.37:g.80718882C>T	ENSP00000476295:p.Gly57Arg		Q7Z5I8	Missense_Mutation	SNP	pfam_Crotonase_core_superfam,pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.G57R	ENST00000570137.2	37	c.169	CCDS32493.1	16	.	.	.	.	.	.	.	.	.	.	C	3.327	-0.137572	0.06711	.	.	ENSG00000166446	ENST00000299564	T	0.37235	1.21	5.08	5.08	0.68730	Chromo domain-like (1);Chromo domain/shadow (2);	0.057409	0.64402	D	0.000001	T	0.06462	0.0166	N	0.00037	-2.525	0.47778	D	0.999511	B	0.02656	0.0	B	0.11329	0.006	T	0.45396	-0.9264	10	0.02654	T	1	.	13.0045	0.58696	0.0:0.9205:0.0:0.0795	.	57	Q8N8U2	CDYL2_HUMAN	R	57	ENSP00000299564:G57R	ENSP00000299564:G57R	G	-	1	0	CDYL2	79276383	1.000000	0.71417	0.999000	0.59377	0.903000	0.53119	3.573000	0.53856	2.636000	0.89361	0.655000	0.94253	GGG	CDYL2	-	superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	ENSG00000166446		0.542	CDYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDYL2	HGNC	protein_coding	OTTHUMT00000434727.2	-	0.00	45	0	C	NM_152342		80718882	-1	tier1	-	no_errors	ENST00000570137	ensembl	human	known	74_37	missense	11.76	60	8	SNP	1.000	T
CELSR3	1951	genome.wustl.edu	37	3	48698502	48698502	+	Silent	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr3:48698502G>A	ENST00000164024.4	-	1	1846	c.1566C>T	c.(1564-1566)ccC>ccT	p.P522P	RP11-148G20.1_ENST00000421275.1_RNA|CELSR3_ENST00000544264.1_Silent_p.P522P	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	522	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AGCGCGGCCCGGGTTCCTGGC	0.642																																																	0													34.0	30.0	32.0					3																	48698502		2203	4300	6503	SO:0001819	synonymous_variant	0			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.1566C>T	3.37:g.48698502G>A			O75092	Silent	SNP	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.P522	ENST00000164024.4	37	c.1566	CCDS2775.1	3																																																																																			CELSR3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000008300		0.642	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	HGNC	protein_coding	OTTHUMT00000257523.1	-	0.00	20	0	G	NM_001407		48698502	-1	tier1	-	no_errors	ENST00000544264	ensembl	human	known	74_37	silent	37.50	10	6	SNP	0.002	A
CENPJ	55835	genome.wustl.edu	37	13	25480207	25480207	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr13:25480207G>A	ENST00000381884.4	-	7	2154	c.1969C>T	c.(1969-1971)Caa>Taa	p.Q657*	CENPJ_ENST00000545981.1_Nonsense_Mutation_p.Q657*	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	657					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		GAATGAAGTTGTTTGGGTGCG	0.458																																																	0													111.0	106.0	108.0					13																	25480207		2203	4300	6503	SO:0001587	stop_gained	0			AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.1969C>T	13.37:g.25480207G>A	ENSP00000371308:p.Gln657*		Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Nonsense_Mutation	SNP	pfam_Tcp10_C_dom	p.Q657*	ENST00000381884.4	37	c.1969	CCDS9310.1	13	.	.	.	.	.	.	.	.	.	.	G	22.6	4.315046	0.81358	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	.	.	.	5.77	3.08	0.35506	.	0.958991	0.08704	N	0.905871	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	4.8415	0.13492	0.2378:0.0:0.6119:0.1503	.	.	.	.	X	657	.	ENSP00000371308:Q657X	Q	-	1	0	CENPJ	24378207	0.004000	0.15560	0.003000	0.11579	0.021000	0.10359	0.774000	0.26675	0.765000	0.33221	0.655000	0.94253	CAA	CENPJ	-	NULL	ENSG00000151849		0.458	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPJ	HGNC	protein_coding	OTTHUMT00000044209.1	-	0.00	70	0	G	NM_018451		25480207	-1	tier1	-	no_errors	ENST00000381884	ensembl	human	known	74_37	nonsense	15.38	98	18	SNP	0.000	A
CHD2	1106	genome.wustl.edu	37	15	93522503	93522503	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr15:93522503G>T	ENST00000394196.4	+	22	3934	c.2866G>T	c.(2866-2868)Gga>Tga	p.G956*	CHD2_ENST00000557381.1_Nonsense_Mutation_p.G956*	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	956					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			AAACAACTCAGGAAGGTCCAA	0.448																																																	0													116.0	112.0	113.0					15																	93522503		2197	4298	6495	SO:0001587	stop_gained	0			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.2866G>T	15.37:g.93522503G>T	ENSP00000377747:p.Gly956*		C6G482|Q96IP5	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.G956*	ENST00000394196.4	37	c.2866	CCDS10374.2	15	.	.	.	.	.	.	.	.	.	.	G	47	13.257712	0.99730	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	.	.	.	5.78	5.78	0.91487	.	0.000000	0.33712	U	0.004633	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-25.2946	20.0983	0.97858	0.0:0.0:1.0:0.0	.	.	.	.	X	956	.	ENSP00000377747:G956X	G	+	1	0	CHD2	91323507	1.000000	0.71417	0.929000	0.37066	0.976000	0.68499	6.579000	0.74036	2.755000	0.94549	0.552000	0.68991	GGA	CHD2	-	superfamily_P-loop_NTPase	ENSG00000173575		0.448	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	HGNC	protein_coding	OTTHUMT00000313528.3	-	0.00	49	0	G	NM_001271		93522503	+1	tier1	-	no_errors	ENST00000557381	ensembl	human	putative	74_37	nonsense	11.43	31	4	SNP	0.998	T
CHEK2	11200	genome.wustl.edu	37	22	29083913	29083913	+	Missense_Mutation	SNP	C	C	T	rs544216926	byFrequency	TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr22:29083913C>T	ENST00000405598.1	-	16	1795	c.1604G>A	c.(1603-1605)cGc>cAc	p.R535H	CHEK2_ENST00000382566.1_3'UTR|CHEK2_ENST00000348295.3_Missense_Mutation_p.R506H|CHEK2_ENST00000382565.1_Missense_Mutation_p.R155H|CHEK2_ENST00000403642.1_Missense_Mutation_p.R444H|CHEK2_ENST00000402731.1_Missense_Mutation_p.R506H|CHEK2_ENST00000404276.1_Missense_Mutation_p.R535H|CHEK2_ENST00000544772.1_Missense_Mutation_p.R314H|CHEK2_ENST00000382580.2_Missense_Mutation_p.R578H|CHEK2_ENST00000328354.6_Missense_Mutation_p.R535H|CHEK2_ENST00000382578.1_Missense_Mutation_p.R444H			O96017	CHK2_HUMAN	checkpoint kinase 2	535					cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CACAGCTGGGCGCTTTGTGGT	0.458			F			breast		Direct reversal of damage;Other conserved DNA damage response genes					C|||	2	0.000399361	0.0	0.0	5008	,	,		18131	0.0		0.0	False		,,,				2504	0.002						yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	0													42.0	44.0	44.0					22																	29083913		1368	2307	3675	SO:0001583	missense	0			AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.1604G>A	22.37:g.29083913C>T	ENSP00000386087:p.Arg535His		A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_FHA_dom,superfamily_Kinase-like_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FHA_dom,pfscan_Prot_kinase_dom	p.R578H	ENST00000405598.1	37	c.1733	CCDS13843.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.39|19.39	3.819005|3.819005	0.71028|0.71028	.|.	.|.	ENSG00000183765|ENSG00000183765	ENST00000434810;ENST00000456369|ENST00000348295;ENST00000382578;ENST00000382565;ENST00000382563;ENST00000544772;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000403642;ENST00000402731	.|T;T;T;T;T;T;T;T;T;T	.|0.68331	.|0.76;-0.26;-0.32;-0.26;-0.27;-0.27;-0.27;-0.23;-0.26;0.76	4.76|4.76	2.63|2.63	0.31362|0.31362	.|.	.|0.439613	.|0.22360	.|N	.|0.061096	T|T	0.64349|0.64349	0.2590|0.2590	N|N	0.24115|0.24115	0.695|0.695	0.20926|0.20926	N|N	0.999824|0.999824	.|D;D;D;D;D;D	.|0.89917	.|1.0;0.958;0.999;0.999;0.99;0.998	.|D;B;P;P;P;P	.|0.63703	.|0.917;0.431;0.826;0.897;0.469;0.78	T|T	0.52646|0.52646	-0.8548|-0.8548	5|10	.|0.48119	.|T	.|0.1	-4.4609|-4.4609	7.9154|7.9154	0.29814|0.29814	0.0:0.798:0.0:0.202|0.0:0.798:0.0:0.202	.|.	.|444;314;535;506;535;578	.|O96017-4;Q9HBS5;A8JZZ5;O96017-12;O96017;O96017-9	.|.;.;.;.;CHK2_HUMAN;.	T|H	268;136|506;444;155;218;314;535;535;535;578;444;506	.|ENSP00000329012:R506H;ENSP00000372021:R444H;ENSP00000372006:R155H;ENSP00000442458:R314H;ENSP00000329178:R535H;ENSP00000385747:R535H;ENSP00000386087:R535H;ENSP00000372023:R578H;ENSP00000384919:R444H;ENSP00000384835:R506H	.|ENSP00000329178:R535H	A|R	-|-	1|2	0|0	CHEK2|CHEK2	27413913|27413913	0.360000|0.360000	0.24964|0.24964	0.833000|0.833000	0.33012|0.33012	0.169000|0.169000	0.22640|0.22640	0.471000|0.471000	0.22100|0.22100	1.136000|1.136000	0.42199|0.42199	0.557000|0.557000	0.71058|0.71058	GCC|CGC	CHEK2	-	NULL	ENSG00000183765		0.458	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHEK2	HGNC	protein_coding	OTTHUMT00000321150.1		0.00	49	0	C	NM_001005735		29083913	-1			no_errors	ENST00000382580	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.189	T
CHM	1121	genome.wustl.edu	37	X	85117544	85117544	+	3'UTR	SNP	C	C	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:85117544C>A	ENST00000357749.2	-	0	4082				CHM_ENST00000467744.2_5'UTR	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)						blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				TAAGAAAAATCGAATCCCTAT	0.403																																																	0																																										SO:0001624	3_prime_UTR_variant	0			X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.*2091G>T	X.37:g.85117544C>A			A1L4D2|O43732	RNA	SNP	-	NULL	ENST00000357749.2	37	NULL	CCDS14454.1	X																																																																																			CHM	-	-	ENSG00000188419		0.403	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHM	HGNC	protein_coding	OTTHUMT00000057396.3	-	0.00	38	0	C	NM_000390		85117544	-1	tier1	-	no_errors	ENST00000467744	ensembl	human	known	74_37	rna	72.22	10	26	SNP	0.004	A
CHRNA4	1137	genome.wustl.edu	37	20	61978016	61978016	+	3'UTR	SNP	C	C	A	rs554529978		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr20:61978016C>A	ENST00000370263.4	-	0	2179				CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)						action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	GAAGCCAGCCCGGCCCCAGGC	0.672																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.*74G>T	20.37:g.61978016C>A			Q4JGR7|Q4VAQ5|Q4VAQ6	RNA	SNP	-	NULL	ENST00000370263.4	37	NULL	CCDS13517.1	20																																																																																			CHRNA4	-	-	ENSG00000101204		0.672	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA4	HGNC	protein_coding	OTTHUMT00000080508.3	-	0.00	21	0	C			61978016	-1	tier1	-	no_errors	ENST00000463705	ensembl	human	known	74_37	rna	15.62	27	5	SNP	0.000	A
CHRNA7	1139	genome.wustl.edu	37	15	32460329	32460329	+	Silent	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr15:32460329C>T	ENST00000306901.3	+	10	1276	c.1179C>T	c.(1177-1179)gaC>gaT	p.D393D	CHRNA7_ENST00000455693.2_Silent_p.D212D|CHRNA7_ENST00000454250.3_Silent_p.D422D	NM_000746.5	NP_000737.1	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7 (neuronal)	393					activation of MAPK activity (GO:0000187)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to ethanol (GO:0048149)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular calcium ion homeostasis (GO:0006874)|cognition (GO:0050890)|dopamine biosynthetic process (GO:0042416)|endocytosis (GO:0006897)|generation of ovulation cycle rhythm (GO:0060112)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|memory (GO:0007613)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of tumor necrosis factor production (GO:0032720)|neuronal action potential (GO:0019228)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate involved in baroreceptor response to decreased systemic arterial blood pressure (GO:0001988)|regulation of norepinephrine secretion (GO:0014061)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to food (GO:0032094)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|T cell activation (GO:0042110)	acetylcholine-gated channel complex (GO:0005892)|apical plasma membrane (GO:0016324)|asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|external side of plasma membrane (GO:0009897)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|acetylcholine-gated cation channel activity (GO:0022848)|beta-amyloid binding (GO:0001540)|chloride channel regulator activity (GO:0017081)|drug binding (GO:0008144)|protein homodimerization activity (GO:0042803)|toxic substance binding (GO:0015643)			endometrium(3)|large_intestine(1)|lung(6)|ovary(2)	12		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	GCGGCCTGGACGGCGTGCACT	0.716																																					Esophageal Squamous(193;529 2900 40232 43193)												0													5.0	6.0	6.0					15																	32460329		1942	3945	5887	SO:0001819	synonymous_variant	0			Z23141	CCDS10027.1, CCDS53924.1	15q13.3	2012-02-11	2012-02-07		ENSG00000175344	ENSG00000175344		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1960	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 7 (neuronal)"""	118511	"""cholinergic receptor, nicotinic, alpha polypeptide 7"""			8188270	Standard	NM_001190455		Approved		uc021sic.2	P36544	OTTHUMG00000129285	ENST00000306901.3:c.1179C>T	15.37:g.32460329C>T			A8K7Q4|B4DFS0|Q15826|Q8IUZ4|Q96RH2|Q99555|Q9BXH0	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.D422	ENST00000306901.3	37	c.1266	CCDS10027.1	15																																																																																			CHRNA7	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000175344		0.716	CHRNA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHRNA7	HGNC	protein_coding	OTTHUMT00000251410.2	-	0.00	72	0	C			32460329	+1	tier1	-	no_errors	ENST00000454250	ensembl	human	known	74_37	silent	13.51	64	10	SNP	0.079	T
CKS1B	1163	genome.wustl.edu	37	1	154950327	154950327	+	Intron	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:154950327C>T	ENST00000308987.5	+	2	106				MIR4258_ENST00000580920.1_RNA|CKS1B_ENST00000368439.1_Intron|CKS1B_ENST00000471245.1_3'UTR|CKS1B_ENST00000368436.1_Intron	NM_001826.2	NP_001817.1	P61024	CKS1_HUMAN	CDC28 protein kinase regulatory subunit 1B						cell division (GO:0051301)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	nucleoplasm (GO:0005654)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			breast(1)|large_intestine(1)|lung(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CTGCTGCTACCCCACAATAAA	0.328																																																	0																																										SO:0001627	intron_variant	0			BC007751	CCDS1077.1	1q21.2	2011-04-28	2002-10-07		ENSG00000173207	ENSG00000173207			19083	protein-coding gene	gene with protein product		116900	"""CDC28 protein kinase 1B"""			2227411	Standard	NM_001826		Approved	ckshs1, CKS1	uc001fgb.3	P61024	OTTHUMG00000037413	ENST00000308987.5:c.60-136C>T	1.37:g.154950327C>T			P33551	RNA	SNP	-	NULL	ENST00000308987.5	37	NULL	CCDS1077.1	1																																																																																			CKS1B	-	-	ENSG00000173207		0.328	CKS1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKS1B	HGNC	protein_coding	OTTHUMT00000091078.1	-	0.00	34	0	C	NM_001826		154950327	+1	tier1	-	no_errors	ENST00000471245	ensembl	human	known	74_37	rna	20.59	26	7	SNP	0.001	T
CNEP1R1	255919	genome.wustl.edu	37	16	50069359	50069359	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr16:50069359A>C	ENST00000427478.2	+	6	422	c.368A>C	c.(367-369)cAt>cCt	p.H123P	CNEP1R1_ENST00000458059.3_Missense_Mutation_p.H140P|CNEP1R1_ENST00000562576.1_3'UTR|CNEP1R1_ENST00000565556.1_Missense_Mutation_p.H91P	NM_001281789.1	NP_001268718.1	Q8N9A8	NEPR1_HUMAN	CTD nuclear envelope phosphatase 1 regulatory subunit 1	123					lipid metabolic process (GO:0006629)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of triglyceride biosynthetic process (GO:0010867)|protein localization to nucleus (GO:0034504)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|Nem1-Spo7 phosphatase complex (GO:0071595)|nuclear membrane (GO:0031965)											CCTAGGCCTCATGTTCAATGA	0.328																																																	0													66.0	60.0	62.0					16																	50069359		1819	4080	5899	SO:0001583	missense	0			AK095420	CCDS45480.1, CCDS61931.1	16q12.1	2012-02-01	2012-02-01	2012-02-01	ENSG00000205423	ENSG00000205423			26759	protein-coding gene	gene with protein product	"""nuclear envelope phosphatase 1-regulatory subunit 1"""		"""chromosome 16 open reading frame 69"", ""transmembrane protein 188"""	C16orf69, TMEM188		22134922	Standard	NM_153261		Approved	FLJ38101, NEP1-R1	uc002eft.3	Q8N9A8		ENST00000427478.2:c.368A>C	16.37:g.50069359A>C	ENSP00000394224:p.His123Pro		Q4G1A9|Q5H9V0|Q8NE06	Missense_Mutation	SNP	pfam_Transmembrane_protein_188	p.H140P	ENST00000427478.2	37	c.419		16	.	.	.	.	.	.	.	.	.	.	A	14.40	2.524006	0.44866	.	.	ENSG00000205423	ENST00000458059;ENST00000427478	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	T	0.35189	0.0923	N	0.19112	0.55	0.47123	D	0.999327	B;P	0.38863	0.009;0.65	B;B	0.28849	0.042;0.095	T	0.24657	-1.0154	8	0.37606	T	0.19	-9.8777	15.591	0.76526	1.0:0.0:0.0:0.0	.	123;140	Q8N9A8;Q8N9A8-2	TM188_HUMAN;.	P	140;123	.	ENSP00000394224:H123P	H	+	2	0	TMEM188	48626860	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.422000	0.73357	2.088000	0.63022	0.383000	0.25322	CAT	CNEP1R1	-	pfam_Transmembrane_protein_188	ENSG00000205423		0.328	CNEP1R1-201	KNOWN	basic|appris_principal	protein_coding	CNEP1R1	HGNC	protein_coding		-	0.00	42	0	A	NM_153261		50069359	+1	tier1	-	no_errors	ENST00000458059	ensembl	human	known	74_37	missense	29.27	29	12	SNP	1.000	C
COG5	10466	genome.wustl.edu	37	7	106898783	106898783	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr7:106898783C>T	ENST00000347053.3	-	15	1764	c.1714G>A	c.(1714-1716)Gaa>Aaa	p.E572K	COG5_ENST00000297135.3_Missense_Mutation_p.E572K|COG5_ENST00000393603.2_Missense_Mutation_p.E572K	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	572					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						CTCTGTCCTTCAGTAAGAGGC	0.343																																																	0													187.0	173.0	178.0					7																	106898783		2203	4300	6503	SO:0001583	missense	0			AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.1714G>A	7.37:g.106898783C>T	ENSP00000334703:p.Glu572Lys		A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Missense_Mutation	SNP	pfam_Cog5	p.E572K	ENST00000347053.3	37	c.1714	CCDS5743.1	7	.	.	.	.	.	.	.	.	.	.	C	17.46	3.395518	0.62066	.	.	ENSG00000164597	ENST00000347053;ENST00000297135;ENST00000393603	T;T;T	0.57273	0.41;0.41;0.41	6.03	6.03	0.97812	.	0.047359	0.85682	D	0.000000	T	0.52613	0.1745	L	0.55481	1.735	0.80722	D	1	B;P	0.47604	0.322;0.898	B;P	0.45037	0.078;0.467	T	0.45920	-0.9228	10	0.08599	T	0.76	-16.3676	19.3283	0.94273	0.0:1.0:0.0:0.0	.	572;572	Q9UP83;Q9UP83-2	COG5_HUMAN;.	K	572	ENSP00000334703:E572K;ENSP00000297135:E572K;ENSP00000377228:E572K	ENSP00000297135:E572K	E	-	1	0	COG5	106686019	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	6.671000	0.74472	2.861000	0.98227	0.655000	0.94253	GAA	COG5	-	NULL	ENSG00000164597		0.343	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COG5	HGNC	protein_coding	OTTHUMT00000060216.4	-	0.00	36	0	C			106898783	-1	tier1	-	no_errors	ENST00000297135	ensembl	human	known	74_37	missense	20.41	39	10	SNP	1.000	T
CNTNAP2	26047	genome.wustl.edu	37	7	147092847	147092847	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr7:147092847A>T	ENST00000361727.3	+	10	2161	c.1645A>T	c.(1645-1647)Att>Ttt	p.I549F		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	549	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GAATGTCAGCATTGACATGTG	0.428										HNSCC(39;0.1)																																							0													155.0	137.0	143.0					7																	147092847		2203	4299	6502	SO:0001583	missense	0			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1645A>T	7.37:g.147092847A>T	ENSP00000354778:p.Ile549Phe		D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,pfam_EG-like_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.I549F	ENST00000361727.3	37	c.1645	CCDS5889.1	7	.	.	.	.	.	.	.	.	.	.	A	14.55	2.567900	0.45798	.	.	ENSG00000174469	ENST00000361727	T	0.76448	-1.02	5.27	4.1	0.47936	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.186590	0.35436	N	0.003215	T	0.64962	0.2646	L	0.33189	0.99	0.80722	D	1	B	0.25441	0.126	B	0.25140	0.058	T	0.55573	-0.8120	10	0.17832	T	0.49	.	10.4518	0.44526	0.8539:0.0:0.0:0.146	.	549	Q9UHC6	CNTP2_HUMAN	F	549	ENSP00000354778:I549F	ENSP00000354778:I549F	I	+	1	0	CNTNAP2	146723780	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.439000	0.73430	0.828000	0.34709	0.482000	0.46254	ATT	CNTNAP2	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000174469		0.428	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	HGNC	protein_coding	OTTHUMT00000327668.1		0.00	26	0	A			147092847	+1			no_errors	ENST00000361727	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
COL6A3	1293	genome.wustl.edu	37	2	238280759	238280759	+	Missense_Mutation	SNP	G	G	A	rs150430813	byFrequency	TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:238280759G>A	ENST00000295550.4	-	9	4353	c.3901C>T	c.(3901-3903)Cgg>Tgg	p.R1301W	COL6A3_ENST00000392004.3_Missense_Mutation_p.R1095W|COL6A3_ENST00000353578.4_Missense_Mutation_p.R1095W|COL6A3_ENST00000392003.2_Missense_Mutation_p.R894W|COL6A3_ENST00000409809.1_Missense_Mutation_p.R1095W|COL6A3_ENST00000472056.1_Missense_Mutation_p.R694W|COL6A3_ENST00000346358.4_Missense_Mutation_p.R1101W|COL6A3_ENST00000347401.3_Missense_Mutation_p.R1100W	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1301	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R1301W(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GGCCTCAGCCGCTGCACCGCG	0.612																																																	1	Substitution - Missense(1)	large_intestine(1)						G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	64.0	57.0	60.0		3901,2680,3283,2080,3283	-4.0	0.0	2	dbSNP_134	60	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	COL6A3	NM_004369.3,NM_057164.4,NM_057165.4,NM_057166.4,NM_057167.3	101,101,101,101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1301/3178,894/1037,1095/1238,694/2571,1095/2972	238280759	1,13005	2203	4300	6503	SO:0001583	missense	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.3901C>T	2.37:g.238280759G>A	ENSP00000295550:p.Arg1301Trp		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.R1301W	ENST00000295550.4	37	c.3901	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	G	12.22	1.873472	0.33069	0.0	1.16E-4	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003	T;T;T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1;1.1;1.1	5.43	-3.95	0.04118	von Willebrand factor, type A (3);	0.000000	0.50627	D	0.000105	T	0.64057	0.2564	M	0.88775	2.98	0.09310	N	0.999997	D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;0.998	D;D;D;D;P	0.85130	0.997;0.954;0.967;0.994;0.828	T	0.63116	-0.6709	10	0.87932	D	0	.	13.923	0.63945	0.0:0.0792:0.241:0.6798	.	694;894;1095;1095;1301	E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;CO6A3_HUMAN	W	1301;1100;1095;694;1095;1101;1095;894	ENSP00000295550:R1301W;ENSP00000315609:R1100W;ENSP00000315873:R1095W;ENSP00000418285:R694W;ENSP00000386844:R1095W;ENSP00000295546:R1101W;ENSP00000375861:R1095W;ENSP00000375860:R894W	ENSP00000295550:R1301W	R	-	1	2	COL6A3	237945498	0.000000	0.05858	0.030000	0.17652	0.049000	0.14656	0.426000	0.21363	-0.342000	0.08363	-0.182000	0.12963	CGG	COL6A3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000163359		0.612	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	-	0.00	35	0	G	NM_004369		238280759	-1	tier1	rs150430813	no_errors	ENST00000295550	ensembl	human	known	74_37	missense	22.73	34	10	SNP	0.000	A
COL6A3	1293	genome.wustl.edu	37	2	238283179	238283179	+	Silent	SNP	G	G	T	rs373719229		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:238283179G>T	ENST00000295550.4	-	8	4007	c.3555C>A	c.(3553-3555)gcC>gcA	p.A1185A	COL6A3_ENST00000392004.3_Silent_p.A979A|COL6A3_ENST00000353578.4_Silent_p.A979A|COL6A3_ENST00000392003.2_Silent_p.A778A|COL6A3_ENST00000409809.1_Silent_p.A979A|COL6A3_ENST00000472056.1_Silent_p.A578A|COL6A3_ENST00000346358.4_Silent_p.A985A|COL6A3_ENST00000347401.3_Silent_p.A984A	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1185	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GAATGGCCACGGCAAAGTCCG	0.627																																																	0													89.0	70.0	77.0					2																	238283179		2203	4300	6503	SO:0001819	synonymous_variant	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.3555C>A	2.37:g.238283179G>T			A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.A1185	ENST00000295550.4	37	c.3555	CCDS33412.1	2																																																																																			COL6A3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000163359		0.627	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	-	0.00	38	0	G	NM_004369		238283179	-1	tier1	-	no_errors	ENST00000295550	ensembl	human	known	74_37	silent	37.50	20	12	SNP	0.001	T
CR2	1380	genome.wustl.edu	37	1	207639910	207639910	+	Missense_Mutation	SNP	G	G	A	rs368072577		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:207639910G>A	ENST00000367058.3	+	2	287	c.98G>A	c.(97-99)cGg>cAg	p.R33Q	CR2_ENST00000458541.2_Missense_Mutation_p.R33Q|CR2_ENST00000367057.3_Missense_Mutation_p.R33Q|CR2_ENST00000367059.3_Missense_Mutation_p.R33Q	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	33	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CTAAATGGCCGGATTAGTTAT	0.413																																																	0								G	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	124.0	129.0	128.0		98,98	2.2	0.0	1		128	0,8600		0,0,4300	no	missense,missense	CR2	NM_001006658.2,NM_001877.4	43,43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	33/1093,33/1034	207639910	1,13005	2203	4300	6503	SO:0001583	missense	0			M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.98G>A	1.37:g.207639910G>A	ENSP00000356025:p.Arg33Gln		C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.R33Q	ENST00000367058.3	37	c.98	CCDS1478.1	1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.947560	0.53186	2.27E-4	0.0	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	5.09	2.21	0.28008	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.68081	0.2962	L	0.53671	1.685	0.09310	N	1	D;D;D	0.76494	0.997;0.999;0.999	P;D;D	0.65443	0.906;0.928;0.935	T	0.54629	-0.8265	9	0.52906	T	0.07	.	4.3542	0.11170	0.1849:0.0:0.6356:0.1795	.	33;33;33	Q5SR47;P20023;P20023-3	.;CR2_HUMAN;.	Q	33	ENSP00000356025:R33Q;ENSP00000356024:R33Q;ENSP00000356026:R33Q;ENSP00000404222:R33Q	ENSP00000356024:R33Q	R	+	2	0	CR2	205706533	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	1.222000	0.32515	0.329000	0.23460	-0.169000	0.13324	CGG	CR2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000117322		0.413	CR2-001	KNOWN	basic|CCDS	protein_coding	CR2	HGNC	protein_coding	OTTHUMT00000088274.1	-	0.00	88	0	G	NM_001877		207639910	+1	tier1	-	no_errors	ENST00000367057	ensembl	human	known	74_37	missense	14.49	59	10	SNP	0.000	A
CSMD3	114788	genome.wustl.edu	37	8	113516028	113516028	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr8:113516028C>A	ENST00000297405.5	-	30	5318	c.5074G>T	c.(5074-5076)Gaa>Taa	p.E1692*	CSMD3_ENST00000455883.2_Nonsense_Mutation_p.E1588*|CSMD3_ENST00000352409.3_Nonsense_Mutation_p.E1692*|CSMD3_ENST00000343508.3_Nonsense_Mutation_p.E1652*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1692	CUB 9. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CCTTTGTATTCTAGATGAAAT	0.333										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													119.0	107.0	111.0					8																	113516028		2203	4300	6503	SO:0001587	stop_gained	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5074G>T	8.37:g.113516028C>A	ENSP00000297405:p.Glu1692*		Q96PZ3	Nonsense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.E1692*	ENST00000297405.5	37	c.5074	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	47	13.123032	0.99721	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	5.08	4.19	0.49359	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	15.4861	0.75569	0.0:0.8609:0.1391:0.0	.	.	.	.	X	1652;1692;1032;1588;1692	.	ENSP00000297405:E1692X	E	-	1	0	CSMD3	113585204	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.817000	0.69229	1.322000	0.45245	0.650000	0.86243	GAA	CSMD3	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000164796		0.333	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	58	0	C	NM_052900		113516028	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	nonsense	33.33	38	19	SNP	1.000	A
CTNNBIP1	56998	genome.wustl.edu	37	1	9910786	9910786	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:9910786C>T	ENST00000377263.1	-	6	547	c.236G>A	c.(235-237)cGg>cAg	p.R79Q	RP11-84A14.5_ENST00000454104.1_RNA|CTNNBIP1_ENST00000537447.1_Missense_Mutation_p.R79Q|CTNNBIP1_ENST00000377256.1_Missense_Mutation_p.R79Q|CTNNBIP1_ENST00000400904.3_Missense_Mutation_p.R79Q|CTNNBIP1_ENST00000377258.1_Missense_Mutation_p.R79Q	NM_001012329.1|NM_020248.2	NP_001012329.1|NP_064633.1	Q9NSA3	CNBP1_HUMAN	catenin, beta interacting protein 1	79					anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of DNA binding (GO:0043392)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription initiation from RNA polymerase II promoter (GO:0060633)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)			cervix(1)|large_intestine(1)|lung(1)	3		all_lung(284;1.82e-05)|Lung NSC(185;3.08e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|Colorectal(212;7.32e-08)|COAD - Colon adenocarcinoma(227;1.73e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000912)|KIRC - Kidney renal clear cell carcinoma(229;0.00112)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		CTACTGCCTCCGGTCTTCCGT	0.612																																																	0													139.0	126.0	130.0					1																	9910786		2203	4300	6503	SO:0001583	missense	0			AB021262	CCDS106.1	1p36.22	2013-09-19	2001-11-29		ENSG00000178585	ENSG00000178585			16913	protein-coding gene	gene with protein product	"""beta-catenin-interacting protein ICAT"", ""inhibitor of beta-catenin and Tcf-4"""	607758	"""catenin, beta-interacting protein 1"""			10898789	Standard	XM_006710779		Approved	ICAT, MGC15093	uc001aql.1	Q9NSA3	OTTHUMG00000001796	ENST00000377263.1:c.236G>A	1.37:g.9910786C>T	ENSP00000366474:p.Arg79Gln		Q5T4V2	Missense_Mutation	SNP	pfam_ICAT,superfamily_ICAT	p.R79Q	ENST00000377263.1	37	c.236	CCDS106.1	1	.	.	.	.	.	.	.	.	.	.	C	17.98	3.519785	0.64634	.	.	ENSG00000178585	ENST00000377263;ENST00000537447;ENST00000400904;ENST00000377258;ENST00000377256	.	.	.	5.51	4.6	0.57074	.	0.000000	0.85682	U	0.000000	T	0.43919	0.1269	.	.	.	0.46798	D	0.999204	B	0.09022	0.002	B	0.01281	0.0	T	0.27806	-1.0063	7	.	.	.	-16.5617	13.07	0.59055	0.0:0.925:0.0:0.075	.	79	Q9NSA3	CNBP1_HUMAN	Q	79	.	.	R	-	2	0	CTNNBIP1	9833373	1.000000	0.71417	0.999000	0.59377	0.864000	0.49448	4.035000	0.57297	1.463000	0.47967	0.650000	0.86243	CGG	CTNNBIP1	-	pfam_ICAT	ENSG00000178585		0.612	CTNNBIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNBIP1	HGNC	protein_coding	OTTHUMT00000005012.1	-	0.00	49	0	C	NM_020248		9910786	-1	tier1	-	no_errors	ENST00000377256	ensembl	human	known	74_37	missense	23.53	26	8	SNP	1.000	T
CYLC1	1538	genome.wustl.edu	37	X	83129383	83129383	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:83129383A>C	ENST00000329312.4	+	4	1704	c.1667A>C	c.(1666-1668)aAg>aCg	p.K556T		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	556					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						GGGGCTAAGAAGAAAATTGAT	0.353																																																	0													50.0	46.0	48.0					X																	83129383		2199	4298	6497	SO:0001583	missense	0			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1667A>C	X.37:g.83129383A>C	ENSP00000331556:p.Lys556Thr		A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	NULL	p.K556T	ENST00000329312.4	37	c.1667	CCDS35341.1	X	.	.	.	.	.	.	.	.	.	.	a	9.649	1.141018	0.21205	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.60920	0.15	3.92	1.38	0.22167	.	.	.	.	.	T	0.66327	0.2778	M	0.70275	2.135	0.09310	N	1	D;D	0.67145	0.99;0.996	D;D	0.66497	0.92;0.944	T	0.53258	-0.8464	9	0.48119	T	0.1	-1.1249	2.6394	0.04967	0.6424:0.0:0.1282:0.2294	.	556;556	P35663;F5H4V5	CYLC1_HUMAN;.	T	556	ENSP00000331556:K556T	ENSP00000331556:K556T	K	+	2	0	CYLC1	83016039	0.021000	0.18746	0.002000	0.10522	0.009000	0.06853	0.148000	0.16224	0.156000	0.19299	0.486000	0.48141	AAG	CYLC1	-	NULL	ENSG00000183035		0.353	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYLC1	HGNC	protein_coding	OTTHUMT00000057371.1	-	0.00	37	0	A	NM_021118		83129383	+1	tier1	-	no_errors	ENST00000329312	ensembl	human	known	74_37	missense	15.91	37	7	SNP	0.005	C
CYP11B1	1584	genome.wustl.edu	37	8	143958194	143958194	+	Missense_Mutation	SNP	C	C	T	rs577746344		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr8:143958194C>T	ENST00000292427.4	-	4	735	c.703G>A	c.(703-705)Gtc>Atc	p.V235I	CYP11B1_ENST00000517471.1_Missense_Mutation_p.V235I|CYP11B1_ENST00000377675.3_Missense_Mutation_p.V306I	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	235					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	ATGAGCTGGACGGTGGATTTG	0.592									Familial Hyperaldosteronism type I				.|||	1	0.000199681	0.0	0.0	5008	,	,		19785	0.0		0.001	False		,,,				2504	0.0																0													36.0	35.0	35.0					8																	143958194		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.703G>A	8.37:g.143958194C>T	ENSP00000292427:p.Val235Ile		Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B,prints_Cyt_P450	p.V235I	ENST00000292427.4	37	c.703	CCDS6392.1	8	.	.	.	.	.	.	.	.	.	.	.	12.35	1.910459	0.33721	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.69040	-0.37;-0.37;-0.37	3.78	-1.03	0.10102	.	1.453280	0.04657	N	0.408270	T	0.53481	0.1799	M	0.68593	2.085	0.09310	N	1	P;B;P	0.35807	0.513;0.164;0.522	B;B;B	0.26202	0.067;0.041;0.049	T	0.30446	-0.9978	10	0.21540	T	0.41	.	0.6878	0.00886	0.1706:0.2667:0.1683:0.3943	.	306;235;235	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	I	235;235;306	ENSP00000292427:V235I;ENSP00000428043:V235I;ENSP00000366903:V306I	ENSP00000292427:V235I	V	-	1	0	CYP11B1	143955196	0.000000	0.05858	0.001000	0.08648	0.495000	0.33615	-1.183000	0.03079	-0.015000	0.14150	-0.142000	0.14014	GTC	CYP11B1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000160882		0.592	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B1	HGNC	protein_coding	OTTHUMT00000379475.2	-	0.00	43	0	C			143958194	-1	tier1	-	no_errors	ENST00000292427	ensembl	human	known	74_37	missense	29.63	19	8	SNP	0.001	T
CYP3A5	1577	genome.wustl.edu	37	7	99273804	99273804	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr7:99273804delA	ENST00000222982.4	-	2	198	c.99delT	c.(97-99)tttfs	p.F33fs	CYP3A5_ENST00000439761.1_Frame_Shift_Del_p.F33fs|CYP3A5_ENST00000480723.1_5'UTR|CYP3A5_ENST00000339843.2_3'UTR|CYP3A5_ENST00000343703.5_Frame_Shift_Del_p.F23fs	NM_000777.3	NP_000768.1	P20815	CP3A5_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 5	33					alkaloid catabolic process (GO:0009822)|drug catabolic process (GO:0042737)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				ado-trastuzumab emtansine(DB05773)|Alfentanil(DB00802)|Alprazolam(DB00404)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Apixaban(DB06605)|Aprepitant(DB00673)|Argatroban(DB00278)|Aripiprazole(DB01238)|Artemether(DB06697)|Astemizole(DB00637)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Beclomethasone(DB00394)|Boceprevir(DB08873)|Brentuximab vedotin(DB08870)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clonidine(DB00575)|Clopidogrel(DB00758)|Cocaine(DB00907)|Codeine(DB00318)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diltiazem(DB00343)|Disulfiram(DB00822)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Dutasteride(DB01126)|Enzalutamide(DB08899)|Eplerenone(DB00700)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Ethosuximide(DB00593)|Etoposide(DB00773)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluticasone Propionate(DB00588)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gestodene(DB06730)|Granisetron(DB00889)|Halofantrine(DB01218)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Losartan(DB00678)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Modafinil(DB00745)|Mycophenolate mofetil(DB00688)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxcarbazepine(DB00776)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Pentamidine(DB00738)|Perampanel(DB08883)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Ponatinib(DB08901)|Pravastatin(DB00175)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Rosuvastatin(DB01098)|Salmeterol(DB00938)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Teniposide(DB00444)|Testosterone(DB00624)|Thalidomide(DB01041)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Troleandomycin(DB01361)|Udenafil(DB06267)|Valproic Acid(DB00313)|Vardenafil(DB00862)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	CCAGTCTCTTAAAAAGTCCAT	0.453																																																	0													114.0	103.0	107.0					7																	99273804		2203	4300	6503	SO:0001589	frameshift_variant	0			L26985	CCDS5672.1, CCDS55134.1	7q21.1	2007-12-14	2003-01-14		ENSG00000106258	ENSG00000106258		"""Cytochrome P450s"""	2638	protein-coding gene	gene with protein product		605325	"""cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 5"""				Standard	NR_033808		Approved	PCN3, P450PCN3, CP35		P20815	OTTHUMG00000156724	ENST00000222982.4:c.99delT	7.37:g.99273804delA	ENSP00000222982:p.Phe33fs		A4D289|B7Z5I7|Q53WY8|Q75MV0|Q9HB56	Frame_Shift_Del	DEL	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_CYP3A,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.F33fs	ENST00000222982.4	37	c.99	CCDS5672.1	7																																																																																			CYP3A5	-	NULL	ENSG00000106258		0.453	CYP3A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP3A5	HGNC	protein_coding	OTTHUMT00000345469.1		0.00	48	0	A			99273804	-1	tier1		no_errors	ENST00000222982	ensembl	human	known	74_37	frame_shift_del	12.90	54	8	DEL	0.750	-
DCDC1	341019	genome.wustl.edu	37	11	30953321	30953321	+	Missense_Mutation	SNP	G	G	A	rs139705632	byFrequency	TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr11:30953321G>A	ENST00000597505.1	-	20	2893	c.2894C>T	c.(2893-2895)aCg>aTg	p.T965M	DCDC1_ENST00000406071.2_De_novo_Start_InFrame|DCDC1_ENST00000339794.5_Missense_Mutation_p.T44M|DCDC1_ENST00000437348.1_5'UTR			P59894	DCDC1_HUMAN	doublecortin domain containing 1	200					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					TTCTTACTGCGTTTTCCGTCC	0.373													G|||	10	0.00199681	0.0068	0.0014	5008	,	,		16712	0.0		0.0	False		,,,				2504	0.0																0								G	MET/THR	13,4391	19.1+/-41.9	0,13,2189	71.0	66.0	68.0		215	-5.3	0.0	11	dbSNP_134	68	0,8598		0,0,4299	yes	missense	DCDC5	NM_020869.3	81	0,13,6488	AA,AG,GG		0.0,0.2952,0.1	benign	72/891	30953321	13,12989	2202	4299	6501	SO:0001583	missense	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.2894C>T	11.37:g.30953321G>A	ENSP00000472625:p.Thr965Met		A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,pfscan_Doublecortin_dom,pfscan_Ricin_B_lectin	p.T44M	ENST00000597505.1	37	c.131		11	.	.	.	.	.	.	.	.	.	.	G	13.42	2.232414	0.39498	0.002952	0.0	ENSG00000170959	ENST00000339794;ENST00000437348	D	0.93659	-3.26	4.62	-5.35	0.02697	Doublecortin domain (3);	2.008630	0.02106	N	0.054393	T	0.81950	0.4931	N	0.11560	0.145	0.09310	N	1	B	0.19583	0.037	B	0.06405	0.002	T	0.70872	-0.4754	10	0.37606	T	0.19	0.3607	1.0729	0.01625	0.4028:0.1114:0.263:0.2227	.	44	Q6ZRR9	DCDC5_HUMAN	M	44	ENSP00000341700:T44M	ENSP00000341700:T44M	T	-	2	0	DCDC5	30909897	0.000000	0.05858	0.000000	0.03702	0.807000	0.45602	-0.975000	0.03790	-0.736000	0.04831	0.455000	0.32223	ACG	DCDC1	-	pfscan_Doublecortin_dom	ENSG00000170959		0.373	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000463167.1	-	0.00	59	0	G	NM_181807		30953321	-1	tier1	rs139705632	no_errors	ENST00000339794	ensembl	human	known	74_37	missense	25.00	39	13	SNP	0.009	A
DDX39B	7919	genome.wustl.edu	37	6	31498434	31498434	+	Intron	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr6:31498434G>A	ENST00000396172.1	-	10	1901				ATP6V1G2-DDX39B_ENST00000376185.1_Intron|DDX39B_ENST00000462421.1_5'UTR|DDX39B_ENST00000417556.2_Intron|DDX39B_ENST00000458640.1_Intron|DDX39B_ENST00000415382.2_Intron|DDX39B_ENST00000376177.2_Intron	NM_004640.6	NP_004631.1	Q13838	DX39B_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B						ATP catabolic process (GO:0006200)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|RNA secondary structure unwinding (GO:0010501)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|transcription export complex (GO:0000346)	ATP binding (GO:0005524)|ATP-dependent protein binding (GO:0043008)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)|RNA-dependent ATPase activity (GO:0008186)|U4 snRNA binding (GO:0030621)|U6 snRNA binding (GO:0017070)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						CAAAGACCAGGGGGCATGAAC	0.488																																																	0																																										SO:0001627	intron_variant	0			Z37166	CCDS4697.1	6p21.33	2011-02-09	2011-02-08	2011-02-08	ENSG00000198563	ENSG00000198563		"""DEAD-boxes"""	13917	protein-coding gene	gene with protein product	"""U2AF65-associated protein 56"""	142560	"""HLA-B associated transcript 1"""	BAT1		7601445, 2813433	Standard	NM_004640		Approved	D6S81E, UAP56	uc003ntu.3	Q13838	OTTHUMG00000031165	ENST00000396172.1:c.1270+121C>T	6.37:g.31498434G>A			B0S8C0|O43496|Q0EFA1|Q2L6F9|Q53GL9|Q5RJ64|Q5RJ66|Q5ST94|Q5STB4|Q5STB5|Q5STB7|Q5STB8|Q5STU4|Q5STU5|Q5STU6|Q5STU8|Q71V76	RNA	SNP	-	NULL	ENST00000396172.1	37	NULL	CCDS4697.1	6																																																																																			DDX39B	-	-	ENSG00000198563		0.488	DDX39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX39B	HGNC	protein_coding	OTTHUMT00000259083.1	-	0.00	21	0	G	NM_004640		31498434	-1	tier1	-	no_errors	ENST00000462421	ensembl	human	putative	74_37	rna	21.05	15	4	SNP	0.000	A
DENND5B	160518	genome.wustl.edu	37	12	31595786	31595786	+	Silent	SNP	A	A	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr12:31595786A>G	ENST00000389082.5	-	7	2199	c.1935T>C	c.(1933-1935)atT>atC	p.I645I	DENND5B_ENST00000306833.6_Silent_p.I680I|DENND5B_ENST00000354285.4_Silent_p.I667I|DENND5B_ENST00000536562.1_Silent_p.I680I	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	645					positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TGCCTTGACCAATTTTCATAT	0.378																																																	0													87.0	84.0	85.0					12																	31595786		1880	4135	6015	SO:0001819	synonymous_variant	0			AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.1935T>C	12.37:g.31595786A>G			B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Silent	SNP	pfam_DENN_dom,pfam_Run,pfam_uDENN_dom,pfam_dDENN_dom,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_Run,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_PLAT/LH2_dom,pfscan_Run	p.I680	ENST00000389082.5	37	c.2040	CCDS44857.1	12																																																																																			DENND5B	-	NULL	ENSG00000170456		0.378	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND5B	HGNC	protein_coding	OTTHUMT00000402040.1	-	0.00	88	0	A	NM_144973		31595786	-1	tier1	-	no_errors	ENST00000306833	ensembl	human	known	74_37	silent	5.33	71	4	SNP	0.996	G
DGCR9	25787	genome.wustl.edu	37	22	19005790	19005790	+	lincRNA	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr22:19005790C>T	ENST00000609630.1	+	0	444				DGCR5_ENST00000440005.2_RNA	NR_024159.1				DiGeorge syndrome critical region gene 9 (non-protein coding)																		AGGGAGGTGGCAGCATCAGAG	0.617																																																	0																																												0			L77571		22q11.21	2014-06-12	2014-06-12			ENSG00000273032			17227	non-coding RNA	RNA, long non-coding			"""DiGeorge syndrome critical region gene 9"""			8776594	Standard	NR_024159		Approved	DGS-A, POM121L5P	uc002zop.3				22.37:g.19005790C>T				RNA	SNP	-	NULL	ENST00000609630.1	37	NULL		22																																																																																			DGCR9	-	-	ENSG00000273032		0.617	DGCR9-001	KNOWN	basic	lincRNA	DGCR9	HGNC	lincRNA	OTTHUMT00000472253.1	-	0.00	74	0	C			19005790	+1	tier1	-	no_errors	ENST00000609630	ensembl	human	known	74_37	rna	18.42	62	14	SNP	0.012	T
DIS3L	115752	genome.wustl.edu	37	15	66604111	66604111	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr15:66604111G>T	ENST00000319212.4	+	5	658	c.608G>T	c.(607-609)tGt>tTt	p.C203F	DIS3L_ENST00000319194.5_Missense_Mutation_p.C120F|DIS3L_ENST00000441424.2_Missense_Mutation_p.C69F	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	203					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CACGAGCTTTGTGATTCTATC	0.458																																																	0													131.0	131.0	131.0					15																	66604111		2201	4299	6500	SO:0001583	missense	0				CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.608G>T	15.37:g.66604111G>T	ENSP00000321711:p.Cys203Phe		Q8N1N8|Q8WTU9|Q96CM7	Missense_Mutation	SNP	NULL	p.C203F	ENST00000319212.4	37	c.608	CCDS45286.1	15	.	.	.	.	.	.	.	.	.	.	G	0.116	-1.131704	0.01756	.	.	ENSG00000166938	ENST00000319194;ENST00000441424;ENST00000319212;ENST00000525109	T;T;T;T	0.40476	2.05;1.03;2.04;1.08	5.14	4.2	0.49525	.	0.306970	0.38272	N	0.001742	T	0.18759	0.0450	N	0.05124	-0.11	0.41869	D	0.990261	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.06338	-1.0832	10	0.20519	T	0.43	5.4759	6.4524	0.21910	0.0854:0.0:0.566:0.3486	.	203;203	Q8TF46;Q8TF46-3	DI3L1_HUMAN;.	F	120;69;203;69	ENSP00000321583:C120F;ENSP00000388980:C69F;ENSP00000321711:C203F;ENSP00000432125:C69F	ENSP00000321583:C120F	C	+	2	0	DIS3L	64391165	1.000000	0.71417	0.542000	0.28115	0.484000	0.33280	2.139000	0.42149	1.104000	0.41587	0.561000	0.74099	TGT	DIS3L	-	NULL	ENSG00000166938		0.458	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIS3L	HGNC	protein_coding	OTTHUMT00000382792.2		0.00	24	0	G	NM_133375		66604111	+1			no_errors	ENST00000319212	ensembl	human	known	74_37	missense	11.11	16	2	SNP	0.993	T
DNAH17	8632	genome.wustl.edu	37	17	76481737	76481737	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:76481737C>T	ENST00000585328.1	-	47	7487	c.7363G>A	c.(7363-7365)Ggc>Agc	p.G2455S	RP11-559N14.5_ENST00000585969.1_RNA|DNAH17_ENST00000389840.5_Missense_Mutation_p.G2446S|DNAH17_ENST00000586052.1_5'UTR|RP11-559N14.5_ENST00000588565.1_RNA	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	2446	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			ACCGACTTGCCCGTCCCCGCG	0.592																																																	0													79.0	88.0	85.0					17																	76481737		2140	4231	6371	SO:0001583	missense	0			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.7363G>A	17.37:g.76481737C>T	ENSP00000465516:p.Gly2455Ser		O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_HR1_rho-bd	p.G2446S	ENST00000585328.1	37	c.7336		17	.	.	.	.	.	.	.	.	.	.	C	36	5.752967	0.96890	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	D	0.92048	-2.96	4.88	4.88	0.63580	.	.	.	.	.	D	0.96166	0.8750	M	0.87038	2.855	0.58432	D	0.999999	.	.	.	.	.	.	D	0.96510	0.9378	7	0.54805	T	0.06	.	18.0175	0.89246	0.0:1.0:0.0:0.0	.	.	.	.	S	2455;2446	ENSP00000374490:G2446S	ENSP00000300671:G2455S	G	-	1	0	DNAH17	73993332	1.000000	0.71417	0.939000	0.37840	0.954000	0.61252	7.711000	0.84669	2.244000	0.73946	0.563000	0.77884	GGC	DNAH17	-	superfamily_P-loop_NTPase	ENSG00000187775		0.592	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000318962.2	-	0.00	50	0	C	NM_173628		76481737	-1	tier1	-	no_errors	ENST00000389840	ensembl	human	known	74_37	missense	40.00	27	18	SNP	1.000	T
DNAH3	55567	genome.wustl.edu	37	16	20981193	20981193	+	Silent	SNP	G	G	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr16:20981193G>C	ENST00000261383.3	-	52	8378	c.8379C>G	c.(8377-8379)ggC>ggG	p.G2793G	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2793	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GTTTGACAGGGCCTGGTGGGT	0.592																																																	0													148.0	127.0	134.0					16																	20981193		2201	4300	6501	SO:0001819	synonymous_variant	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.8379C>G	16.37:g.20981193G>C			O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.G2793	ENST00000261383.3	37	c.8379	CCDS10594.1	16																																																																																			DNAH3	-	NULL	ENSG00000158486		0.592	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	-	0.00	93	0	G	NM_017539		20981193	-1	tier1	-	no_errors	ENST00000261383	ensembl	human	known	74_37	silent	19.35	50	12	SNP	0.606	C
DNAH3	55567	genome.wustl.edu	37	16	21038390	21038390	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr16:21038390C>A	ENST00000261383.3	-	38	5498	c.5499G>T	c.(5497-5499)gaG>gaT	p.E1833D	DNAH3_ENST00000415178.1_Missense_Mutation_p.E1833D	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1833	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GGTCGGCGGGCTCGAAGATCA	0.572																																																	0													70.0	65.0	67.0					16																	21038390		2201	4300	6501	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.5499G>T	16.37:g.21038390C>A	ENSP00000261383:p.Glu1833Asp		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.E1833D	ENST00000261383.3	37	c.5499	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	16.95	3.263672	0.59431	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	D;D	0.96967	-4.19;-4.19	4.93	4.93	0.64822	.	0.000000	0.64402	D	0.000001	D	0.99080	0.9684	H	0.99273	4.495	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99035	1.0822	10	0.87932	D	0	.	18.1477	0.89663	0.0:1.0:0.0:0.0	.	1833	Q8TD57	DYH3_HUMAN	D	1833	ENSP00000261383:E1833D;ENSP00000394245:E1833D	ENSP00000261383:E1833D	E	-	3	2	DNAH3	20945891	1.000000	0.71417	1.000000	0.80357	0.226000	0.24999	2.554000	0.45845	2.273000	0.75805	0.563000	0.77884	GAG	DNAH3	-	superfamily_P-loop_NTPase	ENSG00000158486		0.572	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1		0.00	26	0	C	NM_017539		21038390	-1			no_errors	ENST00000261383	ensembl	human	known	74_37	missense	17.65	14	3	SNP	1.000	A
DNAH9	1770	genome.wustl.edu	37	17	11783507	11783507	+	Nonsense_Mutation	SNP	A	A	T	rs200261738		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:11783507A>T	ENST00000262442.4	+	54	10659	c.10591A>T	c.(10591-10593)Aaa>Taa	p.K3531*	DNAH9_ENST00000608377.1_5'Flank|DNAH9_ENST00000454412.2_Nonsense_Mutation_p.K3531*	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3531	AAA 5. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.K3531*(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGAAGTCATTAAAAAAGGACG	0.507																																																	1	Substitution - Nonsense(1)	endometrium(1)											88.0	89.0	89.0					17																	11783507		2203	4300	6503	SO:0001587	stop_gained	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.10591A>T	17.37:g.11783507A>T	ENSP00000262442:p.Lys3531*		A2VCQ8|O15064|O95494|Q9NQ28	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.K3531*	ENST00000262442.4	37	c.10591	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	A	52	18.677273	0.99909	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	.	.	.	4.46	4.46	0.54185	.	0.133025	0.49305	D	0.000160	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.5648	0.61810	1.0:0.0:0.0:0.0	.	.	.	.	X	3531;3531;2113	.	ENSP00000262442:K3531X	K	+	1	0	DNAH9	11724232	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	8.827000	0.92041	1.879000	0.54435	0.533000	0.62120	AAA	DNAH9	-	superfamily_P-loop_NTPase	ENSG00000007174		0.507	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	-	0.00	29	0	A	NM_001372		11783507	+1	tier1	rs200261738	no_errors	ENST00000262442	ensembl	human	known	74_37	nonsense	20.00	12	3	SNP	1.000	T
STEAP2-AS1	100874100	genome.wustl.edu	37	7	89749036	89749036	+	RNA	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr7:89749036G>A	ENST00000478318.2	-	0	424				RP5-1121E10.2_ENST00000471553.1_lincRNA|DPY19L2P4_ENST00000497063.1_RNA					STEAP2 antisense RNA 1																		GTGGAAAATCGAAAAGGCTTG	0.632																																																	0																																												0					7q21.13	2012-10-12	2012-08-15		ENSG00000227646	ENSG00000227646		"""Long non-coding RNAs"""	40820	non-coding RNA	RNA, long non-coding			"""STEAP2 antisense RNA 1 (non-protein coding)"""				Standard	NR_110029		Approved				OTTHUMG00000065036		7.37:g.89749036G>A				RNA	SNP	-	NULL	ENST00000478318.2	37	NULL		7																																																																																			DPY19L2P4	-	-	ENSG00000235436		0.632	STEAP2-AS1-002	KNOWN	basic	antisense	DPY19L2P4	HGNC	processed_transcript	OTTHUMT00000350909.2	-	0.00	54	0	G			89749036	+1	tier1	-	no_errors	ENST00000497063	ensembl	human	known	74_37	rna	7.35	63	5	SNP	0.001	A
EFCAB7	84455	genome.wustl.edu	37	1	64036560	64036560	+	Intron	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:64036560G>T	ENST00000371088.4	+	13	1953				EFCAB7_ENST00000461039.1_3'UTR	NM_032437.2	NP_115813.2	A8K855	EFCB7_HUMAN	EF-hand calcium binding domain 7								calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	19						GTTGAAAGAAGTAGCCAATTT	0.274																																																	0																																										SO:0001627	intron_variant	0			BC015814	CCDS30737.1	1p31.3	2013-01-10			ENSG00000203965	ENSG00000203965		"""EF-hand domain containing"""	29379	protein-coding gene	gene with protein product						11347906	Standard	NM_032437		Approved	KIAA1799, RP4-534K7.1	uc001dbf.3	A8K855	OTTHUMG00000008983	ENST00000371088.4:c.1708-132G>T	1.37:g.64036560G>T			Q658P0|Q96B95|Q96JM6	RNA	SNP	-	NULL	ENST00000371088.4	37	NULL	CCDS30737.1	1																																																																																			EFCAB7	-	-	ENSG00000203965		0.274	EFCAB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB7	HGNC	protein_coding	OTTHUMT00000024910.1	-	0.00	20	0	G	NM_032437		64036560	+1	tier1	-	no_errors	ENST00000461039	ensembl	human	known	74_37	rna	25.00	12	4	SNP	0.000	T
EMCN	51705	genome.wustl.edu	37	4	101439059	101439059	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr4:101439059G>T	ENST00000296420.4	-	1	191	c.13C>A	c.(13-15)Caa>Aaa	p.Q5K	EMCN_ENST00000502327.1_5'UTR|EMCN_ENST00000305864.3_Missense_Mutation_p.Q5K|EMCN_ENST00000511970.1_Missense_Mutation_p.Q5K	NM_001159694.1|NM_016242.3	NP_001153166.1|NP_057326.2	Q9ULC0	MUCEN_HUMAN	endomucin	5						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		ATGGTCACTTGAAGCAGTTCC	0.463																																																	0													216.0	199.0	205.0					4																	101439059		2203	4300	6503	SO:0001583	missense	0			AF205940	CCDS3655.1, CCDS54782.1	4q22.1	2008-02-05			ENSG00000164035	ENSG00000164035		"""Mucins"""	16041	protein-coding gene	gene with protein product		608350				11418125, 11594763	Standard	NM_016242		Approved	MUC14	uc003hvr.3	Q9ULC0	OTTHUMG00000131051	ENST00000296420.4:c.13C>A	4.37:g.101439059G>T	ENSP00000296420:p.Gln5Lys		A8K716|B4E347|Q8NEY5|Q8WWE7|Q9NRM8	Missense_Mutation	SNP	pfam_Endomucin	p.Q5K	ENST00000296420.4	37	c.13	CCDS3655.1	4	.	.	.	.	.	.	.	.	.	.	G	8.674	0.903626	0.17760	.	.	ENSG00000164035	ENST00000296420;ENST00000305864;ENST00000511970;ENST00000502569	.	.	.	5.36	3.57	0.40892	.	0.532850	0.14523	N	0.314307	T	0.29914	0.0748	L	0.29908	0.895	0.09310	N	1	B;B;B	0.32350	0.366;0.263;0.263	B;B;B	0.35240	0.198;0.111;0.111	T	0.17349	-1.0372	9	0.13108	T	0.6	-1.1714	9.9627	0.41706	0.0:0.3575:0.5113:0.1312	.	5;5;5	Q9ULC0-2;B4E347;Q9ULC0	.;.;MUCEN_HUMAN	K	5	.	ENSP00000296420:Q5K	Q	-	1	0	EMCN	101658082	0.043000	0.20138	0.024000	0.17045	0.155000	0.21991	1.052000	0.30429	0.704000	0.31869	-0.182000	0.12963	CAA	EMCN	-	pfam_Endomucin	ENSG00000164035		0.463	EMCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMCN	HGNC	protein_coding	OTTHUMT00000253699.2	-	0.00	66	0	G	NM_016242		101439059	-1	tier1	-	no_errors	ENST00000296420	ensembl	human	known	74_37	missense	25.00	36	12	SNP	0.036	T
EMCN	51705	genome.wustl.edu	37	4	101439061	101439061	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr4:101439061A>C	ENST00000296420.4	-	1	189	c.11T>G	c.(10-12)cTt>cGt	p.L4R	EMCN_ENST00000502327.1_5'UTR|EMCN_ENST00000305864.3_Missense_Mutation_p.L4R|EMCN_ENST00000511970.1_Missense_Mutation_p.L4R	NM_001159694.1|NM_016242.3	NP_001153166.1|NP_057326.2	Q9ULC0	MUCEN_HUMAN	endomucin	4						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		GGTCACTTGAAGCAGTTCCAT	0.468																																																	0													211.0	195.0	200.0					4																	101439061		2203	4300	6503	SO:0001583	missense	0			AF205940	CCDS3655.1, CCDS54782.1	4q22.1	2008-02-05			ENSG00000164035	ENSG00000164035		"""Mucins"""	16041	protein-coding gene	gene with protein product		608350				11418125, 11594763	Standard	NM_016242		Approved	MUC14	uc003hvr.3	Q9ULC0	OTTHUMG00000131051	ENST00000296420.4:c.11T>G	4.37:g.101439061A>C	ENSP00000296420:p.Leu4Arg		A8K716|B4E347|Q8NEY5|Q8WWE7|Q9NRM8	Missense_Mutation	SNP	pfam_Endomucin	p.L4R	ENST00000296420.4	37	c.11	CCDS3655.1	4	.	.	.	.	.	.	.	.	.	.	A	13.64	2.296709	0.40594	.	.	ENSG00000164035	ENST00000296420;ENST00000305864;ENST00000511970;ENST00000502569	.	.	.	5.03	3.86	0.44501	.	0.324362	0.18094	N	0.151883	T	0.49372	0.1553	L	0.29908	0.895	0.09310	N	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.995;0.992	T	0.33599	-0.9862	9	0.87932	D	0	-6.6276	9.3861	0.38345	0.9189:0.0:0.0811:0.0	.	4;4;4	Q9ULC0-2;B4E347;Q9ULC0	.;.;MUCEN_HUMAN	R	4	.	ENSP00000296420:L4R	L	-	2	0	EMCN	101658084	0.449000	0.25689	0.049000	0.19019	0.180000	0.23129	2.384000	0.44362	0.882000	0.36016	0.533000	0.62120	CTT	EMCN	-	pfam_Endomucin	ENSG00000164035		0.468	EMCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMCN	HGNC	protein_coding	OTTHUMT00000253699.2	-	0.00	66	0	A	NM_016242		101439061	-1	tier1	-	no_errors	ENST00000296420	ensembl	human	known	74_37	missense	24.49	37	12	SNP	0.168	C
ENKUR	219670	genome.wustl.edu	37	10	25273785	25273785	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr10:25273785G>A	ENST00000331161.4	-	5	863	c.644C>T	c.(643-645)tCg>tTg	p.S215L	ENKUR_ENST00000376363.1_Missense_Mutation_p.S215L	NM_145010.3	NP_659447.1	Q8TC29	ENKUR_HUMAN	enkurin, TRPC channel interacting protein	215	Enkurin. {ECO:0000255|PROSITE- ProRule:PRU01000}.					motile cilium (GO:0031514)				endometrium(2)|large_intestine(4)|lung(3)|skin(1)	10						TATAAAGACCGAGAGGGACTG	0.398																																																	0													103.0	96.0	98.0					10																	25273785		2203	4300	6503	SO:0001583	missense	0			AK095021	CCDS7146.1, CCDS73075.1	10p12.31	2014-08-13	2009-04-28	2009-04-28	ENSG00000151023	ENSG00000151023			28388	protein-coding gene	gene with protein product		611025	"""chromosome 10 open reading frame 63"""	C10orf63		17217053, 15385169	Standard	NM_145010		Approved	MGC26778, enkurin, CFAP106	uc001isg.2	Q8TC29	OTTHUMG00000017827	ENST00000331161.4:c.644C>T	10.37:g.25273785G>A	ENSP00000331044:p.Ser215Leu		A8K8Y0|D3DRV2	Missense_Mutation	SNP	NULL	p.S215L	ENST00000331161.4	37	c.644	CCDS7146.1	10	.	.	.	.	.	.	.	.	.	.	G	23.1	4.374912	0.82573	.	.	ENSG00000151023	ENST00000331161;ENST00000376363	.	.	.	5.25	5.25	0.73442	.	0.116267	0.64402	D	0.000009	D	0.83312	0.5227	M	0.84326	2.69	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.983	D	0.84581	0.0661	9	0.52906	T	0.07	-6.9366	18.7861	0.91955	0.0:0.0:1.0:0.0	.	215;215	Q5VV23;Q8TC29	.;ENKUR_HUMAN	L	215	.	ENSP00000331044:S215L	S	-	2	0	ENKUR	25313791	1.000000	0.71417	0.972000	0.41901	0.395000	0.30598	6.806000	0.75195	2.602000	0.87976	0.557000	0.71058	TCG	ENKUR	-	NULL	ENSG00000151023		0.398	ENKUR-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENKUR	HGNC	protein_coding	OTTHUMT00000047239.2	-	0.00	33	0	G	NM_145010		25273785	-1	tier1	-	no_errors	ENST00000331161	ensembl	human	known	74_37	missense	67.86	9	19	SNP	1.000	A
AP001623.1	0	genome.wustl.edu	37	21	43720386	43720387	+	RNA	DEL	GT	GT	-	rs142198765		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	GT	GT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr21:43720386_43720387delGT	ENST00000401378.1	-	0	68_69																											ACAGGGGCTGgtgtgtgtgtgt	0.55																																																	0										117,2837		8,101,1368						-0.2	0.0		dbSNP_134	70	210,4996		37,136,2430	no	intergenic				45,237,3798	A1A1,A1R,RR		4.0338,3.9607,4.0074				327,7833						0																															21.37:g.43720396_43720397delGT				RNA	DEL	-	NULL	ENST00000401378.1	37	NULL		21																																																																																			AP001623.1	-	-	ENSG00000216197		0.550	AP001623.1-201	NOVEL	basic	miRNA	ENSG00000216197	Clone_based_ensembl_gene	miRNA			0.00	50	0	GT			43720387	-1	tier1		no_errors	ENST00000401378	ensembl	human	novel	74_37	rna	11.43	31	4	DEL	0.001:0.000	-
DHDDS	79947	genome.wustl.edu	37	1	26793764	26793764	+	Intron	DEL	A	A	-			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:26793764delA	ENST00000236342.7	+	9	858				RP3-476K8.3_ENST00000423060.1_RNA|DHDDS_ENST00000360009.2_Intron|DHDDS_ENST00000526219.1_Intron|DHDDS_ENST00000525682.2_Intron			Q86SQ9	DHDDS_HUMAN	dehydrodolichyl diphosphate synthase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	transferase activity, transferring alkyl or aryl (other than methyl) groups (GO:0016765)			breast(5)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)|urinary_tract(1)	15		all_cancers(24;2.04e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.0161)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.166)|LUSC - Lung squamous cell carcinoma(448;0.239)		ccatatcctcaAAAAAAATCC	0.532																																																	0																																										SO:0001627	intron_variant	0			AK023164	CCDS281.1, CCDS282.1, CCDS57984.1, CCDS57983.1	1p35.3	2014-01-28			ENSG00000117682	ENSG00000117682			20603	protein-coding gene	gene with protein product		608172				12591616	Standard	NM_024887		Approved	HDS, FLJ13102, DS, RP59	uc001bmk.3	Q86SQ9	OTTHUMG00000003554	ENST00000236342.7:c.766-1622A>-	1.37:g.26793764delA			B7Z4B9|B7ZB20|D3DPK7|D3DPK8|D3DPK9|E9KL43|Q5T0A4|Q8NE90|Q9BTG5|Q9BTK3|Q9H905	RNA	DEL	-	NULL	ENST00000236342.7	37	NULL	CCDS282.1	1																																																																																			RP3-476K8.3	-	-	ENSG00000225891		0.532	DHDDS-011	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000225891	Clone_based_vega_gene	protein_coding	OTTHUMT00000392504.1		0.00	52	0	A	NM_024887		26793764	-1	tier1		no_errors	ENST00000423060	ensembl	human	known	74_37	rna	5.00	38	2	DEL	0.000	-
SCARNA16	677781	genome.wustl.edu	37	1	9142937	9142938	+	RNA	INS	-	-	A	rs374839687		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:9142937_9142938insA	ENST00000516595.1	+	0	183_184									small Cajal body-specific RNA 16																		CTGCAAACAGGACAAAAAaaaa	0.455																																																	0																																												0			AJ609486		17q25.2	2013-09-05			ENSG00000251790	ENSG00000275143		"""ncRNAs / Small nucleolar RNAs : Small cajal body-specific"""	32573	non-coding RNA	RNA, small nucleolar							Standard	NR_003013		Approved	ACA47	uc021qdy.1				1.37:g.9142938_9142938dupA				RNA	INS	-	NULL	ENST00000516595.1	37	NULL		1																																																																																			SCARNA16	-	-	ENSG00000252404		0.455	SCARNA16.3-201	NOVEL	basic	snoRNA	ENSG00000252404	RFAM	snoRNA			0.00	11	0	-	NR_003013		9142938	+1	tier1		no_errors	ENST00000516595	ensembl	human	novel	74_37	rna	33.33	4	2	INS	0.022:0.023	A
AP1G2	8906	genome.wustl.edu	37	14	24036581	24036581	+	5'UTR	SNP	T	T	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr14:24036581T>C	ENST00000308724.5	-	0	698				AP1G2_ENST00000556277.1_Intron|AP1G2_ENST00000397120.3_Intron|RP11-66N24.3_ENST00000555968.1_RNA	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit						intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		TGCCTGGGCTTTCGGCCCAGG	0.592											OREG0022606	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001623	5_prime_UTR_variant	0			AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.-58A>G	14.37:g.24036581T>C		768	D3DS51|O75504	RNA	SNP	-	NULL	ENST00000308724.5	37	NULL	CCDS9602.1	14																																																																																			RP11-66N24.3	-	-	ENSG00000258727		0.592	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258727	Clone_based_vega_gene	protein_coding	OTTHUMT00000071812.4	-	0.00	14	0	T	NM_003917		24036581	+1	tier1	-	no_errors	ENST00000555968	ensembl	human	known	74_37	rna	28.57	10	4	SNP	0.015	C
TRMT112P6	391358	genome.wustl.edu	37	2	26251188	26251188	+	Silent	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:26251188C>T	ENST00000599234.1	-	1	293	c.294G>A	c.(292-294)ctG>ctA	p.L98L																								CCACCTCCAGCAGCAGGTGGT	0.577																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000599234.1:c.294G>A	2.37:g.26251188C>T				Silent	SNP	pfam_UPF0434/Trm112	p.L98	ENST00000599234.1	37	c.294		2																																																																																			AC013449.1	-	pfam_UPF0434/Trm112	ENSG00000268412		0.577	AC013449.1-201	NOVEL	basic|appris_principal	protein_coding	ENSG00000268412	Clone_based_ensembl_gene	protein_coding		-	0.00	43	0	C			26251188	-1	tier1	-	no_errors	ENST00000599234	ensembl	human	novel	74_37	silent	11.43	31	4	SNP	1.000	T
SPATS2L	26010	genome.wustl.edu	37	2	201251916	201251916	+	Intron	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:201251916G>T	ENST00000358677.5	+	3	225				SPATS2L_ENST00000451764.2_Intron|SPATS2L_ENST00000360760.5_Intron|SPATS2L_ENST00000409385.1_Intron|SPATS2L_ENST00000409140.3_Intron|SPATS2L_ENST00000409988.3_Intron|SPATS2L_ENST00000409755.3_Intron|AC105381.1_ENST00000581684.1_RNA|SPATS2L_ENST00000409151.1_Intron|SPATS2L_ENST00000409718.1_Intron	NM_001282735.1|NM_001282743.1|NM_001282744.1|NM_015535.2	NP_001269664.1|NP_001269672.1|NP_001269673.1|NP_056350.2	Q9NUQ6	SPS2L_HUMAN	spermatogenesis associated, serine-rich 2-like							cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|protein complex (GO:0043234)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)	10						TAttaggttggtacaaaagta	0.363																																																	0																																										SO:0001627	intron_variant	0			AF193059	CCDS46483.1, CCDS46484.1, CCDS74621.1, CCDS74622.1	2q33.1	2009-06-12			ENSG00000196141	ENSG00000196141			24574	protein-coding gene	gene with protein product	"""DNA polymerase transactivated protein 6"""	613817				11230166	Standard	NM_001100422		Approved	DNAPTP6	uc002uvr.4	Q9NUQ6	OTTHUMG00000154589	ENST00000358677.5:c.-22-2030G>T	2.37:g.201251916G>T			A8K381|B4DRE6|B4DT67|B7WNZ7|Q53T22|Q8WV53|Q8WYG1|Q9NTW4	RNA	SNP	-	NULL	ENST00000358677.5	37	NULL	CCDS46483.1	2																																																																																			AC105381.1	-	-	ENSG00000264798		0.363	SPATS2L-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000264798	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000336208.3	-	0.00	75	0	G	NM_015535		201251916	+1	tier1	-	no_errors	ENST00000581684	ensembl	human	novel	74_37	rna	5.62	84	5	SNP	0.307	T
POLR1C	9533	genome.wustl.edu	37	6	43487213	43487213	+	Intron	SNP	T	T	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr6:43487213T>A	ENST00000372389.3	+	3	337				YIPF3_ENST00000372422.2_5'Flank|RP3-337H4.9_ENST00000607571.1_RNA|YIPF3_ENST00000506469.1_5'Flank|POLR1C_ENST00000304004.3_Intron|POLR1C_ENST00000372344.2_Intron	NM_203290.2	NP_976035.1	O15160	RPAC1_HUMAN	polymerase (RNA) I polypeptide C, 30kDa						gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)	5	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|all cancers(41;0.00511)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			CTGGAGTTGCTTTGGGAACTG	0.468																																																	0													94.0	74.0	80.0					6																	43487213		2203	4300	6503	SO:0001627	intron_variant	0			AF008442	CCDS4901.1	6p21.1	2013-01-21			ENSG00000171453	ENSG00000171453		"""RNA polymerase subunits"""	20194	protein-coding gene	gene with protein product		610060				11042152, 12446911	Standard	NM_203290		Approved	RPA40, RPA39, RPA5, RPAC1	uc003ovn.3	O15160	OTTHUMG00000014739	ENST00000372389.3:c.249+35T>A	6.37:g.43487213T>A			O75395|Q5JTE3	RNA	SNP	-	NULL	ENST00000372389.3	37	NULL	CCDS4901.1	6																																																																																			RP3-337H4.9	-	-	ENSG00000271754		0.468	POLR1C-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000271754	Clone_based_vega_gene	protein_coding	OTTHUMT00000040652.3	-	0.00	92	0	T	NM_004875		43487213	-1	tier1	-	no_errors	ENST00000607571	ensembl	human	known	74_37	rna	30.36	39	17	SNP	0.000	A
POLR1C	9533	genome.wustl.edu	37	6	43487215	43487215	+	Intron	SNP	T	T	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr6:43487215T>A	ENST00000372389.3	+	3	337				YIPF3_ENST00000372422.2_5'Flank|RP3-337H4.9_ENST00000607571.1_RNA|YIPF3_ENST00000506469.1_5'Flank|POLR1C_ENST00000304004.3_Intron|POLR1C_ENST00000372344.2_Intron	NM_203290.2	NP_976035.1	O15160	RPAC1_HUMAN	polymerase (RNA) I polypeptide C, 30kDa						gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)	5	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|all cancers(41;0.00511)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			GGAGTTGCTTTGGGAACTGCA	0.463																																																	0													93.0	73.0	79.0					6																	43487215		2203	4300	6503	SO:0001627	intron_variant	0			AF008442	CCDS4901.1	6p21.1	2013-01-21			ENSG00000171453	ENSG00000171453		"""RNA polymerase subunits"""	20194	protein-coding gene	gene with protein product		610060				11042152, 12446911	Standard	NM_203290		Approved	RPA40, RPA39, RPA5, RPAC1	uc003ovn.3	O15160	OTTHUMG00000014739	ENST00000372389.3:c.249+37T>A	6.37:g.43487215T>A			O75395|Q5JTE3	RNA	SNP	-	NULL	ENST00000372389.3	37	NULL	CCDS4901.1	6																																																																																			RP3-337H4.9	-	-	ENSG00000271754		0.463	POLR1C-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000271754	Clone_based_vega_gene	protein_coding	OTTHUMT00000040652.3	-	0.00	92	0	T	NM_004875		43487215	-1	tier1	-	no_errors	ENST00000607571	ensembl	human	known	74_37	rna	26.79	41	15	SNP	0.001	A
EPC2	26122	genome.wustl.edu	37	2	149528623	149528623	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:149528623G>T	ENST00000258484.6	+	10	1421	c.1387G>T	c.(1387-1389)Gac>Tac	p.D463Y		NM_015630.3	NP_056445.3	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2 (Drosophila)	463					chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0516)		GGTCATAATGGACCGAATATC	0.378																																																	0													51.0	47.0	49.0					2																	149528623		1844	4098	5942	SO:0001583	missense	0			AF286904	CCDS46422.1	2q23	2008-02-05			ENSG00000135999	ENSG00000135999			24543	protein-coding gene	gene with protein product		611000					Standard	NM_015630		Approved	DKFZP566F2124	uc010zbt.2	Q52LR7	OTTHUMG00000153739	ENST00000258484.6:c.1387G>T	2.37:g.149528623G>T	ENSP00000258484:p.Asp463Tyr		B3KWT7|D3DP89|Q7L9J1|Q96RR7|Q9NUT8|Q9NVR1|Q9UFM9	Missense_Mutation	SNP	pfam_Enhancer_polycomb_C,pfam_Enhancer_polycomb-like_N	p.D463Y	ENST00000258484.6	37	c.1387	CCDS46422.1	2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354071	0.82243	.	.	ENSG00000135999	ENST00000258484	T	0.25579	1.79	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.54647	0.1871	M	0.76574	2.34	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.55692	-0.8101	10	0.87932	D	0	-4.0559	20.0303	0.97534	0.0:0.0:1.0:0.0	.	463	Q52LR7	EPC2_HUMAN	Y	463	ENSP00000258484:D463Y	ENSP00000258484:D463Y	D	+	1	0	EPC2	149245093	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.504000	0.90512	2.794000	0.96219	0.650000	0.86243	GAC	EPC2	-	NULL	ENSG00000135999		0.378	EPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPC2	HGNC	protein_coding	OTTHUMT00000332278.1		0.00	45	0	G	NM_015630		149528623	+1			no_errors	ENST00000258484	ensembl	human	known	74_37	missense	8.57	32	3	SNP	1.000	T
EPHA7	2045	genome.wustl.edu	37	6	93982021	93982021	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr6:93982021C>T	ENST00000369303.4	-	6	1628	c.1444G>A	c.(1444-1446)Gag>Aag	p.E482K		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	482	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		CTTACTTTCTCGTAATACTTG	0.418																																																	0													303.0	271.0	282.0					6																	93982021		2203	4300	6503	SO:0001583	missense	0			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.1444G>A	6.37:g.93982021C>T	ENSP00000358309:p.Glu482Lys		A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.E482K	ENST00000369303.4	37	c.1444	CCDS5031.1	6	.	.	.	.	.	.	.	.	.	.	C	23.2	4.391446	0.83011	.	.	ENSG00000135333	ENST00000369303	T	0.57595	0.39	5.49	5.49	0.81192	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.69214	0.3086	M	0.77406	2.37	0.80722	D	1	D;D;D	0.76494	0.995;0.999;0.999	D;D;D	0.70935	0.956;0.95;0.971	T	0.68002	-0.5524	10	0.45353	T	0.12	.	19.7279	0.96172	0.0:1.0:0.0:0.0	.	482;482;482	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	K	482	ENSP00000358309:E482K	ENSP00000358309:E482K	E	-	1	0	EPHA7	94038742	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	5.677000	0.68142	2.750000	0.94351	0.561000	0.74099	GAG	EPHA7	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000135333		0.418	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA7	HGNC	protein_coding	OTTHUMT00000041545.1	-	0.00	43	0	C			93982021	-1	tier1	-	no_errors	ENST00000369303	ensembl	human	known	74_37	missense	13.64	38	6	SNP	1.000	T
EVC2	132884	genome.wustl.edu	37	4	5617215	5617215	+	Silent	SNP	C	C	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr4:5617215C>A	ENST00000344408.5	-	16	2816	c.2763G>T	c.(2761-2763)ctG>ctT	p.L921L	EVC2_ENST00000310917.2_Silent_p.L841L|EVC2_ENST00000344938.1_Silent_p.L921L	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	921					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						TGCACTTCTTCAGAAGCTCTC	0.502																																																	0													219.0	197.0	204.0					4																	5617215		2203	4300	6503	SO:0001819	synonymous_variant	0			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.2763G>T	4.37:g.5617215C>A			Q86YT3|Q86YT4|Q8NG49	Silent	SNP	pfam_Limbin	p.L921	ENST00000344408.5	37	c.2763	CCDS3382.2	4																																																																																			EVC2	-	NULL	ENSG00000173040		0.502	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	HGNC	protein_coding	OTTHUMT00000289822.2	-	0.00	66	0	C	NM_147127		5617215	-1	tier1	-	no_errors	ENST00000344408	ensembl	human	known	74_37	silent	11.76	45	6	SNP	0.965	A
EYS	346007	genome.wustl.edu	37	6	65300261	65300261	+	Silent	SNP	A	A	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr6:65300261A>G	ENST00000370621.3	-	26	6025	c.5499T>C	c.(5497-5499)acT>acC	p.T1833T	EYS_ENST00000503581.1_Silent_p.T1833T|EYS_ENST00000370616.2_Silent_p.T1833T			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1833					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ATTCTGAAGAAGTCTTGACCT	0.418																																																	0													122.0	110.0	114.0					6																	65300261		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.5499T>C	6.37:g.65300261A>G			A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.T1833	ENST00000370621.3	37	c.5499		6																																																																																			EYS	-	NULL	ENSG00000188107		0.418	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	-	0.00	25	0	A	XM_294050		65300261	-1	tier1	-	no_errors	ENST00000370616	ensembl	human	known	74_37	silent	24.24	25	8	SNP	0.000	G
FAHD2A	51011	genome.wustl.edu	37	2	96078479	96078479	+	Silent	SNP	C	C	T	rs572805523		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:96078479C>T	ENST00000233379.4	+	7	1002	c.849C>T	c.(847-849)gtC>gtT	p.V283V	FAHD2A_ENST00000447036.1_Silent_p.V283V	NM_016044.2	NP_057128.2	Q96GK7	FAH2A_HUMAN	fumarylacetoacetate hydrolase domain containing 2A	283							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(3)|ovary(1)	8						CCCCAGGTGTCGGTGTATTCA	0.552													c|||	1	0.000199681	0.0	0.0	5008	,	,		21025	0.001		0.0	False		,,,				2504	0.0																0													38.0	39.0	39.0					2																	96078479		2203	4297	6500	SO:0001819	synonymous_variant	0			AF151863	CCDS2014.1	2q11.2	2008-02-05			ENSG00000115042	ENSG00000115042			24252	protein-coding gene	gene with protein product							Standard	NM_016044		Approved	CGI-105	uc002sur.3	Q96GK7	OTTHUMG00000130397	ENST00000233379.4:c.849C>T	2.37:g.96078479C>T			Q9Y3B0	Silent	SNP	pfam_Fumarylacetoacetase_C,superfamily_Fumarylacetoacetase_C-rel	p.V283	ENST00000233379.4	37	c.849	CCDS2014.1	2																																																																																			FAHD2A	-	pfam_Fumarylacetoacetase_C,superfamily_Fumarylacetoacetase_C-rel	ENSG00000115042		0.552	FAHD2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAHD2A	HGNC	protein_coding	OTTHUMT00000252778.1	-	0.00	53	0	C	NM_016044		96078479	+1	tier1	-	no_errors	ENST00000233379	ensembl	human	known	74_37	silent	34.69	32	17	SNP	0.978	T
FAM13C	220965	genome.wustl.edu	37	10	61014112	61014112	+	Missense_Mutation	SNP	G	G	T	rs148740536		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr10:61014112G>T	ENST00000373868.2	-	11	1415	c.1328C>A	c.(1327-1329)aCa>aAa	p.T443K	FAM13C_ENST00000277705.6_Missense_Mutation_p.T464K|FAM13C_ENST00000468840.2_Missense_Mutation_p.T360K|FAM13C_ENST00000373867.3_Missense_Mutation_p.T360K|FAM13C_ENST00000442566.3_Missense_Mutation_p.T464K|FAM13C_ENST00000435852.2_Missense_Mutation_p.T443K|FAM13C_ENST00000419214.2_Missense_Mutation_p.T345K|FAM13C_ENST00000422313.2_Missense_Mutation_p.T443K	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	443										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						ACTTACAATTGTTGGAATAAG	0.378																																																	0													265.0	255.0	259.0					10																	61014112		2203	4300	6503	SO:0001583	missense	0			U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.1328C>A	10.37:g.61014112G>T	ENSP00000362975:p.Thr443Lys		B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	NULL	p.T443K	ENST00000373868.2	37	c.1328	CCDS7255.1	10	.	.	.	.	.	.	.	.	.	.	G	2.857	-0.236919	0.05944	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000419214;ENST00000468840;ENST00000435852;ENST00000422313	T;T;T;T;T;T	0.51574	0.82;0.79;0.76;0.84;0.78;0.7	5.51	4.6	0.57074	.	0.076160	0.56097	D	0.000038	T	0.67970	0.2950	M	0.70275	2.135	0.44702	D	0.997699	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.989;0.996;0.999	T	0.72465	-0.4285	10	0.72032	D	0.01	-12.0088	15.6938	0.77477	0.0:0.0:0.8619:0.1381	.	443;360;443;345;443	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31-3;Q8NE31	.;.;.;.;FA13C_HUMAN	K	360;443;464;464;345;360;443;443	ENSP00000362975:T443K;ENSP00000395661:T464K;ENSP00000277705:T464K;ENSP00000391993:T345K;ENSP00000392302:T443K;ENSP00000400241:T443K	ENSP00000277705:T464K	T	-	2	0	FAM13C	60684118	1.000000	0.71417	1.000000	0.80357	0.090000	0.18270	4.939000	0.63526	1.304000	0.44892	-0.324000	0.08512	ACA	FAM13C	-	NULL	ENSG00000148541		0.378	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM13C	HGNC	protein_coding	OTTHUMT00000048162.2		0.00	93	0	G			61014112	-1			no_errors	ENST00000373868	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	T
FAM179A	165186	genome.wustl.edu	37	2	29240131	29240131	+	Missense_Mutation	SNP	T	T	C	rs386644311|rs201148338	byFrequency	TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:29240131T>C	ENST00000379558.4	+	9	1507	c.1156T>C	c.(1156-1158)Tcc>Ccc	p.S386P	FAM179A_ENST00000403861.2_Missense_Mutation_p.S386P|FAM179A_ENST00000465300.1_Intron	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	386										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GGAGCTCACTTCCCAGTGCCT	0.597													C|||	47	0.00938498	0.0348	0.0014	5008	,	,		13919	0.0		0.0	False		,,,				2504	0.0																0													52.0	56.0	55.0					2																	29240131		1955	4148	6103	SO:0001583	missense	0			AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.1156T>C	2.37:g.29240131T>C	ENSP00000368876:p.Ser386Pro		Q6ZUF5	Missense_Mutation	SNP	pfam_CLASP_N_dom,superfamily_ARM-type_fold	p.S386P	ENST00000379558.4	37	c.1156	CCDS1769.2	2	.	.	.	.	.	.	.	.	.	.	C	9.595	1.127105	0.20959	.	.	ENSG00000189350	ENST00000379558;ENST00000403861	T;T	0.10763	3.01;2.84	4.84	-2.12	0.07165	.	.	.	.	.	T	0.05273	0.0140	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.0	T	0.40590	-0.9555	9	0.28530	T	0.3	.	2.6591	0.05021	0.1068:0.2149:0.118:0.5603	.	386;386	F8W8E4;Q6ZUX3	.;F179A_HUMAN	P	386	ENSP00000368876:S386P;ENSP00000384699:S386P	ENSP00000368876:S386P	S	+	1	0	FAM179A	29093635	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.876000	0.04201	-0.897000	0.03910	-0.119000	0.15052	TCC	FAM179A	-	NULL	ENSG00000189350		0.597	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM179A	HGNC	protein_coding	OTTHUMT00000317848.4	-	0.00	43	0	T	NM_199280		29240131	+1	tier1	rs201148338	no_errors	ENST00000379558	ensembl	human	known	74_37	missense	26.67	22	8	SNP	0.001	C
FAM189A2	9413	genome.wustl.edu	37	9	72006645	72006645	+	Silent	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr9:72006645C>T	ENST00000257515.8	+	11	1698	c.1278C>T	c.(1276-1278)gcC>gcT	p.A426A	FAM189A2_ENST00000455972.1_Silent_p.A426A|FAM189A2_ENST00000303068.7_Silent_p.A261A|FAM189A2_ENST00000377216.3_Silent_p.A213A	NM_004816.3	NP_004807.3	Q15884	F1892_HUMAN	family with sequence similarity 189, member A2	426						integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(5)|liver(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12						GGCCCCGAGCCGAGAGGAGGC	0.677																																																	0													21.0	25.0	23.0					9																	72006645		2199	4297	6496	SO:0001819	synonymous_variant	0			L27479	CCDS6629.1	9q21.11	2009-07-09	2009-07-09	2009-07-09	ENSG00000135063	ENSG00000135063			24820	protein-coding gene	gene with protein product		607710	"""chromosome 9 open reading frame 61"""	C9orf61		7951235	Standard	NM_004816		Approved	X123	uc010mon.1	Q15884	OTTHUMG00000019979	ENST00000257515.8:c.1278C>T	9.37:g.72006645C>T			Q14CN5|Q5T6C8|Q5T6C9|Q6ZTX4|Q96N10	Silent	SNP	pfam_CD20-like	p.A426	ENST00000257515.8	37	c.1278	CCDS6629.1	9																																																																																			FAM189A2	-	NULL	ENSG00000135063		0.677	FAM189A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM189A2	HGNC	protein_coding	OTTHUMT00000052576.2	-	0.00	57	0	C	NM_004816		72006645	+1	tier1	-	no_errors	ENST00000257515	ensembl	human	known	74_37	silent	55.00	27	33	SNP	0.000	T
FAM20C	56975	genome.wustl.edu	37	7	299871	299871	+	Silent	SNP	C	C	T	rs371584776		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr7:299871C>T	ENST00000313766.5	+	10	1911	c.1680C>T	c.(1678-1680)tgC>tgT	p.C560C		NM_020223.3	NP_064608.2	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C	560	Kinase domain.				dentinogenesis (GO:0097187)|enamel mineralization (GO:0070166)|odontoblast differentiation (GO:0071895)|osteoclast maturation (GO:0036179)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of phosphorus metabolic process (GO:0051174)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|urinary_tract(1)	4		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		TCCGGGACTGCGTGGAGAGGA	0.711																																																	0								C		3,1381		0,3,689	16.0	23.0	21.0		1680	2.1	0.5	7		21	0,3182		0,0,1591	no	coding-synonymous	FAM20C	NM_020223.2		0,3,2280	TT,TC,CC		0.0,0.2168,0.0657		560/585	299871	3,4563	692	1591	2283	SO:0001819	synonymous_variant	0			BC040074	CCDS47522.1	7p22.3	2012-11-29			ENSG00000177706	ENSG00000177706			22140	protein-coding gene	gene with protein product	"""dentin matrix protein 4"""	611061				17369251, 17924334	Standard	NM_020223		Approved	IMAGE:4942737, DKFZp547D065, DMP4	uc003sip.3	Q8IXL6	OTTHUMG00000151401	ENST00000313766.5:c.1680C>T	7.37:g.299871C>T			A4D2Q5|L8B5W8|Q5I0W9|Q7Z4I0|Q9NPT2	Silent	SNP	pfam_DUF1193	p.C560	ENST00000313766.5	37	c.1680	CCDS47522.1	7																																																																																			FAM20C	-	pfam_DUF1193	ENSG00000177706		0.711	FAM20C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM20C	HGNC	protein_coding	OTTHUMT00000322476.2	-	0.00	69	0	C	NM_020223		299871	+1	tier1	-	no_errors	ENST00000313766	ensembl	human	known	74_37	silent	36.90	53	31	SNP	0.999	T
FASN	2194	genome.wustl.edu	37	17	80046282	80046282	+	Silent	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:80046282G>A	ENST00000306749.2	-	16	2795	c.2577C>T	c.(2575-2577)gcC>gcT	p.A859A		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	859					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	TGTAGATGGCGGCTGAGGGGG	0.677																																					Colon(59;314 1043 11189 28578 32273)												0													27.0	36.0	33.0					17																	80046282		2198	4288	6486	SO:0001819	synonymous_variant	0			U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.2577C>T	17.37:g.80046282G>A			Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	pfam_Acyl_transferase,pfam_Ketoacyl_synth_N,pfam_Thioesterase,pfam_PKS_KR,pfam_DH_sc/Rdtase_SDR,pfam_Ketoacyl_synth_C,pfam_ADH_C,pfam_Acyl_carrier_prot-like,pfam_Methyltransf_12,pfam_Methyltransf_11,superfamily_Thiolase-like,superfamily_Acyl_Trfase/lysoPLipase,superfamily_GroES-like,superfamily_Acyl_carrier_prot-like,superfamily_Malonyl_transacylase_ACP-bd,smart_PKS_Beta-ketoAc_synthase_dom,smart_PKS_acyl_transferase,smart_PKS_dehydratase,smart_PKS_ER,smart_PKS/FAS_KR,smart_PKS_PP-bd,pfscan_Acyl_carrier_prot-like	p.A859	ENST00000306749.2	37	c.2577	CCDS11801.1	17																																																																																			FASN	-	smart_PKS_dehydratase	ENSG00000169710		0.677	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASN	HGNC	protein_coding	OTTHUMT00000442369.1	-	0.00	70	0	G	NM_004104		80046282	-1	tier1	-	no_errors	ENST00000306749	ensembl	human	known	74_37	silent	57.14	15	20	SNP	0.973	A
FBLIM1	54751	genome.wustl.edu	37	1	16101256	16101256	+	Silent	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:16101256C>T	ENST00000375766.3	+	7	1495	c.855C>T	c.(853-855)agC>agT	p.S285S	FBLIM1_ENST00000400773.1_Silent_p.S188S|FBLIM1_ENST00000441801.2_Silent_p.S285S|FBLIM1_ENST00000375771.1_Silent_p.S285S|FBLIM1_ENST00000332305.5_Silent_p.S188S	NM_017556.2	NP_060026.2	Q8WUP2	FBLI1_HUMAN	filamin binding LIM protein 1	285	FERMT2-binding.|LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell junction assembly (GO:0034329)|regulation of cell shape (GO:0008360)|regulation of integrin activation (GO:0033623)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|stress fiber (GO:0001725)	filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	16		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|READ - Rectum adenocarcinoma(331;0.0649)|STAD - Stomach adenocarcinoma(313;0.138)		CCCTGGGCAGCCAGAACGAGG	0.627																																																	0													125.0	117.0	120.0					1																	16101256		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS163.1, CCDS30609.1, CCDS44064.1	1p36.13	2014-04-07			ENSG00000162458	ENSG00000162458			24686	protein-coding gene	gene with protein product		607747				12679033, 12496242	Standard	XM_005245900		Approved	FBLP-1, CAL, migfilin	uc001axe.1	Q8WUP2	OTTHUMG00000003079	ENST00000375766.3:c.855C>T	1.37:g.16101256C>T			B3KNY0|Q5VVE0|Q5VVE1|Q8IX23|Q96T00|Q9UFD6	Silent	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.S285	ENST00000375766.3	37	c.855	CCDS163.1	1																																																																																			FBLIM1	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000162458		0.627	FBLIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FBLIM1	HGNC	protein_coding	OTTHUMT00000008511.3	-	0.00	83	0	C	NM_001024215		16101256	+1	tier1	-	no_errors	ENST00000441801	ensembl	human	known	74_37	silent	8.16	45	4	SNP	0.876	T
FGF14	2259	genome.wustl.edu	37	13	102375254	102375254	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr13:102375254G>A	ENST00000376143.4	-	5	670	c.671C>T	c.(670-672)aCg>aTg	p.T224M	ITGBL1_ENST00000415285.1_3'UTR|FGF14_ENST00000376131.4_Missense_Mutation_p.T229M	NM_004115.3	NP_004106.1	Q92915	FGF14_HUMAN	fibroblast growth factor 14	224					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cell-cell signaling (GO:0007267)|JNK cascade (GO:0007254)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)	p.T224M(1)|p.T229M(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)	29	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTTACTTGGCGTCACCCCAGG	0.473																																																	2	Substitution - Missense(2)	large_intestine(2)											267.0	201.0	224.0					13																	102375254		2203	4300	6503	SO:0001583	missense	0				CCDS9500.1, CCDS9501.1	13q34	2008-02-05			ENSG00000102466	ENSG00000102466			3671	protein-coding gene	gene with protein product		601515				8790420, 17236779	Standard	NM_175929		Approved	FHF4, SCA27	uc001vpf.2	Q92915	OTTHUMG00000017303	ENST00000376143.4:c.671C>T	13.37:g.102375254G>A	ENSP00000365313:p.Thr224Met		Q86YN7|Q96QX6	Missense_Mutation	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	p.T229M	ENST00000376143.4	37	c.686	CCDS9501.1	13	.	.	.	.	.	.	.	.	.	.	G	19.97	3.925108	0.73213	.	.	ENSG00000102466	ENST00000376131;ENST00000376143	T;T	0.79454	-1.27;-1.19	5.65	5.65	0.86999	.	0.181513	0.52532	D	0.000065	T	0.82268	0.5000	L	0.32530	0.975	0.54753	D	0.999989	D;D	0.76494	0.999;0.982	P;P	0.61397	0.888;0.684	D	0.83575	0.0114	10	0.66056	D	0.02	.	19.7432	0.96238	0.0:0.0:1.0:0.0	.	229;224	Q92915-2;Q92915	.;FGF14_HUMAN	M	229;224	ENSP00000365301:T229M;ENSP00000365313:T224M	ENSP00000365301:T229M	T	-	2	0	FGF14	101173255	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.663000	0.90544	0.563000	0.77884	ACG	FGF14	-	NULL	ENSG00000102466		0.473	FGF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF14	HGNC	protein_coding	OTTHUMT00000045679.2	-	0.00	141	0	G			102375254	-1	tier1	-	no_errors	ENST00000376131	ensembl	human	known	74_37	missense	12.31	114	16	SNP	1.000	A
FOLH1	2346	genome.wustl.edu	37	11	49214356	49214356	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr11:49214356C>T	ENST00000256999.2	-	4	762	c.502G>A	c.(502-504)Gga>Aga	p.G168R	FOLH1_ENST00000340334.7_Missense_Mutation_p.G153R|FOLH1_ENST00000533034.1_Missense_Mutation_p.G153R|FOLH1_ENST00000356696.3_Missense_Mutation_p.G168R|FOLH1_ENST00000343844.4_5'UTR	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	168					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TCTGGCATTCCTTGAGGAGAG	0.378																																																	0													86.0	91.0	90.0					11																	49214356		2201	4297	6498	SO:0001583	missense	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.502G>A	11.37:g.49214356C>T	ENSP00000256999:p.Gly168Arg		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.G168R	ENST00000256999.2	37	c.502	CCDS7946.1	11	.	.	.	.	.	.	.	.	.	.	C	21.2	4.106961	0.77096	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	3.45	3.45	0.39498	Protease-associated domain, PA (1);	0.000000	0.48767	D	0.000179	T	0.81688	0.4875	H	0.98407	4.225	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.995;0.993;0.999	D	0.87941	0.2717	10	0.87932	D	0	.	12.5174	0.56040	0.0:1.0:0.0:0.0	.	153;153;153;168;168	Q04609-9;Q04609-7;A4UU13;Q04609-8;Q04609	.;.;.;.;FOLH1_HUMAN	R	168;168;153;153;168	ENSP00000256999:G168R;ENSP00000349129:G168R;ENSP00000344131:G153R;ENSP00000431463:G153R	ENSP00000256999:G168R	G	-	1	0	FOLH1	49170932	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.696000	0.74598	1.781000	0.52344	0.400000	0.26472	GGA	FOLH1	-	pfam_Protease-assoc_domain	ENSG00000086205		0.378	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	-	0.00	96	0	C	NM_004476		49214356	-1	tier1	-	no_errors	ENST00000256999	ensembl	human	known	74_37	missense	17.86	46	10	SNP	1.000	T
FST	10468	genome.wustl.edu	37	5	52779522	52779522	+	Silent	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr5:52779522C>T	ENST00000256759.3	+	3	849	c.466C>T	c.(466-468)Ctg>Ttg	p.L156L	FST_ENST00000396947.3_Silent_p.L156L	NM_013409.2	NP_037541.1	P19883	FST_HUMAN	follistatin	156	Kazal-like 1. {ECO:0000255|PROSITE- ProRule:PRU00798}.				BMP signaling pathway (GO:0030509)|female gonad development (GO:0008585)|gamete generation (GO:0007276)|hair follicle morphogenesis (GO:0031069)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinocyte proliferation (GO:0043616)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|pattern specification process (GO:0007389)|positive regulation of hair follicle development (GO:0051798)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	activin binding (GO:0048185)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|urinary_tract(1)	15		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				GCAGCCAGAACTGGAAGTCCA	0.507																																																	0													61.0	57.0	58.0					5																	52779522		2203	4300	6503	SO:0001819	synonymous_variant	0			M19481	CCDS3959.1, CCDS43315.1	5q11.2	2008-02-05			ENSG00000134363	ENSG00000134363			3971	protein-coding gene	gene with protein product		136470				10411917, 3380788	Standard	NM_006350		Approved	FS	uc003jpd.3	P19883	OTTHUMG00000131183	ENST00000256759.3:c.466C>T	5.37:g.52779522C>T			B5BU94|Q9BTH0	Silent	SNP	pfam_Kazal_dom,pfam_Follistatin/Osteonectin_EGF,superfamily_TB_dom,smart_Fol_N,smart_Kazal_dom	p.L156	ENST00000256759.3	37	c.466	CCDS3959.1	5																																																																																			FST	-	pfam_Kazal_dom,smart_Kazal_dom	ENSG00000134363		0.507	FST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FST	HGNC	protein_coding	OTTHUMT00000253906.1	-	0.00	36	0	C	NM_013409		52779522	+1	tier1	-	no_errors	ENST00000256759	ensembl	human	known	74_37	silent	20.00	16	4	SNP	1.000	T
GAD2	2572	genome.wustl.edu	37	10	26581439	26581439	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr10:26581439G>A	ENST00000376261.3	+	14	1935	c.1432G>A	c.(1432-1434)Gca>Aca	p.A478T	GAD2_ENST00000259271.3_Missense_Mutation_p.A478T	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	478					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TTTGGAGTTGGCAGAGTATTT	0.413																																																	0													134.0	126.0	129.0					10																	26581439		2203	4300	6503	SO:0001583	missense	0			AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.1432G>A	10.37:g.26581439G>A	ENSP00000365437:p.Ala478Thr		Q9UD87	Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase	p.A478T	ENST00000376261.3	37	c.1432	CCDS7149.1	10	.	.	.	.	.	.	.	.	.	.	G	18.41	3.618682	0.66787	.	.	ENSG00000136750	ENST00000376261;ENST00000259271	T;T	0.52983	0.64;0.64	5.59	5.59	0.84812	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.055044	0.85682	D	0.000000	T	0.48333	0.1494	L	0.53671	1.685	0.80722	D	1	B	0.27013	0.166	B	0.34242	0.178	T	0.41034	-0.9531	10	0.40728	T	0.16	-16.6767	14.7678	0.69654	0.0:0.0:0.8556:0.1444	.	478	Q05329	DCE2_HUMAN	T	478	ENSP00000365437:A478T;ENSP00000259271:A478T	ENSP00000259271:A478T	A	+	1	0	GAD2	26621445	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.822000	0.75277	2.793000	0.96121	0.655000	0.94253	GCA	GAD2	-	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase	ENSG00000136750		0.413	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	GAD2	HGNC	protein_coding	OTTHUMT00000047255.1	-	0.00	59	0	G	NM_000818		26581439	+1	tier1	-	no_errors	ENST00000259271	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	A
GFRA2	2675	genome.wustl.edu	37	8	21608305	21608305	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr8:21608305G>A	ENST00000524240.1	-	4	1239	c.589C>T	c.(589-591)Cgc>Tgc	p.R197C	GFRA2_ENST00000517328.1_Missense_Mutation_p.R197C|GFRA2_ENST00000518077.1_Missense_Mutation_p.R64C|GFRA2_ENST00000400782.4_Missense_Mutation_p.R92C	NM_001495.4	NP_001486.4	O00451	GFRA2_HUMAN	GDNF family receptor alpha 2	197					negative regulation of protein autophosphorylation (GO:0031953)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	anchored component of membrane (GO:0031225)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|prostate(1)|skin(1)	7				Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		CACTTGCGGCGGTTGCAGCGC	0.627																																																	0													54.0	65.0	61.0					8																	21608305		2196	4296	6492	SO:0001583	missense	0			AF002700	CCDS47816.1, CCDS55207.1	8p21.3	2008-05-02			ENSG00000168546	ENSG00000168546			4244	protein-coding gene	gene with protein product		601956				9177201	Standard	NM_001165038		Approved	RETL2, GDNFRB, NTNRA, TRNR2	uc003wzu.1	O00451	OTTHUMG00000163897	ENST00000524240.1:c.589C>T	8.37:g.21608305G>A	ENSP00000428518:p.Arg197Cys		E9PD47|O15316|O15328|Q58J92|Q6GTR9|Q7Z5C2	Missense_Mutation	SNP	pfam_GDNF/GAS1,smart_GDNF/GAS1,pirsf_Glial_neurotroph_fac_rcpt_a1/2,prints_GDNF_rcpt,prints_GDNF_rcpt_a2	p.R197C	ENST00000524240.1	37	c.589	CCDS47816.1	8	.	.	.	.	.	.	.	.	.	.	G	19.44	3.827723	0.71143	.	.	ENSG00000168546	ENST00000524240;ENST00000400782;ENST00000517328;ENST00000518077;ENST00000517892;ENST00000522071;ENST00000520826	T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18;-0.18	4.78	4.78	0.61160	GDNF/GAS1 (2);	0.052680	0.85682	D	0.000000	T	0.78966	0.4367	M	0.80616	2.505	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.984;0.975;0.99	T	0.82252	-0.0549	10	0.87932	D	0	-20.1027	13.5679	0.61830	0.0:0.0:0.8438:0.1562	.	64;92;197	O00451-2;E9PD47;O00451	.;.;GFRA2_HUMAN	C	197;92;197;64;92;197;189	ENSP00000428518:R197C;ENSP00000383592:R92C;ENSP00000429445:R197C;ENSP00000429206:R64C;ENSP00000429979:R92C;ENSP00000428721:R197C	ENSP00000383592:R92C	R	-	1	0	GFRA2	21652585	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.709000	0.54853	2.199000	0.70637	0.313000	0.20887	CGC	GFRA2	-	pfam_GDNF/GAS1,smart_GDNF/GAS1,pirsf_Glial_neurotroph_fac_rcpt_a1/2,prints_GDNF_rcpt	ENSG00000168546		0.627	GFRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFRA2	HGNC	protein_coding	OTTHUMT00000376254.3	-	0.00	27	0	G	NM_001495		21608305	-1	tier1	-	no_errors	ENST00000517328	ensembl	human	known	74_37	missense	14.29	30	5	SNP	1.000	A
GIGYF1	64599	genome.wustl.edu	37	7	100282217	100282217	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr7:100282217C>T	ENST00000275732.5	-	13	2694	c.1485G>A	c.(1483-1485)atG>atA	p.M495I	GIGYF1_ENST00000471340.2_5'Flank	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	495	GYF. {ECO:0000255|PROSITE- ProRule:PRU00101}.				insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					ACCACTCTGCCATCTCCTGTG	0.622																																																	0													77.0	88.0	85.0					7																	100282217		2203	4300	6503	SO:0001583	missense	0			AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.1485G>A	7.37:g.100282217C>T	ENSP00000275732:p.Met495Ile		Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.M495I	ENST00000275732.5	37	c.1485	CCDS34708.1	7	.	.	.	.	.	.	.	.	.	.	.	22.9	4.351180	0.82132	.	.	ENSG00000146830	ENST00000539430;ENST00000275732	D	0.91521	-2.86	5.07	5.07	0.68467	GYF (4);	0.000000	0.85682	D	0.000000	D	0.94761	0.8309	M	0.77616	2.38	0.80722	D	1	D	0.62365	0.991	D	0.67548	0.952	D	0.94753	0.7929	10	0.56958	D	0.05	-19.5101	15.9811	0.80111	0.0:1.0:0.0:0.0	.	495	O75420	PERQ1_HUMAN	I	214;495	ENSP00000275732:M495I	ENSP00000275732:M495I	M	-	3	0	GIGYF1	100120153	1.000000	0.71417	1.000000	0.80357	0.494000	0.33585	7.651000	0.83577	2.641000	0.89580	0.491000	0.48974	ATG	GIGYF1	-	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	ENSG00000146830		0.622	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIGYF1	HGNC	protein_coding	OTTHUMT00000347205.2	-	0.00	28	0	C	NM_022574		100282217	-1	tier1	-	no_errors	ENST00000275732	ensembl	human	known	74_37	missense	16.67	20	4	SNP	1.000	T
GJB6	10804	genome.wustl.edu	37	13	20796939	20796939	+	Silent	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr13:20796939C>T	ENST00000356192.6	-	5	1301	c.681G>A	c.(679-681)acG>acA	p.T227T	GJB6_ENST00000400066.3_Silent_p.T227T|GJB6_ENST00000241124.6_Silent_p.T227T|GJB6_ENST00000400065.3_Silent_p.T227T	NM_001110219.2	NP_001103689.1	O95452	CXB6_HUMAN	gap junction protein, beta 6, 30kDa	227					apoptotic process (GO:0006915)|cell communication (GO:0007154)|ear morphogenesis (GO:0042471)|inner ear development (GO:0048839)|negative regulation of cell proliferation (GO:0008285)|sensory perception of sound (GO:0007605)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)				biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)	9		all_cancers(29;2.04e-22)|all_epithelial(30;1.19e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;2.17e-05)|Epithelial(112;0.00075)|OV - Ovarian serous cystadenocarcinoma(117;0.00978)|Lung(94;0.0238)|GBM - Glioblastoma multiforme(144;0.0323)|LUSC - Lung squamous cell carcinoma(192;0.0744)		GATTTTTTTGCGTCTGTGCTC	0.423																																																	0													225.0	194.0	205.0					13																	20796939		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ005585	CCDS9291.1	13q12	2010-01-06	2007-11-06		ENSG00000121742	ENSG00000121742		"""Ion channels / Gap junction proteins (connexins)"""	4288	protein-coding gene	gene with protein product	"""connexin 30"""	604418	"""ectodermal dysplasia 2, hidrotic (Clouston syndrome)"", ""gap junction protein, beta 6 (connexin 30)"", ""gap junction protein, beta 6"""	DFNA3, ED2		10471490, 8845850	Standard	NM_006783		Approved	EDH, HED, CX30	uc001und.4	O95452	OTTHUMG00000016515	ENST00000356192.6:c.681G>A	13.37:g.20796939C>T			B3KQN2|Q5Q1H9|Q5Q1I0|Q5Q1I1|Q5T5U0|Q8IUP0	Silent	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.T227	ENST00000356192.6	37	c.681	CCDS9291.1	13																																																																																			GJB6	-	NULL	ENSG00000121742		0.423	GJB6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GJB6	HGNC	protein_coding	OTTHUMT00000272906.1		0.00	35	0	C			20796939	-1			no_errors	ENST00000241124	ensembl	human	known	74_37	silent	8.11	34	3	SNP	0.000	T
GK	2710	genome.wustl.edu	37	X	30739005	30739005	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:30739005C>T	ENST00000378943.3	+	17	1555	c.1376C>T	c.(1375-1377)gCg>gTg	p.A459V	RP11-242C19.2_ENST00000497961.1_RNA|GK_ENST00000378946.3_Missense_Mutation_p.A465V|GK_ENST00000378945.3_Missense_Mutation_p.A459V|GK_ENST00000427190.1_Missense_Mutation_p.A260V|GK-AS1_ENST00000464659.1_RNA	NM_001128127.2	NP_001121599.1	P32189	GLPK_HUMAN	glycerol kinase	465					cellular lipid metabolic process (GO:0044255)|glucose homeostasis (GO:0042593)|glycerol catabolic process (GO:0019563)|glycerol metabolic process (GO:0006071)|glycerol-3-phosphate biosynthetic process (GO:0046167)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|glycerol kinase activity (GO:0004370)			central_nervous_system(1)|large_intestine(3)	4						GCACTGGGTGCGGCTATGGCG	0.517																																																	0													37.0	34.0	35.0					X																	30739005		2202	4300	6502	SO:0001583	missense	0			X78711	CCDS14225.1, CCDS35224.1, CCDS48090.1, CCDS75963.1	Xp21.3	2014-09-17			ENSG00000198814	ENSG00000198814	2.7.1.30	"""Glycerol kinases"""	4289	protein-coding gene	gene with protein product		300474				7987308	Standard	NM_203391		Approved	GK1, GKD	uc022buj.1	P32189	OTTHUMG00000021328	ENST00000378943.3:c.1376C>T	X.37:g.30739005C>T	ENSP00000368226:p.Ala459Val		A6NJP5|B2R833|Q6IQ27|Q8IVR5|Q9UMP0|Q9UMP1	Missense_Mutation	SNP	pfam_Carb_kinase_FGGY_N,pfam_Carb_kinase_FGGY_C,tigrfam_Glycerol_kin	p.A459V	ENST00000378943.3	37	c.1376	CCDS48090.1	X	.	.	.	.	.	.	.	.	.	.	C	17.51	3.408845	0.62399	.	.	ENSG00000198814	ENST00000378946;ENST00000378943;ENST00000534212;ENST00000378945;ENST00000427190;ENST00000451432;ENST00000378938	D;D;D;D;D	0.94687	-3.49;-3.49;-3.49;-3.49;-3.49	5.46	5.46	0.80206	Carbohydrate kinase, FGGY, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94424	0.8206	M	0.80746	2.51	0.80722	D	1	B;B;B;B;B	0.29571	0.249;0.249;0.21;0.21;0.249	B;B;B;B;B	0.26416	0.052;0.069;0.025;0.025;0.069	D	0.93381	0.6743	10	0.59425	D	0.04	.	18.5995	0.91242	0.0:1.0:0.0:0.0	.	302;465;459;459;465	E7EQC0;P32189;P32189-2;P32189-1;A6NJP5	.;GLPK_HUMAN;.;.;.	V	465;459;465;459;260;302;54	ENSP00000368229:A465V;ENSP00000368226:A459V;ENSP00000368228:A459V;ENSP00000401720:A260V;ENSP00000368221:A54V	ENSP00000368221:A54V	A	+	2	0	GK	30648926	1.000000	0.71417	0.708000	0.30435	0.604000	0.37047	6.030000	0.70903	2.423000	0.82170	0.596000	0.82720	GCG	GK	-	pfam_Carb_kinase_FGGY_C,tigrfam_Glycerol_kin	ENSG00000198814		0.517	GK-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GK	HGNC	protein_coding	OTTHUMT00000056170.1	-	0.00	49	0	C	NM_000167		30739005	+1	tier1	-	no_errors	ENST00000378943	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
GNG2	54331	genome.wustl.edu	37	14	52417396	52417396	+	De_novo_Start_InFrame	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr14:52417396G>A	ENST00000335281.4	+	0	406				GNG2_ENST00000556752.1_De_novo_Start_InFrame|GNG2_ENST00000554875.1_Silent_p.P29P|GNG2_ENST00000554736.1_De_novo_Start_InFrame|GNG2_ENST00000555472.1_De_novo_Start_InFrame|GNG2_ENST00000556766.1_De_novo_Start_InFrame|GNG2_ENST00000557376.1_Silent_p.P39P|GNG2_ENST00000553299.1_3'UTR|GNG2_ENST00000553432.1_Silent_p.P31P	NM_001243774.1	NP_001230703.1	P59768	GBG2_HUMAN	guanine nucleotide binding protein (G protein), gamma 2						adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|energy reserve metabolic process (GO:0006112)|platelet activation (GO:0030168)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|signal transducer activity (GO:0004871)			lung(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	5	all_epithelial(31;0.0659)|Breast(41;0.0684)				Halothane(DB01159)	CCAGCACTCCGATGGCCAGCA	0.448																																																	0													94.0	80.0	85.0					14																	52417396		2203	4300	6503			0			AK001024	CCDS32082.1	14q21	2008-07-28				ENSG00000186469			4404	protein-coding gene	gene with protein product		606981				10833460	Standard	NM_053064		Approved		uc001wzj.3	P59768			14.37:g.52417396G>A			Q5JPE2|Q6P9A9	Silent	SNP	pfam_G-protein_gamma-like_dom,superfamily_G-protein_gamma-like_dom,smart_G-protein_gamma-like_dom,pfscan_G-protein_gamma-like_dom,prints_Gprotein-gamma	p.P39	ENST00000335281.4	37	c.117	CCDS32082.1	14																																																																																			GNG2	-	superfamily_G-protein_gamma-like_dom	ENSG00000186469		0.448	GNG2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GNG2	HGNC	protein_coding	OTTHUMT00000411585.1	-	0.00	27	0	G			52417396	+1	tier1	-	no_errors	ENST00000557376	ensembl	human	putative	74_37	silent	26.32	14	5	SNP	0.897	A
GPC3	2719	genome.wustl.edu	37	X	132795821	132795821	+	Silent	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:132795821C>T	ENST00000370818.3	-	6	1795	c.1350G>A	c.(1348-1350)ctG>ctA	p.L450L	GPC3_ENST00000543339.1_Silent_p.L396L|GPC3_ENST00000394299.2_Silent_p.L473L	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	450					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)			breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					CCTTCATTTTCAGCTCATGGA	0.363			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																														yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	glypican 3		O	0													112.0	100.0	104.0					X																	132795821		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	SGBS	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.1350G>A	X.37:g.132795821C>T			C9JLE3|G3V1R0|Q2L880|Q2L882	Silent	SNP	pfam_Glypican	p.L473	ENST00000370818.3	37	c.1419	CCDS14638.1	X																																																																																			GPC3	-	pfam_Glypican	ENSG00000147257		0.363	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC3	HGNC	protein_coding	OTTHUMT00000058356.1	-	0.00	88	0	C	NM_004484		132795821	-1	tier1	-	no_errors	ENST00000394299	ensembl	human	known	74_37	silent	18.56	79	18	SNP	1.000	T
GPLD1	2822	genome.wustl.edu	37	6	24450083	24450083	+	Silent	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr6:24450083G>A	ENST00000230036.1	-	15	1490	c.1380C>T	c.(1378-1380)aaC>aaT	p.N460N		NM_001503.3	NP_001494.2	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific phospholipase D1	460					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to calcium ion (GO:0071277)|cellular response to cholesterol (GO:0071397)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|cellular response to pH (GO:0071467)|cellular response to triglyceride (GO:0071401)|chondrocyte differentiation (GO:0002062)|complement receptor mediated signaling pathway (GO:0002430)|GPI anchor release (GO:0006507)|hematopoietic stem cell migration (GO:0035701)|hematopoietic stem cell migration to bone marrow (GO:0097241)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cell proliferation (GO:0008285)|negative regulation of triglyceride catabolic process (GO:0010897)|ossification (GO:0001503)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of secretion (GO:0051047)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cellular response to insulin stimulus (GO:1900076)|response to glucose (GO:0009749)|transepithelial transport (GO:0070633)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|proteinaceous extracellular matrix (GO:0005578)	glycosylphosphatidylinositol phospholipase D activity (GO:0004621)|phospholipase D activity (GO:0004630)|sodium channel regulator activity (GO:0017080)			breast(3)|endometrium(5)|kidney(1)|large_intestine(11)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	32						CGCCGTCCACGTTAAAGTCCA	0.607																																																	0													114.0	106.0	108.0					6																	24450083		2203	4300	6503	SO:0001819	synonymous_variant	0			L11701	CCDS4553.1	6p22.1	2008-02-05			ENSG00000112293	ENSG00000112293			4459	protein-coding gene	gene with protein product		602515				11072085	Standard	NM_001503		Approved		uc003ned.2	P80108	OTTHUMG00000016104	ENST00000230036.1:c.1380C>T	6.37:g.24450083G>A			Q15127|Q15128|Q2M2F2|Q5T3Y0|Q7Z6T8|Q8TCV0|Q8WW82|Q96ID6|Q9H167|Q9H4M1|Q9UJC9	Silent	SNP	pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Gprt_PLipase_D	p.N460	ENST00000230036.1	37	c.1380	CCDS4553.1	6																																																																																			GPLD1	-	pfam_FG-GAP,smart_Int_alpha_beta-p	ENSG00000112293		0.607	GPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPLD1	HGNC	protein_coding	OTTHUMT00000043315.1	-	0.00	56	0	G	NM_001503		24450083	-1	tier1	-	no_errors	ENST00000230036	ensembl	human	known	74_37	silent	24.00	19	6	SNP	0.733	A
GPR101	83550	genome.wustl.edu	37	X	136112589	136112589	+	Silent	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:136112589G>A	ENST00000298110.1	-	1	1244	c.1245C>T	c.(1243-1245)taC>taT	p.Y415Y		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	415						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					CTAAAAAGCAGTAGGGCCCCA	0.522																																																	0													85.0	78.0	80.0					X																	136112589		2203	4300	6503	SO:0001819	synonymous_variant	0			AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.1245C>T	X.37:g.136112589G>A			Q5JSM8|Q8NG93	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.Y415	ENST00000298110.1	37	c.1245	CCDS14662.1	X																																																																																			GPR101	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000165370		0.522	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR101	HGNC	protein_coding	OTTHUMT00000058519.1	-	0.00	60	0	G			136112589	-1	tier1	-	no_errors	ENST00000298110	ensembl	human	known	74_37	silent	46.27	36	31	SNP	1.000	A
GPR149	344758	genome.wustl.edu	37	3	154146547	154146547	+	Silent	SNP	T	T	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr3:154146547T>C	ENST00000389740.2	-	1	957	c.858A>G	c.(856-858)gaA>gaG	p.E286E		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	286					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GCCTGCAGGCTTCAGCCCCAG	0.652																																																	0													43.0	46.0	45.0					3																	154146547		1917	4129	6046	SO:0001819	synonymous_variant	0			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.858A>G	3.37:g.154146547T>C				Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.E286	ENST00000389740.2	37	c.858	CCDS43162.1	3																																																																																			GPR149	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000174948		0.652	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR149	HGNC	protein_coding	OTTHUMT00000353430.1	-	0.00	25	0	T	XM_293580		154146547	-1	tier1	-	no_errors	ENST00000389740	ensembl	human	known	74_37	silent	31.58	13	6	SNP	0.001	C
GPR39	2863	genome.wustl.edu	37	2	133175428	133175428	+	Silent	SNP	C	C	T	rs558356688		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:133175428C>T	ENST00000329321.3	+	1	1282	c.813C>T	c.(811-813)agC>agT	p.S271S		NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	271					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AGTCCGAGAGCGAAGAGAGCA	0.617													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18524	0.0		0.0	False		,,,				2504	0.0																0													50.0	52.0	51.0					2																	133175428		2203	4300	6503	SO:0001819	synonymous_variant	0			AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.813C>T	2.37:g.133175428C>T			B2RC12|B6V9G4|Q08AS2|Q53R01	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.S271	ENST00000329321.3	37	c.813	CCDS2170.1	2																																																																																			GPR39	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000183840		0.617	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR39	HGNC	protein_coding	OTTHUMT00000254582.1	-	0.00	29	0	C			133175428	+1	tier1	-	no_errors	ENST00000329321	ensembl	human	known	74_37	silent	20.83	18	5	SNP	0.945	T
GPR87	53836	genome.wustl.edu	37	3	151012162	151012163	+	Frame_Shift_Ins	INS	-	-	T	rs375414416		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr3:151012162_151012163insT	ENST00000260843.4	-	3	1335_1336	c.871_872insA	c.(871-873)atcfs	p.I291fs	MED12L_ENST00000491549.1_Intron|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000273432.4_Intron	NM_023915.3	NP_076404.3	Q9BY21	GPR87_HUMAN	G protein-coupled receptor 87	291					negative regulation of adenylate cyclase activity (GO:0007194)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(6)|large_intestine(6)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	19			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GTAATATAGGATTTTTTGTGCA	0.347																																																	0																																										SO:0001589	frameshift_variant	0			AF237763	CCDS3157.1	3q24	2012-08-21			ENSG00000138271	ENSG00000138271		"""GPCR / Class A : Orphans"""	4538	protein-coding gene	gene with protein product		606379		GPR95		11273702	Standard	NM_023915		Approved		uc003eyt.2	Q9BY21	OTTHUMG00000159858	ENST00000260843.4:c.872dupA	3.37:g.151012168_151012168dupT	ENSP00000260843:p.Ile291fs		Q5KU35|Q96JZ8|Q9BXC2	Frame_Shift_Ins	INS	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_P2Y13_rcpt,prints_P2Y14_rcpt	p.I291fs	ENST00000260843.4	37	c.872_871	CCDS3157.1	3																																																																																			GPR87	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000138271		0.347	GPR87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR87	HGNC	protein_coding	OTTHUMT00000357788.1		0.00	36	0	-			151012163	-1	tier1		no_errors	ENST00000260843	ensembl	human	known	74_37	frame_shift_ins	20.51	31	8	INS	0.996:0.996	T
GRAP2	9402	genome.wustl.edu	37	22	40362100	40362100	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr22:40362100A>G	ENST00000344138.4	+	5	660	c.397A>G	c.(397-399)Agg>Ggg	p.R133G	GRAP2_ENST00000544756.1_Missense_Mutation_p.R61G|GRAP2_ENST00000478445.1_3'UTR|GRAP2_ENST00000399090.2_Intron|RP3-370M22.8_ENST00000424496.1_RNA|GRAP2_ENST00000407075.3_Missense_Mutation_p.R133G|GRAP2_ENST00000543252.1_Missense_Mutation_p.R93G|GRAP2_ENST00000540310.1_Missense_Mutation_p.R67G	NM_004810.2	NP_004801.1	O75791	GRAP2_HUMAN	GRB2-related adaptor protein 2	133	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cell-cell signaling (GO:0007267)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						AGACTACTACAGGACAAATTC	0.453																																																	0													114.0	98.0	103.0					22																	40362100		2203	4300	6503	SO:0001583	missense	0			AF102694	CCDS13999.1	22q13.2	2013-02-14			ENSG00000100351	ENSG00000100351		"""SH2 domain containing"""	4563	protein-coding gene	gene with protein product		604518				9878555, 10224278	Standard	XM_005261836		Approved	Grf40, GrbX, GRBLG, GADS, Mona	uc003ayh.2	O75791	OTTHUMG00000151097	ENST00000344138.4:c.397A>G	22.37:g.40362100A>G	ENSP00000339186:p.Arg133Gly		B7Z8I3|O43726|Q9NRB7	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH2,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.R133G	ENST00000344138.4	37	c.397	CCDS13999.1	22	.	.	.	.	.	.	.	.	.	.	A	17.36	3.368801	0.61624	.	.	ENSG00000100351	ENST00000344138;ENST00000543252;ENST00000544006;ENST00000540310;ENST00000544756;ENST00000407075	T;D;D;D;T	0.82984	-0.08;-1.67;-1.67;-1.67;-0.08	6.03	2.27	0.28462	SH2 motif (4);	0.311047	0.40469	N	0.001096	D	0.87783	0.6264	M	0.75777	2.31	0.46185	D	0.998915	P;D;D;P	0.56746	0.868;0.977;0.961;0.868	B;P;P;B	0.55923	0.185;0.787;0.541;0.185	D	0.88762	0.3258	10	0.87932	D	0	-26.0301	14.5834	0.68308	0.6346:0.3654:0.0:0.0	.	133;67;107;133	Q6FI14;F5H548;B7Z8F8;O75791	.;.;.;GRAP2_HUMAN	G	133;93;107;67;61;133	ENSP00000339186:R133G;ENSP00000446350:R93G;ENSP00000444734:R67G;ENSP00000442195:R61G;ENSP00000385607:R133G	ENSP00000339186:R133G	R	+	1	2	GRAP2	38692046	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.384000	0.52478	0.471000	0.27319	0.533000	0.62120	AGG	GRAP2	-	smart_SH2,pfscan_SH2,prints_SH2	ENSG00000100351		0.453	GRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAP2	HGNC	protein_coding	OTTHUMT00000321295.1	-	0.00	28	0	A	NM_004810		40362100	+1	tier1	-	no_errors	ENST00000344138	ensembl	human	known	74_37	missense	30.56	25	11	SNP	1.000	G
GTF3C5	9328	genome.wustl.edu	37	9	135930461	135930461	+	Intron	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr9:135930461C>T	ENST00000372097.5	+	8	1490				GTF3C5_ENST00000372108.5_Intron|GTF3C5_ENST00000372099.6_Intron|GTF3C5_ENST00000342018.8_Intron|GTF3C5_ENST00000372095.5_Missense_Mutation_p.P308L	NM_012087.3	NP_036219.2	Q9Y5Q8	TF3C5_HUMAN	general transcription factor IIIC, polypeptide 5, 63kDa						5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;4.01e-06)|Epithelial(140;4e-05)		TGTGGTTGTCCTTCTCGAGCC	0.617																																																	0																																										SO:0001627	intron_variant	0			AF133124	CCDS6958.1, CCDS48050.1, CCDS75927.1	9q34.13	2010-03-23	2002-08-29		ENSG00000148308	ENSG00000148308		"""General transcription factors"""	4668	protein-coding gene	gene with protein product	"""transcription factor IIIC, 63 kD"""	604890	"""general transcription factor IIIC, polypeptide 5 (63kD)"""			10373544	Standard	NM_012087		Approved	TFiiiC2-63, TFIIIC63, TFIIICepsilon	uc004ccj.4	Q9Y5Q8	OTTHUMG00000020856	ENST00000372097.5:c.1167+265C>T	9.37:g.135930461C>T			A6NI44|A6NJB9|Q5T7U2|Q5T7U3|Q8N2U7|Q8N857|Q96GD9|Q9H4P2	Missense_Mutation	SNP	pfam_TF_IIIC_su-5	p.P308L	ENST00000372097.5	37	c.923	CCDS6958.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.16|12.16	1.854877|1.854877	0.32791|0.32791	.|.	.|.	ENSG00000148308|ENSG00000148308	ENST00000372089|ENST00000372095	.|.	.|.	.|.	2.23|2.23	0.341|0.341	0.15991|0.15991	.|.	.|.	.|.	.|.	.|.	T|T	0.28300|0.28300	0.0699|0.0699	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.12013	.|0.005	.|B	.|0.12837	.|0.008	T|T	0.27400|0.27400	-1.0075|-1.0075	5|7	0.87932|0.72032	D|D	0|0.01	.|.	4.4625|4.4625	0.11673|0.11673	0.0:0.6587:0.0:0.3413|0.0:0.6587:0.0:0.3413	.|.	.|308	.|B7Z1V3	.|.	F|L	267|308	.|.	ENSP00000361161:L267F|ENSP00000361167:P308L	L|P	+|+	1|2	0|0	GTF3C5|GTF3C5	134920282|134920282	0.012000|0.012000	0.17670|0.17670	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.305000|0.305000	0.19254|0.19254	0.070000|0.070000	0.16634|0.16634	-0.768000|-0.768000	0.03414|0.03414	CTT|CCT	GTF3C5	-	NULL	ENSG00000148308		0.617	GTF3C5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C5	HGNC	protein_coding	OTTHUMT00000054826.1	-	0.00	43	0	C	NM_001122823		135930461	+1	tier1	-	no_errors	ENST00000372095	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.000	T
HEATR5B	54497	genome.wustl.edu	37	2	37276984	37276984	+	Silent	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:37276984G>A	ENST00000233099.5	-	18	2603	c.2508C>T	c.(2506-2508)ggC>ggT	p.G836G	HEATR5B_ENST00000354531.2_Silent_p.G836G	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	836						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				TTTCAGCTAAGCCCTACATTa	0.378																																																	0													49.0	41.0	44.0					2																	37276984		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.2508C>T	2.37:g.37276984G>A			B5MDU8|Q7Z3B2|Q9NVL7	Silent	SNP	superfamily_ARM-type_fold	p.G836	ENST00000233099.5	37	c.2508	CCDS33181.1	2																																																																																			HEATR5B	-	superfamily_ARM-type_fold	ENSG00000008869		0.378	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR5B	HGNC	protein_coding	OTTHUMT00000325492.1	-	0.00	25	0	G	NM_019024		37276984	-1	tier1	-	no_errors	ENST00000233099	ensembl	human	known	74_37	silent	25.00	15	5	SNP	0.993	A
HMHA1	23526	genome.wustl.edu	37	19	1068535	1068535	+	Silent	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr19:1068535C>T	ENST00000313093.2	+	2	444	c.213C>T	c.(211-213)caC>caT	p.H71H	HMHA1_ENST00000536472.1_Intron|HMHA1_ENST00000543365.1_5'Flank|HMHA1_ENST00000586866.1_Silent_p.H75H|HMHA1_ENST00000592335.1_5'Flank|HMHA1_ENST00000539243.2_Silent_p.H87H|HMHA1_ENST00000590214.1_Silent_p.H98H	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	71					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGAGCCGCCACGCCAGCGCGG	0.746																																																	0													6.0	8.0	7.0					19																	1068535		1815	3680	5495	SO:0001819	synonymous_variant	0			D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.213C>T	19.37:g.1068535C>T			B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_FCH_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.H71	ENST00000313093.2	37	c.213	CCDS32863.1	19																																																																																			HMHA1	-	NULL	ENSG00000180448		0.746	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HMHA1	HGNC	protein_coding	OTTHUMT00000458026.1		0.00	17	0	C			1068535	+1			no_errors	ENST00000313093	ensembl	human	known	74_37	silent	27.59	21	8	SNP	1.000	T
HRCT1	646962	genome.wustl.edu	37	9	35906348	35906350	+	In_Frame_Del	DEL	CTG	CTG	-	rs370606246		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr9:35906348_35906350delCTG	ENST00000354323.2	+	1	160_162	c.64_66delCTG	c.(64-66)ctgdel	p.L28del		NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	28						integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						TGTGGCGGTCctgctgctgctgc	0.67																																																	0										367,3839		38,291,1774						-8.3	0.0			23	737,7385		88,561,3412	no	coding	HRCT1	NM_001039792.1		126,852,5186	A1A1,A1R,RR		9.0741,8.7256,8.9552				1104,11224				SO:0001651	inframe_deletion	0				CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.64_66delCTG	9.37:g.35906357_35906359delCTG	ENSP00000346283:p.Leu28del		B7ZBJ1	In_Frame_Del	DEL	NULL	p.L25in_frame_del	ENST00000354323.2	37	c.64_66	CCDS35012.1	9																																																																																			HRCT1	-	NULL	ENSG00000196196		0.670	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRCT1	HGNC	protein_coding	OTTHUMT00000334099.1		0.00	27	0	CTG	NM_001039792		35906350	+1	tier1		no_errors	ENST00000354323	ensembl	human	known	74_37	in_frame_del	8.82	31	3	DEL	0.168:0.493:0.516	-
HSPA14	51182	genome.wustl.edu	37	10	14912595	14912595	+	Splice_Site	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr10:14912595G>A	ENST00000378372.3	+	13	1619		c.e13-1			NM_016299.2	NP_057383.2	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14						'de novo' cotranslational protein folding (GO:0051083)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)			breast(4)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	17						TGTATAAACAGGTTGTACTCC	0.284																																																	0													67.0	69.0	68.0					10																	14912595		2201	4289	6490	SO:0001630	splice_region_variant	0			AF112210	CCDS7103.1, CCDS60487.1	10p13	2011-09-02			ENSG00000187522	ENSG00000187522		"""Heat shock proteins / HSP70"""	29526	protein-coding gene	gene with protein product		610369				12477932	Standard	NM_016299		Approved	HSP70-4, HSP70L1	uc001ind.4	Q0VDF9	OTTHUMG00000017712	ENST00000378372.3:c.1381-1G>A	10.37:g.14912595G>A			A8K8F8|B0YIY9|Q9P0X2|Q9UI07	Splice_Site	SNP	-	e13-1	ENST00000378372.3	37	c.1381-1	CCDS7103.1	10	.	.	.	.	.	.	.	.	.	.	G	23.0	4.360698	0.82353	.	.	ENSG00000187522	ENST00000378372	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5461	0.95297	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HSPA14	14952601	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.232000	0.78116	2.688000	0.91661	0.655000	0.94253	.	HSPA14	-	-	ENSG00000187522		0.284	HSPA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA14	HGNC	protein_coding	OTTHUMT00000046910.1	-	0.00	39	0	G	NM_016299	Intron	14912595	+1	tier1	-	no_errors	ENST00000378372	ensembl	human	known	74_37	splice_site	30.00	21	9	SNP	1.000	A
HUWE1	10075	genome.wustl.edu	37	X	53635828	53635828	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:53635828A>T	ENST00000342160.3	-	23	2761	c.2304T>A	c.(2302-2304)gaT>gaA	p.D768E	HUWE1_ENST00000262854.6_Missense_Mutation_p.D768E|HUWE1_ENST00000218328.8_Missense_Mutation_p.D768E			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	768					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TAAGGATGTAATCCATGAGGG	0.373																																																	0													176.0	147.0	157.0					X																	53635828		2203	4300	6503	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.2304T>A	X.37:g.53635828A>T	ENSP00000340648:p.Asp768Glu		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.D768E	ENST00000342160.3	37	c.2304	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	A	13.65	2.301904	0.40694	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.40225	1.04;1.04;1.04	4.8	4.8	0.61643	E3 ubiquitin ligase, domain of unknown function DUF913 (1);	.	.	.	.	T	0.38295	0.1035	L	0.33485	1.01	0.41859	D	0.990212	P	0.37370	0.592	P	0.46758	0.526	T	0.20009	-1.0288	9	0.27785	T	0.31	.	7.8834	0.29635	0.8995:0.0:0.1005:0.0	.	768	Q7Z6Z7	HUWE1_HUMAN	E	768	ENSP00000340648:D768E;ENSP00000262854:D768E;ENSP00000218328:D768E	ENSP00000218328:D768E	D	-	3	2	HUWE1	53652553	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.146000	0.42216	1.581000	0.49865	0.486000	0.48141	GAT	HUWE1	-	pfam_E3_Ub_ligase_DUF913	ENSG00000086758		0.373	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	-	0.00	26	0	A	XM_497119		53635828	-1	tier1	-	no_errors	ENST00000262854	ensembl	human	known	74_37	missense	36.84	24	14	SNP	1.000	T
IARS	3376	genome.wustl.edu	37	9	95049955	95049955	+	Intron	SNP	T	T	C	rs541195345		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr9:95049955T>C	ENST00000375643.3	-	4	663				IARS_ENST00000443024.2_Intron|IARS_ENST00000447699.2_Intron|IARS_ENST00000375629.3_Intron	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase						gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	AGGTGGAAGCTAACACTTTTT	0.343													T|||	1	0.000199681	0.0008	0.0	5008	,	,		15961	0.0		0.0	False		,,,				2504	0.0																0													71.0	59.0	63.0					9																	95049955		692	1591	2283	SO:0001627	intron_variant	0			AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.396+117A>G	9.37:g.95049955T>C			A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	RNA	SNP	-	NULL	ENST00000375643.3	37	NULL	CCDS6694.1	9																																																																																			IARS	-	-	ENSG00000196305		0.343	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IARS	HGNC	protein_coding	OTTHUMT00000053059.2	-	0.00	29	0	T	NM_002161		95049955	-1	tier1	-	no_errors	ENST00000490438	ensembl	human	known	74_37	rna	13.04	20	3	SNP	0.000	C
IDH3G	3421	genome.wustl.edu	37	X	153052255	153052255	+	Splice_Site	SNP	C	C	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:153052255C>G	ENST00000217901.5	-	10	1121		c.e10+1		IDH3G_ENST00000497043.1_5'Flank|IDH3G_ENST00000370093.1_Splice_Site|IDH3G_ENST00000370092.3_Splice_Site|IDH3G_ENST00000427365.2_Splice_Site	NM_004135.3	NP_004126.1	P51553	IDH3G_HUMAN	isocitrate dehydrogenase 3 (NAD+) gamma						carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|prostate(1)	17	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CCGGCACTCACTGTTTCAAAC	0.582																																																	0													49.0	51.0	50.0					X																	153052255		2203	4298	6501	SO:0001630	splice_region_variant	0				CCDS14730.1, CCDS44019.1	Xq28	2008-02-05			ENSG00000067829	ENSG00000067829	1.1.1.41		5386	protein-coding gene	gene with protein product		300089				9286695	Standard	NM_004135		Approved		uc004fip.4	P51553	OTTHUMG00000024219	ENST00000217901.5:c.924+1G>C	X.37:g.153052255C>G			E9PDD5|Q9BUU5	Splice_Site	SNP	-	e10+1	ENST00000217901.5	37	c.924+1	CCDS14730.1	X	.	.	.	.	.	.	.	.	.	.	C	12.72	2.021682	0.35701	.	.	ENSG00000067829	ENST00000370092;ENST00000217901;ENST00000454076;ENST00000370093;ENST00000427365;ENST00000393771	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4886	0.87696	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	IDH3G	152705449	1.000000	0.71417	1.000000	0.80357	0.032000	0.12392	5.586000	0.67503	2.400000	0.81607	0.513000	0.50165	.	IDH3G	-	-	ENSG00000067829		0.582	IDH3G-005	KNOWN	basic|appris_principal|CCDS	protein_coding	IDH3G	HGNC	protein_coding	OTTHUMT00000061084.27	-	0.00	80	0	C		Intron	153052255	-1	tier1	-	no_errors	ENST00000217901	ensembl	human	known	74_37	splice_site	8.99	81	8	SNP	1.000	G
IFI16	3428	genome.wustl.edu	37	1	158986435	158986435	+	Missense_Mutation	SNP	G	G	A	rs138795047		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:158986435G>A	ENST00000295809.7	+	4	749	c.494G>A	c.(493-495)cGt>cAt	p.R165H	IFI16_ENST00000359709.3_Intron|IFI16_ENST00000368132.3_Missense_Mutation_p.R165H|IFI16_ENST00000430894.2_Intron|IFI16_ENST00000448393.2_Missense_Mutation_p.R165H|IFI16_ENST00000340979.6_Missense_Mutation_p.R165H|IFI16_ENST00000368131.4_Missense_Mutation_p.R165H			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	165					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					GCCATGGGCCGTTCCCCATCT	0.527																																																	0								G	,HIS/ARG	0,4406		0,0,2203	127.0	112.0	117.0		,494	-2.7	0.0	1	dbSNP_134	117	1,8599		0,1,4299	no	intron,missense	IFI16	NM_001206567.1,NM_005531.2	,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,benign	,165/730	158986435	1,13005	2203	4300	6503	SO:0001583	missense	0			M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.494G>A	1.37:g.158986435G>A	ENSP00000295809:p.Arg165His		B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN,pfscan_HIN200/IF120x	p.R165H	ENST00000295809.7	37	c.494		1	.	.	.	.	.	.	.	.	.	.	.	0.001	-2.891840	0.00060	0.0	1.16E-4	ENSG00000163565	ENST00000359709;ENST00000447473;ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132	T;T;T;T;T	0.17528	2.27;3.62;3.63;3.63;3.63	1.34	-2.67	0.06059	.	.	.	.	.	T	0.00784	0.0026	N	0.01048	-1.04	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.25187	-1.0139	9	0.10636	T	0.68	.	3.2039	0.06658	0.2174:0.0:0.3112:0.4714	.	165;165	Q16666-2;Q16666	.;IF16_HUMAN	H	165	ENSP00000407052:R165H;ENSP00000295809:R165H;ENSP00000342741:R165H;ENSP00000357113:R165H;ENSP00000357114:R165H	ENSP00000295809:R165H	R	+	2	0	IFI16	157253059	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-8.449000	0.00020	-3.533000	0.00145	-2.239000	0.00288	CGT	IFI16	-	NULL	ENSG00000163565		0.527	IFI16-013	KNOWN	basic	protein_coding	IFI16	HGNC	protein_coding	OTTHUMT00000421720.1	-	0.00	58	0	G	NM_005531		158986435	+1	tier1	rs138795047	no_errors	ENST00000295809	ensembl	human	known	74_37	missense	22.99	67	20	SNP	0.000	A
INSR	3643	genome.wustl.edu	37	19	7152815	7152815	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr19:7152815T>C	ENST00000302850.5	-	10	2295	c.2153A>G	c.(2152-2154)cAg>cGg	p.Q718R	INSR_ENST00000341500.5_Missense_Mutation_p.Q718R	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	718	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	CTTCAGGATCTGAGAGTCTGT	0.537																																																	0													157.0	136.0	143.0					19																	7152815		2203	4300	6503	SO:0001583	missense	0			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.2153A>G	19.37:g.7152815T>C	ENSP00000303830:p.Gln718Arg		Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom	p.Q718R	ENST00000302850.5	37	c.2153	CCDS12176.1	19	.	.	.	.	.	.	.	.	.	.	T	15.70	2.909617	0.52439	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	T;T	0.70631	-0.5;-0.5	5.57	5.57	0.84162	Fibronectin, type III (2);	0.000000	0.43919	D	0.000515	T	0.66366	0.2782	L	0.55990	1.75	0.58432	D	0.999998	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.10450	0.005;0.002;0.001	T	0.62567	-0.6827	10	0.39692	T	0.17	.	13.6848	0.62508	0.0:0.0:0.0:1.0	.	709;718;718	Q86WY9;P06213-2;P06213	.;.;INSR_HUMAN	R	718	ENSP00000303830:Q718R;ENSP00000342838:Q718R	ENSP00000303830:Q718R	Q	-	2	0	INSR	7103815	1.000000	0.71417	0.997000	0.53966	0.779000	0.44077	7.479000	0.81095	2.124000	0.65301	0.491000	0.48974	CAG	INSR	-	pirsf_Tyr_kinase_insulin-like_rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000171105		0.537	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSR	HGNC	protein_coding	OTTHUMT00000458544.1	-	0.00	45	0	T			7152815	-1	tier1	-	no_errors	ENST00000302850	ensembl	human	known	74_37	missense	25.00	39	13	SNP	1.000	C
INTS8	55656	genome.wustl.edu	37	8	95837220	95837220	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr8:95837220G>T	ENST00000523731.1	+	2	363	c.230G>T	c.(229-231)aGa>aTa	p.R77I	INTS8_ENST00000447247.1_Missense_Mutation_p.R77I	NM_017864.2	NP_060334.2	Q75QN2	INT8_HUMAN	integrator complex subunit 8	77					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(3)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	28	Breast(36;1.05e-06)					GATAACAAGAGAAATCGTATT	0.368																																																	0													78.0	80.0	79.0					8																	95837220		2203	4300	6503	SO:0001583	missense	0			AK091278	CCDS34925.1	8q22.1	2007-05-03	2006-03-15	2006-03-15	ENSG00000164941	ENSG00000164941			26048	protein-coding gene	gene with protein product		611351	"""chromosome 8 open reading frame 52"""	C8orf52		16239144	Standard	NM_017864		Approved	FLJ20530, INT8, MGC131633	uc003yhb.4	Q75QN2	OTTHUMG00000164695	ENST00000523731.1:c.230G>T	8.37:g.95837220G>T	ENSP00000430338:p.Arg77Ile		B2RN92|Q5RKZ3|Q6P1R5|Q7Z314|Q9NVS6|Q9NWY7	Missense_Mutation	SNP	NULL	p.R77I	ENST00000523731.1	37	c.230	CCDS34925.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.5|29.5	5.014797|5.014797	0.93404|0.93404	.|.	.|.	ENSG00000164941|ENSG00000164941	ENST00000521860|ENST00000522171;ENST00000523808;ENST00000519457;ENST00000523731;ENST00000447247	.|.	.|.	.|.	5.1|5.1	5.1|5.1	0.69264|0.69264	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.77824|0.77824	0.4188|0.4188	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	.|D;D	.|0.69078	.|0.997;0.997	.|D;D	.|0.80764	.|0.994;0.994	T|T	0.79725|0.79725	-0.1683|-0.1683	5|9	.|0.87932	.|D	.|0	-20.5725|-20.5725	18.7041|18.7041	0.91631|0.91631	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|77;77	.|Q75QN2;Q75QN2-2	.|INT8_HUMAN;.	D|I	64|36;141;77;77;77	.|.	.|ENSP00000343274:R77I	E|R	+|+	3|2	2|0	INTS8|INTS8	95906396|95906396	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	8.997000|8.997000	0.93544|0.93544	2.648000|2.648000	0.89879|0.89879	0.563000|0.563000	0.77884|0.77884	GAG|AGA	INTS8	-	NULL	ENSG00000164941		0.368	INTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS8	HGNC	protein_coding	OTTHUMT00000379794.1		0.00	29	0	G	NM_017864		95837220	+1			no_errors	ENST00000523731	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
ITGB6	3694	genome.wustl.edu	37	2	161055715	161055715	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:161055715G>A	ENST00000283249.2	-	2	353	c.116C>T	c.(115-117)cCt>cTt	p.P39L	ITGB6_ENST00000428609.2_Intron|ITGB6_ENST00000409872.1_Missense_Mutation_p.P39L|ITGB6_ENST00000485635.1_Intron|ITGB6_ENST00000409967.2_Missense_Mutation_p.P39L	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	39					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						GGCACACTGAGGTCCAATAAG	0.438																																																	0													94.0	91.0	92.0					2																	161055715		2203	4300	6503	SO:0001583	missense	0				CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.116C>T	2.37:g.161055715G>A	ENSP00000283249:p.Pro39Leu		B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt_dom,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	p.P39L	ENST00000283249.2	37	c.116	CCDS2212.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.438727	0.96168	.	.	ENSG00000115221	ENST00000283249;ENST00000409967;ENST00000409872	D;D;D	0.92965	-3.14;-3.14;-3.14	5.68	5.68	0.88126	Integrin beta subunit, N-terminal (2);	0.233772	0.45361	D	0.000369	D	0.94899	0.8351	M	0.78456	2.415	0.80722	D	1	D	0.58268	0.982	P	0.53360	0.724	D	0.95138	0.8261	10	0.87932	D	0	.	19.7917	0.96461	0.0:0.0:1.0:0.0	.	39	P18564	ITB6_HUMAN	L	39	ENSP00000283249:P39L;ENSP00000386828:P39L;ENSP00000386367:P39L	ENSP00000283249:P39L	P	-	2	0	ITGB6	160763961	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.469000	0.80959	2.688000	0.91661	0.563000	0.77884	CCT	ITGB6	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	ENSG00000115221		0.438	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB6	HGNC	protein_coding	OTTHUMT00000255036.1	-	0.00	42	0	G	NM_000888		161055715	-1	tier1	-	no_errors	ENST00000283249	ensembl	human	known	74_37	missense	31.71	28	13	SNP	1.000	A
ITIH1	3697	genome.wustl.edu	37	3	52816275	52816275	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr3:52816275G>A	ENST00000273283.2	+	8	946	c.922G>A	c.(922-924)Gtg>Atg	p.V308M	ITIH1_ENST00000487686.1_3'UTR|ITIH1_ENST00000542827.1_Missense_Mutation_p.V308M|ITIH1_ENST00000540715.1_Missense_Mutation_p.V166M|ITIH1_ENST00000537050.1_Missense_Mutation_p.V20M	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	308	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		AGGCCAGAAAGTGAAGCAGGT	0.507																																																	0													65.0	63.0	64.0					3																	52816275		2203	4300	6503	SO:0001583	missense	0				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.922G>A	3.37:g.52816275G>A	ENSP00000273283:p.Val308Met		A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,superfamily_PsdUridine_synth_cat_dom,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.V308M	ENST00000273283.2	37	c.922	CCDS2864.1	3	.	.	.	.	.	.	.	.	.	.	G	5.312	0.242872	0.10077	.	.	ENSG00000055957	ENST00000542827;ENST00000273283;ENST00000540715;ENST00000537050	D;D;D;D	0.83335	-1.71;-1.71;-1.71;-1.71	5.66	1.35	0.21983	von Willebrand factor, type A (3);	0.310233	0.40469	N	0.001091	T	0.52837	0.1759	N	0.02315	-0.6	0.27383	N	0.955363	B	0.21520	0.057	B	0.29267	0.1	T	0.51996	-0.8634	10	0.02654	T	1	-7.547	3.9039	0.09174	0.2851:0.3745:0.3404:0.0	.	308	P19827	ITIH1_HUMAN	M	308;308;166;20	ENSP00000442584:V308M;ENSP00000273283:V308M;ENSP00000443973:V166M;ENSP00000443847:V20M	ENSP00000273283:V308M	V	+	1	0	ITIH1	52791315	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.653000	0.37323	0.756000	0.33013	0.650000	0.86243	GTG	ITIH1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000055957		0.507	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH1	HGNC	protein_coding	OTTHUMT00000317522.1	-	0.00	27	0	G	NM_002215		52816275	+1	tier1	-	no_errors	ENST00000273283	ensembl	human	known	74_37	missense	22.22	21	6	SNP	1.000	A
ITK	3702	genome.wustl.edu	37	5	156607998	156607998	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr5:156607998T>G	ENST00000422843.3	+	1	162	c.10T>G	c.(10-12)Ttt>Gtt	p.F4V		NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	4	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	CATGAACAACTTTATCCTCCT	0.443			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)			Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	0													85.0	79.0	81.0					5																	156607998		2203	4300	6503	SO:0001583	missense	0			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.10T>G	5.37:g.156607998T>G	ENSP00000398655:p.Phe4Val		B2R752|Q32ML7	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_Znf_Btk_motif,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.F4V	ENST00000422843.3	37	c.10	CCDS4336.1	5	.	.	.	.	.	.	.	.	.	.	T	9.352	1.065659	0.20067	.	.	ENSG00000113263	ENST00000422843	T	0.74002	-0.8	5.27	4.12	0.48240	Pleckstrin homology domain (1);	0.468333	0.24833	N	0.035234	T	0.55465	0.1922	N	0.14661	0.345	0.38073	D	0.936442	B	0.09022	0.002	B	0.08055	0.003	T	0.51116	-0.8746	10	0.31617	T	0.26	.	9.624	0.39739	0.0:0.0789:0.0:0.9211	.	4	Q08881	ITK_HUMAN	V	4	ENSP00000398655:F4V	ENSP00000398655:F4V	F	+	1	0	ITK	156540576	0.998000	0.40836	0.969000	0.41365	0.993000	0.82548	2.426000	0.44731	0.960000	0.38005	0.533000	0.62120	TTT	ITK	-	pfscan_Pleckstrin_homology	ENSG00000113263		0.443	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITK	HGNC	protein_coding	OTTHUMT00000252569.2	-	0.00	38	0	T			156607998	+1	tier1	-	no_errors	ENST00000422843	ensembl	human	known	74_37	missense	18.18	27	6	SNP	0.987	G
JAG1	182	genome.wustl.edu	37	20	10625886	10625886	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr20:10625886T>C	ENST00000254958.5	-	17	2647	c.2132A>G	c.(2131-2133)gAg>gGg	p.E711G	JAG1_ENST00000488480.1_RNA|JAG1_ENST00000423891.2_Missense_Mutation_p.E552G	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	711	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						GCACGTGGCCTCATCACACTG	0.532									Alagille Syndrome																																								0													122.0	102.0	109.0					20																	10625886		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.2132A>G	20.37:g.10625886T>C	ENSP00000254958:p.Glu711Gly		A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Notch_ligand_N,pfam_DSL,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,smart_DSL,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_VWC_out,smart_VWF_C,pfscan_DSL,pfscan_EG-like_dom	p.E711G	ENST00000254958.5	37	c.2132	CCDS13112.1	20	.	.	.	.	.	.	.	.	.	.	T	15.75	2.924735	0.52653	.	.	ENSG00000101384	ENST00000254958;ENST00000423891	D;D	0.88046	-2.33;-2.33	5.85	5.85	0.93711	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.72985	0.3529	N	0.02842	-0.48	0.80722	D	1	B	0.26120	0.142	B	0.23275	0.045	T	0.70876	-0.4753	10	0.30854	T	0.27	.	16.2303	0.82332	0.0:0.0:0.0:1.0	.	711	P78504	JAG1_HUMAN	G	711;552	ENSP00000254958:E711G;ENSP00000389519:E552G	ENSP00000254958:E711G	E	-	2	0	JAG1	10573886	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.286000	0.72665	2.233000	0.73108	0.533000	0.62120	GAG	JAG1	-	pfam_EGF_extracell,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	ENSG00000101384		0.532	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	JAG1	HGNC	protein_coding		-	0.00	46	0	T	NM_000214		10625886	-1	tier1	-	no_errors	ENST00000254958	ensembl	human	known	74_37	missense	62.71	22	37	SNP	1.000	C
KIAA0895	23366	genome.wustl.edu	37	7	36375802	36375802	+	Intron	SNP	G	G	A	rs61735025	byFrequency	TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr7:36375802G>A	ENST00000297063.6	-	4	918				KIAA0895_ENST00000317020.6_Intron|KIAA0895_ENST00000453212.1_Silent_p.H31H|KIAA0895_ENST00000338533.5_Intron|Y_RNA_ENST00000364562.1_RNA|KIAA0895_ENST00000436884.1_Silent_p.H173H|KIAA0895_ENST00000480192.1_5'UTR|KIAA0895_ENST00000440378.1_Silent_p.H273H	NM_001100425.1	NP_001093895.1	Q8NCT3	K0895_HUMAN	KIAA0895											breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						ACTTCCTAACGTGACTCCAGA	0.383													G|||	3	0.000599042	0.0023	0.0	5008	,	,		15820	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	0			BC028678	CCDS43570.1, CCDS47573.1, CCDS56482.1, CCDS56483.1, CCDS56484.1, CCDS75583.1	7p14.2	2008-11-27			ENSG00000164542	ENSG00000164542			22206	protein-coding gene	gene with protein product							Standard	NM_015314		Approved		uc003tfd.2	Q8NCT3	OTTHUMG00000154939	ENST00000297063.6:c.868-1015C>T	7.37:g.36375802G>A			B4DF35|B7ZLT4|B9EGB9|O94969|Q0VGC1|Q7Z4L2	Silent	SNP	pfam_DUF1704	p.H173	ENST00000297063.6	37	c.519	CCDS43570.1	7																																																																																			KIAA0895	-	pfam_DUF1704	ENSG00000164542		0.383	KIAA0895-001	KNOWN	basic|CCDS	protein_coding	KIAA0895	HGNC	protein_coding	OTTHUMT00000337717.1	-	0.00	42	0	G	NM_015314		36375802	-1	tier1	rs61735025	no_errors	ENST00000436884	ensembl	human	putative	74_37	silent	29.55	31	13	SNP	0.829	A
KIF4A	24137	genome.wustl.edu	37	X	69615565	69615565	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:69615565A>C	ENST00000374403.3	+	21	2359	c.2277A>C	c.(2275-2277)gaA>gaC	p.E759D	RNY4P23_ENST00000364507.1_RNA|KIF4A_ENST00000374388.3_Missense_Mutation_p.E759D	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	759	Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						GTACTGAGGAAGCCAAACGCC	0.448																																																	0													80.0	68.0	72.0					X																	69615565		2203	4300	6503	SO:0001583	missense	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.2277A>C	X.37:g.69615565A>C	ENSP00000363524:p.Glu759Asp		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E759D	ENST00000374403.3	37	c.2277	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	a	14.00	2.404929	0.42613	.	.	ENSG00000090889	ENST00000374388;ENST00000374403;ENST00000544650	T;T	0.71934	-0.61;-0.57	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000005	T	0.54287	0.1849	L	0.31371	0.925	0.50813	D	0.999896	B	0.22683	0.073	B	0.22386	0.039	T	0.50311	-0.8843	10	0.21540	T	0.41	.	7.1165	0.25418	0.8271:0.0:0.1729:0.0	.	759	O95239	KIF4A_HUMAN	D	759;759;61	ENSP00000363509:E759D;ENSP00000363524:E759D	ENSP00000363509:E759D	E	+	3	2	KIF4A	69532290	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.618000	0.46393	1.968000	0.57251	0.478000	0.44815	GAA	KIF4A	-	NULL	ENSG00000090889		0.448	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	-	0.00	49	0	A	NM_012310		69615565	+1	tier1	-	no_errors	ENST00000374403	ensembl	human	known	74_37	missense	45.35	47	39	SNP	1.000	C
KMT2C	58508	genome.wustl.edu	37	7	151927069	151927069	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr7:151927069C>T	ENST00000262189.6	-	18	3133	c.2915G>A	c.(2914-2916)gGa>gAa	p.G972E	KMT2C_ENST00000355193.2_Missense_Mutation_p.G972E	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	972					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.G972E(4)									AAGTAATCTTCCTTCTGCTCC	0.353																																																	4	Substitution - Missense(4)	urinary_tract(2)|NS(2)											63.0	52.0	56.0					7																	151927069		2199	4278	6477	SO:0001583	missense	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2915G>A	7.37:g.151927069C>T	ENSP00000262189:p.Gly972Glu		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.G972E	ENST00000262189.6	37	c.2915	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	C	18.21	3.572824	0.65765	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.88277	-2.36;-2.36	4.67	4.67	0.58626	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.40469	U	0.001093	D	0.93993	0.8076	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94782	0.7954	10	0.87932	D	0	.	17.9348	0.89009	0.0:1.0:0.0:0.0	.	972;33	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	E	972	ENSP00000262189:G972E;ENSP00000347325:G972E	ENSP00000262189:G972E	G	-	2	0	MLL3	151558002	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.770000	0.85390	2.303000	0.77524	0.460000	0.39030	GGA	KMT2C	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Znf_RING,pfscan_Znf_PHD-finger	ENSG00000055609		0.353	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	HGNC	protein_coding	OTTHUMT00000318887.3	-	0.00	343	0	C			151927069	-1	tier1	-	no_errors	ENST00000355193	ensembl	human	known	74_37	missense	6.16	274	18	SNP	1.000	T
KMT2D	8085	genome.wustl.edu	37	12	49420963	49420963	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr12:49420963G>T	ENST00000301067.7	-	48	14785	c.14786C>A	c.(14785-14787)cCt>cAt	p.P4929H		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4929	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.P4929fs*66(1)|p.P4659fs*66(1)									GGGCTCAGTAGGGGGACTGGC	0.627																																																	2	Deletion - Frameshift(2)	haematopoietic_and_lymphoid_tissue(2)											34.0	40.0	38.0					12																	49420963		1904	4088	5992	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.14786C>A	12.37:g.49420963G>T	ENSP00000301067:p.Pro4929His		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.P4929H	ENST00000301067.7	37	c.14786	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	G	7.183	0.589957	0.13812	.	.	ENSG00000167548	ENST00000301067	T	0.80304	-1.36	4.21	3.32	0.38043	.	0.221910	0.23303	N	0.049655	T	0.59636	0.2208	N	0.08118	0	0.21822	N	0.999529	P	0.46327	0.876	B	0.36186	0.219	T	0.58323	-0.7656	10	0.87932	D	0	.	11.0604	0.47944	0.0927:0.0:0.9073:0.0	.	4929	O14686	MLL2_HUMAN	H	4929	ENSP00000301067:P4929H	ENSP00000301067:P4929H	P	-	2	0	MLL2	47707230	0.654000	0.27367	0.985000	0.45067	0.920000	0.55202	3.080000	0.50112	1.136000	0.42199	0.650000	0.86243	CCT	KMT2D	-	NULL	ENSG00000167548		0.627	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2		0.00	40	0	G			49420963	-1			no_errors	ENST00000301067	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.816	T
KRTAP19-5	337972	genome.wustl.edu	37	21	31874223	31874223	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr21:31874223G>T	ENST00000334151.2	-	1	212	c.186C>A	c.(184-186)tgC>tgA	p.C62*		NM_181611.1	NP_853642.1	Q3LI72	KR195_HUMAN	keratin associated protein 19-5	62						intermediate filament (GO:0005882)				endometrium(1)|large_intestine(5)|lung(4)|pancreas(1)|prostate(1)	12						ATCCTCCATAGCATGATGGAC	0.517																																																	0													103.0	102.0	103.0					21																	31874223		2203	4300	6503	SO:0001587	stop_gained	0			AP001708	CCDS13597.1	21q22.1	2006-03-13			ENSG00000186977	ENSG00000186977		"""Keratin associated proteins"""	18940	protein-coding gene	gene with protein product						12359730	Standard	NM_181611		Approved	KAP19.5	uc011ada.2	Q3LI72	OTTHUMG00000057774	ENST00000334151.2:c.186C>A	21.37:g.31874223G>T	ENSP00000334985:p.Cys62*		A4IF22	Nonsense_Mutation	SNP	pfam_KRTAP_type6/8/16/19/20	p.C62*	ENST00000334151.2	37	c.186	CCDS13597.1	21	.	.	.	.	.	.	.	.	.	.	G	14.55	2.570307	0.45798	.	.	ENSG00000186977	ENST00000334151	.	.	.	5.16	0.145	0.14829	.	1.338540	0.05734	U	0.600006	.	.	.	.	.	.	0.21740	N	0.999565	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	0.0251	1.5421	0.02557	0.2283:0.151:0.4657:0.1549	.	.	.	.	X	62	.	ENSP00000334985:C62X	C	-	3	2	KRTAP19-5	30796094	0.000000	0.05858	0.000000	0.03702	0.108000	0.19459	0.032000	0.13732	-0.088000	0.12506	0.591000	0.81541	TGC	KRTAP19-5	-	pfam_KRTAP_type6/8/16/19/20	ENSG00000186977		0.517	KRTAP19-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP19-5	HGNC	protein_coding	OTTHUMT00000128226.2	-	0.00	83	0	G			31874223	-1	tier1	-	no_errors	ENST00000334151	ensembl	human	known	74_37	nonsense	21.05	75	20	SNP	0.000	T
LAMB4	22798	genome.wustl.edu	37	7	107746347	107746347	+	Missense_Mutation	SNP	C	C	T	rs377732422		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr7:107746347C>T	ENST00000388781.3	-	8	868	c.785G>A	c.(784-786)cGg>cAg	p.R262Q	LAMB4_ENST00000418464.1_Missense_Mutation_p.R262Q|LAMB4_ENST00000414450.2_Missense_Mutation_p.R262Q|LAMB4_ENST00000388780.3_Missense_Mutation_p.R262Q|LAMB4_ENST00000205386.4_Missense_Mutation_p.R262Q	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	262	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)		p.R262Q(1)		NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						GCAGCTTCCCCGAACAATCAT	0.473																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)						C	GLN/ARG	0,4406		0,0,2203	126.0	110.0	116.0		785	0.0	0.0	7		116	1,8599	1.2+/-3.3	0,1,4299	no	missense	LAMB4	NM_007356.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	262/1762	107746347	1,13005	2203	4300	6503	SO:0001583	missense	0			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.785G>A	7.37:g.107746347C>T	ENSP00000373433:p.Arg262Gln		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.R262Q	ENST00000388781.3	37	c.785	CCDS34732.1	7	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843115	0.71488	0.0	1.16E-4	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780;ENST00000418464;ENST00000414450	T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11	4.87	0.0385	0.14200	Laminin, N-terminal (3);	0.488989	0.17139	N	0.185530	T	0.78935	0.4362	M	0.65975	2.015	0.36009	D	0.837947	D	0.61697	0.99	P	0.51101	0.659	T	0.81052	-0.1107	10	0.87932	D	0	.	10.4608	0.44578	0.0:0.6044:0.0:0.3956	.	262	A4D0S4	LAMB4_HUMAN	Q	262	ENSP00000205386:R262Q;ENSP00000373433:R262Q;ENSP00000373432:R262Q;ENSP00000402353:R262Q;ENSP00000402265:R262Q	ENSP00000205386:R262Q	R	-	2	0	LAMB4	107533583	0.000000	0.05858	0.025000	0.17156	0.949000	0.60115	0.277000	0.18734	-0.184000	0.10567	-0.150000	0.13652	CGG	LAMB4	-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N	ENSG00000091128		0.473	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB4	HGNC	protein_coding	OTTHUMT00000337442.1	-	0.00	37	0	C	XM_209857		107746347	-1	tier1	-	no_errors	ENST00000205386	ensembl	human	known	74_37	missense	21.28	37	10	SNP	0.463	T
LMO7	4008	genome.wustl.edu	37	13	76423325	76423325	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr13:76423325G>A	ENST00000321797.8	+	25	4283	c.3562G>A	c.(3562-3564)Gaa>Aaa	p.E1188K	LMO7_ENST00000526202.1_Missense_Mutation_p.E1065K|LMO7_ENST00000357063.3_Missense_Mutation_p.E1473K|LMO7_ENST00000377534.3_Missense_Mutation_p.E1473K|LMO7_ENST00000341547.4_Missense_Mutation_p.E1139K|LMO7_ENST00000465261.2_Missense_Mutation_p.E1188K			Q8WWI1	LMO7_HUMAN	LIM domain 7	1473					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AATCCTTCAGGAAATGAGGAA	0.463																																																	0													139.0	115.0	123.0					13																	76423325		2203	4300	6503	SO:0001583	missense	0			AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.3562G>A	13.37:g.76423325G>A	ENSP00000317802:p.Glu1188Lys		E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	pfam_CH-domain,pfam_PDZ,superfamily_CH-domain,superfamily_PDZ,smart_CH-domain,smart_PDZ,pfscan_CH-domain,pfscan_PDZ,prints_SM22_calponin	p.E1473K	ENST00000321797.8	37	c.4417		13	.	.	.	.	.	.	.	.	.	.	G	36	5.897022	0.97081	.	.	ENSG00000136153	ENST00000341547;ENST00000357063;ENST00000377534;ENST00000321797;ENST00000526202;ENST00000465261	T;T;T;T;T;T	0.57907	1.3;0.91;0.92;0.76;0.75;0.37	6.02	6.02	0.97574	.	0.044696	0.85682	D	0.000000	T	0.76506	0.3997	M	0.83603	2.65	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.996;0.998;0.967	T	0.74031	-0.3795	10	0.39692	T	0.17	-24.7364	20.5407	0.99260	0.0:0.0:1.0:0.0	.	1065;1139;1188	E9PMS6;Q8WWI1-3;E9PLH4	.;.;.	K	1139;1473;1473;1188;1065;1188	ENSP00000342112:E1139K;ENSP00000349571:E1473K;ENSP00000366757:E1473K;ENSP00000317802:E1188K;ENSP00000431129:E1065K;ENSP00000433352:E1188K	ENSP00000317802:E1188K	E	+	1	0	LMO7	75321326	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.261000	0.95576	2.865000	0.98341	0.655000	0.94253	GAA	LMO7	-	NULL	ENSG00000136153		0.463	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	LMO7	HGNC	protein_coding	OTTHUMT00000045301.3	-	0.00	27	0	G	NM_005358		76423325	+1	tier1	-	no_errors	ENST00000357063	ensembl	human	known	74_37	missense	13.16	33	5	SNP	1.000	A
L1CAM	3897	genome.wustl.edu	37	X	153150822	153150822	+	Intron	SNP	G	G	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:153150822G>C	ENST00000370060.1	-	1	82				L1CAM_ENST00000484587.1_Intron|LCA10_ENST00000357566.1_Missense_Mutation_p.V20L|L1CAM_ENST00000370055.1_Intron	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule						axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CACAGAGCCTGTGGAAACGGG	0.677																																																	0													7.0	7.0	7.0					X																	153150822		1700	3074	4774	SO:0001627	intron_variant	0			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.107+696C>G	X.37:g.153150822G>C			A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	NULL	p.V20L	ENST00000370060.1	37	c.58	CCDS14733.1	X	.	.	.	.	.	.	.	.	.	.	G	8.463	0.855717	0.17106	.	.	ENSG00000196987	ENST00000357566	.	.	.	3.0	-2.04	0.07343	.	.	.	.	.	T	0.26412	0.0645	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.35251	-0.9796	5	0.87932	D	0	.	0.2943	0.00263	0.3453:0.1932:0.2638:0.1977	.	.	.	.	L	20	.	ENSP00000350178:V20L	V	+	1	0	U52112.12	152804016	0.000000	0.05858	0.000000	0.03702	0.175000	0.22909	-0.360000	0.07622	-0.637000	0.05516	0.380000	0.24917	GTG	LCA10	-	NULL	ENSG00000196987		0.677	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100996465	Uniprot_gn	protein_coding	OTTHUMT00000061094.2	-	0.00	51	0	G	NM_024003		153150822	+1	tier1	-	no_errors	ENST00000357566	ensembl	human	known	74_37	missense	18.18	45	10	SNP	0.000	C
LRG1	116844	genome.wustl.edu	37	19	4538426	4538426	+	Silent	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr19:4538426C>T	ENST00000306390.6	-	2	1030	c.570G>A	c.(568-570)ctG>ctA	p.L190L	CTB-50L17.14_ENST00000586020.1_Intron|LRG1_ENST00000586883.1_5'Flank	NM_052972.2	NP_443204.1	P02750	A2GL_HUMAN	leucine-rich alpha-2-glycoprotein 1	190					brown fat cell differentiation (GO:0050873)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				NS(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAGGGTGCGCAGGAGGGTGA	0.602																																																	0													117.0	130.0	126.0					19																	4538426		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12130.1	19p13.3	2013-09-20			ENSG00000171236	ENSG00000171236			29480	protein-coding gene	gene with protein product	"""leucine rich alpha 2 glycoprotein"""	611289				3856868, 12223515	Standard	NM_052972		Approved	LRG	uc002mau.3	P02750	OTTHUMG00000182010	ENST00000306390.6:c.570G>A	19.37:g.4538426C>T			Q8N4F5|Q96QZ4	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L190	ENST00000306390.6	37	c.570	CCDS12130.1	19																																																																																			LRG1	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000171236		0.602	LRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRG1	HGNC	protein_coding	OTTHUMT00000458654.2	-	0.00	46	0	C	NM_052972		4538426	-1	tier1	-	no_errors	ENST00000306390	ensembl	human	known	74_37	silent	42.22	26	19	SNP	1.000	T
LRP1B	53353	genome.wustl.edu	37	2	141762950	141762950	+	Silent	SNP	A	A	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:141762950A>G	ENST00000389484.3	-	15	3428	c.2457T>C	c.(2455-2457)gcT>gcC	p.A819A		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	819	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TATCGGCACAAGCACACACCC	0.433										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													82.0	79.0	80.0					2																	141762950		2203	4300	6503	SO:0001819	synonymous_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.2457T>C	2.37:g.141762950A>G			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.A819	ENST00000389484.3	37	c.2457	CCDS2182.1	2																																																																																			LRP1B	-	smart_EG-like_dom	ENSG00000168702		0.433	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	65	0	A	NM_018557		141762950	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	silent	12.82	34	5	SNP	0.986	G
LRP8	7804	genome.wustl.edu	37	1	53792603	53792604	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:53792603_53792604delAG	ENST00000306052.6	-	2	286_287	c.185_186delCT	c.(184-186)tctfs	p.S62fs	LRP8_ENST00000354412.3_Frame_Shift_Del_p.S62fs|LRP8_ENST00000347547.2_Frame_Shift_Del_p.S62fs|LRP8_ENST00000465675.1_5'UTR|RP4-784A16.5_ENST00000445039.2_lincRNA|LRP8_ENST00000371454.2_Frame_Shift_Del_p.S62fs	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	62	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						ATCTCCACACAGAGGGGATGCA	0.639																																																	0																																										SO:0001589	frameshift_variant	0			D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.185_186delCT	1.37:g.53792605_53792606delAG	ENSP00000303634:p.Ser62fs		B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Frame_Shift_Del	DEL	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.S62fs	ENST00000306052.6	37	c.186_185	CCDS578.1	1																																																																																			LRP8	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	ENSG00000157193		0.639	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRP8	HGNC	protein_coding	OTTHUMT00000024699.1		0.00	50	0	AG	NM_004631		53792604	-1	tier1		no_errors	ENST00000306052	ensembl	human	known	74_37	frame_shift_del	22.86	27	8	DEL	0.013:0.038	-
LRRC71	149499	genome.wustl.edu	37	1	156896983	156896983	+	Intron	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:156896983C>T	ENST00000337428.7	+	6	747				LRRC71_ENST00000490146.1_3'UTR	NM_144702.2	NP_653303.2	Q8N4P6	LRC71_HUMAN	leucine rich repeat containing 71											endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|stomach(1)	12						TCAGATCTCCCCTGCCCTCAG	0.577																																																	0													81.0	88.0	86.0					1																	156896983		692	1591	2283	SO:0001627	intron_variant	0			BC033790	CCDS44249.1	1q23.1	2011-02-14	2011-02-14	2011-02-14	ENSG00000160838	ENSG00000160838			26556	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 92"""	C1orf92		14702039	Standard	NM_144702		Approved	FLJ32884	uc001fqm.2	Q8N4P6	OTTHUMG00000041298	ENST00000337428.7:c.594-11C>T	1.37:g.156896983C>T			Q96M24	RNA	SNP	-	NULL	ENST00000337428.7	37	NULL	CCDS44249.1	1																																																																																			LRRC71	-	-	ENSG00000160838		0.577	LRRC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC71	HGNC	protein_coding	OTTHUMT00000098961.1	-	0.00	35	0	C	NM_144702		156896983	+1	tier1	-	no_errors	ENST00000490146	ensembl	human	known	74_37	rna	26.32	28	10	SNP	0.000	T
MED19	219541	genome.wustl.edu	37	11	57471809	57471809	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr11:57471809G>A	ENST00000431606.2	-	4	660	c.631C>T	c.(631-633)Cgg>Tgg	p.R211W	MED19_ENST00000337672.2_3'UTR			A0JLT2	MED19_HUMAN	mediator complex subunit 19	211	Lys-rich.					mediator complex (GO:0016592)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			cervix(1)|large_intestine(1)|lung(1)|ovary(2)	5						ttccttttccgttcaggatcc	0.413																																																	0																																										SO:0001583	missense	0			AY148462	CCDS7966.1	11q12.1	2008-02-05	2007-07-30		ENSG00000156603	ENSG00000156603			29600	protein-coding gene	gene with protein product		612385	"""mediator of RNA polymerase II transcription, subunit 19 homolog (S. cerevisiae)"""			9417904	Standard	NM_153450		Approved	LCMR1	uc001nlb.3	A0JLT2	OTTHUMG00000167199	ENST00000431606.2:c.631C>T	11.37:g.57471809G>A	ENSP00000416227:p.Arg211Trp		Q8IV02|Q8IZD1	Missense_Mutation	SNP	pfam_Mediator_Med19_met,pfam_DNA-dir_RNA_pol1_su_RPA34	p.R211W	ENST00000431606.2	37	c.631		11	.	.	.	.	.	.	.	.	.	.	G	18.70	3.679527	0.68042	.	.	ENSG00000156603	ENST00000431606	.	.	.	5.26	2.31	0.28768	.	.	.	.	.	T	0.77638	0.4160	.	.	.	0.58432	D	0.999992	D	0.76494	0.999	D	0.68483	0.958	T	0.79364	-0.1834	7	0.87932	D	0	-0.4614	13.5187	0.61555	0.0:0.0:0.5913:0.4087	.	211	A0JLT2	MED19_HUMAN	W	211	.	ENSP00000416227:R211W	R	-	1	2	MED19	57228385	0.975000	0.34042	0.991000	0.47740	0.996000	0.88848	1.029000	0.30140	0.207000	0.20607	-0.152000	0.13540	CGG	MED19	-	pfam_Mediator_Med19_met,pfam_DNA-dir_RNA_pol1_su_RPA34	ENSG00000156603		0.413	MED19-002	KNOWN	basic|appris_principal	protein_coding	MED19	HGNC	protein_coding	OTTHUMT00000393702.1	-	0.00	82	0	G	NM_153450		57471809	-1	tier1	-	no_errors	ENST00000431606	ensembl	human	known	74_37	missense	37.93	36	22	SNP	1.000	A
PCNXL3	399909	genome.wustl.edu	37	11	65380856	65380856	+	5'Flank	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr11:65380856G>A	ENST00000355703.3	+	0	0				MAP3K11_ENST00000309100.3_Silent_p.G124G|MAP3K11_ENST00000530153.1_5'Flank	NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)							integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						AGCCTCCAATGCCGATCACCT	0.652																																																	0													37.0	41.0	40.0					11																	65380856		2199	4291	6490	SO:0001631	upstream_gene_variant	0			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539		11.37:g.65380856G>A	Exception_encountered		Q6MZN8	Silent	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.G124	ENST00000355703.3	37	c.372	CCDS44650.1	11																																																																																			MAP3K11	-	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000173327		0.652	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K11	HGNC	protein_coding	OTTHUMT00000390321.1	-	0.00	95	0	G	NM_032223		65380856	-1	tier1	-	no_errors	ENST00000309100	ensembl	human	known	74_37	silent	10.61	59	7	SNP	0.984	A
MFSD12	126321	genome.wustl.edu	37	19	3546079	3546079	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr19:3546079G>T	ENST00000355415.2	-	8	1451	c.1282C>A	c.(1282-1284)Cct>Act	p.P428T	AC005786.7_ENST00000589360.1_RNA|MFSD12_ENST00000389395.3_Missense_Mutation_p.P428T|MFSD12_ENST00000398558.4_Missense_Mutation_p.P428T|MFSD12_ENST00000591878.1_5'Flank	NM_174983.3	NP_778148.2	Q6NUT3	MFS12_HUMAN	major facilitator superfamily domain containing 12	428					transport (GO:0006810)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				cervix(1)|endometrium(2)|lung(4)|urinary_tract(2)	9						CACGGGCAAGGGTGCAGGCTC	0.557											OREG0025153	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													79.0	88.0	85.0					19																	3546079		2076	4204	6280	SO:0001583	missense	0			AF218008	CCDS42465.1, CCDS74256.1	19p13.3	2012-03-09	2011-11-24	2011-11-24	ENSG00000161091	ENSG00000161091			28299	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 28"""	C19orf28		12477932	Standard	NM_174983		Approved	MGC20700, PP3501	uc002lxw.3	Q6NUT3		ENST00000355415.2:c.1282C>A	19.37:g.3546079G>T	ENSP00000347583:p.Pro428Thr	612	A8MXP7|D6W615|E9PAJ8|Q8N459	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.P428T	ENST00000355415.2	37	c.1282	CCDS42465.1	19	.	.	.	.	.	.	.	.	.	.	G	23.2	4.391683	0.83011	.	.	ENSG00000161091	ENST00000389395;ENST00000398558;ENST00000355415	T;T;T	0.20598	2.1;2.06;2.37	4.79	4.79	0.61399	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.48960	0.1529	M	0.84585	2.705	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.985;0.995;1.0	T	0.51260	-0.8728	10	0.15952	T	0.53	-39.0286	16.8209	0.85745	0.0:0.0:1.0:0.0	.	428;419;428	Q6NUT3;Q6NUT3-2;A8MXP7	CS028_HUMAN;.;.	T	428	ENSP00000374046:P428T;ENSP00000381566:P428T;ENSP00000347583:P428T	ENSP00000347583:P428T	P	-	1	0	C19orf28	3497079	1.000000	0.71417	0.986000	0.45419	0.807000	0.45602	8.949000	0.93012	2.201000	0.70794	0.561000	0.74099	CCT	MFSD12	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000161091		0.557	MFSD12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MFSD12	HGNC	protein_coding	OTTHUMT00000452949.2	-	0.00	35	0	G	NM_174983		3546079	-1	tier1	-	no_errors	ENST00000398558	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
MIEF1	54471	genome.wustl.edu	37	22	39909685	39909685	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr22:39909685G>A	ENST00000325301.2	+	6	1173	c.749G>A	c.(748-750)cGc>cAc	p.R250H	MIEF1_ENST00000402881.1_Missense_Mutation_p.R250H|MIEF1_ENST00000404569.1_Missense_Mutation_p.R250H	NM_019008.4	NP_061881.2	Q9NQG6	MID51_HUMAN	mitochondrial elongation factor 1	250					mitochondrial fission (GO:0000266)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|GDP binding (GO:0019003)|identical protein binding (GO:0042802)	p.R250H(1)									TACTGGGACCGCTGTGTAGTA	0.527																																																	1	Substitution - Missense(1)	kidney(1)																																								SO:0001583	missense	0			AL365515	CCDS13995.1	22q13.1	2013-09-23	2013-09-23	2013-09-23	ENSG00000100335	ENSG00000100335			25979	protein-coding gene	gene with protein product		615497	"""Smith-Magenis syndrome chromosome region, candidate 7-like"""	SMCR7L		21508961, 21701560	Standard	NM_019008		Approved	FLJ20232, MiD51	uc003axx.3	Q9NQG6	OTTHUMG00000151105	ENST00000325301.2:c.749G>A	22.37:g.39909685G>A	ENSP00000327124:p.Arg250His		Q7L890|Q9BUI3	Missense_Mutation	SNP	NULL	p.R250H	ENST00000325301.2	37	c.749	CCDS13995.1	22	.	.	.	.	.	.	.	.	.	.	G	25.0	4.597280	0.87055	.	.	ENSG00000100335	ENST00000402881;ENST00000325301;ENST00000404569	T;T;T	0.08984	3.03;3.03;3.03	6.07	5.05	0.67936	.	0.043881	0.85682	N	0.000000	T	0.27205	0.0667	M	0.66297	2.02	0.80722	D	1	D;B	0.89917	1.0;0.252	D;B	0.85130	0.997;0.071	T	0.01056	-1.1466	10	0.41790	T	0.15	-19.8594	15.4926	0.75619	0.0661:0.0:0.9339:0.0	.	250;250	Q9NQG6;B0QY95	MID51_HUMAN;.	H	250	ENSP00000385110:R250H;ENSP00000327124:R250H;ENSP00000385191:R250H	ENSP00000327124:R250H	R	+	2	0	SMCR7L	38239631	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.858000	0.99539	1.581000	0.49865	0.655000	0.94253	CGC	MIEF1	-	NULL	ENSG00000100335		0.527	MIEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIEF1	HGNC	protein_coding	OTTHUMT00000321325.1		0.00	48	0	G	NM_019008		39909685	+1			no_errors	ENST00000325301	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	A
MIR137HG	400765	genome.wustl.edu	37	1	98511789	98511789	+	lincRNA	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:98511789C>T	ENST00000580305.1	-	0	0				MIR137HG_ENST00000385223.1_lincRNA	NR_039604.1				MIR137 host gene (non-protein coding)																		ctgccgccgccgccgcCACCA	0.632																																																	0													3.0	6.0	5.0					1																	98511789		306	1082	1388			0			AK094607		1p21.3	2013-05-22			ENSG00000225206	ENSG00000225206		"""Long non-coding RNAs"""	42871	non-coding RNA	RNA, long non-coding							Standard	NR_046105		Approved		uc001drx.2		OTTHUMG00000010680		1.37:g.98511789C>T				RNA	SNP	-	NULL	ENST00000580305.1	37	NULL		1																																																																																			MIR137HG	-	-	ENSG00000225206		0.632	MIR137HG-203	KNOWN	basic	miRNA	MIR137HG	HGNC	lincRNA		-	0.00	29	0	C	NR_046105		98511789	-1	tier1	-	no_errors	ENST00000424528	ensembl	human	known	74_37	rna	15.15	28	5	SNP	0.991	T
MLLT4	4301	genome.wustl.edu	37	6	168347466	168347466	+	Silent	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr6:168347466G>T	ENST00000447894.2	+	26	3417	c.3417G>T	c.(3415-3417)ggG>ggT	p.G1139G	MLLT4_ENST00000344191.4_Silent_p.G1139G|MLLT4_ENST00000392108.3_Silent_p.G1139G|MLLT4_ENST00000366806.2_Silent_p.G1139G|MLLT4_ENST00000507679.1_3'UTR|MLLT4_ENST00000392112.1_Silent_p.G1122G|MLLT4_ENST00000351017.4_Silent_p.G1146G|MLLT4_ENST00000400822.3_Silent_p.G1138G			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1139					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		CTCAAAATGGGTCTCCTGAGA	0.443			T	MLL	AL																																			Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	0													106.0	117.0	114.0					6																	168347466		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.3417G>T	6.37:g.168347466G>T			O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Silent	SNP	pfam_Ras-assoc,pfam_Dil_domain,pfam_PDZ,pfam_FHA_dom,superfamily_PDZ,superfamily_SMAD_FHA_domain,smart_Ras-assoc,smart_FHA_dom,smart_PDZ,pfscan_Dilute,pfscan_PDZ,pfscan_Ras-assoc	p.G1139	ENST00000447894.2	37	c.3417		6																																																																																			MLLT4	-	NULL	ENSG00000130396		0.443	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	MLLT4	HGNC	protein_coding	OTTHUMT00000372077.1	-	0.00	61	0	G	NM_005936		168347466	+1	tier1	-	no_errors	ENST00000366806	ensembl	human	known	74_37	silent	6.15	61	4	SNP	0.981	T
MRC2	9902	genome.wustl.edu	37	17	60743551	60743551	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:60743551G>A	ENST00000303375.5	+	3	1019	c.617G>A	c.(616-618)cGc>cAc	p.R206H		NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	206	Fibronectin type-II. {ECO:0000255|PROSITE-ProRule:PRU00479}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						AGCACGGGCCGCGAGGATGGT	0.612																																																	0													54.0	40.0	45.0					17																	60743551		2201	4300	6501	SO:0001583	missense	0			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.617G>A	17.37:g.60743551G>A	ENSP00000307513:p.Arg206His		A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin,prints_AntifreezeII	p.R206H	ENST00000303375.5	37	c.617	CCDS11634.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.205628	0.95033	.	.	ENSG00000011028	ENST00000303375	T	0.53640	0.61	4.55	4.55	0.56014	Fibronectin, type II, collagen-binding (5);Kringle-like fold (1);	0.061993	0.64402	N	0.000008	T	0.70753	0.3260	M	0.80746	2.51	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75164	-0.3414	10	0.56958	D	0.05	-26.0131	17.5058	0.87745	0.0:0.0:1.0:0.0	.	206	Q9UBG0	MRC2_HUMAN	H	206	ENSP00000307513:R206H	ENSP00000307513:R206H	R	+	2	0	MRC2	58097283	1.000000	0.71417	0.995000	0.50966	0.923000	0.55619	9.657000	0.98554	2.368000	0.80403	0.561000	0.74099	CGC	MRC2	-	pfam_FN_type2_col-bd,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	ENSG00000011028		0.612	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC2	HGNC	protein_coding	OTTHUMT00000445152.1	-	0.00	30	0	G			60743551	+1	tier1	-	no_errors	ENST00000303375	ensembl	human	known	74_37	missense	32.35	23	11	SNP	0.987	A
MRPL2	51069	genome.wustl.edu	37	6	43024117	43024117	+	Missense_Mutation	SNP	C	C	T	rs143952438		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr6:43024117C>T	ENST00000388752.3	-	3	756	c.332G>A	c.(331-333)cGt>cAt	p.R111H	CUL7_ENST00000535468.1_5'Flank|MRPL2_ENST00000489623.1_Intron|MRPL2_ENST00000230413.5_Missense_Mutation_p.R111H|CUL7_ENST00000265348.3_5'Flank	NM_015950.3	NP_057034.2	Q5T653	RM02_HUMAN	mitochondrial ribosomal protein L2	111					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(2)	9		Ovarian(999;0.0014)	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)		AGGCCGGAAACGCAGAAAGTC	0.522																																																	0								C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	107.0	94.0	98.0		332	5.6	1.0	6	dbSNP_134	98	0,8600		0,0,4300	no	missense	MRPL2	NM_015950.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	111/306	43024117	1,13005	2203	4300	6503	SO:0001583	missense	0			AB051617	CCDS34454.1, CCDS75458.1	6p21.3	2012-09-13			ENSG00000112651	ENSG00000112651		"""Mitochondrial ribosomal proteins / large subunits"""	14056	protein-coding gene	gene with protein product		611822					Standard	XM_005249161		Approved	MRP-L14, RPML14, CGI-22	uc003ots.1	Q5T653	OTTHUMG00000014719	ENST00000388752.3:c.332G>A	6.37:g.43024117C>T	ENSP00000373404:p.Arg111His		B2RC56|Q8WUL1|Q96Q56|Q9Y311	Missense_Mutation	SNP	pfam_Ribosomal_L2_C,pfam_Rbsml_prot_L2_RNA-bd_dom,superfamily_Translation_prot_SH3-like,superfamily_NA-bd_OB-fold	p.R111H	ENST00000388752.3	37	c.332	CCDS34454.1	6	.	.	.	.	.	.	.	.	.	.	c	33	5.218500	0.95104	2.27E-4	0.0	ENSG00000112651	ENST00000388752;ENST00000230413	T	0.69306	-0.39	5.64	5.64	0.86602	Nucleic acid-binding, OB-fold-like (1);Ribosomal Proteins L2, RNA binding domain (1);Nucleic acid-binding, OB-fold (1);	0.000000	0.85682	D	0.000000	D	0.86192	0.5874	H	0.95402	3.665	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.964	D	0.89771	0.3954	10	0.87932	D	0	-14.6838	17.8827	0.88845	0.0:1.0:0.0:0.0	.	111;111	B4DVE2;Q5T653	.;RM02_HUMAN	H	111	ENSP00000373404:R111H	ENSP00000230413:R111H	R	-	2	0	MRPL2	43132095	1.000000	0.71417	0.986000	0.45419	0.915000	0.54546	7.360000	0.79487	2.658000	0.90341	0.651000	0.88453	CGT	MRPL2	-	pfam_Rbsml_prot_L2_RNA-bd_dom,superfamily_NA-bd_OB-fold	ENSG00000112651		0.522	MRPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL2	HGNC	protein_coding	OTTHUMT00000040577.2	-	0.00	76	0	C			43024117	-1	tier1	rs143952438	no_errors	ENST00000388752	ensembl	human	known	74_37	missense	8.77	52	5	SNP	0.998	T
MSN	4478	genome.wustl.edu	37	X	64959699	64959699	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:64959699C>T	ENST00000360270.5	+	13	1850	c.1678C>T	c.(1678-1680)Cgc>Tgc	p.R560C		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	560					cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)		MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						CAAGACCCTGCGCCAGATCCG	0.542			T	ALK	ALCL																																			Dom	yes		X	Xq11.2-q12	4478	moesin		L	0													123.0	98.0	106.0					X																	64959699		2203	4300	6503	SO:0001583	missense	0			M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.1678C>T	X.37:g.64959699C>T	ENSP00000353408:p.Arg560Cys			Missense_Mutation	SNP	pirsf_ERM,pfam_ERM_C_dom,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin_tail,smart_Band_41_domain,prints_Ez/rad/moesin_like,prints_Band_41_fam,pfscan_FERM_domain	p.R560C	ENST00000360270.5	37	c.1678	CCDS14382.1	X	.	.	.	.	.	.	.	.	.	.	C	22.5	4.297814	0.81025	.	.	ENSG00000147065	ENST00000360270	D	0.88277	-2.36	5.67	5.67	0.87782	Moesin (1);Ezrin/radixin/moesin, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95551	0.8554	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96138	0.9098	10	0.66056	D	0.02	.	17.135	0.86737	0.0:1.0:0.0:0.0	.	560	P26038	MOES_HUMAN	C	560	ENSP00000353408:R560C	ENSP00000353408:R560C	R	+	1	0	MSN	64876424	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.847000	0.62867	2.368000	0.80403	0.594000	0.82650	CGC	MSN	-	pirsf_ERM,pfam_ERM_C_dom,superfamily_Moesin_tail,prints_Ez/rad/moesin_like	ENSG00000147065		0.542	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSN	HGNC	protein_coding	OTTHUMT00000056981.1	-	0.00	63	0	C	NM_002444		64959699	+1	tier1	-	no_errors	ENST00000360270	ensembl	human	known	74_37	missense	41.43	41	29	SNP	1.000	T
MT-ND2	4536	genome.wustl.edu	37	M	1660	1660	+	5'Flank	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrM:1660G>A	ENST00000361453.3	+	0	0				MT-TF_ENST00000387314.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TQ_ENST00000387372.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TI_ENST00000387365.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						TCAACTTAACTTGACCGCTCT	0.433																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.1660G>A	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			MT-TV	-	-	ENSG00000210077		0.433	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-TV	HGNC	protein_coding		-	0.00	9	0	G	YP_003024027		1660	+1	tier1	-	no_errors	ENST00000387342	ensembl	human	known	74_37	rna	100.00	0	4	SNP	NULL	A
MT-ND2	4536	genome.wustl.edu	37	M	2392	2392	+	5'Flank	SNP	T	T	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrM:2392T>C	ENST00000361453.3	+	0	0				MT-TF_ENST00000387314.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TQ_ENST00000387372.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TI_ENST00000387365.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						CAATATCTACAATCAACCAAC	0.388																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2392T>C	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			MT-RNR2	-	-	ENSG00000210082		0.388	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		-	0.00	263	0	T	YP_003024027		2392	+1	tier1	-	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	71.88	45	115	SNP	NULL	C
MTUS1	57509	genome.wustl.edu	37	8	17504627	17504627	+	Intron	DEL	A	A	-	rs565891321|rs538935142	byFrequency	TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr8:17504627delA	ENST00000262102.6	-	14	3726				MTUS1_ENST00000381861.3_Intron|MTUS1_ENST00000519263.1_Intron|MTUS1_ENST00000381869.3_Intron|MTUS1_ENST00000544260.1_Intron|MTUS1_ENST00000400046.1_Intron|MTUS1_ENST00000297488.6_Intron|MTUS1_ENST00000518713.1_5'Flank	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1						cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		ATACAATATTAAAAAAAAAAC	0.333																																																	0													47.0	45.0	45.0					8																	17504627		1805	4071	5876	SO:0001627	intron_variant	0			AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.3502-39T>-	8.37:g.17504627delA			A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	RNA	DEL	-	NULL	ENST00000262102.6	37	NULL	CCDS43717.1	8																																																																																			MTUS1	-	-	ENSG00000129422		0.333	MTUS1-001	KNOWN	basic|CCDS	protein_coding	MTUS1	HGNC	protein_coding	OTTHUMT00000375247.1		0.00	29	0	A	XM_372031		17504627	-1	tier1		no_errors	ENST00000518889	ensembl	human	putative	74_37	rna	8.00	23	2	DEL	0.000	-
MUC16	94025	genome.wustl.edu	37	19	9063745	9063745	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr19:9063745C>T	ENST00000397910.4	-	3	23904	c.23701G>A	c.(23701-23703)Gca>Aca	p.A7901T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7903	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTTATTTCTGCTGATTCTGTC	0.493																																																	0													223.0	203.0	210.0					19																	9063745		2020	4182	6202	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.23701G>A	19.37:g.9063745C>T	ENSP00000381008:p.Ala7901Thr		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.A7901T	ENST00000397910.4	37	c.23701	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	5.430	0.264395	0.10294	.	.	ENSG00000181143	ENST00000397910	T	0.02709	4.19	2.05	-0.384	0.12474	.	.	.	.	.	T	0.02649	0.0080	L	0.34521	1.04	.	.	.	B	0.06786	0.001	B	0.04013	0.001	T	0.27157	-1.0082	8	0.87932	D	0	.	6.3812	0.21536	0.0:0.6765:0.0:0.3235	.	7901	B5ME49	.	T	7901	ENSP00000381008:A7901T	ENSP00000381008:A7901T	A	-	1	0	MUC16	8924745	0.000000	0.05858	0.000000	0.03702	0.109000	0.19521	-0.420000	0.07062	-0.285000	0.09089	-1.137000	0.01932	GCA	MUC16	-	NULL	ENSG00000181143		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	82	0	C	NM_024690		9063745	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.000	T
MUC5B	727897	genome.wustl.edu	37	11	1247857	1247857	+	Missense_Mutation	SNP	C	C	T	rs369252177		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr11:1247857C>T	ENST00000529681.1	+	4	270	c.212C>T	c.(211-213)gCg>gTg	p.A71V	MUC5B_ENST00000447027.1_Missense_Mutation_p.A71V	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	71					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTGAACCCGGCGCACAATGGG	0.647																																																	0								C	VAL/ALA	1,4137		0,1,2068	22.0	23.0	22.0		212	3.5	0.0	11		22	0,8374		0,0,4187	no	missense	MUC5B	NM_002458.2	64	0,1,6255	TT,TC,CC		0.0,0.0242,0.0080	benign	71/5763	1247857	1,12511	2069	4187	6256	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.212C>T	11.37:g.1247857C>T	ENSP00000436812:p.Ala71Val		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.A71V	ENST00000529681.1	37	c.212	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	C	10.90	1.481724	0.26598	2.42E-4	0.0	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.16743	2.32;2.51	3.54	3.54	0.40534	von Willebrand factor, type D domain (1);	.	.	.	.	T	0.15262	0.0368	L	0.54323	1.7	0.09310	N	1	B;P;P	0.43885	0.136;0.82;0.82	B;B;B	0.34590	0.027;0.186;0.186	T	0.16867	-1.0388	9	0.87932	D	0	.	9.1885	0.37184	0.0:0.8987:0.0:0.1013	.	71;727;71	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	V	71;71;71;104	ENSP00000436812:A71V;ENSP00000415793:A71V	ENSP00000343037:A71V	A	+	2	0	MUC5B	1204433	0.017000	0.18338	0.032000	0.17829	0.012000	0.07955	1.598000	0.36740	1.813000	0.52934	0.561000	0.74099	GCG	MUC5B	-	smart_VWF_type-D	ENSG00000117983		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2		0.00	37	0	C	XM_001126093		1247857	+1			no_errors	ENST00000447027	ensembl	human	known	74_37	missense	10.71	25	3	SNP	0.009	T
MYH7B	57644	genome.wustl.edu	37	20	33570357	33570357	+	Splice_Site	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr20:33570357C>T	ENST00000262873.7	+	8	841	c.749C>T	c.(748-750)gCc>gTc	p.A250V		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	208	Myosin motor.					membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GGCAAGAAGGCCGTAAGACTT	0.517																																																	0													49.0	53.0	51.0					20																	33570357		1976	4155	6131	SO:0001630	splice_region_variant	0			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.750+1C>T	20.37:g.33570357C>T			Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A250V	ENST00000262873.7	37	c.749	CCDS42869.1	20	.	.	.	.	.	.	.	.	.	.	C	14.60	2.584479	0.46110	.	.	ENSG00000078814	ENST00000262873	T	0.71461	-0.57	4.83	4.83	0.62350	Myosin head, motor domain (2);	0.000000	0.37669	N	0.001987	T	0.44052	0.1275	N	0.04018	-0.295	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39333	-0.9619	10	0.30078	T	0.28	.	6.7747	0.23613	0.0:0.5732:0.3313:0.0955	.	208	A7E2Y1	MYH7B_HUMAN	V	250	ENSP00000262873:A250V	ENSP00000262873:A250V	A	+	2	0	MYH7B	33034018	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.458000	0.45014	2.504000	0.84457	0.511000	0.50034	GCC	MYH7B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000078814		0.517	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2	-	0.00	62	0	C	NM_020884	Missense_Mutation	33570357	+1	tier1	-	no_errors	ENST00000262873	ensembl	human	novel	74_37	missense	8.14	79	7	SNP	1.000	T
MYOM1	8736	genome.wustl.edu	37	18	3187493	3187493	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr18:3187493T>G	ENST00000356443.4	-	5	1247	c.914A>C	c.(913-915)gAa>gCa	p.E305A	RP13-270P17.2_ENST00000580139.1_RNA|MYOM1_ENST00000400569.3_Missense_Mutation_p.E305A|MYOM1_ENST00000261606.7_Missense_Mutation_p.E305A	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	305	Ig-like C2-type 1.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						GACACGAGGTTCTGGCCAGCC	0.438																																																	0													157.0	148.0	151.0					18																	3187493		1981	4150	6131	SO:0001583	missense	0			AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.914A>C	18.37:g.3187493T>G	ENSP00000348821:p.Glu305Ala		Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.E305A	ENST00000356443.4	37	c.914	CCDS45824.1	18	.	.	.	.	.	.	.	.	.	.	T	12.24	1.878060	0.33162	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.68181	-0.31;-0.31;-0.31	5.4	4.22	0.49857	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.236177	0.43579	N	0.000549	T	0.53110	0.1776	L	0.37507	1.11	0.35648	D	0.811551	B;B	0.14012	0.009;0.003	B;B	0.16289	0.013;0.015	T	0.53229	-0.8468	10	0.11794	T	0.64	.	12.5403	0.56165	0.0:0.0:0.2612:0.7388	.	305;305	P52179-2;P52179	.;MYOM1_HUMAN	A	305	ENSP00000348821:E305A;ENSP00000383413:E305A;ENSP00000261606:E305A	ENSP00000261606:E305A	E	-	2	0	MYOM1	3177493	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.118000	0.41949	0.961000	0.38030	0.455000	0.32223	GAA	MYOM1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000101605		0.438	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYOM1	HGNC	protein_coding	OTTHUMT00000441037.2		0.00	105	0	T	NM_003803		3187493	-1			no_errors	ENST00000356443	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	G
NACA	4666	genome.wustl.edu	37	12	57112994	57112994	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr12:57112994C>G	ENST00000454682.1	-	3	2601	c.2320G>C	c.(2320-2322)Gac>Cac	p.D774H	NACA_ENST00000546392.1_Intron|NACA_ENST00000550952.1_Intron|NACA_ENST00000552540.1_Intron|NACA_ENST00000548563.1_Intron|NACA_ENST00000551793.1_Intron|NACA_ENST00000356769.3_Intron|NACA_ENST00000393891.4_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	774	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						GCACCAGAGTCCTCAGTTGGG	0.488			T	BCL6	NHL																																			Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	0													44.0	41.0	42.0					12																	57112994		1568	3582	5150	SO:0001583	missense	0			X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.2320G>C	12.37:g.57112994C>G	ENSP00000403817:p.Asp774His			Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx_dom,superfamily_UBA-like,pfscan_Nas_poly-pep-assoc_cplx_dom	p.D774H	ENST00000454682.1	37	c.2320		12	.	.	.	.	.	.	.	.	.	.	C	10.18	1.279237	0.23307	.	.	ENSG00000196531	ENST00000454682	T	0.58060	0.36	1.95	1.95	0.26073	.	.	.	.	.	T	0.56572	0.1994	.	.	.	0.19775	N	0.999958	D	0.67145	0.996	P	0.55112	0.769	T	0.42632	-0.9440	7	.	.	.	.	7.9032	0.29746	0.0:1.0:0.0:0.0	.	774	E9PAV3	.	H	774	ENSP00000403817:D774H	.	D	-	1	0	NACA	55399261	0.002000	0.14202	0.609000	0.28983	0.680000	0.39746	0.350000	0.20079	1.039000	0.40074	0.449000	0.29647	GAC	NACA	-	NULL	ENSG00000196531		0.488	NACA-201	KNOWN	basic	protein_coding	NACA	HGNC	protein_coding			0.00	23	0	C	NM_005594		57112994	-1			no_errors	ENST00000454682	ensembl	human	known	74_37	missense	15.38	11	2	SNP	0.784	G
NBEA	26960	genome.wustl.edu	37	13	35806721	35806721	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr13:35806721T>G	ENST00000400445.3	+	34	6275	c.5741T>G	c.(5740-5742)cTt>cGt	p.L1914R	NBEA_ENST00000310336.4_Missense_Mutation_p.L1914R|NBEA_ENST00000540320.1_Missense_Mutation_p.L1914R|NBEA_ENST00000379939.2_Missense_Mutation_p.L1911R	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1914					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TCTCGTACACTTCTTGGCAGT	0.338																																																	0													58.0	52.0	54.0					13																	35806721		1816	4067	5883	SO:0001583	missense	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.5741T>G	13.37:g.35806721T>G	ENSP00000383295:p.Leu1914Arg		B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.L1914R	ENST00000400445.3	37	c.5741	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	T	24.4	4.524761	0.85600	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	T;T;T;T	0.71579	-0.58;-0.57;-0.57;-0.58	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.83732	0.5318	M	0.75085	2.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.85935	0.1454	10	0.87932	D	0	.	15.5776	0.76404	0.0:0.0:0.0:1.0	.	1914;1911	Q8NFP9;Q5T321	NBEA_HUMAN;.	R	1914;1914;1911;1914;541	ENSP00000440951:L1914R;ENSP00000383295:L1914R;ENSP00000369271:L1911R;ENSP00000308534:L1914R	ENSP00000308534:L1914R	L	+	2	0	NBEA	34704721	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.846000	0.86887	2.093000	0.63338	0.533000	0.62120	CTT	NBEA	-	NULL	ENSG00000172915		0.338	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		-	0.00	46	0	T	NM_015678		35806721	+1	tier1	-	no_errors	ENST00000310336	ensembl	human	known	74_37	missense	30.51	41	18	SNP	1.000	G
NEU4	129807	genome.wustl.edu	37	2	242756291	242756291	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:242756291C>T	ENST00000391969.2	+	4	1115	c.404C>T	c.(403-405)tCg>tTg	p.S135L	NEU4_ENST00000405370.1_Missense_Mutation_p.S135L|NEU4_ENST00000404257.1_Missense_Mutation_p.S147L|NEU4_ENST00000407683.1_Missense_Mutation_p.S135L|NEU4_ENST00000325935.6_Missense_Mutation_p.S148L	NM_001167602.1	NP_001161074.1	Q8WWR8	NEUR4_HUMAN	sialidase 4	135					ganglioside catabolic process (GO:0006689)|glycoprotein catabolic process (GO:0006516)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|organelle inner membrane (GO:0019866)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			breast(1)|lung(10)|prostate(2)|skin(2)	15		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		GCCGGCCTCTCGTGGGGCAGC	0.716																																																	0													6.0	7.0	7.0					2																	242756291		2060	4078	6138	SO:0001583	missense	0			BC012899	CCDS2553.1, CCDS54441.1, CCDS54442.1	2q37.3	2008-02-05			ENSG00000204099	ENSG00000204099			21328	protein-coding gene	gene with protein product		608527					Standard	NM_001167600		Approved		uc010fzr.3	Q8WWR8	OTTHUMG00000133412	ENST00000391969.2:c.404C>T	2.37:g.242756291C>T	ENSP00000375830:p.Ser135Leu		A8K056|J3KNJ5|Q96D64	Missense_Mutation	SNP	superfamily_Sialidases	p.S148L	ENST00000391969.2	37	c.443	CCDS54442.1	2	.	.	.	.	.	.	.	.	.	.	C	12.72	2.021311	0.35701	.	.	ENSG00000204099	ENST00000407683;ENST00000405370;ENST00000472793;ENST00000423583;ENST00000404257;ENST00000391969;ENST00000325935;ENST00000420288	D;D;D;D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01	4.57	1.46	0.22682	Neuraminidase (2);	0.350770	0.31734	N	0.007150	D	0.87334	0.6151	M	0.75085	2.285	0.25790	N	0.984626	P;P;P	0.51791	0.919;0.901;0.948	P;B;P	0.52481	0.448;0.32;0.7	T	0.80872	-0.1188	10	0.87932	D	0	-22.3923	10.4691	0.44626	0.1024:0.4206:0.477:0.0	.	147;147;135	A8K211;Q8WWR8-2;Q8WWR8	.;.;NEUR4_HUMAN	L	135;135;145;135;147;135;148;135	ENSP00000385402:S135L;ENSP00000384804:S135L;ENSP00000397860:S135L;ENSP00000385149:S147L;ENSP00000375830:S135L;ENSP00000320318:S148L;ENSP00000388707:S135L	ENSP00000320318:S148L	S	+	2	0	NEU4	242404964	0.985000	0.35326	0.011000	0.14972	0.068000	0.16541	1.063000	0.30567	0.327000	0.23409	0.462000	0.41574	TCG	NEU4	-	superfamily_Sialidases	ENSG00000204099		0.716	NEU4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NEU4	HGNC	protein_coding	OTTHUMT00000257270.2	-	0.00	36	0	C	NM_080741		242756291	+1	tier1	-	no_errors	ENST00000325935	ensembl	human	known	74_37	missense	34.00	33	17	SNP	0.929	T
NME8	51314	genome.wustl.edu	37	7	37924817	37924817	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr7:37924817A>G	ENST00000199447.4	+	14	1582	c.1210A>G	c.(1210-1212)Aga>Gga	p.R404G	EPDR1_ENST00000476620.1_Intron|NME8_ENST00000440017.1_Missense_Mutation_p.R404G	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	404	NDK 2.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)										ACTGGGACCAAGAACTGTTGA	0.383																																																	0													90.0	81.0	84.0					7																	37924817		2203	4300	6503	SO:0001583	missense	0			AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.1210A>G	7.37:g.37924817A>G	ENSP00000199447:p.Arg404Gly		Q9NZH1	Missense_Mutation	SNP	pfam_Nucleoside_diP_kinase,pfam_Thioredoxin_domain,superfamily_Nucleoside_diP_kinase,superfamily_Thioredoxin-like_fold,smart_Nucleoside_diP_kinase	p.R404G	ENST00000199447.4	37	c.1210	CCDS5452.1	7	.	.	.	.	.	.	.	.	.	.	A	4.507	0.094001	0.08632	.	.	ENSG00000086288	ENST00000199447;ENST00000440017	T;T	0.54675	0.56;0.56	3.69	3.69	0.42338	.	1.583150	0.03545	N	0.224498	T	0.33469	0.0864	N	0.03608	-0.345	0.19300	N	0.999973	B	0.02656	0.0	B	0.06405	0.002	T	0.12293	-1.0553	10	0.29301	T	0.29	-0.3598	10.7015	0.45931	1.0:0.0:0.0:0.0	.	404	Q8N427	TXND3_HUMAN	G	404	ENSP00000199447:R404G;ENSP00000397063:R404G	ENSP00000199447:R404G	R	+	1	2	TXNDC3	37891342	0.976000	0.34144	0.753000	0.31225	0.043000	0.13939	2.542000	0.45744	1.905000	0.55150	0.460000	0.39030	AGA	NME8	-	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase	ENSG00000086288		0.383	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME8	HGNC	protein_coding	OTTHUMT00000219946.1	-	0.00	122	0	A	NM_016616		37924817	+1	tier1	-	no_errors	ENST00000199447	ensembl	human	known	74_37	missense	16.67	95	19	SNP	0.898	G
NMT1	4836	genome.wustl.edu	37	17	43171133	43171133	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:43171133T>G	ENST00000592782.1	+	5	597	c.466T>G	c.(466-468)Ttc>Gtc	p.F156V	NMT1_ENST00000590114.1_3'UTR|NMT1_ENST00000258960.2_Missense_Mutation_p.F156V			P30419	NMT1_HUMAN	N-myristoyltransferase 1	156					apoptotic process (GO:0006915)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	8		Prostate(33;0.155)				GCCCCAGGGCTTCACCTGGGA	0.602																																																	0													74.0	64.0	68.0					17																	43171133		2203	4300	6503	SO:0001583	missense	0				CCDS11494.1	17q21.31	2012-10-02			ENSG00000136448	ENSG00000136448			7857	protein-coding gene	gene with protein product	"""alternative, short form NMT-S"", ""myristoyl-CoA:protein N-myristoyltransferase"", ""long form, NMT-L"""	160993				1570339	Standard	NM_021079		Approved	NMT	uc002ihz.3	P30419	OTTHUMG00000180003	ENST00000592782.1:c.466T>G	17.37:g.43171133T>G	ENSP00000468424:p.Phe156Val		A8K7C1|Q9UE09	Missense_Mutation	SNP	pfam_MyristoylCoA_TrFase_C,pfam_MyristoylCoA_TrFase_N,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase	p.F156V	ENST00000592782.1	37	c.466	CCDS11494.1	17	.	.	.	.	.	.	.	.	.	.	T	32	5.110860	0.94292	.	.	ENSG00000136448	ENST00000258960	T	0.61158	0.13	5.02	5.02	0.67125	Acyl-CoA N-acyltransferase (2);Myristoyl-CoA:protein N-myristoyltransferase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.84197	0.5419	H	0.97291	3.975	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.89937	0.4070	10	0.87932	D	0	-14.9955	15.1981	0.73112	0.0:0.0:0.0:1.0	.	156	P30419	NMT1_HUMAN	V	156	ENSP00000258960:F156V	ENSP00000258960:F156V	F	+	1	0	NMT1	40526659	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.868000	0.87116	2.233000	0.73108	0.533000	0.62120	TTC	NMT1	-	pfam_MyristoylCoA_TrFase_N,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase	ENSG00000136448		0.602	NMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMT1	HGNC	protein_coding	OTTHUMT00000449239.1	-	0.00	77	0	T	NM_021079		43171133	+1	tier1	-	no_errors	ENST00000258960	ensembl	human	known	74_37	missense	16.28	36	7	SNP	1.000	G
NRXN2	9379	genome.wustl.edu	37	11	64434787	64434787	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr11:64434787G>A	ENST00000377551.1	-	8	1944	c.1733C>T	c.(1732-1734)gCa>gTa	p.A578V	NRXN2_ENST00000265459.6_Missense_Mutation_p.A578V|NRXN2_ENST00000409571.1_Missense_Mutation_p.A571V|NRXN2_ENST00000377559.3_Missense_Mutation_p.A547V			Q9P2S2	NRX2A_HUMAN	neurexin 2	578	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						GCGGCTGGATGCCCGCAGCTT	0.602																																																	0													94.0	83.0	87.0					11																	64434787		2201	4297	6498	SO:0001583	missense	0				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.1733C>T	11.37:g.64434787G>A	ENSP00000366774:p.Ala578Val		A7E2C1|Q9Y2D6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.A578V	ENST00000377551.1	37	c.1733	CCDS8077.1	11	.	.	.	.	.	.	.	.	.	.	G	18.09	3.545526	0.65198	.	.	ENSG00000110076	ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571	T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11	4.63	4.63	0.57726	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.42053	U	0.000780	T	0.74351	0.3705	L	0.28608	0.87	0.58432	D	0.999998	P;P;B	0.49090	0.919;0.83;0.153	B;P;B	0.49085	0.288;0.6;0.124	T	0.78033	-0.2362	10	0.62326	D	0.03	.	15.0038	0.71495	0.0:0.0:1.0:0.0	.	547;578;324	Q9P2S2-2;Q9P2S2;E7EV67	.;NRX2A_HUMAN;.	V	578;547;578;547;571	ENSP00000366774:A578V;ENSP00000366782:A547V;ENSP00000265459:A578V;ENSP00000386416:A571V	ENSP00000265459:A578V	A	-	2	0	NRXN2	64191363	1.000000	0.71417	0.959000	0.39883	0.992000	0.81027	7.773000	0.85462	2.392000	0.81423	0.462000	0.41574	GCA	NRXN2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000110076		0.602	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRXN2	HGNC	protein_coding	OTTHUMT00000104967.3	-	0.00	51	0	G	NM_015080		64434787	-1	tier1	-	no_errors	ENST00000265459	ensembl	human	known	74_37	missense	42.55	27	20	SNP	0.996	A
NUGGC	389643	genome.wustl.edu	37	8	27922180	27922180	+	Silent	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr8:27922180G>A	ENST00000413272.2	-	7	922	c.780C>T	c.(778-780)gcC>gcT	p.A260A	NUGGC_ENST00000341513.6_Silent_p.A260A	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	260					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										GCATCTCAGCGGCCTCTCCAT	0.562																																																	0													83.0	86.0	85.0					8																	27922180		2146	4247	6393	SO:0001819	synonymous_variant	0			AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.780C>T	8.37:g.27922180G>A			Q6ZP73	Silent	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase	p.A260	ENST00000413272.2	37	c.780	CCDS47833.1	8																																																																																			NUGGC	-	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase	ENSG00000189233		0.562	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUGGC	HGNC	protein_coding	OTTHUMT00000342494.1	-	0.00	81	0	G	NM_001010906		27922180	-1	tier1	-	no_errors	ENST00000341513	ensembl	human	known	74_37	silent	17.24	48	10	SNP	0.000	A
NUP210	23225	genome.wustl.edu	37	3	13372036	13372036	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr3:13372036A>T	ENST00000254508.5	-	30	4116	c.4034T>A	c.(4033-4035)aTg>aAg	p.M1345K		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1345					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					TGTCCCGATCATAGACCCTGA	0.507																																																	0													195.0	180.0	185.0					3																	13372036		2203	4300	6503	SO:0001583	missense	0			AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.4034T>A	3.37:g.13372036A>T	ENSP00000254508:p.Met1345Lys		A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,superfamily_Cadherin-like,smart_Big_2	p.M1345K	ENST00000254508.5	37	c.4034	CCDS33704.1	3	.	.	.	.	.	.	.	.	.	.	A	5.559	0.288085	0.10513	.	.	ENSG00000132182	ENST00000254508	T	0.04049	3.72	5.44	-5.63	0.02474	.	1.060040	0.07313	N	0.876212	T	0.02380	0.0073	N	0.22421	0.69	0.09310	N	1	B	0.16396	0.017	B	0.15870	0.014	T	0.47611	-0.9104	10	0.05721	T	0.95	0.204	5.0725	0.14613	0.2819:0.1178:0.4909:0.1094	.	1345	Q8TEM1	PO210_HUMAN	K	1345	ENSP00000254508:M1345K	ENSP00000254508:M1345K	M	-	2	0	NUP210	13347036	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	1.321000	0.33678	-1.266000	0.02446	0.460000	0.39030	ATG	NUP210	-	NULL	ENSG00000132182		0.507	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	NUP210	HGNC	protein_coding	OTTHUMT00000340085.1	-	0.00	97	0	A	NM_024923		13372036	-1	tier1	-	no_errors	ENST00000254508	ensembl	human	known	74_37	missense	44.44	35	28	SNP	0.000	T
NXF2B	728343	genome.wustl.edu	37	X	101620155	101620155	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:101620155C>A	ENST00000372750.1	-	20	2090	c.1291G>T	c.(1291-1293)Gac>Tac	p.D431Y	NXF2B_ENST00000372749.1_Missense_Mutation_p.D431Y|NXF2B_ENST00000489531.1_5'UTR|NXF2B_ENST00000457521.2_Missense_Mutation_p.D431Y|NXF2B_ENST00000412230.2_Missense_Mutation_p.D431Y|NXF2B_ENST00000372752.1_Missense_Mutation_p.D343Y			Q9GZY0	NXF2_HUMAN	nuclear RNA export factor 2B	431	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|kidney(1)|lung(4)|ovary(1)	7						GGGGCTGAGTCCTTGGGGTCG	0.582																																																	0													59.0	61.0	60.0					X																	101620155		957	1961	2918	SO:0001583	missense	0				CCDS43979.1	Xq22.1	2013-05-14			ENSG00000185945	ENSG00000269437			23984	protein-coding gene	gene with protein product						16382448	Standard	NM_001099686		Approved	bA353J17.1		Q9GZY0	OTTHUMG00000154920	ENST00000372750.1:c.1291G>T	X.37:g.101620155C>A	ENSP00000361836:p.Asp431Tyr		Q9BXU4|Q9NSS1|Q9NX66	Missense_Mutation	SNP	pfam_Tap_RNA-bd,pfam_TAP_C_dom,pfam_NTF2,superfamily_UBA-like,smart_TAP_C_dom,pfscan_Nuclear_transport_factor_2_euk	p.D431Y	ENST00000372750.1	37	c.1291	CCDS43979.1	X	.	.	.	.	.	.	.	.	.	.	.	12.97	2.097292	0.37048	.	.	ENSG00000185945	ENST00000372752;ENST00000457521;ENST00000372749;ENST00000372750;ENST00000412230	T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05	3.67	1.89	0.25635	.	0.178223	0.46145	D	0.000315	T	0.48277	0.1491	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.32079	-0.9920	7	0.23891	T	0.37	-15.1258	7.1564	0.25639	0.0:0.7598:0.0:0.2402	.	.	.	.	Y	343;431;431;431;431	ENSP00000361838:D343Y;ENSP00000396447:D431Y;ENSP00000361835:D431Y;ENSP00000361836:D431Y;ENSP00000413087:D431Y	ENSP00000361835:D431Y	D	-	1	0	NXF2B	101506811	1.000000	0.71417	0.001000	0.08648	0.028000	0.11728	2.488000	0.45276	0.382000	0.24878	0.455000	0.32223	GAC	NXF2B	-	pfam_NTF2,pfscan_Nuclear_transport_factor_2_euk	ENSG00000185945		0.582	NXF2B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	NXF2B	HGNC	protein_coding	OTTHUMT00000058979.1	-	0.00	92	0	C			101620155	-1	tier1	-	no_errors	ENST00000372749	ensembl	human	known	74_37	missense	33.33	42	21	SNP	0.055	A
OR10H2	26538	genome.wustl.edu	37	19	15839475	15839475	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr19:15839475C>A	ENST00000305899.3	+	1	642	c.622C>A	c.(622-624)Ctg>Atg	p.L208M		NM_013939.2	NP_039227.1	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H, member 2	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(1)	27	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					TATCATGGCACTGCTGGGCTG	0.522																																																	0													246.0	194.0	212.0					19																	15839475		2203	4300	6503	SO:0001583	missense	0			AC004597	CCDS12333.1	19p13.1	2012-08-09				ENSG00000171942		"""GPCR / Class A : Olfactory receptors"""	8173	protein-coding gene	gene with protein product							Standard	NM_013939		Approved		uc002nbm.2	O60403		ENST00000305899.3:c.622C>A	19.37:g.15839475C>A	ENSP00000306095:p.Leu208Met		Q6IFQ1|Q96R58	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L208M	ENST00000305899.3	37	c.622	CCDS12333.1	19	.	.	.	.	.	.	.	.	.	.	.	10.30	1.311187	0.23821	.	.	ENSG00000171942	ENST00000305899	T	0.38722	1.12	3.39	3.39	0.38822	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39083	N	0.001463	T	0.55657	0.1934	M	0.63428	1.95	0.09310	N	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.41556	-0.9502	10	0.66056	D	0.02	.	6.6844	0.23136	0.0:0.8627:0.0:0.1373	.	208	O60403	O10H2_HUMAN	M	208	ENSP00000306095:L208M	ENSP00000306095:L208M	L	+	1	2	OR10H2	15700475	0.052000	0.20516	0.847000	0.33407	0.316000	0.28119	0.710000	0.25748	1.441000	0.47550	0.531000	0.56144	CTG	OR10H2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000171942		0.522	OR10H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H2	HGNC	protein_coding	OTTHUMT00000460917.1	-	0.00	142	0	C			15839475	+1	tier1	-	no_errors	ENST00000305899	ensembl	human	known	74_37	missense	11.19	119	15	SNP	0.291	A
OR4A15	81328	genome.wustl.edu	37	11	55135883	55135883	+	Missense_Mutation	SNP	C	C	T	rs374555766		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr11:55135883C>T	ENST00000314706.3	+	1	524	c.524C>T	c.(523-525)gCg>gTg	p.A175V		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	175						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						ATGCTGTTGGCGGCCTGGATT	0.443																																																	0								C	VAL/ALA	0,4402		0,0,2201	230.0	206.0	214.0		524	0.9	0.0	11		214	1,8591		0,1,4295	no	missense	OR4A15	NM_001005275.1	64	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	benign	175/345	55135883	1,12993	2201	4296	6497	SO:0001583	missense	0			AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.524C>T	11.37:g.55135883C>T	ENSP00000325065:p.Ala175Val		Q6IFL4|Q96R65	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A175V	ENST00000314706.3	37	c.524	CCDS31500.1	11	.	.	.	.	.	.	.	.	.	.	-	0.003	-2.404654	0.00195	0.0	1.16E-4	ENSG00000181958	ENST00000314706	T	0.36878	1.23	3.48	0.889	0.19212	GPCR, rhodopsin-like superfamily (1);	0.899723	0.09261	N	0.826617	T	0.13329	0.0323	N	0.05031	-0.125	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.31558	-0.9939	10	0.02654	T	1	.	4.4129	0.11441	0.0:0.1165:0.4033:0.4802	.	175	Q8NGL6	O4A15_HUMAN	V	175	ENSP00000325065:A175V	ENSP00000325065:A175V	A	+	2	0	OR4A15	54892459	0.000000	0.05858	0.028000	0.17463	0.200000	0.23975	-0.127000	0.10547	0.012000	0.14892	-0.487000	0.04747	GCG	OR4A15	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181958		0.443	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A15	HGNC	protein_coding	OTTHUMT00000391161.1	-	0.00	147	0	C	NM_001005275		55135883	+1	tier1	-	no_errors	ENST00000314706	ensembl	human	known	74_37	missense	15.56	114	21	SNP	0.000	T
OR5D13	390142	genome.wustl.edu	37	11	55541165	55541165	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr11:55541165G>T	ENST00000361760.1	+	1	252	c.252G>T	c.(250-252)ttG>ttT	p.L84F		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	84						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				CTAAACTGTTGGAGAACTTGG	0.378																																																	0													175.0	167.0	170.0					11																	55541165		2200	4296	6496	SO:0001583	missense	0			BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.252G>T	11.37:g.55541165G>T	ENSP00000354800:p.Leu84Phe		Q6IF68|Q6IFC9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L84F	ENST00000361760.1	37	c.252	CCDS31507.1	11	.	.	.	.	.	.	.	.	.	.	G	8.661	0.900529	0.17686	.	.	ENSG00000198877	ENST00000361760	T	0.10668	2.85	3.52	-1.63	0.08345	GPCR, rhodopsin-like superfamily (1);	0.000000	0.27604	U	0.018624	T	0.33089	0.0851	H	0.94620	3.56	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.10706	-1.0618	10	0.72032	D	0.01	-10.7529	3.3593	0.07181	0.3742:0.0:0.3343:0.2915	.	84	Q8NGL4	OR5DD_HUMAN	F	84	ENSP00000354800:L84F	ENSP00000354800:L84F	L	+	3	2	OR5D13	55297741	0.000000	0.05858	0.008000	0.14137	0.013000	0.08279	-1.759000	0.01808	-0.155000	0.11098	0.486000	0.48141	TTG	OR5D13	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000198877		0.378	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D13	HGNC	protein_coding	OTTHUMT00000391511.1	-	0.00	61	0	G	NM_001001967		55541165	+1	tier1	-	no_errors	ENST00000361760	ensembl	human	known	74_37	missense	26.56	47	17	SNP	0.001	T
OR8U1	219417	genome.wustl.edu	37	11	56143687	56143687	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr11:56143687G>T	ENST00000302270.1	+	1	588	c.588G>T	c.(586-588)caG>caT	p.Q196H		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					GCTTCAAACAGCTCTGGATCT	0.463																																																	0													218.0	214.0	215.0					11																	56143687		2072	4229	6301	SO:0001583	missense	0			AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.588G>T	11.37:g.56143687G>T	ENSP00000304188:p.Gln196His			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q196H	ENST00000302270.1	37	c.588	CCDS41647.1	11	.	.	.	.	.	.	.	.	.	.	G	6.958	0.546643	0.13312	.	.	ENSG00000172199	ENST00000302270	T	0.00158	8.65	5.78	3.56	0.40772	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45606	D	0.000341	T	0.00144	0.0004	L	0.45698	1.435	0.09310	N	1	B	0.20459	0.045	B	0.26614	0.071	T	0.27872	-1.0061	10	0.87932	D	0	.	8.5662	0.33540	0.1578:0.1307:0.7115:0.0	.	196	Q8NH10	OR8U1_HUMAN	H	196	ENSP00000304188:Q196H	ENSP00000304188:Q196H	Q	+	3	2	OR8U1	55900263	0.005000	0.15991	0.998000	0.56505	0.006000	0.05464	0.432000	0.21461	1.432000	0.47375	0.643000	0.83706	CAG	OR8U1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000172199		0.463	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8U1	HGNC	protein_coding	OTTHUMT00000391607.1	-	0.00	122	0	G	NM_001005204		56143687	+1	tier1	-	no_errors	ENST00000302270	ensembl	human	known	74_37	missense	10.45	120	14	SNP	0.086	T
OR5M3	219482	genome.wustl.edu	37	11	56237921	56237921	+	Missense_Mutation	SNP	C	C	T	rs142752109		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr11:56237921C>T	ENST00000312240.2	-	1	93	c.53G>A	c.(52-54)cGt>cAt	p.R18H		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R18H(1)		NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					CCATTCTCGACGGCTCGTTAG	0.398																																																	1	Substitution - Missense(1)	large_intestine(1)						C	HIS/ARG	1,4401	2.1+/-5.4	0,1,2200	79.0	69.0	72.0		53	-10.0	0.0	11	dbSNP_134	72	1,8589	1.2+/-3.3	0,1,4294	no	missense	OR5M3	NM_001004742.2	29	0,2,6494	TT,TC,CC		0.0116,0.0227,0.0154	benign	18/308	56237921	2,12990	2201	4295	6496	SO:0001583	missense	0			AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.53G>A	11.37:g.56237921C>T	ENSP00000312208:p.Arg18His		B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R18H	ENST00000312240.2	37	c.53	CCDS31532.1	11	.	.	.	.	.	.	.	.	.	.	C	0.456	-0.891453	0.02491	2.27E-4	1.16E-4	ENSG00000174937	ENST00000312240	T	0.01084	5.36	5.0	-10.0	0.00425	.	1.480890	0.04545	N	0.388897	T	0.00815	0.0027	N	0.11673	0.155	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.40646	-0.9552	10	0.27785	T	0.31	3.2324	13.3653	0.60680	0.0:0.1922:0.139:0.6688	.	18	Q8NGP4	OR5M3_HUMAN	H	18	ENSP00000312208:R18H	ENSP00000312208:R18H	R	-	2	0	OR5M3	55994497	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-8.692000	0.00017	-3.524000	0.00147	-1.708000	0.00717	CGT	OR5M3	-	NULL	ENSG00000174937		0.398	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M3	HGNC	protein_coding	OTTHUMT00000391639.1	-	0.00	47	0	C	NM_001004742		56237921	-1	tier1	rs142752109	no_errors	ENST00000312240	ensembl	human	known	74_37	missense	15.38	55	10	SNP	0.000	T
OS9	10956	genome.wustl.edu	37	12	58113911	58113911	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr12:58113911C>T	ENST00000315970.7	+	13	1671	c.1630C>T	c.(1630-1632)Cgg>Tgg	p.R544W	OS9_ENST00000389142.5_Intron|OS9_ENST00000389146.6_Missense_Mutation_p.R529W|OS9_ENST00000413095.2_Intron|OS9_ENST00000257966.8_Intron|OS9_ENST00000439210.2_Intron|RP11-571M6.7_ENST00000549477.1_RNA|OS9_ENST00000435406.2_Intron|OS9_ENST00000551035.1_Intron|OS9_ENST00000552285.1_Intron	NM_001017958.2|NM_006812.3	NP_001017958.1|NP_006803.1	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum lectin	544					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein retention in ER lumen (GO:0006621)|protein targeting (GO:0006605)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum lumen (GO:0005788)|Hrd1p ubiquitin ligase complex (GO:0000836)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	21	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			AGTCCGGGTCCGGGTCACCAA	0.572																																																	0													84.0	85.0	84.0					12																	58113911		2203	4300	6503	SO:0001583	missense	0			AB002806	CCDS31843.1, CCDS31844.1, CCDS31845.1, CCDS31846.1, CCDS58246.1, CCDS58247.1, CCDS58248.1, CCDS58249.1	12q13	2009-08-26	2009-08-26						16994	protein-coding gene	gene with protein product	"""endoplasmic reticulum lectin 2"", ""erlectin 2"""	609677				8634085, 9498564, 19346256, 18264092	Standard	NM_006812		Approved	OS-9, ERLEC2	uc001spj.3	Q13438	OTTHUMG00000170284	ENST00000315970.7:c.1630C>T	12.37:g.58113911C>T	ENSP00000318165:p.Arg544Trp		A6NDD1|A6NFR7|A6NLB2|A8K5Q9|B4DE28|B4DPX1|B4E1I6|E7ENT8|E7EW91|F8VUH2|G3XA88|O00579|Q6IBL2|Q8IZ58|Q9BW99	Missense_Mutation	SNP	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom	p.R544W	ENST00000315970.7	37	c.1630	CCDS31843.1	12	.	.	.	.	.	.	.	.	.	.	C	22.6	4.316366	0.81469	.	.	ENSG00000135506	ENST00000315970;ENST00000389146	T;T	0.37235	1.23;1.21	5.01	5.01	0.66863	.	0.056037	0.64402	D	0.000002	T	0.47340	0.1440	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.992;0.993	T	0.47368	-0.9123	10	0.87932	D	0	.	13.6794	0.62474	0.0:1.0:0.0:0.0	.	529;544	A6NLB2;Q13438	.;OS9_HUMAN	W	544;529	ENSP00000318165:R544W;ENSP00000373798:R529W	ENSP00000318165:R544W	R	+	1	2	OS9	56400178	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	1.443000	0.35057	2.599000	0.87857	0.655000	0.94253	CGG	OS9	-	NULL	ENSG00000135506		0.572	OS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OS9	HGNC	protein_coding	OTTHUMT00000408344.1	-	0.00	43	0	C	NM_006812		58113911	+1	tier1	-	no_errors	ENST00000315970	ensembl	human	known	74_37	missense	15.00	34	6	SNP	1.000	T
PARP3	10039	genome.wustl.edu	37	3	51978457	51978459	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	AAG	AAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr3:51978457_51978459delAAG	ENST00000417220.2	+	5	852_854	c.364_366delAAG	c.(364-366)aagdel	p.K123del	PARP3_ENST00000398755.3_In_Frame_Del_p.K130del|PARP3_ENST00000431474.1_In_Frame_Del_p.K123del|RRP9_ENST00000232888.6_5'Flank			Q9Y6F1	PARP3_HUMAN	poly (ADP-ribose) polymerase family, member 3	123					DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|positive regulation of DNA ligation (GO:0051106)|protein ADP-ribosylation (GO:0006471)|protein localization to site of double-strand break (GO:1990166)|regulation of mitotic spindle organization (GO:0060236)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	catalytic activity (GO:0003824)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AGAAGATGCAAAGAAGGACTTTG	0.512																																																	0																																										SO:0001651	inframe_deletion	0			AF083068	CCDS43097.1, CCDS46839.1	3p22.2-p21.1	2010-07-14	2004-08-20	2004-08-26	ENSG00000041880	ENSG00000041880	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	273	protein-coding gene	gene with protein product	"""poly(ADP-ribose) synthetase-3"", ""NAD+ ADP-ribosyltransferase 3"", ""poly(ADP-ribose) polymerase 3"""	607726	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 3"""	ADPRTL3		10329013	Standard	NM_001003931		Approved	ADPRT3, IRT1, hPARP-3, pADPRT-3	uc003dbz.3	Q9Y6F1	OTTHUMG00000156931	ENST00000417220.2:c.364_366delAAG	3.37:g.51978460_51978462delAAG	ENSP00000395951:p.Lys123del		Q8NER9|Q96CG2|Q9UG81	In_Frame_Del	DEL	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_Poly(ADP-ribose)pol_reg_dom,pfam_WGR_domain,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_WGR_domain,smart_WGR_domain,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.K130in_frame_del	ENST00000417220.2	37	c.385_387	CCDS43097.1	3																																																																																			PARP3	-	pfam_WGR_domain,superfamily_WGR_domain,smart_WGR_domain	ENSG00000041880		0.512	PARP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PARP3	HGNC	protein_coding	OTTHUMT00000348612.2		0.00	48	0	AAG	NM_005485.4		51978459	+1	tier1		no_errors	ENST00000398755	ensembl	human	known	74_37	in_frame_del	26.67	22	8	DEL	0.987:0.996:1.000	-
PBX2	5089	genome.wustl.edu	37	6	32157563	32157563	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr6:32157563C>T	ENST00000375050.4	-	1	400	c.130G>A	c.(130-132)Gtc>Atc	p.V44I		NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	44					embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.V44F(2)		endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						CCTCCCGGGACCCCCCCGCTA	0.711																																																	2	Substitution - Missense(2)	prostate(1)|lung(1)											29.0	31.0	30.0					6																	32157563		1509	2708	4217	SO:0001583	missense	0				CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.130G>A	6.37:g.32157563C>T	ENSP00000364190:p.Val44Ile		A2BFJ2	Missense_Mutation	SNP	pfam_PBX,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.V44I	ENST00000375050.4	37	c.130	CCDS4748.1	6	.	.	.	.	.	.	.	.	.	.	C	17.69	3.450951	0.63290	.	.	ENSG00000204304	ENST00000375050	D	0.82344	-1.6	4.56	4.56	0.56223	.	0.219742	0.22684	N	0.056918	T	0.52741	0.1753	N	0.14661	0.345	0.30447	N	0.775643	B;B	0.21071	0.051;0.028	B;B	0.09377	0.004;0.004	T	0.46965	-0.9153	10	0.37606	T	0.19	-5.1027	10.8156	0.46573	0.0:0.8072:0.1928:0.0	.	44;44	Q7KZE5;P40425	.;PBX2_HUMAN	I	44	ENSP00000364190:V44I	ENSP00000364190:V44I	V	-	1	0	PBX2	32265541	0.974000	0.33945	1.000000	0.80357	0.971000	0.66376	1.692000	0.37731	2.062000	0.61559	0.542000	0.68232	GTC	PBX2	-	NULL	ENSG00000204304		0.711	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PBX2	HGNC	protein_coding	OTTHUMT00000076194.4		0.00	38	0	C			32157563	-1			no_errors	ENST00000375050	ensembl	human	known	74_37	missense	13.16	33	5	SNP	1.000	T
PCDHAC1	56135	genome.wustl.edu	37	5	140308191	140308191	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr5:140308191C>T	ENST00000253807.2	+	1	1714	c.1714C>T	c.(1714-1716)Cgc>Tgc	p.R572C	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHAC1_ENST00000409700.3_Missense_Mutation_p.R572C|PCDHA6_ENST00000529310.1_Intron|PCDHA9_ENST00000532602.1_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	572	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATTGTGCCCCGCTCTGCCAG	0.488																																																	0													112.0	117.0	115.0					5																	140308191		2203	4300	6503	SO:0001583	missense	0			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.1714C>T	5.37:g.140308191C>T	ENSP00000253807:p.Arg572Cys		Q9Y5F5|Q9Y5I5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R572C	ENST00000253807.2	37	c.1714	CCDS4241.1	5	.	.	.	.	.	.	.	.	.	.	C	15.08	2.725935	0.48833	.	.	ENSG00000248383	ENST00000409700;ENST00000253807	T;T	0.51574	0.7;0.7	5.95	3.15	0.36227	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.70098	0.3185	M	0.90145	3.09	0.29521	N	0.853482	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.65162	-0.6235	9	0.87932	D	0	.	6.6807	0.23119	0.1207:0.6952:0.0:0.1841	.	572;572	Q9H158;Q9H158-2	PCDC1_HUMAN;.	C	572	ENSP00000386356:R572C;ENSP00000253807:R572C	ENSP00000253807:R572C	R	+	1	0	PCDHAC1	140288375	0.000000	0.05858	0.993000	0.49108	0.990000	0.78478	-0.364000	0.07583	0.366000	0.24427	0.563000	0.77884	CGC	PCDHAC1	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000248383		0.488	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHAC1	HGNC	protein_coding	OTTHUMT00000251798.1		0.00	23	0	C	NM_018898		140308191	+1			no_errors	ENST00000253807	ensembl	human	known	74_37	missense	16.67	20	4	SNP	0.956	T
PCDHB8	56128	genome.wustl.edu	37	5	140558400	140558400	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr5:140558400T>C	ENST00000239444.2	+	1	1030	c.785T>C	c.(784-786)gTt>gCt	p.V262A	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	262	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCTTCCTGGTTGTGAAGGTC	0.438																																																	0													201.0	267.0	245.0					5																	140558400		2203	4300	6503	SO:0001583	missense	0			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.785T>C	5.37:g.140558400T>C	ENSP00000239444:p.Val262Ala		B9EGV1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V262A	ENST00000239444.2	37	c.785	CCDS4250.1	5	.	.	.	.	.	.	.	.	.	.	T	12.18	1.861468	0.32884	.	.	ENSG00000120322	ENST00000239444	T	0.68331	-0.32	4.25	4.25	0.50352	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.81250	0.4783	M	0.93808	3.46	0.09310	N	1	P	0.46512	0.879	P	0.50708	0.648	T	0.75631	-0.3251	9	0.72032	D	0.01	.	13.0458	0.58925	0.0:0.0:0.0:1.0	.	262	Q9UN66	PCDB8_HUMAN	A	262	ENSP00000239444:V262A	ENSP00000239444:V262A	V	+	2	0	PCDHB8	140538584	0.983000	0.35010	0.001000	0.08648	0.028000	0.11728	7.997000	0.88414	1.558000	0.49541	0.477000	0.44152	GTT	PCDHB8	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000120322		0.438	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	HGNC	protein_coding	OTTHUMT00000251816.2	-	0.00	161	0	T	NM_019120		140558400	+1	tier1	-	no_errors	ENST00000239444	ensembl	human	known	74_37	missense	13.28	111	17	SNP	0.075	C
PCDHB8	56128	genome.wustl.edu	37	5	140559730	140559730	+	Silent	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr5:140559730G>A	ENST00000239444.2	+	1	2360	c.2115G>A	c.(2113-2115)tcG>tcA	p.S705S	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	705					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCTCTTCTCGGTGCTCCTGT	0.677																																																	0													98.0	97.0	98.0					5																	140559730		2202	4298	6500	SO:0001819	synonymous_variant	0			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.2115G>A	5.37:g.140559730G>A			B9EGV1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S705	ENST00000239444.2	37	c.2115	CCDS4250.1	5																																																																																			PCDHB8	-	NULL	ENSG00000120322		0.677	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	HGNC	protein_coding	OTTHUMT00000251816.2	-	0.00	175	0	G	NM_019120		140559730	+1	tier1	-	no_errors	ENST00000239444	ensembl	human	known	74_37	silent	28.37	101	40	SNP	0.021	A
PCDHGA3	56112	genome.wustl.edu	37	5	140725857	140725857	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr5:140725857T>C	ENST00000253812.6	+	1	2257	c.2257T>C	c.(2257-2259)Tat>Cat	p.Y753H	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	753					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGCAGACCTATTCCCACGA	0.642																																																	0													56.0	67.0	63.0					5																	140725857		2203	4298	6501	SO:0001583	missense	0			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.2257T>C	5.37:g.140725857T>C	ENSP00000253812:p.Tyr753His		Q9Y5D4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Y753H	ENST00000253812.6	37	c.2257	CCDS47290.1	5	.	.	.	.	.	.	.	.	.	.	.	25.3	4.625947	0.87560	.	.	ENSG00000254245	ENST00000253812	T	0.51071	0.72	5.33	5.33	0.75918	.	0.000000	0.30752	U	0.008958	T	0.63780	0.2540	M	0.89095	3.005	0.27312	N	0.957277	P;P	0.46621	0.681;0.881	P;P	0.48304	0.573;0.56	T	0.66614	-0.5879	10	0.62326	D	0.03	.	15.2573	0.73596	0.0:0.0:0.0:1.0	.	753;753	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	H	753	ENSP00000253812:Y753H	ENSP00000253812:Y753H	Y	+	1	0	PCDHGA3	140706041	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.306000	0.51881	2.142000	0.66516	0.460000	0.39030	TAT	PCDHGA3	-	NULL	ENSG00000254245		0.642	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA3	HGNC	protein_coding	OTTHUMT00000377017.1	-	0.00	82	0	T	NM_018916		140725857	+1	tier1	-	no_errors	ENST00000253812	ensembl	human	known	74_37	missense	14.29	48	8	SNP	1.000	C
PEG3	5178	genome.wustl.edu	37	19	57325572	57325572	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr19:57325572A>G	ENST00000326441.9	-	10	4601	c.4238T>C	c.(4237-4239)gTg>gCg	p.V1413A	ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.V1413A|PEG3_ENST00000593695.1_Missense_Mutation_p.V1287A|PEG3_ENST00000598410.1_Missense_Mutation_p.V1289A|ZIM2_ENST00000391708.3_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1413	3 X 7 AA repeat of P-E-V-E-A-A-E.|Glu-rich.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AGCAGCCTCCACTTCTGGCTC	0.592																																																	0													45.0	47.0	46.0					19																	57325572		2203	4297	6500	SO:0001583	missense	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4238T>C	19.37:g.57325572A>G	ENSP00000326581:p.Val1413Ala		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.V1413A	ENST00000326441.9	37	c.4238	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	A	13.22	2.173290	0.38413	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02552	4.25;4.25	4.04	4.04	0.47022	.	0.174287	0.27792	N	0.017822	T	0.02571	0.0078	L	0.27053	0.805	.	.	.	P;P;P	0.44006	0.646;0.646;0.824	B;B;B	0.39465	0.225;0.142;0.3	T	0.42565	-0.9444	9	0.42905	T	0.14	-18.3521	9.6712	0.40013	1.0:0.0:0.0:0.0	.	1289;1413;1348	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	A	1413	ENSP00000326581:V1413A;ENSP00000403051:V1413A	ENSP00000326581:V1413A	V	-	2	0	ZIM2	62017384	0.005000	0.15991	0.956000	0.39512	0.293000	0.27360	0.200000	0.17257	2.061000	0.61500	0.533000	0.62120	GTG	PEG3	-	NULL	ENSG00000198300		0.592	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	-	0.00	60	0	A			57325572	-1	tier1	-	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	29.69	45	19	SNP	0.676	G
PIK3AP1	118788	genome.wustl.edu	37	10	98412497	98412497	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr10:98412497C>T	ENST00000339364.5	-	4	789	c.670G>A	c.(670-672)Gcc>Acc	p.A224T	PIK3AP1_ENST00000468783.1_5'UTR|PIK3AP1_ENST00000371110.2_Missense_Mutation_p.A46T	NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	224	DBB. {ECO:0000255|PROSITE- ProRule:PRU00707}.				negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		TCCACCTTGGCTTCCATCCTT	0.463																																																	0													162.0	151.0	154.0					10																	98412497		2203	4300	6503	SO:0001583	missense	0			AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.670G>A	10.37:g.98412497C>T	ENSP00000339826:p.Ala224Thr		Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom	p.A224T	ENST00000339364.5	37	c.670	CCDS31259.1	10	.	.	.	.	.	.	.	.	.	.	C	34	5.369118	0.95900	.	.	ENSG00000155629	ENST00000339364;ENST00000371110	T;T	0.18960	2.87;2.18	6.03	6.03	0.97812	DBB domain (1);	0.282684	0.39544	N	0.001327	T	0.26159	0.0638	L	0.53249	1.67	0.80722	D	1	P	0.43477	0.808	B	0.41813	0.367	T	0.00636	-1.1633	10	0.30854	T	0.27	-8.2234	17.7156	0.88336	0.0:1.0:0.0:0.0	.	224	Q6ZUJ8	BCAP_HUMAN	T	224;46	ENSP00000339826:A224T;ENSP00000360151:A46T	ENSP00000339826:A224T	A	-	1	0	PIK3AP1	98402487	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	6.404000	0.73268	2.868000	0.98415	0.555000	0.69702	GCC	PIK3AP1	-	NULL	ENSG00000155629		0.463	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3AP1	HGNC	protein_coding	OTTHUMT00000049619.2	-	0.00	56	0	C	NM_152309		98412497	-1	tier1	-	no_errors	ENST00000339364	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
PIK3C2A	5286	genome.wustl.edu	37	11	17134183	17134183	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr11:17134183G>A	ENST00000265970.7	-	20	3351	c.3352C>T	c.(3352-3354)Ccc>Tcc	p.P1118S	PIK3C2A_ENST00000540361.1_Missense_Mutation_p.P738S|PIK3C2A_ENST00000531428.1_5'UTR	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	1118					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						ACTTTTAGGGGGACAGCATTA	0.328																																																	0													131.0	131.0	131.0					11																	17134183		2200	4293	6493	SO:0001583	missense	0			Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.3352C>T	11.37:g.17134183G>A	ENSP00000265970:p.Pro1118Ser		B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,pfscan_C2_dom,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.P1118S	ENST00000265970.7	37	c.3352	CCDS7824.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.160614	0.94727	.	.	ENSG00000011405	ENST00000265970;ENST00000540361	D;D	0.86769	-2.17;-2.17	5.82	5.82	0.92795	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.94735	0.8301	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.94857	0.8018	10	0.87932	D	0	-8.1102	20.1012	0.97876	0.0:0.0:1.0:0.0	.	1118	O00443	P3C2A_HUMAN	S	1118;738	ENSP00000265970:P1118S;ENSP00000438687:P738S	ENSP00000265970:P1118S	P	-	1	0	PIK3C2A	17090759	1.000000	0.71417	0.983000	0.44433	0.954000	0.61252	9.618000	0.98365	2.754000	0.94517	0.650000	0.86243	CCC	PIK3C2A	-	superfamily_Kinase-like_dom	ENSG00000011405		0.328	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2A	HGNC	protein_coding	OTTHUMT00000387553.1	-	0.00	23	0	G	NM_002645		17134183	-1	tier1	-	no_errors	ENST00000265970	ensembl	human	known	74_37	missense	28.57	9	4	SNP	1.000	A
PIK3C2B	5287	genome.wustl.edu	37	1	204429718	204429718	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:204429718A>G	ENST00000367187.3	-	7	1938	c.1382T>C	c.(1381-1383)cTg>cCg	p.L461P	PIK3C2B_ENST00000424712.2_Missense_Mutation_p.L461P	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	461	PI3K-RBD. {ECO:0000255|PROSITE- ProRule:PRU00879}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			CTGCTCCATCAGCTGTAGCCG	0.552																																																	0													163.0	129.0	141.0					1																	204429718		2203	4300	6503	SO:0001583	missense	0			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.1382T>C	1.37:g.204429718A>G	ENSP00000356155:p.Leu461Pro		O95666|Q5SW99	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_dom,pfscan_C2_dom,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.L461P	ENST00000367187.3	37	c.1382	CCDS1446.1	1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.640487	0.87859	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.73681	-0.65;-0.77	5.81	5.81	0.92471	Phosphoinositide 3-kinase, ras-binding (2);	0.233836	0.35970	N	0.002872	D	0.83972	0.5370	M	0.64404	1.975	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.996;0.999	D	0.85559	0.1226	10	0.87932	D	0	.	13.6844	0.62506	1.0:0.0:0.0:0.0	.	461;461	F5GWN5;O00750	.;P3C2B_HUMAN	P	461	ENSP00000356155:L461P;ENSP00000400561:L461P	ENSP00000356155:L461P	L	-	2	0	PIK3C2B	202696341	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.042000	0.89430	2.216000	0.71823	0.533000	0.62120	CTG	PIK3C2B	-	pfam_PI3K_Ras-bd_dom,smart_PI3K_Ras-bd_dom	ENSG00000133056		0.552	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2B	HGNC	protein_coding	OTTHUMT00000087965.1	-	0.00	46	0	A	NM_002646		204429718	-1	tier1	-	no_errors	ENST00000367187	ensembl	human	known	74_37	missense	31.43	24	11	SNP	1.000	G
PIK3R6	146850	genome.wustl.edu	37	17	8722421	8722421	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:8722421A>T	ENST00000311434.9	-	19	2211	c.1972T>A	c.(1972-1974)Ttg>Atg	p.L658M	PIK3R6_ENST00000434064.2_5'UTR	NM_001010855.2	NP_001010855.1	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	659					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of MAP kinase activity (GO:0043406)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)										TTTCCCGCCAAGTTGGAGGAC	0.557																																																	0													50.0	49.0	49.0					17																	8722421		1992	4168	6160	SO:0001583	missense	0			AK091819	CCDS73985.1	17p13.1	2013-01-31	2008-02-04	2008-02-04	ENSG00000174083	ENSG00000276231			27101	protein-coding gene	gene with protein product		611462	"""chromosome 17 open reading frame 38"""	C17orf38		16476736	Standard	NM_001010855		Approved	FLJ34500, HsT41028, p87PIKAP	uc002glq.1	Q5UE93	OTTHUMG00000132861	ENST00000311434.9:c.1972T>A	17.37:g.8722421A>T	ENSP00000475670:p.Leu658Met		Q658R3	Missense_Mutation	SNP	pfam_PI3K_1B_gamma_p101_su	p.L658M	ENST00000311434.9	37	c.1972		17																																																																																			PIK3R6	-	pfam_PI3K_1B_gamma_p101_su	ENSG00000174083		0.557	PIK3R6-201	KNOWN	basic|appris_principal	protein_coding	PIK3R6	HGNC	protein_coding		-	0.00	51	0	A	NM_001010855		8722421	-1	tier1	-	no_errors	ENST00000311434	ensembl	human	known	74_37	missense	48.15	14	13	SNP	0.990	T
PKHD1L1	93035	genome.wustl.edu	37	8	110425678	110425678	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr8:110425678C>A	ENST00000378402.5	+	21	2368	c.2264C>A	c.(2263-2265)gCa>gAa	p.A755E		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	755					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GGATTCCTGGCAAATTATATT	0.279										HNSCC(38;0.096)																																							0													88.0	82.0	84.0					8																	110425678		1808	4071	5879	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.2264C>A	8.37:g.110425678C>A	ENSP00000367655:p.Ala755Glu		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.A755E	ENST00000378402.5	37	c.2264	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	C	7.028	0.560097	0.13498	.	.	ENSG00000205038	ENST00000378402	D	0.85258	-1.96	4.82	2.87	0.33458	.	0.679959	0.14298	N	0.328500	T	0.77075	0.4077	M	0.64997	1.995	0.21064	N	0.999795	P	0.36315	0.547	B	0.30316	0.114	T	0.61997	-0.6947	10	0.05620	T	0.96	.	10.0539	0.42233	0.4416:0.5584:0.0:0.0	.	755	Q86WI1	PKHL1_HUMAN	E	755	ENSP00000367655:A755E	ENSP00000367655:A755E	A	+	2	0	PKHD1L1	110494854	0.309000	0.24518	0.997000	0.53966	0.393000	0.30537	0.087000	0.14958	0.316000	0.23135	-0.347000	0.07816	GCA	PKHD1L1	-	NULL	ENSG00000205038		0.279	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	29	0	C	NM_177531		110425678	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	23.08	20	6	SNP	0.999	A
PLCL1	5334	genome.wustl.edu	37	2	198966062	198966062	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:198966062G>T	ENST00000428675.1	+	4	3371	c.2973G>T	c.(2971-2973)aaG>aaT	p.K991N	PLCL1_ENST00000437704.2_Missense_Mutation_p.K893N	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	991					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	TCCAGGAAAAGATTGTACAGT	0.313																																																	0													97.0	98.0	97.0					2																	198966062		2203	4300	6503	SO:0001583	missense	0			D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.2973G>T	2.37:g.198966062G>T	ENSP00000402861:p.Lys991Asn		Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.K991N	ENST00000428675.1	37	c.2973	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	G	16.26	3.072267	0.55646	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.22743	1.94;1.99	5.2	2.36	0.29203	.	0.000000	0.56097	D	0.000030	T	0.38480	0.1042	M	0.79805	2.47	0.50039	D	0.999845	D;D	0.59357	0.985;0.985	P;P	0.58660	0.843;0.843	T	0.18429	-1.0337	9	.	.	.	.	8.6007	0.33742	0.316:0.0:0.684:0.0	.	991;917	Q15111;B4DYZ4	PLCL1_HUMAN;.	N	991;893	ENSP00000402861:K991N;ENSP00000414138:K893N	.	K	+	3	2	PLCL1	198674307	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.434000	0.34958	0.746000	0.32786	-0.218000	0.12543	AAG	PLCL1	-	NULL	ENSG00000115896		0.313	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	HGNC	protein_coding	OTTHUMT00000340210.1	-	0.00	36	0	G	NM_006226		198966062	+1	tier1	-	no_errors	ENST00000428675	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
PLEKHM1	9842	genome.wustl.edu	37	17	43522867	43522867	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:43522867G>A	ENST00000430334.3	-	9	2939	c.2806C>T	c.(2806-2808)Cgg>Tgg	p.R936W	PLEKHM1_ENST00000580404.1_5'UTR|PLEKHM1_ENST00000421073.2_Missense_Mutation_p.R847W	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	936					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					GCGCCACTCCGGCACAGGCCC	0.582																																																	0													32.0	31.0	31.0					17																	43522867		2201	4296	6497	SO:0001583	missense	0			X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.2806C>T	17.37:g.43522867G>A	ENSP00000389913:p.Arg936Trp		Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Missense_Mutation	SNP	pfam_Run,superfamily_Znf_FYVE_PHD,smart_Run,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Pleckstrin_homology,pfscan_Run,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.R936W	ENST00000430334.3	37	c.2806	CCDS32671.1	17	.	.	.	.	.	.	.	.	.	.	G	18.98	3.736873	0.69304	.	.	ENSG00000225190	ENST00000430334;ENST00000446609;ENST00000421073	T;T	0.70869	-0.52;-0.51	4.47	2.25	0.28309	.	0.144593	0.46145	D	0.000303	T	0.76111	0.3942	M	0.91354	3.2	0.54753	D	0.999989	D;P	0.52996	0.957;0.937	P;B	0.44597	0.454;0.438	T	0.82047	-0.0651	10	0.87932	D	0	.	11.0153	0.47685	0.0:0.0:0.6689:0.3311	.	847;936	F8W648;Q9Y4G2	.;PKHM1_HUMAN	W	936;885;847	ENSP00000389913:R936W;ENSP00000414352:R847W	ENSP00000414352:R847W	R	-	1	2	PLEKHM1	40878650	1.000000	0.71417	0.976000	0.42696	0.898000	0.52572	4.561000	0.60809	1.203000	0.43233	0.485000	0.47835	CGG	PLEKHM1	-	NULL	ENSG00000225190		0.582	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM1	HGNC	protein_coding	OTTHUMT00000444659.1	-	0.00	27	0	G	NM_014798		43522867	-1	tier1	-	no_errors	ENST00000430334	ensembl	human	known	74_37	missense	19.05	17	4	SNP	1.000	A
PLEKHM1P	440456	genome.wustl.edu	37	17	62788498	62788498	+	RNA	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:62788498G>A	ENST00000582986.1	-	0	2111					NR_024386.1		Q69YJ1	PKHMP_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1 pseudogene						intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)										GCGCCACTCCGGCACAGGCCC	0.582																																																	0																																												0					17q24.1	2012-10-03			ENSG00000214176	ENSG00000214176			35411	pseudogene	pseudogene							Standard	NR_024386		Approved	LOC440456	uc002jew.4	Q69YJ1	OTTHUMG00000179296		17.37:g.62788498G>A				RNA	SNP	-	NULL	ENST00000582986.1	37	NULL		17																																																																																			PLEKHM1P	-	-	ENSG00000214176		0.582	PLEKHM1P-002	KNOWN	basic	processed_transcript	PLEKHM1P	HGNC	pseudogene	OTTHUMT00000445598.1	-	0.00	13	0	G	NR_024386		62788498	-1	tier1	-	no_errors	ENST00000578036	ensembl	human	known	74_37	rna	42.31	15	11	SNP	1.000	A
PMS2	5395	genome.wustl.edu	37	7	6017359	6017359	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr7:6017359A>G	ENST00000265849.7	-	14	2410	c.2305T>C	c.(2305-2307)Tcc>Ccc	p.S769P	PMS2_ENST00000406569.3_Intron|PMS2_ENST00000382321.4_Missense_Mutation_p.S368P|PMS2_ENST00000441476.2_Missense_Mutation_p.S663P	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	769					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		GTTGGCAAGGAAATCAGTTTA	0.468			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	0													124.0	98.0	107.0					7																	6017359		2194	4285	6479	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.2305T>C	7.37:g.6017359A>G	ENSP00000265849:p.Ser769Pro		B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Missense_Mutation	SNP	pfam_MutL_C,pfam_DNA_mismatch_repair_C,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_MutL_C,tigrfam_DNA_mismatch_repair_N	p.S769P	ENST00000265849.7	37	c.2305	CCDS5343.1	7	.	.	.	.	.	.	.	.	.	.	A	25.2	4.608438	0.87258	.	.	ENSG00000122512	ENST00000265849;ENST00000382322;ENST00000382321;ENST00000441476	T;T;T	0.78364	-1.17;-1.17;-1.17	5.75	5.75	0.90469	MutL, C-terminal, dimerisation (2);	0.000000	0.85682	D	0.000000	D	0.90553	0.7039	M	0.92784	3.345	0.80722	D	1	D;D;D	0.89917	0.999;0.997;1.0	D;D;D	0.91635	0.994;0.986;0.999	D	0.92170	0.5743	10	0.54805	T	0.06	-10.4195	15.2333	0.73407	1.0:0.0:0.0:0.0	.	368;769;663	P54278-2;P54278;C9J167	.;PMS2_HUMAN;.	P	769;722;368;663	ENSP00000265849:S769P;ENSP00000371758:S368P;ENSP00000392843:S663P	ENSP00000265849:S769P	S	-	1	0	PMS2	5983885	1.000000	0.71417	0.994000	0.49952	0.978000	0.69477	8.953000	0.93041	2.202000	0.70862	0.448000	0.29417	TCC	PMS2	-	pfam_MutL_C,smart_MutL_C	ENSG00000122512		0.468	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS2	HGNC	protein_coding	OTTHUMT00000207353.3	-	0.00	58	0	A	NM_000535		6017359	-1	tier1	-	no_errors	ENST00000265849	ensembl	human	known	74_37	missense	42.31	30	22	SNP	1.000	G
POC1B	282809	genome.wustl.edu	37	12	89865998	89865998	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr12:89865998T>G	ENST00000313546.3	-	5	635	c.507A>C	c.(505-507)aaA>aaC	p.K169N	POC1B_ENST00000378528.2_Missense_Mutation_p.K39N|POC1B_ENST00000549035.1_Missense_Mutation_p.K127N|POC1B_ENST00000541909.1_Missense_Mutation_p.K39N|POC1B_ENST00000549504.1_Intron|POC1B_ENST00000393179.4_Missense_Mutation_p.K39N	NM_172240.2	NP_758440.1	Q8TC44	POC1B_HUMAN	POC1 centriolar protein B	169					cell proliferation (GO:0008283)|cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	14						TATCCCAAATTTTAATAGTTT	0.348																																																	0													134.0	130.0	132.0					12																	89865998		2203	4300	6503	SO:0001583	missense	0			AL832918	CCDS31869.1, CCDS55859.1	12q21.33	2014-05-02	2013-08-21	2010-03-26	ENSG00000139323	ENSG00000139323		"""WD repeat domain containing"""	30836	protein-coding gene	gene with protein product		614784	"""WD repeat domain 51B"", ""POC1 centriolar protein homolog B (Chlamydomonas)"""	WDR51B		19109428	Standard	NM_172240		Approved	TUWD12, FLJ14923		Q8TC44	OTTHUMG00000169944	ENST00000313546.3:c.507A>C	12.37:g.89865998T>G	ENSP00000323302:p.Lys169Asn		G3V1X0	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.K169N	ENST00000313546.3	37	c.507	CCDS31869.1	12	.	.	.	.	.	.	.	.	.	.	T	19.20	3.780776	0.70222	.	.	ENSG00000139323	ENST00000393179;ENST00000313546;ENST00000378528;ENST00000549035;ENST00000541909	T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23	5.78	5.78	0.91487	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.044035	0.85682	D	0.000000	T	0.65281	0.2676	M	0.76328	2.33	0.35689	D	0.814685	P	0.43788	0.817	B	0.40534	0.332	T	0.77576	-0.2536	10	0.87932	D	0	.	8.644	0.33994	0.0:0.0683:0.131:0.8007	.	169	Q8TC44	POC1B_HUMAN	N	39;169;39;127;39	ENSP00000376877:K39N;ENSP00000323302:K169N;ENSP00000367789:K39N;ENSP00000447916:K127N;ENSP00000440301:K39N	ENSP00000323302:K169N	K	-	3	2	POC1B	88390129	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	0.603000	0.24149	2.333000	0.79357	0.533000	0.62120	AAA	POC1B	-	pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	ENSG00000139323		0.348	POC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POC1B	HGNC	protein_coding	OTTHUMT00000406637.1		0.00	60	0	T	NM_172240		89865998	-1			no_errors	ENST00000313546	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	G
POLDIP2	26073	genome.wustl.edu	37	17	26678702	26678702	+	Silent	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:26678702G>A	ENST00000540200.1	-	8	743	c.744C>T	c.(742-744)taC>taT	p.Y248Y	POLDIP2_ENST00000003607.4_5'UTR	NM_015584.3	NP_056399.1	Q9Y2S7	PDIP2_HUMAN	polymerase (DNA-directed), delta interacting protein 2	249	ApaG. {ECO:0000255|PROSITE- ProRule:PRU00412}.				mitochondrion morphogenesis (GO:0070584)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)					all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		TCATGCCCATGTAGAAGGGGA	0.567																																																	0													47.0	48.0	48.0					17																	26678702		1994	4175	6169	SO:0001819	synonymous_variant	0			AF077203	CCDS74018.1	17q11.2	2008-02-05			ENSG00000004142	ENSG00000004142			23781	protein-coding gene	gene with protein product		611519				12522211	Standard	NM_015584		Approved	PDIP38, DKFZP586F1524	uc002haz.3	Q9Y2S7	OTTHUMG00000132065	ENST00000540200.1:c.744C>T	17.37:g.26678702G>A			B2R846|Q96JE4	Silent	SNP	pfam_ApaG_domain,pfam_Hemimethylated_DNA-bd_dom,superfamily_ApaG_domain,superfamily_Hemimethylated_DNA-bd_dom,pfscan_ApaG_domain	p.Y248	ENST00000540200.1	37	c.744		17																																																																																			POLDIP2	-	superfamily_ApaG_domain,pfscan_ApaG_domain	ENSG00000004142		0.567	POLDIP2-201	KNOWN	basic|appris_principal	protein_coding	POLDIP2	HGNC	protein_coding			0.00	31	0	G	NM_015584		26678702	-1			no_errors	ENST00000540200	ensembl	human	known	74_37	silent	9.68	28	3	SNP	1.000	A
POP1	10940	genome.wustl.edu	37	8	99170327	99170327	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr8:99170327C>T	ENST00000401707.2	+	16	2984	c.2903C>T	c.(2902-2904)aCt>aTt	p.T968I	POP1_ENST00000349693.3_Missense_Mutation_p.T968I	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	968					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			GGCTTTGTGACTCAGGGAGAT	0.592																																																	0													97.0	102.0	100.0					8																	99170327		2203	4300	6503	SO:0001583	missense	0			D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.2903C>T	8.37:g.99170327C>T	ENSP00000385787:p.Thr968Ile		A8K5W9|Q15037	Missense_Mutation	SNP	pfam_RNase_P/MRP_POP1,pfam_POPLD	p.T968I	ENST00000401707.2	37	c.2903	CCDS6277.1	8	.	.	.	.	.	.	.	.	.	.	C	26.4	4.736307	0.89482	.	.	ENSG00000104356	ENST00000401707;ENST00000349693	T;T	0.14640	2.49;2.49	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.44350	0.1289	M	0.84683	2.71	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.43196	-0.9406	10	0.62326	D	0.03	-6.1446	17.9548	0.89065	0.0:1.0:0.0:0.0	.	968	Q99575	POP1_HUMAN	I	968	ENSP00000385787:T968I;ENSP00000339529:T968I	ENSP00000339529:T968I	T	+	2	0	POP1	99239503	1.000000	0.71417	0.953000	0.39169	0.922000	0.55478	7.601000	0.82783	2.663000	0.90544	0.557000	0.71058	ACT	POP1	-	NULL	ENSG00000104356		0.592	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POP1	HGNC	protein_coding	OTTHUMT00000379470.1	-	0.00	41	0	C	NM_015029		99170327	+1	tier1	-	no_errors	ENST00000349693	ensembl	human	known	74_37	missense	77.08	22	74	SNP	1.000	T
PPFIA2	8499	genome.wustl.edu	37	12	81657153	81657153	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr12:81657153A>C	ENST00000549396.1	-	31	3732	c.3572T>G	c.(3571-3573)tTc>tGc	p.F1191C	PPFIA2_ENST00000552948.1_Missense_Mutation_p.F1170C|PPFIA2_ENST00000550584.2_Missense_Mutation_p.F1191C|PPFIA2_ENST00000333447.7_Missense_Mutation_p.F1179C|PPFIA2_ENST00000548586.1_Missense_Mutation_p.F1185C|PPFIA2_ENST00000550359.2_Missense_Mutation_p.F1038C|PPFIA2_ENST00000541570.2_Missense_Mutation_p.F727C|PPFIA2_ENST00000541017.1_Missense_Mutation_p.F377C|PPFIA2_ENST00000443686.3_Missense_Mutation_p.F1086C|PPFIA2_ENST00000549325.1_Missense_Mutation_p.F1176C|PPFIA2_ENST00000407050.4_Missense_Mutation_p.F1090C|PPFIA2_ENST00000545296.2_Intron	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	1191					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						TCCACGTCTGAAGTTCTTGTC	0.433																																																	0													96.0	92.0	93.0					12																	81657153		1950	4152	6102	SO:0001583	missense	0			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.3572T>G	12.37:g.81657153A>C	ENSP00000450337:p.Phe1191Cys		B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.F1191C	ENST00000549396.1	37	c.3572	CCDS55857.1	12	.	.	.	.	.	.	.	.	.	.	A	18.99	3.739740	0.69304	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000541017;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948	T;T;T;T;T;T;T;T;T	0.39406	1.68;1.63;1.42;1.08;1.47;1.64;1.67;1.33;1.79	5.24	5.24	0.73138	.	0.116668	0.64402	D	0.000017	T	0.41236	0.1150	M	0.66297	2.02	0.58432	D	0.999999	P	0.44344	0.833	B	0.39185	0.293	T	0.47724	-0.9095	10	0.72032	D	0.01	-12.8067	10.9554	0.47354	0.8599:0.0:0.0:0.1401	.	1191	O75334	LIPA2_HUMAN	C	1191;1176;727;377;1090;1204;1179;1185;1086;1170	ENSP00000450337:F1191C;ENSP00000450298:F1176C;ENSP00000438337:F727C;ENSP00000445532:F377C;ENSP00000385093:F1090C;ENSP00000327416:F1179C;ENSP00000449338:F1185C;ENSP00000388373:F1086C;ENSP00000447868:F1170C	ENSP00000327416:F1179C	F	-	2	0	PPFIA2	80181284	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.293000	0.78740	1.976000	0.57569	0.477000	0.44152	TTC	PPFIA2	-	NULL	ENSG00000139220		0.433	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA2	HGNC	protein_coding	OTTHUMT00000408030.1	-	0.00	30	0	A			81657153	-1	tier1	-	no_errors	ENST00000549396	ensembl	human	known	74_37	missense	20.59	27	7	SNP	1.000	C
PPP1R3A	5506	genome.wustl.edu	37	7	113519600	113519600	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr7:113519600T>C	ENST00000284601.3	-	4	1615	c.1547A>G	c.(1546-1548)gAt>gGt	p.D516G		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	516					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TTCTTCATCATCCTTACCATT	0.338																																																	0													66.0	63.0	64.0					7																	113519600		2203	4299	6502	SO:0001583	missense	0			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1547A>G	7.37:g.113519600T>C	ENSP00000284601:p.Asp516Gly		A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	pfam_CBM_21,pfscan_CBM_21	p.D516G	ENST00000284601.3	37	c.1547	CCDS5759.1	7	.	.	.	.	.	.	.	.	.	.	T	12.42	1.933407	0.34096	.	.	ENSG00000154415	ENST00000284601	T	0.20200	2.09	5.76	2.11	0.27256	.	0.870415	0.10173	N	0.706920	T	0.14527	0.0351	L	0.50333	1.59	0.09310	N	1	P	0.38922	0.651	B	0.30943	0.122	T	0.32929	-0.9888	10	0.72032	D	0.01	-0.2575	1.1062	0.01694	0.1741:0.1592:0.1334:0.5332	.	516	Q16821	PPR3A_HUMAN	G	516	ENSP00000284601:D516G	ENSP00000284601:D516G	D	-	2	0	PPP1R3A	113306836	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	-0.063000	0.11655	0.127000	0.18452	-0.256000	0.11100	GAT	PPP1R3A	-	NULL	ENSG00000154415		0.338	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	HGNC	protein_coding	OTTHUMT00000346724.1	-	0.00	58	0	T	NM_002711		113519600	-1	tier1	-	no_errors	ENST00000284601	ensembl	human	known	74_37	missense	29.63	38	16	SNP	0.000	C
PRAC1	84366	genome.wustl.edu	37	17	46801724	46801724	+	5'Flank	SNP	T	T	G	rs3110599|rs372079370|rs369888513	byFrequency	TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:46801724T>G	ENST00000290294.3	-	0	0				PRAC2_ENST00000432056.1_RNA|MIR3185_ENST00000583892.1_RNA|PRAC2_ENST00000422730.2_RNA	NM_032391.2	NP_115767.1	Q96KF2	PRAC1_HUMAN	prostate cancer susceptibility candidate 1							nucleus (GO:0005634)											AAAGTGTGTGTGGGGGGGTCC	0.453											OREG0024525	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		948	0.189297	0.1694	0.2334	5008	,	,		19234	0.2857		0.0984	False		,,,				2504	0.1789																0																																										SO:0001631	upstream_gene_variant	0			AF331165	CCDS11535.1	17q21	2013-08-29	2013-08-29	2013-08-29	ENSG00000159182	ENSG00000159182			30591	protein-coding gene	gene with protein product	"""prostate, rectum and colon"""	609819	"""chromosome 17 open reading frame 92"", ""prostate cancer susceptibility candidate"""	C17orf92, PRAC		11340635	Standard	NM_032391		Approved		uc002iny.3	Q96KF2	OTTHUMG00000159899		17.37:g.46801724T>G	Exception_encountered	942		RNA	SNP	-	NULL	ENST00000290294.3	37	NULL	CCDS11535.1	17																																																																																			PRAC2	-	-	ENSG00000229637		0.453	PRAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAC2	HGNC	protein_coding	OTTHUMT00000358086.1		0.00	24	0	T	NM_032391		46801724	+1			no_errors	ENST00000422730	ensembl	human	known	74_37	rna	19.23	21	5	SNP	0.000	G
PRAMEF14	729528	genome.wustl.edu	37	1	13668960	13668960	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:13668960C>A	ENST00000344998.3	-	4	1408	c.1226G>T	c.(1225-1227)tGc>tTc	p.C409F	PRAMEF14_ENST00000602491.1_5'UTR|PRAMEF14_ENST00000334600.6_Missense_Mutation_p.C457F			Q5SWL7	PRA14_HUMAN	PRAME family member 14	409					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ACAGGAAGGGCAGGGGGTGGG	0.562																																																	0													4.0	5.0	5.0					1																	13668960		1601	3626	5227	SO:0001583	missense	0					1p36.21	2014-04-01			ENSG00000204481	ENSG00000204481		"""-"""	13576	other	unknown							Standard	NM_001024661		Approved	OTTHUMG00000007916		Q5SWL7	OTTHUMG00000007916	ENST00000344998.3:c.1226G>T	1.37:g.13668960C>A	ENSP00000341333:p.Cys409Phe			Missense_Mutation	SNP	NULL	p.C409F	ENST00000344998.3	37	c.1226		1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.474682	0.26511	.	.	ENSG00000204481	ENST00000344998;ENST00000334600	T;T	0.46819	0.86;0.86	1.6	1.6	0.23607	.	0.414698	0.24325	N	0.039507	T	0.65575	0.2704	M	0.86097	2.795	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.51841	-0.8654	10	0.66056	D	0.02	.	6.6871	0.23152	0.0:1.0:0.0:0.0	.	409	Q5SWL7	PRA14_HUMAN	F	409;457	ENSP00000341333:C409F;ENSP00000334410:C457F	ENSP00000334410:C457F	C	-	2	0	PRAMEF14	13541547	0.159000	0.22864	0.051000	0.19133	0.128000	0.20619	1.595000	0.36708	1.195000	0.43115	0.162000	0.16502	TGC	PRAMEF14	-	NULL	ENSG00000204481		0.562	PRAMEF14-201	KNOWN	basic|appris_candidate	protein_coding	PRAMEF14	HGNC	protein_coding		-	0.00	32	0	C	NM_001099854		13668960	-1	tier1	-	no_errors	ENST00000344998	ensembl	human	known	74_37	missense	20.00	24	6	SNP	0.062	A
PRDX4	10549	genome.wustl.edu	37	X	23685898	23685898	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:23685898G>A	ENST00000379341.4	+	1	336	c.211G>A	c.(211-213)Gac>Aac	p.D71N	PRDX4_ENST00000495599.1_3'UTR|PRDX4_ENST00000379331.3_Missense_Mutation_p.D71N	NM_006406.1	NP_006397.1	Q13162	PRDX4_HUMAN	peroxiredoxin 4	71					4-hydroxyproline metabolic process (GO:0019471)|cell redox homeostasis (GO:0045454)|extracellular matrix organization (GO:0030198)|I-kappaB phosphorylation (GO:0007252)|male gonad development (GO:0008584)|negative regulation of male germ cell proliferation (GO:2000255)|protein maturation by protein folding (GO:0022417)|reactive oxygen species metabolic process (GO:0072593)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	thioredoxin peroxidase activity (GO:0008379)			lung(6)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	9						ATCGGTCGCCGACCACTCCCT	0.642																																																	0													38.0	33.0	35.0					X																	23685898		2201	4300	6501	SO:0001583	missense	0			U25182	CCDS14206.1	Xp22.11	2012-09-20			ENSG00000123131	ENSG00000123131			17169	protein-coding gene	gene with protein product		300927				9388242	Standard	XM_005274438		Approved	AOE37-2	uc004dam.3	Q13162	OTTHUMG00000021253	ENST00000379341.4:c.211G>A	X.37:g.23685898G>A	ENSP00000368646:p.Asp71Asn		Q6FHT3	Missense_Mutation	SNP	pfam_AhpC/TSA,pfam_Peroxiredoxin_C,pfam_Redoxin,superfamily_Thioredoxin-like_fold	p.D71N	ENST00000379341.4	37	c.211	CCDS14206.1	X	.	.	.	.	.	.	.	.	.	.	G	17.64	3.439558	0.63067	.	.	ENSG00000123131	ENST00000379341;ENST00000379331	T;T	0.49139	2.46;0.79	4.69	2.85	0.33270	.	0.145719	0.64402	D	0.000012	T	0.40171	0.1106	L	0.52905	1.665	0.80722	D	1	B	0.12013	0.005	B	0.06405	0.002	T	0.21245	-1.0251	10	0.44086	T	0.13	-4.5275	9.0977	0.36649	0.0842:0.1442:0.7716:0.0	.	71	Q13162	PRDX4_HUMAN	N	71	ENSP00000368646:D71N;ENSP00000368635:D71N	ENSP00000368635:D71N	D	+	1	0	PRDX4	23595819	1.000000	0.71417	0.269000	0.24586	0.874000	0.50279	5.086000	0.64474	0.484000	0.27630	0.594000	0.82650	GAC	PRDX4	-	NULL	ENSG00000123131		0.642	PRDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDX4	HGNC	protein_coding	OTTHUMT00000056049.1	-	0.00	70	0	G	NM_006406		23685898	+1	tier1	-	no_errors	ENST00000379341	ensembl	human	known	74_37	missense	45.00	44	36	SNP	0.993	A
PREX2	80243	genome.wustl.edu	37	8	69058490	69058490	+	Silent	SNP	A	A	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr8:69058490A>G	ENST00000288368.4	+	34	4411	c.4134A>G	c.(4132-4134)aaA>aaG	p.K1378K		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1378					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AAGCTCTGAAAGTTTACTTCT	0.338																																																	0													99.0	96.0	97.0					8																	69058490		2203	4300	6503	SO:0001819	synonymous_variant	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.4134A>G	8.37:g.69058490A>G			B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.K1378	ENST00000288368.4	37	c.4134	CCDS6201.1	8																																																																																			PREX2	-	NULL	ENSG00000046889		0.338	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	-	0.00	39	0	A	NM_025170		69058490	+1	tier1	-	no_errors	ENST00000288368	ensembl	human	known	74_37	silent	21.74	36	10	SNP	0.995	G
PRSS3	5646	genome.wustl.edu	37	9	33796660	33796660	+	Silent	SNP	T	T	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr9:33796660T>C	ENST00000361005.5	+	2	231	c.231T>C	c.(229-231)gaT>gaC	p.D77D	RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000379405.3_Silent_p.D20D|PRSS3_ENST00000342836.4_Silent_p.D34D|PRSS3_ENST00000429677.3_Silent_p.D13D	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	77					cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			CCTTTGACGATGATGACAAGA	0.552																																																	0													193.0	181.0	185.0					9																	33796660		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.231T>C	9.37:g.33796660T>C			A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.D77	ENST00000361005.5	37	c.231	CCDS47958.1	9																																																																																			PRSS3	-	superfamily_Trypsin-like_Pept_dom	ENSG00000010438		0.552	PRSS3-003	KNOWN	basic|CCDS	protein_coding	PRSS3	HGNC	protein_coding	OTTHUMT00000052121.1		0.00	76	0	T	NM_002771		33796660	+1			no_errors	ENST00000361005	ensembl	human	known	74_37	silent	7.48	99	8	SNP	0.998	C
PSG8	440533	genome.wustl.edu	37	19	43262165	43262165	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr19:43262165A>C	ENST00000306511.4	-	3	795	c.698T>G	c.(697-699)cTg>cGg	p.L233R	PSG8_ENST00000600709.1_5'UTR|PSG8_ENST00000404209.4_Missense_Mutation_p.L233R|PSG8_ENST00000401467.2_Intron|PSG8_ENST00000406636.3_Missense_Mutation_p.L111R	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	233	Ig-like C2-type 1.					extracellular region (GO:0005576)		p.L233R(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				GAGGAGATTCAGGGTGAATGG	0.532																																																	1	Substitution - Missense(1)	lung(1)											198.0	208.0	205.0					19																	43262165		2203	4299	6502	SO:0001583	missense	0			M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.698T>G	19.37:g.43262165A>C	ENSP00000305005:p.Leu233Arg		A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L233R	ENST00000306511.4	37	c.698	CCDS33037.1	19	.	.	.	.	.	.	.	.	.	.	a	11.74	1.728382	0.30593	.	.	ENSG00000124467	ENST00000404209;ENST00000292109;ENST00000406636;ENST00000426252;ENST00000306511	T;T;T	0.15718	2.4;2.4;2.4	1.53	1.53	0.23141	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.47040	0.1424	H	0.94385	3.53	0.09310	N	1	B;D;D;D	0.89917	0.036;1.0;1.0;1.0	B;D;D;D	0.97110	0.029;1.0;1.0;1.0	T	0.24154	-1.0168	9	0.87932	D	0	.	5.1071	0.14790	1.0:0.0:0.0:0.0	.	111;233;233;233	Q9UQ74-2;Q9UQ74;Q9UQ74-3;A5PKV3	.;PSG8_HUMAN;.;.	R	233;108;111;45;233	ENSP00000385869:L233R;ENSP00000385081:L111R;ENSP00000305005:L233R	ENSP00000292109:L108R	L	-	2	0	PSG8	47954005	0.011000	0.17503	0.026000	0.17262	0.059000	0.15707	1.050000	0.30404	0.697000	0.31718	0.248000	0.18094	CTG	PSG8	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000124467		0.532	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSG8	HGNC	protein_coding	OTTHUMT00000464526.1	-	0.00	309	0	A			43262165	-1	tier1	-	no_errors	ENST00000306511	ensembl	human	known	74_37	missense	23.37	200	61	SNP	0.197	C
PTP4A2	8073	genome.wustl.edu	37	1	32384704	32384704	+	5'UTR	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:32384704G>A	ENST00000602725.1	-	0	380				RP11-84A19.4_ENST00000602889.1_lincRNA|PTP4A2_ENST00000356536.3_5'UTR|PTP4A2_ENST00000457805.2_5'UTR|PTP4A2_ENST00000526960.1_5'Flank|PTP4A2_ENST00000470404.1_5'UTR|PTP4A2_ENST00000344035.6_5'UTR			Q12974	TP4A2_HUMAN	protein tyrosine phosphatase type IVA, member 2						peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	prenylated protein tyrosine phosphatase activity (GO:0004727)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)				GTGTGAGTGTGATGGGGAAAG	0.373																																																	0													59.0	57.0	58.0					1																	32384704		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			L48723	CCDS348.1, CCDS53292.1, CCDS59193.1	1p35	2011-06-09			ENSG00000184007	ENSG00000184007		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9635	protein-coding gene	gene with protein product		601584		PTP4A		8661118, 9514946	Standard	NM_080391		Approved	HU-PP-1, PTPCAAX2, OV-1, ptp-IV1a, PRL-2	uc001bty.2	Q12974	OTTHUMG00000003801	ENST00000602725.1:c.-38C>T	1.37:g.32384704G>A			A8K9I8|B4DM39|D3DPP0|E9PGJ6|O00649|Q15197|Q15259|Q15260|Q15261|R4GN50	RNA	SNP	-	NULL	ENST00000602725.1	37	NULL	CCDS348.1	1																																																																																			PTP4A2	-	-	ENSG00000184007		0.373	PTP4A2-019	KNOWN	basic|appris_principal|CCDS	protein_coding	PTP4A2	HGNC	protein_coding	OTTHUMT00000468092.1	-	0.00	64	0	G	NM_080391		32384704	-1	tier1	-	no_errors	ENST00000532289	ensembl	human	known	74_37	rna	16.67	45	9	SNP	0.991	A
RIMS2	9699	genome.wustl.edu	37	8	104513161	104513161	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr8:104513161C>T	ENST00000406091.3	+	1	47	c.47C>T	c.(46-48)gCg>gTg	p.A16V	RP11-1C8.4_ENST00000523422.1_RNA|RP11-1C8.4_ENST00000517376.1_RNA	NM_001100117.2	NP_001093587.1	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	16					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CCCATCCCGGCGGCCTCTCAG	0.657										HNSCC(12;0.0054)																																							0													15.0	18.0	17.0					8																	104513161		1830	4063	5893	SO:0001583	missense	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000406091.3:c.47C>T	8.37:g.104513161C>T	ENSP00000384892:p.Ala16Val		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.A16V	ENST00000406091.3	37	c.47	CCDS55269.1	8	.	.	.	.	.	.	.	.	.	.	C	13.16	2.154244	0.38021	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998	T;T	0.18657	2.2;2.69	2.53	1.65	0.23941	.	.	.	.	.	T	0.19927	0.0479	L	0.40543	1.245	0.80722	D	1	D	0.60575	0.988	P	0.48030	0.564	T	0.02813	-1.1107	9	0.59425	D	0.04	.	7.5218	0.27633	0.0:0.8612:0.0:0.1387	.	16	F8WD47	.	V	16	ENSP00000427018:A16V;ENSP00000384892:A16V	ENSP00000332184:A16V	A	+	2	0	RIMS2	104582337	0.764000	0.28473	0.998000	0.56505	0.802000	0.45316	0.658000	0.24979	0.626000	0.30322	0.561000	0.74099	GCG	RIMS2	-	NULL	ENSG00000176406		0.657	RIMS2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS2	HGNC	protein_coding		-	0.00	30	0	C	NM_001100117		104513161	+1	tier1	-	no_errors	ENST00000406091	ensembl	human	known	74_37	missense	70.21	28	66	SNP	1.000	T
RIMS2	9699	genome.wustl.edu	37	8	104898169	104898169	+	Silent	SNP	T	T	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr8:104898169T>C	ENST00000436393.2	+	2	917	c.676T>C	c.(676-678)Ttg>Ctg	p.L226L	RIMS2_ENST00000507740.1_Silent_p.L256L|RIMS2_ENST00000262231.10_Silent_p.L256L|RIMS2_ENST00000406091.3_Silent_p.L448L			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	479					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.L256L(1)|p.L226L(1)|p.L484L(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TAGACCAGACTTGAGGCGTAC	0.463										HNSCC(12;0.0054)																																							3	Substitution - coding silent(3)	large_intestine(3)											102.0	94.0	97.0					8																	104898169		1929	4148	6077	SO:0001819	synonymous_variant	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.676T>C	8.37:g.104898169T>C			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.L448	ENST00000436393.2	37	c.1342		8																																																																																			RIMS2	-	NULL	ENSG00000176406		0.463	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	-	0.00	34	0	T	NM_001100117		104898169	+1	tier1	-	no_errors	ENST00000406091	ensembl	human	known	74_37	silent	70.93	25	61	SNP	0.117	C
MFSD3	113655	genome.wustl.edu	37	8	145739086	145739086	+	IGR	SNP	G	G	A	rs369950284		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr8:145739086G>A	ENST00000301327.4	+	0	1548				RECQL4_ENST00000532237.1_5'UTR|CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000428558.2_Missense_Mutation_p.T690M	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TTGCAGCAGCGTCAACAGTGC	0.612																																																	0													20.0	21.0	21.0					8																	145739086		2004	4068	6072	SO:0001628	intergenic_variant	0				CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177		8.37:g.145739086G>A				Missense_Mutation	SNP	pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_DNA_rep_checkpnt_protein,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.T690M	ENST00000301327.4	37	c.2069	CCDS6431.1	8																																																																																			RECQL4	-	superfamily_P-loop_NTPase,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000160957		0.612	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECQL4	HGNC	protein_coding	OTTHUMT00000382478.2	-	0.00	33	0	G	NM_138431		145739086	-1	tier1	-	no_errors	ENST00000428558	ensembl	human	known	74_37	missense	22.22	28	8	SNP	0.996	A
RNF213	57674	genome.wustl.edu	37	17	78268540	78268540	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:78268540T>C	ENST00000582970.1	+	9	1636	c.1493T>C	c.(1492-1494)aTa>aCa	p.I498T	RNF213_ENST00000319921.4_Missense_Mutation_p.I498T|RNF213_ENST00000456466.1_Missense_Mutation_p.I498T|RNF213_ENST00000508628.2_Missense_Mutation_p.I547T	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	498					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TACTATGACATAGTTTATATG	0.507																																																	0													103.0	98.0	100.0					17																	78268540		2203	4300	6503	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.1493T>C	17.37:g.78268540T>C	ENSP00000464087:p.Ile498Thr		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.I498T	ENST00000582970.1	37	c.1493	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	T	3.287	-0.145826	0.06627	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000456466;ENST00000319921	.	.	.	5.04	2.71	0.32032	.	0.258114	0.27159	N	0.020649	T	0.64416	0.2596	M	0.67953	2.075	0.33367	D	0.573022	D;D	0.65815	0.991;0.995	P;D	0.63877	0.883;0.919	T	0.71909	-0.4450	9	0.87932	D	0	-12.1057	8.6159	0.33831	0.3057:0.0:0.0:0.6943	.	498;498	Q9HCF4;Q9HCF4-2	ALO17_HUMAN;.	T	498;547;498;498	.	ENSP00000324392:I498T	I	+	2	0	RNF213	75883135	0.998000	0.40836	0.012000	0.15200	0.151000	0.21798	3.913000	0.56394	0.212000	0.20703	0.379000	0.24179	ATA	RNF213	-	NULL	ENSG00000173821		0.507	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1		0.00	54	0	T	NM_020914		78268540	+1			no_errors	ENST00000582970	ensembl	human	known	74_37	missense	8.11	34	3	SNP	0.412	C
RP1	6101	genome.wustl.edu	37	8	55541559	55541559	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr8:55541559T>C	ENST00000220676.1	+	4	5265	c.5117T>C	c.(5116-5118)gTt>gCt	p.V1706A		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1706					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AAGTGTGATGTTAGTGCTGTG	0.408																																					Colon(91;1014 1389 7634 14542 40420)												0													172.0	170.0	171.0					8																	55541559		2203	4300	6503	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.5117T>C	8.37:g.55541559T>C	ENSP00000220676:p.Val1706Ala			Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.V1706A	ENST00000220676.1	37	c.5117	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	T	0.067	-1.210385	0.01555	.	.	ENSG00000104237	ENST00000220676	T	0.20332	2.08	5.93	3.57	0.40892	.	1.383560	0.04726	N	0.420304	T	0.12817	0.0311	N	0.11427	0.14	0.09310	N	1	B	0.14805	0.011	B	0.08055	0.003	T	0.34104	-0.9842	10	0.18710	T	0.47	-0.782	8.519	0.33264	0.0:0.1522:0.0:0.8478	.	1706	P56715	RP1_HUMAN	A	1706	ENSP00000220676:V1706A	ENSP00000220676:V1706A	V	+	2	0	RP1	55704112	0.601000	0.26907	0.002000	0.10522	0.024000	0.10985	1.689000	0.37700	0.504000	0.28082	0.533000	0.62120	GTT	RP1	-	NULL	ENSG00000104237		0.408	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	-	0.00	79	0	T	NM_006269		55541559	+1	tier1	-	no_errors	ENST00000220676	ensembl	human	known	74_37	missense	29.49	55	23	SNP	0.144	C
RPL35	11224	genome.wustl.edu	37	9	127620266	127620266	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr9:127620266G>T	ENST00000348462.3	-	4	351	c.303C>A	c.(301-303)aaC>aaA	p.N101K	RPL35_ENST00000373570.4_3'UTR	NM_007209.3	NP_009140.1	P42766	RL35_HUMAN	ribosomal protein L35	101					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleolus (GO:0005730)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|large_intestine(1)|lung(1)|ovary(1)	4				GBM - Glioblastoma multiforme(294;0.182)		TGGTCTTCAGGTTCTCCTCGT	0.617																																																	0													49.0	41.0	44.0					9																	127620266		2203	4300	6503	SO:0001583	missense	0			U12465	CCDS6858.1	9q34.1	2011-04-06			ENSG00000136942	ENSG00000136942		"""L ribosomal proteins"""	10344	protein-coding gene	gene with protein product	"""60S ribosomal protein L35"""					11401437	Standard	NM_007209		Approved	L35	uc004boy.1	P42766	OTTHUMG00000020659	ENST00000348462.3:c.303C>A	9.37:g.127620266G>T	ENSP00000259469:p.Asn101Lys		A8K4V7|Q4VBY5|Q5JTN5|Q6IBC7|Q96QJ7|Q9BYF4	Missense_Mutation	SNP	pfam_Ribosomal_L29,superfamily_Ribosomal_L29,tigrfam_Ribosomal_L29	p.N101K	ENST00000348462.3	37	c.303	CCDS6858.1	9	.	.	.	.	.	.	.	.	.	.	G	14.13	2.443442	0.43429	.	.	ENSG00000136942	ENST00000348462	.	.	.	5.6	2.69	0.31865	.	0.427352	0.31290	N	0.007907	T	0.28101	0.0693	N	0.11064	0.09	0.44754	D	0.997756	B	0.02656	0.0	B	0.01281	0.0	T	0.04537	-1.0944	9	0.35671	T	0.21	.	5.8592	0.18736	0.2351:0.1839:0.581:0.0	.	101	P42766	RL35_HUMAN	K	101	.	ENSP00000259469:N101K	N	-	3	2	RPL35	126660087	0.993000	0.37304	0.999000	0.59377	0.997000	0.91878	0.392000	0.20801	0.787000	0.33731	0.655000	0.94253	AAC	RPL35	-	NULL	ENSG00000136942		0.617	RPL35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL35	HGNC	protein_coding	OTTHUMT00000054035.1		0.00	65	0	G	NM_007209		127620266	-1			no_errors	ENST00000348462	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.998	T
RPL36AL	6166	genome.wustl.edu	37	14	50085611	50085611	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr14:50085611T>C	ENST00000298289.6	-	2	371	c.212A>G	c.(211-213)gAa>gGa	p.E71G	RP11-649E7.5_ENST00000555043.1_RNA|MGAT2_ENST00000305386.2_5'Flank	NM_001001.4	NP_000992.1	Q969Q0	RL36L_HUMAN	ribosomal protein L36a-like	71					translation (GO:0006412)	ribosome (GO:0005840)	structural constituent of ribosome (GO:0003735)					all_epithelial(31;0.0021)|Breast(41;0.0124)					CTCAACACATTCCAGCCTTAG	0.483																																																	0													115.0	109.0	111.0					14																	50085611		2203	4300	6503	SO:0001583	missense	0			BC000741	CCDS9689.1	14q21	2008-08-29	2002-01-15	2002-01-18	ENSG00000165502	ENSG00000165502		"""L ribosomal proteins"""	10346	protein-coding gene	gene with protein product		180469	"""ribosomal protein L36a"""	RPL36A		1577483	Standard	NM_001001		Approved		uc001wwq.2	Q969Q0	OTTHUMG00000152330	ENST00000298289.6:c.212A>G	14.37:g.50085611T>C	ENSP00000346012:p.Glu71Gly		Q3B7A5	Missense_Mutation	SNP	pfam_Ribosomal_L44e,superfamily_Ribosomal_zn-bd	p.E71G	ENST00000298289.6	37	c.212	CCDS9689.1	14	.	.	.	.	.	.	.	.	.	.	T	16.07	3.018844	0.54576	.	.	ENSG00000165502	ENST00000298289	T	0.50001	0.76	4.16	4.16	0.48862	Ribosomal protein, zinc-binding domain (1);	0.000000	0.64402	U	0.000002	T	0.38321	0.1036	.	.	.	0.43275	D	0.995239	P	0.36944	0.574	B	0.33339	0.162	T	0.44605	-0.9317	9	0.72032	D	0.01	-39.753	11.9374	0.52880	0.0:0.0:0.0:1.0	.	71	Q969Q0	RL36L_HUMAN	G	71	ENSP00000346012:E71G	ENSP00000346012:E71G	E	-	2	0	RPL36AL	49155361	1.000000	0.71417	0.698000	0.30274	0.799000	0.45148	7.442000	0.80503	2.142000	0.66516	0.472000	0.43445	GAA	RPL36AL	-	pfam_Ribosomal_L44e,superfamily_Ribosomal_zn-bd	ENSG00000165502		0.483	RPL36AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL36AL	HGNC	protein_coding	OTTHUMT00000276808.2	-	0.00	82	0	T			50085611	-1	tier1	-	no_errors	ENST00000298289	ensembl	human	known	74_37	missense	14.47	65	11	SNP	1.000	C
RPS21	6227	genome.wustl.edu	37	20	60963477	60963477	+	Intron	SNP	C	C	T	rs535184758		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr20:60963477C>T	ENST00000343986.4	+	6	281				RPS21_ENST00000370562.1_3'UTR|RPS21_ENST00000450116.2_3'UTR|RPS21_ENST00000492356.2_3'UTR	NM_001024.3	NP_001015.1	P63220	RS21_HUMAN	ribosomal protein S21						cellular protein metabolic process (GO:0044267)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 3'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000461)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|structural constituent of ribosome (GO:0003735)			endometrium(2)|lung(1)|prostate(1)	4	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCTCCAGAGGCGTGGTCTTAA	0.463													C|||	1	0.000199681	0.0	0.0	5008	,	,		18149	0.0		0.0	False		,,,				2504	0.001																0													165.0	144.0	151.0					20																	60963477		2203	4300	6503	SO:0001627	intron_variant	0			L04483	CCDS13497.1	20q13.3	2011-04-05			ENSG00000171858	ENSG00000171858		"""S ribosomal proteins"""	10409	protein-coding gene	gene with protein product	"""8.2 kDa differentiation factor"""	180477				8332502, 9582194	Standard	NM_001024		Approved	S21	uc002ycr.3	P63220	OTTHUMG00000032915	ENST00000343986.4:c.243-36C>T	20.37:g.60963477C>T			P35265	RNA	SNP	-	NULL	ENST00000343986.4	37	NULL	CCDS13497.1	20																																																																																			RPS21	-	-	ENSG00000171858		0.463	RPS21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPS21	HGNC	protein_coding	OTTHUMT00000080031.2	-	0.00	124	0	C	NM_001024		60963477	+1	tier1	-	no_errors	ENST00000492356	ensembl	human	known	74_37	rna	21.90	107	30	SNP	0.000	T
RSPH1	89765	genome.wustl.edu	37	21	43913166	43913166	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr21:43913166C>A	ENST00000291536.3	-	2	245	c.78G>T	c.(76-78)gaG>gaT	p.E26D	RSPH1_ENST00000398352.3_Intron	NM_080860.2	NP_543136.1	Q8WYR4	RSPH1_HUMAN	radial spoke head 1 homolog (Chlamydomonas)	26					axoneme assembly (GO:0035082)|meiotic nuclear division (GO:0007126)	cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleus (GO:0005634)				large_intestine(7)|lung(2)|ovary(1)|prostate(1)|stomach(1)	12						TTTCGCCTGCCTCATTCCGAC	0.507																																					Esophageal Squamous(23;63 706 6286 10288 12913)												0													209.0	195.0	199.0					21																	43913166		2203	4300	6503	SO:0001583	missense	0			AB006536	CCDS13688.1, CCDS68210.1	21q22.3	2014-02-03	2007-06-25	2007-06-25	ENSG00000160188	ENSG00000160188			12371	protein-coding gene	gene with protein product	"""meichroacidin"""	609314	"""testis specific A2 homolog (mouse)"""	TSGA2		9403069, 9578619, 17451891	Standard	XM_005261208		Approved	FLJ32753, RSP44, RSPH10A, CILD24	uc002zbg.3	Q8WYR4	OTTHUMG00000086804	ENST00000291536.3:c.78G>T	21.37:g.43913166C>A	ENSP00000291536:p.Glu26Asp		A8MWV0|B2RBN9|Q3MJA1	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.E26D	ENST00000291536.3	37	c.78	CCDS13688.1	21	.	.	.	.	.	.	.	.	.	.	C	12.05	1.820155	0.32145	.	.	ENSG00000160188	ENST00000291536	T	0.43688	0.94	5.08	-0.596	0.11657	.	0.213759	0.47455	N	0.000229	T	0.25121	0.0610	L	0.47016	1.485	0.58432	D	0.999999	B	0.25048	0.117	B	0.23419	0.046	T	0.05241	-1.0897	10	0.20519	T	0.43	.	1.1984	0.01880	0.2156:0.3154:0.1058:0.3632	.	26	Q8WYR4	RSPH1_HUMAN	D	26	ENSP00000291536:E26D	ENSP00000291536:E26D	E	-	3	2	RSPH1	42786235	0.013000	0.17824	0.283000	0.24790	0.549000	0.35272	-0.222000	0.09190	-0.092000	0.12417	0.563000	0.77884	GAG	RSPH1	-	NULL	ENSG00000160188		0.507	RSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH1	HGNC	protein_coding	OTTHUMT00000195379.1	-	0.00	67	0	C			43913166	-1	tier1	-	no_errors	ENST00000291536	ensembl	human	known	74_37	missense	43.33	34	26	SNP	0.623	A
RSPH1	89765	genome.wustl.edu	37	21	43913176	43913176	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr21:43913176C>T	ENST00000291536.3	-	2	235	c.68G>A	c.(67-69)gGt>gAt	p.G23D	RSPH1_ENST00000398352.3_Intron	NM_080860.2	NP_543136.1	Q8WYR4	RSPH1_HUMAN	radial spoke head 1 homolog (Chlamydomonas)	23					axoneme assembly (GO:0035082)|meiotic nuclear division (GO:0007126)	cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleus (GO:0005634)				large_intestine(7)|lung(2)|ovary(1)|prostate(1)|stomach(1)	12						CTCATTCCGACCCCCCTCATA	0.498																																					Esophageal Squamous(23;63 706 6286 10288 12913)												0													190.0	179.0	183.0					21																	43913176		2203	4300	6503	SO:0001583	missense	0			AB006536	CCDS13688.1, CCDS68210.1	21q22.3	2014-02-03	2007-06-25	2007-06-25	ENSG00000160188	ENSG00000160188			12371	protein-coding gene	gene with protein product	"""meichroacidin"""	609314	"""testis specific A2 homolog (mouse)"""	TSGA2		9403069, 9578619, 17451891	Standard	XM_005261208		Approved	FLJ32753, RSP44, RSPH10A, CILD24	uc002zbg.3	Q8WYR4	OTTHUMG00000086804	ENST00000291536.3:c.68G>A	21.37:g.43913176C>T	ENSP00000291536:p.Gly23Asp		A8MWV0|B2RBN9|Q3MJA1	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.G23D	ENST00000291536.3	37	c.68	CCDS13688.1	21	.	.	.	.	.	.	.	.	.	.	C	7.354	0.623463	0.14193	.	.	ENSG00000160188	ENST00000291536	T	0.58210	0.35	5.08	1.3	0.21679	.	0.746157	0.13555	N	0.379225	T	0.21022	0.0506	N	0.01289	-0.905	0.53688	D	0.999976	B	0.02656	0.0	B	0.01281	0.0	T	0.03231	-1.1058	10	0.34782	T	0.22	.	6.5972	0.22681	0.0:0.1387:0.1307:0.7307	.	23	Q8WYR4	RSPH1_HUMAN	D	23	ENSP00000291536:G23D	ENSP00000291536:G23D	G	-	2	0	RSPH1	42786245	0.780000	0.28664	0.147000	0.22382	0.241000	0.25554	1.121000	0.31283	0.055000	0.16094	-1.632000	0.00781	GGT	RSPH1	-	NULL	ENSG00000160188		0.498	RSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH1	HGNC	protein_coding	OTTHUMT00000195379.1	-	0.00	67	0	C			43913176	-1	tier1	-	no_errors	ENST00000291536	ensembl	human	known	74_37	missense	39.22	31	20	SNP	0.405	T
RSPH10B2	728194	genome.wustl.edu	37	7	6803595	6803595	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr7:6803595G>A	ENST00000403107.1	+	5	823	c.436G>A	c.(436-438)Gtg>Atg	p.V146M	RSPH10B2_ENST00000433859.2_Missense_Mutation_p.V146M|RSPH10B2_ENST00000359718.3_5'UTR|RSPH10B2_ENST00000463354.2_3'UTR|RSPH10B2_ENST00000297186.3_Missense_Mutation_p.V146M|RSPH10B2_ENST00000404077.1_Missense_Mutation_p.V146M			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)	146										breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						GAACCACGGCGTGTACACGTG	0.592																																																	0													26.0	23.0	24.0					7																	6803595		2195	4277	6472	SO:0001583	missense	0				CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.436G>A	7.37:g.6803595G>A	ENSP00000384766:p.Val146Met		A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	Missense_Mutation	SNP	pfam_MORN,smart_MORN	p.V146M	ENST00000403107.1	37	c.436	CCDS43552.1	7	.	.	.	.	.	.	.	.	.	.	G	5.555	0.287317	0.10513	.	.	ENSG00000169402	ENST00000403107;ENST00000404077;ENST00000297186;ENST00000433859;ENST00000540958	T;T;T;T	0.60920	0.15;0.15;0.15;0.15	3.61	-4.14	0.03892	.	1.935030	0.02710	N	0.112725	T	0.44371	0.1290	L	0.41236	1.265	0.09310	N	0.999993	P	0.36110	0.537	B	0.28011	0.085	T	0.38001	-0.9681	10	0.31617	T	0.26	.	10.8707	0.46881	0.7932:0.0:0.2068:0.0	.	146	B2RC85	R10B2_HUMAN	M	146;146;146;146;5	ENSP00000384766:V146M;ENSP00000386102:V146M;ENSP00000297186:V146M;ENSP00000416710:V146M	ENSP00000297186:V146M	V	+	1	0	RSPH10B2	6770120	0.000000	0.05858	0.001000	0.08648	0.311000	0.27955	-0.536000	0.06135	-0.816000	0.04340	-0.568000	0.04159	GTG	RSPH10B2	-	pfam_MORN,smart_MORN	ENSG00000169402		0.592	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH10B2	HGNC	protein_coding	OTTHUMT00000324184.4		0.00	70	0	G	NM_001099697		6803595	+1			no_errors	ENST00000297186	ensembl	human	known	74_37	missense	9.59	66	7	SNP	0.000	A
RSRC2	65117	genome.wustl.edu	37	12	123005118	123005118	+	Intron	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr12:123005118G>A	ENST00000331738.7	-	3	353				RSRC2_ENST00000354654.2_Intron	NM_023012.5	NP_075388.2	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2								poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|urinary_tract(2)	24	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		GTCTCTTCGCGCATAAGCACG	0.333																																																	0													161.0	126.0	136.0					12																	123005118		692	1591	2283	SO:0001627	intron_variant	0			AF161432	CCDS31920.1	12q24.31	2007-02-13			ENSG00000111011	ENSG00000111011			30559	protein-coding gene	gene with protein product						17203224	Standard	NM_023012		Approved	FLJ11021	uc001ucr.3	Q7L4I2	OTTHUMG00000167572	ENST00000331738.7:c.207+813C>T	12.37:g.123005118G>A			Q6N040|Q6NW16|Q9H864	Missense_Mutation	SNP	NULL	p.A73V	ENST00000331738.7	37	c.218	CCDS31920.1	12	.	.	.	.	.	.	.	.	.	.	G	15.27	2.782421	0.49891	.	.	ENSG00000111011	ENST00000528279	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	T	0.79435	0.4445	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.81167	-0.1056	5	0.87932	D	0	.	19.8217	0.96599	0.0:0.0:1.0:0.0	.	.	.	.	C	18	.	ENSP00000445664:R18C	R	-	1	0	RSRC2	121571071	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.420000	0.97426	2.775000	0.95449	0.650000	0.86243	CGC	RSRC2	-	NULL	ENSG00000111011		0.333	RSRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSRC2	HGNC	protein_coding	OTTHUMT00000395096.3	-	0.00	34	0	G	NM_023012		123005118	-1	tier1	-	no_errors	ENST00000433877	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	A
RYR2	6262	genome.wustl.edu	37	1	237890425	237890425	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:237890425T>G	ENST00000366574.2	+	76	11081	c.10764T>G	c.(10762-10764)caT>caG	p.H3588Q	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.H3572Q|RYR2_ENST00000360064.6_Missense_Mutation_p.H3586Q	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3588	Interaction with CALM.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTGTATGGCATAAACTACTGT	0.388																																																	0													85.0	83.0	84.0					1																	237890425		1845	4083	5928	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10764T>G	1.37:g.237890425T>G	ENSP00000355533:p.His3588Gln		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.H3586Q	ENST00000366574.2	37	c.10758	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	T	11.01	1.514027	0.27123	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.96491	-4.03;-4.0;-4.03	4.98	0.757	0.18427	.	0.000000	0.64402	U	0.000013	D	0.93481	0.7920	M	0.62154	1.92	0.80722	D	1	B	0.33103	0.397	B	0.34180	0.177	D	0.88567	0.3127	10	0.49607	T	0.09	-16.6703	7.6571	0.28381	0.0:0.4033:0.0:0.5967	.	3588	Q92736	RYR2_HUMAN	Q	3588;3586;3572;543	ENSP00000355533:H3588Q;ENSP00000353174:H3586Q;ENSP00000443798:H3572Q	ENSP00000353174:H3586Q	H	+	3	2	RYR2	235957048	0.062000	0.20869	0.975000	0.42487	0.501000	0.33797	-0.591000	0.05753	0.177000	0.19895	-0.263000	0.10527	CAT	RYR2	-	NULL	ENSG00000198626		0.388	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	52	0	T	NM_001035		237890425	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	26.32	42	15	SNP	0.995	G
SACS	26278	genome.wustl.edu	37	13	23905799	23905799	+	Silent	SNP	A	A	C	rs574182225		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr13:23905799A>C	ENST00000382292.3	-	9	12489	c.12216T>G	c.(12214-12216)acT>acG	p.T4072T	SACS_ENST00000402364.1_Silent_p.T3322T|SACS_ENST00000382298.3_Silent_p.T4072T			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	4072					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AAAAAGCAAAAGTTTCACTTC	0.363																																																	0													69.0	66.0	67.0					13																	23905799		2203	4299	6502	SO:0001819	synonymous_variant	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.12216T>G	13.37:g.23905799A>C			O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.T4072	ENST00000382292.3	37	c.12216	CCDS9300.2	13																																																																																			SACS	-	NULL	ENSG00000151835		0.363	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	-	0.00	20	0	A	NM_014363		23905799	-1	tier1	-	no_errors	ENST00000382292	ensembl	human	known	74_37	silent	31.82	15	7	SNP	0.033	C
SCN2A	6326	genome.wustl.edu	37	2	166245431	166245431	+	Silent	SNP	C	C	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:166245431C>A	ENST00000375437.2	+	27	5405	c.5115C>A	c.(5113-5115)atC>atA	p.I1705I	SCN2A_ENST00000375427.2_Silent_p.I1705I|SCN2A_ENST00000357398.3_Silent_p.I1705I|SCN2A_ENST00000283256.6_Silent_p.I1705I	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1705					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.I1705I(2)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACAGCATGATCTGCCTGTTCC	0.463																																																	2	Substitution - coding silent(2)	lung(2)											232.0	227.0	229.0					2																	166245431		2203	4300	6503	SO:0001819	synonymous_variant	0			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.5115C>A	2.37:g.166245431C>A			A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.I1705	ENST00000375437.2	37	c.5115	CCDS33314.1	2																																																																																			SCN2A	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000136531		0.463	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	-	0.00	83	0	C	NM_021007		166245431	+1	tier1	-	no_errors	ENST00000283256	ensembl	human	known	74_37	silent	22.86	54	16	SNP	1.000	A
SFI1	9814	genome.wustl.edu	37	22	32002366	32002366	+	Frame_Shift_Del	DEL	A	A	-	rs548693448		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr22:32002366delA	ENST00000400288.2	+	21	2212	c.2107delA	c.(2107-2109)aaafs	p.K704fs	SFI1_ENST00000414585.1_Frame_Shift_Del_p.K551fs|SFI1_ENST00000432498.1_Frame_Shift_Del_p.K673fs|SFI1_ENST00000443011.1_Frame_Shift_Del_p.K551fs|SFI1_ENST00000443326.1_Frame_Shift_Del_p.K622fs|SFI1_ENST00000400289.1_Frame_Shift_Del_p.K622fs|SFI1_ENST00000540643.1_Frame_Shift_Del_p.K649fs	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	704					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						GGATGAAGCCAAAAAAACCTT	0.512																																																	0													86.0	86.0	86.0					22																	32002366		2033	4185	6218	SO:0001589	frameshift_variant	0			AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.2107delA	22.37:g.32002366delA	ENSP00000383145:p.Lys704fs		A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Frame_Shift_Del	DEL	superfamily_Cyclin-like	p.T705fs	ENST00000400288.2	37	c.2107	CCDS43004.1	22																																																																																			SFI1	-	superfamily_Cyclin-like	ENSG00000198089		0.512	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SFI1	HGNC	protein_coding	OTTHUMT00000337180.3		0.00	23	0	A	NM_014775		32002366	+1	tier1		no_errors	ENST00000400288	ensembl	human	known	74_37	frame_shift_del	14.29	12	2	DEL	0.055	-
SLA2	84174	genome.wustl.edu	37	20	35242298	35242298	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr20:35242298C>T	ENST00000262866.4	-	8	1179	c.757G>A	c.(757-759)Gac>Aac	p.D253N	SLA2_ENST00000360672.2_3'UTR	NM_032214.3|NM_175077.2	NP_115590.1|NP_778252.1	Q9H6Q3	SLAP2_HUMAN	Src-like-adaptor 2	253	SLA C-terminal.				antigen receptor-mediated signaling pathway (GO:0050851)|B cell mediated immunity (GO:0019724)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of B cell activation (GO:0050869)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of signal transduction (GO:0009967)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|late endosome (GO:0005770)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(2)|skin(2)	5	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				ACAGCCTCGTCATTCAGGCTG	0.567																																					Ovarian(59;720 1165 26994 46188 51693)												0													76.0	71.0	73.0					20																	35242298		2203	4300	6503	SO:0001583	missense	0			AF326353	CCDS13282.1, CCDS13283.1	20q11.23	2013-02-14			ENSG00000101082	ENSG00000101082		"""SH2 domain containing"""	17329	protein-coding gene	gene with protein product		606577		C20orf156		11696592	Standard	NM_032214		Approved	FLJ21992, SLAP-2	uc002xfv.3	Q9H6Q3	OTTHUMG00000032393	ENST00000262866.4:c.757G>A	20.37:g.35242298C>T	ENSP00000262866:p.Asp253Asn		A8K648|E1P5U1|E1P5U2|Q5TH27|Q5TH28|Q8WY18|Q96QI4|Q9H135	Missense_Mutation	SNP	pfam_SH2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2	p.D253N	ENST00000262866.4	37	c.757	CCDS13282.1	20	.	.	.	.	.	.	.	.	.	.	C	10.77	1.444111	0.25987	.	.	ENSG00000101082	ENST00000262866	T	0.78126	-1.15	5.35	3.36	0.38483	.	0.700616	0.13759	N	0.364744	T	0.69611	0.3130	L	0.44542	1.39	0.39171	D	0.962595	B	0.14438	0.01	B	0.14023	0.01	T	0.67173	-0.5737	10	0.72032	D	0.01	-1.8779	8.938	0.35711	0.1686:0.6692:0.1622:0.0	.	253	Q9H6Q3	SLAP2_HUMAN	N	253	ENSP00000262866:D253N	ENSP00000262866:D253N	D	-	1	0	SLA2	34675712	0.642000	0.27260	0.126000	0.21872	0.099000	0.18886	1.748000	0.38308	0.899000	0.36444	0.655000	0.94253	GAC	SLA2	-	NULL	ENSG00000101082		0.567	SLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLA2	HGNC	protein_coding	OTTHUMT00000079037.2		0.00	59	0	C	NM_175077		35242298	-1			no_errors	ENST00000262866	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.546	T
SLC36A3	285641	genome.wustl.edu	37	5	150657079	150657079	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr5:150657079C>T	ENST00000335230.3	-	10	1699	c.1288G>A	c.(1288-1290)Gcc>Acc	p.A430T	SLC36A3_ENST00000377713.3_Missense_Mutation_p.A471T	NM_181774.3	NP_861439.3	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3	430						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	21		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATGTCCTTGGCAATGGTGACA	0.537																																																	0													131.0	116.0	121.0					5																	150657079		2203	4300	6503	SO:0001583	missense	0			AY162215	CCDS4314.1, CCDS47316.1	5q33.1	2013-07-17	2013-07-17		ENSG00000186334	ENSG00000186334		"""Solute carriers"""	19659	protein-coding gene	gene with protein product		608332				12809675	Standard	NM_181774		Approved	PAT3, TRAMD2, tramdorin2	uc003ltw.2	Q495N2	OTTHUMG00000130128	ENST00000335230.3:c.1288G>A	5.37:g.150657079C>T	ENSP00000334750:p.Ala430Thr		Q495N3|Q6ZMU7|Q6ZRU4|Q7Z6B4	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.A471T	ENST00000335230.3	37	c.1411	CCDS4314.1	5	.	.	.	.	.	.	.	.	.	.	C	15.26	2.780824	0.49891	.	.	ENSG00000186334	ENST00000335230;ENST00000377713	T;T	0.02323	4.34;4.34	4.69	2.87	0.33458	.	0.889964	0.09930	N	0.737317	T	0.02342	0.0072	N	0.17800	0.525	0.34006	D	0.650843	B;B;B	0.19445	0.018;0.011;0.036	B;B;B	0.25614	0.025;0.062;0.036	T	0.32877	-0.9890	10	0.20046	T	0.44	.	6.6203	0.22800	0.1539:0.6982:0.0:0.1479	.	471;430;415	Q495N2-3;Q495N2;Q495N2-2	.;S36A3_HUMAN;.	T	430;471	ENSP00000334750:A430T;ENSP00000366942:A471T	ENSP00000334750:A430T	A	-	1	0	SLC36A3	150637272	0.054000	0.20591	0.966000	0.40874	0.918000	0.54935	0.785000	0.26830	1.306000	0.44926	0.655000	0.94253	GCC	SLC36A3	-	pfam_AA_transpt_TM	ENSG00000186334		0.537	SLC36A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC36A3	HGNC	protein_coding	OTTHUMT00000252436.1	-	0.00	58	0	C	NM_181774		150657079	-1	tier1	-	no_errors	ENST00000377713	ensembl	human	known	74_37	missense	11.11	40	5	SNP	0.979	T
SMAD4	4089	genome.wustl.edu	37	18	48573437	48573437	+	Silent	SNP	G	G	T	rs142292491		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr18:48573437G>T	ENST00000342988.3	+	2	559	c.21G>T	c.(19-21)acG>acT	p.T7T	SMAD4_ENST00000398417.2_Silent_p.T7T|SMAD4_ENST00000588745.1_Silent_p.T7T|RP11-729L2.2_ENST00000590722.2_3'UTR|RP11-729L2.2_ENST00000588256.1_3'UTR|SMAD4_ENST00000452201.2_Silent_p.T7T	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	7					atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(5)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		TGTCTATTACGAATACACCAA	0.348																																																	41	Whole gene deletion(36)|Unknown(5)	pancreas(26)|large_intestine(3)|stomach(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|oesophagus(1)|NS(1)											100.0	90.0	94.0					18																	48573437		2203	4300	6503	SO:0001819	synonymous_variant	0			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.21G>T	18.37:g.48573437G>T			A8K405	Silent	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.T7	ENST00000342988.3	37	c.21	CCDS11950.1	18																																																																																			SMAD4	-	NULL	ENSG00000141646		0.348	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD4	HGNC	protein_coding	OTTHUMT00000255993.3		0.00	56	0	G	NM_005359		48573437	+1			no_errors	ENST00000342988	ensembl	human	known	74_37	silent	7.41	25	2	SNP	0.665	T
SMARCA5	8467	genome.wustl.edu	37	4	144457812	144457812	+	Silent	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr4:144457812C>T	ENST00000283131.3	+	11	1938	c.1476C>T	c.(1474-1476)ctC>ctT	p.L492L		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	492	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					ACAAGCTGCTCCCTAAGTTAA	0.373																																																	0													90.0	84.0	86.0					4																	144457812		2203	4300	6503	SO:0001819	synonymous_variant	0			AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.1476C>T	4.37:g.144457812C>T				Silent	SNP	pfam_SNF2_N,pfam_SLIDE,pfam_ISWI_HAND-dom,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_HDA_complex_subunit-2/3,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,superfamily_ISWI_HAND-dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_SANT/Myb,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L492	ENST00000283131.3	37	c.1476	CCDS3761.1	4																																																																																			SMARCA5	-	pfam_HDA_complex_subunit-2/3,superfamily_P-loop_NTPase,pfscan_Helicase_C	ENSG00000153147		0.373	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCA5	HGNC	protein_coding	OTTHUMT00000365077.3		0.00	19	0	C			144457812	+1			no_errors	ENST00000283131	ensembl	human	known	74_37	silent	25.00	15	5	SNP	0.777	T
SMC2	10592	genome.wustl.edu	37	9	106862398	106862398	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr9:106862398G>T	ENST00000286398.7	+	6	793	c.505G>T	c.(505-507)Gct>Tct	p.A169S	SMC2_ENST00000374787.3_Missense_Mutation_p.A169S|SMC2_ENST00000374793.3_Missense_Mutation_p.A169S|SMC2_ENST00000303219.8_Missense_Mutation_p.A169S	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	169					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)	p.A169S(2)		breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						AGAAGAAGCAGCTGGAACCAG	0.299																																																	2	Substitution - Missense(2)	endometrium(2)											35.0	39.0	38.0					9																	106862398		2188	4284	6472	SO:0001583	missense	0			AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.505G>T	9.37:g.106862398G>T	ENSP00000286398:p.Ala169Ser		Q6IEE0|Q9P1P2	Missense_Mutation	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,smart_SMC_hinge	p.A169S	ENST00000286398.7	37	c.505	CCDS35086.1	9	.	.	.	.	.	.	.	.	.	.	G	34	5.303509	0.95601	.	.	ENSG00000136824	ENST00000286398;ENST00000440179;ENST00000374793;ENST00000303219;ENST00000536893;ENST00000374787	T;T;T;T;T	0.07567	3.18;3.18;3.18;3.18;3.18	5.83	5.83	0.93111	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.27967	0.0689	L	0.58583	1.82	0.80722	D	1	D;D;D	0.89917	0.998;0.999;1.0	D;D;D	0.91635	0.971;0.98;0.999	T	0.00056	-1.2176	10	0.59425	D	0.04	-12.675	18.6931	0.91590	0.0:0.0:1.0:0.0	.	169;169;169	A8K984;O95347;Q2KQ72	.;SMC2_HUMAN;.	S	169;24;169;169;169;169	ENSP00000286398:A169S;ENSP00000414999:A24S;ENSP00000363925:A169S;ENSP00000306152:A169S;ENSP00000363919:A169S	ENSP00000286398:A169S	A	+	1	0	SMC2	105902219	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.755000	0.98912	2.761000	0.94854	0.650000	0.86243	GCT	SMC2	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	ENSG00000136824		0.299	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC2	HGNC	protein_coding	OTTHUMT00000053470.1		0.00	35	0	G			106862398	+1			no_errors	ENST00000286398	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
SMG9	56006	genome.wustl.edu	37	19	44251857	44251857	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr19:44251857G>A	ENST00000270066.6	-	4	760	c.418C>T	c.(418-420)Cag>Tag	p.Q140*	SMG9_ENST00000601170.1_Nonsense_Mutation_p.Q140*	NM_019108.2	NP_061981.2	Q9H0W8	SMG9_HUMAN	SMG9 nonsense mediated mRNA decay factor	140					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|intracellular (GO:0005622)	identical protein binding (GO:0042802)			kidney(1)|large_intestine(5)|liver(1)|lung(7)|pancreas(1)|prostate(2)|urinary_tract(2)	19						GTGGGTCTCTGCCCCTCCTTC	0.687																																																	0													23.0	26.0	25.0					19																	44251857		2203	4298	6501	SO:0001587	stop_gained	0			BC008869	CCDS33043.2	19q13.31	2013-07-02	2013-07-02	2011-06-21	ENSG00000105771	ENSG00000105771			25763	protein-coding gene	gene with protein product		613176	"""chromosome 19 open reading frame 61"", ""smg-9 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C19orf61		11230166, 19417104	Standard	NM_019108		Approved	FLJ12886	uc002oxj.2	Q9H0W8	OTTHUMG00000150337	ENST00000270066.6:c.418C>T	19.37:g.44251857G>A	ENSP00000270066:p.Gln140*		O60429|Q9H9A9	Nonsense_Mutation	SNP	pfam_Smg8/Smg9,superfamily_P-loop_NTPase	p.Q140*	ENST00000270066.6	37	c.418	CCDS33043.2	19	.	.	.	.	.	.	.	.	.	.	G	40	8.519503	0.98845	.	.	ENSG00000105771	ENST00000270066	.	.	.	5.3	5.3	0.74995	.	0.065652	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-0.108	16.4556	0.84011	0.0:0.0:1.0:0.0	.	.	.	.	X	140	.	ENSP00000270066:Q140X	Q	-	1	0	SMG9	48943697	1.000000	0.71417	0.992000	0.48379	0.994000	0.84299	8.469000	0.90395	2.499000	0.84300	0.655000	0.94253	CAG	SMG9	-	NULL	ENSG00000105771		0.687	SMG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG9	HGNC	protein_coding	OTTHUMT00000317668.1	-	0.00	54	0	G	NM_019108		44251857	-1	tier1	-	no_errors	ENST00000270066	ensembl	human	known	74_37	nonsense	13.89	31	5	SNP	1.000	A
SMIM11	54065	genome.wustl.edu	37	21	35774492	35774492	+	3'UTR	DEL	T	T	-	rs534668511	byFrequency	TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr21:35774492delT	ENST00000399299.1	+	0	450				SMIM11_ENST00000481710.1_3'UTR|AP000322.54_ENST00000410005.1_5'Flank			P58511	SIM11_HUMAN	small integral membrane protein 11							integral component of membrane (GO:0016021)											TGGAGGAGGATTTTTTTTTTT	0.373																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC015596	CCDS33550.1	21q22.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000205670	ENSG00000205670			1293	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 51"", ""family with sequence similarity 165, member B"""	C21orf51, FAM165B			Standard	NM_058182		Approved		uc002ytu.4	P58511	OTTHUMG00000086193	ENST00000399299.1:c.*98T>-	21.37:g.35774492delT				RNA	DEL	-	NULL	ENST00000399299.1	37	NULL		21																																																																																			SMIM11	-	-	ENSG00000205670		0.373	SMIM11-002	PUTATIVE	basic|exp_conf	protein_coding	SMIM11	HGNC	protein_coding	OTTHUMT00000194076.1		0.00	19	0	T	NM_058182		35774492	+1	tier1		no_errors	ENST00000481710	ensembl	human	known	74_37	rna	31.58	13	6	DEL	0.002	-
SNAP91	9892	genome.wustl.edu	37	6	84302714	84302714	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr6:84302714delT	ENST00000439399.2	-	20	2113	c.1797delA	c.(1795-1797)caafs	p.Q599fs	SNAP91_ENST00000195649.6_Frame_Shift_Del_p.Q599fs|SNAP91_ENST00000520302.1_Frame_Shift_Del_p.Q597fs|SNAP91_ENST00000428679.2_Frame_Shift_Del_p.Q599fs|SNAP91_ENST00000437520.1_Intron|SNAP91_ENST00000521485.1_Frame_Shift_Del_p.Q599fs|SNAP91_ENST00000520213.1_Intron|SNAP91_ENST00000521743.1_Frame_Shift_Del_p.Q599fs|SNAP91_ENST00000369694.2_Frame_Shift_Del_p.Q599fs	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	599					clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		GAGAGGCCCCTTGTGGTGGAG	0.443																																																	0													45.0	46.0	46.0					6																	84302714		1891	4127	6018	SO:0001589	frameshift_variant	0			AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.1797delA	6.37:g.84302714delT	ENSP00000400459:p.Gln599fs		A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Frame_Shift_Del	DEL	pfam_ANTH_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.A601fs	ENST00000439399.2	37	c.1797	CCDS47455.1	6																																																																																			SNAP91	-	NULL	ENSG00000065609		0.443	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SNAP91	HGNC	protein_coding	OTTHUMT00000375296.1		0.00	8	0	T			84302714	-1			no_errors	ENST00000369694	ensembl	human	known	74_37	frame_shift_del	33.33	4	2	DEL	0.992	0
SOBP	55084	genome.wustl.edu	37	6	107956647	107956647	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr6:107956647C>T	ENST00000317357.5	+	6	3258	c.2599C>T	c.(2599-2601)Cga>Tga	p.R867*	SOBP_ENST00000494935.1_3'UTR	NM_018013.3	NP_060483.3			sine oculis binding protein homolog (Drosophila)											endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	26		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		GAGGTGCCTCCGAATTAGAAA	0.597																																																	0													43.0	50.0	48.0					6																	107956647		1946	4143	6089	SO:0001587	stop_gained	0			AK001021	CCDS43488.1	6q21	2007-03-15			ENSG00000112320	ENSG00000112320			29256	protein-coding gene	gene with protein product		613667					Standard	NM_018013		Approved	FLJ10159	uc003prx.3	A7XYQ1	OTTHUMG00000015312	ENST00000317357.5:c.2599C>T	6.37:g.107956647C>T	ENSP00000318900:p.Arg867*			Nonsense_Mutation	SNP	NULL	p.R867*	ENST00000317357.5	37	c.2599	CCDS43488.1	6	.	.	.	.	.	.	.	.	.	.	C	47	13.441981	0.99742	.	.	ENSG00000112320	ENST00000317357;ENST00000230065	.	.	.	5.38	5.38	0.77491	.	0.245175	0.24781	U	0.035642	.	.	.	.	.	.	0.52501	D	0.999959	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.3472	19.1356	0.93426	0.0:1.0:0.0:0.0	.	.	.	.	X	867;262	.	ENSP00000230065:R262X	R	+	1	2	SOBP	108063340	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.667000	0.68067	2.507000	0.84556	0.563000	0.77884	CGA	SOBP	-	NULL	ENSG00000112320		0.597	SOBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOBP	HGNC	protein_coding	OTTHUMT00000041693.2	-	0.00	20	0	C	NM_018013		107956647	+1	tier1	-	no_errors	ENST00000317357	ensembl	human	known	74_37	nonsense	42.86	16	12	SNP	1.000	T
SPATA31D1	389763	genome.wustl.edu	37	9	84610022	84610022	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr9:84610022C>T	ENST00000344803.2	+	4	4684	c.4637C>T	c.(4636-4638)gCt>gTt	p.A1546V		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1546					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CCAACCAGTGCTAAAAGCCCT	0.517																																																	0													20.0	21.0	20.0					9																	84610022		2079	4223	6302	SO:0001583	missense	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.4637C>T	9.37:g.84610022C>T	ENSP00000341988:p.Ala1546Val			Missense_Mutation	SNP	NULL	p.A1546V	ENST00000344803.2	37	c.4637	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	C	14.58	2.578898	0.46006	.	.	ENSG00000214929	ENST00000344803	T	0.08458	3.09	2.37	1.44	0.22558	.	.	.	.	.	T	0.12987	0.0315	N	0.24115	0.695	0.09310	N	1	D	0.89917	1.0	D	0.72338	0.977	T	0.20174	-1.0283	9	0.48119	T	0.1	-1.6923	6.3297	0.21262	0.2936:0.7064:0.0:0.0	.	1546	Q6ZQQ2	F75D1_HUMAN	V	1546	ENSP00000341988:A1546V	ENSP00000341988:A1546V	A	+	2	0	FAM75D1	83799842	0.000000	0.05858	0.058000	0.19502	0.009000	0.06853	-0.209000	0.09358	0.547000	0.28938	0.655000	0.94253	GCT	SPATA31D1	-	NULL	ENSG00000214929		0.517	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	HGNC	protein_coding	OTTHUMT00000402325.1	-	0.00	46	0	C	NM_001001670		84610022	+1	tier1	-	no_errors	ENST00000344803	ensembl	human	known	74_37	missense	21.15	41	11	SNP	0.066	T
SPIN3	169981	genome.wustl.edu	37	X	57021369	57021369	+	Silent	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:57021369C>T	ENST00000374919.3	-	2	334	c.12G>A	c.(10-12)ccG>ccA	p.P4P		NM_001010862.2	NP_001010862.2	Q5JUX0	SPIN3_HUMAN	spindlin family, member 3	4				P -> A (in Ref. 1; BAH14098). {ECO:0000305}.	gamete generation (GO:0007276)					central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4						CCTTTCCAAACGGGGTCTTCA	0.522																																																	0													31.0	30.0	31.0					X																	57021369		2067	4168	6235	SO:0001819	synonymous_variant	0			AL832091	CCDS43963.1	Xp11.22	2008-02-05			ENSG00000204271	ENSG00000204271			27272	protein-coding gene	gene with protein product							Standard	NM_001010862		Approved		uc004dux.1	Q5JUX0	OTTHUMG00000021677	ENST00000374919.3:c.12G>A	X.37:g.57021369C>T			B2RUW3|B7Z8W2|Q8N5D9	Silent	SNP	pfam_Spin_Ssty	p.P4	ENST00000374919.3	37	c.12	CCDS43963.1	X																																																																																			SPIN3	-	NULL	ENSG00000204271		0.522	SPIN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIN3	HGNC	protein_coding	OTTHUMT00000056908.1	-	0.00	48	0	C	XM_093024		57021369	-1	tier1	-	no_errors	ENST00000374919	ensembl	human	known	74_37	silent	37.25	32	19	SNP	0.006	T
SPTBN4	57731	genome.wustl.edu	37	19	41025471	41025471	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr19:41025471C>T	ENST00000352632.3	+	16	3153	c.3067C>T	c.(3067-3069)Cgt>Tgt	p.R1023C	SPTBN4_ENST00000344104.3_Missense_Mutation_p.R1023C|SPTBN4_ENST00000595535.1_Missense_Mutation_p.R1023C|SPTBN4_ENST00000338932.3_Missense_Mutation_p.R1023C|SPTBN4_ENST00000598249.1_Missense_Mutation_p.R1023C			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1023					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ccTGCAGTGGCGTCTTAGCGG	0.746																																																	0													5.0	7.0	7.0					19																	41025471		2108	4113	6221	SO:0001583	missense	0			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.3067C>T	19.37:g.41025471C>T	ENSP00000263373:p.Arg1023Cys		E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.R1023C	ENST00000352632.3	37	c.3067	CCDS12559.1	19	.	.	.	.	.	.	.	.	.	.	C	20.7	4.027698	0.75390	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.79033	-1.2;-1.18;-1.23	4.52	3.47	0.39725	.	0.292881	0.26796	N	0.022454	T	0.77267	0.4105	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;1.0	P;D	0.67231	0.899;0.95	T	0.79063	-0.1957	10	0.87932	D	0	.	10.8777	0.46921	0.3416:0.6584:0.0:0.0	.	1023;1023	Q9H254;Q71S06	SPTN4_HUMAN;.	C	1023	ENSP00000263373:R1023C;ENSP00000340345:R1023C;ENSP00000340741:R1023C	ENSP00000340345:R1023C	R	+	1	0	SPTBN4	45717311	0.002000	0.14202	0.997000	0.53966	0.990000	0.78478	0.118000	0.15605	1.107000	0.41642	0.462000	0.41574	CGT	SPTBN4	-	pirsf_Spectrin_bsu,smart_Spectrin/alpha-actinin	ENSG00000160460		0.746	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	HGNC	protein_coding	OTTHUMT00000462559.2		0.00	34	0	C			41025471	+1			no_errors	ENST00000352632	ensembl	human	known	74_37	missense	12.50	21	3	SNP	0.991	T
SRCAP	10847	genome.wustl.edu	37	16	30750430	30750430	+	Silent	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr16:30750430C>T	ENST00000262518.4	+	34	9454	c.9069C>T	c.(9067-9069)ccC>ccT	p.P3023P	SRCAP_ENST00000344771.4_Silent_p.P2865P|RP11-2C24.4_ENST00000483578.1_lincRNA|SRCAP_ENST00000395059.2_Silent_p.P2961P	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	3023	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GCCAGCTCCCCGTCTTGGACC	0.607																																																	0													88.0	78.0	81.0					16																	30750430		2197	4300	6497	SO:0001819	synonymous_variant	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.9069C>T	16.37:g.30750430C>T			B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.P3023	ENST00000262518.4	37	c.9069	CCDS10689.2	16																																																																																			SRCAP	-	NULL	ENSG00000080603		0.607	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	-	0.00	43	0	C	NM_006662		30750430	+1	tier1	-	no_errors	ENST00000262518	ensembl	human	known	74_37	silent	18.18	27	6	SNP	0.987	T
SSBP2	23635	genome.wustl.edu	37	5	80716264	80716264	+	3'UTR	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr5:80716264G>A	ENST00000320672.4	-	0	1355				SSBP2_ENST00000505980.1_3'UTR|SSBP2_ENST00000514493.1_3'UTR|SSBP2_ENST00000510060.1_5'UTR|SSBP2_ENST00000509053.1_3'UTR|SSBP2_ENST00000515395.1_3'UTR	NM_001256732.1|NM_001256733.1|NM_012446.3	NP_001243661.1|NP_001243662.1|NP_036578.2	P81877	SSBP2_HUMAN	single-stranded DNA binding protein 2						regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)		SSBP2/JAK2(4)	central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)		ATTTTCTTCCGTAGTAGTTCT	0.423																																																	0													102.0	92.0	95.0					5																	80716264		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			AF077048	CCDS4056.1, CCDS58960.1, CCDS58961.1, CCDS58962.1, CCDS58963.1, CCDS75268.1	5q14.1	2012-05-25	2001-11-28		ENSG00000145687	ENSG00000145687			15831	protein-coding gene	gene with protein product		607389	"""single-stranded DNA-binding protein 2"""			11230166, 11042152	Standard	NM_001256732		Approved	HSPC116	uc003khp.4	P81877	OTTHUMG00000119039	ENST00000320672.4:c.*59C>T	5.37:g.80716264G>A			B2R5W1|B7Z1J2|B7Z2L9|B7Z665|D6RH18|E9PB74|E9PDA8|Q8N2Q2|Q9BWW6|Q9Y4T7	RNA	SNP	-	NULL	ENST00000320672.4	37	NULL	CCDS4056.1	5																																																																																			SSBP2	-	-	ENSG00000145687		0.423	SSBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSBP2	HGNC	protein_coding	OTTHUMT00000239249.1	-	0.00	66	0	G	NM_012446		80716264	-1	tier1	-	no_errors	ENST00000510060	ensembl	human	known	74_37	rna	18.18	45	10	SNP	0.894	A
SSTR3	6753	genome.wustl.edu	37	22	37602896	37602896	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr22:37602896A>C	ENST00000328544.3	-	2	1480	c.947T>G	c.(946-948)cTc>cGc	p.L316R	SSTR3_ENST00000402501.1_Missense_Mutation_p.L316R	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	316					cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	GCGGTAGGAGAGGAAGCCATA	0.657																																																	0													64.0	57.0	60.0					22																	37602896		2203	4300	6503	SO:0001583	missense	0				CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.947T>G	22.37:g.37602896A>C	ENSP00000330138:p.Leu316Arg		A8K550|Q53ZR7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Somatstn_rcpt_3,prints_GPCR_Rhodpsn,prints_Somatstn_rcpt,prints_Somatstn_rcpt_5,prints_Neuropept_B/W_rcpt	p.L316R	ENST00000328544.3	37	c.947	CCDS13944.1	22	.	.	.	.	.	.	.	.	.	.	A	22.2	4.261161	0.80246	.	.	ENSG00000183473	ENST00000328544;ENST00000402501	T;T	0.37058	1.22;1.22	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.59985	0.2234	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.64639	-0.6360	10	0.87932	D	0	.	15.2332	0.73407	1.0:0.0:0.0:0.0	.	316	P32745	SSR3_HUMAN	R	316	ENSP00000330138:L316R;ENSP00000384904:L316R	ENSP00000330138:L316R	L	-	2	0	SSTR3	35932842	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.313000	0.96297	1.991000	0.58162	0.460000	0.39030	CTC	SSTR3	-	pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_GPCR_Rhodpsn,prints_Somatstn_rcpt	ENSG00000183473		0.657	SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSTR3	HGNC	protein_coding	OTTHUMT00000318802.1	-	0.00	93	0	A			37602896	-1	tier1	-	no_errors	ENST00000328544	ensembl	human	known	74_37	missense	17.05	73	15	SNP	1.000	C
STAB1	23166	genome.wustl.edu	37	3	52546871	52546871	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr3:52546871C>T	ENST00000321725.6	+	29	3131	c.3055C>T	c.(3055-3057)Cgc>Tgc	p.R1019C		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1019	FAS1 3. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TCCTGCCGACCGCCGAGTCAC	0.667																																																	0													33.0	38.0	36.0					3																	52546871		2199	4289	6488	SO:0001583	missense	0			AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.3055C>T	3.37:g.52546871C>T	ENSP00000312946:p.Arg1019Cys		A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,smart_EG-like_dom,smart_EGF_laminin,smart_FAS1_domain,smart_EGF-like_Ca-bd_dom,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.R1019C	ENST00000321725.6	37	c.3055	CCDS33768.1	3	.	.	.	.	.	.	.	.	.	.	C	13.63	2.294440	0.40594	.	.	ENSG00000010327	ENST00000321725	D	0.91792	-2.91	5.84	-5.35	0.02697	FAS1 domain (4);	1.092920	0.06754	N	0.780586	D	0.86590	0.5969	L	0.42245	1.32	0.09310	N	1	P	0.40360	0.714	B	0.37422	0.249	T	0.79040	-0.1966	10	0.56958	D	0.05	.	9.6067	0.39637	0.2868:0.2099:0.5033:0.0	.	1019	Q9NY15	STAB1_HUMAN	C	1019	ENSP00000312946:R1019C	ENSP00000312946:R1019C	R	+	1	0	STAB1	52521911	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.060000	0.14342	-1.243000	0.02519	-2.333000	0.00248	CGC	STAB1	-	pfam_FAS1_domain,superfamily_FAS1_domain,pfscan_FAS1_domain	ENSG00000010327		0.667	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	HGNC	protein_coding	OTTHUMT00000351380.2	-	0.00	43	0	C	NM_015136		52546871	+1	tier1	-	no_errors	ENST00000321725	ensembl	human	known	74_37	missense	42.31	15	11	SNP	0.000	T
STAU1	6780	genome.wustl.edu	37	20	47734455	47734455	+	Silent	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr20:47734455G>A	ENST00000371856.2	-	11	1778	c.1368C>T	c.(1366-1368)gcC>gcT	p.A456A	STAU1_ENST00000371802.1_Silent_p.A381A|STAU1_ENST00000371792.1_Silent_p.A373A|STAU1_ENST00000360426.4_Silent_p.A375A|STAU1_ENST00000371828.3_Silent_p.A381A|STAU1_ENST00000347458.5_Silent_p.A375A|STAU1_ENST00000340954.7_Silent_p.A375A	NM_017453.2	NP_059347.2	O95793	STAU1_HUMAN	staufen double-stranded RNA binding protein 1	456					intracellular mRNA localization (GO:0008298)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|rough endoplasmic reticulum (GO:0005791)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	23			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			ACAACTCTCGGGCTATCATGG	0.542																																																	0													143.0	136.0	139.0					20																	47734455		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13414.1, CCDS13415.1, CCDS33481.1	20q13.1	2014-06-13	2013-06-05	2005-11-04	ENSG00000124214	ENSG00000124214			11370	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 150"""	601716	"""staufen (Drosophila, RNA-binding protein)"", ""staufen, RNA binding protein (Drosophila)"", ""staufen, RNA binding protein, homolog 1 (Drosophila)"""	STAU		8884277, 15680326	Standard	XM_005260524		Approved	PPP1R150	uc002xud.3	O95793	OTTHUMG00000032691	ENST00000371856.2:c.1368C>T	20.37:g.47734455G>A			A8K9Z4|E1P5Y1|E1P608|Q5JW29|Q6GTM4|Q9H5B4|Q9H5B5|Q9Y3Q2	Silent	SNP	pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom	p.A456	ENST00000371856.2	37	c.1368	CCDS13414.1	20																																																																																			STAU1	-	NULL	ENSG00000124214		0.542	STAU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAU1	HGNC	protein_coding	OTTHUMT00000079633.1	-	0.00	72	0	G	NM_017453		47734455	-1	tier1	-	no_errors	ENST00000371856	ensembl	human	known	74_37	silent	15.53	87	16	SNP	1.000	A
SULF1	23213	genome.wustl.edu	37	8	70551032	70551032	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr8:70551032G>T	ENST00000260128.4	+	21	3207	c.2490G>T	c.(2488-2490)atG>atT	p.M830I	SULF1_ENST00000419716.3_Missense_Mutation_p.M830I|SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000458141.2_Missense_Mutation_p.M830I|SULF1_ENST00000402687.4_Missense_Mutation_p.M830I	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	830					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			TACAACTAATGGAGCTCAGAA	0.383																																																	0													101.0	90.0	94.0					8																	70551032		2203	4300	6503	SO:0001583	missense	0			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.2490G>T	8.37:g.70551032G>T	ENSP00000260128:p.Met830Ile		Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.M830I	ENST00000260128.4	37	c.2490	CCDS6204.1	8	.	.	.	.	.	.	.	.	.	.	G	37	6.362717	0.97507	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	5.29	4.35	0.52113	Alkaline-phosphatase-like, core domain (1);	0.042895	0.85682	D	0.000000	T	0.27765	0.0683	L	0.59967	1.855	0.58432	D	0.999996	B	0.31026	0.304	B	0.30401	0.115	T	0.07443	-1.0772	10	0.44086	T	0.13	.	15.0589	0.71936	0.0:0.0:0.8575:0.1425	.	830	Q8IWU6	SULF1_HUMAN	I	830	ENSP00000403040:M830I;ENSP00000260128:M830I;ENSP00000385704:M830I;ENSP00000390315:M830I	ENSP00000260128:M830I	M	+	3	0	SULF1	70713586	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.838000	0.86804	2.645000	0.89757	0.650000	0.86243	ATG	SULF1	-	superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	ENSG00000137573		0.383	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	HGNC	protein_coding	OTTHUMT00000378885.2	-	0.00	34	0	G	NM_015170		70551032	+1	tier1	-	no_errors	ENST00000260128	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	T
SVEP1	79987	genome.wustl.edu	37	9	113228183	113228183	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr9:113228183G>T	ENST00000401783.2	-	18	3620	c.3284C>A	c.(3283-3285)aCt>aAt	p.T1095N	SVEP1_ENST00000374469.1_Missense_Mutation_p.T1072N|SVEP1_ENST00000302728.8_Missense_Mutation_p.T1095N|SVEP1_ENST00000467821.1_5'UTR	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	1095					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TCTTTTCACAGTTGAGGTGTT	0.443																																																	0													61.0	54.0	56.0					9																	113228183		1864	4091	5955	SO:0001583	missense	0			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.3284C>A	9.37:g.113228183G>T	ENSP00000384917:p.Thr1095Asn		Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_EG-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Growth_fac_rcpt_N_dom,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.T1095N	ENST00000401783.2	37	c.3284	CCDS48004.1	9	.	.	.	.	.	.	.	.	.	.	G	31	5.069886	0.93950	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728	T;T;T	0.60040	0.22;0.22;0.22	5.91	5.91	0.95273	Tyrosine-protein kinase ephrin type A/B receptor-like (1);Growth factor, receptor (1);	0.046798	0.85682	D	0.000000	T	0.77123	0.4084	M	0.89353	3.025	0.48632	D	0.999687	D;D	0.52996	0.957;0.957	P;P	0.54372	0.75;0.75	T	0.79907	-0.1605	10	0.56958	D	0.05	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	1095;1095	E9PBN8;Q4LDE5	.;SVEP1_HUMAN	N	1095;1072;1095	ENSP00000384917:T1095N;ENSP00000363593:T1072N;ENSP00000304118:T1095N	ENSP00000304118:T1095N	T	-	2	0	SVEP1	112268004	1.000000	0.71417	0.241000	0.24154	0.904000	0.53231	9.166000	0.94766	2.793000	0.96121	0.655000	0.94253	ACT	SVEP1	-	pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Growth_fac_rcpt_N_dom	ENSG00000165124		0.443	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	HGNC	protein_coding			0.00	37	0	G			113228183	-1			no_errors	ENST00000401783	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152676068	152676068	+	Nonsense_Mutation	SNP	G	G	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr6:152676068G>C	ENST00000367255.5	-	67	11253	c.10652C>G	c.(10651-10653)tCa>tGa	p.S3551*	SYNE1_ENST00000423061.1_Nonsense_Mutation_p.S3558*|SYNE1_ENST00000341594.5_Nonsense_Mutation_p.S3522*|SYNE1_ENST00000265368.4_Nonsense_Mutation_p.S3551*|SYNE1_ENST00000448038.1_Nonsense_Mutation_p.S3558*	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3551					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTGCAGCACTGAGTTCAACAG	0.537										HNSCC(10;0.0054)																																							0													123.0	125.0	124.0					6																	152676068		2203	4300	6503	SO:0001587	stop_gained	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10652C>G	6.37:g.152676068G>C	ENSP00000356224:p.Ser3551*		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.S3551*	ENST00000367255.5	37	c.10652	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	55	24.264322	0.99959	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	.	.	.	5.12	5.12	0.69794	.	0.421059	0.19749	N	0.106941	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	17.1049	0.86659	0.0:0.0:1.0:0.0	.	.	.	.	X	3551;3558;3551;3558;3522	.	ENSP00000265368:S3551X	S	-	2	0	SYNE1	152717761	1.000000	0.71417	0.129000	0.21949	0.943000	0.58893	6.152000	0.71812	2.535000	0.85469	0.561000	0.74099	TCA	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.537	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2		0.00	45	0	G	NM_182961		152676068	-1			no_errors	ENST00000265368	ensembl	human	known	74_37	nonsense	15.79	32	6	SNP	0.957	C
TNFRSF13B	23495	genome.wustl.edu	37	17	16832578	16832578	+	IGR	SNP	A	A	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:16832578A>C	ENST00000437538.2	-	0	1397				TBC1D27_ENST00000261651.2_RNA			O14836	TR13B_HUMAN	tumor necrosis factor receptor superfamily, member 13B						B cell homeostasis (GO:0001782)|cell surface receptor signaling pathway (GO:0007166)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of B cell proliferation (GO:0030889)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|skin(1)	16						GTCTAGCAGAAGTGCCCACGC	0.532									IgA Deficiency, Selective																																								0																																										SO:0001628	intergenic_variant	0	Familial Cancer Database	IGAD1, IGAD2	AF023614	CCDS11181.1	17p11.2	2014-09-17			ENSG00000240505	ENSG00000240505		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	18153	protein-coding gene	gene with protein product		604907				9311921	Standard	NM_012452		Approved	TACI, CD267	uc002gqs.1	O14836	OTTHUMG00000059262		17.37:g.16832578A>C			B2R8B0|B7Z6V8|Q32LX4|Q7Z6F5	RNA	SNP	-	NULL	ENST00000437538.2	37	NULL		17																																																																																			TBC1D27	-	-	ENSG00000128438		0.532	TNFRSF13B-201	KNOWN	basic	protein_coding	TBC1D27	HGNC	protein_coding		-	0.00	19	0	A			16832578	-1	tier1	-	no_errors	ENST00000261651	ensembl	human	known	74_37	rna	27.27	8	3	SNP	0.002	C
TENM1	10178	genome.wustl.edu	37	X	123779098	123779098	+	Missense_Mutation	SNP	C	C	T	rs201117886		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:123779098C>T	ENST00000371130.3	-	10	1834	c.1771G>A	c.(1771-1773)Gtt>Att	p.V591I	TENM1_ENST00000422452.2_Missense_Mutation_p.V591I	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	591	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TCTTCCGGAACGTCACACTCT	0.532																																																	0													244.0	210.0	221.0					X																	123779098		2203	4300	6503	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.1771G>A	X.37:g.123779098C>T	ENSP00000360171:p.Val591Ile		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD	p.V591I	ENST00000371130.3	37	c.1771	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	15.75	2.925853	0.52759	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.03496	3.91;3.91	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000001	T	0.06096	0.0158	L	0.49455	1.56	0.58432	D	0.999995	D;D;P	0.63046	0.981;0.992;0.627	B;B;B	0.42245	0.381;0.381;0.056	T	0.50448	-0.8827	10	0.27785	T	0.31	.	18.0549	0.89361	0.0:1.0:0.0:0.0	.	590;591;591	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	I	591	ENSP00000360171:V591I;ENSP00000403954:V591I	ENSP00000360171:V591I	V	-	1	0	ODZ1	123606779	1.000000	0.71417	0.998000	0.56505	0.804000	0.45430	3.244000	0.51399	2.199000	0.70637	0.600000	0.82982	GTT	TENM1	-	NULL	ENSG00000009694		0.532	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM1	HGNC	protein_coding	OTTHUMT00000058985.1	-	0.00	38	0	C	NM_014253		123779098	-1	tier1	rs201117886	no_errors	ENST00000422452	ensembl	human	known	74_37	missense	19.23	42	10	SNP	1.000	T
TET1	80312	genome.wustl.edu	37	10	70432744	70432744	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr10:70432744A>C	ENST00000373644.4	+	8	4975	c.4766A>C	c.(4765-4767)aAg>aCg	p.K1589T		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1589	Interaction with DNA. {ECO:0000250}.				chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						AATGGCTGTAAGTTTGGTAGA	0.378																																																	0													158.0	149.0	152.0					10																	70432744		2203	4300	6503	SO:0001583	missense	0			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.4766A>C	10.37:g.70432744A>C	ENSP00000362748:p.Lys1589Thr		Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.K1589T	ENST00000373644.4	37	c.4766	CCDS7281.1	10	.	.	.	.	.	.	.	.	.	.	A	24.4	4.531151	0.85706	.	.	ENSG00000138336	ENST00000373644;ENST00000545846	T	0.14766	2.48	5.36	5.36	0.76844	TET cysteine-rich domain (1);	0.000000	0.85682	D	0.000000	T	0.39963	0.1098	M	0.84219	2.685	0.53688	D	0.999972	D	0.61080	0.989	D	0.65140	0.932	T	0.40572	-0.9556	10	0.87932	D	0	.	15.6332	0.76929	1.0:0.0:0.0:0.0	.	1589	Q8NFU7	TET1_HUMAN	T	1589;61	ENSP00000362748:K1589T	ENSP00000362748:K1589T	K	+	2	0	TET1	70102750	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.244000	0.95423	2.155000	0.67459	0.477000	0.44152	AAG	TET1	-	NULL	ENSG00000138336		0.378	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TET1	HGNC	protein_coding	OTTHUMT00000048354.1	-	0.00	82	0	A	NM_030625		70432744	+1	tier1	-	no_errors	ENST00000373644	ensembl	human	known	74_37	missense	22.22	56	16	SNP	1.000	C
TEX101	83639	genome.wustl.edu	37	19	43920564	43920564	+	Missense_Mutation	SNP	C	C	T	rs148052365		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr19:43920564C>T	ENST00000598265.1	+	4	414	c.248C>T	c.(247-249)cCg>cTg	p.P83L	TEX101_ENST00000253435.7_Missense_Mutation_p.P101L|TEX101_ENST00000602198.1_Missense_Mutation_p.P101L|TEX101_ENST00000601707.1_3'UTR	NM_001130011.1	NP_001123483.1	Q9BY14	TX101_HUMAN	testis expressed 101	83						acrosomal membrane (GO:0002080)|anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				large_intestine(1)|lung(12)|ovary(1)|skin(1)	15		Prostate(69;0.0199)				GGCTGCATCCCGGAAGGGGAG	0.542																																																	0								C	LEU/PRO,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	129.0	121.0	124.0		248,302	-8.0	0.0	19	dbSNP_134	124	0,8600		0,0,4300	yes	missense,missense	TEX101	NM_001130011.1,NM_031451.4	98,98	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	83/250,101/268	43920564	1,13005	2203	4300	6503	SO:0001583	missense	0			AF241268	CCDS12619.1, CCDS59393.1	19q13.31	2013-06-06	2007-03-13			ENSG00000131126			30722	protein-coding gene	gene with protein product	"""cancer/testis antigen 131"", ""spermatogenesis associated 44"""	612665	"""testis expressed sequence 101"""			16388701, 16516155	Standard	NM_031451		Approved	MGC4766, SGRG, CT131, SPATA44	uc010xwo.2	Q9BY14		ENST00000598265.1:c.248C>T	19.37:g.43920564C>T	ENSP00000472769:p.Pro83Leu		Q7L5R2|Q9BPY7	Missense_Mutation	SNP	pfam_LY6_UPAR	p.P101L	ENST00000598265.1	37	c.302	CCDS59393.1	19	.	.	.	.	.	.	.	.	.	.	C	6.149	0.395674	0.11638	2.27E-4	0.0	ENSG00000131126	ENST00000253435;ENST00000407156	T	0.68331	-0.32	4.0	-7.97	0.01139	.	2.403860	0.01391	N	0.013242	T	0.33614	0.0869	N	0.04018	-0.295	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.04013	0.0;0.001	T	0.21075	-1.0256	10	0.19590	T	0.45	4.385	0.5324	0.00631	0.3609:0.1902:0.1186:0.3303	.	83;101	Q9BY14;Q9BY14-2	TX101_HUMAN;.	L	101;96	ENSP00000253435:P101L	ENSP00000253435:P101L	P	+	2	0	TEX101	48612404	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.518000	0.06267	-1.445000	0.01948	-0.254000	0.11334	CCG	TEX101	-	NULL	ENSG00000131126		0.542	TEX101-004	KNOWN	non_canonical_other|basic|CCDS	protein_coding	TEX101	HGNC	protein_coding	OTTHUMT00000463176.1	-	0.00	62	0	C	NM_031451		43920564	+1	tier1	rs148052365	no_errors	ENST00000253435	ensembl	human	known	74_37	missense	41.18	30	21	SNP	0.000	T
TEX15	56154	genome.wustl.edu	37	8	30700453	30700453	+	Silent	SNP	A	A	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr8:30700453A>G	ENST00000256246.2	-	1	6155	c.6081T>C	c.(6079-6081)gaT>gaC	p.D2027D		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	2027					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		CCATGTTATTATCTTGTAGCA	0.318																																																	0													19.0	21.0	20.0					8																	30700453		2171	4276	6447	SO:0001819	synonymous_variant	0			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.6081T>C	8.37:g.30700453A>G				Silent	SNP	NULL	p.D2027	ENST00000256246.2	37	c.6081	CCDS6080.1	8																																																																																			TEX15	-	NULL	ENSG00000133863		0.318	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	HGNC	protein_coding	OTTHUMT00000376193.1	-	0.00	44	0	A			30700453	-1	tier1	-	no_errors	ENST00000256246	ensembl	human	known	74_37	silent	35.71	27	15	SNP	0.799	G
TGM6	343641	genome.wustl.edu	37	20	2413135	2413135	+	Splice_Site	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr20:2413135G>A	ENST00000202625.2	+	13	2028		c.e13-1		TGM6_ENST00000381423.1_Splice_Site	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6						cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	CCTTCCTCCAGCGTGCCTACC	0.602																																																	0													80.0	69.0	73.0					20																	2413135		2203	4300	6503	SO:0001630	splice_region_variant	0			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1968-1G>A	20.37:g.2413135G>A			Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Splice_Site	SNP	-	e13-1	ENST00000202625.2	37	c.1968-1	CCDS13025.1	20	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819553	0.50633	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4986	0.61440	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TGM6	2361135	0.996000	0.38824	0.789000	0.31954	0.173000	0.22820	5.013000	0.64023	2.632000	0.89209	0.655000	0.94253	.	TGM6	-	-	ENSG00000166948		0.602	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM6	HGNC	protein_coding	OTTHUMT00000077581.2	-	0.00	41	0	G	NM_198994	Intron	2413135	+1	tier1	-	no_errors	ENST00000202625	ensembl	human	known	74_37	splice_site	13.04	40	6	SNP	0.796	A
THEMIS2	9473	genome.wustl.edu	37	1	28208692	28208692	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:28208692G>C	ENST00000373921.3	+	4	861	c.857G>C	c.(856-858)gGc>gCc	p.G286A	THEMIS2_ENST00000373927.3_Intron|THEMIS2_ENST00000328928.7_Intron|THEMIS2_ENST00000373925.1_Intron	NM_001105556.1	NP_001099026.1	Q5TEJ8	THMS2_HUMAN	thymocyte selection associated family member 2	286	CABIT 2.				cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											TTGCAAAAAGGCCAGAGGCTT	0.657																																																	0													30.0	32.0	31.0					1																	28208692		1942	4135	6077	SO:0001583	missense	0			AF044896	CCDS30653.1, CCDS30654.1, CCDS41290.1, CCDS65461.1	1p35.2	2012-07-10	2012-07-10	2012-07-10	ENSG00000130775	ENSG00000130775			16839	protein-coding gene	gene with protein product	"""induced by contact to basement membrane 1"""		"""chromosome 1 open reading frame 38"""	C1orf38		16219472	Standard	XM_005246041		Approved	ICB-1, Icb-1	uc001bpc.4	Q5TEJ8	OTTHUMG00000003735	ENST00000373921.3:c.857G>C	1.37:g.28208692G>C	ENSP00000363031:p.Gly286Ala		A2RTZ3|B4DZT9|B4DZY3|O60560|Q5TEJ1|Q5TEJ9|Q5TEK1|Q68DP4|Q9BYB6|Q9NS90	Missense_Mutation	SNP	NULL	p.G286A	ENST00000373921.3	37	c.857	CCDS41290.1	1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.788379	0.49997	.	.	ENSG00000130775	ENST00000442118;ENST00000373921	T;T	0.18338	2.22;2.22	5.18	5.18	0.71444	.	0.150537	0.64402	D	0.000016	T	0.46698	0.1406	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.49762	-0.8905	10	0.72032	D	0.01	-30.9927	18.6748	0.91525	0.0:0.0:1.0:0.0	.	286	Q5TEJ8	THMS2_HUMAN	A	149;286	ENSP00000413725:G149A;ENSP00000363031:G286A	ENSP00000363031:G286A	G	+	2	0	C1orf38	28081279	1.000000	0.71417	1.000000	0.80357	0.257000	0.26127	4.620000	0.61226	2.586000	0.87340	0.491000	0.48974	GGC	THEMIS2	-	NULL	ENSG00000130775		0.657	THEMIS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THEMIS2	HGNC	protein_coding	OTTHUMT00000011148.1	-	0.00	64	0	G	NM_004848		28208692	+1	tier1	-	no_errors	ENST00000373921	ensembl	human	known	74_37	missense	27.27	32	12	SNP	1.000	C
TMEM248	55069	genome.wustl.edu	37	7	66406853	66406853	+	Start_Codon_SNP	SNP	A	A	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr7:66406853A>C	ENST00000341567.4	+	2	256	c.1A>C	c.(1-3)Atg>Ctg	p.M1L		NM_017994.4	NP_060464.1	Q9NWD8	TM248_HUMAN	transmembrane protein 248	1						integral component of membrane (GO:0016021)											GATCAGAATAATGTTCAGCAT	0.473																																																	0													108.0	103.0	105.0					7																	66406853		2203	4300	6503	SO:0001582	initiator_codon_variant	0				CCDS5536.1	7q11.21	2012-05-30	2012-05-30	2012-05-30	ENSG00000106609	ENSG00000106609			25476	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 42"""	C7orf42		12477932	Standard	XM_005250482		Approved	FLJ10099, FLJ13090	uc003tvk.3	Q9NWD8	OTTHUMG00000129553	ENST00000341567.4:c.1A>C	7.37:g.66406853A>C	ENSP00000340668:p.Met1Leu		Q53H07|Q96FR2	Missense_Mutation	SNP	NULL	p.M1L	ENST00000341567.4	37	c.1	CCDS5536.1	7	.	.	.	.	.	.	.	.	.	.	A	16.40	3.111856	0.56398	.	.	ENSG00000106609	ENST00000341567;ENST00000413593;ENST00000424964;ENST00000418375	.	.	.	5.61	5.61	0.85477	.	0.081722	0.85682	D	0.000000	T	0.56485	0.1988	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.11329	0.006	T	0.54118	-0.8341	8	0.54805	T	0.06	-7.9085	14.9818	0.71316	1.0:0.0:0.0:0.0	.	1	Q9NWD8	CG042_HUMAN	L	1	.	ENSP00000340668:M1L	M	+	1	0	C7orf42	66044288	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	6.439000	0.73430	2.141000	0.66446	0.533000	0.62120	ATG	TMEM248	-	NULL	ENSG00000106609		0.473	TMEM248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM248	HGNC	protein_coding	OTTHUMT00000251745.2		0.00	26	0	A	NM_017994	Missense_Mutation	66406853	+1			no_errors	ENST00000341567	ensembl	human	known	74_37	missense	9.09	30	3	SNP	1.000	C
TMEM41B	440026	genome.wustl.edu	37	11	9310086	9310086	+	Intron	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr11:9310086G>T	ENST00000528080.1	-	4	707				TMEM41B_ENST00000527813.1_Intron	NM_015012.3	NP_055827.1	Q5BJD5	TM41B_HUMAN	transmembrane protein 41B						nervous system development (GO:0007399)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(1)|prostate(1)|urinary_tract(2)	7				all cancers(16;9.96e-08)|Epithelial(150;4.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0972)		TTGCAAGCTGGTAACTTTTAA	0.284																																																	0													41.0	46.0	44.0					11																	9310086		2200	4293	6493	SO:0001627	intron_variant	0			D26067	CCDS31424.1, CCDS53600.1	11p15.3	2008-02-05			ENSG00000166471	ENSG00000166471			28948	protein-coding gene	gene with protein product						7584026, 7584028	Standard	NM_015012		Approved	KIAA0033	uc001mhn.2	Q5BJD5	OTTHUMG00000165719	ENST00000528080.1:c.369-4C>A	11.37:g.9310086G>T			D3DQU9|E9PP29|Q15055|Q4G0P0	Nonsense_Mutation	SNP	NULL	p.Y124*	ENST00000528080.1	37	c.372	CCDS31424.1	11																																																																																			TMEM41B	-	NULL	ENSG00000166471		0.284	TMEM41B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM41B	HGNC	protein_coding	OTTHUMT00000385940.2	-	0.00	21	0	G			9310086	-1	tier1	-	no_errors	ENST00000524543	ensembl	human	known	74_37	nonsense	20.00	20	5	SNP	0.983	T
TMF1	7110	genome.wustl.edu	37	3	69097567	69097567	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr3:69097567A>C	ENST00000398559.2	-	2	505	c.289T>G	c.(289-291)Ttc>Gtc	p.F97V	CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|TMF1_ENST00000543976.1_Missense_Mutation_p.F97V|CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|MIR3136_ENST00000583498.1_RNA|CTD-2013N24.2_ENST00000596274.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	97					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		AAGGCACTGAAGAAATTTTCA	0.448																																																	0													237.0	226.0	229.0					3																	69097567		1922	4140	6062	SO:0001583	missense	0				CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.289T>G	3.37:g.69097567A>C	ENSP00000381567:p.Phe97Val		B7ZLJ2|Q17R87|Q59GK0	Missense_Mutation	SNP	pfam_TMF_TATA-bd,pfam_TMF_DNA-bd	p.F97V	ENST00000398559.2	37	c.289	CCDS43105.1	3	.	.	.	.	.	.	.	.	.	.	A	28.3	4.905561	0.92107	.	.	ENSG00000144747	ENST00000398559;ENST00000543976;ENST00000356248;ENST00000438636	T;T	0.36699	1.25;1.24	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.55705	0.1937	M	0.66939	2.045	0.80722	D	1	D;D	0.71674	0.998;0.991	D;P	0.71656	0.974;0.88	T	0.50923	-0.8770	10	0.15499	T	0.54	-7.2764	16.1461	0.81569	1.0:0.0:0.0:0.0	.	97;97	P82094-2;P82094	.;TMF1_HUMAN	V	97	ENSP00000381567:F97V;ENSP00000438706:F97V	ENSP00000348582:F97V	F	-	1	0	TMF1	69180257	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.962000	0.93254	2.219000	0.72066	0.533000	0.62120	TTC	TMF1	-	NULL	ENSG00000144747		0.448	TMF1-001	KNOWN	basic|CCDS	protein_coding	TMF1	HGNC	protein_coding	OTTHUMT00000352106.1	-	0.00	43	0	A	NM_007114		69097567	-1	tier1	-	no_errors	ENST00000543976	ensembl	human	known	74_37	missense	15.09	45	8	SNP	1.000	C
TMX2	51075	genome.wustl.edu	37	11	57506730	57506730	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr11:57506730G>A	ENST00000278422.4	+	7	754	c.742G>A	c.(742-744)Gag>Aag	p.E248K	RP11-691N7.6_ENST00000531074.1_5'Flank|TMX2-CTNND1_ENST00000528395.1_Intron|C11orf31_ENST00000388857.4_5'Flank|TMX2_ENST00000378312.4_Missense_Mutation_p.E210K|C11orf31_ENST00000534355.1_5'Flank	NM_015959.3	NP_057043.1	Q9Y320	TMX2_HUMAN	thioredoxin-related transmembrane protein 2	248	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(2)	12						GACCTTCTCTGAGGTACCTGA	0.557																																																	0													88.0	75.0	79.0					11																	57506730		2201	4296	6497	SO:0001583	missense	0			AF132965	CCDS7967.1, CCDS44601.1	11q12.1	2012-09-20	2009-02-23	2009-02-23	ENSG00000213593	ENSG00000213593		"""Protein disulfide isomerases"""	30739	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 12"""		"""thioredoxin domain containing 14"""	TXNDC14		12670024	Standard	NM_015959		Approved	PDIA12	uc001nlc.2	Q9Y320	OTTHUMG00000167200	ENST00000278422.4:c.742G>A	11.37:g.57506730G>A	ENSP00000278422:p.Glu248Lys		B7Z4R4|Q53G73|Q561W0|Q5J7Q7|Q8NBP9|Q9H3L1	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.E248K	ENST00000278422.4	37	c.742	CCDS7967.1	11	.	.	.	.	.	.	.	.	.	.	G	18.33	3.600651	0.66332	.	.	ENSG00000213593	ENST00000378312;ENST00000278422	T	0.44083	0.93	5.35	5.35	0.76521	Thioredoxin-like fold (1);	0.125339	0.52532	U	0.000063	T	0.42017	0.1184	L	0.38953	1.18	0.80722	D	1	P;B	0.50528	0.936;0.402	P;B	0.49140	0.601;0.102	T	0.13953	-1.0490	9	.	.	.	-13.6307	14.3155	0.66446	0.0:0.1484:0.8516:0.0	.	210;248	Q9Y320-2;Q9Y320	.;TMX2_HUMAN	K	210;248	ENSP00000367562:E210K	.	E	+	1	0	TMX2	57263306	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.328000	0.79160	2.503000	0.84419	0.561000	0.74099	GAG	TMX2	-	NULL	ENSG00000213593		0.557	TMX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMX2	HGNC	protein_coding	OTTHUMT00000393708.1		0.00	39	0	G	NM_015959		57506730	+1			no_errors	ENST00000278422	ensembl	human	known	74_37	missense	11.36	39	5	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7579414	7579414	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:7579414C>T	ENST00000269305.4	-	4	462	c.273G>A	c.(271-273)tgG>tgA	p.W91*	TP53_ENST00000420246.2_Nonsense_Mutation_p.W91*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Nonsense_Mutation_p.W91*|TP53_ENST00000413465.2_Nonsense_Mutation_p.W91*|TP53_ENST00000445888.2_Nonsense_Mutation_p.W91*|TP53_ENST00000455263.2_Nonsense_Mutation_p.W91*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	91	Interaction with WWOX.		W -> C (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.W91*(13)|p.0?(8)|p.G59fs*23(3)|p.V73fs*9(1)|p.D48fs*55(1)|p.P92fs*57(1)|p.W91fs*57(1)|p.A88fs*52(1)|p.W91fs*13(1)|p.P87fs*54(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGACAGGGGCCAGGAGGGGG	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	33	Substitution - Nonsense(13)|Deletion - Frameshift(11)|Whole gene deletion(8)|Insertion - Frameshift(1)	lung(10)|upper_aerodigestive_tract(6)|breast(4)|bone(4)|central_nervous_system(2)|urinary_tract(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)|prostate(1)|liver(1)	GRCh37	CM065495	TP53	M							44.0	50.0	48.0					17																	7579414		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.273G>A	17.37:g.7579414C>T	ENSP00000269305:p.Trp91*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.W91*	ENST00000269305.4	37	c.273	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	24.6	4.552604	0.86127	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	4.62	4.62	0.57501	.	0.425160	0.22616	N	0.057766	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-8.1711	8.8476	0.35179	0.0:0.8991:0.0:0.1009	.	.	.	.	X	91	.	ENSP00000269305:W91X	W	-	3	0	TP53	7520139	1.000000	0.71417	1.000000	0.80357	0.680000	0.39746	1.567000	0.36407	2.561000	0.86390	0.561000	0.74099	TGG	TP53	-	NULL	ENSG00000141510		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	248	0	C	NM_000546		7579414	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	37.31	125	75	SNP	1.000	T
TOB1	10140	genome.wustl.edu	37	17	48940888	48940888	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr17:48940888C>T	ENST00000268957.3	-	3	919	c.491G>A	c.(490-492)aGc>aAc	p.S164N	TOB1_ENST00000509385.1_5'UTR|TOB1_ENST00000499247.2_Missense_Mutation_p.S164N	NM_001243877.1	NP_001230806.1	P50616	TOB1_HUMAN	transducer of ERBB2, 1	164					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060212)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of translation (GO:0017148)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of signal transduction (GO:0009967)|SMAD protein import into nucleus (GO:0007184)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor tyrosine kinase binding (GO:0030971)|SH3/SH2 adaptor activity (GO:0005070)|transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			GAAGGTAGGGCTTACAGCAGC	0.522											OREG0024576	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(144;643 1919 24513 29423 40686)												0													97.0	80.0	86.0					17																	48940888		2203	4300	6503	SO:0001583	missense	0			D38305	CCDS11576.1	17q21.33	2012-08-14			ENSG00000141232	ENSG00000141232			11979	protein-coding gene	gene with protein product		605523		TROB1		8632892, 17785442	Standard	NM_005749		Approved	TOB, TROB	uc002isw.3	P50616	OTTHUMG00000162277	ENST00000268957.3:c.491G>A	17.37:g.48940888C>T	ENSP00000268957:p.Ser164Asn	958	B2R9T0|D3DTY3|Q4KMQ0	Missense_Mutation	SNP	pfam_Anti_prolifrtn,smart_Anti_prolifrtn,prints_Anti_prolifrtn	p.S164N	ENST00000268957.3	37	c.491	CCDS11576.1	17	.	.	.	.	.	.	.	.	.	.	C	17.12	3.308703	0.60305	.	.	ENSG00000141232	ENST00000499247;ENST00000268957	T;T	0.50548	0.74;0.74	5.67	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.67401	0.2889	M	0.78049	2.395	0.58432	D	0.999999	D	0.57899	0.981	D	0.65140	0.932	T	0.71586	-0.4548	10	0.56958	D	0.05	.	14.7195	0.69294	0.0:0.9307:0.0:0.0693	.	164	P50616	TOB1_HUMAN	N	164	ENSP00000427695:S164N;ENSP00000268957:S164N	ENSP00000268957:S164N	S	-	2	0	TOB1	46295887	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	1.405000	0.46838	0.655000	0.94253	AGC	TOB1	-	NULL	ENSG00000141232		0.522	TOB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	TOB1	HGNC	protein_coding	OTTHUMT00000368364.1	-	0.00	48	0	C			48940888	-1	tier1	-	no_errors	ENST00000268957	ensembl	human	known	74_37	missense	21.82	43	12	SNP	1.000	T
TPD52L1	7164	genome.wustl.edu	37	6	125569519	125569519	+	Missense_Mutation	SNP	G	G	A	rs541032352		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr6:125569519G>A	ENST00000534000.1	+	4	672	c.376G>A	c.(376-378)Gga>Aga	p.G126R	HDDC2_ENST00000608456.1_Intron|TPD52L1_ENST00000304877.13_Missense_Mutation_p.G126R|TPD52L1_ENST00000392482.2_Missense_Mutation_p.G97R|TPD52L1_ENST00000524679.1_Missense_Mutation_p.G97R|TPD52L1_ENST00000532429.1_Missense_Mutation_p.G97R|TPD52L1_ENST00000368388.2_Missense_Mutation_p.G126R|TPD52L1_ENST00000527711.1_Missense_Mutation_p.G126R|TPD52L1_ENST00000530868.1_3'UTR|TPD52L1_ENST00000534199.1_Missense_Mutation_p.G97R|TPD52L1_ENST00000528193.1_Missense_Mutation_p.G126R|TPD52L1_ENST00000368402.5_Missense_Mutation_p.G126R	NM_003287.2	NP_003278.1	Q16890	TPD53_HUMAN	tumor protein D52-like 1	126					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(2)|prostate(1)	5			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0265)		CAAGAAGTTCGGAGACATGAG	0.483																																																	0													120.0	97.0	105.0					6																	125569519		2203	4300	6503	SO:0001583	missense	0			U44427	CCDS5130.1, CCDS34527.1, CCDS34528.1, CCDS43502.1, CCDS75513.1, CCDS75514.1	6q22-q23	2008-07-29			ENSG00000111907	ENSG00000111907			12006	protein-coding gene	gene with protein product		604069				8812487, 16112108	Standard	NM_003287		Approved	D53, hD53	uc003pzu.1	Q16890	OTTHUMG00000015505	ENST00000534000.1:c.376G>A	6.37:g.125569519G>A	ENSP00000434142:p.Gly126Arg		A8K757|A8K772|A8MUD2|A8MUJ7|A8MW70|F6V707|O43397|Q5TC99|Q5TDQ0|Q9BUQ6|Q9C054	Missense_Mutation	SNP	pfam_TPD52	p.G126R	ENST00000534000.1	37	c.376	CCDS5130.1	6	.	.	.	.	.	.	.	.	.	.	G	31	5.066173	0.93898	.	.	ENSG00000111907	ENST00000304877;ENST00000534000;ENST00000368402;ENST00000368388;ENST00000527711;ENST00000528193;ENST00000532429;ENST00000534199;ENST00000392482;ENST00000524679;ENST00000392484	T;T;T;T;T;T;T;T;T;T	0.38887	1.81;1.11;1.11;1.81;1.81;1.11;1.81;1.81;1.81;1.81	5.58	5.58	0.84498	.	0.050818	0.85682	D	0.000000	T	0.64405	0.2595	M	0.82823	2.61	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.994;1.0;0.999;1.0	T	0.65240	-0.6216	9	.	.	.	-18.8095	19.5364	0.95255	0.0:0.0:1.0:0.0	.	126;126;126;126	E9PPQ1;Q16890-3;Q16890-2;Q16890	.;.;.;TPD53_HUMAN	R	126;126;126;126;126;126;97;97;97;97;126	ENSP00000306285:G126R;ENSP00000434142:G126R;ENSP00000357387:G126R;ENSP00000357373:G126R;ENSP00000436953:G126R;ENSP00000434743:G126R;ENSP00000435447:G97R;ENSP00000432590:G97R;ENSP00000376273:G97R;ENSP00000432787:G97R	.	G	+	1	0	TPD52L1	125611218	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	8.048000	0.89442	2.779000	0.95612	0.650000	0.86243	GGA	TPD52L1	-	pfam_TPD52	ENSG00000111907		0.483	TPD52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPD52L1	HGNC	protein_coding	OTTHUMT00000042065.2	-	0.00	20	0	G			125569519	+1	tier1	-	no_errors	ENST00000534000	ensembl	human	known	74_37	missense	21.95	32	9	SNP	1.000	A
TPRN	286262	genome.wustl.edu	37	9	140093662	140093662	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr9:140093662A>G	ENST00000409012.4	-	1	1588	c.1502T>C	c.(1501-1503)tTc>tCc	p.F501S	TPRN_ENST00000541945.1_Intron|TPRN_ENST00000321773.2_Missense_Mutation_p.F440S	NM_001128228.2	NP_001121700.2	Q4KMQ1	TPRN_HUMAN	taperin	501					sensory perception of sound (GO:0007605)	stereocilium (GO:0032420)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	8						CACCACTGTGAAGGTGTTGCT	0.672																																																	0													63.0	62.0	62.0					9																	140093662		2203	4300	6503	SO:0001583	missense	0			AK074735	CCDS56594.1	9q34.3	2011-01-06	2010-03-24	2010-03-24	ENSG00000176058	ENSG00000176058			26894	protein-coding gene	gene with protein product		613354	"""chromosome 9 open reading frame 75"", ""deafness, autosomal recessive 79"""	C9orf75, DFNB79		20170898, 20170899	Standard	NM_001128228		Approved	FLJ90254	uc004clu.3	Q4KMQ1	OTTHUMG00000020984	ENST00000409012.4:c.1502T>C	9.37:g.140093662A>G	ENSP00000387100:p.Phe501Ser		B7ZKU5|Q5VSG5|Q5VSG6|Q6IPP2|Q8NCH2	Missense_Mutation	SNP	NULL	p.F501S	ENST00000409012.4	37	c.1502	CCDS56594.1	9	.	.	.	.	.	.	.	.	.	.	A	18.68	3.676812	0.67928	.	.	ENSG00000176058	ENST00000333046;ENST00000409012;ENST00000321773	.	.	.	3.66	3.66	0.41972	.	0.000000	0.85682	D	0.000000	T	0.76256	0.3962	M	0.78801	2.425	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.76945	-0.2771	9	0.48119	T	0.1	-18.8427	10.2728	0.43493	1.0:0.0:0.0:0.0	.	501	Q4KMQ1	TPRN_HUMAN	S	299;501;440	.	ENSP00000313704:F440S	F	-	2	0	TPRN	139213483	1.000000	0.71417	0.727000	0.30756	0.700000	0.40528	8.372000	0.90127	1.505000	0.48720	0.379000	0.24179	TTC	TPRN	-	NULL	ENSG00000176058		0.672	TPRN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPRN	HGNC	protein_coding	OTTHUMT00000055323.3	-	0.00	44	0	A	NM_173691		140093662	-1	tier1	-	no_errors	ENST00000409012	ensembl	human	known	74_37	missense	28.57	20	8	SNP	1.000	G
TRAPPC10	7109	genome.wustl.edu	37	21	45502896	45502896	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr21:45502896T>C	ENST00000291574.4	+	14	2126	c.1951T>C	c.(1951-1953)Tcc>Ccc	p.S651P		NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	651					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						GCACAAGACGTCCAATGGGAT	0.502																																																	0													167.0	156.0	160.0					21																	45502896		2203	4300	6503	SO:0001583	missense	0			U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.1951T>C	21.37:g.45502896T>C	ENSP00000291574:p.Ser651Pro		Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Missense_Mutation	SNP	NULL	p.S651P	ENST00000291574.4	37	c.1951	CCDS13704.1	21	.	.	.	.	.	.	.	.	.	.	T	8.234	0.805211	0.16467	.	.	ENSG00000160218	ENST00000291574	T	0.24350	1.86	5.58	-4.0	0.04057	.	0.604665	0.19428	N	0.114536	T	0.11367	0.0277	N	0.14661	0.345	0.25547	N	0.987126	B	0.02656	0.0	B	0.04013	0.001	T	0.21999	-1.0229	10	0.22109	T	0.4	.	10.3658	0.44024	0.0:0.1344:0.5911:0.2746	.	651	P48553	TPC10_HUMAN	P	651	ENSP00000291574:S651P	ENSP00000291574:S651P	S	+	1	0	TRAPPC10	44327324	0.030000	0.19436	0.029000	0.17559	0.495000	0.33615	0.035000	0.13797	-0.998000	0.03446	-0.291000	0.09656	TCC	TRAPPC10	-	NULL	ENSG00000160218		0.502	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TRAPPC10	HGNC	protein_coding	OTTHUMT00000195737.1	-	0.00	37	0	T	NM_003274		45502896	+1	tier1	-	no_errors	ENST00000291574	ensembl	human	known	74_37	missense	39.13	28	18	SNP	0.024	C
TRHDE	29953	genome.wustl.edu	37	12	73014977	73014977	+	Silent	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr12:73014977C>T	ENST00000261180.4	+	14	2520	c.2424C>T	c.(2422-2424)taC>taT	p.Y808Y		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	808					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						AAGCATCCTACCAACATGAGT	0.353																																																	0													113.0	101.0	105.0					12																	73014977		2203	4300	6503	SO:0001819	synonymous_variant	0			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2424C>T	12.37:g.73014977C>T			A5PL19|Q6UWJ4	Silent	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.Y808	ENST00000261180.4	37	c.2424	CCDS9004.1	12																																																																																			TRHDE	-	NULL	ENSG00000072657		0.353	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1	-	0.00	59	0	C	NM_013381		73014977	+1	tier1	-	no_errors	ENST00000261180	ensembl	human	known	74_37	silent	28.57	45	18	SNP	1.000	T
TRIM13	10206	genome.wustl.edu	37	13	50586140	50586140	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr13:50586140G>A	ENST00000378182.3	+	2	802	c.64G>A	c.(64-66)Gtt>Att	p.V22I	TRIM13_ENST00000420995.2_Missense_Mutation_p.V22I|TRIM13_ENST00000298772.5_Missense_Mutation_p.V25I|TRIM13_ENST00000356017.4_Missense_Mutation_p.V25I|TRIM13_ENST00000457662.2_Missense_Mutation_p.V22I|TRIM13_ENST00000478111.1_Intron	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13	22					anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		TGATCCACGGGTTTTGCCTTG	0.423																																																	0													143.0	124.0	131.0					13																	50586140		2203	4300	6503	SO:0001583	missense	0			AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.64G>A	13.37:g.50586140G>A	ENSP00000367424:p.Val22Ile		B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.V25I	ENST00000378182.3	37	c.73	CCDS9423.1	13	.	.	.	.	.	.	.	.	.	.	G	23.8	4.464933	0.84425	.	.	ENSG00000204977	ENST00000442421;ENST00000378183;ENST00000420995;ENST00000378182;ENST00000356017;ENST00000457662;ENST00000298772	D;T;T;T;T;T;T	0.92911	-3.13;2.32;2.32;2.32;2.32;2.32;2.32	5.82	5.82	0.92795	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	D	0.89935	0.6859	N	0.11023	0.085	0.58432	D	0.999994	D;D	0.56746	0.977;0.971	P;P	0.54238	0.746;0.629	D	0.90077	0.4167	10	0.37606	T	0.19	-7.0843	20.088	0.97803	0.0:0.0:1.0:0.0	.	22;25	O60858;O60858-3	TRI13_HUMAN;.	I	22;22;22;22;25;22;25	ENSP00000404586:V22I;ENSP00000367425:V22I;ENSP00000412943:V22I;ENSP00000367424:V22I;ENSP00000348299:V25I;ENSP00000399206:V22I;ENSP00000298772:V25I	ENSP00000298772:V25I	V	+	1	0	TRIM13	49484141	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.826000	0.99387	2.739000	0.93911	0.655000	0.94253	GTT	TRIM13	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000204977		0.423	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	TRIM13	HGNC	protein_coding	OTTHUMT00000354875.1	-	0.00	43	0	G	NM_001007278		50586140	+1	tier1	-	no_errors	ENST00000298772	ensembl	human	known	74_37	missense	33.33	38	19	SNP	1.000	A
TSGA10	80705	genome.wustl.edu	37	2	99722121	99722121	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:99722121T>C	ENST00000393483.3	-	8	1094	c.250A>G	c.(250-252)Aaa>Gaa	p.K84E	TSGA10_ENST00000410001.1_Missense_Mutation_p.K84E|TSGA10_ENST00000478090.1_5'UTR|TSGA10_ENST00000539964.1_Missense_Mutation_p.K84E|TSGA10_ENST00000542655.1_Missense_Mutation_p.K84E|TSGA10_ENST00000355053.4_Missense_Mutation_p.K84E	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	84					cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						TTACAGCTTTTCATCATTTCT	0.378																																																	0													235.0	223.0	227.0					2																	99722121		2203	4300	6503	SO:0001583	missense	0			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.250A>G	2.37:g.99722121T>C	ENSP00000377123:p.Lys84Glu		B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Missense_Mutation	SNP	NULL	p.K84E	ENST00000393483.3	37	c.250	CCDS2037.1	2	.	.	.	.	.	.	.	.	.	.	T	19.90	3.912626	0.72983	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482;ENST00000542655	T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85	4.99	4.99	0.66335	.	0.000000	0.64402	D	0.000013	T	0.44519	0.1297	L	0.47716	1.5	0.29579	N	0.849274	P;P	0.50156	0.932;0.884	P;P	0.47827	0.558;0.457	T	0.40590	-0.9555	10	0.22706	T	0.39	-26.9549	9.9333	0.41537	0.0:0.0:0.1709:0.8291	.	84;84	B7Z925;Q9BZW7	.;TSG10_HUMAN	E	84	ENSP00000377123:K84E;ENSP00000386956:K84E;ENSP00000347161:K84E;ENSP00000444419:K84E;ENSP00000386508:K84E;ENSP00000377122:K84E	ENSP00000347161:K84E	K	-	1	0	TSGA10	99088553	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.381000	0.59587	2.101000	0.63845	0.529000	0.55759	AAA	TSGA10	-	NULL	ENSG00000135951		0.378	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA10	HGNC	protein_coding	OTTHUMT00000253125.1	-	0.00	23	0	T	NM_182911		99722121	-1	tier1	-	no_errors	ENST00000355053	ensembl	human	known	74_37	missense	21.43	22	6	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179579062	179579062	+	Missense_Mutation	SNP	G	G	T	rs200088963		TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:179579062G>T	ENST00000591111.1	-	89	25712	c.25488C>A	c.(25486-25488)aaC>aaA	p.N8496K	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.N8813K|TTN_ENST00000342992.6_Missense_Mutation_p.N7569K|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12660	Ig-like 67.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCCAGCATCGTTTTTGATCT	0.418																																																	0													144.0	139.0	141.0					2																	179579062		1914	4121	6035	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.25488C>A	2.37:g.179579062G>T	ENSP00000465570:p.Asn8496Lys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.N7569K	ENST00000591111.1	37	c.22707		2	.	.	.	.	.	.	.	.	.	.	G	14.10	2.435814	0.43224	.	.	ENSG00000155657	ENST00000342992	T	0.59638	0.25	5.96	-7.18	0.01505	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.82692	0.5092	H	0.98936	4.375	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87745	0.2588	9	0.87932	D	0	.	15.5727	0.76352	0.6423:0.0:0.3577:0.0	.	8496	Q8WZ42	TITIN_HUMAN	K	7569	ENSP00000343764:N7569K	ENSP00000343764:N7569K	N	-	3	2	TTN	179287307	0.561000	0.26578	0.827000	0.32855	0.883000	0.51084	-0.088000	0.11198	-1.416000	0.02019	-0.294000	0.09567	AAC	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	27	0	G	NM_133378		179579062	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	22.73	17	5	SNP	0.977	T
TTN	7273	genome.wustl.edu	37	2	179596611	179596611	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:179596611G>T	ENST00000591111.1	-	56	16264	c.16040C>A	c.(16039-16041)cCt>cAt	p.P5347H	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.P5664H|TTN_ENST00000342992.6_Missense_Mutation_p.P4420H|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000582847.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12165	Ig-like 34.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCAAAGGGAGGAGTGCCTGC	0.418																																																	0													110.0	114.0	113.0					2																	179596611		2033	4208	6241	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.16040C>A	2.37:g.179596611G>T	ENSP00000465570:p.Pro5347His		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P4420H	ENST00000591111.1	37	c.13259		2	.	.	.	.	.	.	.	.	.	.	G	11.59	1.682977	0.29872	.	.	ENSG00000155657	ENST00000342992	T	0.74526	-0.85	6.17	6.17	0.99709	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.86944	0.6055	M	0.83774	2.66	0.80722	D	1	D	0.61697	0.99	P	0.60345	0.873	D	0.87237	0.2264	9	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	5347	Q8WZ42	TITIN_HUMAN	H	4420	ENSP00000343764:P4420H	ENSP00000343764:P4420H	P	-	2	0	TTN	179304856	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	6.537000	0.73847	2.941000	0.99782	0.655000	0.94253	CCT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	68	0	G	NM_133378		179596611	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179640598	179640598	+	Missense_Mutation	SNP	C	C	T	rs144135510	byFrequency	TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:179640598C>T	ENST00000591111.1	-	28	6217	c.5993G>A	c.(5992-5994)cGc>cAc	p.R1998H	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R1952H|TTN_ENST00000589042.1_Missense_Mutation_p.R1998H|TTN_ENST00000342992.6_Missense_Mutation_p.R1998H|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R1952H|RP11-88L24.4_ENST00000582038.2_RNA|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.R1998H|TTN_ENST00000460472.2_Missense_Mutation_p.R1952H			Q8WZ42	TITIN_HUMAN	titin	12808			R -> H. {ECO:0000269|PubMed:17344846}.		adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAATTTACTGCGCAGCTCTTC	0.453													C|||	8	0.00159744	0.0	0.0	5008	,	,		19737	0.0		0.0	False		,,,				2504	0.0082																0								C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	113.0	120.0	117.0		5855,5993,5993,5855,5855	5.1	1.0	2	dbSNP_134	117	10,8590	7.7+/-29.5	0,10,4290	yes	missense,missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133379.3,NM_133432.3,NM_133437.3	29,29,29,29,29	0,10,6493	TT,TC,CC		0.1163,0.0,0.0769	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1952/26927,1998/33424,1998/5605,1952/27052,1952/27119	179640598	10,12996	2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.5993G>A	2.37:g.179640598C>T	ENSP00000465570:p.Arg1998His		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R1998H	ENST00000591111.1	37	c.5993		2	.	.	.	.	.	.	.	.	.	.	C	11.79	1.744028	0.30865	0.0	0.001163	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.66280	-0.2;0.04;0.03;0.02;0.15	5.12	5.12	0.69794	Ribonuclease H-like (1);	.	.	.	.	T	0.72195	0.3430	L	0.32530	0.975	0.30885	N	0.731033	D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;1.0	P;P;P;D;D	0.74023	0.869;0.869;0.893;0.939;0.982	T	0.73808	-0.3866	9	0.87932	D	0	.	18.5589	0.91094	0.0:1.0:0.0:0.0	.	1952;1952;1952;1998;1998	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	H	1998;1952;1952;1952;1952;1998	ENSP00000343764:R1998H;ENSP00000434586:R1952H;ENSP00000340554:R1952H;ENSP00000352154:R1952H;ENSP00000354117:R1998H	ENSP00000340554:R1952H	R	-	2	0	TTN	179348843	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.733000	0.62036	2.387000	0.81309	0.609000	0.83330	CGC	TTN	-	superfamily_RNaseH-like_dom	ENSG00000155657		0.453	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	43	0	C	NM_133378		179640598	-1	tier1	rs144135510	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	27.66	34	13	SNP	1.000	T
UBASH3A	53347	genome.wustl.edu	37	21	43829716	43829716	+	Splice_Site	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr21:43829716C>T	ENST00000319294.6	+	3	384	c.353C>T	c.(352-354)aCg>aTg	p.T118M	UBASH3A_ENST00000398367.1_Splice_Site_p.T118M|UBASH3A_ENST00000291535.6_Splice_Site_p.T118M|UBASH3A_ENST00000450356.1_Splice_Site_p.T118M	NM_018961.3	NP_061834.1	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing A	118					negative regulation of T cell receptor signaling pathway (GO:0050860)|regulation of cytokine production (GO:0001817)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(9)|lung(12)|ovary(3)	28						GACTTCTTCACGGTGAGTCAA	0.488																																																	0													112.0	97.0	102.0					21																	43829716		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ277750	CCDS13687.1, CCDS33566.1, CCDS58791.1	21q22.3	2010-04-28	2010-04-28		ENSG00000160185	ENSG00000160185			12462	protein-coding gene	gene with protein product		605736				11281453	Standard	NM_018961		Approved	STS-2, TULA, CLIP4	uc002zbf.3	P57075	OTTHUMG00000086805	ENST00000319294.6:c.354+1C>T	21.37:g.43829716C>T			G5E9E4|Q6HA34|Q6HA35|Q6ISI6|Q6ISK3|Q6ISS9	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-1,pfam_SH3_domain,superfamily_SH3_domain,superfamily_UBA-like,smart_SH3_domain,pfscan_SH3_domain,pfscan_UBA/transl_elong_EF1B_N_euk	p.T118M	ENST00000319294.6	37	c.353	CCDS13687.1	21	.	.	.	.	.	.	.	.	.	.	C	17.94	3.512157	0.64522	.	.	ENSG00000160185	ENST00000291535;ENST00000450356;ENST00000319294;ENST00000398367	T;T;T;T	0.42900	0.96;1.87;1.87;0.96	5.64	4.76	0.60689	.	0.000000	0.64402	D	0.000007	T	0.50990	0.1648	L	0.45698	1.435	0.39643	D	0.97035	D;D;D	0.89917	1.0;1.0;1.0	D;D;P	0.69824	0.939;0.966;0.879	T	0.47923	-0.9079	10	0.13470	T	0.59	-27.8673	10.79	0.46428	0.0:0.8549:0.0:0.1451	.	118;118;118	G5E9E4;P57075-2;P57075	.;.;UBS3A_HUMAN	M	118	ENSP00000291535:T118M;ENSP00000407179:T118M;ENSP00000317327:T118M;ENSP00000381408:T118M	ENSP00000291535:T118M	T	+	2	0	UBASH3A	42702785	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	4.196000	0.58407	1.404000	0.46819	-0.151000	0.13558	ACG	UBASH3A	-	NULL	ENSG00000160185		0.488	UBASH3A-001	KNOWN	basic|CCDS	protein_coding	UBASH3A	HGNC	protein_coding	OTTHUMT00000195382.1		0.00	39	0	C	NM_001001895	Missense_Mutation	43829716	+1			no_errors	ENST00000319294	ensembl	human	known	74_37	missense	8.33	22	2	SNP	1.000	T
USH2A	7399	genome.wustl.edu	37	1	216497030	216497030	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:216497030G>C	ENST00000307340.3	-	8	1722	c.1336C>G	c.(1336-1338)Cca>Gca	p.P446A	USH2A_ENST00000366943.2_Missense_Mutation_p.P446A|USH2A_ENST00000366942.3_Missense_Mutation_p.P446A	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	446	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CGGGAATATGGAGTAAAACTG	0.343										HNSCC(13;0.011)																																							0													96.0	97.0	96.0					1																	216497030		2203	4300	6503	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.1336C>G	1.37:g.216497030G>C	ENSP00000305941:p.Pro446Ala		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.P446A	ENST00000307340.3	37	c.1336	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.290848	0.80914	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.26518	2.03;2.02;1.73	5.4	5.4	0.78164	Laminin, N-terminal (3);	0.000000	0.44688	D	0.000423	T	0.62282	0.2415	M	0.91818	3.245	0.80722	D	1	D;D	0.89917	0.996;1.0	P;D	0.97110	0.904;1.0	T	0.71705	-0.4512	10	0.87932	D	0	.	19.1691	0.93570	0.0:0.0:1.0:0.0	.	446;446	O75445-2;O75445	.;USH2A_HUMAN	A	446	ENSP00000305941:P446A;ENSP00000355910:P446A;ENSP00000355909:P446A	ENSP00000305941:P446A	P	-	1	0	USH2A	214563653	1.000000	0.71417	0.899000	0.35326	0.924000	0.55760	7.129000	0.77225	2.508000	0.84585	0.655000	0.94253	CCA	USH2A	-	smart_Laminin_N,pfscan_Laminin_N	ENSG00000042781		0.343	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1		0.00	12	0	G	NM_007123		216497030	-1			no_errors	ENST00000366943	ensembl	human	known	74_37	missense	35.29	11	6	SNP	1.000	C
URB2	9816	genome.wustl.edu	37	1	229773808	229773808	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:229773808C>T	ENST00000258243.2	+	4	3584	c.3448C>T	c.(3448-3450)Cat>Tat	p.H1150Y		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	1150						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						GCTGCTCTCCCATGTTGCCCT	0.562																																																	0													110.0	112.0	111.0					1																	229773808		2203	4300	6503	SO:0001583	missense	0			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.3448C>T	1.37:g.229773808C>T	ENSP00000258243:p.His1150Tyr		Q5VYC9	Missense_Mutation	SNP	pfam_Urb2/Npa2_C	p.H1150Y	ENST00000258243.2	37	c.3448	CCDS31052.1	1	.	.	.	.	.	.	.	.	.	.	C	13.57	2.276548	0.40294	.	.	ENSG00000135763	ENST00000258243	T	0.34072	1.38	5.57	3.68	0.42216	.	0.382752	0.30762	N	0.008932	T	0.23330	0.0564	L	0.27053	0.805	0.09310	N	1	P	0.52842	0.956	B	0.41619	0.361	T	0.06991	-1.0796	9	.	.	.	-0.2674	8.6957	0.34293	0.2699:0.6612:0.0:0.0689	.	1150	Q14146	URB2_HUMAN	Y	1150	ENSP00000258243:H1150Y	.	H	+	1	0	URB2	227840431	0.005000	0.15991	0.001000	0.08648	0.016000	0.09150	1.065000	0.30592	0.828000	0.34709	0.585000	0.79938	CAT	URB2	-	NULL	ENSG00000135763		0.562	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	HGNC	protein_coding	OTTHUMT00000095232.1	-	0.00	38	0	C	NM_014777		229773808	+1	tier1	-	no_errors	ENST00000258243	ensembl	human	known	74_37	missense	16.22	31	6	SNP	0.015	T
WDR43	23160	genome.wustl.edu	37	2	29140791	29140791	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:29140791C>T	ENST00000407426.3	+	6	835	c.779C>T	c.(778-780)gCa>gTa	p.A260V		NM_015131.1	NP_055946.1	Q15061	WDR43_HUMAN	WD repeat domain 43	260						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	20	Acute lymphoblastic leukemia(172;0.155)					GAAAAGAGTGCAGTGATGTCA	0.353																																																	0													68.0	64.0	66.0					2																	29140791		1845	4111	5956	SO:0001583	missense	0			D87716	CCDS46251.1	2p23.3	2013-01-09			ENSG00000163811	ENSG00000163811		"""WD repeat domain containing"""	28945	protein-coding gene	gene with protein product	"""UTP5, small subunit (SSU) processome component, homolog (yeast)"""					7584026, 7584028, 17699751	Standard	NM_015131		Approved	KIAA0007, NET12, UTP5	uc002rmo.2	Q15061	OTTHUMG00000152015	ENST00000407426.3:c.779C>T	2.37:g.29140791C>T	ENSP00000384302:p.Ala260Val		Q15395|Q92577	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A260V	ENST00000407426.3	37	c.779	CCDS46251.1	2	.	.	.	.	.	.	.	.	.	.	C	28.8	4.954117	0.92726	.	.	ENSG00000163811	ENST00000407426;ENST00000296126	T;T	0.69561	-0.06;-0.41	5.58	5.58	0.84498	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.055204	0.85682	D	0.000000	T	0.74809	0.3765	L	0.56769	1.78	0.52501	D	0.999956	D	0.65815	0.995	P	0.56398	0.797	T	0.68884	-0.5291	10	0.17832	T	0.49	-20.8462	19.586	0.95490	0.0:1.0:0.0:0.0	.	260	Q15061	WDR43_HUMAN	V	260;79	ENSP00000384302:A260V;ENSP00000296126:A79V	ENSP00000296126:A79V	A	+	2	0	WDR43	28994295	1.000000	0.71417	1.000000	0.80357	0.739000	0.42172	6.823000	0.75282	2.621000	0.88768	0.650000	0.86243	GCA	WDR43	-	superfamily_WD40_repeat_dom	ENSG00000163811		0.353	WDR43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR43	HGNC	protein_coding	OTTHUMT00000324865.1	-	0.00	104	0	C	XM_087089		29140791	+1	tier1	-	no_errors	ENST00000407426	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
XKR8	55113	genome.wustl.edu	37	1	28290117	28290117	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr1:28290117C>T	ENST00000373884.5	+	2	1011	c.403C>T	c.(403-405)Ctc>Ttc	p.L135F		NM_018053.2	NP_060523.2	Q9H6D3	XKR8_HUMAN	XK, Kell blood group complex subunit-related family, member 8	135					engulfment of apoptotic cell (GO:0043652)|phosphatidylserine exposure on apoptotic cell surface (GO:0070782)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(1)	4		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;4.72e-24)|Colorectal(126;1.52e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00572)|READ - Rectum adenocarcinoma(331;0.0526)		CATGCTGCGGCTCTTCGAGAC	0.632																																																	0													35.0	31.0	32.0					1																	28290117		2203	4300	6503	SO:0001583	missense	0			AK091615	CCDS315.1	1p35.3	2008-02-05	2006-01-12		ENSG00000158156	ENSG00000158156			25508	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 8"""			12477932	Standard	NM_018053		Approved	FLJ10307	uc001bph.1	Q9H6D3	OTTHUMG00000003912	ENST00000373884.5:c.403C>T	1.37:g.28290117C>T	ENSP00000362991:p.Leu135Phe			Missense_Mutation	SNP	pfam_Transport_prot_XK	p.L135F	ENST00000373884.5	37	c.403	CCDS315.1	1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.037361	0.93630	.	.	ENSG00000158156	ENST00000373884	T	0.71461	-0.57	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000001	D	0.85026	0.5603	M	0.91406	3.205	0.80722	D	1	D	0.56521	0.976	P	0.55055	0.767	D	0.87185	0.2230	10	0.48119	T	0.1	.	19.2521	0.93929	0.0:1.0:0.0:0.0	.	135	Q9H6D3	XKR8_HUMAN	F	135	ENSP00000362991:L135F	ENSP00000362991:L135F	L	+	1	0	XKR8	28162704	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.049000	0.71053	2.557000	0.86248	0.655000	0.94253	CTC	XKR8	-	pfam_Transport_prot_XK	ENSG00000158156		0.632	XKR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR8	HGNC	protein_coding	OTTHUMT00000011175.1	-	0.00	41	0	C	NM_018053		28290117	+1	tier1	-	no_errors	ENST00000373884	ensembl	human	known	74_37	missense	24.39	31	10	SNP	1.000	T
ZDHHC11B	653082	genome.wustl.edu	37	5	733935	733935	+	Silent	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr5:733935G>A	ENST00000382776.4	-	8	954	c.955C>T	c.(955-957)Ctg>Ttg	p.L319L	ZDHHC11B_ENST00000522356.1_5'Flank|ZDHHC11_ENST00000424784.2_Intron|ZDHHC11B_ENST00000508859.2_Silent_p.L330L			P0C7U3	ZH11B_HUMAN	zinc finger, DHHC-type containing 11B	319						integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			lung(3)|stomach(1)	4						TAAATCAGCAGGGAGCTCTTG	0.562																																																	0																																										SO:0001819	synonymous_variant	0					5p15.33	2007-01-29				ENSG00000206077		"""Zinc fingers, DHHC-type"""	32962	protein-coding gene	gene with protein product							Standard	XM_003118532		Approved			P0C7U3		ENST00000382776.4:c.955C>T	5.37:g.733935G>A			A6NHR3	Silent	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.L319	ENST00000382776.4	37	c.955		5																																																																																			ZDHHC11B	-	NULL	ENSG00000206077		0.562	ZDHHC11B-201	KNOWN	basic|appris_candidate	protein_coding	ZDHHC11B	HGNC	protein_coding		-	0.00	28	0	G	XM_926053		733935	-1	tier1	-	no_errors	ENST00000382776	ensembl	human	known	74_37	silent	17.86	23	5	SNP	0.001	A
ZFP2	80108	genome.wustl.edu	37	5	178359071	178359071	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr5:178359071C>T	ENST00000361362.2	+	5	1287	c.757C>T	c.(757-759)Caa>Taa	p.Q253*	ZFP2_ENST00000503510.2_Nonsense_Mutation_p.Q253*|ZFP2_ENST00000523286.1_Nonsense_Mutation_p.Q253*|ZFP2_ENST00000520301.1_Nonsense_Mutation_p.Q253*	NM_030613.2	NP_085116.2	Q6ZN57	ZFP2_HUMAN	ZFP2 zinc finger protein	253					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	20	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.00655)|GBM - Glioblastoma multiforme(465;0.0302)|OV - Ovarian serous cystadenocarcinoma(192;0.0615)|Epithelial(171;0.111)		AGCCTTCAGTCAAAGCATGCA	0.383																																																	0													67.0	69.0	69.0					5																	178359071		2203	4300	6503	SO:0001587	stop_gained	0			AK025281	CCDS4440.1	5q35.3	2013-01-08	2012-11-27		ENSG00000198939	ENSG00000198939		"""Zinc fingers, C2H2-type"""	26138	protein-coding gene	gene with protein product			"""zinc finger protein 2 homolog (mouse)"""				Standard	NM_030613		Approved	FLJ21628, ZNF751	uc003mjn.1	Q6ZN57	OTTHUMG00000130885	ENST00000361362.2:c.757C>T	5.37:g.178359071C>T	ENSP00000354453:p.Gln253*		A5PLN5|B7ZM23|Q9H6Z6	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q253*	ENST00000361362.2	37	c.757	CCDS4440.1	5	.	.	.	.	.	.	.	.	.	.	c	36	5.604889	0.96626	.	.	ENSG00000198939	ENST00000361362;ENST00000520301;ENST00000523286;ENST00000503510	.	.	.	4.67	3.78	0.43462	.	0.000000	0.31188	N	0.008090	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-10.1249	6.6882	0.23156	0.0:0.7213:0.1808:0.0979	.	.	.	.	X	253	.	ENSP00000354453:Q253X	Q	+	1	0	ZFP2	178291677	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	-0.818000	0.04467	2.408000	0.81797	0.650000	0.86243	CAA	ZFP2	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198939		0.383	ZFP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP2	HGNC	protein_coding	OTTHUMT00000253470.2	-	0.00	46	0	C	NM_030613		178359071	+1	tier1	-	no_errors	ENST00000361362	ensembl	human	known	74_37	nonsense	13.33	26	4	SNP	0.529	T
ZIC4	84107	genome.wustl.edu	37	3	147106021	147106021	+	3'UTR	SNP	C	C	T	rs546306579	byFrequency	TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr3:147106021C>T	ENST00000383075.3	-	0	2142				ZIC4_ENST00000425731.3_3'UTR|ZIC4-AS1_ENST00000462168.1_RNA|ZIC4_ENST00000472749.2_5'UTR|ZIC4_ENST00000525172.2_3'UTR	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						GCCTTTGAAGCGGCCGCTCCC	0.512																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.*625G>A	3.37:g.147106021C>T			A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	RNA	SNP	-	NULL	ENST00000383075.3	37	NULL	CCDS43160.1	3																																																																																			ZIC4	-	-	ENSG00000174963		0.512	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355504.1	-	0.00	22	0	C			147106021	-1	tier1	-	no_errors	ENST00000472749	ensembl	human	known	74_37	rna	50.00	10	10	SNP	0.998	T
ZMYM3	9203	genome.wustl.edu	37	X	70469460	70469460	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:70469460G>A	ENST00000353904.2	-	7	1508	c.1321C>T	c.(1321-1323)Cgg>Tgg	p.R441W	ZMYM3_ENST00000373984.3_Missense_Mutation_p.R443W|ZMYM3_ENST00000373978.1_Silent_p.S344S|ZMYM3_ENST00000373998.1_Missense_Mutation_p.R441W|ZMYM3_ENST00000373981.1_Missense_Mutation_p.R441W|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373982.1_Missense_Mutation_p.R443W|ZMYM3_ENST00000314425.5_Missense_Mutation_p.R441W|ZMYM3_ENST00000373988.1_Missense_Mutation_p.R443W	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	441					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					TTGTTGGCCCGGAATTTGGAG	0.577																																																	0													143.0	93.0	110.0					X																	70469460		2203	4300	6503	SO:0001583	missense	0			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.1321C>T	X.37:g.70469460G>A	ENSP00000343909:p.Arg441Trp		D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH_dom	p.R443W	ENST00000353904.2	37	c.1327	CCDS14409.1	X	.	.	.	.	.	.	.	.	.	.	g	18.73	3.685770	0.68157	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988;ENST00000373982;ENST00000373981	T;T;T;T;T;T;T	0.59906	0.83;0.23;0.83;0.83;0.83;0.39;0.39	4.43	4.43	0.53597	TRASH (1);	0.000000	0.56097	D	0.000030	T	0.75034	0.3795	M	0.70595	2.14	0.50813	D	0.999895	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.993;0.993;0.999;0.998	T	0.79356	-0.1837	10	0.87932	D	0	-10.6023	16.3668	0.83335	0.0:0.0:1.0:0.0	.	443;441;441;441	A6NL54;Q96E26;Q14202-2;Q14202	.;.;.;ZMYM3_HUMAN	W	441;441;441;443;443;443;441	ENSP00000322845:R441W;ENSP00000363110:R441W;ENSP00000343909:R441W;ENSP00000363096:R443W;ENSP00000363100:R443W;ENSP00000363094:R443W;ENSP00000363093:R441W	ENSP00000322845:R441W	R	-	1	2	ZMYM3	70386185	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.235000	0.78143	2.032000	0.59987	0.464000	0.42555	CGG	ZMYM3	-	smart_TRASH_dom	ENSG00000147130		0.577	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	HGNC	protein_coding	OTTHUMT00000057154.1	-	0.00	41	0	G	NM_201599		70469460	-1	tier1	-	no_errors	ENST00000373988	ensembl	human	known	74_37	missense	16.07	47	9	SNP	1.000	A
ZNF208	7757	genome.wustl.edu	37	19	22155173	22155173	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr19:22155173G>T	ENST00000397126.4	-	4	2811	c.2663C>A	c.(2662-2664)cCc>cAc	p.P888H	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	888					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ACATTTGTAGGGTTTCTCTCC	0.378																																																	0													43.0	46.0	45.0					19																	22155173		2073	4224	6297	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2663C>A	19.37:g.22155173G>T	ENSP00000380315:p.Pro888His			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P888H	ENST00000397126.4	37	c.2663	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	G	12.09	1.833017	0.32421	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.29397	1.57	2.58	2.58	0.30949	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.51261	0.1664	.	.	.	0.09310	N	1	D	0.71674	0.998	D	0.73380	0.98	T	0.31024	-0.9958	8	0.72032	D	0.01	.	10.0864	0.42421	0.0:0.0:1.0:0.0	.	788	O43345	ZN208_HUMAN	H	888;788	ENSP00000380315:P888H	ENSP00000380315:P888H	P	-	2	0	ZNF208	21947013	0.149000	0.22717	0.004000	0.12327	0.059000	0.15707	1.147000	0.31602	1.024000	0.39682	0.289000	0.19496	CCC	ZNF208	-	pfscan_Znf_C2H2	ENSG00000160321		0.378	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	-	0.00	33	0	G	NM_007153		22155173	-1	tier1	-	no_errors	ENST00000397126	ensembl	human	novel	74_37	missense	18.52	22	5	SNP	0.084	T
ZNF257	113835	genome.wustl.edu	37	19	22270892	22270892	+	Silent	SNP	A	A	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr19:22270892A>C	ENST00000594947.1	+	4	484	c.340A>C	c.(340-342)Aga>Cga	p.R114R	ZNF257_ENST00000600162.1_3'UTR	NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	114					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTTACAATTAAGAAAGGGCTG	0.358																																																	0													76.0	82.0	80.0					19																	22270892		2162	4273	6435	SO:0001819	synonymous_variant	0			AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.340A>C	19.37:g.22270892A>C			B3KPS4|E9PG34|Q8NE34	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R114	ENST00000594947.1	37	c.340	CCDS46030.1	19																																																																																			ZNF257	-	NULL	ENSG00000197134		0.358	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF257	HGNC	protein_coding	OTTHUMT00000464382.1	-	0.00	77	0	A			22270892	+1	tier1	-	no_errors	ENST00000594947	ensembl	human	known	74_37	silent	17.78	37	8	SNP	0.005	C
ZNF337	26152	genome.wustl.edu	37	20	25657617	25657617	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr20:25657617G>T	ENST00000376436.1	-	4	846	c.307C>A	c.(307-309)Caa>Aaa	p.Q103K	ZNF337_ENST00000538750.1_Missense_Mutation_p.Q71K|RP4-694B14.5_ENST00000439498.1_RNA|RP4-694B14.5_ENST00000421829.1_RNA|ZNF337_ENST00000481610.1_5'UTR|ZNF337_ENST00000252979.5_Missense_Mutation_p.Q103K|RP4-694B14.5_ENST00000414393.1_RNA|RP4-694B14.5_ENST00000455791.1_RNA			Q9Y3M9	ZN337_HUMAN	zinc finger protein 337	103					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AGTTGCTGTTGCCTCTGATGT	0.443																																																	0													62.0	58.0	60.0					20																	25657617		2203	4300	6503	SO:0001583	missense	0				CCDS13174.1	20p11.1	2013-09-20			ENSG00000130684	ENSG00000130684		"""Zinc fingers, C2H2-type"", ""-"""	15809	protein-coding gene	gene with protein product							Standard	XM_005260702		Approved	dJ694B14.1	uc002wuz.3	Q9Y3M9	OTTHUMG00000032131	ENST00000376436.1:c.307C>A	20.37:g.25657617G>T	ENSP00000365619:p.Gln103Lys		B4DSM2|Q9Y3Y5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q103K	ENST00000376436.1	37	c.307	CCDS13174.1	20	.	.	.	.	.	.	.	.	.	.	.	12.52	1.964049	0.34659	.	.	ENSG00000130684	ENST00000376436;ENST00000252979;ENST00000376412;ENST00000538750	T;T;T	0.05649	3.47;3.47;3.41	0.462	0.462	0.16695	.	.	.	.	.	T	0.03011	0.0089	N	0.20685	0.6	0.20563	N	0.99989	B;B	0.28233	0.204;0.204	B;B	0.14023	0.01;0.01	T	0.43686	-0.9376	9	0.06494	T	0.89	.	6.7586	0.23528	1.0E-4:0.0:0.9999:0.0	.	71;103	B4DSM2;Q9Y3M9	.;ZN337_HUMAN	K	103;103;103;71	ENSP00000365619:Q103K;ENSP00000252979:Q103K;ENSP00000442181:Q71K	ENSP00000252979:Q103K	Q	-	1	0	ZNF337	25605617	0.023000	0.18921	0.098000	0.21074	0.854000	0.48673	2.426000	0.44731	0.513000	0.28278	0.306000	0.20318	CAA	ZNF337	-	NULL	ENSG00000130684		0.443	ZNF337-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF337	HGNC	protein_coding	OTTHUMT00000078454.1	-	0.00	43	0	G			25657617	-1	tier1	-	no_errors	ENST00000252979	ensembl	human	known	74_37	missense	13.33	52	8	SNP	0.618	T
ZNF536	9745	genome.wustl.edu	37	19	30935178	30935178	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr19:30935178G>A	ENST00000355537.3	+	2	856	c.709G>A	c.(709-711)Gcc>Acc	p.A237T		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	237					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CCCGCTGGCCGCCTGCACCCT	0.751																																																	0													3.0	4.0	4.0					19																	30935178		1711	3483	5194	SO:0001583	missense	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.709G>A	19.37:g.30935178G>A	ENSP00000347730:p.Ala237Thr		A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A237T	ENST00000355537.3	37	c.709	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	G	4.708	0.131616	0.08981	.	.	ENSG00000198597	ENST00000355537	T	0.09255	3.0	5.7	-4.97	0.03029	.	1.068630	0.07065	N	0.834423	T	0.05547	0.0146	N	0.12182	0.205	0.24971	N	0.991663	B;B	0.14805	0.002;0.011	B;B	0.06405	0.001;0.002	T	0.44097	-0.9350	10	0.27082	T	0.32	-1.8624	10.0056	0.41955	0.7348:0.1213:0.1439:0.0	.	237;237	A7E228;O15090	.;ZN536_HUMAN	T	237	ENSP00000347730:A237T	ENSP00000347730:A237T	A	+	1	0	ZNF536	35627018	0.082000	0.21442	0.933000	0.37362	0.935000	0.57460	0.295000	0.19065	-0.696000	0.05098	0.491000	0.48974	GCC	ZNF536	-	NULL	ENSG00000198597		0.751	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	-	0.00	8	0	G	NM_014717		30935178	+1	tier1	-	no_errors	ENST00000355537	ensembl	human	known	74_37	missense	44.44	5	4	SNP	0.932	A
ZNF382	84911	genome.wustl.edu	37	19	37118379	37118379	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr19:37118379A>G	ENST00000292928.2	+	5	1693	c.1580A>G	c.(1579-1581)aAg>aGg	p.K527R	ZNF382_ENST00000435416.1_Missense_Mutation_p.K526R|ZNF382_ENST00000439428.1_Missense_Mutation_p.K526R|CTD-3234P18.2_ENST00000585467.1_lincRNA|ZNF382_ENST00000423582.1_Missense_Mutation_p.K478R	NM_001256838.1|NM_032825.4	NP_001243767.1|NP_116214.2	Q96SR6	ZN382_HUMAN	zinc finger protein 382	527	Required for transcriptional repression activity; probably mediates sequence- specific DNA-binding. {ECO:0000250}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	34	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			CAGTGTGGGAAGTTCTTCAGT	0.398																																																	0													81.0	81.0	81.0					19																	37118379		2203	4300	6503	SO:0001583	missense	0			AF513816	CCDS33004.1, CCDS58659.1	19q13.13	2013-01-08			ENSG00000161298	ENSG00000161298		"""Zinc fingers, C2H2-type"", ""-"""	17409	protein-coding gene	gene with protein product		609516					Standard	NM_032825		Approved	FLJ14686, KS1	uc010efb.4	Q96SR6	OTTHUMG00000048153	ENST00000292928.2:c.1580A>G	19.37:g.37118379A>G	ENSP00000292928:p.Lys527Arg		A3KMP6|A8MT55|C9K0V5|Q53ZY8|Q5JPJ2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K527R	ENST00000292928.2	37	c.1580	CCDS33004.1	19	.	.	.	.	.	.	.	.	.	.	A	20.3	3.965056	0.74131	.	.	ENSG00000161298	ENST00000423582;ENST00000292928;ENST00000439428;ENST00000435416	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	4.27	4.27	0.50696	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45361	D	0.000364	T	0.47154	0.1430	M	0.73319	2.225	0.36003	D	0.83753	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.71870	0.958;0.958;0.975	T	0.60566	-0.7238	10	0.72032	D	0.01	.	11.63	0.51168	1.0:0.0:0.0:0.0	.	526;526;527	Q96SR6-2;Q96SR6-3;Q96SR6	.;.;ZN382_HUMAN	R	478;527;526;526	ENSP00000389722:K478R;ENSP00000292928:K527R;ENSP00000407593:K526R;ENSP00000410113:K526R	ENSP00000292928:K527R	K	+	2	0	ZNF382	41810219	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	5.507000	0.66999	1.917000	0.55516	0.482000	0.46254	AAG	ZNF382	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000161298		0.398	ZNF382-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF382	HGNC	protein_coding	OTTHUMT00000109562.2	-	0.00	49	0	A	NM_032825		37118379	+1	tier1	-	no_errors	ENST00000292928	ensembl	human	known	74_37	missense	18.52	22	5	SNP	0.998	G
ZNF638	27332	genome.wustl.edu	37	2	71576566	71576566	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:71576566C>A	ENST00000409544.1	+	2	1112	c.482C>A	c.(481-483)cCt>cAt	p.P161H	ZNF638_ENST00000355812.3_Missense_Mutation_p.P161H|ZNF638_ENST00000377802.2_Missense_Mutation_p.P161H|ZNF638_ENST00000264447.4_Missense_Mutation_p.P161H|ZNF638_ENST00000410075.1_3'UTR	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	161					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						AGTCGCTATCCTGATGAACAA	0.393																																																	0													65.0	65.0	65.0					2																	71576566		2203	4300	6503	SO:0001583	missense	0			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.482C>A	2.37:g.71576566C>A	ENSP00000386433:p.Pro161His		B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	pfam_RRM_dom,smart_Znf_U1,smart_Znf_C2H2-like,smart_RRM_dom,pfscan_Znf_C2H2_matrin,pfscan_RRM_dom	p.P161H	ENST00000409544.1	37	c.482	CCDS1917.1	2	.	.	.	.	.	.	.	.	.	.	C	18.19	3.569187	0.65765	.	.	ENSG00000075292	ENST00000410075;ENST00000544512;ENST00000355812;ENST00000377802;ENST00000264447;ENST00000409544;ENST00000437658	D;D;D;D;T;T;T	0.93859	-2.71;-3.3;-2.3;-2.8;-1.28;-1.28;-1.12	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.94555	0.8246	L	0.29908	0.895	0.58432	D	0.999998	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.998;0.999;0.998;0.998	D	0.95186	0.8304	10	0.87932	D	0	-12.7388	17.365	0.87360	0.0:1.0:0.0:0.0	.	267;161;161;161;161	F5H330;Q14966-4;Q14966-3;Q14966;Q14966-2	.;.;.;ZN638_HUMAN;.	H	161;267;161;161;161;161;161	ENSP00000386669:P161H;ENSP00000438189:P267H;ENSP00000348066:P161H;ENSP00000367033:P161H;ENSP00000264447:P161H;ENSP00000386433:P161H;ENSP00000388164:P161H	ENSP00000264447:P161H	P	+	2	0	ZNF638	71430074	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.226000	0.78060	2.713000	0.92767	0.655000	0.94253	CCT	ZNF638	-	NULL	ENSG00000075292		0.393	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF638	HGNC	protein_coding	OTTHUMT00000327431.1		0.00	21	0	C	NM_014497		71576566	+1			no_errors	ENST00000264447	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	A
ZNF726	730087	genome.wustl.edu	37	19	24116956	24116956	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr19:24116956G>C	ENST00000322487.7	+	5	1962	c.1877G>C	c.(1876-1878)tGt>tCt	p.C626S	ZNF726_ENST00000594466.1_3'UTR|CTB-92J24.3_ENST00000596326.1_RNA|ZNF726_ENST00000575986.1_Intron|ZNF726_ENST00000334589.5_Intron			A6NNF4	ZN726_HUMAN	zinc finger protein 726	626					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TGTGAAGAATGTGGGAAAGCT	0.323																																																	0																																										SO:0001583	missense	0			DQ036016, BC046415	CCDS59372.1	19p12	2013-01-08			ENSG00000213967	ENSG00000213967		"""Zinc fingers, C2H2-type"", ""-"""	32462	protein-coding gene	gene with protein product							Standard	NM_001244038		Approved		uc021urw.1	A6NNF4	OTTHUMG00000167681	ENST00000322487.7:c.1877G>C	19.37:g.24116956G>C	ENSP00000317125:p.Cys626Ser		M0R0X8|Q86Y87	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C626S	ENST00000322487.7	37	c.1877		19	.	.	.	.	.	.	.	.	.	.	g	1.917	-0.449341	0.04572	.	.	ENSG00000213967	ENST00000322487	D	0.85861	-2.04	0.949	0.949	0.19566	.	.	.	.	.	D	0.83078	0.5176	.	.	.	0.25061	N	0.99106	.	.	.	.	.	.	T	0.74472	-0.3654	6	0.87932	D	0	.	7.3266	0.26560	0.0:0.0:1.0:0.0	.	.	.	.	S	626	ENSP00000317125:C626S	ENSP00000317125:C626S	C	+	2	0	ZNF726	23908796	1.000000	0.71417	0.190000	0.23270	0.188000	0.23474	6.543000	0.73874	0.392000	0.25172	0.398000	0.26397	TGT	ZNF726	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213967		0.323	ZNF726-201	KNOWN	basic|appris_principal	protein_coding	ZNF726	HGNC	protein_coding		-	0.00	34	0	G	XM_001715134		24116956	+1	tier1	-	no_errors	ENST00000322487	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.998	C
ZNF804A	91752	genome.wustl.edu	37	2	185801978	185801978	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chr2:185801978A>G	ENST00000302277.6	+	4	2449	c.1855A>G	c.(1855-1857)Aaa>Gaa	p.K619E		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	619							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AACTCGCTGCAAAATGGAAGC	0.343																																																	0													88.0	96.0	93.0					2																	185801978		2203	4297	6500	SO:0001583	missense	0			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.1855A>G	2.37:g.185801978A>G	ENSP00000303252:p.Lys619Glu		A7E253|Q6ZN26	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.K619E	ENST00000302277.6	37	c.1855	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	A	11.97	1.797194	0.31777	.	.	ENSG00000170396	ENST00000302277	T	0.06449	3.3	5.51	5.51	0.81932	.	0.774714	0.11449	N	0.562926	T	0.12178	0.0296	L	0.53249	1.67	0.22779	N	0.998749	D	0.53151	0.958	P	0.50082	0.63	T	0.22977	-1.0201	10	0.36615	T	0.2	-10.612	9.2187	0.37364	0.9111:0.0:0.0889:0.0	.	619	Q7Z570	Z804A_HUMAN	E	619	ENSP00000303252:K619E	ENSP00000303252:K619E	K	+	1	0	ZNF804A	185510223	0.000000	0.05858	0.871000	0.34182	0.026000	0.11368	0.294000	0.19047	2.087000	0.62958	0.533000	0.62120	AAA	ZNF804A	-	NULL	ENSG00000170396		0.343	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	HGNC	protein_coding	OTTHUMT00000255871.1	-	0.00	30	0	A	NM_194250		185801978	+1	tier1	-	no_errors	ENST00000302277	ensembl	human	known	74_37	missense	26.67	22	8	SNP	0.645	G
ZNF81	347344	genome.wustl.edu	37	X	47774637	47774637	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OG-01A-11D-A27G-09	TCGA-L5-A4OG-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0ed3ca80-a102-4b10-8db6-6731c3ed2055	8a7c92d1-444c-481f-b02f-81285ae3002f	g.chrX:47774637A>G	ENST00000376954.1	+	6	960	c.592A>G	c.(592-594)Agt>Ggt	p.S198G	ZNF81_ENST00000338637.7_Missense_Mutation_p.S198G			P51508	ZNF81_HUMAN	zinc finger protein 81	198					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				ATTTGGGAAGAGTTTTAAGCA	0.343																																																	0													47.0	44.0	45.0					X																	47774637		1816	4071	5887	SO:0001583	missense	0			AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.592A>G	X.37:g.47774637A>G	ENSP00000366153:p.Ser198Gly		Q6RX22|Q96QH6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S198G	ENST00000376954.1	37	c.592	CCDS43933.1	X	.	.	.	.	.	.	.	.	.	.	A	3.833	-0.035387	0.07497	.	.	ENSG00000197779	ENST00000376954;ENST00000338637	T;T	0.06687	3.27;3.27	4.04	-2.18	0.07037	.	1.339640	0.04937	N	0.458045	T	0.06188	0.0160	L	0.35723	1.085	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41179	-0.9523	10	0.37606	T	0.19	.	0.6011	0.00745	0.2214:0.1935:0.315:0.27	.	198	P51508	ZNF81_HUMAN	G	198	ENSP00000366153:S198G;ENSP00000341151:S198G	ENSP00000341151:S198G	S	+	1	0	ZNF81	47659581	0.000000	0.05858	0.188000	0.23233	0.965000	0.64279	-1.174000	0.03105	-0.613000	0.05694	-0.396000	0.06452	AGT	ZNF81	-	NULL	ENSG00000197779		0.343	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF81	HGNC	protein_coding	OTTHUMT00000056455.2	-	0.00	46	0	A	NM_007137		47774637	+1	tier1	-	no_errors	ENST00000338637	ensembl	human	known	74_37	missense	46.34	22	19	SNP	0.022	G
